#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACADS	35	genome.wustl.edu	37	12	121176660	121176660	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:121176660C>T	ENST00000242592.4	+	8	1122	c.971C>T	c.(970-972)gCc>gTc	p.A324V	ACADS_ENST00000411593.2_Missense_Mutation_p.A320V|RP11-173P15.7_ENST00000542620.1_RNA	NM_000017.2	NP_000008.1	P16219	ACADS_HUMAN	acyl-CoA dehydrogenase, C-2 to C-3 short chain	324					butyrate catabolic process (GO:0046359)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|protein homotetramerization (GO:0051289)|response to glucocorticoid (GO:0051384)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|butyryl-CoA dehydrogenase activity (GO:0004085)|fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)			central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(3)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			Flavin adenine dinucleotide(DB03147)	CTGGAGAGTGCCCGGCTGCTG	0.632																																																	0													51.0	58.0	56.0					12																	121176660		2203	4300	6503	SO:0001583	missense	0			M26393	CCDS9207.1	12q24.31	2012-07-13	2010-04-30		ENSG00000122971	ENSG00000122971	1.3.8.1		90	protein-coding gene	gene with protein product		606885	"""acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain"""			2565344	Standard	NM_000017		Approved	SCAD, ACAD3	uc001tza.4	P16219	OTTHUMG00000169203	ENST00000242592.4:c.971C>T	12.37:g.121176660C>T	ENSP00000242592:p.Ala324Val		P78331	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.A324V	ENST00000242592.4	37	c.971	CCDS9207.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.396406	0.96009	.	.	ENSG00000122971	ENST00000242592;ENST00000411593	D;D	0.97161	-4.27;-4.27	4.63	4.63	0.57726	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.98658	0.9550	M	0.89840	3.065	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.998	D;D;D	0.72338	0.977;0.941;0.941	D	0.99843	1.1063	10	0.87932	D	0	.	17.5068	0.87748	0.0:1.0:0.0:0.0	.	320;324;324	E9PE82;E5KSD5;P16219	.;.;ACADS_HUMAN	V	324;320	ENSP00000242592:A324V;ENSP00000401045:A320V	ENSP00000242592:A324V	A	+	2	0	ACADS	119661043	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.506000	0.81665	2.125000	0.65367	0.561000	0.74099	GCC	ACADS	-	pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCo_DH/oxidase_C	ENSG00000122971		0.632	ACADS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADS	HGNC	protein_coding	OTTHUMT00000402861.1		0.00	77	0	C	NM_000017		121176660	+1			no_errors	ENST00000242592	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
ACOT11	26027	genome.wustl.edu	37	1	55070051	55070051	+	Silent	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:55070051G>A	ENST00000371316.3	+	12	1267	c.1185G>A	c.(1183-1185)ttG>ttA	p.L395L	ACOT11_ENST00000481208.1_3'UTR|ACOT11_ENST00000343744.2_Silent_p.L395L	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	395	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						TCTCCTCCTTGAAGATGCTTG	0.552																																					Ovarian(148;1440 1861 22015 32453 51933)												0													130.0	101.0	111.0					1																	55070051		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.1185G>A	1.37:g.55070051G>A			B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Silent	SNP	pfam_START_lipid-bd_dom,pfam_Thioestr_supf,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.L395	ENST00000371316.3	37	c.1185	CCDS592.1	1																																																																																			ACOT11	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom	ENSG00000162390		0.552	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	-	0.00	60	0	G	NM_015547		55070051	+1	tier1	-	no_errors	ENST00000371316	ensembl	human	known	74_37	silent	25.58	32	11	SNP	1.000	A
ADAM32	203102	genome.wustl.edu	37	8	39103684	39103684	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:39103684G>T	ENST00000379907.4	+	17	2028	c.1901G>T	c.(1900-1902)gGa>gTa	p.G634V	ADAM32_ENST00000437682.2_Splice_Site_p.G535V|ADAM32_ENST00000519315.1_Splice_Site_p.G528V	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	634	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			TCTGGACATGGAGTAAGTAAC	0.363																																																	0													179.0	168.0	171.0					8																	39103684		1893	4117	6010	SO:0001630	splice_region_variant	0			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1902+1G>T	8.37:g.39103684G>T			Q8TC42	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.G634V	ENST00000379907.4	37	c.1901	CCDS47846.1	8	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130751	0.56828	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	D;D;D	0.97256	-4.31;-4.31;-4.31	4.31	4.31	0.51392	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.98770	0.9586	H	0.95328	3.655	0.58432	D	0.999996	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.963;1.0;0.968;1.0	D	0.98664	1.0685	9	0.87932	D	0	.	12.5887	0.56432	0.0:0.0:1.0:0.0	.	535;58;528;634	E7EPX8;Q6ZP86;E7ER82;Q8TC27	.;.;.;ADA32_HUMAN	V	535;528;634	ENSP00000405978:G535V;ENSP00000429422:G528V;ENSP00000369238:G634V	ENSP00000369238:G634V	G	+	2	0	ADAM32	39222841	1.000000	0.71417	0.998000	0.56505	0.721000	0.41392	3.570000	0.53834	2.677000	0.91161	0.655000	0.94253	GGA	ADAM32	-	pfscan_EG-like_dom	ENSG00000197140		0.363	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM32	HGNC	protein_coding	OTTHUMT00000377089.1	-	0.00	44	0	G	NM_145004	Missense_Mutation	39103684	+1	tier1	-	no_errors	ENST00000379907	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.998	T
ADAMTS16	170690	genome.wustl.edu	37	5	5232548	5232548	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:5232548C>T	ENST00000274181.7	+	12	1907	c.1769C>T	c.(1768-1770)tCg>tTg	p.S590L		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	590	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GGCCACTGGTCGGACTGGTCT	0.532																																																	0													95.0	111.0	105.0					5																	5232548		2105	4228	6333	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1769C>T	5.37:g.5232548C>T	ENSP00000274181:p.Ser590Leu		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.S590L	ENST00000274181.7	37	c.1769	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	C	28.6	4.937384	0.92458	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.60920	0.15	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000002	D	0.83353	0.5236	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69479	0.963;0.964	D	0.89056	0.3459	10	0.87932	D	0	.	17.4795	0.87669	0.0:1.0:0.0:0.0	.	590;590	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	L	590	ENSP00000274181:S590L	ENSP00000274181:S590L	S	+	2	0	ADAMTS16	5285548	1.000000	0.71417	0.971000	0.41717	0.786000	0.44442	7.442000	0.80503	2.418000	0.82041	0.491000	0.48974	TCG	ADAMTS16	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145536		0.532	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	-	0.00	66	0	C	NM_139056		5232548	+1	tier1	-	no_errors	ENST00000274181	ensembl	human	known	74_37	missense	18.33	49	11	SNP	1.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33588775	33588775	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:33588775G>T	ENST00000504830.1	-	18	3129	c.2794C>A	c.(2794-2796)Ccc>Acc	p.P932T	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.P847T	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	932	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						AGGGTCTTGGGCTTCAGCAGG	0.637										HNSCC(64;0.19)																																							0													142.0	144.0	143.0					5																	33588775		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2794C>A	5.37:g.33588775G>T	ENSP00000422554:p.Pro932Thr		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P932T	ENST00000504830.1	37	c.2794	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.223955	0.95139	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.63255	-0.03;-0.03	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	H	0.99261	4.49	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.957	D	0.92708	0.6180	10	0.72032	D	0.01	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	847;932	P58397-3;P58397	.;ATS12_HUMAN	T	932;847	ENSP00000422554:P932T;ENSP00000344847:P847T	ENSP00000344847:P847T	P	-	1	0	ADAMTS12	33624532	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.718000	0.98758	2.894000	0.99253	0.591000	0.81541	CCC	ADAMTS12	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000151388		0.637	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	53	0	G	NM_030955		33588775	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
ADAMTS2	9509	genome.wustl.edu	37	5	178634684	178634684	+	Missense_Mutation	SNP	G	G	A	rs140045997		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:178634684G>A	ENST00000251582.7	-	4	822	c.721C>T	c.(721-723)Cgc>Tgc	p.R241C	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.R241C	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	241			R -> H (in dbSNP:rs11750821).		collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CCCAGGGCGCGGCTGAGGCTG	0.667																																																	0								G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	68.0	62.0	64.0		721,721	2.3	0.6	5	dbSNP_134	64	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	ADAMTS2	NM_014244.4,NM_021599.2	180,180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	241/1212,241/567	178634684	2,13004	2203	4300	6503	SO:0001583	missense	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.721C>T	5.37:g.178634684G>A	ENSP00000251582:p.Arg241Cys			Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.R241C	ENST00000251582.7	37	c.721	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857838	0.32791	0.0	2.33E-4	ENSG00000087116	ENST00000251582;ENST00000274609	T;T	0.62498	0.09;0.02	5.49	2.34	0.29019	.	1.174200	0.06781	N	0.785253	T	0.45498	0.1345	L	0.36672	1.1	0.29193	N	0.875726	P;P	0.51653	0.851;0.947	B;B	0.34452	0.176;0.183	T	0.41161	-0.9524	10	0.36615	T	0.2	.	6.7106	0.23274	0.0932:0.0:0.3672:0.5396	.	241;241	O95450-2;O95450	.;ATS2_HUMAN	C	241	ENSP00000251582:R241C;ENSP00000274609:R241C	ENSP00000251582:R241C	R	-	1	0	ADAMTS2	178567290	0.364000	0.24997	0.601000	0.28877	0.023000	0.10783	0.532000	0.23067	0.656000	0.30886	0.561000	0.74099	CGC	ADAMTS2	-	prints_Pept_M12B_ADAM-TS2	ENSG00000087116		0.667	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	91	0	G	NM_014244		178634684	-1	tier1	rs140045997	no_errors	ENST00000251582	ensembl	human	known	74_37	missense	26.83	60	22	SNP	0.470	A
ADH6	130	genome.wustl.edu	37	4	100130052	100130052	+	Silent	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:100130052G>A	ENST00000237653.7	-	6	985	c.601C>T	c.(601-603)Ctg>Ttg	p.L201L	ADH6_ENST00000394897.1_Silent_p.L201L|RP11-696N14.1_ENST00000500358.2_RNA|ADH6_ENST00000394899.2_Silent_p.L201L|ADH6_ENST00000407820.2_5'UTR|RP11-696N14.1_ENST00000506160.1_RNA|RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000504257.1_5'UTR	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	201					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)	p.L201M(2)		breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	ACTCCTCCCAGGCCAAACACA	0.458																																																	2	Substitution - Missense(2)	lung(2)											196.0	200.0	199.0					4																	100130052		2203	4300	6503	SO:0001819	synonymous_variant	0			AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.601C>T	4.37:g.100130052G>A			B3KS45|Q58F53	Silent	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.L201	ENST00000237653.7	37	c.601	CCDS3647.1	4																																																																																			ADH6	-	smart_PKS_ER	ENSG00000172955		0.458	ADH6-003	KNOWN	basic|CCDS	protein_coding	ADH6	HGNC	protein_coding	OTTHUMT00000253665.1		0.00	26	0	G	NM_000672		100130052	-1			no_errors	ENST00000394899	ensembl	human	known	74_37	silent	5.26	36	2	SNP	1.000	A
ADRBK2	157	genome.wustl.edu	37	22	26070486	26070486	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:26070486C>T	ENST00000324198.6	+	8	830	c.638C>T	c.(637-639)aCt>aTt	p.T213I		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	213	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	AAAGCAGACACTGGAAAAATG	0.363																																																	0													138.0	133.0	135.0					22																	26070486		2203	4300	6503	SO:0001583	missense	0			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.638C>T	22.37:g.26070486C>T	ENSP00000317578:p.Thr213Ile		Q9UGW9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.T213I	ENST00000324198.6	37	c.638	CCDS13832.1	22	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410014	0.83340	.	.	ENSG00000100077	ENST00000324198;ENST00000545323	T	0.29917	1.55	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.115517	0.56097	D	0.000021	T	0.62841	0.2461	M	0.88842	2.985	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.69525	-0.5122	10	0.87932	D	0	-18.8505	16.4538	0.84007	0.0:1.0:0.0:0.0	.	213;213	A8K869;P35626	.;ARBK2_HUMAN	I	213	ENSP00000317578:T213I	ENSP00000317578:T213I	T	+	2	0	ADRBK2	24400486	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.882000	0.75589	2.744000	0.94065	0.655000	0.94253	ACT	ADRBK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000100077		0.363	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK2	HGNC	protein_coding	OTTHUMT00000317296.4	-	0.00	91	0	C	NM_005160		26070486	+1	tier1	-	no_errors	ENST00000324198	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
AGBL1	123624	genome.wustl.edu	37	15	87089267	87089267	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:87089267A>G	ENST00000441037.2	+	19	2677	c.2582A>G	c.(2581-2583)aAg>aGg	p.K861R	AGBL1_ENST00000421325.2_Missense_Mutation_p.K861R|AGBL1_ENST00000389298.3_Missense_Mutation_p.K592R	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	861					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TCCCAAAAGAAGAATGTGTTC	0.438																																																	0													116.0	108.0	111.0					15																	87089267		1925	4142	6067	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2582A>G	15.37:g.87089267A>G	ENSP00000413001:p.Lys861Arg		A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.K861R	ENST00000441037.2	37	c.2582	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	A	20.7	4.030368	0.75504	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10573	2.86;2.86	5.53	4.41	0.53225	Peptidase M14, carboxypeptidase A (1);	1.052520	0.07812	U	0.958378	T	0.18425	0.0442	L	0.46157	1.445	0.30817	N	0.738263	B	0.33477	0.413	B	0.42738	0.396	T	0.21280	-1.0250	10	0.66056	D	0.02	-11.896	10.9616	0.47389	0.9272:0.0:0.0728:0.0	.	861	Q96MI9	CBPC4_HUMAN	R	896;861;592	ENSP00000397173:K861R;ENSP00000373949:K592R	ENSP00000373949:K592R	K	+	2	0	AGBL1	84890271	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.817000	0.75252	1.107000	0.41642	0.533000	0.62120	AAG	AGBL1	-	pfam_Peptidase_M14	ENSG00000166748		0.438	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	64	0	A	NM_152336		87089267	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	G
AKAP3	10566	genome.wustl.edu	37	12	4736244	4736244	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:4736244C>T	ENST00000545990.2	-	5	2348	c.1824G>A	c.(1822-1824)aaG>aaA	p.K608K	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Silent_p.K608K	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	608					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)	p.K608N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						TCTGGTCACGCTTGAAAATGG	0.478																																																	2	Substitution - Missense(2)	lung(2)											74.0	72.0	73.0					12																	4736244		2203	4300	6503	SO:0001819	synonymous_variant	0			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1824G>A	12.37:g.4736244C>T			O75945|Q86X01|Q9UM61	Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.K608	ENST00000545990.2	37	c.1824	CCDS8531.1	12																																																																																			AKAP3	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000111254		0.478	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2		0.00	40	0	C	NM_006422		4736244	-1			no_errors	ENST00000228850	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.762	T
AMBRA1	55626	genome.wustl.edu	37	11	46515709	46515709	+	Silent	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:46515709C>A	ENST00000458649.2	-	10	2803	c.2385G>T	c.(2383-2385)cgG>cgT	p.R795R	AMBRA1_ENST00000298834.3_Silent_p.R735R|AMBRA1_ENST00000528950.1_Silent_p.R766R|AMBRA1_ENST00000426438.1_Silent_p.R766R|AMBRA1_ENST00000534300.1_Silent_p.R735R|AMBRA1_ENST00000533727.1_Silent_p.R676R|AMBRA1_ENST00000314845.3_Silent_p.R705R|AMBRA1_ENST00000529963.1_5'UTR			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	795					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GTGCAGACATCCGGGCATTGC	0.473																																																	0													56.0	50.0	52.0					11																	46515709		2201	4299	6500	SO:0001819	synonymous_variant	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2385G>T	11.37:g.46515709C>A			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R795	ENST00000458649.2	37	c.2385		11																																																																																			AMBRA1	-	NULL	ENSG00000110497		0.473	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	40	0	C	NM_017749		46515709	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	silent	12.50	35	5	SNP	0.874	A
AMOT	154796	genome.wustl.edu	37	X	112058796	112058796	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:112058796C>T	ENST00000524145.1	-	3	1256	c.1182G>A	c.(1180-1182)caG>caA	p.Q394Q	AMOT_ENST00000371958.1_Silent_p.Q162Q|AMOT_ENST00000371959.3_Silent_p.Q394Q|AMOT_ENST00000304758.1_5'UTR|AMOT_ENST00000371962.1_Silent_p.Q162Q			Q4VCS5	AMOT_HUMAN	angiomotin	394					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)	p.Q394Q(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gctgctgctgctgttgttggt	0.582																																																	1	Substitution - coding silent(1)	lung(1)											38.0	34.0	36.0					X																	112058796		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1182G>A	X.37:g.112058796C>T			Q504X5|Q9HD27|Q9UPT1	Silent	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.Q394	ENST00000524145.1	37	c.1182	CCDS48154.1	X																																																																																			AMOT	-	NULL	ENSG00000126016		0.582	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1		0.00	34	0	C	NM_133265		112058796	-1			no_errors	ENST00000371959	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.970	T
ANKRD30A	91074	genome.wustl.edu	37	10	37430816	37430816	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:37430816T>A	ENST00000602533.1	+	7	922	c.823T>A	c.(823-825)Ttg>Atg	p.L275M	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.L275M|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.L275M			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	331					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GGCTGCATCCTTGGTGGAGGG	0.473																																																	0													67.0	67.0	67.0					10																	37430816		1881	4126	6007	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.823T>A	10.37:g.37430816T>A	ENSP00000473551:p.Leu275Met		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L275M	ENST00000602533.1	37	c.823		10	.	.	.	.	.	.	.	.	.	.	.	10.89	1.478971	0.26511	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.05717	3.4;3.4	0.736	0.736	0.18307	.	.	.	.	.	T	0.13157	0.0319	L	0.46157	1.445	0.09310	N	1	D	0.65815	0.995	D	0.70487	0.969	T	0.18209	-1.0344	9	0.46703	T	0.11	.	3.7666	0.08624	0.0:0.0:0.0:1.0	.	331	Q9BXX3	AN30A_HUMAN	M	275	ENSP00000354432:L275M;ENSP00000363792:L275M	ENSP00000354432:L275M	L	+	1	2	ANKRD30A	37470822	0.925000	0.31364	0.002000	0.10522	0.006000	0.05464	0.181000	0.16880	0.555000	0.29079	0.363000	0.22086	TTG	ANKRD30A	-	NULL	ENSG00000148513		0.473	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	139	0	T	NM_052997		37430816	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	7.81	118	10	SNP	0.003	A
ANKRD50	57182	genome.wustl.edu	37	4	125590831	125590831	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:125590831C>T	ENST00000504087.1	-	4	4638	c.3601G>A	c.(3601-3603)Gct>Act	p.A1201T	ANKRD50_ENST00000515641.1_Missense_Mutation_p.A1022T	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	1201	Ser-rich.							p.A1201T(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						ACTGTTTGAGCCGTTGCTGTA	0.393																																																	1	Substitution - Missense(1)	prostate(1)											129.0	127.0	128.0					4																	125590831		2203	4300	6503	SO:0001583	missense	0			AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.3601G>A	4.37:g.125590831C>T	ENSP00000425658:p.Ala1201Thr		A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A1201T	ENST00000504087.1	37	c.3601	CCDS34060.1	4	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630378	0.67015	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.68624	-0.34;-0.3	5.29	5.29	0.74685	.	0.052111	0.85682	D	0.000000	T	0.66127	0.2758	N	0.08118	0	0.58432	D	0.999999	D	0.63880	0.993	D	0.74674	0.984	T	0.64588	-0.6372	10	0.19147	T	0.46	.	19.1278	0.93393	0.0:1.0:0.0:0.0	.	1201	Q9ULJ7	ANR50_HUMAN	T	1201;1022	ENSP00000425658:A1201T;ENSP00000425355:A1022T	ENSP00000425658:A1201T	A	-	1	0	ANKRD50	125810281	1.000000	0.71417	0.945000	0.38365	0.969000	0.65631	7.164000	0.77533	2.756000	0.94617	0.561000	0.74099	GCT	ANKRD50	-	NULL	ENSG00000151458		0.393	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD50	HGNC	protein_coding	OTTHUMT00000364775.1		0.00	39	0	C	NM_020337		125590831	-1			no_errors	ENST00000504087	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
ANKRD54	129138	genome.wustl.edu	37	22	38227856	38227856	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:38227856C>T	ENST00000215941.4	-	0	1189				ANKRD54_ENST00000498417.1_5'UTR|ANKRD54_ENST00000406423.1_3'UTR	NM_138797.2	NP_620152.1	Q6NXT1	ANR54_HUMAN	ankyrin repeat domain 54						nucleocytoplasmic transport (GO:0006913)|positive regulation of erythrocyte differentiation (GO:0045648)|regulation of intracellular signal transduction (GO:1902531)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	protein kinase regulator activity (GO:0019887)			lung(1)	1	Melanoma(58;0.045)					CAGACAAGTGCAGCTCCAAGT	0.612																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC014641	CCDS13959.1	22q13.1	2013-01-10			ENSG00000100124	ENSG00000100124		"""Ankyrin repeat domain containing"""	25185	protein-coding gene	gene with protein product		613383				15461802	Standard	NM_138797		Approved	LIAR	uc003auc.3	Q6NXT1	OTTHUMG00000150663	ENST00000215941.4:c.*94G>A	22.37:g.38227856C>T			Q6ZSB1|Q9UGV1	RNA	SNP	-	NULL	ENST00000215941.4	37	NULL	CCDS13959.1	22																																																																																			ANKRD54	-	-	ENSG00000100124		0.612	ANKRD54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD54	HGNC	protein_coding	OTTHUMT00000319490.1	-	0.00	33	0	C	NM_138797		38227856	-1	tier1	-	no_errors	ENST00000498417	ensembl	human	known	74_37	rna	9.09	40	4	SNP	0.000	T
ANKS1B	56899	genome.wustl.edu	37	12	99640518	99640518	+	Silent	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:99640518C>A	ENST00000547776.2	-	13	1880	c.1881G>T	c.(1879-1881)ggG>ggT	p.G627G	ANKS1B_ENST00000550833.1_5'UTR|ANKS1B_ENST00000547010.1_Silent_p.G207G|ANKS1B_ENST00000329257.7_Silent_p.G627G	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	627						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GTTCTCTTTTCCCATAGAGAT	0.438																																																	0													114.0	108.0	110.0					12																	99640518		1865	4101	5966	SO:0001819	synonymous_variant	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1881G>T	12.37:g.99640518C>A			A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.G627	ENST00000547776.2	37	c.1881	CCDS55872.1	12																																																																																			ANKS1B	-	NULL	ENSG00000185046		0.438	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	45	0	C	NM_020140		99640518	-1	tier1	-	no_errors	ENST00000329257	ensembl	human	known	74_37	silent	19.05	34	8	SNP	0.997	A
AP2A2	161	genome.wustl.edu	37	11	994158	994158	+	Silent	SNP	G	G	A	rs540330346		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:994158G>A	ENST00000448903.2	+	14	2010	c.1869G>A	c.(1867-1869)acG>acA	p.T623T	AP2A2_ENST00000332231.5_Silent_p.T624T|AP2A2_ENST00000534328.1_Intron	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	623					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCCCCAGCACGGTGACAGACC	0.637																																																	0													59.0	73.0	68.0					11																	994158		2032	4154	6186	SO:0001819	synonymous_variant	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1869G>A	11.37:g.994158G>A			O75403|Q53ET1|Q96SI8	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.T624	ENST00000448903.2	37	c.1872	CCDS44512.1	11																																																																																			AP2A2	-	pirsf_AP2_complex_asu	ENSG00000183020		0.637	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2		0.00	54	0	G	NM_012305		994158	+1			no_errors	ENST00000332231	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.083	A
APOA4	337	genome.wustl.edu	37	11	116692293	116692293	+	Missense_Mutation	SNP	C	C	T	rs12721043	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:116692293C>T	ENST00000357780.3	-	3	595	c.481G>A	c.(481-483)Gca>Aca	p.A161T		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	161	13 X 22 AA approximate tandem repeats.		A -> S (in Seattle-3). {ECO:0000269|PubMed:15108119, ECO:0000269|PubMed:8956036}.		cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		ATGCGCTGTGCGTAGGGGGTC	0.692																																																	0			GRCh37	CM960070	APOA4	M	rs12721043						69.0	63.0	65.0					11																	116692293		2201	4295	6496	SO:0001583	missense	0				CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.481G>A	11.37:g.116692293C>T	ENSP00000350425:p.Ala161Thr		A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	pfam_ApoA1_A4_E	p.A161T	ENST00000357780.3	37	c.481	CCDS31681.1	11	.	.	.	.	.	.	.	.	.	.	C	7.104	0.574582	0.13623	.	.	ENSG00000110244	ENST00000357780	T	0.75821	-0.97	5.02	-0.411	0.12370	Apolipoprotein/apolipophorin (1);	0.885835	0.09778	N	0.757032	T	0.60431	0.2268	L	0.58354	1.805	0.09310	N	1	P	0.43431	0.807	B	0.31495	0.131	T	0.49523	-0.8931	10	0.35671	T	0.21	-8.7513	5.5518	0.17095	0.1266:0.5848:0.0:0.2887	.	161	P06727	APOA4_HUMAN	T	161	ENSP00000350425:A161T	ENSP00000350425:A161T	A	-	1	0	APOA4	116197503	0.000000	0.05858	0.000000	0.03702	0.111000	0.19643	0.071000	0.14594	-0.052000	0.13311	-0.355000	0.07637	GCA	APOA4	-	pfam_ApoA1_A4_E	ENSG00000110244		0.692	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA4	HGNC	protein_coding	OTTHUMT00000106279.2		0.00	15	0	C	NM_000482		116692293	-1			no_errors	ENST00000357780	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.001	T
APOB	338	genome.wustl.edu	37	2	21239325	21239325	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:21239325G>T	ENST00000233242.1	-	21	3445	c.3318C>A	c.(3316-3318)ctC>ctA	p.L1106L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1106					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.L1106L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTGGCCCATGAGGGCGACCT	0.478																																																	1	Substitution - coding silent(1)	endometrium(1)											77.0	75.0	76.0					2																	21239325		2203	4300	6503	SO:0001819	synonymous_variant	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.3318C>A	2.37:g.21239325G>T			O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L1106	ENST00000233242.1	37	c.3318	CCDS1703.1	2																																																																																			APOB	-	NULL	ENSG00000084674		0.478	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1		0.00	31	0	G			21239325	-1			no_errors	ENST00000233242	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.043	T
APOBEC3G	60489	genome.wustl.edu	37	22	39477202	39477202	+	Missense_Mutation	SNP	C	C	T	rs200526446		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:39477202C>T	ENST00000407997.3	+	3	793	c.436C>T	c.(436-438)Cgt>Tgt	p.R146C	APOBEC3G_ENST00000461827.1_3'UTR|APOBEC3G_ENST00000452957.2_Missense_Mutation_p.R146C	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	146					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					AGACGGTCCGCGTGCCACCAT	0.537																																																	0													81.0	81.0	81.0					22																	39477202		2203	4300	6503	SO:0001583	missense	0			AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.436C>T	22.37:g.39477202C>T	ENSP00000385057:p.Arg146Cys		B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.R146C	ENST00000407997.3	37	c.436	CCDS13984.1	22	.	.	.	.	.	.	.	.	.	.	.	13.50	2.255916	0.39896	.	.	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.64438	-0.1;-0.1	1.83	-2.85	0.05734	APOBEC-like, C-terminal (1);	.	.	.	.	T	0.66781	0.2824	L	0.55481	1.735	0.09310	N	1	D	0.69078	0.997	P	0.58970	0.849	T	0.62215	-0.6901	9	0.87932	D	0	.	9.7829	0.40660	0.0:0.6768:0.3232:0.0	.	146	Q9HC16	ABC3G_HUMAN	C	146	ENSP00000413376:R146C;ENSP00000385057:R146C	ENSP00000385057:R146C	R	+	1	0	APOBEC3G	37807148	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.329000	0.19698	-0.520000	0.06435	-0.502000	0.04539	CGT	APOBEC3G	-	pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	ENSG00000239713		0.537	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3G	HGNC	protein_coding	OTTHUMT00000321219.1	-	0.00	70	0	C	NM_021822		39477202	+1	tier1	rs200526446	no_errors	ENST00000407997	ensembl	human	known	74_37	missense	20.51	31	8	SNP	0.000	T
ARHGAP9	64333	genome.wustl.edu	37	12	57869649	57869649	+	Nonsense_Mutation	SNP	C	C	T	rs370652888		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:57869649C>T	ENST00000356411.2	-	10	1416	c.1278G>A	c.(1276-1278)tgG>tgA	p.W426*	ARHGAP9_ENST00000550288.1_Nonsense_Mutation_p.W505*|ARHGAP9_ENST00000424809.2_Nonsense_Mutation_p.W426*|ARHGAP9_ENST00000430041.2_Nonsense_Mutation_p.W242*|ARHGAP9_ENST00000393797.2_Nonsense_Mutation_p.W497*|ARHGAP9_ENST00000393791.3_Nonsense_Mutation_p.W426*|ARHGAP9_ENST00000550454.1_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	426	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			GCGCGCGGTGCCAGGCTCGCA	0.677																																																	0								C	stop/TRP,stop/TRP,stop/TRP	0,4406		0,0,2203	27.0	29.0	28.0		726,1278,1278	4.2	1.0	12		28	1,8597	1.2+/-3.3	0,1,4298	no	stop-gained,stop-gained,stop-gained	ARHGAP9	NM_001080156.1,NM_001080157.1,NM_032496.2	,,	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	,,	242/548,426/641,426/732	57869649	1,13003	2203	4299	6502	SO:0001587	stop_gained	0			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.1278G>A	12.37:g.57869649C>T	ENSP00000348782:p.Trp426*		B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.W426*	ENST00000356411.2	37	c.1278		12	.	.	.	.	.	.	.	.	.	.	C	39	7.750263	0.98468	0.0	1.16E-4	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000423291;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041;ENST00000548139	.	.	.	4.25	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0569	0.64774	0.0:1.0:0.0:0.0	.	.	.	.	X	426;426;96;426;497;475;242;242	.	ENSP00000344852:W475X	W	-	3	0	ARHGAP9	56155916	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	3.896000	0.56266	2.378000	0.81104	0.561000	0.74099	TGG	ARHGAP9	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000123329		0.677	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP9	HGNC	protein_coding			0.00	87	0	C	NM_032496		57869649	-1			no_errors	ENST00000356411	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	1.000	T
ARHGEF15	22899	genome.wustl.edu	37	17	8215791	8215791	+	Nonsense_Mutation	SNP	C	C	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:8215791C>G	ENST00000361926.3	+	2	544	c.434C>G	c.(433-435)tCa>tGa	p.S145*	ARHGEF15_ENST00000421050.1_Nonsense_Mutation_p.S145*	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	145					negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						GGCTCTGCCTCAGCTCCTGGC	0.672																																																	0													53.0	54.0	53.0					17																	8215791		2203	4300	6503	SO:0001587	stop_gained	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.434C>G	17.37:g.8215791C>G	ENSP00000355026:p.Ser145*		A8K6G1|Q8N449|Q9H8B4	Nonsense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.S145*	ENST00000361926.3	37	c.434	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292465	0.80914	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	.	.	.	5.12	5.12	0.69794	.	1.787260	0.03046	N	0.153884	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-10.5299	13.983	0.64317	0.0:1.0:0.0:0.0	.	.	.	.	X	145;46;145	.	ENSP00000355026:S145X	S	+	2	0	ARHGEF15	8156516	0.932000	0.31603	0.881000	0.34555	0.925000	0.55904	3.576000	0.53878	2.688000	0.91661	0.555000	0.69702	TCA	ARHGEF15	-	NULL	ENSG00000198844		0.672	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2	-	0.00	125	0	C	NM_173728		8215791	+1	tier1	-	no_errors	ENST00000361926	ensembl	human	known	74_37	nonsense	18.42	62	14	SNP	0.931	G
ARID1A	8289	genome.wustl.edu	37	1	27087417	27087417	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:27087417delC	ENST00000324856.7	+	5	2362	c.1991delC	c.(1990-1992)tcafs	p.S664fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.S664fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.S281fs|RN7SL501P_ENST00000578818.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	664					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.S664*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GTGAGCACATCAGGGATTTCC	0.517			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Substitution - Nonsense(1)	ovary(1)											133.0	137.0	135.0					1																	27087417		2203	4300	6503	SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1991delC	1.37:g.27087417delC	ENSP00000320485:p.Ser664fs		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.S664fs	ENST00000324856.7	37	c.1991	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.517	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2		0.00	49	0	C	NM_139135		27087417	+1	tier1		no_errors	ENST00000324856	ensembl	human	known	74_37	frame_shift_del	29.17	34	14	DEL	1.000	-
ASPDH	554235	genome.wustl.edu	37	19	51016575	51016575	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:51016575C>T	ENST00000389208.4	-	2	212	c.151G>A	c.(151-153)Gtg>Atg	p.V51M	ASPDH_ENST00000597030.1_Intron|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000391815.3_5'Flank|JOSD2_ENST00000595669.1_5'Flank|ASPDH_ENST00000376916.3_Intron|JOSD2_ENST00000601423.1_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	51					NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						GAAGGGGGCACGCTCCCTGCC	0.597																																																	0													49.0	45.0	46.0					19																	51016575		692	1591	2283	SO:0001583	missense	0				CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.151G>A	19.37:g.51016575C>T	ENSP00000373860:p.Val51Met		Q6NZ37	Missense_Mutation	SNP	pfam_Asp_DH,pfam_Asp/hSer_DH_NAD-bd	p.V51M	ENST00000389208.4	37	c.151	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	C	15.73	2.920950	0.52653	.	.	ENSG00000204653	ENST00000389208	T	0.50001	0.76	3.44	0.644	0.17776	Aspartate/homoserine dehydrogenase, NAD-binding (1);NAD(P)-binding domain (1);	0.595355	0.13690	U	0.369591	T	0.33527	0.0866	L	0.47190	1.495	0.26776	N	0.969695	P	0.47962	0.903	B	0.38562	0.276	T	0.28776	-1.0033	10	0.72032	D	0.01	-1.0976	4.3433	0.11120	0.0:0.5345:0.3167:0.1488	.	51	A6ND91	ASPD_HUMAN	M	51	ENSP00000373860:V51M	ENSP00000373860:V51M	V	-	1	0	ASPDH	55708387	0.922000	0.31269	0.845000	0.33349	0.925000	0.55904	1.867000	0.39499	0.544000	0.28883	0.561000	0.74099	GTG	ASPDH	-	pfam_Asp/hSer_DH_NAD-bd	ENSG00000204653		0.597	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	HGNC	protein_coding	OTTHUMT00000464861.1	-	0.00	67	0	C	NM_001024656		51016575	-1	tier1	-	no_errors	ENST00000389208	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.764	T
ATM	472	genome.wustl.edu	37	11	108143528	108143528	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:108143528T>G	ENST00000452508.2	+	23	3422	c.3233T>G	c.(3232-3234)cTt>cGt	p.L1078R	ATM_ENST00000278616.4_Missense_Mutation_p.L1078R			Q13315	ATM_HUMAN	ATM serine/threonine kinase	1078					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ACACAATTTCTTGCTGACAAT	0.388			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													139.0	130.0	133.0					11																	108143528		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.3233T>G	11.37:g.108143528T>G	ENSP00000388058:p.Leu1078Arg		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.L1078R	ENST00000452508.2	37	c.3233	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	T	22.6	4.310551	0.81358	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.77489	-1.1;-1.1;-1.1	5.63	5.63	0.86233	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87426	0.6174	M	0.71581	2.175	0.48762	D	0.999707	D	0.89917	1.0	D	0.91635	0.999	D	0.88748	0.3248	10	0.87932	D	0	.	16.1381	0.81502	0.0:0.0:0.0:1.0	.	1078	Q13315	ATM_HUMAN	R	1078	ENSP00000435747:L1078R;ENSP00000278616:L1078R;ENSP00000388058:L1078R	ENSP00000278616:L1078R	L	+	2	0	ATM	107648738	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	6.481000	0.73608	2.258000	0.74832	0.533000	0.62120	CTT	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.388	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	50	0	T	NM_000051		108143528	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	15.00	34	6	SNP	1.000	G
ATP8B1	5205	genome.wustl.edu	37	18	55334367	55334367	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:55334367G>T	ENST00000283684.4	-	19	2241	c.2242C>A	c.(2242-2244)Ctt>Att	p.L748I	RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.3_ENST00000599199.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA|ATP8B1_ENST00000536015.1_Missense_Mutation_p.L748I|RP11-35G9.3_ENST00000591854.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	748					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TCAGTCAGAAGTTCACAAGCA	0.323																																																	0													109.0	104.0	106.0					18																	55334367		2203	4300	6503	SO:0001583	missense	0			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.2242C>A	18.37:g.55334367G>T	ENSP00000283684:p.Leu748Ile		Q9BTP8	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L748I	ENST00000283684.4	37	c.2242	CCDS11965.1	18	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890523	0.91889	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	D;D	0.93712	-3.27;-3.27	5.35	5.35	0.76521	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.95999	0.8697	M	0.82056	2.57	0.80722	D	1	P	0.49862	0.929	P	0.55577	0.779	D	0.95564	0.8632	10	0.48119	T	0.1	.	19.0393	0.92992	0.0:0.0:1.0:0.0	.	748	O43520	AT8B1_HUMAN	I	748	ENSP00000283684:L748I;ENSP00000445359:L748I	ENSP00000283684:L748I	L	-	1	0	ATP8B1	53485365	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.179000	0.94861	2.657000	0.90304	0.650000	0.86243	CTT	ATP8B1	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000081923		0.323	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B1	HGNC	protein_coding	OTTHUMT00000256097.1	-	0.00	47	0	G	NM_005603		55334367	-1	tier1	-	no_errors	ENST00000283684	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
ATP8B2	57198	genome.wustl.edu	37	1	154307045	154307045	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:154307045T>G	ENST00000368489.3	+	11	914	c.914T>G	c.(913-915)cTa>cGa	p.L305R	ATP8B2_ENST00000426445.1_3'UTR|ATP8B2_ENST00000368487.3_Missense_Mutation_p.L272R|ATP8B2_ENST00000341822.2_Missense_Mutation_p.L291R	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	291					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATCGATCGCCTAATGAATACC	0.527																																																	0													88.0	82.0	84.0					1																	154307045		2203	4300	6503	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.914T>G	1.37:g.154307045T>G	ENSP00000357475:p.Leu305Arg		B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L305R	ENST00000368489.3	37	c.914	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.261173	0.80246	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	D;T;T	0.90261	-2.64;-1.08;-1.08	4.86	4.86	0.63082	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.64402	D	0.000017	D	0.92655	0.7666	L	0.60455	1.87	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.995	D;D;D	0.85130	0.995;0.997;0.965	D	0.93740	0.7049	10	0.87932	D	0	.	13.4382	0.61096	0.0:0.0:0.0:1.0	.	291;305;272	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	R	272;305;291	ENSP00000357472:L272R;ENSP00000357475:L305R;ENSP00000340448:L291R	ENSP00000340448:L291R	L	+	2	0	ATP8B2	152573669	1.000000	0.71417	0.920000	0.36463	0.936000	0.57629	7.868000	0.87116	2.043000	0.60533	0.482000	0.46254	CTA	ATP8B2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000143515		0.527	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	-	0.00	25	0	T	NM_020452		154307045	+1	tier1	-	no_errors	ENST00000368489	ensembl	human	known	74_37	missense	21.74	18	5	SNP	0.997	G
ATP9B	374868	genome.wustl.edu	37	18	76936828	76936828	+	Missense_Mutation	SNP	G	G	A	rs140291894		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:76936828G>A	ENST00000426216.2	+	8	811	c.794G>A	c.(793-795)cGa>cAa	p.R265Q	ATP9B_ENST00000307671.7_Missense_Mutation_p.R265Q	NM_198531.3	NP_940933.3	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	265					establishment of protein localization to Golgi (GO:0072600)|phospholipid translocation (GO:0045332)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.R265Q(2)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(3)|prostate(1)|skin(2)|stomach(1)	38		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		TGTTTTATTCGAACTGATCAA	0.448																																																	2	Substitution - Missense(2)	large_intestine(2)						G	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	106.0	102.0	103.0		794	5.6	1.0	18	dbSNP_134	103	0,8600		0,0,4300	no	missense	ATP9B	NM_198531.3	43	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	265/1148	76936828	2,13004	2203	4300	6503	SO:0001583	missense	0			R51412	CCDS12014.1	18q23	2010-04-20	2007-09-19		ENSG00000166377	ENSG00000166377		"""ATPases / P-type"""	13541	protein-coding gene	gene with protein product		614446	"""ATPase, Class II, type 9B"""			9548971, 11015572	Standard	NM_198531		Approved	ATPIIB	uc002lmx.3	O43861	OTTHUMG00000132898	ENST00000426216.2:c.794G>A	18.37:g.76936828G>A	ENSP00000398076:p.Arg265Gln		O60872|Q08AD8|Q08AD9	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.R265Q	ENST00000426216.2	37	c.794	CCDS12014.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.504855	0.96371	4.54E-4	0.0	ENSG00000166377	ENST00000426216;ENST00000307671	D;D	0.90444	-2.67;-2.67	5.56	5.56	0.83823	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.95645	0.8584	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	D	0.95811	0.8841	10	0.87932	D	0	.	19.5243	0.95197	0.0:0.0:1.0:0.0	.	265;265	O43861;O43861-2	ATP9B_HUMAN;.	Q	265	ENSP00000398076:R265Q;ENSP00000304500:R265Q	ENSP00000304500:R265Q	R	+	2	0	ATP9B	75037816	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	8.857000	0.92250	2.605000	0.88082	0.655000	0.94253	CGA	ATP9B	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000166377		0.448	ATP9B-001	KNOWN	basic|CCDS	protein_coding	ATP9B	HGNC	protein_coding	OTTHUMT00000256402.3		0.00	32	0	G	NM_198531		76936828	+1			no_errors	ENST00000426216	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
ATPAF1	64756	genome.wustl.edu	37	1	47110925	47110925	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:47110925G>C	ENST00000371937.4	-	7	696	c.592C>G	c.(592-594)Cta>Gta	p.L198V	ATPAF1_ENST00000329231.4_Intron|ATPAF1_ENST00000542495.1_Missense_Mutation_p.L47V|ATPAF1_ENST00000532925.1_Missense_Mutation_p.L110V|ATPAF1_ENST00000574428.1_Intron|ATPAF1_ENST00000576409.1_Missense_Mutation_p.L221V	NM_022745.4	NP_073582.3	Q5TC12	ATPF1_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 1	198					protein complex assembly (GO:0006461)	mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	8	Acute lymphoblastic leukemia(166;0.155)					AGAGCACATAGAAACTGTGAA	0.368																																					Melanoma(138;107 1777 21672 30337 52312)												0													118.0	112.0	114.0					1																	47110925		2203	4300	6503	SO:0001583	missense	0			AK026004	CCDS541.1, CCDS41327.1, CCDS541.2, CCDS41327.2, CCDS57997.1, CCDS57998.1	1p33-p32.3	2012-10-12			ENSG00000123472	ENSG00000123472		"""Mitochondrial respiratory chain complex assembly factors"""	18803	protein-coding gene	gene with protein product		608917				11410595	Standard	NM_022745		Approved	FLJ22351, Atp11p, ATP11	uc001cqh.4	Q5TC12	OTTHUMG00000007988	ENST00000371937.4:c.592C>G	1.37:g.47110925G>C	ENSP00000361005:p.Leu198Val		B1AQW7|B7Z7D6|B7Z7I6|Q9H6E3	Missense_Mutation	SNP	pfam_ATP11	p.L221V	ENST00000371937.4	37	c.661		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.93|13.93	2.382949|2.382949	0.42207|0.42207	.|.	.|.	ENSG00000123472|ENSG00000123472	ENST00000534216|ENST00000371937;ENST00000492233;ENST00000542495;ENST00000532925	.|T	.|0.34275	.|1.37	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.22437|0.22437	0.0541|0.0541	N|N	0.21617|0.21617	0.685|0.685	0.58432|0.58432	D|D	0.999995|0.999995	.|P;P	.|0.42296	.|0.767;0.775	.|B;B	.|0.39660	.|0.172;0.306	T|T	0.06215|0.06215	-1.0839|-1.0839	6|10	0.87932|0.05525	D|T	0|0.97	-8.3799|-8.3799	13.2961|13.2961	0.60298|0.60298	0.072:0.0:0.928:0.0|0.072:0.0:0.928:0.0	.|.	.|110;198	.|B7Z7I6;Q5TC12	.|.;ATPF1_HUMAN	L|V	52|198;2;47;110	.|ENSP00000361005:L198V	ENSP00000432771:F52L|ENSP00000361005:L198V	F|L	-|-	3|1	2|2	ATPAF1|ATPAF1	46883512|46883512	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.800000|0.800000	0.45204|0.45204	5.849000|5.849000	0.69465|0.69465	2.747000|2.747000	0.94245|0.94245	0.650000|0.650000	0.86243|0.86243	TTC|CTA	ATPAF1	-	pfam_ATP11	ENSG00000123472		0.368	ATPAF1-201	KNOWN	basic	protein_coding	ATPAF1	HGNC	protein_coding		-	0.00	23	0	G	NM_022745		47110925	-1	tier1	-	no_errors	ENST00000576409	ensembl	human	known	74_37	missense	21.88	25	7	SNP	1.000	C
ATRX	546	genome.wustl.edu	37	X	76920219	76920219	+	Silent	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:76920219A>G	ENST00000373344.5	-	11	4072	c.3858T>C	c.(3856-3858)tcT>tcC	p.S1286S	ATRX_ENST00000395603.3_Silent_p.S1248S|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1286	Interaction with DAXX.			S -> P (in Ref. 4; BAD92165). {ECO:0000305}.	ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CATCCTCATCAGAGGAAAGAT	0.378			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											122.0	110.0	114.0					X																	76920219		2203	4296	6499	SO:0001819	synonymous_variant	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3858T>C	X.37:g.76920219A>G			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1286	ENST00000373344.5	37	c.3858	CCDS14434.1	X																																																																																			ATRX	-	NULL	ENSG00000085224		0.378	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	-	0.00	32	0	A	NM_000489		76920219	-1	tier1	-	no_errors	ENST00000373344	ensembl	human	known	74_37	silent	11.54	23	3	SNP	0.991	G
BAI3	577	genome.wustl.edu	37	6	69349111	69349111	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:69349111G>C	ENST00000370598.1	+	3	1365	c.544G>C	c.(544-546)Gaa>Caa	p.E182Q		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	182					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CTTAAAATCAGAAAATGGGAG	0.428																																																	0													70.0	71.0	70.0					6																	69349111		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.544G>C	6.37:g.69349111G>C	ENSP00000359630:p.Glu182Gln		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.E182Q	ENST00000370598.1	37	c.544	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	16.58	3.163801	0.57476	.	.	ENSG00000135298	ENST00000370598	T	0.20463	2.07	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000002	T	0.29652	0.0740	L	0.36672	1.1	0.80722	D	1	D	0.57899	0.981	D	0.67900	0.954	T	0.04165	-1.0972	10	0.72032	D	0.01	.	19.1611	0.93533	0.0:0.0:1.0:0.0	.	182	O60242	BAI3_HUMAN	Q	182	ENSP00000359630:E182Q	ENSP00000359630:E182Q	E	+	1	0	BAI3	69405832	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.610000	0.88304	0.655000	0.94253	GAA	BAI3	-	NULL	ENSG00000135298		0.428	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1		0.00	32	0	G			69349111	+1			no_errors	ENST00000370598	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	C
BRINP1	1620	genome.wustl.edu	37	9	121929790	121929790	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:121929790G>A	ENST00000265922.3	-	8	2319	c.1858C>T	c.(1858-1860)Cgt>Tgt	p.R620C	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	620					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GTCCGACTACGTAGGTAGATG	0.537																																																	0													123.0	120.0	121.0					9																	121929790		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1858C>T	9.37:g.121929790G>A	ENSP00000265922:p.Arg620Cys		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R620C	ENST00000265922.3	37	c.1858	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339327	0.60963	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.21932	1.98	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.43540	-0.9385	10	0.87932	D	0	-8.5031	18.8724	0.92320	0.0:0.0:1.0:0.0	.	620	O60477	DBC1_HUMAN	C	620	ENSP00000265922:R620C	ENSP00000265922:R620C	R	-	1	0	DBC1	120969611	1.000000	0.71417	0.983000	0.44433	0.991000	0.79684	4.514000	0.60482	2.540000	0.85666	0.655000	0.94253	CGT	BRINP1	-	NULL	ENSG00000078725		0.537	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	44	0	G	NM_014618		121929790	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	A
BRINP2	57795	genome.wustl.edu	37	1	177250184	177250184	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:177250184C>A	ENST00000361539.4	+	8	2184	c.1872C>A	c.(1870-1872)tgC>tgA	p.C624*	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	624					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CTGCCCAGTGCCAAAACTGGA	0.527																																																	0													70.0	69.0	69.0					1																	177250184		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1872C>A	1.37:g.177250184C>A	ENSP00000354481:p.Cys624*		O95560|Q6ZWC1|Q7LCZ9|Q8N360	Nonsense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.C624*	ENST00000361539.4	37	c.1872	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.542487	0.98348	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	.	.	.	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.9836	18.4386	0.90656	0.0:1.0:0.0:0.0	.	.	.	.	X	377;624	.	ENSP00000354481:C624X	C	+	3	2	FAM5B	175516807	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.689000	0.54706	2.443000	0.82685	0.313000	0.20887	TGC	BRINP2	-	NULL	ENSG00000198797		0.527	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	-	0.00	46	0	C	NM_021165		177250184	+1	tier1	-	no_errors	ENST00000361539	ensembl	human	known	74_37	nonsense	34.29	23	12	SNP	1.000	A
C2	717	genome.wustl.edu	37	6	31896637	31896637	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:31896637C>T	ENST00000299367.5	+	3	661	c.385C>T	c.(385-387)Cgt>Tgt	p.R129C	CFB_ENST00000556679.1_Intron|CFB_ENST00000477310.1_Missense_Mutation_p.R129C|CFB_ENST00000456570.1_Intron|C2_ENST00000442278.2_Intron|C2_ENST00000418949.2_Missense_Mutation_p.R129C|C2_ENST00000452323.2_Intron|C2_ENST00000469372.1_Intron	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	129	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		CTCGCCTGTGCGTCAGTGTCG	0.582																																																	0													104.0	90.0	94.0					6																	31896637		2203	4300	6503	SO:0001583	missense	0				CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.385C>T	6.37:g.31896637C>T	ENSP00000299367:p.Arg129Cys		B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	pfam_VWF_A,pfam_Peptidase_S1,pfam_Sushi_SCR_CCP,superfamily_Trypsin-like_Pept_dom,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_VWF_A,smart_Peptidase_S1,pirsf_Compl_C2_B,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R129C	ENST00000299367.5	37	c.385	CCDS4728.1	6	.	.	.	.	.	.	.	.	.	.	C	16.38	3.105890	0.56291	.	.	ENSG00000166278;ENSG00000166278;ENSG00000166278;ENSG00000244255	ENST00000413154;ENST00000299367;ENST00000418949;ENST00000477310	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.6	2.4	0.29515	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.34435	N	0.003975	T	0.72070	0.3415	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.995;1.0;0.999	T	0.77332	-0.2627	9	0.87932	D	0	-20.7336	12.8872	0.58051	0.4841:0.5159:0.0:0.0	.	100;129;129	B4DV48;P06681;Q8N6L6	.;CO2_HUMAN;.	C	129	ENSP00000403325:R129C;ENSP00000299367:R129C;ENSP00000406190:R129C;ENSP00000418996:R129C	ENSP00000299367:R129C	R	+	1	0	C2;XXbac-BPG116M5.17	32004616	0.987000	0.35691	0.697000	0.30258	0.594000	0.36715	0.845000	0.27668	0.675000	0.31264	0.491000	0.48974	CGT	C2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pirsf_Compl_C2_B,pfscan_Sushi_SCR_CCP	ENSG00000166278		0.582	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2	HGNC	protein_coding	OTTHUMT00000076379.9	-	0.00	35	0	C			31896637	+1	tier1	-	no_errors	ENST00000299367	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.631	T
C7orf55-LUC7L2	100996928	genome.wustl.edu	37	7	139045070	139045071	+	Splice_Site	INS	-	-	AA			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:139045070_139045071insAA	ENST00000354926.4	+	1	415		c.e1+2		RP11-634H22.1_ENST00000608266.1_RNA|C7orf55-LUC7L2_ENST00000541170.3_Intron|LUC7L2_ENST00000541515.3_Intron	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		CCCGGGACGGTAAGTCTCTGCC	0.748																																																	0																																										SO:0001630	splice_region_variant	0				CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.61+2->AA	7.37:g.139045071_139045072dupAA				Splice_Site	INS	-	e1+2	ENST00000354926.4	37	c.61+2_61+1	CCDS43656.1	7																																																																																			C7orf55-LUC7L2	-	-	ENSG00000146963		0.748	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf55-LUC7L2	HGNC	protein_coding	OTTHUMT00000323618.2		0.00	23	0	-		Intron	139045071	+1	tier1		no_errors	ENST00000354926	ensembl	human	known	74_37	splice_site_ins	17.14	29	6	INS	1.000:1.000	AA
KEL	3792	genome.wustl.edu	37	7	142636712	142636712	+	IGR	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:142636712C>T	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Silent_p.G23G	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					AGTGGGTGGGCAGGTCCATGC	0.667																																																	0													45.0	47.0	47.0					7																	142636712		2203	4300	6503	SO:0001628	intergenic_variant	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142636712C>T			B2RBV4|Q96RS8|Q99885	Silent	SNP	NULL	p.G23	ENST00000355265.2	37	c.69	CCDS34766.1	7																																																																																			C7orf34	-	NULL	ENSG00000165131		0.667	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf34	HGNC	protein_coding	OTTHUMT00000347671.2		0.00	23	0	C	NM_000420		142636712	+1			no_errors	ENST00000409607	ensembl	human	known	74_37	silent	11.11	32	4	SNP	0.531	T
CACNA1H	8912	genome.wustl.edu	37	16	1250520	1250520	+	Silent	SNP	C	C	T	rs369894677		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:1250520C>T	ENST00000348261.5	+	7	1316	c.1068C>T	c.(1066-1068)aaC>aaT	p.N356N	CACNA1H_ENST00000565831.1_Silent_p.N356N|CACNA1H_ENST00000358590.4_Silent_p.N356N	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	356					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)	p.N356N(2)		breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	ACCCCCACAACGGTGCCATCA	0.657																																																	2	Substitution - coding silent(2)	lung(2)						G	,	0,4264		0,0,2132	59.0	65.0	63.0		1068,1068	-0.2	1.0	16		63	1,8449		0,1,4224	no	coding-synonymous,coding-synonymous	CACNA1H	NM_001005407.1,NM_021098.2	,	0,1,6356	TT,TC,CC		0.0118,0.0,0.0079	,	356/2348,356/2354	1250520	1,12713	2132	4225	6357	SO:0001819	synonymous_variant	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.1068C>T	16.37:g.1250520C>T			B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.N356	ENST00000348261.5	37	c.1068	CCDS45375.1	16																																																																																			CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.657	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	-	0.00	72	0	C	NM_001005407		1250520	+1	tier1	-	no_errors	ENST00000348261	ensembl	human	known	74_37	silent	16.00	61	12	SNP	0.992	T
CARNS1	57571	genome.wustl.edu	37	11	67191150	67191150	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:67191150C>T	ENST00000307823.3	+	9	2014	c.1562C>T	c.(1561-1563)gCg>gTg	p.A521V	CARNS1_ENST00000445895.2_Missense_Mutation_p.A644V|CARNS1_ENST00000531040.1_Missense_Mutation_p.A618V|CARNS1_ENST00000423745.2_Missense_Mutation_p.A521V|CARNS1_ENST00000524740.1_3'UTR	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	521	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						CCCTGGCCTGCGCCCTCCCTC	0.657																																																	0													18.0	21.0	20.0					11																	67191150		2124	4235	6359	SO:0001583	missense	0				CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.1562C>T	11.37:g.67191150C>T	ENSP00000308268:p.Ala521Val		A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	superfamily_PreATP-grasp_dom,superfamily_TIL_dom,pfscan_ATP-grasp	p.A644V	ENST00000307823.3	37	c.1931	CCDS44658.1	11	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849837	0.32699	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000423745;ENST00000445895	D;D;D;D	0.97752	-4.52;-4.52;-4.52;-4.52	5.37	4.39	0.52855	ATP-grasp fold (1);	0.165132	0.28618	N	0.014716	D	0.93956	0.8065	L	0.29908	0.895	0.09310	N	1	P;P	0.51791	0.873;0.948	B;B	0.39503	0.27;0.301	D	0.88518	0.3094	10	0.29301	T	0.29	-20.3516	14.4366	0.67284	0.0:0.8514:0.1486:0.0	.	521;660	A5YM72;A5YM72-3	CRNS1_HUMAN;.	V	618;521;618;521;644	ENSP00000431670:A618V;ENSP00000308268:A521V;ENSP00000401519:A521V;ENSP00000389009:A644V	ENSP00000308268:A521V	A	+	2	0	CARNS1	66947726	0.638000	0.27225	0.772000	0.31596	0.919000	0.55068	3.924000	0.56476	2.515000	0.84797	0.549000	0.68633	GCG	CARNS1	-	pfscan_ATP-grasp	ENSG00000172508		0.657	CARNS1-001	KNOWN	basic|CCDS	protein_coding	CARNS1	HGNC	protein_coding	OTTHUMT00000395501.1		0.00	38	0	C	NM_020811		67191150	+1			no_errors	ENST00000445895	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.170	T
CCAR2	57805	genome.wustl.edu	37	8	22472942	22472942	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:22472942C>T	ENST00000308511.4	+	12	1459	c.1210C>T	c.(1210-1212)Cgc>Tgc	p.R404C	CCAR2_ENST00000520861.1_Missense_Mutation_p.R79C|CCAR2_ENST00000389279.3_Missense_Mutation_p.R404C|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	404					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)										GTGCAGGTGGCGCTTTGCCGA	0.562																																																	0													72.0	81.0	78.0					8																	22472942		2203	4300	6503	SO:0001583	missense	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.1210C>T	8.37:g.22472942C>T	ENSP00000310670:p.Arg404Cys		A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold	p.R404C	ENST00000308511.4	37	c.1210	CCDS34863.1	8	.	.	.	.	.	.	.	.	.	.	C	29.5	5.015255	0.93404	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000520861;ENST00000522599	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.38	5.38	0.77491	.	0.090044	0.45126	D	0.000390	T	0.68540	0.3012	M	0.71036	2.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.70777	-0.4780	10	0.87932	D	0	-16.3802	16.6817	0.85294	0.0:1.0:0.0:0.0	.	79;404	G3V119;Q8N163	.;K1967_HUMAN	C	404;404;79;222	ENSP00000310670:R404C;ENSP00000373930:R404C;ENSP00000429773:R79C;ENSP00000429739:R222C	ENSP00000310670:R404C	R	+	1	0	KIAA1967	22528887	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.066000	0.76734	2.793000	0.96121	0.655000	0.94253	CGC	CCAR2	-	NULL	ENSG00000158941		0.562	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR2	HGNC	protein_coding	OTTHUMT00000375865.1		0.00	56	0	C	NM_021174		22472942	+1			no_errors	ENST00000308511	ensembl	human	known	74_37	missense	5.17	54	3	SNP	1.000	T
CCDC141	285025	genome.wustl.edu	37	2	179914590	179914590	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:179914590T>C	ENST00000409284.1	-	1	196	c.79A>G	c.(79-81)Aaa>Gaa	p.K27E	CCDC141_ENST00000420890.2_Missense_Mutation_p.K27E			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	27										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ATAACGATTTTGGAGTCCCCA	0.453																																																	0																																										SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.79A>G	2.37:g.179914590T>C	ENSP00000386503:p.Lys27Glu		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K27E	ENST00000409284.1	37	c.79		2	.	.	.	.	.	.	.	.	.	.	T	21.4	4.141782	0.77775	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	T;T	0.48522	0.81;1.43	5.72	4.5	0.54988	.	.	.	.	.	T	0.27169	0.0666	N	0.19112	0.55	0.80722	D	1	P	0.38922	0.651	B	0.27887	0.084	T	0.09335	-1.0679	8	.	.	.	.	12.5505	0.56223	0.0:0.0:0.1388:0.8612	.	27	B8ZZB3	.	E	27	ENSP00000395995:K27E;ENSP00000390190:K27E	.	K	-	1	0	CCDC141	179622835	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.340000	0.52143	2.185000	0.69588	0.454000	0.30748	AAA	CCDC141	-	NULL	ENSG00000163492		0.453	CCDC141-003	PUTATIVE	basic	protein_coding	CCDC141	HGNC	protein_coding	OTTHUMT00000335873.1	-	0.00	67	0	T	NM_173648		179914590	-1	tier1	-	no_errors	ENST00000420890	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	C
CCDC168	643677	genome.wustl.edu	37	13	103386123	103386123	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:103386123G>A	ENST00000322527.2	-	1	3036	c.3037C>T	c.(3037-3039)Cga>Tga	p.R1013*		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	1013																	GACCTGACTCGTGAAGGTTGG	0.463																																																	0													51.0	46.0	48.0					13																	103386123		692	1591	2283	SO:0001587	stop_gained	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.3037C>T	13.37:g.103386123G>A	ENSP00000320232:p.Arg1013*		Q8N800	Nonsense_Mutation	SNP	NULL	p.R1013*	ENST00000322527.2	37	c.3037		13	.	.	.	.	.	.	.	.	.	.	G	37	6.312425	0.97467	.	.	ENSG00000175820	ENST00000322527	.	.	.	3.34	2.47	0.30058	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	7.9088	0.29778	0.0:0.0:0.7541:0.2459	.	.	.	.	X	1013	.	ENSP00000320232:R1013X	R	-	1	2	CCDC168	102184124	0.001000	0.12720	0.001000	0.08648	0.054000	0.15201	0.755000	0.26405	0.946000	0.37632	-0.309000	0.09137	CGA	CCDC168	-	NULL	ENSG00000175820		0.463	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding			0.00	50	0	G	NM_001146197		103386123	-1			no_errors	ENST00000322527	ensembl	human	known	74_37	nonsense	9.52	38	4	SNP	0.001	A
CCDC173	129881	genome.wustl.edu	37	2	170502518	170502518	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:170502518G>T	ENST00000447353.1	-	9	1597	c.1492C>A	c.(1492-1494)Cag>Aag	p.Q498K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	498																	GGTCCTTCCTGTACAGCTTTT	0.443																																																	0													172.0	176.0	175.0					2																	170502518		1885	4104	5989	SO:0001583	missense	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.1492C>A	2.37:g.170502518G>T	ENSP00000391504:p.Gln498Lys		Q6PJF6	Missense_Mutation	SNP	NULL	p.Q498K	ENST00000447353.1	37	c.1492	CCDS46445.1	2	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878328	0.33162	.	.	ENSG00000154479	ENST00000447353	.	.	.	5.87	3.94	0.45596	.	0.552371	0.19114	N	0.122350	T	0.37489	0.1005	L	0.50333	1.59	0.28565	N	0.910919	B	0.02656	0.0	B	0.04013	0.001	T	0.24261	-1.0165	9	0.12103	T	0.63	.	9.9798	0.41806	0.0:0.1133:0.6303:0.2564	.	498	Q0VFZ6	CB077_HUMAN	K	498	.	ENSP00000391504:Q498K	Q	-	1	0	C2orf77	170210764	0.883000	0.30277	0.999000	0.59377	0.988000	0.76386	1.994000	0.40757	1.578000	0.49821	0.655000	0.94253	CAG	CCDC173	-	NULL	ENSG00000154479		0.443	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC173	HGNC	protein_coding	OTTHUMT00000333954.2	-	0.00	90	0	G	NM_001085447		170502518	-1	tier1	-	no_errors	ENST00000447353	ensembl	human	known	74_37	missense	5.68	83	5	SNP	0.994	T
CCR5	1234	genome.wustl.edu	37	3	46414667	46414667	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:46414667G>A	ENST00000292303.4	+	2	420	c.274G>A	c.(274-276)Gcc>Acc	p.A92T	RP11-24F11.2_ENST00000451485.1_RNA|CCR5_ENST00000343801.4_Missense_Mutation_p.A92T|CCR5_ENST00000445772.1_Missense_Mutation_p.A92T	NM_001100168.1	NP_001093638.1	P51681	CCR5_HUMAN	chemokine (C-C motif) receptor 5 (gene/pseudogene)	92					calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|signaling (GO:0023052)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine receptor activity (GO:0004950)|coreceptor activity (GO:0015026)|phosphatidylinositol phospholipase C activity (GO:0004435)			central_nervous_system(1)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(193;0.00112)|KIRC - Kidney renal clear cell carcinoma(197;0.017)|Kidney(197;0.02)	Maraviroc(DB04835)	CTATGCTGCCGCCCAGTGGGA	0.473																																																	0													173.0	171.0	171.0					3																	46414667		2203	4296	6499	SO:0001583	missense	0				CCDS2739.1	3p21	2012-08-08	2012-01-23		ENSG00000160791	ENSG00000160791		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1606	protein-coding gene	gene with protein product		601373	"""chemokine (C-C motif) receptor 5"""	CMKBR5		8639485	Standard	NM_001100168		Approved	CKR-5, CC-CKR-5, CKR5, CD195, IDDM22	uc003cpo.4	P51681	OTTHUMG00000133481	ENST00000292303.4:c.274G>A	3.37:g.46414667G>A	ENSP00000292303:p.Ala92Thr		O14692|O14693|O14695|O14696|O14697|O14698|O14699|O14700|O14701|O14702|O14703|O14704|O14705|O14706|O14707|O14708|O15538|Q9UPA4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_rcpt,prints_GPCR_Rhodpsn,prints_Chemokine_CCR5,prints_Chemokine_CCR1,prints_ATII_rcpt	p.A92T	ENST00000292303.4	37	c.274	CCDS2739.1	3	.	.	.	.	.	.	.	.	.	.	G	5.406	0.260046	0.10239	.	.	ENSG00000160791	ENST00000343801;ENST00000400886;ENST00000292303;ENST00000445772	T;T;T	0.72615	-0.67;-0.67;-0.67	5.42	-2.67	0.06059	GPCR, rhodopsin-like superfamily (1);	0.985119	0.08230	U	0.977791	T	0.50274	0.1606	N	0.25890	0.77	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.22695	-1.0209	10	0.33940	T	0.23	.	2.7975	0.05405	0.3804:0.311:0.2163:0.0923	.	92	P51681	CCR5_HUMAN	T	92;72;92;92	ENSP00000343985:A92T;ENSP00000292303:A92T;ENSP00000404881:A92T	ENSP00000292303:A92T	A	+	1	0	CCR5	46389671	0.000000	0.05858	0.000000	0.03702	0.182000	0.23217	-0.099000	0.11007	-0.992000	0.03472	-0.314000	0.08810	GCC	CCR5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ATII_rcpt	ENSG00000160791		0.473	CCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR5	HGNC	protein_coding	OTTHUMT00000257377.2	-	0.00	52	0	G	NM_000579		46414667	+1	tier1	-	no_errors	ENST00000292303	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.000	A
CDH12	1010	genome.wustl.edu	37	5	21760691	21760691	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:21760691T>G	ENST00000382254.1	-	13	2695	c.1609A>C	c.(1609-1611)Aat>Cat	p.N537H	CDH12_ENST00000504376.2_Missense_Mutation_p.N537H|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Missense_Mutation_p.N497H|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	537	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ACTGTAAAATTTGGTTTGATA	0.383										HNSCC(59;0.17)																																							0													132.0	138.0	136.0					5																	21760691		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1609A>C	5.37:g.21760691T>G	ENSP00000371689:p.Asn537His		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N537H	ENST00000382254.1	37	c.1609	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	T	20.8	4.051557	0.75960	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.52754	0.65;0.65;0.65	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.65616	0.2708	M	0.64630	1.985	0.58432	D	0.999997	D;D	0.76494	0.998;0.999	D;D	0.87578	0.976;0.998	T	0.65639	-0.6119	10	0.42905	T	0.14	.	15.3511	0.74389	0.0:0.0:0.0:1.0	.	497;537	B7Z2U6;P55289	.;CAD12_HUMAN	H	537;537;497	ENSP00000423577:N537H;ENSP00000371689:N537H;ENSP00000428786:N497H	ENSP00000371689:N537H	N	-	1	0	CDH12	21796448	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.628000	0.83189	2.081000	0.62600	0.528000	0.53228	AAT	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.383	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	55	0	T	NM_004061		21760691	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	12.33	64	9	SNP	1.000	G
CDKN1C	1028	genome.wustl.edu	37	11	2906386	2906386	+	Missense_Mutation	SNP	C	C	T	rs483352976		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:2906386C>T	ENST00000414822.3	-	1	725	c.334G>A	c.(334-336)Gcg>Acg	p.A112T	CDKN1C_ENST00000313407.6_Missense_Mutation_p.A101T|CDKN1C_ENST00000380725.1_Intron|CDKN1C_ENST00000430149.2_Missense_Mutation_p.A112T|CDKN1C_ENST00000440480.2_Missense_Mutation_p.A101T	NM_000076.2	NP_000067.1	P49918	CDN1C_HUMAN	cyclin-dependent kinase inhibitor 1C (p57, Kip2)	112					adrenal gland development (GO:0030325)|aging (GO:0007568)|camera-type eye development (GO:0043010)|cell cycle arrest (GO:0007050)|digestive system development (GO:0055123)|embryonic placenta morphogenesis (GO:0060669)|genetic imprinting (GO:0071514)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|myeloid cell differentiation (GO:0030099)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of kinase activity (GO:0033673)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron maturation (GO:0042551)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|skeletal system development (GO:0001501)|uterus development (GO:0060065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)			central_nervous_system(1)|lung(1)	2		all_epithelial(84;0.000187)|Medulloblastoma(188;0.00106)|Ovarian(85;0.0014)|Breast(177;0.00328)|all_neural(188;0.00681)|all_lung(207;0.157)|Lung NSC(207;0.216)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACAGCCACCGCGACCGCGACG	0.766																																					GBM(111;59 1151 2497 5746 16112 18241 29216)												0													2.0	2.0	2.0					11																	2906386		1405	2729	4134	SO:0001583	missense	0			D64137	CCDS7738.1, CCDS44519.1	11p15.5	2014-09-17	2004-02-13		ENSG00000129757	ENSG00000129757			1786	protein-coding gene	gene with protein product		600856	"""Beckwith-Wiedemann syndrome"""	BWCR, BWS		7729684	Standard	NM_000076		Approved	P57, KIP2	uc001lws.4	P49918	OTTHUMG00000010040	ENST00000414822.3:c.334G>A	11.37:g.2906386C>T	ENSP00000413720:p.Ala112Thr			Missense_Mutation	SNP	pfam_CDI	p.A112T	ENST00000414822.3	37	c.334	CCDS7738.1	11	.	.	.	.	.	.	.	.	.	.	c	13.39	2.224162	0.39300	.	.	ENSG00000129757	ENST00000414822;ENST00000440480;ENST00000313407;ENST00000430149	D;D;D;D	0.91351	-2.5;-2.83;-2.83;-2.5	1.87	0.936	0.19488	.	.	.	.	.	T	0.78426	0.4281	L	0.29908	0.895	0.09310	N	1	B	0.31209	0.313	B	0.12156	0.007	T	0.62914	-0.6753	9	0.14656	T	0.56	.	3.8251	0.08851	0.2357:0.6144:0.0:0.1498	.	112	P49918	CDN1C_HUMAN	T	112;101;101;112	ENSP00000413720:A112T;ENSP00000411257:A101T;ENSP00000321019:A101T;ENSP00000411552:A112T	ENSP00000321019:A101T	A	-	1	0	CDKN1C	2862962	0.000000	0.05858	0.002000	0.10522	0.698000	0.40448	0.234000	0.17930	0.381000	0.24851	0.298000	0.19748	GCG	CDKN1C	-	NULL	ENSG00000129757		0.766	CDKN1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDKN1C	HGNC	protein_coding	OTTHUMT00000027774.2		0.00	31	0	C	NM_000076		2906386	-1			no_errors	ENST00000414822	ensembl	human	known	74_37	missense	38.89	10	7	SNP	0.004	T
CDKN2A	1029	genome.wustl.edu	37	9	21971119	21971119	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:21971119C>T	ENST00000304494.5	-	2	509	c.239G>A	c.(238-240)cGa>cAa	p.R80Q	CDKN2A_ENST00000530628.2_Silent_p.P94P|CDKN2A_ENST00000361570.3_Silent_p.P135P|CDKN2A_ENST00000494262.1_Missense_Mutation_p.R29Q|CDKN2A_ENST00000497750.1_Missense_Mutation_p.R29Q|CDKN2A_ENST00000498124.1_Missense_Mutation_p.R80Q|CDKN2A_ENST00000498628.2_Missense_Mutation_p.R29Q|CDKN2A_ENST00000579755.1_Silent_p.P94P|CDKN2A_ENST00000446177.1_Missense_Mutation_p.R80Q|CDKN2A_ENST00000579122.1_Missense_Mutation_p.R80Q|CDKN2A_ENST00000578845.2_Missense_Mutation_p.R29Q|CDKN2A_ENST00000479692.2_Missense_Mutation_p.R29Q|RP11-145E5.5_ENST00000404796.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	80			R -> L (in a head and neck tumor).|R -> P (in CMM2; loss of CDK4 binding). {ECO:0000269|PubMed:19260062}.		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.R80Q(2)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.R80fs*66(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.E61_L94del(1)|p.A68fs*3(1)|p.R80fs*34(1)|p.R80L(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GTGCACGGGTCGGGTGAGAGT	0.731		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1371	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(7)|Substitution - Missense(3)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(284)|skin(174)|central_nervous_system(167)|lung(145)|urinary_tract(92)|bone(75)|soft_tissue(57)|oesophagus(56)|pleura(51)|upper_aerodigestive_tract(50)|ovary(36)|kidney(32)|breast(32)|pancreas(31)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)											11.0	14.0	13.0					9																	21971119		2169	4250	6419	SO:0001583	missense	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.239G>A	9.37:g.21971119C>T	ENSP00000307101:p.Arg80Gln		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.R80Q	ENST00000304494.5	37	c.239	CCDS6510.1	9	.	.	.	.	.	.	.	.	.	.	C	18.90	3.720783	0.68959	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	T;T	0.78707	-1.2;-1.2	5.93	2.87	0.33458	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.81903	0.4921	.	.	.	0.80722	D	1	D	0.89917	1.0	P	0.61003	0.882	T	0.80937	-0.1159	8	0.54805	T	0.06	-2.989	5.4685	0.16656	0.1617:0.6145:0.0:0.2239	.	80	P42771	CD2A1_HUMAN	Q	80	ENSP00000307101:R80Q;ENSP00000394932:R80Q	ENSP00000307101:R80Q	R	-	2	0	CDKN2A	21961119	0.010000	0.17322	0.993000	0.49108	0.886000	0.51366	0.044000	0.13992	1.514000	0.48869	0.650000	0.86243	CGA	CDKN2A	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000147889		0.731	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1		0.00	25	0	C	NM_000077		21971119	-1			no_errors	ENST00000446177	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.875	T
CEBPA	1050	genome.wustl.edu	37	19	33793280	33793280	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:33793280G>T	ENST00000498907.2	-	1	190	c.41C>A	c.(40-42)cCg>cAg	p.P14Q	CTD-2540B15.11_ENST00000589932.1_RNA|CTD-2540B15.7_ENST00000587312.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.9_ENST00000593041.1_lincRNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	14					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.P14fs*143(2)|p.P14R(1)|p.Y7_G130del(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					GCTGCTCATCGGGGGCCGCGG	0.771			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																															Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	4	Deletion - Frameshift(2)|Substitution - Missense(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(4)											1.0	1.0	1.0					19																	33793280		445	1001	1446	SO:0001583	missense	0	Familial Cancer Database	Familial AML	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.41C>A	19.37:g.33793280G>T	ENSP00000427514:p.Pro14Gln		A7LNP2|P78319|Q05CA4	Missense_Mutation	SNP	pfam_bZIP,smart_bZIP,pirsf_CCAAT/enhancer-binding,pfscan_bZIP	p.P14Q	ENST00000498907.2	37	c.41	CCDS54243.1	19	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299478	0.40694	.	.	ENSG00000245848	ENST00000498907	T	0.34472	1.36	4.13	1.91	0.25777	.	.	.	.	.	T	0.27313	0.0670	L	0.43152	1.355	0.29100	N	0.881568	P	0.49862	0.929	B	0.40134	0.32	T	0.11203	-1.0597	9	0.27082	T	0.32	.	9.3556	0.38164	0.184:0.0:0.816:0.0	.	14	P49715	CEBPA_HUMAN	Q	14	ENSP00000427514:P14Q	ENSP00000427514:P14Q	P	-	2	0	CEBPA	38485120	1.000000	0.71417	0.995000	0.50966	0.518000	0.34316	2.064000	0.41432	0.199000	0.20427	-0.707000	0.03653	CCG	CEBPA	-	pirsf_CCAAT/enhancer-binding	ENSG00000245848		0.771	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEBPA	HGNC	protein_coding	OTTHUMT00000365012.1		0.00	12	0	G	NM_004364		33793280	-1			no_errors	ENST00000498907	ensembl	human	known	74_37	missense	50.00	3	3	SNP	0.995	T
CENPI	2491	genome.wustl.edu	37	X	100395679	100395679	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:100395679G>T	ENST00000372927.1	+	15	1772	c.1495G>T	c.(1495-1497)Gag>Tag	p.E499*	CENPI_ENST00000423383.1_Nonsense_Mutation_p.E499*|CENPI_ENST00000372926.1_Nonsense_Mutation_p.E499*|CENPI_ENST00000218507.5_Nonsense_Mutation_p.E499*	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	499					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						GAGTCTGAAAGAGCTATTGCA	0.403																																																	0													222.0	208.0	213.0					X																	100395679		2203	4300	6503	SO:0001587	stop_gained	0			X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	ENST00000372927.1:c.1495G>T	X.37:g.100395679G>T	ENSP00000362018:p.Glu499*		Q5JWZ9|Q96ED0	Nonsense_Mutation	SNP	pfam_CENP-I	p.E499*	ENST00000372927.1	37	c.1495	CCDS14479.1	X	.	.	.	.	.	.	.	.	.	.	g	39	7.681898	0.98431	.	.	ENSG00000102384	ENST00000423383;ENST00000218507;ENST00000372926;ENST00000372927	.	.	.	5.48	4.57	0.56435	.	0.334913	0.34879	N	0.003614	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-6.7795	15.9146	0.79503	0.0:0.1317:0.8683:0.0	.	.	.	.	X	499	.	ENSP00000218507:E499X	E	+	1	0	CENPI	100282335	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	2.418000	0.44662	2.428000	0.82296	0.600000	0.82982	GAG	CENPI	-	pfam_CENP-I	ENSG00000102384		0.403	CENPI-004	KNOWN	basic|CCDS	protein_coding	CENPI	HGNC	protein_coding	OTTHUMT00000057519.1	-	0.00	23	0	G	NM_006733		100395679	+1	tier1	-	no_errors	ENST00000372927	ensembl	human	known	74_37	nonsense	12.50	28	4	SNP	1.000	T
CHEK2	11200	genome.wustl.edu	37	22	29130401	29130401	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:29130401A>T	ENST00000405598.1	-	3	500	c.309T>A	c.(307-309)ttT>ttA	p.F103L	CHEK2_ENST00000382578.1_Missense_Mutation_p.F103L|CHEK2_ENST00000404276.1_Missense_Mutation_p.F103L|CHEK2_ENST00000382566.1_Missense_Mutation_p.F103L|CHEK2_ENST00000348295.3_Missense_Mutation_p.F103L|CHEK2_ENST00000382565.1_Missense_Mutation_p.F103L|CHEK2_ENST00000544772.1_5'UTR|CHEK2_ENST00000403642.1_Missense_Mutation_p.F103L|CHEK2_ENST00000328354.6_Missense_Mutation_p.F103L|CHEK2_ENST00000382580.2_Missense_Mutation_p.F103L|CHEK2_ENST00000402731.1_Missense_Mutation_p.F103L			O96017	CHK2_HUMAN	checkpoint kinase 2	103					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CAAGATTGGCAAATCCATCCT	0.458			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	0													41.0	45.0	43.0					22																	29130401		2203	4300	6503	SO:0001583	missense	0			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.309T>A	22.37:g.29130401A>T	ENSP00000386087:p.Phe103Leu		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_FHA_dom,superfamily_Kinase-like_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FHA_dom,pfscan_Prot_kinase_dom	p.F103L	ENST00000405598.1	37	c.309	CCDS13843.1	22	.	.	.	.	.	.	.	.	.	.	A	18.98	3.738409	0.69304	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000382565;ENST00000382566;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731;ENST00000447421;ENST00000439200;ENST00000398017	D;T;T;D;D;D;D;T;T;D;D;T;D	0.89746	-2.56;-0.15;-1.02;-2.56;-2.56;-2.56;-2.56;2.51;-0.15;-2.56;-2.56;2.51;-2.56	5.32	4.31	0.51392	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.043608	0.85682	D	0.000000	D	0.91878	0.7429	M	0.61703	1.905	0.49582	D	0.999803	P;D;P;P;B;B	0.67145	0.783;0.996;0.818;0.859;0.1;0.082	B;D;B;P;B;B	0.73380	0.335;0.98;0.255;0.487;0.113;0.122	D	0.90626	0.4563	10	0.42905	T	0.14	-7.6284	9.1006	0.36667	0.17:0.0:0.83:0.0	.	103;103;103;103;103;103	O96017-7;O96017-4;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	L	103;103;103;103;103;103;103;103;103;103;103;103;113	ENSP00000329012:F103L;ENSP00000372021:F103L;ENSP00000372006:F103L;ENSP00000372007:F103L;ENSP00000329178:F103L;ENSP00000385747:F103L;ENSP00000386087:F103L;ENSP00000372023:F103L;ENSP00000384919:F103L;ENSP00000384835:F103L;ENSP00000397478:F103L;ENSP00000408065:F103L;ENSP00000381099:F113L	ENSP00000329178:F103L	F	-	3	2	CHEK2	27460401	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.678000	0.54627	1.350000	0.45770	-0.242000	0.12053	TTT	CHEK2	-	superfamily_SMAD_FHA_domain	ENSG00000183765		0.458	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	HGNC	protein_coding	OTTHUMT00000321150.1	-	0.00	55	0	A	NM_001005735		29130401	-1	tier1	-	no_errors	ENST00000382580	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
CHM	1121	genome.wustl.edu	37	X	85117942	85117943	+	3'UTR	INS	-	-	A	rs201221621		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:85117942_85117943insA	ENST00000357749.2	-	0	3683_3684				CHM_ENST00000467744.2_5'UTR	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				GATGTTGTGAGAAAAAAAAACA	0.376													?|AAAAAAAAA|AAAAAAAAAA|unsure	21	0.00556291	0.0159	0.0	3775	,	,		14395	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.*1693->T	X.37:g.85117951_85117951dupA			A1L4D2|O43732	RNA	INS	-	NULL	ENST00000357749.2	37	NULL	CCDS14454.1	X																																																																																			CHM	-	-	ENSG00000188419		0.376	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3		0.00	35	0	-	NM_000390		85117943	-1	tier1		no_errors	ENST00000467744	ensembl	human	known	74_37	rna	7.89	35	3	INS	0.000:0.002	A
CLEC17A	388512	genome.wustl.edu	37	19	14720879	14720879	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:14720879C>A	ENST00000417570.1	+	14	1046	c.1008C>A	c.(1006-1008)ttC>ttA	p.F336L	CLEC17A_ENST00000397439.2_Missense_Mutation_p.L283M|CLEC17A_ENST00000547437.1_Missense_Mutation_p.L300M	NM_001204118.1	NP_001191047.1	Q6ZS10	CL17A_HUMAN	C-type lectin domain family 17, member A	336	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					cell surface (GO:0009986)|integral component of membrane (GO:0016021)	fucose binding (GO:0042806)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)										catccagcttctgggagccaG	0.463																																																	0													98.0	92.0	94.0					19																	14720879		1907	4130	6037	SO:0001583	missense	0			AK127809	CCDS46002.1, CCDS46002.2, CCDS56087.1	19p13.12	2009-06-26			ENSG00000187912	ENSG00000187912		"""C-type lectin domain containing"""	34520	protein-coding gene	gene with protein product	"""prolectin"""					19419970	Standard	NM_207390		Approved	FLJ45910	uc010dzn.2	Q6ZS10		ENST00000417570.1:c.1008C>A	19.37:g.14720879C>A	ENSP00000393719:p.Phe336Leu		A8MX68|B2RTX0|B7ZMM4	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.F336L	ENST00000417570.1	37	c.1008	CCDS56087.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.498|8.498	0.863666|0.863666	0.17250|0.17250	.|.	.|.	ENSG00000187912|ENSG00000187912	ENST00000417570|ENST00000547437;ENST00000397439	T|T;T	0.16324|0.20881	2.35|2.04;2.05	3.73|3.73	-1.41|-1.41	0.08941|0.08941	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);|.	.|.	.|.	.|.	.|.	T|T	0.35998|0.35998	0.0951|0.0951	L|L	0.58354|0.58354	1.805|1.805	0.21416|0.21416	N|N	0.999694|0.999694	D|D	0.69078|0.89917	0.997|1.0	D|D	0.79108|0.87578	0.992|0.998	T|T	0.18461|0.18461	-1.0336|-1.0336	9|9	0.66056|0.87932	D|D	0.02|0	.|.	6.7171|6.7171	0.23310|0.23310	0.0:0.486:0.0:0.514|0.0:0.486:0.0:0.514	.|.	336|300	Q6ZS10|Q6ZS10-3	CL17A_HUMAN|.	L|M	336|300;283	ENSP00000393719:F336L|ENSP00000450065:L300M;ENSP00000380581:L283M	ENSP00000393719:F336L|ENSP00000380581:L283M	F|L	+|+	3|1	2|2	CLEC17A|CLEC17A	14581879|14581879	0.999000|0.999000	0.42202|0.42202	0.830000|0.830000	0.32933|0.32933	0.016000|0.016000	0.09150|0.09150	0.150000|0.150000	0.16263|0.16263	-0.374000|-0.374000	0.07967|0.07967	-0.766000|-0.766000	0.03442|0.03442	TTC|CTG	CLEC17A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000187912		0.463	CLEC17A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC17A	HGNC	protein_coding	OTTHUMT00000403400.1	-	0.00	80	0	C	NM_207390		14720879	+1	tier1	-	no_errors	ENST00000417570	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.964	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43844248	43844248	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:43844248T>G	ENST00000377564.3	+	10	1975	c.1582T>G	c.(1582-1584)Tta>Gta	p.L528V		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	528	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						GGATCCCATCTTAGTACAGCA	0.572																																																	0																																										SO:0001583	missense	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1582T>G	9.37:g.43844248T>G	ENSP00000366787:p.Leu528Val		B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.L528V	ENST00000377564.3	37	c.1582	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	t	13.34	2.208785	0.39003	.	.	ENSG00000154529	ENST00000377564;ENST00000341990	T	0.72942	-0.7	3.34	-3.56	0.04626	.	.	.	.	.	T	0.46386	0.1390	N	0.16656	0.425	0.09310	N	1	.	.	.	.	.	.	T	0.35251	-0.9796	7	0.13108	T	0.6	.	6.8984	0.24269	0.144:0.0:0.4725:0.3834	.	.	.	.	V	528	ENSP00000366787:L528V	ENSP00000340890:L528V	L	+	1	2	CNTNAP3B	43784244	0.000000	0.05858	0.000000	0.03702	0.939000	0.58152	0.001000	0.13038	-0.763000	0.04658	0.402000	0.26972	TTA	CNTNAP3B	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000154529		0.572	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	-	0.00	101	0	T			43844248	+1	tier1	-	no_errors	ENST00000377564	ensembl	human	known	74_37	missense	18.68	74	17	SNP	0.000	G
COL11A2	1302	genome.wustl.edu	37	6	33141688	33141688	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:33141688G>A	ENST00000374708.4	-	32	2545	c.2287C>T	c.(2287-2289)Cgg>Tgg	p.R763W	COL11A2_ENST00000374713.1_Missense_Mutation_p.R802W|COL11A2_ENST00000361917.1_Missense_Mutation_p.R742W|COL11A2_ENST00000374712.1_Missense_Mutation_p.R768W|COL11A2_ENST00000374714.1_Missense_Mutation_p.R823W|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000357486.1_Missense_Mutation_p.R828W|COL11A2_ENST00000395197.1_Missense_Mutation_p.R789W|COL11A2_ENST00000341947.2_Missense_Mutation_p.R849W	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	849	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CGGGGTCCCCGCTGACCCCGT	0.612																																					Melanoma(1;90 116 3946 5341 17093)												0													73.0	78.0	76.0					6																	33141688		2203	4300	6503	SO:0001583	missense	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2287C>T	6.37:g.33141688G>A	ENSP00000363840:p.Arg763Trp		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.R849W	ENST00000374708.4	37	c.2545	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561303	0.65538	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	4.6	3.72	0.42706	.	0.000000	0.85682	D	0.000000	T	0.69070	0.3070	M	0.91196	3.185	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.99	T	0.75651	-0.3244	10	0.87932	D	0	.	9.9522	0.41645	0.0:0.0:0.6322:0.3678	.	742;763;849	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	W	763;849;828;823;802;789;768;742	ENSP00000363840:R763W;ENSP00000339915:R849W;ENSP00000350079:R828W;ENSP00000363846:R823W;ENSP00000363845:R802W;ENSP00000378623:R789W;ENSP00000363844:R768W;ENSP00000355123:R742W	ENSP00000339915:R849W	R	-	1	2	COL11A2	33249666	0.998000	0.40836	1.000000	0.80357	0.848000	0.48234	1.526000	0.35964	1.145000	0.42336	0.448000	0.29417	CGG	COL11A2	-	pfam_Collagen	ENSG00000204248		0.612	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2		0.00	51	0	G			33141688	-1			no_errors	ENST00000341947	ensembl	human	known	74_37	missense	5.00	37	2	SNP	1.000	A
COL4A2	1284	genome.wustl.edu	37	13	111160399	111160399	+	Missense_Mutation	SNP	C	C	T	rs201300563		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:111160399C>T	ENST00000360467.5	+	47	5018	c.4712C>T	c.(4711-4713)gCg>gTg	p.A1571V	COL4A2-AS1_ENST00000417970.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1571	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)	p.A1571G(1)		NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			TCTACCACTGCGCCGCTGCCC	0.622																																																	1	Substitution - Missense(1)	endometrium(1)						C	VAL/ALA	0,4366		0,0,2183	76.0	84.0	81.0		4712	4.9	0.9	13		81	2,8568		0,2,4283	yes	missense	COL4A2	NM_001846.2	64	0,2,6466	TT,TC,CC		0.0233,0.0,0.0155	probably-damaging	1571/1713	111160399	2,12934	2183	4285	6468	SO:0001583	missense	0			AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.4712C>T	13.37:g.111160399C>T	ENSP00000353654:p.Ala1571Val		Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.A1571V	ENST00000360467.5	37	c.4712	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585217	0.86748	0.0	2.33E-4	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.82893	-1.66	4.94	4.94	0.65067	C-type lectin fold (1);	0.000000	0.56097	D	0.000038	D	0.91429	0.7295	M	0.87456	2.885	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	D	0.89622	0.3849	10	0.13853	T	0.58	.	18.1809	0.89777	0.0:1.0:0.0:0.0	.	1571	P08572	CO4A2_HUMAN	V	1571	ENSP00000353654:A1571V	ENSP00000257309:A1571V	A	+	2	0	COL4A2	109958400	1.000000	0.71417	0.867000	0.34043	0.739000	0.42172	5.579000	0.67457	2.256000	0.74724	0.655000	0.94253	GCG	COL4A2	-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	ENSG00000134871		0.622	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	HGNC	protein_coding	OTTHUMT00000045761.2		0.00	40	0	C	NM_001846		111160399	+1			no_errors	ENST00000360467	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.998	T
CUX1	1523	genome.wustl.edu	37	7	101740766	101740766	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:101740766G>A	ENST00000292535.7	+	5	429	c.391G>A	c.(391-393)Gaa>Aaa	p.E131K	CUX1_ENST00000547394.2_Missense_Mutation_p.E126K|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.E131K|CUX1_ENST00000292538.4_Missense_Mutation_p.E142K|CUX1_ENST00000437600.4_Missense_Mutation_p.E142K|CUX1_ENST00000393824.3_Missense_Mutation_p.E105K|CUX1_ENST00000360264.3_Missense_Mutation_p.E142K|CUX1_ENST00000549414.2_Missense_Mutation_p.E131K|CUX1_ENST00000550008.2_Missense_Mutation_p.E131K|CUX1_ENST00000556210.1_Missense_Mutation_p.E131K	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	131					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						GGAATTTGCTGAAGTGAAAAA	0.378																																																	0													90.0	94.0	92.0					7																	101740766		2203	4300	6503	SO:0001583	missense	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.391G>A	7.37:g.101740766G>A	ENSP00000292535:p.Glu131Lys		B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.E142K	ENST00000292535.7	37	c.424	CCDS5721.1	7	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653829	0.88056	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T	0.77750	1.05;1.05;1.05;1.05;1.05;-1.12;1.05;1.05;1.05	5.96	5.96	0.96718	.	0.187557	0.46758	D	0.000266	T	0.79701	0.4491	L	0.52905	1.665	0.47214	D	0.99935	P;P;D;P;D;P	0.57257	0.915;0.799;0.979;0.675;0.965;0.873	B;B;P;B;P;P	0.50109	0.164;0.272;0.631;0.367;0.526;0.461	T	0.74785	-0.3547	10	0.19147	T	0.46	-9.6931	18.5813	0.91172	0.0:0.0:1.0:0.0	.	105;131;126;142;142;142	B4DZZ2;P39880;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;CASP_HUMAN;.	K	142;126;142;142;131;131;131;131;131	ENSP00000292538:E142K;ENSP00000449371:E126K;ENSP00000353401:E142K;ENSP00000414091:E142K;ENSP00000292535:E131K;ENSP00000446630:E131K;ENSP00000447373:E131K;ENSP00000450125:E131K;ENSP00000451558:E131K	ENSP00000292535:E131K	E	+	1	0	CUX1	101527486	1.000000	0.71417	0.938000	0.37757	0.967000	0.64934	7.174000	0.77620	2.826000	0.97356	0.655000	0.94253	GAA	CUX1	-	NULL	ENSG00000257923		0.378	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	-	0.00	66	0	G	NM_001913		101740766	+1	tier1	-	no_errors	ENST00000360264	ensembl	human	known	74_37	missense	19.15	38	9	SNP	0.999	A
CUL1	8454	genome.wustl.edu	37	7	148480983	148480983	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:148480983G>T	ENST00000325222.4	+	10	1470		c.e10+1		CUL1_ENST00000602748.1_Splice_Site|CUL1_ENST00000409469.1_Splice_Site	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TCTTGATAAGGTAGGTGCGTG	0.443																																																	0													121.0	107.0	112.0					7																	148480983		2203	4300	6503	SO:0001630	splice_region_variant	0			U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1191+1G>T	7.37:g.148480983G>T			D3DWG3|O60719|Q08AL6|Q8IYW1	Splice_Site	SNP	-	e9+1	ENST00000325222.4	37	c.1191+1	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	g	19.60	3.857808	0.71834	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.418	0.90577	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CUL1	148111916	1.000000	0.71417	0.993000	0.49108	0.594000	0.36715	9.485000	0.97942	2.421000	0.82119	0.655000	0.94253	.	CUL1	-	-	ENSG00000055130		0.443	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	HGNC	protein_coding	OTTHUMT00000467785.1	-	0.00	77	0	G	NM_003592	Intron	148480983	+1	tier1	-	no_errors	ENST00000325222	ensembl	human	known	74_37	splice_site	6.35	59	4	SNP	1.000	T
CXXC5	51523	genome.wustl.edu	37	5	139060236	139060236	+	Missense_Mutation	SNP	C	C	T	rs201076972		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:139060236C>T	ENST00000302517.3	+	2	842	c.128C>T	c.(127-129)gCc>gTc	p.A43V	CXXC5_ENST00000511048.1_Missense_Mutation_p.A43V	NM_016463.7	NP_057547.5	Q7LFL8	CXXC5_HUMAN	CXXC finger protein 5	43					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGTGGCTGCCGCCGCACCA	0.652																																																	0													18.0	32.0	27.0					5																	139060236		2116	4201	6317	SO:0001583	missense	0			AK024338	CCDS43370.1	5q31.3	2014-02-18	2011-12-01						26943	protein-coding gene	gene with protein product	"""retinoid-inducible nuclear factor"", ""WT1-induced Inhibitor of Dishevelled"""	612752				11042152, 19001364, 19182210, 20220130	Standard	NM_016463		Approved	HSPC195, RINF, WID	uc010jfg.1	Q7LFL8		ENST00000302517.3:c.128C>T	5.37:g.139060236C>T	ENSP00000302543:p.Ala43Val		B3KND0|C8CBA8|Q8TB79|Q9NV51|Q9P0S8	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.A43V	ENST00000302517.3	37	c.128	CCDS43370.1	5	.	.	.	.	.	.	.	.	.	.	C	8.171	0.791696	0.16258	.	.	ENSG00000171604	ENST00000502295;ENST00000504944;ENST00000302517;ENST00000504844;ENST00000502336;ENST00000520967;ENST00000511048;ENST00000512816;ENST00000509238;ENST00000502716;ENST00000503511;ENST00000511457	.	.	.	4.38	3.5	0.40072	.	1.600890	0.03402	N	0.203478	T	0.27524	0.0676	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.16958	-1.0385	9	0.42905	T	0.14	2.0176	8.0272	0.30444	0.0:0.8885:0.0:0.1115	.	43	Q7LFL8	CXXC5_HUMAN	V	43	.	ENSP00000302543:A43V	A	+	2	0	CXXC5	139040420	0.001000	0.12720	0.005000	0.12908	0.117000	0.20001	1.192000	0.32150	1.187000	0.43000	0.561000	0.74099	GCC	CXXC5	-	NULL	ENSG00000171604		0.652	CXXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC5	HGNC	protein_coding	OTTHUMT00000372744.1		0.00	56	0	C	NM_016463		139060236	+1			no_errors	ENST00000302517	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.017	T
DAGLB	221955	genome.wustl.edu	37	7	6487513	6487513	+	5'UTR	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:6487513G>C	ENST00000297056.6	-	0	130				DAGLB_ENST00000428902.2_5'UTR|DAGLB_ENST00000436575.1_Intron|DAGLB_ENST00000425398.2_5'UTR|DAGLB_ENST00000479922.2_5'UTR|DAGLB_ENST00000421761.2_5'UTR|KDELR2_ENST00000463747.1_Intron	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta						arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		GAGACCCCGCGCGCCGTTCAC	0.667																																																	0													13.0	16.0	15.0					7																	6487513		2190	4283	6473	SO:0001623	5_prime_UTR_variant	0			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.-40C>G	7.37:g.6487513G>C			A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	RNA	SNP	-	NULL	ENST00000297056.6	37	NULL	CCDS5350.1	7																																																																																			DAGLB	-	-	ENSG00000164535		0.667	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLB	HGNC	protein_coding	OTTHUMT00000246840.2	-	0.00	42	0	G	NM_139179		6487513	-1	tier1	-	no_errors	ENST00000479922	ensembl	human	known	74_37	rna	28.89	32	13	SNP	0.856	C
DCAF12	25853	genome.wustl.edu	37	9	34125063	34125063	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:34125063C>A	ENST00000361264.4	-	2	632	c.291G>T	c.(289-291)tgG>tgT	p.W97C	DCAF12_ENST00000463286.1_5'UTR	NM_015397.3	NP_056212.1	Q5T6F0	DCA12_HUMAN	DDB1 and CUL4 associated factor 12	97					protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|cytoplasm (GO:0005737)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	11						TATGATTCAACCACTGAGATG	0.493																																																	0													152.0	140.0	144.0					9																	34125063		2203	4300	6503	SO:0001583	missense	0			AB067479	CCDS6549.1	9p11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000198876	ENSG00000198876		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	19911	protein-coding gene	gene with protein product	"""cancer/testis antigen 102"""		"""KIAA1892"", ""WD repeat domain 40A"""	KIAA1892, WDR40A		11572484, 9110174	Standard	NM_015397		Approved	DKFZP434O125, MGC1058, CT102, TCC52	uc003ztt.2	Q5T6F0	OTTHUMG00000019806	ENST00000361264.4:c.291G>T	9.37:g.34125063C>A	ENSP00000355114:p.Trp97Cys		A8KA70|D3DRL6|Q5T6E9|Q5T6F1|Q6P3V0|Q7L4F8|Q96PZ5|Q9NXA9|Q9UFJ1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W97C	ENST00000361264.4	37	c.291	CCDS6549.1	9	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956099	0.73902	.	.	ENSG00000198876	ENST00000361264;ENST00000396990;ENST00000450964	T;T;T	0.69306	-0.39;-0.39;-0.39	5.39	4.49	0.54785	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.81842	0.4908	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84542	0.0639	10	0.87932	D	0	-17.3398	14.0018	0.64437	0.0:0.9265:0.0:0.0735	.	97	Q5T6F0	DCA12_HUMAN	C	97;79;76	ENSP00000355114:W97C;ENSP00000380187:W79C;ENSP00000415833:W76C	ENSP00000355114:W97C	W	-	3	0	DCAF12	34115063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.690000	0.84178	1.273000	0.44346	0.650000	0.86243	TGG	DCAF12	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000198876		0.493	DCAF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12	HGNC	protein_coding	OTTHUMT00000052133.2		0.00	20	0	C	NM_015397		34125063	-1			no_errors	ENST00000361264	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	A
DCPS	28960	genome.wustl.edu	37	11	126215610	126215610	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:126215610G>A	ENST00000263579.4	+	0	1445				DCPS_ENST00000530860.1_3'UTR	NM_014026.3	NP_054745.1	Q96C86	DCPS_HUMAN	decapping enzyme, scavenger						cellular response to menadione (GO:0036245)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA metabolic process (GO:0016071)|negative regulation of programmed cell death (GO:0043069)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	m7G(5')pppN diphosphatase activity (GO:0050072)|RNA 7-methylguanosine cap binding (GO:0000340)			endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00949)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.08)		TTTTATACCGGCTTATTCCTA	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF077201	CCDS8473.1	11q24	2008-02-05			ENSG00000110063	ENSG00000110063			29812	protein-coding gene	gene with protein product		610534				12198172, 14523240	Standard	NM_014026		Approved	HSPC015, HINT-5, HSL1	uc001qdp.3	Q96C86	OTTHUMG00000165829	ENST00000263579.4:c.*102G>A	11.37:g.126215610G>A			Q8NHL8|Q9Y2S5	RNA	SNP	-	NULL	ENST00000263579.4	37	NULL	CCDS8473.1	11																																																																																			DCPS	-	-	ENSG00000110063		0.478	DCPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCPS	HGNC	protein_coding	OTTHUMT00000386455.1	-	0.00	29	0	G	NM_014026		126215610	+1	tier1	-	no_errors	ENST00000530860	ensembl	human	known	74_37	rna	15.00	17	3	SNP	0.829	A
DDX3X	1654	genome.wustl.edu	37	X	41207101	41207101	+	3'UTR	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:41207101T>G	ENST00000399959.2	+	0	2973				DDX3X_ENST00000441189.2_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000457138.2_3'UTR|DDX3X_ENST00000478993.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked						ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						CCACTGAAATTTTTTTTTTAA	0.398										HNSCC(61;0.18)																																							0																																										SO:0001624	3_prime_UTR_variant	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.*129T>G	X.37:g.41207101T>G			A8K538|B4E3E8|O15536	RNA	SNP	-	NULL	ENST00000399959.2	37	NULL	CCDS43931.1	X																																																																																			DDX3X	-	-	ENSG00000215301		0.398	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	-	0.00	30	0	T	NM_024005		41207101	+1	tier1	-	no_errors	ENST00000478993	ensembl	human	known	74_37	rna	30.77	18	8	SNP	1.000	G
DDX60L	91351	genome.wustl.edu	37	4	169391990	169391991	+	Intron	INS	-	-	A	rs78162593		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:169391990_169391991insA	ENST00000511577.1	-	4	512				DDX60L_ENST00000260184.7_Intron|DDX60L_ENST00000515088.1_Splice_Site|SNORA51_ENST00000384442.1_RNA|DDX60L_ENST00000505890.1_Intron			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like								ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		aaactccatctaaaaaaaaaaa	0.441																																																	0																																										SO:0001627	intron_variant	0			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.264+906->T	4.37:g.169392001_169392001dupA			Q96ND6	Splice_Site	INS	-	NULL	ENST00000511577.1	37	c.NULL		4																																																																																			DDX60L	-	-	ENSG00000181381		0.441	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	HGNC	protein_coding	OTTHUMT00000364839.1		0.00	15	0	-	NM_001012967		169391991	-1	tier1		no_errors	ENST00000513901	ensembl	human	known	74_37	splice_site_ins	30.00	7	3	INS	0.006:0.001	A
DET1	55070	genome.wustl.edu	37	15	89074069	89074069	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:89074069G>T	ENST00000268148.8	-	2	1013	c.868C>A	c.(868-870)Cct>Act	p.P290T	DET1_ENST00000564406.1_Missense_Mutation_p.P301T|DET1_ENST00000444300.1_Missense_Mutation_p.P301T|DET1_ENST00000558413.1_3'UTR|DET1_ENST00000559656.1_5'Flank	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	290						nucleus (GO:0005634)		p.P301S(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TTGATGAAAGGATCCCTAAAG	0.522																																																	1	Substitution - Missense(1)	lung(1)											48.0	48.0	48.0					15																	89074069		1981	4163	6144	SO:0001583	missense	0			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.868C>A	15.37:g.89074069G>T	ENSP00000268148:p.Pro290Thr		B3KNN6|Q2VPC0|Q9NWD5	Missense_Mutation	SNP	pfam_De-etiolated_protein_1_Det1	p.P301T	ENST00000268148.8	37	c.901	CCDS45344.1	15	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540772	0.27563	.	.	ENSG00000140543	ENST00000444300;ENST00000268148	.	.	.	6.17	5.24	0.73138	.	0.101830	0.64402	D	0.000002	T	0.37073	0.0990	N	0.10874	0.06	0.45806	D	0.998682	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.23476	-1.0187	9	0.09084	T	0.74	-25.3906	15.9261	0.79618	0.0:0.0:0.864:0.136	.	290;301	Q7L5Y6;B3KNN6	DET1_HUMAN;.	T	301;290	.	ENSP00000268148:P290T	P	-	1	0	DET1	86875073	1.000000	0.71417	0.969000	0.41365	0.998000	0.95712	6.594000	0.74104	1.584000	0.49913	0.655000	0.94253	CCT	DET1	-	pfam_De-etiolated_protein_1_Det1	ENSG00000140543		0.522	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DET1	HGNC	protein_coding	OTTHUMT00000415442.2		0.00	45	0	G	NM_017996		89074069	-1			no_errors	ENST00000444300	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.996	T
DKK2	27123	genome.wustl.edu	37	4	107845203	107845203	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:107845203G>A	ENST00000285311.3	-	4	1393	c.688C>T	c.(688-690)Cgt>Tgt	p.R230C	DKK2_ENST00000510463.1_Missense_Mutation_p.R184C|DKK2_ENST00000513208.1_Missense_Mutation_p.R130C	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	230	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.R230C(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		CAGTCGCAACGCTGGAAAATT	0.483																																																	1	Substitution - Missense(1)	large_intestine(1)											158.0	145.0	149.0					4																	107845203		2203	4300	6503	SO:0001583	missense	0			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.688C>T	4.37:g.107845203G>A	ENSP00000285311:p.Arg230Cys		A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	pfam_Dickkopf_N,superfamily_Zn2-C6_fun-type_DNA-bd	p.R230C	ENST00000285311.3	37	c.688	CCDS3675.1	4	.	.	.	.	.	.	.	.	.	.	G	19.01	3.742934	0.69418	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.57907	0.37;0.5;0.52	5.64	3.79	0.43588	.	0.000000	0.85682	D	0.000000	T	0.71945	0.3400	M	0.81341	2.54	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.77040	-0.2735	10	0.87932	D	0	-11.8314	13.5124	0.61519	0.0:0.0:0.5801:0.4199	.	230	Q9UBU2	DKK2_HUMAN	C	230;130;184	ENSP00000285311:R230C;ENSP00000421255:R130C;ENSP00000423797:R184C	ENSP00000285311:R230C	R	-	1	0	DKK2	108064652	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	4.419000	0.59835	1.320000	0.45209	0.585000	0.79938	CGT	DKK2	-	NULL	ENSG00000155011		0.483	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DKK2	HGNC	protein_coding	OTTHUMT00000253959.4	-	0.00	30	0	G			107845203	-1	tier1	-	no_errors	ENST00000285311	ensembl	human	novel	74_37	missense	31.25	21	10	SNP	1.000	A
DLEC1	9940	genome.wustl.edu	37	3	38103733	38103733	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:38103733C>T	ENST00000308059.6	+	4	768	c.747C>T	c.(745-747)aaC>aaT	p.N249N	DLEC1_ENST00000452631.2_Silent_p.N249N|DLEC1_ENST00000346219.3_Silent_p.N249N					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AAGAGCTGAACAAGAAGCTTG	0.448																																																	0													99.0	91.0	94.0					3																	38103733		1971	4173	6144	SO:0001819	synonymous_variant	0			AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.747C>T	3.37:g.38103733C>T				Silent	SNP	superfamily_PapD-like	p.N249	ENST00000308059.6	37	c.747	CCDS2672.2	3																																																																																			DLEC1	-	NULL	ENSG00000008226		0.448	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	HGNC	protein_coding	OTTHUMT00000253745.3	-	0.00	46	0	C	NM_007337		38103733	+1	tier1	-	no_errors	ENST00000346219	ensembl	human	known	74_37	silent	11.11	39	5	SNP	0.003	T
DPH6	89978	genome.wustl.edu	37	15	35742931	35742931	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:35742931T>C	ENST00000256538.4	-	5	486	c.460A>G	c.(460-462)Ata>Gta	p.I154V		NM_080650.3	NP_542381.1	Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6	154					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										TTAGATGATATCATCTCTCTG	0.388																																																	0													168.0	146.0	154.0					15																	35742931		2201	4298	6499	SO:0001583	missense	0				CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000256538.4:c.460A>G	15.37:g.35742931T>C	ENSP00000256538:p.Ile154Val		B3KWG1|Q96HJ6	Missense_Mutation	SNP	pfam_DUF71_dom,tigrfam_DUF71_dom	p.I154V	ENST00000256538.4	37	c.460	CCDS10043.1	15	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316873	0.40996	.	.	ENSG00000134146	ENST00000256538	T	0.38722	1.12	5.3	4.15	0.48705	Domain of unknown function DUF71, ATP-binding domain (2);	0.041140	0.85682	D	0.000000	T	0.32224	0.0822	L	0.35414	1.06	0.80722	D	1	B	0.22983	0.078	B	0.25614	0.062	T	0.06162	-1.0842	10	0.27082	T	0.32	-6.5225	12.2961	0.54847	0.0:0.0:0.1418:0.8582	.	154	Q7L8W6	ATBD4_HUMAN	V	154	ENSP00000256538:I154V	ENSP00000256538:I154V	I	-	1	0	ATPBD4	33530223	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	5.367000	0.66127	0.995000	0.38917	0.533000	0.62120	ATA	DPH6	-	pfam_DUF71_dom,tigrfam_DUF71_dom	ENSG00000134146		0.388	DPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH6	HGNC	protein_coding	OTTHUMT00000251973.1	-	0.00	63	0	T	NM_080650		35742931	-1	tier1	-	no_errors	ENST00000256538	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	C
DSC1	1823	genome.wustl.edu	37	18	28737381	28737381	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:28737381G>A	ENST00000257198.5	-	3	565	c.304C>T	c.(304-306)Cgg>Tgg	p.R102W	RP11-408H20.2_ENST00000581836.1_RNA|DSC1_ENST00000257197.3_Missense_Mutation_p.R102W	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	102					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			TGTTGTTCCCGTCTCTGACCA	0.403																																																	0													115.0	91.0	99.0					18																	28737381		2203	4300	6503	SO:0001583	missense	0			AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.304C>T	18.37:g.28737381G>A	ENSP00000257198:p.Arg102Trp		Q9HB01	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin/Desmocollin,prints_Cadherin,prints_Desmosomal_cadherin	p.R102W	ENST00000257198.5	37	c.304	CCDS11894.1	18	.	.	.	.	.	.	.	.	.	.	G	6.079	0.382817	0.11524	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.61392	0.11;0.11	5.45	1.43	0.22495	Cadherin prodomain-like (1);Cadherin-like (1);	1.316840	0.05168	N	0.499063	T	0.35307	0.0927	N	0.24115	0.695	0.09310	N	1	P;P	0.44521	0.669;0.837	B;B	0.24541	0.054;0.054	T	0.36016	-0.9765	10	0.87932	D	0	.	5.8595	0.18738	0.1346:0.0:0.2914:0.574	.	102;102	Q08554;Q9HB00	DSC1_HUMAN;.	W	102	ENSP00000257197:R102W;ENSP00000257198:R102W	ENSP00000257197:R102W	R	-	1	2	DSC1	26991379	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.109000	0.10840	0.299000	0.22661	0.655000	0.94253	CGG	DSC1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000134765		0.403	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC1	HGNC	protein_coding	OTTHUMT00000254946.1	-	0.00	75	0	G	NM_004948, NM_024421		28737381	-1	tier1	-	no_errors	ENST00000257198	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.000	A
DST	667	genome.wustl.edu	37	6	56357224	56357224	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:56357224G>A	ENST00000361203.3	-	80	19605	c.19598C>T	c.(19597-19599)gCc>gTc	p.A6533V	DST_ENST00000244364.6_Missense_Mutation_p.A4230V|DST_ENST00000446842.2_Missense_Mutation_p.A6318V|DST_ENST00000370788.2_Missense_Mutation_p.A4447V|DST_ENST00000312431.6_3'UTR|DST_ENST00000340834.4_5'Flank|DST_ENST00000421834.2_Missense_Mutation_p.A4556V|DST_ENST00000370754.5_Missense_Mutation_p.A6822V|DST_ENST00000370769.4_Missense_Mutation_p.A6644V			Q03001	DYST_HUMAN	dystonin	6533					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TACTTCATTGGCAAAAACCTT	0.313																																																	0													73.0	70.0	71.0					6																	56357224		1802	4064	5866	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19598C>T	6.37:g.56357224G>A	ENSP00000354508:p.Ala6533Val		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A6822V	ENST00000361203.3	37	c.20465		6	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232729	0.58777	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.11	5.11	0.69529	.	0.000000	0.48286	D	0.000195	T	0.19927	0.0479	N	0.02368	-0.58	0.33387	D	0.575589	B;P;P;B;B	0.40032	0.153;0.699;0.518;0.019;0.035	B;P;B;B;B	0.51806	0.095;0.68;0.349;0.015;0.034	T	0.16129	-1.0413	9	0.19147	T	0.46	.	12.2938	0.54833	0.0781:0.0:0.9219:0.0	.	4556;6644;6822;6642;4230	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	4230;6822;6644;4556;6318;4447;6533	ENSP00000244364:A4230V;ENSP00000359790:A6822V;ENSP00000359805:A6644V;ENSP00000400883:A4556V;ENSP00000393645:A6318V;ENSP00000359824:A4447V;ENSP00000354508:A6533V	ENSP00000244364:A4230V	A	-	2	0	DST	56465183	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.888000	0.69758	2.540000	0.85666	0.591000	0.81541	GCC	DST	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.313	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3		0.00	48	0	G	NM_001723		56357224	-1			no_errors	ENST00000370754	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
DUOX1	53905	genome.wustl.edu	37	15	45431424	45431424	+	Intron	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:45431424G>T	ENST00000321429.4	+	12	1623				DUOX1_ENST00000561166.1_Missense_Mutation_p.A46S|DUOX1_ENST00000389037.3_Intron	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1						cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		AAGAGGCTCAGCTGGACTTCC	0.582																																																	0																																										SO:0001627	intron_variant	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.1216+58G>T	15.37:g.45431424G>T			A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF_hand_dom,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Haem_peroxidase_animal,prints_Recoverin	p.A46S	ENST00000321429.4	37	c.136	CCDS32221.1	15																																																																																			DUOX1	-	pfscan_Haem_peroxidase_animal	ENSG00000137857		0.582	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	-	0.00	44	0	G	NM_017434		45431424	+1	tier1	-	no_errors	ENST00000561166	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.000	T
EBF2	64641	genome.wustl.edu	37	8	25890600	25890600	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:25890600C>T	ENST00000520164.1	-	6	1089		c.e6+1		EBF2_ENST00000408929.3_Splice_Site	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2						adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TTTCCCCCTACCTGTCAATTA	0.428																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)												0													122.0	122.0	122.0					8																	25890600		1948	4185	6133	SO:0001630	splice_region_variant	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.551+1G>A	8.37:g.25890600C>T			A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Splice_Site	SNP	-	e6+1	ENST00000520164.1	37	c.551+1	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	C	28.1	4.894963	0.91962	.	.	ENSG00000221818	ENST00000520164;ENST00000408929	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EBF2	25946517	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	.	EBF2	-	-	ENSG00000221818		0.428	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2	-	0.00	59	0	C	NM_022659	Intron	25890600	-1	tier1	-	no_errors	ENST00000520164	ensembl	human	known	74_37	splice_site	9.52	38	4	SNP	1.000	T
EFCAB1	79645	genome.wustl.edu	37	8	49647756	49647756	+	5'UTR	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:49647756G>A	ENST00000262103.3	-	0	35				EFCAB1_ENST00000521002.1_5'UTR|EFCAB1_ENST00000433756.1_5'UTR|EFCAB1_ENST00000523092.1_5'UTR	NM_024593.3	NP_078869.1	Q9HAE3	EFCB1_HUMAN	EF-hand calcium binding domain 1								calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|urinary_tract(2)	14		all_epithelial(80;0.0134)|Lung NSC(129;0.0207)|all_lung(136;0.0464)				CTCTGGGCGCGCGGCTACCGA	0.637																																																	0													44.0	47.0	46.0					8																	49647756		2201	4299	6500	SO:0001623	5_prime_UTR_variant	0				CCDS6145.1, CCDS47853.1	8q11.21	2013-01-10			ENSG00000034239	ENSG00000034239		"""EF-hand domain containing"""	25678	protein-coding gene	gene with protein product						12477932	Standard	NM_024593		Approved	FLJ11767	uc003xqo.2	Q9HAE3	OTTHUMG00000164203	ENST00000262103.3:c.-46C>T	8.37:g.49647756G>A			B4DSB4|E7EVN7	RNA	SNP	-	NULL	ENST00000262103.3	37	NULL	CCDS6145.1	8																																																																																			EFCAB1	-	-	ENSG00000034239		0.637	EFCAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB1	HGNC	protein_coding	OTTHUMT00000377778.1	-	0.00	33	0	G	NM_024593		49647756	-1	tier1	-	no_errors	ENST00000521002	ensembl	human	known	74_37	rna	25.81	23	8	SNP	0.000	A
EIF2B5	8893	genome.wustl.edu	37	3	183855472	183855472	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:183855472C>T	ENST00000273783.3	+	3	507	c.385C>T	c.(385-387)Cga>Tga	p.R129*	RP11-778D9.12_ENST00000608232.1_RNA|RP11-778D9.12_ENST00000608135.1_RNA|EIF2B5_ENST00000498831.1_3'UTR|EIF2B5_ENST00000444495.1_Nonsense_Mutation_p.R129*	NM_003907.2	NP_003898.2	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B, subunit 5 epsilon, 82kDa	129					astrocyte development (GO:0014002)|astrocyte differentiation (GO:0048708)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|positive regulation of translational initiation (GO:0045948)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|nucleus (GO:0005634)	guanyl-nucleotide exchange factor activity (GO:0005085)|translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(9)|ovary(5)|urinary_tract(1)	27	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			AGAGCTCTATCGATCACTGGG	0.473																																																	0													167.0	143.0	151.0					3																	183855472		2203	4300	6503	SO:0001587	stop_gained	0			U23028	CCDS3252.1	3q27.3	2006-07-18	2002-08-29		ENSG00000145191	ENSG00000145191			3261	protein-coding gene	gene with protein product		603945	"""eukaryotic translation initiation factor 2B, subunit 5 (epsilon, 82kD)"""			8688466	Standard	NM_003907		Approved	EIF2Bepsilon, EIF-2B	uc003fmp.3	Q13144	OTTHUMG00000156840	ENST00000273783.3:c.385C>T	3.37:g.183855472C>T	ENSP00000273783:p.Arg129*		Q541Z1|Q96D04	Nonsense_Mutation	SNP	pfam_W2_domain,superfamily_ARM-type_fold,superfamily_Trimer_LpxA-like,smart_W2_domain	p.R129*	ENST00000273783.3	37	c.385	CCDS3252.1	3	.	.	.	.	.	.	.	.	.	.	c	37	6.167074	0.97343	.	.	ENSG00000145191	ENST00000273783;ENST00000444495	.	.	.	5.8	4.92	0.64577	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-10.4254	13.7014	0.62611	0.2975:0.7025:0.0:0.0	.	.	.	.	X	129	.	ENSP00000273783:R129X	R	+	1	2	EIF2B5	185338166	1.000000	0.71417	0.986000	0.45419	0.913000	0.54294	4.874000	0.63064	1.426000	0.47256	0.655000	0.94253	CGA	EIF2B5	-	NULL	ENSG00000145191		0.473	EIF2B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B5	HGNC	protein_coding	OTTHUMT00000346168.1	-	0.00	43	0	C			183855472	+1	tier1	-	no_errors	ENST00000273783	ensembl	human	known	74_37	nonsense	8.96	61	6	SNP	1.000	T
EMR3	84658	genome.wustl.edu	37	19	14774282	14774282	+	Silent	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:14774282A>G	ENST00000253673.5	-	3	247	c.147T>C	c.(145-147)taT>taC	p.Y49Y	EMR3_ENST00000443157.2_Silent_p.Y49Y|EMR3_ENST00000344373.4_Silent_p.Y49Y|EMR3_ENST00000599900.1_5'UTR	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	49	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						ATCCAGAAGTATATCCATGGT	0.393																																																	0													94.0	85.0	88.0					19																	14774282		2203	4300	6503	SO:0001819	synonymous_variant	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.147T>C	19.37:g.14774282A>G				Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.Y49	ENST00000253673.5	37	c.147	CCDS12315.1	19																																																																																			EMR3	-	smart_EG-like_dom	ENSG00000131355		0.393	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1		0.00	68	0	A	NM_032571		14774282	-1			no_errors	ENST00000253673	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.000	G
EMR2	30817	genome.wustl.edu	37	19	14875291	14875291	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:14875291C>A	ENST00000315576.3	-	11	1489	c.1038G>T	c.(1036-1038)aaG>aaT	p.K346N	EMR2_ENST00000392967.2_Missense_Mutation_p.K346N|EMR2_ENST00000594294.1_Missense_Mutation_p.K297N|EMR2_ENST00000346057.1_Missense_Mutation_p.K297N|EMR2_ENST00000594076.1_Missense_Mutation_p.K253N|EMR2_ENST00000601345.1_Missense_Mutation_p.K346N|EMR2_ENST00000595839.1_Missense_Mutation_p.K204N|EMR2_ENST00000392964.3_Missense_Mutation_p.K85N|EMR2_ENST00000353876.1_Missense_Mutation_p.K253N|EMR2_ENST00000353005.1_Missense_Mutation_p.K204N|EMR2_ENST00000596991.2_Missense_Mutation_p.K346N|EMR2_ENST00000392965.3_Missense_Mutation_p.K346N	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	346					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TGGAAAGGTTCTTGCTCAGGC	0.587																																																	0													67.0	62.0	64.0					19																	14875291		2203	4299	6502	SO:0001583	missense	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1038G>T	19.37:g.14875291C>A	ENSP00000319883:p.Lys346Asn		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.K346N	ENST00000315576.3	37	c.1038	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	13.33	2.205995	0.39003	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965;ENST00000392964;ENST00000392962	T;T;T;T;T;T;T;T	0.79554	-0.95;-1.1;-0.49;0.31;1.03;-1.28;1.33;-1.23	3.54	1.08	0.20341	.	.	.	.	.	T	0.78691	0.4323	M	0.62723	1.935	0.09310	N	1	P;B;P;P;B;B;B;P	0.39862	0.454;0.164;0.563;0.692;0.099;0.382;0.126;0.516	B;B;B;P;B;B;B;B	0.47528	0.15;0.149;0.168;0.549;0.124;0.091;0.058;0.328	T	0.64976	-0.6280	9	0.30078	T	0.28	.	3.9767	0.09478	0.2234:0.626:0.0:0.1506	.	346;253;346;204;297;346;346;346	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	N	346;346;297;253;204;346;85;297	ENSP00000319883:K346N;ENSP00000376694:K346N;ENSP00000263380:K297N;ENSP00000319454:K253N;ENSP00000319838:K204N;ENSP00000376692:K346N;ENSP00000376691:K85N;ENSP00000376689:K297N	ENSP00000319883:K346N	K	-	3	2	EMR2	14736291	0.001000	0.12720	0.001000	0.08648	0.043000	0.13939	0.206000	0.17375	0.174000	0.19809	0.508000	0.49915	AAG	EMR2	-	prints_GPCR_2_CD97	ENSG00000127507		0.587	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	-	0.00	61	0	C			14875291	-1	tier1	-	no_errors	ENST00000315576	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.002	A
EN1	2019	genome.wustl.edu	37	2	119600674	119600674	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:119600674A>T	ENST00000295206.6	-	2	1529	c.1019T>A	c.(1018-1020)cTc>cAc	p.L340H	EN1_ENST00000546667.1_5'Flank	NM_001426.3	NP_001417.3	Q05925	HME1_HUMAN	engrailed homeobox 1	340					anatomical structure morphogenesis (GO:0009653)|dorsal/ventral pattern formation (GO:0009953)|embryonic forelimb morphogenesis (GO:0035115)|hindbrain development (GO:0030902)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|multicellular organism growth (GO:0035264)|neuron development (GO:0048666)|pigmentation (GO:0043473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|response to cocaine (GO:0042220)|skeletal system development (GO:0001501)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	9						GTTGAGGCTGAGTTCCTGGGC	0.612																																																	0													69.0	63.0	65.0					2																	119600674		2203	4300	6503	SO:0001583	missense	0			L12699	CCDS2123.1	2q14.2	2011-06-20	2007-02-15		ENSG00000163064	ENSG00000163064		"""Homeoboxes / ANTP class : NKL subclass"""	3342	protein-coding gene	gene with protein product		131290				8094370	Standard	NM_001426		Approved		uc002tlm.3	Q05925	OTTHUMG00000131401	ENST00000295206.6:c.1019T>A	2.37:g.119600674A>T	ENSP00000295206:p.Leu340His		Q4ZG44	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Homeobox-engrailed_C-terminal,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeodomain_engrailed,prints_Homeobox_metazoa,prints_Antifreeze_1,prints_K_chnl_volt-dep_Kv1.4	p.L340H	ENST00000295206.6	37	c.1019	CCDS2123.1	2	.	.	.	.	.	.	.	.	.	.	A	22.7	4.323907	0.81580	.	.	ENSG00000163064	ENST00000295206	D	0.98296	-4.85	4.89	4.89	0.63831	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99432	0.9799	H	0.99169	4.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98029	1.0375	10	0.87932	D	0	-14.1387	14.1743	0.65529	1.0:0.0:0.0:0.0	.	340	Q05925	HME1_HUMAN	H	340	ENSP00000295206:L340H	ENSP00000295206:L340H	L	-	2	0	EN1	119317144	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.330000	0.96422	1.831000	0.53308	0.454000	0.30748	CTC	EN1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	ENSG00000163064		0.612	EN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EN1	HGNC	protein_coding	OTTHUMT00000254191.3	-	0.00	54	0	A			119600674	-1	tier1	-	no_errors	ENST00000295206	ensembl	human	known	74_37	missense	19.30	46	11	SNP	1.000	T
PHF20L1	51105	genome.wustl.edu	37	8	133854715	133854715	+	Intron	DEL	T	T	-			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:133854715delT	ENST00000395386.2	+	19	2686				AF230666.2_ENST00000429151.1_RNA|AF230666.2_ENST00000608375.1_RNA|PHF20L1_ENST00000395390.2_Intron|PHF20L1_ENST00000220847.7_Intron	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1								zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGTTAATAGATTTTTTTTTTT	0.353																																																	0										771,404,58,2217		4,7,7,749,7,1,382,4,42,522	29.0	27.0	28.0			1.7	0.0	8	dbSNP_130	30	1671,958,90,5033		27,10,2,1605,5,4,934,0,84,1205	no	intron	PHF20L1	NM_016018.4		31,17,9,2354,12,5,1316,4,126,1727	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		35.0748,35.7391,35.2794			133854715	2442,1362,148,7250	1781	4050	5831	SO:0001627	intron_variant	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2388-45T>-	8.37:g.133854715delT			A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	RNA	DEL	-	NULL	ENST00000395386.2	37	NULL	CCDS6367.2	8																																																																																			AF230666.2	-	-	ENSG00000223697		0.353	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ENSG00000223697	Clone_based_vega_gene	protein_coding	OTTHUMT00000308949.3		0.00	43	0	T	NM_016018		133854715	-1	tier1		no_errors	ENST00000608375	ensembl	human	known	74_37	rna	11.11	40	5	DEL	0.003	-
RP11-26F2.1	0	genome.wustl.edu	37	15	23130582	23130582	+	RNA	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:23130582T>G	ENST00000560053.1	-	0	191																											TCTTCAAAACTTCTTTTCTTA	0.303																																																	0																																												0																															15.37:g.23130582T>G				RNA	SNP	-	NULL	ENST00000560053.1	37	NULL		15																																																																																			RP11-26F2.1	-	-	ENSG00000259480		0.303	RP11-26F2.1-002	KNOWN	basic	processed_transcript	ENSG00000259480	Clone_based_vega_gene	pseudogene	OTTHUMT00000415904.1	-	0.00	126	0	T			23130582	-1	tier1	-	no_errors	ENST00000560053	ensembl	human	known	74_37	rna	23.58	94	29	SNP	1.000	G
FRG2DP	146481	genome.wustl.edu	37	16	34712321	34712321	+	RNA	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:34712321T>C	ENST00000569028.2	-	0	1033																											GCAATGTGGCTGAAACAAGCC	0.552																																																	0																																												0																															16.37:g.34712321T>C				RNA	SNP	-	NULL	ENST00000569028.2	37	NULL		16																																																																																			RP11-80F22.9	-	-	ENSG00000261711		0.552	RP11-80F22.9-002	KNOWN	basic	processed_transcript	ENSG00000261711	Clone_based_vega_gene	pseudogene	OTTHUMT00000431372.2	-	0.00	54	0	T			34712321	-1	tier1	-	no_errors	ENST00000569028	ensembl	human	known	74_37	rna	9.30	39	4	SNP	0.054	C
EPB41L1	2036	genome.wustl.edu	37	20	34778674	34778674	+	Missense_Mutation	SNP	C	C	T	rs138153077		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:34778674C>T	ENST00000338074.2	+	11	1416	c.1255C>T	c.(1255-1257)Cgt>Tgt	p.R419C	EPB41L1_ENST00000202028.5_Missense_Mutation_p.R357C|EPB41L1_ENST00000441639.1_Missense_Mutation_p.R357C|EPB41L1_ENST00000373946.3_Missense_Mutation_p.R388C|EPB41L1_ENST00000373950.2_Missense_Mutation_p.R322C|EPB41L1_ENST00000373941.1_Missense_Mutation_p.R419C	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	419					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CTTCTTTGAGCGTTCTTCCAG	0.612																																																	0													59.0	52.0	55.0					20																	34778674		2203	4300	6503	SO:0001583	missense	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1255C>T	20.37:g.34778674C>T	ENSP00000337168:p.Arg419Cys		O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Missense_Mutation	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R419C	ENST00000338074.2	37	c.1255	CCDS13271.1	20	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142456	0.77888	.	.	ENSG00000088367	ENST00000202028;ENST00000373950;ENST00000397315;ENST00000373951;ENST00000441639;ENST00000373946;ENST00000338074;ENST00000373941	D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.48	4.54	0.55810	FERM adjacent (FA) (1);	.	.	.	.	D	0.98579	0.9525	H	0.95402	3.665	0.80722	D	1	D;D;D;D;B;D	0.89917	1.0;1.0;1.0;1.0;0.018;1.0	D;D;D;D;B;D	0.97110	1.0;1.0;1.0;0.998;0.011;0.998	D	0.99253	1.0888	9	0.87932	D	0	.	13.1124	0.59281	0.0:0.922:0.0:0.078	.	419;419;388;322;322;357	B7Z653;Q9H4G0;Q9H4G0-4;Q9H4G0-3;B3KUB6;Q9H4G0-2	.;E41L1_HUMAN;.;.;.;.	C	357;322;419;322;357;388;419;419	ENSP00000202028:R357C;ENSP00000363061:R322C;ENSP00000399214:R357C;ENSP00000363057:R388C;ENSP00000337168:R419C;ENSP00000363052:R419C	ENSP00000202028:R357C	R	+	1	0	EPB41L1	34242088	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.826000	0.62715	1.302000	0.44855	0.561000	0.74099	CGT	EPB41L1	-	pfam_FERM-adjacent,pirsf_Band_41_protein	ENSG00000088367		0.612	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3	-	0.00	37	0	C	NM_012156		34778674	+1	tier1	-	no_errors	ENST00000338074	ensembl	human	known	74_37	missense	23.68	29	9	SNP	1.000	T
EPS15L1	58513	genome.wustl.edu	37	19	16506198	16506198	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:16506198G>C	ENST00000248070.6	-	17	2011	c.1872C>G	c.(1870-1872)gaC>gaG	p.D624E	EPS15L1_ENST00000535753.2_Missense_Mutation_p.D624E|EPS15L1_ENST00000455140.2_Missense_Mutation_p.D624E|EPS15L1_ENST00000594975.1_Missense_Mutation_p.D626E	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	624	15 X 3 AA repeats of D-P-F.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						ATTTGAAGGGGTCTTCTGTCT	0.398																																																	0													167.0	169.0	169.0					19																	16506198		2203	4300	6503	SO:0001583	missense	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.1872C>G	19.37:g.16506198G>C	ENSP00000248070:p.Asp624Glu		A2RRF3|A5PL29|B4DKA3	Missense_Mutation	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.D624E	ENST00000248070.6	37	c.1872	CCDS32944.1	19	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571768	0.65765	.	.	ENSG00000127527	ENST00000455140;ENST00000248070;ENST00000535753	T;T;T	0.35236	1.56;1.6;1.32	5.1	4.0	0.46444	.	0.000000	0.85682	D	0.000000	T	0.41305	0.1153	L	0.49778	1.585	0.54753	D	0.999986	D;D;P;D	0.60575	0.987;0.965;0.899;0.988	P;P;B;P	0.62740	0.746;0.632;0.342;0.906	T	0.36962	-0.9726	10	0.07990	T	0.79	.	6.7736	0.23607	0.1919:0.0:0.8081:0.0	.	626;624;624;624	A8K5P4;A2RRF3;Q9UBC2;G3V0H2	.;.;EP15R_HUMAN;.	E	624	ENSP00000393313:D624E;ENSP00000248070:D624E;ENSP00000440103:D624E	ENSP00000248070:D624E	D	-	3	2	EPS15L1	16367198	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.516000	0.45520	2.382000	0.81193	0.555000	0.69702	GAC	EPS15L1	-	NULL	ENSG00000127527		0.398	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	-	0.00	90	0	G	NM_021235		16506198	-1	tier1	-	no_errors	ENST00000455140	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	C
ERC2	26059	genome.wustl.edu	37	3	56044601	56044601	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:56044601C>T	ENST00000288221.6	-	9	2051	c.1796G>A	c.(1795-1797)cGc>cAc	p.R599H		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	599						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTCTTTCAAGCGCTCAATTAT	0.388																																																	0													199.0	181.0	186.0					3																	56044601		1837	4085	5922	SO:0001583	missense	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1796G>A	3.37:g.56044601C>T	ENSP00000288221:p.Arg599His		Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.R599H	ENST00000288221.6	37	c.1796	CCDS46851.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.369866|5.369866	0.95900|0.95900	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000492584|ENST00000288221	.|T	.|0.47869	.|0.83	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.65770|0.65770	0.2723|0.2723	L|L	0.49126|0.49126	1.545|1.545	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.78314	.|0.991	T|T	0.57579|0.57579	-0.7787|-0.7787	5|10	.|0.36615	.|T	.|0.2	-10.9059|-10.9059	20.8598|20.8598	0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|599	.|O15083	.|ERC2_HUMAN	T|H	238|599	.|ENSP00000288221:R599H	.|ENSP00000288221:R599H	A|R	-|-	1|2	0|0	ERC2|ERC2	56019641|56019641	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCT|CGC	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	ENSG00000187672		0.388	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	64	0	C	NM_015576		56044601	-1	tier1	-	no_errors	ENST00000288221	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	T
FAM149B1	317662	genome.wustl.edu	37	10	74934538	74934538	+	Silent	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:74934538A>G	ENST00000242505.6	+	2	315	c.141A>G	c.(139-141)acA>acG	p.T47T		NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	47										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						AGAAAGACACAAGTTCCCAAA	0.418																																																	0													84.0	71.0	75.0					10																	74934538		692	1591	2283	SO:0001819	synonymous_variant	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.141A>G	10.37:g.74934538A>G			Q9Y2I0	Silent	SNP	pfam_DUF3719	p.T47	ENST00000242505.6	37	c.141	CCDS44435.1	10																																																																																			FAM149B1	-	NULL	ENSG00000138286		0.418	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1		0.00	48	0	A	NM_173348		74934538	+1			no_errors	ENST00000242505	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.991	G
FARSA	2193	genome.wustl.edu	37	19	13041425	13041425	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:13041425C>T	ENST00000314606.4	-	2	304		c.e2+1		FARSA_ENST00000588025.1_Splice_Site|CTC-425F1.2_ENST00000592636.1_RNA|FARSA_ENST00000423140.2_Splice_Site	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit						gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	GCAGCTCCTACCATAAGCTCG	0.632																																																	0													63.0	50.0	54.0					19																	13041425		2203	4300	6503	SO:0001630	splice_region_variant	0			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.285+1G>A	19.37:g.13041425C>T			B4E363|Q9NSD8|Q9Y4W8	Splice_Site	SNP	-	e2+1	ENST00000314606.4	37	c.285+1	CCDS12287.1	19	.	.	.	.	.	.	.	.	.	.	C	21.9	4.209760	0.79240	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5415	0.87849	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FARSA	12902425	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	7.275000	0.78548	2.438000	0.82558	0.561000	0.74099	.	FARSA	-	-	ENSG00000179115		0.632	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSA	HGNC	protein_coding	OTTHUMT00000451935.1	-	0.00	50	0	C	NM_004461	Intron	13041425	-1	tier1	-	no_errors	ENST00000314606	ensembl	human	known	74_37	splice_site	26.47	25	9	SNP	1.000	T
FBN1	2200	genome.wustl.edu	37	15	48805826	48805826	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:48805826T>C	ENST00000316623.5	-	13	1963	c.1508A>G	c.(1507-1509)gAg>gGg	p.E503G		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	503	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTTAATACACTCACCACCAGC	0.458																																																	0													102.0	82.0	89.0					15																	48805826		2197	4296	6493	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.1508A>G	15.37:g.48805826T>C	ENSP00000325527:p.Glu503Gly		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.E503G	ENST00000316623.5	37	c.1508	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	T	18.23	3.578554	0.65878	.	.	ENSG00000166147	ENST00000316623	D	0.87179	-2.22	5.67	5.67	0.87782	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.201562	0.51477	D	0.000091	T	0.79034	0.4378	N	0.12920	0.275	0.80722	D	1	B	0.30542	0.284	B	0.34093	0.175	T	0.76610	-0.2896	10	0.30078	T	0.28	.	15.0973	0.72244	0.0:0.0:0.0:1.0	.	503	P35555	FBN1_HUMAN	G	503	ENSP00000325527:E503G	ENSP00000325527:E503G	E	-	2	0	FBN1	46593118	1.000000	0.71417	0.953000	0.39169	0.651000	0.38670	5.740000	0.68629	2.171000	0.68590	0.528000	0.53228	GAG	FBN1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000166147		0.458	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	44	0	T			48805826	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	C
FBXL17	64839	genome.wustl.edu	37	5	107521860	107521860	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:107521860A>C	ENST00000542267.1	-	6	2109	c.1703T>G	c.(1702-1704)cTt>cGt	p.L568R	FBXL17_ENST00000359660.5_Missense_Mutation_p.L170R|FBXL17_ENST00000496714.1_Missense_Mutation_p.L170R	NM_001163315.2	NP_001156787.2	Q9UF56	FXL17_HUMAN	F-box and leucine-rich repeat protein 17	568										endometrium(1)|large_intestine(4)|lung(1)	6		all_cancers(142;0.00273)|all_epithelial(76;0.000362)|Prostate(80;0.0115)|Myeloproliferative disorder(839;0.0393)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;9.63e-11)|Epithelial(69;4.02e-10)		GAGAGAGCTAAGATTTTTGCA	0.348																																																	0													95.0	90.0	92.0					5																	107521860		2202	4300	6502	SO:0001583	missense	0			AL133602	CCDS54886.1	5q21.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000145743	ENSG00000145743		"""F-boxes / Leucine-rich repeats"""	13615	protein-coding gene	gene with protein product		609083	"""F-box only protein 13"""	FBXO13			Standard	NM_001163315		Approved	DKFZP434C1715, Fbx13, Fbl17	uc011cvc.2	Q9UF56	OTTHUMG00000159785	ENST00000542267.1:c.1703T>G	5.37:g.107521860A>C	ENSP00000437464:p.Leu568Arg		A1A4E3	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.L568R	ENST00000542267.1	37	c.1703	CCDS54886.1	5	.	.	.	.	.	.	.	.	.	.	A	20.9	4.068446	0.76301	.	.	ENSG00000145743	ENST00000359660;ENST00000542267;ENST00000496714	T;T;T	0.55234	0.53;0.53;0.53	5.46	4.29	0.51040	.	0.143577	0.47455	D	0.000224	T	0.63768	0.2539	L	0.48642	1.525	0.49483	D	0.999792	D;D	0.76494	0.999;0.999	D;D	0.72075	0.946;0.976	T	0.65393	-0.6179	10	0.87932	D	0	.	11.3604	0.49640	0.9284:0.0:0.0716:0.0	.	568;170	Q9UF56;Q9UF56-2	FXL17_HUMAN;.	R	170;568;170	ENSP00000352683:L170R;ENSP00000437464:L568R;ENSP00000418111:L170R	ENSP00000352683:L170R	L	-	2	0	FBXL17	107549759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.832000	0.92079	0.996000	0.38943	0.482000	0.46254	CTT	FBXL17	-	NULL	ENSG00000145743		0.348	FBXL17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL17	HGNC	protein_coding		-	0.00	100	0	A			107521860	-1	tier1	-	no_errors	ENST00000542267	ensembl	human	known	74_37	missense	18.29	67	15	SNP	1.000	C
FLYWCH1	84256	genome.wustl.edu	37	16	2983971	2983971	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:2983971G>T	ENST00000253928.9	+	6	1909	c.1504G>T	c.(1504-1506)Ggg>Tgg	p.G502W	FLYWCH1_ENST00000399667.2_Missense_Mutation_p.G502W|FLYWCH1_ENST00000416288.2_Missense_Mutation_p.G501W			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	502						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						GGCGCAGCGGGGGAGCCCAGG	0.716																																																	0													4.0	5.0	5.0					16																	2983971		1832	3880	5712	SO:0001583	missense	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.1504G>T	16.37:g.2983971G>T	ENSP00000253928:p.Gly502Trp		D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	pfam_Znf_FLYWCH	p.G502W	ENST00000253928.9	37	c.1504		16	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620425	0.46736	.	.	ENSG00000059122	ENST00000399667;ENST00000253928;ENST00000416288	.	.	.	3.83	3.83	0.44106	.	.	.	.	.	T	0.47673	0.1458	N	0.22421	0.69	0.09310	N	1	D;D;D	0.76494	0.997;0.992;0.999	D;P;D	0.66979	0.947;0.869;0.948	T	0.30909	-0.9962	8	0.62326	D	0.03	.	11.5312	0.50612	0.0:0.0:1.0:0.0	.	502;502;501	Q4VC44-3;Q4VC44;Q4VC44-2	.;FWCH1_HUMAN;.	W	502;502;501	.	ENSP00000253928:G502W	G	+	1	0	FLYWCH1	2923972	0.491000	0.26019	0.005000	0.12908	0.149000	0.21700	4.356000	0.59430	2.427000	0.82271	0.462000	0.41574	GGG	FLYWCH1	-	NULL	ENSG00000059122		0.716	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	-	0.00	17	0	G	NM_032296		2983971	+1	tier1	-	no_errors	ENST00000399667	ensembl	human	known	74_37	missense	20.00	15	4	SNP	0.005	T
FOXS1	2307	genome.wustl.edu	37	20	30432416	30432416	+	Silent	SNP	G	G	A	rs139927827	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:30432416G>A	ENST00000375978.3	-	1	1004	c.930C>T	c.(928-930)tcC>tcT	p.S310S		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	310					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						ATGGGTAGCCGGAGCCTCCCT	0.647													G|||	2	0.000399361	0.0015	0.0	5008	,	,		15086	0.0		0.0	False		,,,				2504	0.0																0								G		2,4404	4.2+/-10.8	0,2,2201	38.0	39.0	39.0		930	-7.6	0.0	20	dbSNP_134	39	0,8600		0,0,4300	no	coding-synonymous	FOXS1	NM_004118.3		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		310/331	30432416	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.930C>T	20.37:g.30432416G>A			Q96D28	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S310	ENST00000375978.3	37	c.930	CCDS13192.1	20																																																																																			FOXS1	-	NULL	ENSG00000179772		0.647	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXS1	HGNC	protein_coding	OTTHUMT00000078560.2	-	0.00	81	0	G	NM_004118		30432416	-1	tier1	rs139927827	no_errors	ENST00000375978	ensembl	human	known	74_37	silent	31.58	65	30	SNP	0.000	A
FZR1	51343	genome.wustl.edu	37	19	3525874	3525874	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:3525874G>T	ENST00000395095.3	+	2	78	c.78G>T	c.(76-78)gaG>gaT	p.E26D	FZR1_ENST00000441788.2_Missense_Mutation_p.E26D|FZR1_ENST00000313639.8_Missense_Mutation_p.E26D	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	26					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGTCACAGAGATGCGGCGGA	0.672																																																	0													35.0	36.0	36.0					19																	3525874		2202	4298	6500	SO:0001583	missense	0			AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.78G>T	19.37:g.3525874G>T	ENSP00000378529:p.Glu26Asp		O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E26D	ENST00000395095.3	37	c.78	CCDS45916.1	19	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524469	0.27299	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.08546	3.08;3.08;3.08	4.42	3.36	0.38483	.	0.344959	0.29558	N	0.011804	T	0.04724	0.0128	N	0.14661	0.345	0.22342	N	0.999188	B;P;B	0.35493	0.0;0.505;0.0	B;B;B	0.36464	0.0;0.225;0.001	T	0.42172	-0.9467	10	0.19147	T	0.46	-51.7891	8.311	0.32071	0.1885:0.0:0.8115:0.0	.	26;26;26	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	D	26	ENSP00000410369:E26D;ENSP00000378529:E26D;ENSP00000321800:E26D	ENSP00000321800:E26D	E	+	3	2	FZR1	3476874	1.000000	0.71417	0.998000	0.56505	0.277000	0.26821	3.533000	0.53561	2.012000	0.59069	0.561000	0.74099	GAG	FZR1	-	NULL	ENSG00000105325		0.672	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FZR1	HGNC	protein_coding	OTTHUMT00000452869.2	-	0.00	49	0	G	NM_016263		3525874	+1	tier1	-	no_errors	ENST00000395095	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
GAB3	139716	genome.wustl.edu	37	X	153906516	153906516	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:153906516T>G	ENST00000369575.3	-	10	1731	c.1700A>C	c.(1699-1701)aAg>aCg	p.K567T	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Missense_Mutation_p.K568T	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	567					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AGCCTGTGTCTTCTGCTCATC	0.438																																																	0													189.0	140.0	157.0					X																	153906516		2203	4300	6503	SO:0001583	missense	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1700A>C	X.37:g.153906516T>G	ENSP00000358588:p.Lys567Thr		A6NHF8|E9PB44	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K568T	ENST00000369575.3	37	c.1703	CCDS14760.1	X	.	.	.	.	.	.	.	.	.	.	T	21.0	4.087625	0.76642	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.39997	1.05;1.86;1.35	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.64148	0.2572	M	0.85945	2.785	0.58432	D	0.999993	D;D;D	0.71674	0.998;0.998;0.998	P;P;P	0.61940	0.896;0.896;0.896	T	0.70673	-0.4807	10	0.87932	D	0	-22.8399	11.9318	0.52851	0.0:0.0:0.0:1.0	.	529;568;567	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	T	567;529;568	ENSP00000358588:K567T;ENSP00000358581:K529T;ENSP00000399588:K568T	ENSP00000358581:K529T	K	-	2	0	GAB3	153559710	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	4.387000	0.59626	1.719000	0.51432	0.417000	0.27973	AAG	GAB3	-	NULL	ENSG00000160219		0.438	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	-	0.00	26	0	T	NM_001081573		153906516	-1	tier1	-	no_errors	ENST00000424127	ensembl	human	known	74_37	missense	52.17	11	12	SNP	1.000	G
GABBR1	2550	genome.wustl.edu	37	6	29574700	29574700	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:29574700C>T	ENST00000377034.4	-	18	2526	c.2191G>A	c.(2191-2193)Gtg>Atg	p.V731M	GABBR1_ENST00000355973.3_Missense_Mutation_p.V614M|GABBR1_ENST00000377012.4_Missense_Mutation_p.V614M|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377016.4_Missense_Mutation_p.V669M	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	731					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	AGAGGGTCCACGATCTGCCAG	0.592																																																	0													85.0	72.0	77.0					6																	29574700		1511	2709	4220	SO:0001583	missense	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2191G>A	6.37:g.29574700C>T	ENSP00000366233:p.Val731Met		B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Peripla_BP_I,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.V731M	ENST00000377034.4	37	c.2191	CCDS4663.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.69|11.69	1.713722|1.713722	0.30413|0.30413	.|.	.|.	ENSG00000204681|ENSG00000204681	ENST00000485026|ENST00000355973;ENST00000377016;ENST00000377012;ENST00000377034	.|D;D;D;D	.|0.89415	.|-2.51;-2.51;-2.51;-2.51	4.35|4.35	3.48|3.48	0.39840|0.39840	.|GPCR, family 3, C-terminal (2);	.|0.143153	.|0.47455	.|N	.|0.000238	T|T	0.78591|0.78591	0.4307|0.4307	L|L	0.58669|0.58669	1.825|1.825	0.80722|0.80722	D|D	1|1	.|P;P;P	.|0.46987	.|0.888;0.886;0.886	.|B;B;B	.|0.38156	.|0.225;0.266;0.266	T|T	0.78959|0.78959	-0.1998|-0.1998	5|10	.|0.54805	.|T	.|0.06	-10.5065|-10.5065	10.2994|10.2994	0.43644|0.43644	0.0:0.9008:0.0:0.0992|0.0:0.9008:0.0:0.0992	.|.	.|669;731;614	.|Q9UBS5-3;Q9UBS5;Q5SUJ9	.|.;GABR1_HUMAN;.	H|M	111|614;669;614;731	.|ENSP00000348248:V614M;ENSP00000366215:V669M;ENSP00000366211:V614M;ENSP00000366233:V731M	.|ENSP00000348248:V614M	R|V	-|-	2|1	0|0	GABBR1|GABBR1	29682679|29682679	0.999000|0.999000	0.42202|0.42202	0.964000|0.964000	0.40570|0.40570	0.422000|0.422000	0.31414|0.31414	4.286000|4.286000	0.58995|0.58995	0.949000|0.949000	0.37715|0.37715	-0.253000|-0.253000	0.11424|0.11424	CGT|GTG	GABBR1	-	pfam_GPCR_3_C,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	ENSG00000204681		0.592	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	-	0.00	53	0	C			29574700	-1	tier1	-	no_errors	ENST00000377034	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.994	T
GALNT7	51809	genome.wustl.edu	37	4	174223211	174223211	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:174223211G>T	ENST00000265000.4	+	7	1245	c.1162G>T	c.(1162-1164)Gct>Tct	p.A388S		NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7	388	Catalytic subdomain B.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		CCCAGCCATGGCTGGGGGATT	0.438																																																	0													214.0	222.0	219.0					4																	174223211		2203	4300	6503	SO:0001583	missense	0			AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1162G>T	4.37:g.174223211G>T	ENSP00000265000:p.Ala388Ser		B3KQU3|Q7Z5W7|Q9UJ28	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A388S	ENST00000265000.4	37	c.1162	CCDS3815.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.350509|5.350509	0.95830|0.95830	.|.	.|.	ENSG00000109586|ENSG00000109586	ENST00000265000;ENST00000458613|ENST00000505308	D|.	0.83250|.	-1.7|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78253|0.78253	0.4254|0.4254	M|M	0.76433|0.76433	2.335|2.335	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.97110|.	1.0;0.961|.	T|T	0.75875|0.75875	-0.3163|-0.3163	10|5	0.87932|.	D|.	0|.	.|.	20.4238|20.4238	0.99064|0.99064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	165;388|.	B4DIB4;Q86SF2|.	.;GALT7_HUMAN|.	S|C	388;165|184	ENSP00000265000:A388S|.	ENSP00000265000:A388S|.	A|W	+|+	1|3	0|0	GALNT7|GALNT7	174459786|174459786	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.869000|9.869000	0.99810|0.99810	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	GCT|TGG	GALNT7	-	NULL	ENSG00000109586		0.438	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT7	HGNC	protein_coding	OTTHUMT00000362456.2	-	0.00	59	0	G	NM_017423		174223211	+1	tier1	-	no_errors	ENST00000265000	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
GLDC	2731	genome.wustl.edu	37	9	6589249	6589249	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:6589249G>A	ENST00000321612.6	-	12	1676	c.1526C>T	c.(1525-1527)cCa>cTa	p.P509L		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	509					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	CACAGACCCTGGAATACCTCT	0.502																																																	0													160.0	126.0	138.0					9																	6589249		2203	4298	6501	SO:0001583	missense	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1526C>T	9.37:g.6589249G>A	ENSP00000370737:p.Pro509Leu		Q2M2F8	Missense_Mutation	SNP	pfam_GDC-P_N,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase,tigrfam_GDC_P_homo	p.P509L	ENST00000321612.6	37	c.1526	CCDS34987.1	9	.	.	.	.	.	.	.	.	.	.	G	6.388	0.439695	0.12104	.	.	ENSG00000178445	ENST00000321612	D	0.99143	-5.48	5.37	-1.6	0.08426	.	0.497841	0.23310	N	0.049568	D	0.92886	0.7737	N	0.02960	-0.455	0.31314	N	0.686841	B	0.02656	0.0	B	0.01281	0.0	D	0.87704	0.2562	10	0.10377	T	0.69	0.5223	11.1796	0.48620	0.8159:0.0:0.1841:0.0	.	509	P23378	GCSP_HUMAN	L	509	ENSP00000370737:P509L	ENSP00000370737:P509L	P	-	2	0	GLDC	6579249	0.990000	0.36364	0.708000	0.30435	0.181000	0.23173	2.165000	0.42396	-0.153000	0.11137	0.557000	0.71058	CCA	GLDC	-	tigrfam_GDC_P_homo	ENSG00000178445		0.502	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	-	0.00	46	0	G	NM_000170		6589249	-1	tier1	-	no_errors	ENST00000321612	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.998	A
ZFP41	286128	genome.wustl.edu	37	8	144357978	144357978	+	Intron	SNP	C	C	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:144357978C>G	ENST00000522452.1	+	4	2390				GLI4_ENST00000340042.1_Intron|GLI4_ENST00000523812.1_3'UTR|GLI4_ENST00000523522.1_Intron			Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GCCCCCCCGTCCAGCTCTGCT	0.662																																																	0																																										SO:0001627	intron_variant	0				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000522452.1:c.595-89C>G	8.37:g.144357978C>G			D3DWJ5	RNA	SNP	-	NULL	ENST00000522452.1	37	NULL	CCDS6397.1	8																																																																																			GLI4	-	-	ENSG00000250571		0.662	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|readthrough_transcript|CCDS	protein_coding	GLI4	HGNC	protein_coding	OTTHUMT00000381125.2	-	0.00	34	0	C	NM_173832		144357978	+1	tier1	-	no_errors	ENST00000523812	ensembl	human	known	74_37	rna	21.43	22	6	SNP	0.000	G
GOLGA3	2802	genome.wustl.edu	37	12	133373178	133373178	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:133373178G>A	ENST00000450791.2	-	9	2230	c.2047C>T	c.(2047-2049)Cgg>Tgg	p.R683W	GOLGA3_ENST00000537452.1_Missense_Mutation_p.R683W|GOLGA3_ENST00000456883.2_Missense_Mutation_p.R683W|GOLGA3_ENST00000545875.1_Missense_Mutation_p.R683W|GOLGA3_ENST00000204726.3_Missense_Mutation_p.R683W			Q08378	GOGA3_HUMAN	golgin A3	683	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CTCTGCAGCCGCTCCCTCTCA	0.612																																																	0													188.0	181.0	183.0					12																	133373178		2203	4300	6503	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2047C>T	12.37:g.133373178G>A	ENSP00000410378:p.Arg683Trp		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.R683W	ENST00000450791.2	37	c.2047	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792580	0.90453	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.34072	1.81;1.81;1.8;1.38;1.38	5.48	3.56	0.40772	.	0.381500	0.33092	N	0.005295	T	0.43344	0.1243	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.998;0.993;0.998	P;P;P	0.59424	0.719;0.613;0.857	T	0.38757	-0.9646	10	0.72032	D	0.01	.	14.1799	0.65566	0.0:0.0:0.7263:0.2737	.	683;683;683	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	W	683	ENSP00000204726:R683W;ENSP00000410378:R683W;ENSP00000409303:R683W;ENSP00000442143:R683W;ENSP00000442603:R683W	ENSP00000204726:R683W	R	-	1	2	GOLGA3	131883251	1.000000	0.71417	0.960000	0.40013	0.883000	0.51084	4.789000	0.62446	0.600000	0.29862	0.655000	0.94253	CGG	GOLGA3	-	NULL	ENSG00000090615		0.612	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	65	0	G	NM_005895		133373178	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.996	A
GPHA2	170589	genome.wustl.edu	37	11	64702840	64702840	+	Silent	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:64702840G>A	ENST00000279168.2	-	2	147	c.93C>T	c.(91-93)tgC>tgT	p.C31C	GPHA2_ENST00000532246.1_Silent_p.C31C|GPHA2_ENST00000533257.1_Silent_p.C31C	NM_130769.3	NP_570125.1	Q96T91	GPHA2_HUMAN	glycoprotein hormone alpha 2	31						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|prostate(1)	3						GGTGCAAGTGGCAGCCTGGGA	0.622																																																	0													46.0	41.0	43.0					11																	64702840		2201	4297	6498	SO:0001819	synonymous_variant	0			AF260739	CCDS8086.1	11q13.1	2008-07-18				ENSG00000149735			18054	protein-coding gene	gene with protein product	"""glycoprotein alpha 2"", ""cysteine knot protein"""	609651				11809971	Standard	NM_130769		Approved	GPA2, ZSIG51, A2, MGC126572	uc001oca.3	Q96T91		ENST00000279168.2:c.93C>T	11.37:g.64702840G>A			Q52LE2	Silent	SNP	pfam_DAN,pfscan_Cys_knot_C,pfscan_Glyco_hormone	p.C31	ENST00000279168.2	37	c.93	CCDS8086.1	11																																																																																			GPHA2	-	pfam_DAN,pfscan_Cys_knot_C,pfscan_Glyco_hormone	ENSG00000149735		0.622	GPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPHA2	HGNC	protein_coding	OTTHUMT00000385470.1	-	0.00	44	0	G	NM_130769		64702840	-1	tier1	-	no_errors	ENST00000279168	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.989	A
GPR153	387509	genome.wustl.edu	37	1	6313985	6313985	+	Silent	SNP	G	G	A	rs537787050		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:6313985G>A	ENST00000377893.2	-	3	838	c.579C>T	c.(577-579)atC>atT	p.I193I		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		GGAAGAGGGCGATGGCTGTGC	0.706													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17371	0.0		0.0	False		,,,				2504	0.0																0													25.0	28.0	27.0					1																	6313985		2199	4296	6495	SO:0001819	synonymous_variant	0			AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.579C>T	1.37:g.6313985G>A			Q5TGR5|Q6AHW8|Q86SP8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR153,prints_GCR_153/162	p.I193	ENST00000377893.2	37	c.579	CCDS64.1	1																																																																																			GPR153	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GCR_153/162	ENSG00000158292		0.706	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR153	HGNC	protein_coding	OTTHUMT00000003717.2	-	0.00	40	0	G			6313985	-1	tier1	-	no_errors	ENST00000377893	ensembl	human	known	74_37	silent	14.00	43	7	SNP	0.983	A
GPR158	57512	genome.wustl.edu	37	10	25861813	25861813	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:25861813G>A	ENST00000376351.3	+	7	2109	c.1750G>A	c.(1750-1752)Gtt>Att	p.V584I		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	584					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CATGACAGCAGTTGGTATGTG	0.413																																																	0													117.0	94.0	102.0					10																	25861813		2203	4300	6503	SO:0001583	missense	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1750G>A	10.37:g.25861813G>A	ENSP00000365529:p.Val584Ile		Q6QR81|Q9ULT3	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.V584I	ENST00000376351.3	37	c.1750	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390666	0.42410	.	.	ENSG00000151025	ENST00000376351	D	0.87256	-2.23	5.67	2.15	0.27550	GPCR, family 3, C-terminal (2);	0.415223	0.22207	N	0.063159	T	0.79822	0.4512	L	0.31207	0.915	0.34734	D	0.730044	B	0.24675	0.109	B	0.34180	0.177	T	0.74771	-0.3552	10	0.22706	T	0.39	.	9.6718	0.40017	0.3942:0.0:0.6058:0.0	.	584	Q5T848	GP158_HUMAN	I	584	ENSP00000365529:V584I	ENSP00000365529:V584I	V	+	1	0	GPR158	25901819	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.735000	0.38176	0.656000	0.30886	0.557000	0.71058	GTT	GPR158	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000151025		0.413	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	36	0	G	XM_166110		25861813	+1	tier1	-	no_errors	ENST00000376351	ensembl	human	known	74_37	missense	20.45	35	9	SNP	0.989	A
GREB1	9687	genome.wustl.edu	37	2	11758761	11758761	+	Missense_Mutation	SNP	C	C	T	rs368329579		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:11758761C>T	ENST00000381486.2	+	22	4060	c.3760C>T	c.(3760-3762)Cgc>Tgc	p.R1254C	GREB1_ENST00000234142.5_Missense_Mutation_p.R1254C|GREB1_ENST00000396123.1_Missense_Mutation_p.R252C	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1254						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CAAGGCCTGCCGCCAGCCACC	0.672																																					Ovarian(39;850 945 2785 23371 33093)												0								C	CYS/ARG	0,4306		0,0,2153	28.0	32.0	31.0		3760	2.6	0.7	2		31	1,8489		0,1,4244	no	missense	GREB1	NM_014668.3	180	0,1,6397	TT,TC,CC		0.0118,0.0,0.0078	probably-damaging	1254/1950	11758761	1,12795	2153	4245	6398	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3760C>T	2.37:g.11758761C>T	ENSP00000370896:p.Arg1254Cys		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R1254C	ENST00000381486.2	37	c.3760	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	C	11.16	1.557381	0.27827	0.0	1.18E-4	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.24350	3.18;3.18;1.86	4.65	2.57	0.30868	.	0.511140	0.21884	N	0.067688	T	0.20251	0.0487	L	0.34521	1.04	0.09310	N	0.999998	P	0.51653	0.947	P	0.44990	0.466	T	0.07233	-1.0783	10	0.56958	D	0.05	-60.0247	7.3683	0.26787	0.3947:0.5083:0.0:0.097	.	1254	Q4ZG55	GREB1_HUMAN	C	1254;1254;252	ENSP00000370896:R1254C;ENSP00000234142:R1254C;ENSP00000379429:R252C	ENSP00000234142:R1254C	R	+	1	0	GREB1	11676212	0.861000	0.29849	0.658000	0.29665	0.046000	0.14306	1.621000	0.36986	0.379000	0.24794	-0.277000	0.10078	CGC	GREB1	-	NULL	ENSG00000196208		0.672	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	-	0.00	86	0	C	NM_014668		11758761	+1	tier1	-	no_errors	ENST00000234142	ensembl	human	known	74_37	missense	13.64	57	9	SNP	0.001	T
GRID1	2894	genome.wustl.edu	37	10	87615841	87615841	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:87615841C>A	ENST00000327946.7	-	7	1143	c.1058G>T	c.(1057-1059)cGg>cTg	p.R353L		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	353					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AGTGGATTTCCGTATGCAGTT	0.547										Multiple Myeloma(13;0.14)																																							0													169.0	136.0	147.0					10																	87615841		2203	4300	6503	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1058G>T	10.37:g.87615841C>A	ENSP00000330148:p.Arg353Leu		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R353L	ENST00000327946.7	37	c.1058	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	C	20.6	4.019060	0.75275	.	.	ENSG00000182771	ENST00000327946	T	0.12774	2.65	5.34	5.34	0.76211	Extracellular ligand-binding receptor (1);	0.092556	0.64402	D	0.000001	T	0.24928	0.0605	L	0.56769	1.78	0.80722	D	1	P	0.47409	0.895	P	0.48400	0.576	T	0.00641	-1.1631	10	0.62326	D	0.03	.	18.0162	0.89241	0.0:1.0:0.0:0.0	.	353	Q9ULK0	GRID1_HUMAN	L	353	ENSP00000330148:R353L	ENSP00000330148:R353L	R	-	2	0	GRID1	87605821	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.956000	0.56722	2.501000	0.84356	0.655000	0.94253	CGG	GRID1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000182771		0.547	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3		0.00	61	0	C	XM_043613		87615841	-1			no_errors	ENST00000327946	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
GRIN2D	2906	genome.wustl.edu	37	19	48917815	48917815	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:48917815C>T	ENST00000263269.3	+	5	1474	c.1386C>T	c.(1384-1386)tgC>tgT	p.C462C		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	462					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCGTCCCCTGCCGGAGCCAGC	0.657																																																	0													34.0	29.0	30.0					19																	48917815		2163	4257	6420	SO:0001819	synonymous_variant	0			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.1386C>T	19.37:g.48917815C>T				Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.C462	ENST00000263269.3	37	c.1386	CCDS12719.1	19																																																																																			GRIN2D	-	smart_Iontro_glu_rcpt	ENSG00000105464		0.657	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	HGNC	protein_coding	OTTHUMT00000466121.1		0.00	84	0	C			48917815	+1			no_errors	ENST00000263269	ensembl	human	known	74_37	silent	9.52	38	4	SNP	1.000	T
GSTT1	2952	genome.wustl.edu	37	22	24382981	24382981	+	Intron	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:24382981C>T	ENST00000248935.5	-	1	165				GSTT1_ENST00000439996.2_Intron	NM_000853.2	NP_000844.2	P30711	GSTT1_HUMAN							glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|ovary(1)|prostate(1)|skin(1)	6					Carboplatin(DB00958)|Cisplatin(DB00515)|Etoposide(DB00773)|Glutathione(DB00143)|Oxaliplatin(DB00526)	ACCTCCCCAGCAGGAACAAGA	0.607									Myelodysplasia and Acute Myeloid Leukemia (AML), Familial																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database	incl.: Familial Myelodysplastic syndrome (late-onset), Familial AML, Familial Monocytic Leukemia, Familial Monosomy 7 and AML																												ENST00000248935.5:c.112+1138G>A	22.37:g.24382981C>T			O00226|Q5TZY2|Q6IC69|Q969K8|Q96IY3	Silent	SNP	superfamily_Thioredoxin-like_fold	p.L71	ENST00000248935.5	37	c.213	CCDS13822.1	22																																																																																			GSTT1	-	NULL	ENSG00000184674		0.607	GSTT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTT1	HGNC	protein_coding	OTTHUMT00000320184.2	-	0.00	52	0	C			24382981	-1	tier1	-	no_errors	ENST00000418883	ensembl	human	known	74_37	silent	7.55	49	4	SNP	0.000	T
GTSF1L	149699	genome.wustl.edu	37	20	42355079	42355079	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:42355079C>A	ENST00000373003.1	-	1	559	c.256G>T	c.(256-258)Gag>Tag	p.E86*	GTSF1L_ENST00000373005.2_Nonsense_Mutation_p.E86*	NM_001008901.1|NM_176791.3	NP_001008901.1|NP_789761.1	Q9H1H1	GTSFL_HUMAN	gametocyte specific factor 1-like	86							metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TCGTTCTGCTCTGAACTAGGA	0.517																																																	0													138.0	116.0	124.0					20																	42355079		2203	4300	6503	SO:0001587	stop_gained	0			AK058060	CCDS13323.1, CCDS33471.1	20q13.12	2007-11-27	2007-11-27	2007-11-27	ENSG00000124196	ENSG00000124196			16198	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 65"", ""family with sequence similarity 112, member A"""	C20orf65, FAM112A			Standard	NM_176791		Approved	dJ1028D15.4	uc002xld.3	Q9H1H1	OTTHUMG00000032510	ENST00000373003.1:c.256G>T	20.37:g.42355079C>A	ENSP00000362094:p.Glu86*		Q5JWH5	Nonsense_Mutation	SNP	pfam_TRM13/UPF0224_CHHC_Znf_dom	p.E86*	ENST00000373003.1	37	c.256	CCDS13323.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.167666	0.94768	.	.	ENSG00000124196	ENST00000373003;ENST00000373005	.	.	.	3.95	-1.56	0.08532	.	2.071930	0.03425	U	0.206910	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-19.5352	4.2114	0.10514	0.0:0.3749:0.3276:0.2975	.	.	.	.	X	86	.	ENSP00000362094:E86X	E	-	1	0	GTSF1L	41788493	0.012000	0.17670	0.001000	0.08648	0.410000	0.31052	-0.080000	0.11339	-0.233000	0.09797	0.430000	0.28490	GAG	GTSF1L	-	NULL	ENSG00000124196		0.517	GTSF1L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GTSF1L	HGNC	protein_coding	OTTHUMT00000079313.1	-	0.00	46	0	C	NM_176791		42355079	-1	tier1	-	no_errors	ENST00000373003	ensembl	human	known	74_37	nonsense	30.00	49	21	SNP	0.001	A
HDAC6	10013	genome.wustl.edu	37	X	48676794	48676794	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:48676794G>A	ENST00000334136.5	+	22	2340	c.2162G>A	c.(2161-2163)cGc>cAc	p.R721H	HDAC6_ENST00000444343.2_Missense_Mutation_p.R735H|HDAC6_ENST00000376619.2_Missense_Mutation_p.R721H			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	721	Histone deacetylase 2.				aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)	p.R721H(1)		breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GCCTGGCATCGCCTGGTGCTT	0.632																																					Pancreas(112;205 1675 2305 8976 15959)												1	Substitution - Missense(1)	endometrium(1)											48.0	37.0	41.0					X																	48676794		2203	4300	6503	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.2162G>A	X.37:g.48676794G>A	ENSP00000334061:p.Arg721His		O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.R735H	ENST00000334136.5	37	c.2204	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	G	9.153	1.016872	0.19355	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619;ENST00000436813	T;T;T	0.70516	-0.49;-0.49;-0.49	5.35	4.29	0.51040	Histone deacetylase domain (2);	0.251907	0.38605	N	0.001629	T	0.48607	0.1509	N	0.13235	0.315	0.80722	D	1	P;P;P	0.45240	0.854;0.784;0.854	B;B;B	0.37508	0.227;0.252;0.227	T	0.48387	-0.9040	10	0.24483	T	0.36	-15.8975	11.0109	0.47663	0.1114:0.0:0.8886:0.0	.	711;369;721	B4DZN1;B3KVK5;Q9UBN7	.;.;HDAC6_HUMAN	H	735;721;721;721	ENSP00000398566:R735H;ENSP00000334061:R721H;ENSP00000365804:R721H	ENSP00000334061:R721H	R	+	2	0	HDAC6	48561738	0.992000	0.36948	0.941000	0.38009	0.985000	0.73830	2.479000	0.45197	2.229000	0.72834	0.600000	0.82982	CGC	HDAC6	-	pfam_His_deacetylse_dom	ENSG00000094631		0.632	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	-	0.00	18	0	G	NM_006044		48676794	+1	tier1	-	no_errors	ENST00000444343	ensembl	human	known	74_37	missense	35.29	11	6	SNP	0.809	A
HDC	3067	genome.wustl.edu	37	15	50544900	50544900	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:50544900G>T	ENST00000267845.3	-	8	1261	c.859C>A	c.(859-861)Cgg>Agg	p.R287R	HDC_ENST00000543581.1_Silent_p.R287R	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		AGAAACCCCCGGAACTCGGGG	0.557																																					GBM(95;1627 1936 6910 9570)												0													53.0	55.0	54.0					15																	50544900		2196	4295	6491	SO:0001819	synonymous_variant	0				CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.859C>A	15.37:g.50544900G>T				Silent	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.R287	ENST00000267845.3	37	c.859	CCDS10134.1	15																																																																																			HDC	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase	ENSG00000140287		0.557	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	HGNC	protein_coding	OTTHUMT00000254540.1		0.00	48	0	G			50544900	-1			no_errors	ENST00000267845	ensembl	human	known	74_37	silent	8.82	31	3	SNP	1.000	T
HECW1	23072	genome.wustl.edu	37	7	43157830	43157831	+	Intron	INS	-	-	A	rs371047353|rs570118410		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:43157830_43157831insA	ENST00000395891.2	+	2	574				HECW1-IT1_ENST00000322220.1_RNA|HECW1_ENST00000453890.1_Intron	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GTGTGTGAAAGAAAAAAAAAAG	0.351																																																	0																																										SO:0001627	intron_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.-32+3840->A	7.37:g.43157840_43157840dupA			A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	RNA	INS	-	NULL	ENST00000395891.2	37	NULL	CCDS5469.2	7																																																																																			HECW1-IT1	-	-	ENSG00000181211		0.351	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1-IT1	HGNC	protein_coding	OTTHUMT00000250893.2		0.00	51	0	-	NM_015052		43157831	+1	tier1		no_errors	ENST00000322220	ensembl	human	known	74_37	rna	17.95	32	7	INS	0.031:0.000	A
HIST2H2AC	8338	genome.wustl.edu	37	1	149858858	149858858	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:149858858A>T	ENST00000331380.2	+	1	334	c.334A>T	c.(334-336)Atc>Ttc	p.I112F	BOLA1_ENST00000369153.2_5'Flank|HIST2H2BE_ENST00000369155.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	112						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TTTGCCTAACATCCAGGCCGT	0.512																																																	0													86.0	86.0	86.0					1																	149858858		2203	4300	6503	SO:0001583	missense	0			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.334A>T	1.37:g.149858858A>T	ENSP00000332194:p.Ile112Phe		Q6DRA7|Q8IUE5	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.I112F	ENST00000331380.2	37	c.334	CCDS937.1	1	.	.	.	.	.	.	.	.	.	.	A	15.30	2.791520	0.50102	.	.	ENSG00000184260	ENST00000331380	T	0.47528	0.84	5.56	5.56	0.83823	Histone-fold (2);Histone H2A (2);	0.000000	0.45126	D	0.000392	T	0.55673	0.1935	H	0.97131	3.945	0.54753	D	0.999981	B	0.28820	0.224	B	0.31245	0.126	T	0.67910	-0.5548	10	0.87932	D	0	.	14.6135	0.68531	1.0:0.0:0.0:0.0	.	112	Q16777	H2A2C_HUMAN	F	112	ENSP00000332194:I112F	ENSP00000332194:I112F	I	+	1	0	HIST2H2AC	148125482	1.000000	0.71417	0.998000	0.56505	0.539000	0.34962	8.976000	0.93442	2.140000	0.66376	0.491000	0.48974	ATC	HIST2H2AC	-	superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184260		0.512	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	HGNC	protein_coding	OTTHUMT00000087128.1	-	0.00	134	0	A	NM_003517		149858858	+1	tier1	-	no_errors	ENST00000331380	ensembl	human	known	74_37	missense	20.34	94	24	SNP	1.000	T
HSP90B1	7184	genome.wustl.edu	37	12	104335268	104335268	+	Silent	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:104335268A>G	ENST00000299767.5	+	9	1355	c.1173A>G	c.(1171-1173)acA>acG	p.T391T		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	391					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	TTGTACCCACATCTGCTCCAC	0.373																																																	0													117.0	119.0	118.0					12																	104335268		2203	4300	6503	SO:0001819	synonymous_variant	0			AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.1173A>G	12.37:g.104335268A>G			Q96A97	Silent	SNP	pirsf_Hsp90_fam,pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,prints_Hsp90_N	p.T391	ENST00000299767.5	37	c.1173	CCDS9094.1	12																																																																																			HSP90B1	-	pirsf_Hsp90_fam,pfam_Hsp90_fam,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000166598		0.373	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSP90B1	HGNC	protein_coding	OTTHUMT00000407349.1	-	0.00	82	0	A	NM_003299		104335268	+1	tier1	-	no_errors	ENST00000299767	ensembl	human	known	74_37	silent	22.06	53	15	SNP	0.063	G
IBSP	3381	genome.wustl.edu	37	4	88732640	88732640	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:88732640G>A	ENST00000226284.5	+	7	599	c.532G>A	c.(532-534)Ggc>Agc	p.G178S		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	178					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AGGCATAAACGGCACCAGTAC	0.478																																																	0													171.0	152.0	158.0					4																	88732640		2203	4300	6503	SO:0001583	missense	0				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.532G>A	4.37:g.88732640G>A	ENSP00000226284:p.Gly178Ser			Missense_Mutation	SNP	pfam_BSP_II	p.G178S	ENST00000226284.5	37	c.532	CCDS3624.1	4	.	.	.	.	.	.	.	.	.	.	G	18.44	3.624210	0.66901	.	.	ENSG00000029559	ENST00000226284	T	0.27104	1.69	4.89	3.1	0.35709	.	0.168026	0.42420	N	0.000701	T	0.20373	0.0490	L	0.52126	1.63	0.36574	D	0.87317	P	0.46859	0.885	B	0.37601	0.254	T	0.15350	-1.0440	10	0.56958	D	0.05	.	8.9094	0.35543	0.1835:0.0:0.8165:0.0	.	178	P21815	SIAL_HUMAN	S	178	ENSP00000226284:G178S	ENSP00000226284:G178S	G	+	1	0	IBSP	88951664	0.986000	0.35501	0.716000	0.30569	0.966000	0.64601	1.968000	0.40500	0.542000	0.28846	0.591000	0.81541	GGC	IBSP	-	pfam_BSP_II	ENSG00000029559		0.478	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBSP	HGNC	protein_coding	OTTHUMT00000253050.2	-	0.00	40	0	G			88732640	+1	tier1	-	no_errors	ENST00000226284	ensembl	human	known	74_37	missense	25.81	23	8	SNP	0.980	A
ID3	3399	genome.wustl.edu	37	1	23885693	23885693	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:23885693G>C	ENST00000374561.5	-	1	592	c.225C>G	c.(223-225)gaC>gaG	p.D75E	ID3_ENST00000486541.1_5'UTR	NM_002167.4	NP_002158.3	Q02535	ID3_HUMAN	inhibitor of DNA binding 3, dominant negative helix-loop-helix protein	75	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				central nervous system development (GO:0007417)|epithelial cell differentiation (GO:0030855)|heart development (GO:0007507)|metanephros development (GO:0001656)|multicellular organismal development (GO:0007275)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|notochord development (GO:0030903)|odontogenesis (GO:0042476)|positive regulation of apoptotic process (GO:0043065)|regulation of cell cycle (GO:0051726)|regulation of DNA replication (GO:0006275)|response to wounding (GO:0009611)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|lung(3)	4		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00314)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;8.83e-25)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;6.5e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		CGAGAATGTAGTCGATGACGC	0.627																																																	0													58.0	65.0	63.0					1																	23885693		2203	4300	6503	SO:0001583	missense	0			X69111	CCDS237.1	1p36.13-p36.12	2013-05-21			ENSG00000117318	ENSG00000117318		"""Basic helix-loop-helix proteins"""	5362	protein-coding gene	gene with protein product		600277				1628620	Standard	NM_002167		Approved	HEIR-1, bHLHb25	uc001bhh.4	Q02535	OTTHUMG00000003229	ENST00000374561.5:c.225C>G	1.37:g.23885693G>C	ENSP00000363689:p.Asp75Glu		A8K1T8|O75641	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.D75E	ENST00000374561.5	37	c.225	CCDS237.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.514307	0.85389	.	.	ENSG00000117318	ENST00000374561	D	0.97352	-4.35	5.6	4.69	0.59074	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.98046	0.9356	M	0.74647	2.275	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98476	1.0603	10	0.62326	D	0.03	-16.451	13.1444	0.59452	0.0778:0.0:0.9222:0.0	.	75	Q02535	ID3_HUMAN	E	75	ENSP00000363689:D75E	ENSP00000363689:D75E	D	-	3	2	ID3	23758280	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.501000	0.53325	1.369000	0.46134	-0.218000	0.12543	GAC	ID3	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	ENSG00000117318		0.627	ID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID3	HGNC	protein_coding	OTTHUMT00000008904.1	-	0.00	55	0	G	NM_002167		23885693	-1	tier1	-	no_errors	ENST00000374561	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
IKZF4	64375	genome.wustl.edu	37	12	56428846	56428846	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:56428846G>A	ENST00000262032.5	+	12	1856	c.1489G>A	c.(1489-1491)Gag>Aag	p.E497K	RP11-603J24.4_ENST00000551846.1_RNA|IKZF4_ENST00000431367.2_Missense_Mutation_p.E395K|IKZF4_ENST00000547791.1_Missense_Mutation_p.E452K|IKZF4_ENST00000547167.1_Missense_Mutation_p.E497K			Q9H2S9	IKZF4_HUMAN	IKAROS family zinc finger 4 (Eos)	497					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|lung(3)|ovary(1)|prostate(1)	8			UCEC - Uterine corpus endometrioid carcinoma (6;0.025)|OV - Ovarian serous cystadenocarcinoma(18;0.123)			CTACGCCAAAGAGGACCCCAA	0.662																																																	0													42.0	45.0	44.0					12																	56428846		1891	4109	6000	SO:0001583	missense	0			AF230809	CCDS44917.1	12q13	2013-01-08	2006-08-25	2006-08-25		ENSG00000123411		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13179	protein-coding gene	gene with protein product		606239	"""zinc finger protein, subfamily 1A, 4 (Eos)"""	ZNFN1A4		10978333	Standard	NM_022465		Approved	Eos	uc001sjc.1	Q9H2S9		ENST00000262032.5:c.1489G>A	12.37:g.56428846G>A	ENSP00000262032:p.Glu497Lys		Q96JP3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E497K	ENST00000262032.5	37	c.1489	CCDS44917.1	12	.	.	.	.	.	.	.	.	.	.	G	17.93	3.509217	0.64522	.	.	ENSG00000123411	ENST00000262032;ENST00000431367;ENST00000547167;ENST00000547791	T;T;T;T	0.08008	3.16;3.15;3.16;3.14	4.08	4.08	0.47627	.	0.000000	0.47852	D	0.000216	T	0.15262	0.0368	L	0.41356	1.27	0.44188	D	0.997007	D;P;P;P	0.56287	0.975;0.815;0.885;0.88	P;B;B;P	0.53861	0.736;0.182;0.389;0.636	T	0.01326	-1.1384	10	0.59425	D	0.04	-19.8609	15.5539	0.76177	0.0:0.0:1.0:0.0	.	395;452;456;497	G5E9S4;F8VPL6;Q9H2S9-2;Q9H2S9	.;.;.;IKZF4_HUMAN	K	497;395;497;452	ENSP00000262032:E497K;ENSP00000412101:E395K;ENSP00000448419:E497K;ENSP00000450020:E452K	ENSP00000262032:E497K	E	+	1	0	IKZF4	54715113	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.374000	0.79633	2.268000	0.75426	0.313000	0.20887	GAG	IKZF4	-	NULL	ENSG00000123411		0.662	IKZF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF4	HGNC	protein_coding	OTTHUMT00000407590.1	-	0.00	43	0	G	NM_022465		56428846	+1	tier1	-	no_errors	ENST00000262032	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	A
IQSEC2	23096	genome.wustl.edu	37	X	53279888	53279888	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:53279888C>A	ENST00000375368.5	-	4	2040	c.1840G>T	c.(1840-1842)Gat>Tat	p.D614Y	IQSEC2_ENST00000375365.2_Missense_Mutation_p.D419Y|IQSEC2_ENST00000396435.3_Missense_Mutation_p.D624Y			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	614	Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTGCAGCCATCAGCCTCATAC	0.662																																																	0													17.0	19.0	18.0					X																	53279888		2197	4290	6487	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1840G>T	X.37:g.53279888C>A	ENSP00000364517:p.Asp614Tyr		B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_P-loop_NTPase,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.D624Y	ENST00000375368.5	37	c.1870		X	.	.	.	.	.	.	.	.	.	.	c	18.27	3.585935	0.66105	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.12984	2.63;2.63;2.66	5.37	5.37	0.77165	.	34.085800	0.01504	U	0.017612	T	0.25717	0.0626	N	0.24115	0.695	0.38296	D	0.942837	D;P	0.59767	0.986;0.936	P;P	0.54100	0.742;0.568	T	0.04976	-1.0914	10	0.62326	D	0.03	.	16.8728	0.86044	0.0:1.0:0.0:0.0	.	624;419	Q5JU85-2;Q5JU85-3	.;.	Y	624;614;419	ENSP00000379712:D624Y;ENSP00000364517:D614Y;ENSP00000364514:D419Y	ENSP00000364514:D419Y	D	-	1	0	IQSEC2	53296613	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.748000	0.85085	2.246000	0.74042	0.597000	0.82753	GAT	IQSEC2	-	NULL	ENSG00000124313		0.662	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		-	0.00	23	0	C	XM_291345		53279888	-1	tier1	-	no_errors	ENST00000396435	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.994	A
KANK4	163782	genome.wustl.edu	37	1	62732473	62732475	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:62732473_62732475delTTC	ENST00000371153.4	-	6	2626_2628	c.2248_2250delGAA	c.(2248-2250)gaadel	p.E750del	KANK4_ENST00000354381.3_In_Frame_Del_p.E122del|KANK4_ENST00000371150.1_In_Frame_Del_p.E106del	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	750						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						CATTAAGAAATTCTTCTGAGGGT	0.365																																																	0																																										SO:0001651	inframe_deletion	0			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.2248_2250delGAA	1.37:g.62732476_62732478delTTC	ENSP00000360195:p.Glu750del		B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	In_Frame_Del	DEL	pfam_KN_motif,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E750in_frame_del	ENST00000371153.4	37	c.2250_2248	CCDS620.1	1																																																																																			KANK4	-	NULL	ENSG00000132854		0.365	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK4	HGNC	protein_coding	OTTHUMT00000024877.1		0.00	30	0	TTC	NM_181712		62732475	-1	tier1		no_errors	ENST00000371153	ensembl	human	known	74_37	in_frame_del	18.75	13	3	DEL	0.965:0.998:1.000	-
KCND2	3751	genome.wustl.edu	37	7	119914757	119914757	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:119914757C>T	ENST00000331113.4	+	1	1036	c.71C>T	c.(70-72)tCg>tTg	p.S24L		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	24					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CCTGTGGCCTCGGGGCCTATG	0.617																																																	0													88.0	105.0	99.0					7																	119914757		2201	4299	6500	SO:0001583	missense	0			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.71C>T	7.37:g.119914757C>T	ENSP00000333496:p.Ser24Leu		O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.S24L	ENST00000331113.4	37	c.71	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584256	0.46110	.	.	ENSG00000184408	ENST00000331113	D	0.96774	-4.12	5.51	5.51	0.81932	Shal-type voltage-gated potassium channels (1);	0.235105	0.37437	N	0.002099	D	0.94364	0.8188	L	0.48642	1.525	0.36870	D	0.888858	B	0.21753	0.06	B	0.21708	0.036	D	0.92612	0.6100	9	.	.	.	.	19.427	0.94746	0.0:1.0:0.0:0.0	.	24	Q9NZV8	KCND2_HUMAN	L	24	ENSP00000333496:S24L	.	S	+	2	0	KCND2	119701993	0.692000	0.27719	1.000000	0.80357	0.997000	0.91878	1.340000	0.33896	2.603000	0.88011	0.655000	0.94253	TCG	KCND2	-	pfam_Shal-type	ENSG00000184408		0.617	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	-	0.00	40	0	C	NM_012281		119914757	+1	tier1	-	no_errors	ENST00000331113	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	T
KCNJ16	3773	genome.wustl.edu	37	17	68128730	68128730	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:68128730G>T	ENST00000589377.1	+	2	665	c.502G>T	c.(502-504)Gcc>Tcc	p.A168S	KCNJ16_ENST00000283936.1_Missense_Mutation_p.A168S|KCNJ16_ENST00000392671.1_Missense_Mutation_p.A168S|KCNJ16_ENST00000585558.1_Missense_Mutation_p.A203S|KCNJ16_ENST00000392670.1_Missense_Mutation_p.A168S|KCNJ16_ENST00000586462.1_Missense_Mutation_p.A207S	NM_001270422.1	NP_001257351.1	Q9NPI9	KCJ16_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 16	168					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	32	Breast(10;2.96e-09)					CATTGGAGCTGCCTTGGCCAA	0.453																																																	0													96.0	85.0	89.0					17																	68128730		2203	4300	6503	SO:0001583	missense	0			AF153815	CCDS11687.1, CCDS74141.1	17q24.3	2011-07-05				ENSG00000153822		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6262	protein-coding gene	gene with protein product		605722				11240146, 16382105	Standard	NM_018658		Approved	Kir5.1, BIR9	uc002jio.4	Q9NPI9		ENST00000589377.1:c.502G>T	17.37:g.68128730G>T	ENSP00000465967:p.Ala168Ser			Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir5,prints_K_chnl_inward-rec_Kir	p.A168S	ENST00000589377.1	37	c.502	CCDS11687.1	17	.	.	.	.	.	.	.	.	.	.	G	15.04	2.716075	0.48622	.	.	ENSG00000153822	ENST00000283936;ENST00000392671;ENST00000392670	D;D;D	0.94000	-3.33;-3.33;-3.33	5.54	5.54	0.83059	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.153953	0.56097	D	0.000025	D	0.95082	0.8407	L	0.44542	1.39	0.43246	D	0.995167	D;D	0.71674	0.998;0.997	D;P	0.69307	0.963;0.908	D	0.93882	0.7172	9	.	.	.	.	19.4518	0.94871	0.0:0.0:1.0:0.0	.	168;168	A8K434;Q9NPI9	.;IRK16_HUMAN	S	168	ENSP00000283936:A168S;ENSP00000376439:A168S;ENSP00000376438:A168S	.	A	+	1	0	KCNJ16	65640325	1.000000	0.71417	0.653000	0.29593	0.104000	0.19210	6.640000	0.74319	2.764000	0.94973	0.650000	0.86243	GCC	KCNJ16	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000153822		0.453	KCNJ16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ16	HGNC	protein_coding	OTTHUMT00000450880.1	-	0.00	62	0	G	NM_018658		68128730	+1	tier1	-	no_errors	ENST00000283936	ensembl	human	known	74_37	missense	15.69	43	8	SNP	0.999	T
KCNQ5	56479	genome.wustl.edu	37	6	73332285	73332285	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:73332285G>A	ENST00000370398.1	+	1	477	c.368G>A	c.(367-369)cGc>cAc	p.R123H	KCNQ5_ENST00000355635.3_Missense_Mutation_p.R123H|KCNQ5_ENST00000414165.2_Missense_Mutation_p.R123H|KCNQ5_ENST00000370392.1_Missense_Mutation_p.R123H|KCNQ5_ENST00000342056.2_Missense_Mutation_p.R123H|KCNQ5_ENST00000403813.2_Missense_Mutation_p.R123H|KCNQ5_ENST00000355194.4_Missense_Mutation_p.R123H|KCNQ5_ENST00000402622.2_Missense_Mutation_p.R123H	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	123					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GAGAGACCCCGCGGCTGGGCG	0.662																																					GBM(142;1375 1859 14391 23261 44706)												0													29.0	32.0	31.0					6																	73332285		2203	4300	6503	SO:0001583	missense	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.368G>A	6.37:g.73332285G>A	ENSP00000359425:p.Arg123His		A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.R123H	ENST00000370398.1	37	c.368	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	G	16.46	3.128501	0.56721	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000370392;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D;D	0.99413	-5.73;-5.71;-5.69;-5.63;-5.73;-5.7;-5.73;-5.86	4.58	4.58	0.56647	.	0.096191	0.37530	N	0.002048	D	0.98626	0.9540	L	0.54965	1.715	0.52501	D	0.999956	B;P;P;P;P;P	0.46327	0.1;0.851;0.751;0.839;0.876;0.571	B;P;B;B;B;B	0.47573	0.01;0.55;0.259;0.445;0.425;0.399	D	0.99885	1.1121	10	0.72032	D	0.01	-6.4643	17.3876	0.87421	0.0:0.0:1.0:0.0	.	123;123;123;123;123;123	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82;Q9NR82-4	.;.;.;.;KCNQ5_HUMAN;.	H	123	ENSP00000345055:R123H;ENSP00000347326:R123H;ENSP00000359425:R123H;ENSP00000359419:R123H;ENSP00000385501:R123H;ENSP00000347853:R123H;ENSP00000384453:R123H;ENSP00000409861:R123H	ENSP00000345055:R123H	R	+	2	0	KCNQ5	73389006	1.000000	0.71417	1.000000	0.80357	0.333000	0.28666	9.192000	0.94947	2.109000	0.64355	0.561000	0.74099	CGC	KCNQ5	-	NULL	ENSG00000185760		0.662	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	-	0.00	70	0	G	NM_019842		73332285	+1	tier1	-	no_errors	ENST00000402622	ensembl	human	known	74_37	missense	17.65	56	12	SNP	1.000	A
KIAA0922	23240	genome.wustl.edu	37	4	154541996	154541996	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:154541996G>T	ENST00000409663.3	+	27	3705	c.3653G>T	c.(3652-3654)aGa>aTa	p.R1218I	KIAA0922_ENST00000409959.3_Missense_Mutation_p.R1219I|KIAA0922_ENST00000440693.1_Missense_Mutation_p.R1135I	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1218						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				CGAACATGTAGAAAGAACAAG	0.323																																																	0													91.0	108.0	103.0					4																	154541996		2203	4300	6503	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3653G>T	4.37:g.154541996G>T	ENSP00000386574:p.Arg1218Ile		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.R1219I	ENST00000409663.3	37	c.3656	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165024	0.57476	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.33438	1.75;1.41;1.75;1.43	5.63	5.63	0.86233	.	0.421727	0.27486	N	0.019160	T	0.55242	0.1908	L	0.58101	1.795	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.998;0.999;0.998	T	0.54337	-0.8309	10	0.66056	D	0.02	-21.9598	19.6809	0.95962	0.0:0.0:1.0:0.0	.	1135;1219;1218	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	I	1218;1135;1219;996	ENSP00000386574:R1218I;ENSP00000409663:R1135I;ENSP00000386787:R1219I;ENSP00000240487:R996I	ENSP00000240487:R996I	R	+	2	0	KIAA0922	154761446	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	4.553000	0.60753	2.644000	0.89710	0.655000	0.94253	AGA	KIAA0922	-	NULL	ENSG00000121210		0.323	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	-	0.00	72	0	G	NM_015196		154541996	+1	tier1	-	no_errors	ENST00000409959	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
KIAA1033	23325	genome.wustl.edu	37	12	105558045	105558045	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:105558045C>T	ENST00000332180.5	+	31	3401	c.3314C>T	c.(3313-3315)aCc>aTc	p.T1105I	KIAA1033_ENST00000547171.1_3'UTR	NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						CTCTTACAAACCATGAATCTC	0.418																																																	0													88.0	86.0	86.0					12																	105558045		1890	4117	6007	SO:0001583	missense	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.3314C>T	12.37:g.105558045C>T	ENSP00000328062:p.Thr1105Ile			Missense_Mutation	SNP	NULL	p.T1105I	ENST00000332180.5	37	c.3314	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	C	29.0	4.968368	0.92855	.	.	ENSG00000136051	ENST00000332180	T	0.78816	-1.21	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.89178	0.6641	M	0.84326	2.69	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.65987	0.94;0.94	D	0.89606	0.3838	10	0.87932	D	0	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	1106;1105	B7ZKT9;Q2M389	.;WASH7_HUMAN	I	1105	ENSP00000328062:T1105I	ENSP00000328062:T1105I	T	+	2	0	KIAA1033	104082175	1.000000	0.71417	0.999000	0.59377	0.872000	0.50106	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	ACC	KIAA1033	-	NULL	ENSG00000136051		0.418	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	-	0.00	33	0	C	NM_015275		105558045	+1	tier1	-	no_errors	ENST00000332180	ensembl	human	known	74_37	missense	25.00	26	9	SNP	1.000	T
KIAA1324L	222223	genome.wustl.edu	37	7	86541502	86541502	+	Missense_Mutation	SNP	C	C	A	rs376940774		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:86541502C>A	ENST00000450689.2	-	15	2240	c.2055G>T	c.(2053-2055)ttG>ttT	p.L685F	KIAA1324L_ENST00000444627.1_Intron|KIAA1324L_ENST00000416314.1_Missense_Mutation_p.L518F|KIAA1324L_ENST00000297222.6_Missense_Mutation_p.L445F|KIAA1324L_ENST00000490995.1_5'Flank	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	685						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					AGTCATAGTGCAAACTCTGAT	0.368																																																	0													129.0	129.0	129.0					7																	86541502		2203	4300	6503	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.2055G>T	7.37:g.86541502C>A	ENSP00000413445:p.Leu685Phe		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt_N_dom	p.L685F	ENST00000450689.2	37	c.2055	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.71|15.71	2.912789|2.912789	0.52439|0.52439	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000297222;ENST00000416314	.|T;T;T	.|0.04049	.|3.72;3.72;3.72	6.02|6.02	4.18|4.18	0.49190|0.49190	.|Mannose-6-phosphate receptor, binding (1);	.|0.065857	.|0.64402	.|N	.|0.000007	T|T	0.12220|0.12220	0.0297|0.0297	L|L	0.53729|0.53729	1.69|1.69	0.80722|0.80722	D|D	1|1	.|B;D;D	.|0.63046	.|0.185;0.992;0.992	.|B;P;P	.|0.62813	.|0.14;0.907;0.907	T|T	0.17167|0.17167	-1.0378|-1.0378	5|10	.|0.20046	.|T	.|0.44	.|.	9.9033|9.9033	0.41362|0.41362	0.1493:0.7797:0.0:0.071|0.1493:0.7797:0.0:0.071	.|.	.|685;445;518	.|A8MWY0;A8MWY0-2;B4DJV3	.|K132L_HUMAN;.;.	S|F	646|685;445;518	.|ENSP00000413445:L685F;ENSP00000297222:L445F;ENSP00000402390:L518F	.|ENSP00000297222:L445F	A|L	-|-	1|3	0|2	KIAA1324L|KIAA1324L	86379438|86379438	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.480000|1.480000	0.35464|0.35464	0.826000|0.826000	0.34661|0.34661	0.650000|0.650000	0.86243|0.86243	GCA|TTG	KIAA1324L	-	superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000164659		0.368	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	-	0.00	26	0	C	NM_152748		86541502	-1	tier1	-	no_errors	ENST00000450689	ensembl	human	known	74_37	missense	20.93	34	9	SNP	1.000	A
KIAA1614	57710	genome.wustl.edu	37	1	180914462	180914462	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:180914462G>A	ENST00000367588.4	+	9	3366	c.3311G>A	c.(3310-3312)cGt>cAt	p.R1104H	KIAA1614_ENST00000461346.1_3'UTR|RP11-46A10.5_ENST00000358073.2_RNA|KIAA1614_ENST00000367587.1_Missense_Mutation_p.R725H	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	1104										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TCACCACGGCGTGCCCTCAGT	0.647																																																	0													52.0	58.0	56.0					1																	180914462		2077	4189	6266	SO:0001583	missense	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.3311G>A	1.37:g.180914462G>A	ENSP00000356560:p.Arg1104His		Q5VZ45|Q9HCF8	Missense_Mutation	SNP	NULL	p.R1104H	ENST00000367588.4	37	c.3311	CCDS41442.1	1	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408240	0.62399	.	.	ENSG00000135835	ENST00000367588;ENST00000367587	T;T	0.29655	2.14;1.56	4.91	3.0	0.34707	.	0.410312	0.25683	N	0.028997	T	0.23649	0.0572	L	0.48642	1.525	0.37966	D	0.933112	B;P	0.50272	0.417;0.933	B;B	0.40009	0.105;0.316	T	0.35276	-0.9795	9	0.39692	T	0.17	-7.4577	8.3925	0.32537	0.1406:0.1309:0.7285:0.0	.	725;1104	Q5VZ46-2;Q5VZ46	.;K1614_HUMAN	H	1104;725	ENSP00000356560:R1104H;ENSP00000356559:R725H	ENSP00000356559:R725H	R	+	2	0	KIAA1614	179181085	1.000000	0.71417	0.591000	0.28745	0.723000	0.41478	3.315000	0.51951	1.060000	0.40578	0.655000	0.94253	CGT	KIAA1614	-	NULL	ENSG00000135835		0.647	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	-	0.00	52	0	G	XM_046531		180914462	+1	tier1	-	no_errors	ENST00000367588	ensembl	human	known	74_37	missense	23.91	35	11	SNP	0.917	A
KIAA1683	80726	genome.wustl.edu	37	19	18368166	18368166	+	Missense_Mutation	SNP	C	C	T	rs138028745		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:18368166C>T	ENST00000600328.3	-	4	3560	c.3367G>A	c.(3367-3369)Gcc>Acc	p.A1123T	PDE4C_ENST00000596647.1_5'Flank|KIAA1683_ENST00000392413.4_Missense_Mutation_p.A1310T|KIAA1683_ENST00000600359.3_Missense_Mutation_p.A1077T|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	1123	IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						CCCCTCCAGGCGGACTGGATG	0.652																																																	0								T	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	52.0	49.0	50.0		3928,3229,3367	0.8	0.1	19	dbSNP_134	50	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	KIAA1683	NM_001145304.1,NM_001145305.1,NM_025249.3	58,58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign	1310/1368,1077/1135,1123/1181	18368166	1,13005	2203	4300	6503	SO:0001583	missense	0			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3367G>A	19.37:g.18368166C>T	ENSP00000470780:p.Ala1123Thr		B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.A1310T	ENST00000600328.3	37	c.3928	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	c	2.706	-0.269853	0.05716	0.0	1.16E-4	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000358422;ENST00000411671	T;T;T	0.28666	1.6;1.6;1.6	4.63	0.771	0.18504	.	0.899723	0.09162	N	0.840021	T	0.28665	0.0710	M	0.61703	1.905	0.09310	N	1	B;P	0.43519	0.011;0.809	B;B	0.39419	0.01;0.299	T	0.16217	-1.0410	10	0.34782	T	0.22	-4.413	7.2035	0.25895	0.0:0.6519:0.1443:0.2038	.	1310;1123	E9PDE0;Q9H0B3	.;K1683_HUMAN	T	1310;1123;1077;387;508;737	ENSP00000376213:A1310T;ENSP00000352774:A1123T;ENSP00000404501:A1077T	ENSP00000351198:A508T	A	-	1	0	KIAA1683	18229166	0.003000	0.15002	0.086000	0.20670	0.001000	0.01503	-0.332000	0.07904	0.083000	0.17047	-1.295000	0.01343	GCC	KIAA1683	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000130518		0.652	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3	-	0.00	41	0	C			18368166	-1	tier1	rs138028745	no_errors	ENST00000392413	ensembl	human	known	74_37	missense	30.00	21	9	SNP	0.006	T
KIF3A	11127	genome.wustl.edu	37	5	132039180	132039180	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:132039180G>A	ENST00000378746.4	-	10	1578	c.1360C>T	c.(1360-1362)Cgg>Tgg	p.R454W	KIF3A_ENST00000378735.1_Missense_Mutation_p.R457W|KIF3A_ENST00000487055.1_5'UTR|AC004237.1_ENST00000431165.1_RNA|KIF3A_ENST00000403231.1_Missense_Mutation_p.R481W	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	454					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTTTTTCCCGTTTCTCTAAT	0.323																																																	0													123.0	119.0	120.0					5																	132039180		2201	4299	6500	SO:0001583	missense	0			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1360C>T	5.37:g.132039180G>A	ENSP00000368020:p.Arg454Trp		A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.R457W	ENST00000378746.4	37	c.1369	CCDS34235.1	5	.	.	.	.	.	.	.	.	.	.	G	19.39	3.817788	0.71028	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000403231	T;T;T	0.73469	-0.73;3.63;-0.75	5.64	4.72	0.59763	.	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.78049	2.395	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;0.997;1.0	D;D;P;D	0.71414	0.973;0.973;0.803;0.973	D	0.86195	0.1615	10	0.87932	D	0	.	13.576	0.61875	0.0:0.0:0.7318:0.2681	.	481;481;454;480	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	W	454;457;481;481	ENSP00000368020:R454W;ENSP00000368009:R457W;ENSP00000385808:R481W	ENSP00000368009:R457W	R	-	1	2	KIF3A	132067079	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.845000	0.55880	2.816000	0.96949	0.561000	0.74099	CGG	KIF3A	-	NULL	ENSG00000131437		0.323	KIF3A-001	KNOWN	basic|CCDS	protein_coding	KIF3A	HGNC	protein_coding	OTTHUMT00000132788.3	-	0.00	30	0	G	NM_007054		132039180	-1	tier1	-	no_errors	ENST00000378735	ensembl	human	known	74_37	missense	27.78	13	5	SNP	1.000	A
KIF20A	10112	genome.wustl.edu	37	5	137522914	137522914	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:137522914C>T	ENST00000394894.3	+	19	2711	c.2485C>T	c.(2485-2487)Cgc>Tgc	p.R829C	KIF20A_ENST00000508792.1_Missense_Mutation_p.R811C	NM_005733.2	NP_005724.1	O95235	KI20A_HUMAN	kinesin family member 20A	829	Globular. {ECO:0000255}.				ATP catabolic process (GO:0006200)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule bundle formation (GO:0001578)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|liver(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(1)	27			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TGCCAAAAAGCGCCTTGGTAC	0.478																																																	0													96.0	92.0	93.0					5																	137522914		2203	4300	6503	SO:0001583	missense	0			AF070672	CCDS4199.1	5q31	2008-02-05	2003-01-13	2003-01-17	ENSG00000112984	ENSG00000112984		"""Kinesins"""	9787	protein-coding gene	gene with protein product		605664	"""RAB6 interacting, kinesin-like (rabkinesin6)"""	RAB6KIFL		11416179, 10806357	Standard	NM_005733		Approved		uc003lcj.3	O95235	OTTHUMG00000129195	ENST00000394894.3:c.2485C>T	5.37:g.137522914C>T	ENSP00000378356:p.Arg829Cys		B4DL79|D3DQB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R829C	ENST00000394894.3	37	c.2485	CCDS4199.1	5	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339718	0.81911	.	.	ENSG00000112984	ENST00000394894;ENST00000508792	T;T	0.72394	-0.58;-0.65	5.53	5.53	0.82687	.	0.000000	0.43416	D	0.000580	T	0.81446	0.4824	L	0.54323	1.7	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.64506	0.926;0.65	T	0.82329	-0.0511	10	0.87932	D	0	-11.133	19.8407	0.96681	0.0:1.0:0.0:0.0	.	811;829	B4DL79;O95235	.;KI20A_HUMAN	C	829;811	ENSP00000378356:R829C;ENSP00000420880:R811C	ENSP00000378356:R829C	R	+	1	0	KIF20A	137550813	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	3.660000	0.54496	2.763000	0.94921	0.563000	0.77884	CGC	KIF20A	-	NULL	ENSG00000112984		0.478	KIF20A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF20A	HGNC	protein_coding	OTTHUMT00000251272.1	-	0.00	23	0	C	NM_005733		137522914	+1	tier1	-	no_errors	ENST00000394894	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	T
KLHL32	114792	genome.wustl.edu	37	6	97423985	97423985	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:97423985C>T	ENST00000369261.4	+	3	499	c.136C>T	c.(136-138)Ctg>Ttg	p.L46L	KLHL32_ENST00000536676.1_Silent_p.L46L|KLHL32_ENST00000544166.1_5'UTR|KLHL32_ENST00000539200.1_Silent_p.L46L	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	46	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		CGACATCACCCTGATTGCTGA	0.507																																																	0													101.0	79.0	86.0					6																	97423985		2203	4300	6503	SO:0001819	synonymous_variant	0			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.136C>T	6.37:g.97423985C>T			B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L46	ENST00000369261.4	37	c.136	CCDS5038.1	6																																																																																			KLHL32	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000186231		0.507	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1		0.00	49	0	C	NM_052904		97423985	+1			no_errors	ENST00000369261	ensembl	human	known	74_37	silent	5.88	32	2	SNP	1.000	T
LINC00174	285908	genome.wustl.edu	37	7	65842331	65842331	+	lincRNA	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:65842331C>A	ENST00000421767.1	-	0	3401					NR_026873.1				long intergenic non-protein coding RNA 174																		GAGGCAGGAGCTGGGCCCGTG	0.716																																																	0													9.0	12.0	11.0					7																	65842331		2177	4264	6441			0			AK091213		7q11.21	2013-12-05	2013-12-05	2013-12-05	ENSG00000179406	ENSG00000179406		"""Long non-coding RNAs"""	27788	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 174"""	NCRNA00174			Standard	NR_026873		Approved		uc003tux.4		OTTHUMG00000156590		7.37:g.65842331C>A				RNA	SNP	-	NULL	ENST00000421767.1	37	NULL		7																																																																																			LINC00174	-	-	ENSG00000179406		0.716	LINC00174-001	KNOWN	basic	lincRNA	LINC00174	HGNC	lincRNA	OTTHUMT00000344721.1	-	0.00	23	0	C	NR_026873		65842331	-1	tier1	-	no_errors	ENST00000421767	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.002	A
LINC00305	221241	genome.wustl.edu	37	18	61747618	61747618	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:61747618G>T	ENST00000323355.3	-	0	497					NR_027245.1		Q7Z4B0	CR020_HUMAN	long intergenic non-protein coding RNA 305							extracellular region (GO:0005576)											gtaaccttttgaaaggttctt	0.388																																																	0													250.0	207.0	220.0					18																	61747618		692	1591	2283			0			BC029565		18q22.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000179676	ENSG00000179676		"""Long non-coding RNAs"""	28597	non-coding RNA	RNA, long non-coding			"""chromosome 18 open reading frame 20"", ""non-protein coding RNA 305"""	C18orf20, NCRNA00305		12477932	Standard	NR_027245		Approved	MGC39571, HsT1235	uc010dqk.2	Q7Z4B0	OTTHUMG00000060637		18.37:g.61747618G>T			Q8NHR5	RNA	SNP	-	NULL	ENST00000323355.3	37	NULL		18																																																																																			LINC00305	-	-	ENSG00000179676		0.388	LINC00305-001	KNOWN	basic	lincRNA	LINC00305	HGNC	lincRNA	OTTHUMT00000134071.2	-	0.00	48	0	G	NM_152728		61747618	-1	tier1	-	no_errors	ENST00000323355	ensembl	human	known	74_37	rna	5.56	68	4	SNP	0.000	T
LINC00477	144360	genome.wustl.edu	37	12	24736553	24736553	+	lincRNA	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:24736553T>C	ENST00000483544.1	-	0	549					NR_029451.2		Q96M19	CL067_HUMAN	long intergenic non-protein coding RNA 477							integral component of membrane (GO:0016021)											CTTAAAAAACTTAAGAAGGAA	0.547																																																	0													40.0	48.0	45.0					12																	24736553		2203	4300	6503			0			AK057456		12p12.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000197503	ENSG00000197503		"""Long non-coding RNAs"""	26557	non-coding RNA	RNA, long non-coding	"""family with sequence similarity 191, member B"""		"""chromosome 12 open reading frame 67"""	C12orf67		14702039	Standard	NR_029451		Approved	FLJ32894, FAM191B	uc001rgb.1	Q96M19	OTTHUMG00000159485		12.37:g.24736553T>C				RNA	SNP	-	NULL	ENST00000483544.1	37	NULL		12																																																																																			LINC00477	-	-	ENSG00000197503		0.547	LINC00477-001	KNOWN	basic	lincRNA	LINC00477	HGNC	lincRNA	OTTHUMT00000355725.1	-	0.00	44	0	T	NM_144667		24736553	-1	tier1	-	no_errors	ENST00000483544	ensembl	human	known	74_37	rna	16.36	46	9	SNP	0.389	C
RP11-782C8.1	0	genome.wustl.edu	37	1	143230236	143230236	+	lincRNA	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:143230236C>A	ENST00000438000.1	+	0	147				RP11-782C8.5_ENST00000427309.1_lincRNA																							CTTTCCATTACCACCATAAAA	0.328																																																	0																																												0																															1.37:g.143230236C>A				RNA	SNP	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			RP11-782C8.5	-	-	ENSG00000225278		0.328	RP11-782C8.1-002	KNOWN	basic	lincRNA	LOC101930284	Clone_based_vega_gene	lincRNA	OTTHUMT00000037560.1	-	0.00	29	0	C			143230236	-1	tier1	-	no_errors	ENST00000427309	ensembl	human	known	74_37	rna	12.50	28	4	SNP	0.204	A
LOXHD1	125336	genome.wustl.edu	37	18	44109156	44109156	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:44109156T>C	ENST00000398722.4	-	22	3679	c.3680A>G	c.(3679-3681)aAg>aGg	p.K1227R	LOXHD1_ENST00000536736.1_Missense_Mutation_p.K1505R|LOXHD1_ENST00000441893.2_Missense_Mutation_p.K438R|LOXHD1_ENST00000441551.2_Missense_Mutation_p.K1299R|LOXHD1_ENST00000300591.6_Missense_Mutation_p.K394R|LOXHD1_ENST00000582408.1_Missense_Mutation_p.K394R|LOXHD1_ENST00000579038.1_Missense_Mutation_p.K298R			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1227	PLAT 9. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCTCTCGAACTTGTTGGTCCG	0.592																																																	0													171.0	162.0	164.0					18																	44109156		692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.3680A>G	18.37:g.44109156T>C	ENSP00000381707:p.Lys1227Arg		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.K1505R	ENST00000398722.4	37	c.4514		18	.	.	.	.	.	.	.	.	.	.	T	15.94	2.981438	0.53827	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.14	5.14	0.70334	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.153654	0.56097	D	0.000023	T	0.38321	0.1036	L	0.52823	1.66	0.50313	D	0.999861	D;D;D;D	0.76494	0.999;0.996;0.977;0.995	D;D;P;D	0.83275	0.996;0.99;0.779;0.954	T	0.11567	-1.0582	10	0.11485	T	0.65	.	14.9195	0.70826	0.0:0.0:0.0:1.0	.	1505;438;1227;1227	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	R	394;1227;1505;438;1227	ENSP00000300591:K394R;ENSP00000381707:K1227R;ENSP00000444586:K1505R;ENSP00000409062:K438R	ENSP00000300591:K394R	K	-	2	0	LOXHD1	42363154	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.705000	0.84606	2.073000	0.62155	0.418000	0.28097	AAG	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	ENSG00000167210		0.592	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	55	0	T	NM_144612		44109156	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	C
LOXL2	4017	genome.wustl.edu	37	8	23167424	23167424	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:23167424G>A	ENST00000389131.3	-	10	2006	c.1637C>T	c.(1636-1638)aCc>aTc	p.T546I		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	546					aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GTCAGGGGCGGCTGCGGAGGA	0.607																																																	0													38.0	37.0	38.0					8																	23167424		2203	4299	6502	SO:0001630	splice_region_variant	0			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1637-1C>T	8.37:g.23167424G>A			B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.T546I	ENST00000389131.3	37	c.1637	CCDS34864.1	8	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961905	0.53400	.	.	ENSG00000134013	ENST00000389131	T	0.28069	1.63	5.67	5.67	0.87782	Speract/scavenger receptor-related (1);	0.047631	0.85682	D	0.000000	T	0.48333	0.1494	M	0.65975	2.015	0.80722	D	1	D;D	0.55172	0.969;0.97	P;P	0.53809	0.677;0.735	T	0.43972	-0.9358	10	0.54805	T	0.06	.	18.3462	0.90322	0.0:0.0:1.0:0.0	.	546;546	B2R5Q0;Q9Y4K0	.;LOXL2_HUMAN	I	546	ENSP00000373783:T546I	ENSP00000373783:T546I	T	-	2	0	LOXL2	23223369	1.000000	0.71417	0.905000	0.35620	0.070000	0.16714	6.829000	0.75314	2.677000	0.91161	0.561000	0.74099	ACC	LOXL2	-	superfamily_Srcr_rcpt-rel	ENSG00000134013		0.607	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	HGNC	protein_coding	OTTHUMT00000375603.1		0.00	45	0	G		Missense_Mutation	23167424	-1			no_errors	ENST00000389131	ensembl	human	known	74_37	missense	15.38	32	6	SNP	0.999	A
LRP1B	53353	genome.wustl.edu	37	2	141598614	141598614	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:141598614A>C	ENST00000389484.3	-	30	5958	c.4987T>G	c.(4987-4989)Tta>Gta	p.L1663V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1663					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATCCAGTATAAATTACGTGAC	0.368										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													136.0	126.0	130.0					2																	141598614		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4987T>G	2.37:g.141598614A>C	ENSP00000374135:p.Leu1663Val		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.L1663V	ENST00000389484.3	37	c.4987	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	A	15.42	2.828954	0.50845	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.93604	-3.25	5.44	3.02	0.34903	Six-bladed beta-propeller, TolB-like (1);	0.105287	0.41001	U	0.000976	D	0.89959	0.6866	L	0.58669	1.825	0.35556	D	0.804269	B	0.15141	0.012	B	0.15052	0.012	D	0.88151	0.2851	10	0.66056	D	0.02	.	7.7369	0.28819	0.7864:0.1408:0.0728:0.0	.	1663	Q9NZR2	LRP1B_HUMAN	V	1663;1601	ENSP00000374135:L1663V	ENSP00000374135:L1663V	L	-	1	2	LRP1B	141315084	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.978000	0.40598	0.864000	0.35578	0.377000	0.23210	TTA	LRP1B	-	smart_LDLR_classB_rpt	ENSG00000168702		0.368	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	86	0	A	NM_018557		141598614	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	21.88	50	14	SNP	1.000	C
LRRC16A	55604	genome.wustl.edu	37	6	25606315	25606315	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:25606315G>A	ENST00000329474.6	+	35	4029	c.3661G>A	c.(3661-3663)Gag>Aag	p.E1221K		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1221					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						AGGTCTTCCAGAGAACCGCTT	0.468																																																	0													48.0	52.0	51.0					6																	25606315		1868	4092	5960	SO:0001583	missense	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3661G>A	6.37:g.25606315G>A	ENSP00000331983:p.Glu1221Lys		B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E1221K	ENST00000329474.6	37	c.3661	CCDS54973.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.53|18.53	3.644092|3.644092	0.67244|0.67244	.|.	.|.	ENSG00000079691|ENSG00000079691	ENST00000399313|ENST00000329474	.|T	.|0.20332	.|2.08	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.365828	.|0.26582	.|N	.|0.023580	.|T	.|0.30198	.|0.0757	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	.|D;B;P	.|0.69078	.|0.997;0.163;0.628	.|D;B;B	.|0.67231	.|0.95;0.024;0.254	.|T	.|0.06770	.|-1.0808	.|10	.|0.06625	.|T	.|0.88	.|-26.6018	20.1649|20.1649	0.98147|0.98147	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1221;1215;1176	.|Q5VZK9;B2RTQ5;Q5VZK9-2	.|LR16A_HUMAN;.;.	.|K	-1|1221	.|ENSP00000331983:E1221K	.|ENSP00000331983:E1221K	.|E	+|+	.|1	.|0	LRRC16A|LRRC16A	25714294|25714294	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.974000|0.974000	0.67602|0.67602	6.775000|6.775000	0.75018|0.75018	2.753000|2.753000	0.94483|0.94483	0.655000|0.655000	0.94253|0.94253	.|GAG	LRRC16A	-	NULL	ENSG00000079691		0.468	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	-	0.00	61	0	G	NM_017640		25606315	+1	tier1	-	no_errors	ENST00000329474	ensembl	human	novel	74_37	missense	6.90	54	4	SNP	1.000	A
LRRC49	54839	genome.wustl.edu	37	15	71329574	71329574	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:71329574A>T	ENST00000260382.5	+	15	2020	c.1760A>T	c.(1759-1761)aAc>aTc	p.N587I	LRRC49_ENST00000443425.2_Missense_Mutation_p.N543I|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560369.1_Missense_Mutation_p.N592I|LRRC49_ENST00000560158.2_Missense_Mutation_p.N275I|LRRC49_ENST00000560691.1_Missense_Mutation_p.N293I|LRRC49_ENST00000544974.2_Missense_Mutation_p.N577I	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	587						cytoplasm (GO:0005737)|microtubule (GO:0005874)		p.N587S(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						GGTATTATCAACGAAGAAAAT	0.318																																																	1	Substitution - Missense(1)	prostate(1)											85.0	93.0	91.0					15																	71329574		2199	4295	6494	SO:0001583	missense	0				CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1760A>T	15.37:g.71329574A>T	ENSP00000260382:p.Asn587Ile		B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.N587I	ENST00000260382.5	37	c.1760	CCDS32282.1	15	.	.	.	.	.	.	.	.	.	.	A	8.321	0.824334	0.16678	.	.	ENSG00000137821	ENST00000544974;ENST00000260382;ENST00000443425;ENST00000436542	T;T;T	0.35421	1.31;1.31;1.31	5.04	-6.24	0.02046	.	0.634375	0.17060	N	0.188588	T	0.22044	0.0531	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.22541	0.034;0.056;0.071;0.042;0.045	B;B;B;B;B	0.25291	0.019;0.043;0.059;0.027;0.045	T	0.07158	-1.0787	10	0.22109	T	0.4	-0.4476	17.7229	0.88357	0.2339:0.0:0.7661:0.0	.	592;559;543;587;577	B7Z366;G5E9Q1;G5E9T5;Q8IUZ0;F5H1J4	.;.;.;LRC49_HUMAN;.	I	577;587;543;559	ENSP00000439600:N577I;ENSP00000260382:N587I;ENSP00000414065:N543I	ENSP00000260382:N587I	N	+	2	0	LRRC49	69116628	0.100000	0.21855	0.026000	0.17262	0.927000	0.56198	-0.553000	0.06012	-1.105000	0.03011	0.533000	0.62120	AAC	LRRC49	-	NULL	ENSG00000137821		0.318	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRC49	HGNC	protein_coding	OTTHUMT00000417209.3		0.00	32	0	A	NM_017691		71329574	+1			no_errors	ENST00000260382	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.011	T
LRRC7	57554	genome.wustl.edu	37	1	70226051	70226051	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:70226051C>T	ENST00000035383.5	+	1	194	c.164C>T	c.(163-165)gCc>gTc	p.A55V	LRRC7_ENST00000370958.1_Missense_Mutation_p.A93V|LRRC7_ENST00000415775.2_5'UTR|LRRC7_ENST00000310961.5_Missense_Mutation_p.A60V	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	55						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TATCTAGATGCCAATCAAATT	0.333																																																	0													78.0	78.0	78.0					1																	70226051		2203	4299	6502	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.164C>T	1.37:g.70226051C>T	ENSP00000035383:p.Ala55Val		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.A55V	ENST00000035383.5	37	c.164	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.249548	0.95305	.	.	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	T;T;T	0.52754	1.85;0.65;1.84	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	N	0.14661	0.345	0.80722	D	1	D;D	0.76494	0.981;0.999	D;D	0.91635	0.913;0.999	T	0.55023	-0.8205	10	0.59425	D	0.04	.	18.5004	0.90879	0.0:1.0:0.0:0.0	.	55;93	Q96NW7;B1AKT2	LRRC7_HUMAN;.	V	60;93;55;55	ENSP00000309245:A60V;ENSP00000359997:A93V;ENSP00000035383:A55V	ENSP00000035383:A55V	A	+	2	0	LRRC7	69998639	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.721000	0.93114	0.585000	0.79938	GCC	LRRC7	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000033122		0.333	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	49	0	C	NM_020794		70226051	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
LRRIQ1	84125	genome.wustl.edu	37	12	85517961	85517961	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:85517961A>G	ENST00000393217.2	+	17	3732	c.3671A>G	c.(3670-3672)aAg>aGg	p.K1224R		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1224								p.K1224T(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		ACTATCACCAAGAAAGATGAA	0.408																																																	2	Substitution - Missense(2)	large_intestine(2)											98.0	102.0	101.0					12																	85517961		2203	4300	6503	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3671A>G	12.37:g.85517961A>G	ENSP00000376910:p.Lys1224Arg		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.K1224R	ENST00000393217.2	37	c.3671	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	A	5.532	0.283028	0.10458	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.54279	0.58	5.52	3.08	0.35506	.	0.662303	0.14387	N	0.322759	T	0.35508	0.0934	N	0.24115	0.695	0.09310	N	1	B;B	0.15473	0.013;0.013	B;B	0.12156	0.007;0.007	T	0.21211	-1.0252	10	0.38643	T	0.18	.	6.9784	0.24690	0.7748:0.1493:0.0759:0.0	.	1224;1199	Q96JM4;C9JI57	LRIQ1_HUMAN;.	R	1224;1199;1224	ENSP00000376910:K1224R	ENSP00000256007:K1224R	K	+	2	0	LRRIQ1	84042092	0.014000	0.17966	0.006000	0.13384	0.028000	0.11728	2.664000	0.46783	0.348000	0.23949	0.477000	0.44152	AAG	LRRIQ1	-	NULL	ENSG00000133640		0.408	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	39	0	A	NM_032165		85517961	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.012	G
LRTM1	57408	genome.wustl.edu	37	3	54958762	54958762	+	Missense_Mutation	SNP	C	C	T	rs201096330	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:54958762C>T	ENST00000273286.5	-	2	650	c.488G>A	c.(487-489)cGa>cAa	p.R163Q	CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000474759.1_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.R87Q|CACNA2D3_ENST00000490478.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	163						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		CAGGAGCGCTCGATCAAGCTG	0.488																																																	0													99.0	99.0	99.0					3																	54958762		2203	4300	6503	SO:0001583	missense	0			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.488G>A	3.37:g.54958762C>T	ENSP00000273286:p.Arg163Gln		Q8IUU2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R163Q	ENST00000273286.5	37	c.488	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	c	16.19	3.051815	0.55218	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.90133	4.32;-2.62	5.96	4.16	0.48862	.	0.173533	0.51477	D	0.000091	D	0.92922	0.7748	L	0.42581	1.335	0.43141	D	0.994896	D	0.89917	1.0	D	0.68039	0.955	D	0.93275	0.6655	10	0.66056	D	0.02	.	16.7694	0.85533	0.0:0.7563:0.2437:0.0	.	163	Q9HBL6	LRTM1_HUMAN	Q	163;87	ENSP00000273286:R163Q;ENSP00000419772:R87Q	ENSP00000273286:R163Q	R	-	2	0	LRTM1	54933802	0.999000	0.42202	0.004000	0.12327	0.067000	0.16453	4.506000	0.60428	0.839000	0.34971	-0.121000	0.15023	CGA	LRTM1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000144771		0.488	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	HGNC	protein_coding	OTTHUMT00000351399.1	-	0.00	47	0	C	NM_020678		54958762	-1	tier1	-	no_errors	ENST00000273286	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.945	T
LYST	1130	genome.wustl.edu	37	1	235976294	235976294	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:235976294G>A	ENST00000389794.3	-	4	434	c.260C>T	c.(259-261)cCt>cTt	p.P87L	LYST_ENST00000389793.2_Missense_Mutation_p.P87L|LYST_ENST00000536965.1_Missense_Mutation_p.P87L			Q99698	LYST_HUMAN	lysosomal trafficking regulator	87					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.P87L(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTCTTGGACAGGTATCTTCCA	0.373																																																	1	Substitution - Missense(1)	lung(1)											91.0	87.0	88.0					1																	235976294		2203	4300	6503	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.260C>T	1.37:g.235976294G>A	ENSP00000374444:p.Pro87Leu		O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P87L	ENST00000389794.3	37	c.260	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821772	0.90873	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	D;D;T	0.84516	-1.86;-1.86;0.24	5.63	5.63	0.86233	.	0.099762	0.64402	D	0.000001	D	0.91774	0.7398	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91462	0.5190	10	0.62326	D	0.03	.	20.0572	0.97657	0.0:0.0:1.0:0.0	.	87;87	Q99698-3;Q99698	.;LYST_HUMAN	L	87	ENSP00000374444:P87L;ENSP00000374443:P87L;ENSP00000438315:P87L	ENSP00000374443:P87L	P	-	2	0	LYST	234042917	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	9.375000	0.97178	2.826000	0.97356	0.655000	0.94253	CCT	LYST	-	NULL	ENSG00000143669		0.373	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5		0.00	39	0	G			235976294	-1			no_errors	ENST00000389793	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
MAML3	55534	genome.wustl.edu	37	4	140811108	140811108	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:140811108C>T	ENST00000509479.2	-	2	2338	c.1482G>A	c.(1480-1482)caG>caA	p.Q494Q	MAML3_ENST00000398940.1_Silent_p.Q33Q|MAML3_ENST00000327122.5_Silent_p.Q338Q	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.537																																																	0													14.0	19.0	17.0					4																	140811108		2165	4272	6437	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1482G>A	4.37:g.140811108C>T				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q494	ENST00000509479.2	37	c.1482	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.537	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	-	0.00	26	0	C			140811108	-1	tier1	-	no_errors	ENST00000509479	ensembl	human	known	74_37	silent	16.00	21	4	SNP	1.000	T
MAN1B1	11253	genome.wustl.edu	37	9	139992307	139992307	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:139992307G>T	ENST00000371589.4	+	5	721	c.648G>T	c.(646-648)gaG>gaT	p.E216D	MAN1B1_ENST00000474902.1_5'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	216					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		TCGAGCCTGAGCAGGGCACCG	0.637																																																	0													38.0	26.0	30.0					9																	139992307		2163	4235	6398	SO:0001583	missense	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.648G>T	9.37:g.139992307G>T	ENSP00000360645:p.Glu216Asp		Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.E216D	ENST00000371589.4	37	c.648	CCDS7029.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.819|6.819	0.520203|0.520203	0.13005|0.13005	.|.	.|.	ENSG00000177239|ENSG00000177239	ENST00000535144;ENST00000542372|ENST00000371589	.|T	.|0.72282	.|-0.64	4.85|4.85	-1.79|-1.79	0.07932|0.07932	.|.	.|0.507042	.|0.18095	.|U	.|0.151873	T|T	0.48624|0.48624	0.1510|0.1510	L|L	0.33485|0.33485	1.01|1.01	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.19817	.|0.003;0.002;0.004;0.039	.|B;B;B;B	.|0.23018	.|0.002;0.006;0.003;0.043	T|T	0.12293|0.12293	-1.0553|-1.0553	5|9	.|.	.|.	.|.	-7.315|-7.315	2.1597|2.1597	0.03821|0.03821	0.2005:0.4027:0.2656:0.1313|0.2005:0.4027:0.2656:0.1313	.|.	.|117;180;216;117	.|B4DPS9;B4DR05;Q9UKM7;Q68D80	.|.;.;MA1B1_HUMAN;.	S|D	190;161|216	.|ENSP00000360645:E216D	.|.	A|E	+|+	1|3	0|2	MAN1B1|MAN1B1	139112128|139112128	1.000000|1.000000	0.71417|0.71417	0.032000|0.032000	0.17829|0.17829	0.031000|0.031000	0.12232|0.12232	0.734000|0.734000	0.26101|0.26101	-0.088000|-0.088000	0.12506|0.12506	-0.254000|-0.254000	0.11334|0.11334	GCA|GAG	MAN1B1	-	NULL	ENSG00000177239		0.637	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	-	0.00	54	0	G	NM_016219		139992307	+1	tier1	-	no_errors	ENST00000371589	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.988	T
MANEA	79694	genome.wustl.edu	37	6	96044722	96044722	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:96044722G>T	ENST00000358812.4	+	3	788	c.654G>T	c.(652-654)aaG>aaT	p.K218N	MANEA_ENST00000474553.1_3'UTR	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	218	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		ATAACCTAAAGGTATTTTATT	0.284																																																	0													77.0	76.0	77.0					6																	96044722		2203	4300	6503	SO:0001630	splice_region_variant	0			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.654+1G>T	6.37:g.96044722G>T			A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF	p.K218N	ENST00000358812.4	37	c.654	CCDS5032.1	6	.	.	.	.	.	.	.	.	.	.	G	26.3	4.726860	0.89390	.	.	ENSG00000172469	ENST00000358812	D	0.92446	-3.04	5.45	5.45	0.79879	Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.96460	0.8845	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96326	0.9240	10	0.54805	T	0.06	-13.0923	18.2605	0.90034	0.0:0.0:1.0:0.0	.	218	Q5SRI9	MANEA_HUMAN	N	218	ENSP00000351669:K218N	ENSP00000351669:K218N	K	+	3	2	MANEA	96151443	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.200000	0.95010	2.557000	0.86248	0.573000	0.79308	AAG	MANEA	-	superfamily_Glycoside_hydrolase_SF	ENSG00000172469		0.284	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1		0.00	33	0	G	NM_024641	Missense_Mutation	96044722	+1			no_errors	ENST00000358812	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210557839	210557839	+	Silent	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:210557839T>C	ENST00000360351.4	+	7	1451	c.945T>C	c.(943-945)agT>agC	p.S315S	MAP2_ENST00000447185.1_Silent_p.S311S|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	315					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CCATGCCAAGTCCCTTTCAAG	0.458																																					Pancreas(27;423 979 28787 29963)												0													69.0	71.0	70.0					2																	210557839		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.945T>C	2.37:g.210557839T>C			Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.S315	ENST00000360351.4	37	c.945	CCDS2384.1	2																																																																																			MAP2	-	NULL	ENSG00000078018		0.458	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	43	0	T	NM_001039538		210557839	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	silent	25.00	27	9	SNP	0.997	C
MAP3K7	6885	genome.wustl.edu	37	6	91261851	91261851	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:91261851G>C	ENST00000369329.3	-	8	945	c.784C>G	c.(784-786)Ctg>Gtg	p.L262V	MAP3K7_ENST00000369320.1_5'UTR|MAP3K7_ENST00000369325.3_Missense_Mutation_p.L262V|MAP3K7_ENST00000369332.3_Missense_Mutation_p.L262V|MAP3K7_ENST00000369327.3_Missense_Mutation_p.L262V	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	262	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		CGAGTCATCAGGCTCTCAATG	0.413																																																	0													134.0	130.0	131.0					6																	91261851		2203	4300	6503	SO:0001583	missense	0			AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.784C>G	6.37:g.91261851G>C	ENSP00000358335:p.Leu262Val		B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L262V	ENST00000369329.3	37	c.784	CCDS5028.1	6	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908812	0.72868	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327;ENST00000450832	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.76	3.59	0.41128	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.39489	0.1080	L	0.49455	1.56	0.80722	D	1	D;D;D;D	0.71674	0.972;0.972;0.998;0.977	D;D;D;D	0.68192	0.934;0.925;0.956;0.955	T	0.44862	-0.9300	10	0.72032	D	0.01	.	4.3791	0.11284	0.4513:0.0:0.5487:0.0	.	262;262;262;262	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	V	262;262;262;262;189	ENSP00000358338:L262V;ENSP00000358335:L262V;ENSP00000358331:L262V;ENSP00000358333:L262V	ENSP00000358331:L262V	L	-	1	2	MAP3K7	91318572	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.590000	0.46154	1.546000	0.49388	0.650000	0.86243	CTG	MAP3K7	-	pirsf_MAPKKK7,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135341		0.413	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K7	HGNC	protein_coding	OTTHUMT00000041530.1	-	0.00	63	0	G	NM_145331		91261851	-1	tier1	-	no_errors	ENST00000369329	ensembl	human	known	74_37	missense	9.38	58	6	SNP	1.000	C
MAPRE2	10982	genome.wustl.edu	37	18	32682021	32682021	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:32682021G>T	ENST00000300249.5	+	4	688	c.508G>T	c.(508-510)Gta>Tta	p.V170L	MAPRE2_ENST00000589699.1_Missense_Mutation_p.V127L|MAPRE2_ENST00000538170.2_Missense_Mutation_p.V117L|MAPRE2_ENST00000436190.2_Missense_Mutation_p.V158L|MAPRE2_ENST00000413393.1_Missense_Mutation_p.V127L|MAPRE2_ENST00000588910.1_Missense_Mutation_p.V170L	NM_014268.3	NP_055083.1	Q15555	MARE2_HUMAN	microtubule-associated protein, RP/EB family, member 2	170					cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)		p.V170L(1)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	9						GTATGATCCTGTAGAGGCACG	0.463																																																	1	Substitution - Missense(1)	lung(1)											125.0	106.0	112.0					18																	32682021		2203	4300	6503	SO:0001583	missense	0			X94232	CCDS11910.1, CCDS45850.1, CCDS45851.1, CCDS58619.1	18q12.1	2013-01-17			ENSG00000166974	ENSG00000166974			6891	protein-coding gene	gene with protein product	"""APC-binding protein EB1"""	605789				9233623, 12475954	Standard	NM_001143826		Approved	RP1, EB1, EB2	uc010xcc.3	Q15555	OTTHUMG00000132551	ENST00000300249.5:c.508G>T	18.37:g.32682021G>T	ENSP00000300249:p.Val170Leu		B2RE21|B3KR39|B4DJV4|B7Z2L3|E9PHR3|F5H1V8|G5E9I6|Q9UQ33	Missense_Mutation	SNP	pfam_EB1_C,pfam_CH-domain,superfamily_CH-domain,superfamily_EB1_C,pfscan_CH-domain	p.V170L	ENST00000300249.5	37	c.508	CCDS11910.1	18	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687187	0.29962	.	.	ENSG00000166974	ENST00000413393;ENST00000436190;ENST00000300249;ENST00000538170	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	5.38	5.38	0.77491	Calponin homology domain (2);	0.061416	0.64402	D	0.000004	T	0.36744	0.0978	L	0.38175	1.15	0.80722	D	1	B;B;B;B	0.15473	0.0;0.013;0.001;0.0	B;B;B;B	0.21151	0.006;0.033;0.001;0.003	T	0.12915	-1.0529	10	0.18276	T	0.48	-15.3349	19.1073	0.93301	0.0:0.0:1.0:0.0	.	158;117;170;170	E9PHR3;F5H1V8;Q15555;Q15555-2	.;.;MARE2_HUMAN;.	L	127;158;170;117	ENSP00000396074:V127L;ENSP00000407723:V158L;ENSP00000300249:V170L;ENSP00000446343:V117L	ENSP00000300249:V170L	V	+	1	0	MAPRE2	30936019	1.000000	0.71417	0.729000	0.30791	0.963000	0.63663	4.874000	0.63064	2.518000	0.84900	0.561000	0.74099	GTA	MAPRE2	-	superfamily_CH-domain	ENSG00000166974		0.463	MAPRE2-001	KNOWN	basic|CCDS	protein_coding	MAPRE2	HGNC	protein_coding	OTTHUMT00000255753.2		0.00	70	0	G	NM_014268		32682021	+1			no_errors	ENST00000300249	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.993	T
MDN1	23195	genome.wustl.edu	37	6	90440489	90440489	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:90440489C>A	ENST00000369393.3	-	35	5211	c.5096G>T	c.(5095-5097)gGa>gTa	p.G1699V	MDN1_ENST00000428876.1_Missense_Mutation_p.G1699V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1699					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GTTATCTATTCCAGTGAATTC	0.313																																																	0													93.0	87.0	89.0					6																	90440489		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.5096G>T	6.37:g.90440489C>A	ENSP00000358400:p.Gly1699Val		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.G1699V	ENST00000369393.3	37	c.5096	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	11.54	1.669254	0.29604	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03124	4.04;4.04	5.62	3.74	0.42951	.	0.259424	0.42053	D	0.000776	T	0.00875	0.0029	N	0.05078	-0.115	0.46499	D	0.999071	B	0.13594	0.008	B	0.06405	0.002	T	0.51100	-0.8748	10	0.17369	T	0.5	.	15.8307	0.78749	0.0:0.7437:0.2563:0.0	.	1699	Q9NU22	MDN1_HUMAN	V	1699	ENSP00000358400:G1699V;ENSP00000413970:G1699V	ENSP00000358400:G1699V	G	-	2	0	MDN1	90497210	0.996000	0.38824	1.000000	0.80357	0.968000	0.65278	2.777000	0.47717	1.366000	0.46076	0.585000	0.79938	GGA	MDN1	-	pirsf_Midasin	ENSG00000112159		0.313	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	71	0	C			90440489	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
MEGF8	1954	genome.wustl.edu	37	19	42855402	42855402	+	Missense_Mutation	SNP	G	G	A	rs368247409		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:42855402G>A	ENST00000251268.6	+	16	2771	c.2771G>A	c.(2770-2772)cGc>cAc	p.R924H	MEGF8_ENST00000334370.4_Missense_Mutation_p.R857H	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	924	PSI 3.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				AGCACCAGCCGCAAAGGGGAC	0.667																																																	0								G	HIS/ARG	0,4362		0,0,2181	8.0	9.0	9.0		2570	5.1	1.0	19		9	2,8528		0,2,4263	no	missense	MEGF8	NM_001410.2	29	0,2,6444	AA,AG,GG		0.0234,0.0,0.0155	possibly-damaging	857/2779	42855402	2,12890	2181	4265	6446	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.2771G>A	19.37:g.42855402G>A	ENSP00000251268:p.Arg924His		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_CUB_dom,smart_EG-like_dom,smart_Plexin-like_fold,smart_EGF-like_Ca-bd_dom,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin	p.R924H	ENST00000251268.6	37	c.2771		19	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765172	0.90020	0.0	2.34E-4	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.22336	1.96;1.97	5.08	5.08	0.68730	.	0.077206	0.51477	D	0.000081	T	0.20170	0.0485	N	0.08118	0	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.60117	0.869;0.784	T	0.05084	-1.0907	10	0.41790	T	0.15	-35.1848	9.5757	0.39457	0.0952:0.0:0.9048:0.0	.	924;857	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	H	857;924	ENSP00000334219:R857H;ENSP00000251268:R924H	ENSP00000251268:R924H	R	+	2	0	MEGF8	47547242	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.039000	0.70972	2.362000	0.80069	0.655000	0.94253	CGC	MEGF8	-	superfamily_Plexin-like_fold,smart_Plexin-like_fold	ENSG00000105429		0.667	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1		0.00	87	0	G	NM_001410		42855402	+1			no_errors	ENST00000251268	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
METTL13	51603	genome.wustl.edu	37	1	171753485	171753485	+	Silent	SNP	C	C	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:171753485C>G	ENST00000361735.3	+	2	1025	c.759C>G	c.(757-759)gcC>gcG	p.A253A	METTL13_ENST00000458517.1_Silent_p.A252A|METTL13_ENST00000367737.5_Intron|METTL13_ENST00000362019.3_Silent_p.A167A	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	253							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						AGCAGTATGCCTGGCTGTGCA	0.662																																																	0													27.0	27.0	27.0					1																	171753485		2202	4299	6501	SO:0001819	synonymous_variant	0			AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.759C>G	1.37:g.171753485C>G			A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Silent	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.A253	ENST00000361735.3	37	c.759	CCDS1299.1	1																																																																																			METTL13	-	NULL	ENSG00000010165		0.662	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	-	0.00	44	0	C	NM_014955		171753485	+1	tier1	-	no_errors	ENST00000361735	ensembl	human	known	74_37	silent	26.09	34	12	SNP	1.000	G
MICA	100507436	genome.wustl.edu	37	6	31379008	31379008	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:31379008C>T	ENST00000449934.2	+	3	539	c.485C>T	c.(484-486)gCc>gTc	p.A162V	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				CAGACCTTGGCCATGAACGTC	0.517																																																	0													102.0	88.0	93.0					6																	31379008		692	1591	2283	SO:0001583	missense	0			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.485C>T	6.37:g.31379008C>T	ENSP00000413079:p.Ala162Val			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A162V	ENST00000449934.2	37	c.485	CCDS56412.1	6	.	.	.	.	.	.	.	.	.	.	N	13.47	2.246436	0.39697	.	.	ENSG00000204520	ENST00000364810;ENST00000399172;ENST00000449934	T	0.05717	3.4	1.41	0.503	0.16940	.	0.000000	0.36665	N	0.002461	T	0.07098	0.0180	M	0.81942	2.565	0.09310	N	1	D	0.60575	0.988	P	0.55345	0.774	T	0.08452	-1.0721	10	0.87932	D	0	.	5.9179	0.19065	0.0:0.8092:0.0:0.1908	.	162	Q96QC4	.	V	162;119;162	ENSP00000413079:A162V	ENSP00000365394:A162V	A	+	2	0	MICA	31486987	0.006000	0.16342	0.000000	0.03702	0.002000	0.02628	1.516000	0.35856	0.186000	0.20125	0.306000	0.20318	GCC	MICA	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000204520		0.517	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	-	0.00	37	0	C	NM_001177519		31379008	+1	tier1	-	no_errors	ENST00000449934	ensembl	human	known	74_37	missense	14.63	35	6	SNP	0.001	T
MLLT4	4301	genome.wustl.edu	37	6	168265353	168265353	+	Silent	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:168265353G>C	ENST00000447894.2	+	2	228	c.228G>C	c.(226-228)gcG>gcC	p.A76A	MLLT4_ENST00000351017.4_Silent_p.A76A|MLLT4_ENST00000366806.2_Silent_p.A76A|MLLT4_ENST00000392112.1_Silent_p.A76A|MLLT4_ENST00000392108.3_Silent_p.A76A|MLLT4_ENST00000400822.3_Silent_p.A76A|MLLT4_ENST00000344191.4_Silent_p.A76A			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	76	Ras-associating 1. {ECO:0000255|PROSITE- ProRule:PRU00166}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)	p.A76A(4)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		AAACGCTCGCGGAGAAATTTC	0.433			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	4	Substitution - coding silent(4)	lung(2)|kidney(2)											181.0	189.0	187.0					6																	168265353		2203	4296	6499	SO:0001819	synonymous_variant	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.228G>C	6.37:g.168265353G>C			O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.A76	ENST00000447894.2	37	c.228		6																																																																																			MLLT4	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000130396		0.433	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1		0.00	76	0	G	NM_005936		168265353	+1			no_errors	ENST00000366806	ensembl	human	known	74_37	silent	5.08	56	3	SNP	0.009	C
MS4A14	84689	genome.wustl.edu	37	11	60164185	60164185	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:60164185T>C	ENST00000300187.6	+	1	411	c.134T>C	c.(133-135)tTg>tCg	p.L45S	MS4A14_ENST00000395005.2_Missense_Mutation_p.L45S|MS4A14_ENST00000531783.1_Missense_Mutation_p.L45S|MS4A14_ENST00000531787.1_Intron|MS4A14_ENST00000395001.1_5'UTR	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	45						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						CCAAGAGTCTTGGGGGTAAGT	0.423																																																	0													67.0	59.0	62.0					11																	60164185		2203	4300	6503	SO:0001583	missense	0			AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.134T>C	11.37:g.60164185T>C	ENSP00000300187:p.Leu45Ser		E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	pfam_CD20-like	p.L45S	ENST00000300187.6	37	c.134	CCDS31569.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.51|17.51	3.406566|3.406566	0.62399|0.62399	.|.	.|.	ENSG00000166928|ENSG00000166928	ENST00000300187;ENST00000395005;ENST00000526375;ENST00000531783|ENST00000534688	T;T;T;T|.	0.56275|.	3.24;0.47;3.24;3.24|.	4.58|4.58	4.58|4.58	0.56647|0.56647	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.79563|0.79563	0.4467|0.4467	M|M	0.91768|0.91768	3.24|3.24	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.74348|.	0.972;0.983|.	T|T	0.83322|0.83322	-0.0017|-0.0017	10|5	0.87932|.	D|.	0|.	-7.6901|-7.6901	10.2839|10.2839	0.43556|0.43556	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	45;45|.	Q96JA4-2;Q96JA4|.	.;M4A14_HUMAN|.	S|R	45|4	ENSP00000300187:L45S;ENSP00000378453:L45S;ENSP00000435764:L45S;ENSP00000433761:L45S|.	ENSP00000300187:L45S|.	L|W	+|+	2|1	0|0	MS4A14|MS4A14	59920761|59920761	0.996000|0.996000	0.38824|0.38824	0.542000|0.542000	0.28115|0.28115	0.907000|0.907000	0.53573|0.53573	3.251000|3.251000	0.51453|0.51453	1.924000|1.924000	0.55735|0.55735	0.533000|0.533000	0.62120|0.62120	TTG|TGG	MS4A14	-	pfam_CD20-like	ENSG00000166928		0.423	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	HGNC	protein_coding	OTTHUMT00000395383.2		0.00	59	0	T			60164185	+1			no_errors	ENST00000300187	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.715	C
MT-ND4L	4539	genome.wustl.edu	37	M	10670	10670	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrM:10670C>T	ENST00000361335.1	+	1	201	c.201C>T	c.(199-201)gcC>gcT	p.A67A	MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA			P03901	NU4LM_HUMAN	mitochondrially encoded NADH dehydrogenase 4L	67					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(2)|kidney(2)	5						CTAGTCTTTGCCGCCTGCGAA	0.458																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000212907	ENSG00000212907	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7460	protein-coding gene	gene with protein product	"""complex I ND4L subunit"", ""NADH-ubiquinone oxidoreductase chain 4L"""	516004	"""NADH dehydrogenase 4L"""	MTND4L			Standard			Approved	ND4L, NAD4L		P03901		ENST00000361335.1:c.201C>T	M.37:g.10670C>T				Silent	SNP	pfam_NADH_UbQ_OxRdtase_chain4L/K	p.A67	ENST00000361335.1	37	c.201		MT																																																																																			MT-ND4L	-	pfam_NADH_UbQ_OxRdtase_chain4L/K	ENSG00000212907		0.458	MT-ND4L-201	KNOWN	basic|appris_principal	protein_coding	MT-ND4L	HGNC	protein_coding		-	0.00	33	0	C	YP_003024034		10670	+1	tier1	-	no_errors	ENST00000361335	ensembl	human	known	74_37	silent	14.29	12	2	SNP	NULL	T
MT1H	4496	genome.wustl.edu	37	16	56703817	56703817	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:56703817C>T	ENST00000332374.4	+	1	92	c.21C>T	c.(19-21)tgC>tgT	p.C7C	MT1G_ENST00000568675.1_5'Flank|MT1G_ENST00000569500.1_5'Flank|MT1G_ENST00000444837.2_5'Flank|MT1G_ENST00000379811.3_5'Flank|MT1H_ENST00000569155.1_Silent_p.C7C	NM_005951.2	NP_005942.1	P80294	MT1H_HUMAN	metallothionein 1H	7	Beta.				cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			lung(5)	5						ACTGCTCCTGCGAGGCTGGTA	0.567																																																	0													134.0	127.0	129.0					16																	56703817		2198	4300	6498	SO:0001819	synonymous_variant	0			BC008408	CCDS10767.1	16q13	2008-02-05			ENSG00000205358	ENSG00000205358		"""Metallothioneins"""	7400	protein-coding gene	gene with protein product		156354		MT1		2286373, 8049263	Standard	NM_005951		Approved		uc002ejw.3	P80294	OTTHUMG00000133283	ENST00000332374.4:c.21C>T	16.37:g.56703817C>T			B2RUY6	Silent	SNP	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.C7	ENST00000332374.4	37	c.21	CCDS10767.1	16																																																																																			MT1H	-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	ENSG00000205358		0.567	MT1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1H	HGNC	protein_coding	OTTHUMT00000257063.1	-	0.00	92	0	C	NM_005951		56703817	+1	tier1	-	no_errors	ENST00000332374	ensembl	human	known	74_37	silent	5.83	97	6	SNP	0.025	T
MUC5B	727897	genome.wustl.edu	37	11	1280192	1280192	+	Silent	SNP	C	C	A	rs540837204		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:1280192C>A	ENST00000529681.1	+	44	16672	c.16614C>A	c.(16612-16614)ggC>ggA	p.G5538G	MUC5B_ENST00000447027.1_Silent_p.G5541G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5538	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTCCCAGGCGCCCTTCCCT	0.642																																																	0													41.0	48.0	46.0					11																	1280192		1906	4021	5927	SO:0001819	synonymous_variant	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16614C>A	11.37:g.1280192C>A			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G5541	ENST00000529681.1	37	c.16623	CCDS44515.2	11																																																																																			MUC5B	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	ENSG00000117983		0.642	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	-	0.00	59	0	C	XM_001126093		1280192	+1	tier1	-	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	34.38	21	11	SNP	0.000	A
MYPN	84665	genome.wustl.edu	37	10	69881426	69881426	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:69881426T>A	ENST00000358913.5	+	2	719	c.231T>A	c.(229-231)aaT>aaA	p.N77K	MYPN_ENST00000373675.3_Missense_Mutation_p.N77K|MYPN_ENST00000354393.2_Intron|MYPN_ENST00000540630.1_Missense_Mutation_p.N77K	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	77	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						AAAGTGTCAATTTGGCAAGAC	0.478																																																	0													53.0	53.0	53.0					10																	69881426		2203	4300	6503	SO:0001583	missense	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.231T>A	10.37:g.69881426T>A	ENSP00000351790:p.Asn77Lys		Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N77K	ENST00000358913.5	37	c.231	CCDS7275.1	10	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329587	0.60743	.	.	ENSG00000138347	ENST00000358913;ENST00000540630;ENST00000373675	T;T;T	0.66099	0.22;0.19;-0.19	5.5	1.79	0.24919	.	0.095223	0.64402	D	0.000001	T	0.69387	0.3105	L	0.60455	1.87	0.34302	D	0.684524	D;D	0.71674	0.998;0.988	D;P	0.66351	0.943;0.681	T	0.73241	-0.4045	9	.	.	.	.	8.6948	0.34289	0.0:0.3932:0.0:0.6068	.	77;77	Q86TC9-3;Q86TC9	.;MYPN_HUMAN	K	77	ENSP00000351790:N77K;ENSP00000441668:N77K;ENSP00000362779:N77K	.	N	+	3	2	MYPN	69551432	0.996000	0.38824	0.998000	0.56505	0.970000	0.65996	0.338000	0.19858	0.138000	0.18790	0.533000	0.62120	AAT	MYPN	-	NULL	ENSG00000138347		0.478	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	-	0.00	61	0	T	NM_032578		69881426	+1	tier1	-	no_errors	ENST00000358913	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
NACAD	23148	genome.wustl.edu	37	7	45122736	45122736	+	Missense_Mutation	SNP	C	C	T	rs576670818	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:45122736C>T	ENST00000490531.2	-	2	3062	c.3043G>A	c.(3043-3045)Gca>Aca	p.A1015T		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	1015					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TCTTCCTGTGCGGCCCAAGGT	0.617																																																	0													18.0	17.0	17.0					7																	45122736		692	1591	2283	SO:0001583	missense	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.3043G>A	7.37:g.45122736C>T	ENSP00000420477:p.Ala1015Thr			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,pfscan_Nas_poly-pep-assoc_cplx_dom	p.A1015T	ENST00000490531.2	37	c.3043	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	C	4.365	0.067222	0.08388	.	.	ENSG00000136274	ENST00000490531	T	0.12255	2.7	3.38	-1.22	0.09494	.	11.292800	0.01419	N	0.014284	T	0.07413	0.0187	L	0.29908	0.895	0.09310	N	1	P	0.39665	0.682	B	0.20955	0.032	T	0.29366	-1.0014	10	0.26408	T	0.33	-0.0018	4.5443	0.12073	0.2635:0.2204:0.5162:0.0	.	1015	O15069	NACAD_HUMAN	T	1015	ENSP00000420477:A1015T	ENSP00000420477:A1015T	A	-	1	0	NACAD	45089261	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.005000	0.03674	-0.115000	0.11915	-0.558000	0.04189	GCA	NACAD	-	NULL	ENSG00000136274		0.617	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	-	0.00	33	0	C	NM_001146334		45122736	-1	tier1	-	no_errors	ENST00000490531	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.000	T
NAP1L3	4675	genome.wustl.edu	37	X	92926986	92926986	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:92926986A>G	ENST00000373079.3	-	1	1581	c.1318T>C	c.(1318-1320)Ttc>Ctc	p.F440L	FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.F433L|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	440					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						AAGAAGTTGAAGAATGATGCA	0.433																																																	0													78.0	61.0	67.0					X																	92926986		2203	4300	6503	SO:0001583	missense	0				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.1318T>C	X.37:g.92926986A>G	ENSP00000362171:p.Phe440Leu		B2RCM0|O60788	Missense_Mutation	SNP	pfam_NAP_family	p.F440L	ENST00000373079.3	37	c.1318	CCDS14465.1	X	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727301	0.69074	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.65732	-0.17	3.42	3.42	0.39159	.	0.000000	0.85682	D	0.000000	T	0.79913	0.4528	M	0.90252	3.1	0.40990	D	0.984849	D	0.57257	0.979	D	0.74023	0.982	T	0.83129	-0.0114	10	0.87932	D	0	.	9.462	0.38789	1.0:0.0:0.0:0.0	.	440	Q99457	NP1L3_HUMAN	L	440;433	ENSP00000362171:F440L	ENSP00000362171:F440L	F	-	1	0	NAP1L3	92813642	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	4.985000	0.63845	1.588000	0.49971	0.430000	0.28490	TTC	NAP1L3	-	pfam_NAP_family	ENSG00000186310		0.433	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	HGNC	protein_coding	OTTHUMT00000057449.1	-	0.00	34	0	A	NM_004538		92926986	-1	tier1	-	no_errors	ENST00000373079	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	G
NBEA	26960	genome.wustl.edu	37	13	35730247	35730248	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:35730247_35730248insA	ENST00000400445.3	+	20	3089_3090	c.2555_2556insA	c.(2554-2559)ttaaaafs	p.LK852fs	NBEA_ENST00000540320.1_Frame_Shift_Ins_p.LK852fs|NBEA_ENST00000379939.2_Frame_Shift_Ins_p.LK852fs|NBEA_ENST00000310336.4_Frame_Shift_Ins_p.LK852fs	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	852					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GCAACTTTGTTAAAAAACTCTA	0.322																																																	0																																										SO:0001589	frameshift_variant	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2561dupA	13.37:g.35730253_35730253dupA	ENSP00000383295:p.Leu852fs		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Frame_Shift_Ins	INS	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.N854fs	ENST00000400445.3	37	c.2555_2556	CCDS45026.1	13																																																																																			NBEA	-	superfamily_ARM-type_fold	ENSG00000172915		0.322	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding			0.00	51	0	0	NM_015678		35730248	+1			no_errors	ENST00000310336	ensembl	human	known	74_37	frame_shift_ins	8.24	78	7	INS	1.000:1.000	A
NCOA6	23054	genome.wustl.edu	37	20	33345744	33345744	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:33345744C>T	ENST00000374796.2	-	8	3377	c.807G>A	c.(805-807)caG>caA	p.Q269Q	NCOA6_ENST00000359003.2_Silent_p.Q269Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	269	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q269Q(15)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						gctgctgctgctgttgttgtt	0.537																																																	15	Substitution - coding silent(15)	lung(5)|prostate(4)|endometrium(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)											64.0	52.0	56.0					20																	33345744		2203	4300	6503	SO:0001819	synonymous_variant	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.807G>A	20.37:g.33345744C>T			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	NULL	p.Q269	ENST00000374796.2	37	c.807	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.537	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2		0.00	46	0	C	NM_014071		33345744	-1			no_errors	ENST00000359003	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.002	T
NELL2	4753	genome.wustl.edu	37	12	44913815	44913815	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:44913815G>T	ENST00000429094.2	-	19	2877	c.2373C>A	c.(2371-2373)ggC>ggA	p.G791G	NELL2_ENST00000551601.1_Silent_p.G743G|NELL2_ENST00000549027.1_Silent_p.G790G|NELL2_ENST00000395487.2_Silent_p.G790G|NELL2_ENST00000437801.2_Silent_p.G841G|NELL2_ENST00000333837.4_Silent_p.G814G|NELL2_ENST00000452445.2_Silent_p.G791G	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	791						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TACACTCAGTGCCATGTTTGA	0.483																																																	0													105.0	92.0	96.0					12																	44913815		2203	4300	6503	SO:0001819	synonymous_variant	0			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2373C>A	12.37:g.44913815G>T			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.G841	ENST00000429094.2	37	c.2523	CCDS8746.1	12																																																																																			NELL2	-	NULL	ENSG00000184613		0.483	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL2	HGNC	protein_coding	OTTHUMT00000404180.1	-	0.00	44	0	G	NM_006159		44913815	-1	tier1	-	no_errors	ENST00000437801	ensembl	human	known	74_37	silent	10.81	33	4	SNP	1.000	T
NMNAT2	23057	genome.wustl.edu	37	1	183221791	183221791	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:183221791G>T	ENST00000287713.6	-	11	1243	c.909C>A	c.(907-909)atC>atA	p.I303I	NMNAT2_ENST00000294868.4_Silent_p.I298I	NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	303					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						CGGAGGCATTGATGTACAGCT	0.577																																																	0													206.0	173.0	184.0					1																	183221791		2203	4300	6503	SO:0001819	synonymous_variant	0			AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.909C>A	1.37:g.183221791G>T			O75067|Q5T1Q3|Q8WU99|Q96QW1	Silent	SNP	pfam_Cyt_trans-like	p.I303	ENST00000287713.6	37	c.909	CCDS1353.1	1																																																																																			NMNAT2	-	NULL	ENSG00000157064		0.577	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT2	HGNC	protein_coding	OTTHUMT00000086255.1	-	0.00	69	0	G			183221791	-1	tier1	-	no_errors	ENST00000287713	ensembl	human	known	74_37	silent	5.80	64	4	SNP	1.000	T
NMNAT2	23057	genome.wustl.edu	37	1	183387334	183387334	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:183387334C>T	ENST00000287713.6	-	1	403	c.69G>A	c.(67-69)ggG>ggA	p.G23G		NM_015039.3	NP_055854.1	Q9BZQ4	NMNA2_HUMAN	nicotinamide nucleotide adenylyltransferase 2	23					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|late endosome (GO:0005770)|synapse (GO:0045202)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	18						TCTGAATGTGCCCTTTGGTGA	0.597																																																	0													248.0	207.0	221.0					1																	183387334		2203	4300	6503	SO:0001819	synonymous_variant	0			AF288395	CCDS1353.1, CCDS1354.1	1q25	2008-02-05	2003-04-30	2003-05-02	ENSG00000157064	ENSG00000157064			16789	protein-coding gene	gene with protein product		608701	"""chromosome 1 open reading frame 15"""	C1orf15		11318611, 12359228	Standard	NM_015039		Approved	KIAA0479, PNAT2	uc001gqc.2	Q9BZQ4	OTTHUMG00000035519	ENST00000287713.6:c.69G>A	1.37:g.183387334C>T			O75067|Q5T1Q3|Q8WU99|Q96QW1	Silent	SNP	pfam_Cyt_trans-like	p.G23	ENST00000287713.6	37	c.69	CCDS1353.1	1																																																																																			NMNAT2	-	pfam_Cyt_trans-like	ENSG00000157064		0.597	NMNAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT2	HGNC	protein_coding	OTTHUMT00000086255.1	-	0.00	44	0	C			183387334	-1	tier1	-	no_errors	ENST00000287713	ensembl	human	known	74_37	silent	17.78	37	8	SNP	0.999	T
NOM1	64434	genome.wustl.edu	37	7	156752836	156752836	+	Missense_Mutation	SNP	G	G	T	rs111976742	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:156752836G>T	ENST00000275820.3	+	4	1615	c.1600G>T	c.(1600-1602)Ggg>Tgg	p.G534W		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	534	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CAAAGCCAGCGGGGCAGGCAG	0.473																																																	0													67.0	75.0	72.0					7																	156752836		2203	4300	6503	SO:0001583	missense	0			AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.1600G>T	7.37:g.156752836G>T	ENSP00000275820:p.Gly534Trp		Q96I08	Missense_Mutation	SNP	pfam_Initiation_fac_eIF4g_MI,pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.G534W	ENST00000275820.3	37	c.1600	CCDS34787.1	7	.	.	.	.	.	.	.	.	.	.	G	9.867	1.197962	0.22037	.	.	ENSG00000146909	ENST00000275820	T	0.21932	1.98	4.93	3.13	0.36017	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.379059	0.28104	N	0.016598	T	0.40932	0.1137	M	0.61703	1.905	0.09310	N	1	D	0.61080	0.989	D	0.70487	0.969	T	0.21759	-1.0236	10	0.72032	D	0.01	-12.5735	12.3194	0.54977	0.1706:0.0:0.8294:0.0	.	534	Q5C9Z4	NOM1_HUMAN	W	534	ENSP00000275820:G534W	ENSP00000275820:G534W	G	+	1	0	NOM1	156445597	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.156000	0.16382	0.496000	0.27904	-1.247000	0.01520	GGG	NOM1	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000146909		0.473	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOM1	HGNC	protein_coding	OTTHUMT00000327098.1		0.00	70	0	G	NM_138400		156752836	+1			no_errors	ENST00000275820	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.013	T
NRP2	8828	genome.wustl.edu	37	2	206592644	206592644	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:206592644G>T	ENST00000357785.5	+	7	1051	c.1020G>T	c.(1018-1020)acG>acT	p.T340T	NRP2_ENST00000360409.3_Silent_p.T340T|NRP2_ENST00000357118.4_Silent_p.T340T|NRP2_ENST00000417189.1_Silent_p.T340T|NRP2_ENST00000355117.4_Silent_p.T340T|NRP2_ENST00000272849.3_Silent_p.T340T|NRP2_ENST00000412873.2_Silent_p.T340T|NRP2_ENST00000540841.1_Silent_p.T340T|NRP2_ENST00000540178.1_Silent_p.T340T			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.T340T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CCATGCTCACGGCCATCGCAA	0.502																																																	1	Substitution - coding silent(1)	ovary(1)											95.0	79.0	84.0					2																	206592644		2203	4300	6503	SO:0001819	synonymous_variant	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.1020G>T	2.37:g.206592644G>T			B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.T340	ENST00000357785.5	37	c.1020	CCDS46496.1	2																																																																																			NRP2	-	pirsf_Neuropilin,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000118257		0.502	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1		0.00	30	0	G			206592644	+1			no_errors	ENST00000360409	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.005	T
OPHN1	4983	genome.wustl.edu	37	X	67273604	67273604	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:67273604G>T	ENST00000355520.5	-	22	2848	c.2207C>A	c.(2206-2208)aCc>aAc	p.T736N	OPHN1_ENST00000540071.1_Missense_Mutation_p.T628N	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	736	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						GCGGATGATGGTTGGCTTTTC	0.557																																																	0													59.0	53.0	55.0					X																	67273604		2203	4300	6503	SO:0001583	missense	0			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.2207C>A	X.37:g.67273604G>T	ENSP00000347710:p.Thr736Asn		B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.T736N	ENST00000355520.5	37	c.2207	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162624	0.38217	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.55052	0.54;0.54	4.98	4.12	0.48240	.	0.594079	0.17776	N	0.162427	T	0.49830	0.1580	N	0.14661	0.345	0.09310	N	1	D;B	0.61697	0.99;0.396	D;B	0.68621	0.959;0.133	T	0.29912	-0.9996	10	0.38643	T	0.18	.	6.6911	0.23171	0.2121:0.0:0.7879:0.0	.	628;736	F5H2E3;O60890	.;OPHN1_HUMAN	N	736;628	ENSP00000347710:T736N;ENSP00000438617:T628N	ENSP00000347710:T736N	T	-	2	0	OPHN1	67190329	1.000000	0.71417	0.996000	0.52242	0.887000	0.51463	3.375000	0.52410	1.086000	0.41228	0.600000	0.82982	ACC	OPHN1	-	NULL	ENSG00000079482		0.557	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1		0.00	36	0	G	NM_002547		67273604	-1			no_errors	ENST00000355520	ensembl	human	known	74_37	missense	6.67	55	4	SNP	0.996	T
OR10H5	284433	genome.wustl.edu	37	19	15905096	15905096	+	Missense_Mutation	SNP	C	C	T	rs142693914		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:15905096C>T	ENST00000308940.8	+	1	336	c.238C>T	c.(238-240)Cgc>Tgc	p.R80C		NM_001004466.1	NP_001004466.1	Q8NGA6	O10H5_HUMAN	olfactory receptor, family 10, subfamily H, member 5	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(9)|ovary(1)	20						CATCATCCCGCGCATGCTGGC	0.617													.|||	1	0.000199681	0.0	0.0	5008	,	,		21792	0.0		0.001	False		,,,				2504	0.0																0								C	CYS/ARG	0,4406		0,0,2203	122.0	100.0	108.0		238	2.3	0.8	19	dbSNP_134	108	1,8599		0,1,4299	no	missense	OR10H5	NM_001004466.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	80/316	15905096	1,13005	2203	4300	6503	SO:0001583	missense	0			AC011537	CCDS32940.1	19p13.12	2013-09-24			ENSG00000172519	ENSG00000172519		"""GPCR / Class A : Olfactory receptors"""	15389	protein-coding gene	gene with protein product							Standard	NM_001004466		Approved		uc010xos.2	Q8NGA6	OTTHUMG00000182284	ENST00000308940.8:c.238C>T	19.37:g.15905096C>T	ENSP00000310704:p.Arg80Cys		Q6IFJ0|Q96R60	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R80C	ENST00000308940.8	37	c.238	CCDS32940.1	19	.	.	.	.	.	.	.	.	.	.	.	11.79	1.744090	0.30865	0.0	1.16E-4	ENSG00000172519	ENST00000308940	T	0.01685	4.69	3.47	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.158984	0.29266	N	0.012650	T	0.03695	0.0105	M	0.87328	2.875	0.09310	N	0.999999	B	0.25667	0.131	B	0.21151	0.033	T	0.17776	-1.0358	10	0.72032	D	0.01	.	7.7827	0.29074	0.4047:0.5953:0.0:0.0	.	80	Q8NGA6	O10H5_HUMAN	C	80	ENSP00000310704:R80C	ENSP00000310704:R80C	R	+	1	0	OR10H5	15766096	0.000000	0.05858	0.807000	0.32361	0.898000	0.52572	1.227000	0.32576	1.647000	0.50633	0.585000	0.79938	CGC	OR10H5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172519		0.617	OR10H5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H5	HGNC	protein_coding	OTTHUMT00000460363.1	-	0.00	73	0	C			15905096	+1	tier1	rs142693914	no_errors	ENST00000308940	ensembl	human	known	74_37	missense	15.07	62	11	SNP	0.079	T
OR2Y1	134083	genome.wustl.edu	37	5	180166493	180166493	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:180166493G>A	ENST00000307832.2	-	1	606	c.566C>T	c.(565-567)gCg>gTg	p.A189V		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTGTGTCCGCACAAGCCAA	0.507																																																	0													82.0	70.0	74.0					5																	180166493		2203	4300	6503	SO:0001583	missense	0			AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.566C>T	5.37:g.180166493G>A	ENSP00000312403:p.Ala189Val		B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A189V	ENST00000307832.2	37	c.566	CCDS34323.1	5	.	.	.	.	.	.	.	.	.	.	g	0.125	-1.120816	0.01785	.	.	ENSG00000174339	ENST00000307832	T	0.00137	8.68	4.41	-8.81	0.00813	GPCR, rhodopsin-like superfamily (1);	2.447600	0.01860	N	0.036546	T	0.00039	0.0001	N	0.02685	-0.53	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.45891	-0.9230	10	0.02654	T	1	.	1.5139	0.02502	0.3935:0.1488:0.3068:0.1509	.	189	Q8NGV0	OR2Y1_HUMAN	V	189	ENSP00000312403:A189V	ENSP00000312403:A189V	A	-	2	0	OR2Y1	180099099	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.460000	0.06720	-1.715000	0.01389	-1.294000	0.01345	GCG	OR2Y1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000174339		0.507	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Y1	HGNC	protein_coding	OTTHUMT00000368059.2		0.00	25	0	G	XM_068682		180166493	-1			no_errors	ENST00000307832	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.000	A
OR4C12	283093	genome.wustl.edu	37	11	50003816	50003816	+	Silent	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:50003816A>G	ENST00000335238.4	-	1	255	c.222T>C	c.(220-222)tcT>tcC	p.S74S		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						TAGGAGCTGAAGAAGAAGAAT	0.433																																																	0													71.0	74.0	73.0					11																	50003816		2201	4296	6497	SO:0001819	synonymous_variant	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.222T>C	11.37:g.50003816A>G			B2RNF0|Q6IF49	Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S74	ENST00000335238.4	37	c.222	CCDS31496.1	11																																																																																			OR4C12	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221954		0.433	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1	-	0.00	77	0	A	NM_001005270		50003816	-1	tier1	-	no_errors	ENST00000335238	ensembl	human	known	74_37	silent	23.75	61	19	SNP	0.000	G
OR4A16	81327	genome.wustl.edu	37	11	55111323	55111323	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:55111323G>T	ENST00000314721.2	+	1	697	c.647G>T	c.(646-648)tGt>tTt	p.C216F		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						CTAATCTCCTGTGGAGTCATC	0.438																																																	0													179.0	165.0	170.0					11																	55111323		2201	4296	6497	SO:0001583	missense	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.647G>T	11.37:g.55111323G>T	ENSP00000325128:p.Cys216Phe		Q6IFL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C216F	ENST00000314721.2	37	c.647	CCDS31499.1	11	.	.	.	.	.	.	.	.	.	.	a	0.574	-0.840116	0.02692	.	.	ENSG00000181961	ENST00000314721	T	0.00032	8.88	2.54	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00109	0.0003	N	0.14661	0.345	0.21220	N	0.999757	B	0.02656	0.0	B	0.09377	0.004	T	0.21042	-1.0257	9	0.87932	D	0	.	6.1964	0.20552	0.8606:0.0:0.1394:0.0	.	216	Q8NH70	O4A16_HUMAN	F	216	ENSP00000325128:C216F	ENSP00000325128:C216F	C	+	2	0	OR4A16	54867899	0.998000	0.40836	0.373000	0.26003	0.026000	0.11368	4.159000	0.58157	0.179000	0.19938	-1.286000	0.01371	TGT	OR4A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181961		0.438	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1		0.00	50	0	G	NM_001005274		55111323	+1			no_errors	ENST00000314721	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.637	T
OR52I2	143502	genome.wustl.edu	37	11	4608198	4608198	+	Silent	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:4608198T>G	ENST00000312614.4	+	1	178	c.156T>G	c.(154-156)tcT>tcG	p.S52S		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		GACTGCAATCTTCACATCTTT	0.493																																																	0													197.0	198.0	197.0					11																	4608198		2201	4296	6497	SO:0001819	synonymous_variant	0			BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.156T>G	11.37:g.4608198T>G			B2RNJ5|B9EKV8|Q6IFJ8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S52	ENST00000312614.4	37	c.156	CCDS31355.1	11																																																																																			OR52I2	-	NULL	ENSG00000226288		0.493	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52I2	HGNC	protein_coding	OTTHUMT00000385946.1	-	0.00	77	0	T	NM_001005170		4608198	+1	tier1	-	no_errors	ENST00000312614	ensembl	human	known	74_37	silent	20.75	42	11	SNP	0.078	G
OR51M1	390059	genome.wustl.edu	37	11	5411357	5411357	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:5411357A>C	ENST00000328611.3	+	1	751	c.729A>C	c.(727-729)caA>caC	p.Q243H	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	243					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGGCCTCCCAAGAGGAGCAGC	0.562																																																	0													116.0	111.0	113.0					11																	5411357		2069	4208	6277	SO:0001583	missense	0			BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.729A>C	11.37:g.5411357A>C	ENSP00000333196:p.Gln243His		Q6IF80	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q243H	ENST00000328611.3	37	c.729	CCDS53596.1	11	.	.	.	.	.	.	.	.	.	.	A	1.745	-0.490794	0.04322	.	.	ENSG00000184698	ENST00000328611	T	0.00137	8.68	5.24	-2.48	0.06423	GPCR, rhodopsin-like superfamily (1);	1.031050	0.07817	U	0.959210	T	0.00109	0.0003	L	0.35249	1.045	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.01945	-1.1242	10	0.27785	T	0.31	.	9.3094	0.37895	0.4568:0.1067:0.4365:0.0	.	232	Q9H341	O51M1_HUMAN	H	243	ENSP00000333196:Q243H	ENSP00000333196:Q243H	Q	+	3	2	OR51M1	5367933	0.000000	0.05858	0.015000	0.15790	0.010000	0.07245	-1.031000	0.03578	-0.652000	0.05408	-1.139000	0.01908	CAA	OR51M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000184698		0.562	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51M1	HGNC	protein_coding	OTTHUMT00000142981.1	-	0.00	47	0	A	NM_001004756		5411357	+1	tier1	-	no_errors	ENST00000328611	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.000	C
OR52N2	390077	genome.wustl.edu	37	11	5841919	5841919	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:5841919G>A	ENST00000317037.2	+	1	376	c.354G>A	c.(352-354)atG>atA	p.M118I	TRIM5_ENST00000380027.1_Intron	NM_001005174.1	NP_001005174.1	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N, member 2	118						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|urinary_tract(1)	32		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGTGCTCATGCTCATGGCCC	0.537																																																	0													158.0	129.0	139.0					11																	5841919		2201	4296	6497	SO:0001583	missense	0			AB065816	CCDS31399.1	11p15.4	2012-08-09			ENSG00000180988	ENSG00000180988		"""GPCR / Class A : Olfactory receptors"""	15228	protein-coding gene	gene with protein product							Standard	NM_001005174		Approved		uc010qzp.2	Q8NGI0	OTTHUMG00000168801	ENST00000317037.2:c.354G>A	11.37:g.5841919G>A	ENSP00000322801:p.Met118Ile		Q6IFF9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M118I	ENST00000317037.2	37	c.354	CCDS31399.1	11	.	.	.	.	.	.	.	.	.	.	G	12.70	2.016194	0.35606	.	.	ENSG00000180988	ENST00000317037	T	0.36157	1.27	5.91	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.074200	0.56097	N	0.000021	T	0.31575	0.0801	L	0.28694	0.88	0.29248	N	0.872179	B	0.06786	0.001	B	0.12837	0.008	T	0.20240	-1.0281	10	0.72032	D	0.01	.	16.9473	0.86232	0.0684:0.0:0.9316:0.0	.	118	Q8NGI0	O52N2_HUMAN	I	118	ENSP00000322801:M118I	ENSP00000322801:M118I	M	+	3	0	OR52N2	5798495	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	3.143000	0.50608	0.853000	0.35312	-0.797000	0.03246	ATG	OR52N2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000180988		0.537	OR52N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N2	HGNC	protein_coding	OTTHUMT00000401143.1		0.00	49	0	G	NM_001005174		5841919	+1			no_errors	ENST00000317037	ensembl	human	known	74_37	missense	6.67	27	2	SNP	1.000	A
OR4C6	219432	genome.wustl.edu	37	11	55432669	55432669	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:55432669A>C	ENST00000314259.3	+	1	56	c.27A>C	c.(25-27)gaA>gaC	p.E9D		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						ATGTGACTGAATTCATTCTTC	0.368																																																	0													111.0	105.0	107.0					11																	55432669		2200	4296	6496	SO:0001583	missense	0			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.27A>C	11.37:g.55432669A>C	ENSP00000324769:p.Glu9Asp		B2RP11|Q6IFD2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E9D	ENST00000314259.3	37	c.27	CCDS31506.1	11	.	.	.	.	.	.	.	.	.	.	A	8.253	0.809440	0.16537	.	.	ENSG00000181903	ENST00000314259	T	0.00566	6.55	3.83	-0.887	0.10587	.	0.589948	0.14075	N	0.343150	T	0.00637	0.0021	M	0.73319	2.225	0.22127	N	0.999347	B	0.20164	0.042	B	0.26614	0.071	T	0.44544	-0.9321	10	0.62326	D	0.03	.	2.9909	0.05982	0.5389:0.0:0.281:0.1802	.	9	Q8NH72	OR4C6_HUMAN	D	9	ENSP00000324769:E9D	ENSP00000324769:E9D	E	+	3	2	OR4C6	55189245	0.000000	0.05858	0.978000	0.43139	0.074000	0.17049	-2.016000	0.01446	-0.545000	0.06224	-0.565000	0.04167	GAA	OR4C6	-	NULL	ENSG00000181903		0.368	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C6	HGNC	protein_coding	OTTHUMT00000391504.1	-	0.00	31	0	A	NM_001004704		55432669	+1	tier1	-	no_errors	ENST00000314259	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.975	C
OR5W2	390148	genome.wustl.edu	37	11	55681987	55681987	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:55681987T>G	ENST00000344514.1	-	1	71	c.72A>C	c.(70-72)aaA>aaC	p.K24N		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATAGGGTCACTTTCATCTCTG	0.353																																					Melanoma(48;171 1190 15239 43886 49348)												0													57.0	59.0	59.0					11																	55681987		2201	4296	6497	SO:0001583	missense	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.72A>C	11.37:g.55681987T>G	ENSP00000342448:p.Lys24Asn			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K24N	ENST00000344514.1	37	c.72	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	T	11.64	1.699023	0.30142	.	.	ENSG00000187612	ENST00000344514	T	0.00446	7.39	5.01	-3.89	0.04193	.	0.175040	0.27340	N	0.019811	T	0.00210	0.0006	L	0.31065	0.9	0.09310	N	1	B	0.18310	0.027	B	0.24394	0.053	T	0.47886	-0.9082	10	0.62326	D	0.03	.	4.1875	0.10405	0.3379:0.3134:0.0:0.3487	.	24	Q8NH69	OR5W2_HUMAN	N	24	ENSP00000342448:K24N	ENSP00000342448:K24N	K	-	3	2	OR5W2	55438563	.	.	0.001000	0.08648	0.046000	0.14306	.	.	-0.322000	0.08615	-0.548000	0.04221	AAA	OR5W2	-	NULL	ENSG00000187612		0.353	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	-	0.00	58	0	T	NM_001001960		55681987	-1	tier1	-	no_errors	ENST00000344514	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.000	G
OR8K5	219453	genome.wustl.edu	37	11	55927568	55927568	+	Missense_Mutation	SNP	C	C	A	rs374506844		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:55927568C>A	ENST00000313447.1	-	1	225	c.226G>T	c.(226-228)Gtc>Ttc	p.V76F		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				GGACAAATGACAGTAGAATTA	0.378																																																	0													107.0	106.0	106.0					11																	55927568		2201	4296	6497	SO:0001583	missense	0			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.226G>T	11.37:g.55927568C>A	ENSP00000323853:p.Val76Phe		Q6IFB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V76F	ENST00000313447.1	37	c.226	CCDS31521.1	11	.	.	.	.	.	.	.	.	.	.	C	15.68	2.903887	0.52333	.	.	ENSG00000181752	ENST00000313447	T	0.00558	6.61	3.88	3.88	0.44766	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01353	0.0044	M	0.70787	2.145	0.09310	N	1	D	0.56746	0.977	P	0.55011	0.766	T	0.48269	-0.9050	9	0.87932	D	0	.	10.3217	0.43769	0.0:0.8976:0.0:0.1024	.	76	Q8NH50	OR8K5_HUMAN	F	76	ENSP00000323853:V76F	ENSP00000323853:V76F	V	-	1	0	OR8K5	55684144	0.000000	0.05858	0.448000	0.26945	0.979000	0.70002	-1.368000	0.02580	2.155000	0.67459	0.567000	0.79289	GTC	OR8K5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181752		0.378	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	HGNC	protein_coding	OTTHUMT00000391543.1	-	0.00	43	0	C	NM_001004058		55927568	-1	tier1	-	no_errors	ENST00000313447	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.002	A
OR8H1	219469	genome.wustl.edu	37	11	56058343	56058343	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:56058343A>C	ENST00000313022.2	-	1	223	c.196T>G	c.(196-198)Ttg>Gtg	p.L66V		NM_001005199.1	NP_001005199.1	Q8NGG4	OR8H1_HUMAN	olfactory receptor, family 8, subfamily H, member 1	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Esophageal squamous(21;0.00448)					ATAAATGACAAGTGAGTAAGG	0.423																																																	0													267.0	255.0	259.0					11																	56058343		2201	4296	6497	SO:0001583	missense	0			AB065836	CCDS31526.1	11q11	2012-08-09			ENSG00000181693	ENSG00000181693		"""GPCR / Class A : Olfactory receptors"""	14824	protein-coding gene	gene with protein product							Standard	NM_001005199		Approved		uc010rje.2	Q8NGG4	OTTHUMG00000162671	ENST00000313022.2:c.196T>G	11.37:g.56058343A>C	ENSP00000323595:p.Leu66Val		B2RNI7|Q6IFC5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L66V	ENST00000313022.2	37	c.196	CCDS31526.1	11	.	.	.	.	.	.	.	.	.	.	A	9.522	1.108576	0.20714	.	.	ENSG00000181693	ENST00000313022;ENST00000395186	T	0.00587	6.38	3.94	0.989	0.19802	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41194	D	0.000937	T	0.03651	0.0104	H	0.96080	3.765	0.09310	N	1	D	0.76494	0.999	D	0.74023	0.982	T	0.11641	-1.0579	10	0.87932	D	0	.	8.0796	0.30737	0.4414:0.0:0.5586:0.0	.	66	Q8NGG4	OR8H1_HUMAN	V	66;62	ENSP00000323595:L66V	ENSP00000323595:L66V	L	-	1	2	OR8H1	55814919	0.008000	0.16893	0.013000	0.15412	0.002000	0.02628	0.136000	0.15974	0.092000	0.17331	-0.245000	0.11935	TTG	OR8H1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181693		0.423	OR8H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H1	HGNC	protein_coding	OTTHUMT00000370019.1	-	0.00	81	0	A	NM_001005199		56058343	-1	tier1	-	no_errors	ENST00000313022	ensembl	human	known	74_37	missense	20.63	50	13	SNP	0.046	C
OSBPL3	26031	genome.wustl.edu	37	7	24874153	24874153	+	Missense_Mutation	SNP	G	G	T	rs540420021		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:24874153G>T	ENST00000313367.2	-	15	2149	c.1698C>A	c.(1696-1698)agC>agA	p.S566R	OSBPL3_ENST00000409069.1_Missense_Mutation_p.S499R|OSBPL3_ENST00000396431.1_Missense_Mutation_p.S535R|OSBPL3_ENST00000353930.1_Missense_Mutation_p.S530R|OSBPL3_ENST00000431825.2_Missense_Mutation_p.S499R|OSBPL3_ENST00000352860.1_Missense_Mutation_p.S535R|OSBPL3_ENST00000396429.1_Missense_Mutation_p.S530R	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	566					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.S566S(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CCAGGAGCTCGCTGTACTCCA	0.637																																																	1	Substitution - coding silent(1)	endometrium(1)											72.0	68.0	69.0					7																	24874153		2203	4300	6503	SO:0001583	missense	0			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.1698C>A	7.37:g.24874153G>T	ENSP00000315410:p.Ser566Arg		A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S566R	ENST00000313367.2	37	c.1698	CCDS5390.1	7	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161326	0.78226	.	.	ENSG00000070882	ENST00000313367;ENST00000352860;ENST00000353930;ENST00000431825;ENST00000396431;ENST00000396429;ENST00000409069	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.85	-2.76	0.05896	.	0.037652	0.85682	D	0.000000	T	0.54886	0.1886	M	0.87827	2.91	0.58432	D	0.999993	D;D;D;D;P;D	0.89917	1.0;1.0;0.999;1.0;0.885;1.0	D;D;D;D;P;D	0.91635	0.999;0.995;0.986;0.991;0.66;0.995	T	0.61342	-0.7082	10	0.87932	D	0	-15.8911	13.0483	0.58939	0.5309:0.0:0.4691:0.0	.	499;530;499;535;530;566	Q9H4L5-8;Q9H4L5-7;Q9H4L5-4;Q9H4L5-2;Q9H4L5-3;Q9H4L5	.;.;.;.;.;OSBL3_HUMAN	R	566;535;530;499;535;530;499	ENSP00000315410:S566R;ENSP00000315331:S535R;ENSP00000315277:S530R;ENSP00000389779:S499R;ENSP00000379708:S535R;ENSP00000379706:S530R;ENSP00000386953:S499R	ENSP00000315410:S566R	S	-	3	2	OSBPL3	24840678	0.988000	0.35896	0.958000	0.39756	0.976000	0.68499	0.188000	0.17018	-0.601000	0.05783	0.467000	0.42956	AGC	OSBPL3	-	pfam_Oxysterol-bd	ENSG00000070882		0.637	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2		0.00	49	0	G			24874153	-1			no_errors	ENST00000313367	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.989	T
PAQR5	54852	genome.wustl.edu	37	15	69652441	69652441	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:69652441A>G	ENST00000340965.3	+	3	690	c.22A>G	c.(22-24)Agg>Ggg	p.R8G	PAQR5_ENST00000395407.2_Missense_Mutation_p.R8G|PAQR5_ENST00000561027.1_3'UTR|PAQR5_ENST00000561153.1_Missense_Mutation_p.R8G	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	8					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						GAAGCTCCCCAGGCTGTTTAG	0.547																																																	0													134.0	120.0	125.0					15																	69652441		2200	4298	6498	SO:0001583	missense	0				CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.22A>G	15.37:g.69652441A>G	ENSP00000343877:p.Arg8Gly		Q8IXU2	Missense_Mutation	SNP	pfam_HlyIII-related	p.R8G	ENST00000340965.3	37	c.22	CCDS10232.1	15	.	.	.	.	.	.	.	.	.	.	A	13.91	2.377831	0.42105	.	.	ENSG00000137819	ENST00000395407;ENST00000340965	T;T	0.26518	1.73;1.73	5.02	3.9	0.45041	.	0.114785	0.64402	D	0.000011	T	0.20618	0.0496	L	0.43598	1.365	0.37085	D	0.899168	B	0.27380	0.177	B	0.27076	0.076	T	0.10683	-1.0619	10	0.33940	T	0.23	-6.4697	8.73	0.34494	0.7917:0.2083:0.0:0.0	.	8	Q9NXK6	MPRG_HUMAN	G	8	ENSP00000378803:R8G;ENSP00000343877:R8G	ENSP00000343877:R8G	R	+	1	2	PAQR5	67439495	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	1.581000	0.36558	0.937000	0.37394	0.459000	0.35465	AGG	PAQR5	-	NULL	ENSG00000137819		0.547	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR5	HGNC	protein_coding	OTTHUMT00000416671.1	-	0.00	33	0	A	NM_017705		69652441	+1	tier1	-	no_errors	ENST00000340965	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	G
PARD3B	117583	genome.wustl.edu	37	2	206036969	206036969	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:206036969C>T	ENST00000406610.2	+	12	1862	c.1655C>T	c.(1654-1656)gCa>gTa	p.A552V	PARD3B_ENST00000462231.1_Missense_Mutation_p.A552V|PARD3B_ENST00000349953.3_Missense_Mutation_p.A552V|PARD3B_ENST00000358768.2_Missense_Mutation_p.A490V|PARD3B_ENST00000351153.1_Missense_Mutation_p.A552V	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	552	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)		p.A491V(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CAGCTGATTGCAGTTAATGGG	0.453																																																	1	Substitution - Missense(1)	large_intestine(1)											134.0	125.0	128.0					2																	206036969		1920	4139	6059	SO:0001583	missense	0			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.1655C>T	2.37:g.206036969C>T	ENSP00000385848:p.Ala552Val		E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A552V	ENST00000406610.2	37	c.1655		2	.	.	.	.	.	.	.	.	.	.	C	33	5.236530	0.95240	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.30182	1.54;2.1;1.54;1.54	5.65	5.65	0.86999	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.56292	0.1975	M	0.64260	1.97	0.58432	D	0.999997	D;D;D;D;D	0.89917	0.999;1.0;0.988;1.0;1.0	D;D;D;D;D	0.97110	0.988;0.999;0.943;0.999;1.0	T	0.56226	-0.8014	10	0.72032	D	0.01	.	19.733	0.96192	0.0:1.0:0.0:0.0	.	552;552;552;490;552	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	V	552;490;552;552	ENSP00000385848:A552V;ENSP00000351618:A490V;ENSP00000317261:A552V;ENSP00000340280:A552V	ENSP00000340280:A552V	A	+	2	0	PARD3B	205745214	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.717000	0.68446	2.665000	0.90641	0.585000	0.79938	GCA	PARD3B	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000116117		0.453	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	HGNC	protein_coding	OTTHUMT00000335992.1		0.00	68	0	C	NM_057177		206036969	+1			no_errors	ENST00000406610	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
PDE4D	5144	genome.wustl.edu	37	5	59783742	59783743	+	Intron	INS	-	-	A	rs398084152|rs201437010|rs397997931|rs3214934	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:59783742_59783743insA	ENST00000502484.2	-	1	135				PART1_ENST00000504876.2_lincRNA	NM_001165899.1	NP_001159371.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific						adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TTACTGAGCTTAAAAAAAAAAT	0.366																																																	0																																										SO:0001627	intron_variant	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000502484.2:c.88+25->T	5.37:g.59783752_59783752dupA			O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	RNA	INS	-	NULL	ENST00000502484.2	37	NULL	CCDS54859.1	5																																																																																			PART1	-	-	ENSG00000152931		0.366	PDE4D-003	KNOWN	basic|CCDS	protein_coding	PART1	HGNC	protein_coding	OTTHUMT00000368094.3		0.00	21	0	-			59783743	+1	tier1		no_errors	ENST00000515734	ensembl	human	known	74_37	rna	16.00	21	4	INS	0.001:0.033	A
PAXIP1	22976	genome.wustl.edu	37	7	154760609	154760611	+	In_Frame_Del	DEL	CTG	CTG	-	rs151102688		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:154760609_154760611delCTG	ENST00000404141.1	-	7	1454_1456	c.1300_1302delCAG	c.(1300-1302)cagdel	p.Q434del	PAXIP1_ENST00000397192.1_In_Frame_Del_p.Q434del|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	434	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GCTGAGAGATctgctgctgctgc	0.591																																																	0										67,3215		7,53,1581						-1.6	0.0		dbSNP_134	18	123,6147		12,99,3024	no	coding	PAXIP1	NM_007349.3		19,152,4605	A1A1,A1R,RR		1.9617,2.0414,1.9891				190,9362				SO:0001651	inframe_deletion	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1300_1302delCAG	7.37:g.154760618_154760620delCTG	ENSP00000384048:p.Gln434del		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	In_Frame_Del	DEL	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q434in_frame_del	ENST00000404141.1	37	c.1302_1300	CCDS47753.1	7																																																																																			PAXIP1	-	NULL	ENSG00000157212		0.591	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	31	0	CTG	NM_007349		154760611	-1	tier1		no_errors	ENST00000397192	ensembl	human	known	74_37	in_frame_del	12.20	36	5	DEL	0.998:0.998:0.999	-
PCDHA5	56143	genome.wustl.edu	37	5	140203227	140203227	+	Missense_Mutation	SNP	G	G	A	rs138093911		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:140203227G>A	ENST00000529859.1	+	1	1867	c.1867G>A	c.(1867-1869)Gtg>Atg	p.V623M	PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529619.1_Missense_Mutation_p.V623M|PCDHA5_ENST00000378126.3_Missense_Mutation_p.V623M|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	623	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCGTTCCGCGTGGGGCTGTA	0.642																																																	0								G	,,,,MET/VAL,,MET/VAL	0,4406		0,0,2203	76.0	79.0	78.0		,,,,1867,,1867	3.0	1.0	5	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,intron,intron,missense,intron,missense	PCDHA5,PCDHA4,PCDHA3,PCDHA2,PCDHA1	NM_018900.2,NM_018905.2,NM_018906.2,NM_018907.2,NM_018908.2,NM_031411.1,NM_031501.1	,,,,21,,21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,	,,,,623/937,,623/817	140203227	1,13005	2203	4300	6503	SO:0001583	missense	0			AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1867G>A	5.37:g.140203227G>A	ENSP00000436557:p.Val623Met		O75284|Q8N4R3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V623M	ENST00000529859.1	37	c.1867	CCDS54917.1	5	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280338	0.40294	0.0	1.16E-4	ENSG00000204965	ENST00000529619;ENST00000529859;ENST00000378126	T;T;T	0.59502	0.26;0.26;0.26	3.87	2.97	0.34412	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72875	0.3515	M	0.79123	2.44	0.24027	N	0.996123	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71870	0.975;0.958;0.973	T	0.59820	-0.7382	9	0.87932	D	0	.	9.4131	0.38505	0.1023:0.0:0.8977:0.0	.	623;623;623	Q9Y5H7;Q9Y5H7-3;Q9Y5H7-2	PCDA5_HUMAN;.;.	M	623	ENSP00000433416:V623M;ENSP00000436557:V623M;ENSP00000367366:V623M	ENSP00000367366:V623M	V	+	1	0	PCDHA5	140183411	0.315000	0.24571	1.000000	0.80357	0.815000	0.46073	0.653000	0.24902	1.887000	0.54652	0.306000	0.20318	GTG	PCDHA5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204965		0.642	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	HGNC	protein_coding	OTTHUMT00000372883.2	-	0.00	136	0	G	NM_018908		140203227	+1	tier1	rs138093911	no_errors	ENST00000529859	ensembl	human	known	74_37	missense	13.11	105	16	SNP	1.000	A
PCDHB6	56130	genome.wustl.edu	37	5	140530327	140530327	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:140530327C>A	ENST00000231136.1	+	1	489	c.489C>A	c.(487-489)agC>agA	p.S163R	PCDHB6_ENST00000543635.1_Missense_Mutation_p.S27R	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACACCGGCAGCAACGGCCTTC	0.498																																																	0													152.0	162.0	159.0					5																	140530327		2203	4300	6503	SO:0001583	missense	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.489C>A	5.37:g.140530327C>A	ENSP00000231136:p.Ser163Arg		B2R8R9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S163R	ENST00000231136.1	37	c.489	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	C	3.620	-0.077699	0.07184	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.51817	0.69;0.69	4.7	2.85	0.33270	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.37489	0.1005	L	0.35793	1.09	0.24520	N	0.99417	B	0.30664	0.289	B	0.40477	0.33	T	0.35549	-0.9784	9	0.20046	T	0.44	.	2.7049	0.05159	0.1512:0.5425:0.1464:0.16	.	163	Q9Y5E3	PCDB6_HUMAN	R	27;163	ENSP00000438466:S27R;ENSP00000231136:S163R	ENSP00000231136:S163R	S	+	3	2	PCDHB6	140510511	0.000000	0.05858	0.996000	0.52242	0.746000	0.42486	-3.140000	0.00586	0.476000	0.27440	0.561000	0.74099	AGC	PCDHB6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113211		0.498	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	-	0.00	34	0	C	NM_018939		140530327	+1	tier1	-	no_errors	ENST00000231136	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.958	A
PCM1	5108	genome.wustl.edu	37	8	17868164	17868164	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:17868164A>G	ENST00000519253.1	+	32	5434	c.5183A>G	c.(5182-5184)gAt>gGt	p.D1728G	PCM1_ENST00000325083.8_Missense_Mutation_p.D1736G|PCM1_ENST00000327578.8_Missense_Mutation_p.D435G|PCM1_ENST00000524226.1_Missense_Mutation_p.D1682G			Q15154	PCM1_HUMAN	pericentriolar material 1	1736	Interaction with HAP1.				centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		GGAGAGATTGATGATGAAGAC	0.418			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																			Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0													120.0	116.0	117.0					8																	17868164		1868	4105	5973	SO:0001583	missense	0				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.5183A>G	8.37:g.17868164A>G	ENSP00000431099:p.Asp1728Gly		Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	NULL	p.D1736G	ENST00000519253.1	37	c.5207		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.05|17.05	3.290494|3.290494	0.59976|0.59976	.|.	.|.	ENSG00000078674|ENSG00000078674	ENST00000325083;ENST00000519253;ENST00000524226;ENST00000327578|ENST00000522275	T;T;T;T|.	0.18338|.	3.58;3.58;3.36;2.22|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.147481|.	0.64402|.	D|.	0.000012|.	T|T	0.58977|0.58977	0.2160|0.2160	L|L	0.46157|0.46157	1.445|1.445	0.37220|0.37220	D|D	0.905192|0.905192	D;D;D;D;D;D;D|.	0.71674|.	0.998;0.998;0.998;0.998;0.988;0.983;0.998|.	D;D;D;D;P;D;D|.	0.78314|.	0.991;0.991;0.991;0.991;0.786;0.919;0.991|.	T|T	0.62562|0.62562	-0.6828|-0.6828	10|5	0.15499|.	T|.	0.54|.	-14.961|-14.961	11.5513|11.5513	0.50723|0.50723	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1728;1736;535;1728;1681;1682;1736|.	B9EIS5;D3DSQ0;B4DJ00;E7ETA6;Q15154-2;E7EV56;Q15154|.	.;.;.;.;.;.;PCM1_HUMAN|.	G|V	1736;1728;1682;435|476	ENSP00000327077:D1736G;ENSP00000431099:D1728G;ENSP00000430521:D1682G;ENSP00000328332:D435G|.	ENSP00000327077:D1736G|.	D|M	+|+	2|1	0|0	PCM1|PCM1	17912444|17912444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.865000|0.865000	0.49528|0.49528	3.478000|3.478000	0.53158|0.53158	2.045000|2.045000	0.60652|0.60652	0.459000|0.459000	0.35465|0.35465	GAT|ATG	PCM1	-	NULL	ENSG00000078674		0.418	PCM1-003	NOVEL	basic|exp_conf	protein_coding	PCM1	HGNC	protein_coding	OTTHUMT00000374800.1	-	0.00	50	0	A	NM_006197		17868164	+1	tier1	-	no_errors	ENST00000325083	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	G
PCSK9	255738	genome.wustl.edu	37	1	55523165	55523165	+	Silent	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:55523165A>G	ENST00000302118.5	+	7	1448	c.1158A>G	c.(1156-1158)tcA>tcG	p.S386S	PCSK9_ENST00000490692.1_3'UTR|PCSK9_ENST00000543384.1_Silent_p.S186S	NM_174936.3	NP_777596.2	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	386	Peptidase S8.				apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|kidney development (GO:0001822)|lipoprotein metabolic process (GO:0042157)|liver development (GO:0001889)|low-density lipoprotein particle receptor catabolic process (GO:0032802)|lysosomal transport (GO:0007041)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|negative regulation of receptor recycling (GO:0001920)|neurogenesis (GO:0022008)|neuron differentiation (GO:0030182)|phospholipid metabolic process (GO:0006644)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of receptor internalization (GO:0002092)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)|regulation of neuron apoptotic process (GO:0043523)|regulation of receptor activity (GO:0010469)|triglyceride metabolic process (GO:0006641)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|extracellular space (GO:0005615)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	apolipoprotein binding (GO:0034185)|apolipoprotein receptor binding (GO:0034190)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein particle receptor binding (GO:0050750)|poly(A) RNA binding (GO:0044822)|protein self-association (GO:0043621)|serine-type endopeptidase activity (GO:0004252)|sodium channel inhibitor activity (GO:0019871)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(1)|liver(2)|lung(4)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	32						GTGGGACATCACAGGCTGCTG	0.622																																					Pancreas(137;1454 1827 5886 22361 42375)												0													54.0	44.0	48.0					1																	55523165		2203	4300	6503	SO:0001819	synonymous_variant	0			AX207686	CCDS603.1	1p34.1-p32	2014-09-17	2003-05-13		ENSG00000169174	ENSG00000169174			20001	protein-coding gene	gene with protein product		607786	"""hypercholesterolemia, autosomal dominant 3"""	HCHOLA3		12552133, 12730697	Standard	NM_174936		Approved	NARC-1, FH3	uc001cyf.2	Q8NBP7	OTTHUMG00000008136	ENST00000302118.5:c.1158A>G	1.37:g.55523165A>G			A8T640|C0JYY9|Q5PSM5|Q5SZQ2	Silent	SNP	pfam_Peptidase_S8/S53_dom,pfam_Inhibitor_I9,superfamily_Peptidase_S8/S53_dom,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.S386	ENST00000302118.5	37	c.1158	CCDS603.1	1																																																																																			PCSK9	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom,prints_Peptidase_S8_subtilisin-rel	ENSG00000169174		0.622	PCSK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK9	HGNC	protein_coding	OTTHUMT00000022280.1	-	0.00	41	0	A	NM_174936		55523165	+1	tier1	-	no_errors	ENST00000302118	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.040	G
PDHA2	5161	genome.wustl.edu	37	4	96762002	96762002	+	Missense_Mutation	SNP	C	C	T	rs201115909		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:96762002C>T	ENST00000295266.4	+	1	764	c.701C>T	c.(700-702)gCa>gTa	p.A234V		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	234					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		ACTGAGAGAGCAGCAGCCAGC	0.433																																																	0													105.0	109.0	108.0					4																	96762002		2203	4300	6503	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.701C>T	4.37:g.96762002C>T	ENSP00000295266:p.Ala234Val		B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.A234V	ENST00000295266.4	37	c.701	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	C	20.3	3.971996	0.74246	.	.	ENSG00000163114	ENST00000295266	D	0.96200	-3.94	4.91	4.91	0.64330	Dehydrogenase, E1 component (1);	0.112950	0.64402	D	0.000014	D	0.96558	0.8877	L	0.54908	1.71	0.80722	D	1	D	0.69078	0.997	D	0.65010	0.931	D	0.96785	0.9578	10	0.87932	D	0	-20.0456	16.0034	0.80327	0.0:1.0:0.0:0.0	.	234	P29803	ODPAT_HUMAN	V	234	ENSP00000295266:A234V	ENSP00000295266:A234V	A	+	2	0	PDHA2	96981025	1.000000	0.71417	0.299000	0.25016	0.549000	0.35272	7.036000	0.76524	2.733000	0.93635	0.467000	0.42956	GCA	PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000163114		0.433	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	-	0.00	64	0	C			96762002	+1	tier1	rs201115909	no_errors	ENST00000295266	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.999	T
PDZRN4	29951	genome.wustl.edu	37	12	41585273	41585273	+	Missense_Mutation	SNP	A	A	C	rs542974500		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:41585273A>C	ENST00000402685.2	+	2	670	c.662A>C	c.(661-663)aAg>aCg	p.K221T		NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	221							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GGAGAGCATAAGCCATTCACT	0.299																																																	0													103.0	95.0	98.0					12																	41585273		1568	3578	5146	SO:0001583	missense	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.662A>C	12.37:g.41585273A>C	ENSP00000384197:p.Lys221Thr		Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.K221T	ENST00000402685.2	37	c.662	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	A	11.26	1.586112	0.28268	.	.	ENSG00000165966	ENST00000402685	T	0.52057	0.68	4.48	3.28	0.37604	PDZ/DHR/GLGF (1);	.	.	.	.	T	0.34424	0.0897	L	0.46157	1.445	0.80722	D	1	P	0.38195	0.622	B	0.34346	0.18	T	0.05920	-1.0856	9	0.14656	T	0.56	.	9.3988	0.38420	0.8407:0.0:0.0:0.1593	.	221	Q6ZMN7	PZRN4_HUMAN	T	221	ENSP00000384197:K221T	ENSP00000384197:K221T	K	+	2	0	PDZRN4	39871540	0.996000	0.38824	0.622000	0.29159	0.059000	0.15707	5.712000	0.68407	0.771000	0.33359	0.460000	0.39030	AAG	PDZRN4	-	superfamily_PDZ	ENSG00000165966		0.299	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	-	0.00	31	0	A	NM_013377		41585273	+1	tier1	-	no_errors	ENST00000402685	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.969	C
PGGT1B	5229	genome.wustl.edu	37	5	114557680	114557680	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:114557680G>T	ENST00000419445.1	-	7	704	c.684C>A	c.(682-684)gcC>gcA	p.A228A	PGGT1B_ENST00000514178.1_5'UTR|PGGT1B_ENST00000379615.3_Intron	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	228					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		GACATAGTGAGGCAATGCCAC	0.343																																																	0													90.0	86.0	87.0					5																	114557680		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.684C>A	5.37:g.114557680G>T			Q5MJP9	Silent	SNP	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	p.A228	ENST00000419445.1	37	c.684	CCDS4116.1	5																																																																																			PGGT1B	-	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000164219		0.343	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGGT1B	HGNC	protein_coding	OTTHUMT00000250855.2	-	0.00	54	0	G	NM_005023		114557680	-1	tier1	-	no_errors	ENST00000419445	ensembl	human	known	74_37	silent	8.57	32	3	SNP	0.891	T
PIK3R5	23533	genome.wustl.edu	37	17	8791758	8791758	+	Missense_Mutation	SNP	G	G	A	rs368972251		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:8791758G>A	ENST00000447110.1	-	10	1470	c.1346C>T	c.(1345-1347)aCg>aTg	p.T449M	PIK3R5_ENST00000584803.1_Missense_Mutation_p.T449M|PIK3R5_ENST00000581552.1_Missense_Mutation_p.T449M	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	449					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						GGGCAGGGCCGTGTCCGAGCT	0.672																																					NSCLC(18;589 615 7696 20311 50332)												0													8.0	10.0	9.0					17																	8791758		2167	4270	6437	SO:0001583	missense	0			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1346C>T	17.37:g.8791758G>A	ENSP00000392812:p.Thr449Met		B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	pfam_PI3K_1B_gamma_p101_su	p.T449M	ENST00000447110.1	37	c.1346	CCDS11147.1	17	.	.	.	.	.	.	.	.	.	.	G	4.319	0.058629	0.08339	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.77489	-1.1	4.59	1.43	0.22495	.	1.666930	0.02848	N	0.128764	T	0.59756	0.2217	N	0.14661	0.345	0.09310	N	1	P	0.40282	0.711	B	0.31442	0.13	T	0.55392	-0.8148	10	0.46703	T	0.11	1.032	6.2308	0.20734	0.1729:0.1598:0.6673:0.0	.	449	Q8WYR1	PI3R5_HUMAN	M	449	ENSP00000392812:T449M	ENSP00000269300:T449M	T	-	2	0	PIK3R5	8732483	0.000000	0.05858	0.001000	0.08648	0.529000	0.34654	0.117000	0.15583	0.177000	0.19895	0.484000	0.47621	ACG	PIK3R5	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000141506		0.672	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIK3R5	HGNC	protein_coding	OTTHUMT00000227003.2	-	0.00	66	0	G	NM_014308		8791758	-1	tier1	-	no_errors	ENST00000447110	ensembl	human	known	74_37	missense	17.07	34	7	SNP	0.001	A
PKD2	5311	genome.wustl.edu	37	4	88929174	88929176	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:88929174_88929176delGAG	ENST00000237596.2	+	1	355_357	c.289_291delGAG	c.(289-291)gagdel	p.E102del		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CTTCGAGGCCgaggaggaggagg	0.739																																																	0										18,82,2250		6,0,6,18,46,1099						-3.4	0.9			2	8,117,4707		2,0,4,14,89,2307	no	codingComplex	PKD2	NM_000297.3		8,0,10,32,135,3406	A1A1,A1A2,A1R,A2A2,A2R,RR		2.5869,4.2553,3.1328				26,199,6957				SO:0001651	inframe_deletion	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.289_291delGAG	4.37:g.88929183_88929185delGAG	ENSP00000237596:p.Glu102del		Q8TB08|Q9P0T6|Q9Y3X8	In_Frame_Del	DEL	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.E100in_frame_del	ENST00000237596.2	37	c.289_291	CCDS3627.1	4																																																																																			PKD2	-	NULL	ENSG00000118762		0.739	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4		0.00	33	0	GAG	NM_000297		88929176	+1	tier1		no_errors	ENST00000237596	ensembl	human	known	74_37	in_frame_del	15.38	22	4	DEL	1.000:1.000:1.000	-
PKDREJ	10343	genome.wustl.edu	37	22	46656747	46656747	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:46656747G>T	ENST00000253255.5	-	1	2472	c.2473C>A	c.(2473-2475)Caa>Aaa	p.Q825K		NM_006071.1	NP_006062.1	Q9NTG1	PKDRE_HUMAN	polycystin (PKD) family receptor for egg jelly	825	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				acrosome reaction (GO:0007340)|calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|neuropeptide signaling pathway (GO:0007218)|regulation of acrosome reaction (GO:0060046)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			NS(2)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(4)|kidney(5)|large_intestine(21)|lung(16)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	73		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		TTAACTACTTGGTGAGGAGAA	0.358																																																	0													62.0	66.0	64.0					22																	46656747		2203	4300	6503	SO:0001583	missense	0			AF116458	CCDS14073.1	22q13.31	2013-07-31	2013-07-31		ENSG00000130943	ENSG00000130943			9015	protein-coding gene	gene with protein product		604670	"""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly, sea urchin homolog)-like"", ""polycystic kidney disease (polycystin) and REJ (sperm receptor for egg jelly homolog, sea urchin)-like"", ""polycystic kidney disease (polycystin) and REJ homolog (sperm receptor for egg jelly homolog, sea urchin)"""			9949214, 10591208	Standard	NM_006071		Approved		uc003bhh.3	Q9NTG1	OTTHUMG00000150493	ENST00000253255.5:c.2473C>A	22.37:g.46656747G>T	ENSP00000253255:p.Gln825Lys		B1AJY3|O95850	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_Ion_trans_dom,superfamily_Lipase_LipOase,smart_GPS_dom,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,prints_PKD_2	p.Q825K	ENST00000253255.5	37	c.2473	CCDS14073.1	22	.	.	.	.	.	.	.	.	.	.	G	2.416	-0.334296	0.05278	.	.	ENSG00000130943	ENST00000253255	T	0.34859	1.34	5.18	-9.94	0.00449	Egg jelly receptor, REJ-like (1);	2.023630	0.02215	N	0.063540	T	0.16514	0.0397	N	0.16478	0.41	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.07849	-1.0751	10	0.23302	T	0.38	0.2856	3.8952	0.09136	0.0885:0.176:0.4038:0.3317	.	825	Q9NTG1	PKDRE_HUMAN	K	825	ENSP00000253255:Q825K	ENSP00000253255:Q825K	Q	-	1	0	PKDREJ	45035411	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.037000	0.01420	-1.948000	0.01033	-0.397000	0.06425	CAA	PKDREJ	-	pfscan_REJ-like	ENSG00000130943		0.358	PKDREJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDREJ	HGNC	protein_coding	OTTHUMT00000318466.1		0.00	60	0	G	NM_006071		46656747	-1			no_errors	ENST00000253255	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.000	T
PLEKHA7	144100	genome.wustl.edu	37	11	16877392	16877392	+	Silent	SNP	C	C	T	rs145257579		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:16877392C>T	ENST00000355661.3	-	5	385	c.375G>A	c.(373-375)acG>acA	p.T125T	PLEKHA7_ENST00000532079.1_Intron|PLEKHA7_ENST00000531066.1_Silent_p.T125T|PLEKHA7_ENST00000448080.2_Silent_p.T125T			Q6IQ23	PKHA7_HUMAN	pleckstrin homology domain containing, family A member 7	125					epithelial cell-cell adhesion (GO:0090136)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|zonula adherens (GO:0005915)	delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	37						CGGTCCCAGCCGTGGATGTTT	0.542													C|||	1	0.000199681	0.0	0.0	5008	,	,		18434	0.0		0.0	False		,,,				2504	0.001																0								C		0,4400		0,0,2200	184.0	177.0	179.0		375	-9.8	0.4	11	dbSNP_134	179	5,8583	4.3+/-15.6	0,5,4289	no	coding-synonymous	PLEKHA7	NM_175058.4		0,5,6489	TT,TC,CC		0.0582,0.0,0.0385		125/1122	16877392	5,12983	2200	4294	6494	SO:0001819	synonymous_variant	0			BC033239	CCDS31434.1	11p15	2013-01-10			ENSG00000166689	ENSG00000166689		"""Pleckstrin homology (PH) domain containing"""	27049	protein-coding gene	gene with protein product		612686				12477932	Standard	NM_175058		Approved	DKFZp686M22243	uc001mmo.3	Q6IQ23	OTTHUMG00000165954	ENST00000355661.3:c.375G>A	11.37:g.16877392C>T			B4DK33|B4DWC3|Q86VZ7	Silent	SNP	pfam_Pleckstrin_homology,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_dom	p.T125	ENST00000355661.3	37	c.375	CCDS31434.1	11																																																																																			PLEKHA7	-	NULL	ENSG00000166689		0.542	PLEKHA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA7	HGNC	protein_coding	OTTHUMT00000387242.2	-	0.00	51	0	C	NM_175058		16877392	-1	tier1	rs145257579	no_errors	ENST00000448080	ensembl	human	known	74_37	silent	22.50	31	9	SNP	0.029	T
PLEKHB2	55041	genome.wustl.edu	37	2	131904337	131904337	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:131904337G>T	ENST00000403716.1	+	8	1220	c.660G>T	c.(658-660)tgG>tgT	p.W220C	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000439822.2_3'UTR|PLEKHB2_ENST00000538982.1_Missense_Mutation_p.W172C|PLEKHB2_ENST00000409279.1_Missense_Mutation_p.W220C|PLEKHB2_ENST00000234115.6_Missense_Mutation_p.W219C|PLEKHB2_ENST00000409612.1_Missense_Mutation_p.W220C|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000409158.1_Missense_Mutation_p.W228C|PLEKHB2_ENST00000438882.2_3'UTR	NM_001100623.1|NM_001267062.1|NM_001267063.1|NM_001267064.1|NM_001267065.1|NM_001267066.1|NM_017958.2	NP_001094093.1|NP_001253991.1|NP_001253992.1|NP_001253993.1|NP_001253994.1|NP_001253995.1|NP_060428.2	Q96CS7	PKHB2_HUMAN	pleckstrin homology domain containing, family B (evectins) member 2	220						endosome (GO:0005768)|membrane (GO:0016020)				large_intestine(1)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.0828)		CTCTATTTTGGGTCTTCTAGG	0.493																																																	0													125.0	128.0	127.0					2																	131904337		2203	4300	6503	SO:0001583	missense	0				CCDS2166.1, CCDS46413.1, CCDS58729.1, CCDS58730.1, CCDS74576.1, CCDS74577.1	2q22.1	2013-01-10			ENSG00000115762	ENSG00000115762		"""Pleckstrin homology (PH) domain containing"""	19236	protein-coding gene	gene with protein product						10200314	Standard	NM_017958		Approved	EVT2, FLJ20783	uc031rpd.1	Q96CS7	OTTHUMG00000131656	ENST00000403716.1:c.660G>T	2.37:g.131904337G>T	ENSP00000385892:p.Trp220Cys		B4DF08|B4DZ66|B8ZZN1|Q53FF1|Q53TH7|Q86W37|Q9BV75|Q9NWK1	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.W220C	ENST00000403716.1	37	c.660	CCDS46413.1	2	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633466	0.67015	.	.	ENSG00000115762	ENST00000409158;ENST00000403716;ENST00000234115;ENST00000538982;ENST00000409612;ENST00000409279	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	T	0.79540	0.4463	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.997;0.997	T	0.81172	-0.1054	8	0.72032	D	0.01	.	17.1543	0.86785	0.0:0.0:1.0:0.0	.	219;219;220;228	Q53FF1;Q96CS7-3;Q96CS7;B8ZZN1	.;.;PKHB2_HUMAN;.	C	228;220;219;172;220;220	.	ENSP00000234115:W219C	W	+	3	0	PLEKHB2	131620807	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.357000	0.59436	2.654000	0.90174	0.644000	0.83932	TGG	PLEKHB2	-	NULL	ENSG00000115762		0.493	PLEKHB2-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHB2	HGNC	protein_coding	OTTHUMT00000331304.2	-	0.00	68	0	G	NM_017958		131904337	+1	tier1	-	no_errors	ENST00000403716	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
PLXNA2	5362	genome.wustl.edu	37	1	208217905	208217905	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:208217905C>T	ENST00000367033.3	-	20	4579	c.3822G>A	c.(3820-3822)ctG>ctA	p.L1274L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1274					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TCTGCATTTGCAGCCGCTTGA	0.562																																																	0													109.0	86.0	93.0					1																	208217905		2203	4300	6503	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3822G>A	1.37:g.208217905C>T			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L1274	ENST00000367033.3	37	c.3822	CCDS31013.1	1																																																																																			PLXNA2	-	NULL	ENSG00000076356		0.562	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	46	0	C	NM_025179		208217905	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.988	T
POSTN	10631	genome.wustl.edu	37	13	38151912	38151912	+	Silent	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:38151912T>C	ENST00000379747.4	-	16	2103	c.1986A>G	c.(1984-1986)aaA>aaG	p.K662K	POSTN_ENST00000379749.4_Silent_p.K662K|POSTN_ENST00000379742.4_Silent_p.K662K|POSTN_ENST00000541179.1_Silent_p.K662K|POSTN_ENST00000541481.1_Silent_p.K662K|POSTN_ENST00000379743.4_Silent_p.K662K	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	662					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CGGGGATTTCTTTGAAGGTGC	0.328																																																	0													53.0	60.0	57.0					13																	38151912		2203	4297	6500	SO:0001819	synonymous_variant	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1986A>G	13.37:g.38151912T>C			B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.K662	ENST00000379747.4	37	c.1986	CCDS9364.1	13																																																																																			POSTN	-	pirsf_TGFb-ind_bIGH3/osteoblast_fac2	ENSG00000133110		0.328	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	-	0.00	135	0	T	NM_006475		38151912	-1	tier1	-	no_errors	ENST00000379747	ensembl	human	known	74_37	silent	14.46	71	12	SNP	1.000	C
POTEH	23784	genome.wustl.edu	37	22	16279279	16279279	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:16279279A>C	ENST00000343518.6	-	4	995	c.944T>G	c.(943-945)cTt>cGt	p.L315R	POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	315										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						ATGTACACCAAGTAACAGTGG	0.318																																																	0																																										SO:0001583	missense	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.944T>G	22.37:g.16279279A>C	ENSP00000340610:p.Leu315Arg		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L315R	ENST00000343518.6	37	c.944	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	11.79	1.742389	0.30865	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.56275	0.47	1.38	1.38	0.22167	Ankyrin repeat-containing domain (3);	0.279276	0.18784	U	0.131260	T	0.60090	0.2242	L	0.54965	1.715	0.09310	N	0.999992	D;D	0.89917	0.997;1.0	D;D	0.91635	0.989;0.999	T	0.42344	-0.9457	10	0.45353	T	0.12	.	4.9438	0.13978	1.0:0.0:0.0:0.0	.	315;278	Q6S545;A6NKF6	POTEH_HUMAN;.	R	278;315	ENSP00000340610:L315R	ENSP00000340610:L315R	L	-	2	0	POTEH	14659279	0.737000	0.28175	0.294000	0.24946	0.068000	0.16541	3.904000	0.56325	0.890000	0.36211	0.147000	0.16070	CTT	POTEH	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000198062		0.318	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	763	0	A	NM_001136213		16279279	-1	tier1	-	no_errors	ENST00000343518	ensembl	human	known	74_37	missense	6.39	601	41	SNP	0.103	C
PPP1R15A	23645	genome.wustl.edu	37	19	49379107	49379107	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:49379107G>T	ENST00000200453.5	+	3	2171	c.1902G>T	c.(1900-1902)ttG>ttT	p.L634F		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	634					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		CCCAGACCTTGCCTTCCTCCT	0.682																																																	0													150.0	152.0	151.0					19																	49379107		2203	4300	6503	SO:0001583	missense	0			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1902G>T	19.37:g.49379107G>T	ENSP00000200453:p.Leu634Phe		B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	pfam_Prot_Pase1_reg-su15A/B_C	p.L634F	ENST00000200453.5	37	c.1902	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090359	0.36855	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.06768	3.26	4.5	-1.85	0.07784	.	0.589252	0.12910	N	0.429007	T	0.05135	0.0137	N	0.14661	0.345	0.09310	N	1	P	0.50943	0.94	B	0.44133	0.442	T	0.40646	-0.9552	10	0.38643	T	0.18	2.9866	8.6415	0.33981	0.403:0.0:0.597:0.0	.	634	O75807	PR15A_HUMAN	F	634;474;592	ENSP00000200453:L634F	ENSP00000200453:L634F	L	+	3	2	PPP1R15A	54070919	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.208000	0.17415	-0.307000	0.08804	-0.136000	0.14681	TTG	PPP1R15A	-	NULL	ENSG00000087074		0.682	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	HGNC	protein_coding	OTTHUMT00000466226.1	-	0.00	48	0	G	NM_014330		49379107	+1	tier1	-	no_errors	ENST00000200453	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.000	T
PPP1R21	129285	genome.wustl.edu	37	2	48737157	48737157	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:48737157C>T	ENST00000294952.8	+	20	2246	c.2089C>T	c.(2089-2091)Cga>Tga	p.R697*	PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000449090.2_Nonsense_Mutation_p.R655*|PPP1R21_ENST00000281394.4_Nonsense_Mutation_p.R686*	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	697						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						TTTACAGTGCCGAGCACTGTC	0.408																																																	0													62.0	61.0	61.0					2																	48737157		2203	4300	6503	SO:0001587	stop_gained	0			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2089C>T	2.37:g.48737157C>T	ENSP00000294952:p.Arg697*		B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Nonsense_Mutation	SNP	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin-like_SF	p.R697*	ENST00000294952.8	37	c.2089	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.727864	0.98456	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.56	3.71	0.42584	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-8.2918	14.5875	0.68339	0.2667:0.7333:0.0:0.0	.	.	.	.	X	686;697;655	.	ENSP00000281394:R686X	R	+	1	2	KLRAQ1	48590661	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.960000	0.70348	0.665000	0.31066	-0.169000	0.13324	CGA	PPP1R21	-	pfam_KLRAQ/TTKRSYEDQ_C	ENSG00000162869		0.408	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	HGNC	protein_coding	OTTHUMT00000251238.4	-	0.00	32	0	C	NM_152994		48737157	+1	tier1	-	no_errors	ENST00000294952	ensembl	human	known	74_37	nonsense	14.71	29	5	SNP	1.000	T
PPP1R9A	55607	genome.wustl.edu	37	7	94881072	94881072	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:94881072A>C	ENST00000433881.1	+	10	2862		c.e10-1		PPP1R9A_ENST00000289495.5_Splice_Site|PPP1R9A_ENST00000433360.1_Splice_Site|PPP1R9A_ENST00000340694.4_Splice_Site|PPP1R9A_ENST00000456331.2_Splice_Site|PPP1R9A_ENST00000424654.1_Splice_Site			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			TTTCTTCTTAAGAGAGCTTGA	0.343										HNSCC(28;0.073)																																							0													37.0	39.0	38.0					7																	94881072		2203	4300	6503	SO:0001630	splice_region_variant	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.2331-1A>C	7.37:g.94881072A>C			A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Splice_Site	SNP	-	e9-2	ENST00000433881.1	37	c.2331-2	CCDS34683.1	7	.	.	.	.	.	.	.	.	.	.	A	11.58	1.679967	0.29783	.	.	ENSG00000158528	ENST00000433360;ENST00000340694;ENST00000424654;ENST00000433881;ENST00000289495;ENST00000456331	.	.	.	5.05	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7705	0.46319	0.9254:0.0:0.0746:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPP1R9A	94719008	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	7.973000	0.88032	0.888000	0.36160	0.454000	0.30748	.	PPP1R9A	-	-	ENSG00000158528		0.343	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	-	0.00	62	0	A	NM_001166160	Intron	94881072	+1	tier1	-	no_errors	ENST00000289495	ensembl	human	known	74_37	splice_site	25.00	45	15	SNP	1.000	C
PRF1	5551	genome.wustl.edu	37	10	72358125	72358125	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:72358125C>T	ENST00000441259.1	-	3	1512	c.1352G>A	c.(1351-1353)aGc>aAc	p.S451N	PRF1_ENST00000373209.2_Missense_Mutation_p.S451N	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	451	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CCACACGGTGCTCGTCCTCAG	0.602			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																														yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0													70.0	72.0	71.0					10																	72358125		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1352G>A	10.37:g.72358125C>T	ENSP00000398568:p.Ser451Asn		B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	pfam_MACPF,pfam_C2_dom,superfamily_C2_dom,smart_MACPF,smart_C2_dom,pfscan_C2_dom	p.S451N	ENST00000441259.1	37	c.1352	CCDS7305.1	10	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.613245	0.00835	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	T;T	0.69926	-0.44;-0.44	5.6	-11.2	0.00127	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	2.439520	0.01049	N	0.004423	T	0.54351	0.1853	L	0.42487	1.325	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.39921	-0.9590	10	0.16896	T	0.51	-0.0934	14.4199	0.67175	0.0:0.5661:0.2285:0.2053	.	451	P14222	PERF_HUMAN	N	451	ENSP00000362305:S451N;ENSP00000398568:S451N	ENSP00000316746:S451N	S	-	2	0	PRF1	72028131	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.675000	0.00105	-3.078000	0.00251	-1.264000	0.01445	AGC	PRF1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000180644		0.602	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRF1	HGNC	protein_coding	OTTHUMT00000048517.2	-	0.00	52	0	C	NM_005041		72358125	-1	tier1	-	no_errors	ENST00000373209	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.000	T
PRIM2	5558	genome.wustl.edu	37	6	57512786	57512787	+	3'UTR	INS	-	-	GC	rs555766381|rs373452397|rs386701662		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:57512786_57512787insGC	ENST00000389488.2	+	0	1701_1702				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gttgcactctgttgtgtaattg	0.426																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1699->GC	6.37:g.57512786_57512787insGC			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.426	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3		0.00	35	0	-	NM_000947		57512787	+1	tier1		no_errors	ENST00000389488	ensembl	human	known	74_37	rna	15.79	16	3	INS	0.067:0.057	GC
PROKR1	10887	genome.wustl.edu	37	2	68882627	68882627	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:68882627C>T	ENST00000303786.3	+	3	1521	c.1101C>T	c.(1099-1101)ggC>ggT	p.G367G	PROKR1_ENST00000394342.2_Silent_p.G367G			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	367					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						CTTACAATGGCGGTAAGTCCA	0.493																																																	0													83.0	74.0	77.0					2																	68882627		2203	4300	6503	SO:0001819	synonymous_variant	0			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.1101C>T	2.37:g.68882627C>T			A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.G367	ENST00000303786.3	37	c.1101	CCDS1889.1	2																																																																																			PROKR1	-	NULL	ENSG00000169618		0.493	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR1	HGNC	protein_coding	OTTHUMT00000251760.2		0.00	25	0	C			68882627	+1			no_errors	ENST00000303786	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.014	T
PROKR2	128674	genome.wustl.edu	37	20	5294744	5294744	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:5294744A>T	ENST00000217270.3	-	1	271	c.272T>A	c.(271-273)cTc>cAc	p.L91H	PROKR2_ENST00000546004.1_Missense_Mutation_p.L91H	NM_144773.2	NP_658986.1	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	91					circadian rhythm (GO:0007623)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(3)|lung(22)|ovary(5)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	53						GTTGGCAATGAGCAGATTGGT	0.562										HNSCC(71;0.22)																																							0													191.0	148.0	162.0					20																	5294744		2203	4300	6503	SO:0001583	missense	0			AL121755	CCDS13089.1	20p12.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000101292	ENSG00000101292		"""GPCR / Class A : Prokineticin receptors"""	15836	protein-coding gene	gene with protein product		607123	"""G protein-coupled receptor 73-like 1"", ""Kallmann syndrome 3 (autosomal dominant)"""	GPR73L1, KAL3		11886876, 17054399	Standard	NM_144773		Approved	GPR73b, PKR2, GPRg2, dJ680N4.3	uc010zqw.2	Q8NFJ6	OTTHUMG00000031800	ENST00000217270.3:c.272T>A	20.37:g.5294744A>T	ENSP00000217270:p.Leu91His		A5JUU1|Q2M3C0|Q5TDY1|Q9NTT0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.L91H	ENST00000217270.3	37	c.272	CCDS13089.1	20	.	.	.	.	.	.	.	.	.	.	A	20.4	3.987515	0.74589	.	.	ENSG00000101292	ENST00000546004;ENST00000217270	T;T	0.75260	-0.92;-0.92	5.32	5.32	0.75619	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.89473	0.6725	H	0.94264	3.515	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.92109	0.5694	10	0.87932	D	0	.	13.5109	0.61511	1.0:0.0:0.0:0.0	.	91	Q8NFJ6	PKR2_HUMAN	H	91	ENSP00000440790:L91H;ENSP00000217270:L91H	ENSP00000217270:L91H	L	-	2	0	PROKR2	5242744	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.223000	0.78033	2.130000	0.65690	0.533000	0.62120	CTC	PROKR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	ENSG00000101292		0.562	PROKR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR2	HGNC	protein_coding	OTTHUMT00000077854.1	-	0.00	79	0	A	NM_144773		5294744	-1	tier1	-	no_errors	ENST00000217270	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
PSD2	84249	genome.wustl.edu	37	5	139219650	139219650	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:139219650G>T	ENST00000274710.3	+	14	2212	c.2007G>T	c.(2005-2007)caG>caT	p.Q669H		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	669					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTGAGGCAGCTGACTGCGG	0.552																																																	0													104.0	95.0	98.0					5																	139219650		2203	4300	6503	SO:0001583	missense	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.2007G>T	5.37:g.139219650G>T	ENSP00000274710:p.Gln669His		D3DQD3|Q8N3J8	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.Q669H	ENST00000274710.3	37	c.2007	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	G	16.13	3.035500	0.54896	.	.	ENSG00000146005	ENST00000274710	T	0.12984	2.63	4.95	3.15	0.36227	.	0.000000	0.85682	D	0.000000	T	0.13884	0.0336	L	0.60845	1.875	0.48696	D	0.999698	B	0.27882	0.192	B	0.30646	0.118	T	0.04840	-1.0923	10	0.51188	T	0.08	.	5.8332	0.18593	0.2303:0.139:0.6307:0.0	.	669	Q9BQI7	PSD2_HUMAN	H	669	ENSP00000274710:Q669H	ENSP00000274710:Q669H	Q	+	3	2	PSD2	139199834	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	3.868000	0.56055	0.599000	0.29845	0.561000	0.74099	CAG	PSD2	-	NULL	ENSG00000146005		0.552	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	-	0.00	39	0	G	NM_032289		139219650	+1	tier1	-	no_errors	ENST00000274710	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
PTBP3	9991	genome.wustl.edu	37	9	115038236	115038236	+	Missense_Mutation	SNP	C	C	T	rs375648210		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:115038236C>T	ENST00000374255.2	-	4	323	c.176G>A	c.(175-177)cGt>cAt	p.R59H	PTBP3_ENST00000334318.6_Missense_Mutation_p.R62H|PTBP3_ENST00000374257.1_Missense_Mutation_p.R31H|PTBP3_ENST00000487997.1_Intron|PTBP3_ENST00000458258.1_Missense_Mutation_p.R65H|PTBP3_ENST00000343327.2_Intron			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	59	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ATGGAGAACACGGGAAGGCGA	0.353																																																	0								C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	119.0	112.0	114.0		92,185,176	5.5	1.0	9		114	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ROD1	NM_001163788.1,NM_001163790.1,NM_005156.5	29,29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	31/525,62/556,59/553	115038236	1,13005	2203	4300	6503	SO:0001583	missense	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.176G>A	9.37:g.115038236C>T	ENSP00000363373:p.Arg59His		B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.R65H	ENST00000374255.2	37	c.194	CCDS6784.1	9	.	.	.	.	.	.	.	.	.	.	C	35	5.540424	0.96474	0.0	1.16E-4	ENSG00000119314	ENST00000374257;ENST00000334318;ENST00000458258;ENST00000374255;ENST00000210227;ENST00000450374	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	5.51	5.51	0.81932	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.056577	0.64402	D	0.000001	D	0.90947	0.7154	M	0.91717	3.235	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	P;D;D;D;D	0.76575	0.879;0.969;0.982;0.953;0.988	D	0.92585	0.6078	10	0.87932	D	0	-5.7149	19.3944	0.94601	0.0:1.0:0.0:0.0	.	31;31;62;59;65	B1ALY5;O95758-2;O95758-5;O95758;O95758-4	.;.;.;ROD1_HUMAN;.	H	31;62;65;59;65;62	ENSP00000363375:R31H;ENSP00000334499:R62H;ENSP00000414921:R65H;ENSP00000363373:R59H;ENSP00000210227:R65H	ENSP00000210227:R65H	R	-	2	0	ROD1	114078057	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.757000	0.68766	2.574000	0.86865	0.591000	0.81541	CGT	PTBP3	-	pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000119314		0.353	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	-	0.00	100	0	C			115038236	-1	tier1	-	no_errors	ENST00000458258	ensembl	human	known	74_37	missense	5.31	107	6	SNP	1.000	T
PTPN13	5783	genome.wustl.edu	37	4	87687596	87687596	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:87687596C>T	ENST00000411767.2	+	27	4318	c.4255C>T	c.(4255-4257)Cta>Tta	p.L1419L	PTPN13_ENST00000436978.1_Silent_p.L1424L|PTPN13_ENST00000427191.2_Silent_p.L1400L|PTPN13_ENST00000511467.1_Silent_p.L1424L|PTPN13_ENST00000316707.6_Silent_p.L1228L			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1419	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.		L -> P. {ECO:0000269|PubMed:12436199}.		peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TGATCGCGTCCTAGCTGTCAA	0.363																																																	0													122.0	109.0	113.0					4																	87687596		1879	4106	5985	SO:0001819	synonymous_variant	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4255C>T	4.37:g.87687596C>T			B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L1424	ENST00000411767.2	37	c.4270	CCDS47094.1	4																																																																																			PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000163629		0.363	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	50	0	C			87687596	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	T
PURG	29942	genome.wustl.edu	37	8	30890164	30890164	+	Silent	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:30890164T>A	ENST00000475541.1	-	1	1067	c.135A>T	c.(133-135)tcA>tcT	p.S45S	WRN_ENST00000298139.5_5'Flank|PURG_ENST00000339382.2_Silent_p.S45S	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	45						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		TAGGGGTGGCTGAGGCCGCGT	0.607																																																	0													21.0	23.0	22.0					8																	30890164		2202	4300	6502	SO:0001819	synonymous_variant	0			AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.135A>T	8.37:g.30890164T>A			Q8TE64	Silent	SNP	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	p.S45	ENST00000475541.1	37	c.135	CCDS6081.1	8																																																																																			PURG	-	NULL	ENSG00000172733		0.607	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PURG	HGNC	protein_coding	OTTHUMT00000348565.1		0.00	49	0	T	NM_013357		30890164	-1			no_errors	ENST00000475541	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.327	A
RAB4B	53916	genome.wustl.edu	37	19	41289869	41289869	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:41289869C>T	ENST00000594800.1	+	5	479	c.319C>T	c.(319-321)Cgc>Tgc	p.R107C	RAB4B_ENST00000357052.2_Missense_Mutation_p.R107C|RAB4B-EGLN2_ENST00000594136.1_Missense_Mutation_p.R107C|RAB4B-EGLN2_ENST00000601949.1_Intron|RAB4B_ENST00000602069.1_3'UTR|MIA-RAB4B_ENST00000600729.1_3'UTR			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	107					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GACGGATGCCCGCACCCTGGC	0.627																																																	0													43.0	40.0	41.0					19																	41289869		2203	4300	6503	SO:0001583	missense	0			AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.319C>T	19.37:g.41289869C>T	ENSP00000470246:p.Arg107Cys		P22750|Q7Z514|Q9HBR6	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R107C	ENST00000594800.1	37	c.319	CCDS33030.1	19	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181616	0.57800	.	.	ENSG00000167578	ENST00000357052	T	0.80566	-1.39	4.88	2.67	0.31697	Small GTP-binding protein domain (1);	0.000000	0.64402	U	0.000001	D	0.87366	0.6159	M	0.72576	2.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.964;0.992	D	0.86968	0.2096	10	0.87932	D	0	.	11.7554	0.51872	0.4622:0.5378:0.0:0.0	.	142;107	P61018-2;P61018	.;RAB4B_HUMAN	C	107	ENSP00000349560:R107C	ENSP00000349560:R107C	R	+	1	0	RAB4B	45981709	0.736000	0.28164	0.723000	0.30687	0.805000	0.45488	1.410000	0.34691	0.431000	0.26258	0.478000	0.44815	CGC	RAB4B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000167578		0.627	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4B	HGNC	protein_coding	OTTHUMT00000463168.1	-	0.00	93	0	C	NM_016154		41289869	+1	tier1	-	no_errors	ENST00000357052	ensembl	human	known	74_37	missense	26.09	51	18	SNP	1.000	T
RAD51AP2	729475	genome.wustl.edu	37	2	17697366	17697366	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:17697366T>C	ENST00000399080.2	-	1	2340	c.2317A>G	c.(2317-2319)Aag>Gag	p.K773E		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	773										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TTACTGATCTTATTATGTCCC	0.338																																																	0													106.0	99.0	101.0					2																	17697366		1857	4105	5962	SO:0001583	missense	0			AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2317A>G	2.37:g.17697366T>C	ENSP00000382030:p.Lys773Glu			Missense_Mutation	SNP	NULL	p.K773E	ENST00000399080.2	37	c.2317	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	T	5.352	0.250193	0.10130	.	.	ENSG00000214842	ENST00000399080	T	0.24723	1.84	4.49	2.0	0.26442	.	.	.	.	.	T	0.13415	0.0325	L	0.27053	0.805	0.09310	N	1	B	0.27882	0.192	B	0.23018	0.043	T	0.33343	-0.9872	9	0.11794	T	0.64	0.7246	5.2362	0.15448	0.0:0.1811:0.2468:0.572	.	773	Q09MP3	R51A2_HUMAN	E	773	ENSP00000382030:K773E	ENSP00000382030:K773E	K	-	1	0	RAD51AP2	17560847	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	0.160000	0.16462	0.295000	0.22570	0.533000	0.62120	AAG	RAD51AP2	-	NULL	ENSG00000214842		0.338	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	HGNC	protein_coding	OTTHUMT00000323801.3	-	0.00	68	0	T	NM_001099218		17697366	-1	tier1	-	no_errors	ENST00000399080	ensembl	human	known	74_37	missense	19.23	42	10	SNP	0.000	C
RASAL2	9462	genome.wustl.edu	37	1	178269224	178269224	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:178269224A>G	ENST00000367649.3	+	3	780	c.428A>G	c.(427-429)gAg>gGg	p.E143G	RASAL2_ENST00000448150.3_Missense_Mutation_p.E125G			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CAGTTTCCCGAGTACCCACCA	0.478											OREG0014010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													67.0	69.0	68.0					1																	178269224		2203	4300	6503	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.428A>G	1.37:g.178269224A>G	ENSP00000356621:p.Glu143Gly	1945	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.E143G	ENST00000367649.3	37	c.428	CCDS1321.2	1	.	.	.	.	.	.	.	.	.	.	A	17.87	3.495391	0.64186	.	.	ENSG00000075391	ENST00000448150;ENST00000367649	T;T	0.23348	1.95;1.91	5.61	5.61	0.85477	.	0.186754	0.43416	D	0.000577	T	0.15739	0.0379	N	0.14661	0.345	0.44469	D	0.9974	P	0.37330	0.59	B	0.30646	0.118	T	0.05818	-1.0862	10	0.56958	D	0.05	.	15.0834	0.72133	1.0:0.0:0.0:0.0	.	143	F8W755	.	G	125;143	ENSP00000407768:E125G;ENSP00000356621:E143G	ENSP00000356621:E143G	E	+	2	0	RASAL2	176535847	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	6.629000	0.74267	2.254000	0.74563	0.533000	0.62120	GAG	RASAL2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000075391		0.478	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000352415.1	-	0.00	57	0	A	NM_170692		178269224	+1	tier1	-	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.999	G
RASGRF1	5923	genome.wustl.edu	37	15	79341902	79341902	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:79341902C>T	ENST00000419573.3	-	4	834	c.560G>A	c.(559-561)cGc>cAc	p.R187H	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.R187H	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	187					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGACTGGATGCGCTCATTGTC	0.572																																																	0													126.0	99.0	108.0					15																	79341902		2196	4293	6489	SO:0001583	missense	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.560G>A	15.37:g.79341902C>T	ENSP00000405963:p.Arg187His		F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R187H	ENST00000419573.3	37	c.560	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837281	0.91117	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.40476	1.03	5.15	5.15	0.70609	.	0.673907	0.14360	N	0.324518	T	0.53302	0.1788	L	0.46157	1.445	0.80722	D	1	P;P;P;P	0.51057	0.941;0.941;0.941;0.916	P;P;P;P	0.54965	0.587;0.701;0.587;0.765	T	0.51371	-0.8714	10	0.59425	D	0.04	.	16.1717	0.81822	0.0:1.0:0.0:0.0	.	187;187;187;187	A8K270;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	H	187	ENSP00000405963:R187H	ENSP00000378224:R187H	R	-	2	0	RASGRF1	77128957	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.570000	0.67398	2.660000	0.90430	0.655000	0.94253	CGC	RASGRF1	-	NULL	ENSG00000058335		0.572	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3		0.00	31	0	C	NM_002891		79341902	-1			no_errors	ENST00000419573	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.994	T
RBM26	64062	genome.wustl.edu	37	13	79943032	79943032	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:79943032G>T	ENST00000438737.2	-	6	1168	c.728C>A	c.(727-729)tCt>tAt	p.S243Y	RBM26_ENST00000461008.1_5'Flank|RBM26_ENST00000438724.1_Missense_Mutation_p.S243Y|RBM26_ENST00000267229.7_Missense_Mutation_p.S243Y			Q5T8P6	RBM26_HUMAN	RNA binding motif protein 26	243					mRNA processing (GO:0006397)|negative regulation of phosphatase activity (GO:0010923)		metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33		Acute lymphoblastic leukemia(28;0.0279)		GBM - Glioblastoma multiforme(99;0.0188)		GTAGTGGCCAGATGAAATACT	0.393																																																	0													179.0	170.0	173.0					13																	79943032		2203	4300	6503	SO:0001583	missense	0			AF116667	CCDS9462.1, CCDS66566.1, CCDS73591.1	13q31.1	2014-06-13	2006-06-22	2006-06-22	ENSG00000139746	ENSG00000139746		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	20327	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 2"", ""protein phosphatase 1, regulatory 132"""		"""chromosome 13 open reading frame 10"""	C13orf10		11149944, 15741184	Standard	XM_005266497		Approved	PRO1777, SE70-2, FLJ20957, ZC3H17, ARRS2, PPP1R132	uc001vky.2	Q5T8P6	OTTHUMG00000017133	ENST00000438737.2:c.728C>A	13.37:g.79943032G>T	ENSP00000387531:p.Ser243Tyr		B4DZE0|Q2NKM2|Q2NKQ2|Q5CZH8|Q5T8P5|Q5T8P8|Q5U5P5|Q5W0G7|Q8N3H5|Q96K92|Q96SZ3|Q9H2F8|Q9H7F9|Q9P1G7	Missense_Mutation	SNP	pfam_PWI_dom,superfamily_PWI_dom,smart_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.S243Y	ENST00000438737.2	37	c.728		13	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989048	0.93106	.	.	ENSG00000139746	ENST00000267229;ENST00000438737;ENST00000327303;ENST00000438724	T;T	0.51574	0.7;0.7	5.79	5.79	0.91817	.	0.168962	0.53938	D	0.000049	T	0.59487	0.2197	L	0.34521	1.04	0.58432	D	0.999998	D;D;D	0.64830	0.994;0.991;0.994	D;P;P	0.68192	0.956;0.687;0.905	T	0.52902	-0.8513	9	.	.	.	-13.208	20.0367	0.97561	0.0:0.0:1.0:0.0	.	243;243;243	Q5T8P6-2;Q5T8P6;Q5T8P6-3	.;RBM26_HUMAN;.	Y	243;244;243;243	ENSP00000267229:S243Y;ENSP00000390222:S243Y	.	S	-	2	0	RBM26	78841033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.294000	0.78760	2.727000	0.93392	0.591000	0.81541	TCT	RBM26	-	NULL	ENSG00000139746		0.393	RBM26-004	NOVEL	not_organism_supported|basic	protein_coding	RBM26	HGNC	protein_coding	OTTHUMT00000045373.4	-	0.00	94	0	G	NM_022118		79943032	-1	tier1	-	no_errors	ENST00000438724	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104897916	104897916	+	Silent	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:104897916G>A	ENST00000436393.2	+	2	664	c.423G>A	c.(421-423)cgG>cgA	p.R141R	RIMS2_ENST00000262231.10_Silent_p.R171R|RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000507740.1_Silent_p.R171R|RIMS2_ENST00000406091.3_Silent_p.R363R			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	394	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CCCGAGCACGGCATGAGAGAA	0.468										HNSCC(12;0.0054)																																							0													95.0	94.0	95.0					8																	104897916		1992	4157	6149	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.423G>A	8.37:g.104897916G>A			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R363	ENST00000436393.2	37	c.1089		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.468	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	58	0	G	NM_001100117		104897916	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.998	A
RNF10	9921	genome.wustl.edu	37	12	120995414	120995414	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:120995414G>A	ENST00000325954.4	+	6	1357	c.896G>A	c.(895-897)aGg>aAg	p.R299K	RNF10_ENST00000413266.2_Missense_Mutation_p.R299K	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	299					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R299M(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGATGAAGAGGGAGAAAGGG	0.443																																																	1	Substitution - Missense(1)	lung(1)											307.0	251.0	270.0					12																	120995414		2203	4300	6503	SO:0001583	missense	0			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.896G>A	12.37:g.120995414G>A	ENSP00000322242:p.Arg299Lys		Q92550|Q9NPP8|Q9ULW4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R299K	ENST00000325954.4	37	c.896	CCDS9201.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.401201|5.401201	0.96030|0.96030	.|.	.|.	ENSG00000022840|ENSG00000022840	ENST00000542207;ENST00000541955|ENST00000325954;ENST00000458409;ENST00000413266	.|D;D	.|0.96300	.|-3.61;-3.97	6.04|6.04	5.13|5.13	0.70059|0.70059	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.97920|0.97920	0.9316|0.9316	M|M	0.79011|0.79011	2.435|2.435	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.998	.|D;D	.|0.80764	.|0.994;0.984	D|D	0.98290|0.98290	1.0513|1.0513	5|10	.|0.87932	.|D	.|0	.|.	16.801|16.801	0.85614|0.85614	0.0:0.0:0.8708:0.1292|0.0:0.0:0.8708:0.1292	.|.	.|299;299	.|Q8N5U6-2;Q8N5U6	.|.;RNF10_HUMAN	R|K	97;92|299	.|ENSP00000322242:R299K;ENSP00000415682:R299K	.|ENSP00000322242:R299K	G|R	+|+	1|2	0|0	RNF10|RNF10	119479797|119479797	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.001000|8.001000	0.88508|0.88508	2.873000|2.873000	0.98535|0.98535	0.563000|0.563000	0.77884|0.77884	GGG|AGG	RNF10	-	NULL	ENSG00000022840		0.443	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF10	HGNC	protein_coding	OTTHUMT00000401898.4	-	0.00	46	0	G			120995414	+1	tier1	-	no_errors	ENST00000413266	ensembl	human	known	74_37	missense	25.00	18	6	SNP	1.000	A
RNF213	57674	genome.wustl.edu	37	17	78272202	78272202	+	Silent	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:78272202G>C	ENST00000582970.1	+	11	2237	c.2094G>C	c.(2092-2094)ctG>ctC	p.L698L	RNF213_ENST00000508628.2_Silent_p.L747L|RNF213_ENST00000456466.1_Silent_p.L698L|RNF213_ENST00000319921.4_Silent_p.L698L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	698					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.L698L(2)|p.L747L(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGCCTGTCCTGCACTGCTGTA	0.622																																																	3	Substitution - coding silent(3)	lung(3)											71.0	58.0	62.0					17																	78272202		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.2094G>C	17.37:g.78272202G>C			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L698	ENST00000582970.1	37	c.2094	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.622	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	28	0	G	NM_020914		78272202	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.991	C
RNFT2	84900	genome.wustl.edu	37	12	117289626	117289626	+	Intron	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:117289626C>T	ENST00000392549.2	+	12	1604				RNFT2_ENST00000407967.3_Intron|RNFT2_ENST00000551251.1_Intron|RNFT2_ENST00000319176.7_Silent_p.P281P	NM_001109903.1	NP_001103373.1	Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		AGCTTTGGCCCAGATGTGGTT	0.468																																																	0																																										SO:0001627	intron_variant	0			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000392549.2:c.1333-517C>T	12.37:g.117289626C>T			E9PAM7|Q96SU5	Silent	SNP	NULL	p.P281	ENST00000392549.2	37	c.843	CCDS44987.1	12																																																																																			RNFT2	-	NULL	ENSG00000135119		0.468	RNFT2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	HGNC	protein_coding		-	0.00	86	0	C	NM_032814		117289626	+1	tier1	-	no_errors	ENST00000319176	ensembl	human	putative	74_37	silent	5.71	66	4	SNP	0.068	T
RORA	6095	genome.wustl.edu	37	15	60792129	60792129	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:60792129G>T	ENST00000335670.6	-	10	1469	c.1369C>A	c.(1369-1371)Cta>Ata	p.L457I	RORA_ENST00000261523.5_Missense_Mutation_p.L490I|RP11-219B17.1_ENST00000501579.2_RNA|RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000449337.2_Missense_Mutation_p.L402I|RP11-219B17.1_ENST00000558140.1_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RORA_ENST00000309157.4_Missense_Mutation_p.L482I	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	457	Ligand-binding.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						TTCTTCTGTAGGACGTGTTGA	0.408																																																	0													282.0	251.0	261.0					15																	60792129		2203	4299	6502	SO:0001583	missense	0			U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.1369C>A	15.37:g.60792129G>T	ENSP00000335087:p.Leu457Ile		P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.L490I	ENST00000335670.6	37	c.1468	CCDS10177.1	15	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740151	0.49045	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01	5.66	4.75	0.60458	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.64402	D	0.000001	D	0.92811	0.7714	N	0.13371	0.34	0.80722	D	1	B;B;B;B	0.29716	0.076;0.255;0.036;0.076	B;P;P;B	0.47118	0.253;0.538;0.454;0.253	D	0.86886	0.2045	10	0.06236	T	0.91	.	9.2008	0.37258	0.2173:0.0:0.7827:0.0	.	457;482;490;402	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	I	457;402;482;490	ENSP00000335087:L457I;ENSP00000402971:L402I;ENSP00000309753:L482I;ENSP00000261523:L490I	ENSP00000261523:L490I	L	-	1	2	RORA	58579421	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.102000	0.57776	1.527000	0.49086	0.655000	0.94253	CTA	RORA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000069667		0.408	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RORA	HGNC	protein_coding	OTTHUMT00000256142.2		0.00	55	0	G			60792129	-1			no_errors	ENST00000261523	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
RP1L1	94137	genome.wustl.edu	37	8	10480591	10480591	+	Nonsense_Mutation	SNP	G	G	A	rs552894484		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:10480591G>A	ENST00000382483.3	-	2	344	c.121C>T	c.(121-123)Cga>Tga	p.R41*	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	41	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GGATCCCCTCGCTTGAGGAAG	0.657																																																	0													40.0	45.0	43.0					8																	10480591		2080	4185	6265	SO:0001587	stop_gained	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.121C>T	8.37:g.10480591G>A	ENSP00000371923:p.Arg41*		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Nonsense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.R41*	ENST00000382483.3	37	c.121	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	g	34	5.343039	0.95783	.	.	ENSG00000183638	ENST00000382483	.	.	.	4.65	1.41	0.22369	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9107	11.7964	0.52102	0.0:0.0:0.3238:0.6762	.	.	.	.	X	41	.	ENSP00000371923:R41X	R	-	1	2	RP1L1	10518001	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	1.724000	0.38064	0.519000	0.28406	0.457000	0.33378	CGA	RP1L1	-	smart_Doublecortin_dom,pfscan_Doublecortin_dom	ENSG00000183638		0.657	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	53	0	G			10480591	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	nonsense	16.67	35	7	SNP	1.000	A
RPA2	6118	genome.wustl.edu	37	1	28240737	28240737	+	Intron	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:28240737G>A	ENST00000373912.3	-	2	310				RPA2_ENST00000373909.3_Intron|RPA2_ENST00000313433.7_Missense_Mutation_p.A73V	NM_002946.3	NP_002937.1	P15927	RFA2_HUMAN	replication protein A2, 32kDa						base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of DNA damage checkpoint (GO:2000001)|regulation of double-strand break repair via homologous recombination (GO:0010569)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	damaged DNA binding (GO:0003684)|enzyme binding (GO:0019899)|protein phosphatase binding (GO:0019903)|single-stranded DNA binding (GO:0003697)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(3)|skin(1)	11		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		CGAGAAACCCGCAGGCTCCCG	0.632								Direct reversal of damage;Nucleotide excision repair (NER)																																									0																																										SO:0001627	intron_variant	0			BC021257	CCDS314.1, CCDS72740.1	1p35	2008-02-05	2002-08-29		ENSG00000117748	ENSG00000117748			10290	protein-coding gene	gene with protein product		179836	"""replication protein A2 (32kD)"""			8454588	Standard	XM_005245965		Approved		uc001bpe.1	P15927	OTTHUMG00000003915	ENST00000373912.3:c.11-57C>T	1.37:g.28240737G>A			Q52II0|Q5TEI9|Q5TEJ5	Missense_Mutation	SNP	pfam_RPA_C,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold	p.A73V	ENST00000373912.3	37	c.218	CCDS314.1	1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988345	0.35036	.	.	ENSG00000117748	ENST00000313433	T	0.22336	1.96	2.84	-5.67	0.02444	.	10.410900	0.00166	N	0.000008	T	0.09862	0.0242	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.11251	-1.0595	6	.	.	.	1.9946	2.1758	0.03862	0.1935:0.4316:0.231:0.1439	.	.	.	.	V	73	ENSP00000363015:A73V	.	A	-	2	0	RPA2	28113324	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.399000	0.07250	-1.501000	0.01817	-0.339000	0.08088	GCG	RPA2	-	NULL	ENSG00000117748		0.632	RPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA2	HGNC	protein_coding	OTTHUMT00000011179.1	-	0.00	94	0	G	NM_002946		28240737	-1	tier1	-	no_errors	ENST00000313433	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.000	A
RPAP2	79871	genome.wustl.edu	37	1	92846361	92846361	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:92846361A>T	ENST00000610020.1	+	12	1878	c.1769A>T	c.(1768-1770)gAa>gTa	p.E590V		NM_024813.2	NP_079089.2	Q8IXW5	RPAP2_HUMAN	RNA polymerase II associated protein 2	590					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|snRNA transcription (GO:0009301)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleolus (GO:0005730)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	22		all_lung(203;0.0565)|Lung NSC(277;0.152)|Glioma(108;0.222)		all cancers(265;0.00647)|GBM - Glioblastoma multiforme(16;0.0234)|Epithelial(280;0.115)		CTCCTTGAAGAATTACATCTA	0.363																																																	0													127.0	127.0	127.0					1																	92846361		2203	4300	6503	SO:0001583	missense	0			AK023212	CCDS740.1	1p22.1	2014-01-28	2007-07-26	2007-07-26	ENSG00000122484	ENSG00000122484			25791	protein-coding gene	gene with protein product		611476	"""chromosome 1 open reading frame 82"""	C1orf82		17643375	Standard	NM_024813		Approved	FLJ13150	uc001dot.2	Q8IXW5	OTTHUMG00000010288	ENST00000610020.1:c.1769A>T	1.37:g.92846361A>T	ENSP00000476948:p.Glu590Val		C9JKB5|Q49AS7|Q9H8Y2	Missense_Mutation	SNP	pfam_DUF408	p.E590V	ENST00000610020.1	37	c.1769	CCDS740.1	1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.955759	0.53293	.	.	ENSG00000122484	ENST00000370343	.	.	.	5.74	5.74	0.90152	.	0.049897	0.85682	D	0.000000	T	0.58133	0.2101	L	0.32530	0.975	0.33541	D	0.594888	D	0.89917	1.0	D	0.85130	0.997	T	0.66512	-0.5905	8	0.72032	D	0.01	-12.758	13.5778	0.61885	1.0:0.0:0.0:0.0	.	590	Q8IXW5	RPAP2_HUMAN	V	590	.	ENSP00000359368:E590V	E	+	2	0	RPAP2	92618949	1.000000	0.71417	0.998000	0.56505	0.564000	0.35744	5.137000	0.64789	2.191000	0.70037	0.528000	0.53228	GAA	RPAP2	-	NULL	ENSG00000122484		0.363	RPAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP2	HGNC	protein_coding	OTTHUMT00000028368.2	-	0.00	83	0	A	NM_024813		92846361	+1	tier1	-	no_errors	ENST00000610020	ensembl	human	known	74_37	missense	18.31	58	13	SNP	1.000	T
RPAP3	79657	genome.wustl.edu	37	12	48090064	48090064	+	Silent	SNP	C	C	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:48090064C>G	ENST00000005386.3	-	5	655	c.540G>C	c.(538-540)ctG>ctC	p.L180L	RPAP3_ENST00000380650.4_Silent_p.L180L|RPAP3_ENST00000432584.3_Silent_p.L21L	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	180										endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					CTTACTTTTTCAGTCTAAAAT	0.378																																																	0													152.0	134.0	140.0					12																	48090064		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.540G>C	12.37:g.48090064C>G			B4DRW9|Q6PHR5	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L180	ENST00000005386.3	37	c.540	CCDS8753.1	12																																																																																			RPAP3	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000005175		0.378	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP3	HGNC	protein_coding	OTTHUMT00000405340.1		0.00	59	0	C	NM_024604		48090064	-1			no_errors	ENST00000005386	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	G
RPL31	6160	genome.wustl.edu	37	2	101622446	101622446	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:101622446C>T	ENST00000264258.3	+	4	860	c.259C>T	c.(259-261)Cgg>Tgg	p.R87W	RPL31_ENST00000409320.3_Missense_Mutation_p.R87W|RPL31_ENST00000409038.1_Missense_Mutation_p.R87W|RPL31_ENST00000409650.1_Missense_Mutation_p.R87W|RPL31_ENST00000409028.4_Missense_Mutation_p.R87W|RPL31_ENST00000409733.1_Missense_Mutation_p.R87W|RPL31_ENST00000409711.1_3'UTR	NM_000993.4	NP_000984.1	P62899	RL31_HUMAN	ribosomal protein L31	87					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)|urinary_tract(3)	8						AATCCGTGTGCGGCTGTCCAG	0.393																																																	0													64.0	62.0	63.0					2																	101622446		2203	4300	6503	SO:0001583	missense	0			X15940	CCDS2049.1, CCDS46373.1, CCDS46374.1	2q11.2	2011-04-06			ENSG00000071082	ENSG00000071082		"""L ribosomal proteins"""	10334	protein-coding gene	gene with protein product						2780320, 11875025	Standard	NM_000993		Approved	L31	uc010fiu.1	P62899	OTTHUMG00000130687	ENST00000264258.3:c.259C>T	2.37:g.101622446C>T	ENSP00000264258:p.Arg87Trp		B7Z4K2|D3DVJ4|P12947|Q53SQ5|Q6IRZ0|Q6LBJ6	Missense_Mutation	SNP	pfam_Ribosomal_L31e,superfamily_Ribosomal_L31e_dom	p.R87W	ENST00000264258.3	37	c.259	CCDS2049.1	2	.	.	.	.	.	.	.	.	.	.	C	17.17	3.320864	0.60634	.	.	ENSG00000071082	ENST00000264258;ENST00000409028;ENST00000409320;ENST00000409733;ENST00000409650;ENST00000409038;ENST00000456292	.	.	.	5.14	4.24	0.50183	Ribosomal protein L31e domain (2);	0.000000	0.85682	U	0.000000	D	0.85531	0.5718	M	0.93462	3.42	0.80722	D	1	B;D;B;B;B	0.89917	0.078;1.0;0.438;0.036;0.016	B;D;B;B;B	0.83275	0.055;0.996;0.138;0.055;0.007	D	0.88661	0.3189	9	0.52906	T	0.07	.	14.5898	0.68356	0.1581:0.8418:0.0:0.0	.	87;87;87;87;87	B7Z4E3;B7Z4C8;B7Z4K2;Q6IRZ0;P62899	.;.;.;.;RL31_HUMAN	W	87	.	ENSP00000264258:R87W	R	+	1	2	RPL31	100988878	1.000000	0.71417	0.944000	0.38274	0.977000	0.68977	5.763000	0.68818	1.321000	0.45227	0.563000	0.77884	CGG	RPL31	-	pfam_Ribosomal_L31e,superfamily_Ribosomal_L31e_dom	ENSG00000071082		0.393	RPL31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPL31	HGNC	protein_coding	OTTHUMT00000253182.3	-	0.00	35	0	C	NM_001098577		101622446	+1	tier1	-	no_errors	ENST00000264258	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
RRP12	23223	genome.wustl.edu	37	10	99129214	99129214	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:99129214C>T	ENST00000370992.4	-	25	3034	c.2923G>A	c.(2923-2925)Gtg>Atg	p.V975M	RRP12_ENST00000414986.1_Missense_Mutation_p.V914M|RRP12_ENST00000315563.6_Missense_Mutation_p.V875M|RRP12_ENST00000536831.1_Missense_Mutation_p.V693M|RRP12_ENST00000479481.1_5'UTR	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	975						integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		AGGTGCGCCACGTCCATGACA	0.612																																																	0													101.0	68.0	79.0					10																	99129214		2203	4300	6503	SO:0001583	missense	0				CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.2923G>A	10.37:g.99129214C>T	ENSP00000360031:p.Val975Met		B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Missense_Mutation	SNP	pfam_Uncharacterised_NUC173,superfamily_ARM-type_fold	p.V975M	ENST00000370992.4	37	c.2923	CCDS7457.1	10	.	.	.	.	.	.	.	.	.	.	C	0.694	-0.793518	0.02862	.	.	ENSG00000052749	ENST00000370992;ENST00000315563;ENST00000414986;ENST00000536831	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.2	2.26	0.28386	Armadillo-like helical (1);Armadillo-type fold (1);	0.482593	0.23949	N	0.042962	T	0.48277	0.1491	L	0.50333	1.59	0.09310	N	1	P;P;P;B	0.40602	0.54;0.609;0.723;0.007	B;B;B;B	0.30029	0.032;0.091;0.11;0.003	T	0.35126	-0.9801	10	0.48119	T	0.1	-8.55	10.2164	0.43170	0.0:0.6026:0.0:0.3974	.	914;875;693;975	E9PCK7;Q5JTH9-2;F5H456;Q5JTH9	.;.;.;RRP12_HUMAN	M	975;875;914;693	ENSP00000360031:V975M;ENSP00000324315:V875M;ENSP00000414863:V914M;ENSP00000446184:V693M	ENSP00000324315:V875M	V	-	1	0	RRP12	99119204	0.100000	0.21855	0.001000	0.08648	0.003000	0.03518	0.837000	0.27558	0.213000	0.20722	-1.134000	0.01955	GTG	RRP12	-	superfamily_ARM-type_fold	ENSG00000052749		0.612	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RRP12	HGNC	protein_coding	OTTHUMT00000049699.4		0.00	20	0	C	NM_015179		99129214	-1			no_errors	ENST00000370992	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.001	T
RTTN	25914	genome.wustl.edu	37	18	67753884	67753884	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:67753884T>A	ENST00000255674.6	-	32	4625	c.4339A>T	c.(4339-4341)Atg>Ttg	p.M1447L	RTTN_ENST00000454359.1_3'UTR|RTTN_ENST00000437017.1_Missense_Mutation_p.M1447L	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1447					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				TCTGTAGGCATTGGAATTACA	0.269																																																	0													87.0	90.0	89.0					18																	67753884		1787	4053	5840	SO:0001583	missense	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.4339A>T	18.37:g.67753884T>A	ENSP00000255674:p.Met1447Leu		Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M1447L	ENST00000255674.6	37	c.4339	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	T	12.01	1.808205	0.31961	.	.	ENSG00000176225	ENST00000255674;ENST00000437017	T;T	0.61040	0.84;0.14	5.07	3.83	0.44106	.	0.073417	0.85682	D	0.000000	T	0.45538	0.1347	L	0.41236	1.265	0.80722	D	1	B	0.19073	0.033	B	0.13407	0.009	T	0.39603	-0.9606	10	0.32370	T	0.25	.	10.5324	0.44983	0.2344:0.0:0.0:0.7656	.	1447	Q86VV8	RTTN_HUMAN	L	1447	ENSP00000255674:M1447L;ENSP00000399520:M1447L	ENSP00000255674:M1447L	M	-	1	0	RTTN	65904864	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.474000	0.53129	2.031000	0.59945	0.528000	0.53228	ATG	RTTN	-	NULL	ENSG00000176225		0.269	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	-	0.00	75	0	T	NM_173630		67753884	-1	tier1	-	no_errors	ENST00000255674	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	33988632	33988632	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:33988632G>A	ENST00000389232.4	+	39	6144	c.6074G>A	c.(6073-6075)cGc>cAc	p.R2025H	RYR3_ENST00000415757.3_Missense_Mutation_p.R2025H	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2025	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGCCAAATCCGCTCCCTCCTC	0.577																																																	0													85.0	90.0	89.0					15																	33988632		2117	4241	6358	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6074G>A	15.37:g.33988632G>A	ENSP00000373884:p.Arg2025His		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.R2025H	ENST00000389232.4	37	c.6074	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685615	0.88639	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;D	0.95756	-0.28;-3.8	4.84	3.9	0.45041	Intracellular calcium-release channel (1);	0.134219	0.46758	D	0.000275	D	0.97414	0.9154	M	0.78637	2.42	0.47476	D	0.999439	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.98149	1.0440	10	0.87932	D	0	.	15.2883	0.73846	0.0:0.1408:0.8592:0.0	.	2025;2025	Q15413-2;Q15413	.;RYR3_HUMAN	H	2025	ENSP00000373884:R2025H;ENSP00000399610:R2025H	ENSP00000354735:R2025H	R	+	2	0	RYR3	31775924	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	9.601000	0.98297	1.354000	0.45846	0.650000	0.86243	CGC	RYR3	-	pfam_Ca-rel_channel	ENSG00000198838		0.577	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1		0.00	43	0	G			33988632	+1			no_errors	ENST00000389232	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
SCN5A	6331	genome.wustl.edu	37	3	38651309	38651309	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:38651309A>C	ENST00000333535.4	-	7	999	c.850T>G	c.(850-852)Ttc>Gtc	p.F284V	SCN5A_ENST00000449557.2_Missense_Mutation_p.F284V|SCN5A_ENST00000414099.2_Missense_Mutation_p.F284V|SCN5A_ENST00000425664.1_Missense_Mutation_p.F284V|SCN5A_ENST00000423572.2_Missense_Mutation_p.F284V|SCN5A_ENST00000451551.2_Missense_Mutation_p.F284V|SCN5A_ENST00000413689.1_Missense_Mutation_p.F284V|SCN5A_ENST00000443581.1_Missense_Mutation_p.F284V|SCN5A_ENST00000450102.2_Missense_Mutation_p.F284V|SCN5A_ENST00000455624.2_Missense_Mutation_p.F284V			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	284					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	AGCGCTGTGAAGTTGCGCACG	0.592																																																	0													75.0	81.0	79.0					3																	38651309		2170	4272	6442	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.850T>G	3.37:g.38651309A>C	ENSP00000328968:p.Phe284Val		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.F284V	ENST00000333535.4	37	c.850	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	A	13.40	2.225395	0.39300	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557;ENST00000399254	D;D;D;D;D;D;D;D;D;D	0.95949	-3.78;-3.8;-3.8;-3.8;-3.8;-3.78;-3.8;-3.86;-3.8;-3.8	5.34	5.34	0.76211	Ion transport (1);	0.424581	0.26032	N	0.026757	D	0.88676	0.6501	N	0.03983	-0.305	0.36036	D	0.839762	B;P;P;B;B;P;B	0.43231	0.01;0.763;0.801;0.01;0.01;0.622;0.008	B;B;P;B;B;B;B	0.46510	0.012;0.385;0.519;0.012;0.012;0.217;0.007	D	0.88573	0.3131	10	0.17369	T	0.5	.	9.9009	0.41346	0.9246:0.0:0.0754:0.0	.	284;284;284;284;284;284;284	E9PEF3;Q14524-3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	V	284;284;284;284;284;284;284;284;284;284;94	ENSP00000398962:F284V;ENSP00000398266:F284V;ENSP00000410257:F284V;ENSP00000388797:F284V;ENSP00000397915:F284V;ENSP00000416634:F284V;ENSP00000328968:F284V;ENSP00000399524:F284V;ENSP00000403355:F284V;ENSP00000413996:F284V	ENSP00000328968:F284V	F	-	1	0	SCN5A	38626313	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	1.844000	0.39269	2.248000	0.74166	0.533000	0.62120	TTC	SCN5A	-	pfam_Ion_trans_dom	ENSG00000183873		0.592	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	36	0	A	NM_198056		38651309	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	C
SEC23B	10483	genome.wustl.edu	37	20	18511355	18511355	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:18511355A>T	ENST00000336714.3	+	10	1573	c.1141A>T	c.(1141-1143)Act>Tct	p.T381S	SEC23B_ENST00000377465.1_Missense_Mutation_p.T381S|SEC23B_ENST00000377475.3_Missense_Mutation_p.T381S|SEC23B_ENST00000262544.2_Missense_Mutation_p.T381S	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	381					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TTCTTTCAACACTTCTCTCTT	0.373																																																	0													97.0	96.0	96.0					20																	18511355		2202	4300	6502	SO:0001583	missense	0			X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.1141A>T	20.37:g.18511355A>T	ENSP00000338844:p.Thr381Ser		D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Gelsolin_dom,pfam_Znf_Sec23_Sec24,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.T381S	ENST00000336714.3	37	c.1141	CCDS13137.1	20	.	.	.	.	.	.	.	.	.	.	A	12.19	1.864152	0.32977	.	.	ENSG00000101310	ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	5.3	5.3	0.74995	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	T	0.58061	0.2096	N	0.10733	0.035	0.80722	D	1	B;B	0.19583	0.037;0.002	B;B	0.21360	0.034;0.01	T	0.56044	-0.8044	10	0.09843	T	0.71	-24.3237	14.5888	0.68347	1.0:0.0:0.0:0.0	.	363;381	B4DJW8;Q15437	.;SC23B_HUMAN	S	381	ENSP00000338844:T381S;ENSP00000262544:T381S;ENSP00000366695:T381S;ENSP00000366685:T381S	ENSP00000262544:T381S	T	+	1	0	SEC23B	18459355	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.087000	0.94110	2.235000	0.73313	0.533000	0.62120	ACT	SEC23B	-	pfam_Sec23/24_trunk_dom	ENSG00000101310		0.373	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEC23B	HGNC	protein_coding	OTTHUMT00000078184.5		0.00	76	0	A			18511355	+1			no_errors	ENST00000262544	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
SEC31A	22872	genome.wustl.edu	37	4	83745770	83745770	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:83745770G>T	ENST00000395310.2	-	25	3531	c.3349C>A	c.(3349-3351)Ctc>Atc	p.L1117I	SEC31A_ENST00000508502.1_Missense_Mutation_p.L1102I|SEC31A_ENST00000505472.1_Missense_Mutation_p.L1148I|SEC31A_ENST00000432794.1_Missense_Mutation_p.L1130I|SEC31A_ENST00000509142.1_Missense_Mutation_p.L1003I|SEC31A_ENST00000505984.1_Missense_Mutation_p.L1063I|SEC31A_ENST00000264405.5_Missense_Mutation_p.L866I|SEC31A_ENST00000513858.1_Missense_Mutation_p.L964I|SEC31A_ENST00000500777.2_Missense_Mutation_p.L964I|SEC31A_ENST00000355196.2_Missense_Mutation_p.L1117I|SEC31A_ENST00000443462.2_Missense_Mutation_p.L1097I|SEC31A_ENST00000448323.1_Missense_Mutation_p.L1117I|SEC31A_ENST00000311785.7_Missense_Mutation_p.L1003I|SEC31A_ENST00000348405.4_Missense_Mutation_p.L1078I|SEC31A_ENST00000326950.5_Missense_Mutation_p.L1078I	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	1117					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				TTTAGAATGAGGTGCTCATCT	0.363																																																	0													156.0	156.0	156.0					4																	83745770		2203	4300	6503	SO:0001583	missense	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.3349C>A	4.37:g.83745770G>T	ENSP00000378721:p.Leu1117Ile		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1130I	ENST00000395310.2	37	c.3388	CCDS3596.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.36|19.36	3.812520|3.812520	0.70912|0.70912	.|.	.|.	ENSG00000138674|ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984|ENST00000515062;ENST00000511338	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.38077|.	1.35;1.25;2.41;2.38;1.3;2.31;2.41;1.35;1.3;1.16;1.25;2.4;2.41;3.26;2.34|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.139013|.	0.49916|.	D|.	0.000121|.	T|T	0.48926|0.48926	0.1527|0.1527	L|L	0.31752|0.31752	0.955|0.955	0.23953|0.23953	N|N	0.996362|0.996362	D;D;P;P;P;D;P;D;P|.	0.69078|.	0.967;0.997;0.802;0.919;0.802;0.989;0.868;0.981;0.926|.	D;D;B;P;B;D;B;D;P|.	0.72625|.	0.93;0.978;0.231;0.548;0.231;0.968;0.346;0.967;0.835|.	T|T	0.42865|0.42865	-0.9426|-0.9426	10|5	0.20046|.	T|.	0.44|.	-13.2665|-13.2665	19.7538|19.7538	0.96281|0.96281	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1097;1063;964;1078;1003;1102;1117;866;1130|.	B4DIW6;B7ZL00;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7;O94979-8|.	.;.;.;.;.;.;SC31A_HUMAN;.;.|.	I|H	1078;964;1117;1097;1003;1130;1117;1078;1003;1148;964;1102;1117;866;1063|101;213	ENSP00000337602:L1078I;ENSP00000426886:L964I;ENSP00000378721:L1117I;ENSP00000408027:L1097I;ENSP00000426569:L1003I;ENSP00000407944:L1130I;ENSP00000400926:L1117I;ENSP00000325087:L1078I;ENSP00000309070:L1003I;ENSP00000421633:L1148I;ENSP00000421464:L964I;ENSP00000424635:L1102I;ENSP00000347329:L1117I;ENSP00000264405:L866I;ENSP00000424451:L1063I|.	ENSP00000264405:L866I|.	L|P	-|-	1|2	0|0	SEC31A|SEC31A	83964794|83964794	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	4.493000|4.493000	0.60341|0.60341	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	CTC|CCT	SEC31A	-	NULL	ENSG00000138674		0.363	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	-	0.00	70	0	G	NM_016211		83745770	-1	tier1	-	no_errors	ENST00000432794	ensembl	human	known	74_37	missense	8.20	56	5	SNP	1.000	T
SEC61A2	55176	genome.wustl.edu	37	10	12185143	12185143	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:12185143G>T	ENST00000298428.9	+	4	258	c.169G>T	c.(169-171)Gat>Tat	p.D57Y	SEC61A2_ENST00000379051.1_Missense_Mutation_p.D57Y|SEC61A2_ENST00000304267.8_Missense_Mutation_p.D57Y|snoU13_ENST00000458754.1_RNA|SEC61A2_ENST00000495368.1_3'UTR|SEC61A2_ENST00000379017.3_Missense_Mutation_p.D57Y|SEC61A2_ENST00000379020.4_Missense_Mutation_p.D57Y|SEC61A2_ENST00000379033.3_Missense_Mutation_p.D35Y	NM_018144.3	NP_060614.2	Q9H9S3	S61A2_HUMAN	Sec61 alpha 2 subunit (S. cerevisiae)	57					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ribosome binding (GO:0043022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Renal(717;0.228)				CATGTCATCAGATTCTGCAGA	0.398																																																	0													283.0	257.0	266.0					10																	12185143		2203	4300	6503	SO:0001583	missense	0			AF346603	CCDS7088.1, CCDS44358.1, CCDS44359.1	10p14	2004-01-06			ENSG00000065665	ENSG00000065665			17702	protein-coding gene	gene with protein product							Standard	NM_018144		Approved	FLJ10578	uc001ile.2	Q9H9S3	OTTHUMG00000017679	ENST00000298428.9:c.169G>T	10.37:g.12185143G>T	ENSP00000298428:p.Asp57Tyr		A8K8D0|B4DX72|F8W773	Missense_Mutation	SNP	pfam_SecY/SEC61-alpha,pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	p.D57Y	ENST00000298428.9	37	c.169	CCDS7088.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	22.6|22.6|22.6	4.306561|4.306561|4.306561	0.81247|0.81247|0.81247	.|.|.	.|.|.	ENSG00000065665|ENSG00000065665|ENSG00000065665	ENST00000379051;ENST00000379033;ENST00000441368;ENST00000298428;ENST00000304267;ENST00000379020;ENST00000379017|ENST00000457034|ENST00000418772	.|.|.	.|.|.	.|.|.	5.11|5.11|5.11	5.11|5.11|5.11	0.69529|0.69529|0.69529	Translocon Sec61/SecY, plug domain (1);SecY subunit domain (2);|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000006|.|.	T|T|T	0.70500|0.70500|0.70500	0.3231|0.3231|0.3231	L|L|L	0.55213|0.55213|0.55213	1.73|1.73|1.73	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;D;B|.|.	0.63880|.|.	0.026;0.993;0.365|.|.	B;D;P|.|.	0.73708|.|.	0.037;0.981;0.823|.|.	T|T|T	0.68352|0.68352|0.68352	-0.5431|-0.5431|-0.5431	9|5|5	0.72032|.|.	D|.|.	0.01|.|.	.|.|.	17.5239|17.5239|17.5239	0.87794|0.87794|0.87794	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	35;57;57|.|.	F8W773;Q9H9S3-2;Q9H9S3|.|.	.;.;S61A2_HUMAN|.|.	Y|H|I	57;35;57;57;57;57;57|30|2	.|.|.	ENSP00000298428:D57Y|.|.	D|Q|R	+|+|+	1|3|2	0|2|0	SEC61A2|SEC61A2|SEC61A2	12225149|12225149|12225149	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.966000|0.966000|0.966000	0.64601|0.64601|0.64601	9.788000|9.788000|9.788000	0.99064|0.99064|0.99064	2.380000|2.380000|2.380000	0.81148|0.81148|0.81148	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAT|CAG|AGA	SEC61A2	-	pfam_Translocon_Sec61/SecY_plug_dom,superfamily_SecY_su_dom,pirsf_SecY/SEC61-alpha,tigrfam_SecY/SEC61-alpha	ENSG00000065665		0.398	SEC61A2-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC61A2	HGNC	protein_coding	OTTHUMT00000046795.1		0.00	60	0	G	NM_018144		12185143	+1			no_errors	ENST00000298428	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
SELENBP1	8991	genome.wustl.edu	37	1	151338125	151338125	+	Missense_Mutation	SNP	G	G	A	rs369459403		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:151338125G>A	ENST00000368868.5	-	9	1049	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	SELENBP1_ENST00000435071.1_Missense_Mutation_p.R256C|SELENBP1_ENST00000426705.2_Missense_Mutation_p.R362C|SELENBP1_ENST00000447402.3_Missense_Mutation_p.R258C|SELENBP1_ENST00000473693.1_5'Flank	NM_003944.3	NP_003935.2	Q13228	SBP1_HUMAN	selenium binding protein 1	320					protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	selenium binding (GO:0008430)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|urinary_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TAGAGGAAGCGGTCGTCCAGG	0.587																																																	0													124.0	134.0	131.0					1																	151338125		2203	4300	6503	SO:0001583	missense	0			U29091	CCDS995.1, CCDS58027.1, CCDS60266.1	1q21.3	2014-05-19			ENSG00000143416	ENSG00000143416			10719	protein-coding gene	gene with protein product		604188				9027582	Standard	NM_003944		Approved	hSP56, hSBP, LPSB	uc010pcy.3	Q13228	OTTHUMG00000012498	ENST00000368868.5:c.958C>T	1.37:g.151338125G>A	ENSP00000357861:p.Arg320Cys		A6NML9|A6PVW9|B2RDR3|B4DKP6|B4E1F3|Q49AQ8|Q96GX7	Missense_Mutation	SNP	pfam_Se-bd	p.R362C	ENST00000368868.5	37	c.1084	CCDS995.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267972	0.80469	.	.	ENSG00000143416	ENST00000368868;ENST00000447402;ENST00000435071	T;T;T	0.33865	1.39;1.39;1.39	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.93978	3.48	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.85130	0.91;0.997;0.988;0.935;0.993	T	0.73304	-0.4025	10	0.87932	D	0	-17.5809	13.6725	0.62434	0.0:0.0:0.8449:0.1551	.	258;280;173;256;320	B4E1F3;A6PVW8;B4DPI7;Q13228-2;Q13228	.;.;.;.;SBP1_HUMAN	C	320;258;256	ENSP00000357861:R320C;ENSP00000413960:R258C;ENSP00000408263:R256C	ENSP00000357861:R320C	R	-	1	0	SELENBP1	149604749	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	4.765000	0.62271	2.557000	0.86248	0.655000	0.94253	CGC	SELENBP1	-	pfam_Se-bd	ENSG00000143416		0.587	SELENBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELENBP1	HGNC	protein_coding	OTTHUMT00000034904.4	-	0.00	43	0	G			151338125	-1	tier1	-	no_errors	ENST00000426705	ensembl	human	known	74_37	missense	25.00	27	9	SNP	1.000	A
SGOL2	151246	genome.wustl.edu	37	2	201399805	201399805	+	Silent	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:201399805A>C	ENST00000357799.4	+	3	318	c.220A>C	c.(220-222)Aga>Cga	p.R74R	SGOL2_ENST00000409203.3_Silent_p.R74R	NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	74					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GAATTCTCGAAGAATTACAAC	0.313																																																	0													61.0	56.0	57.0					2																	201399805		1807	4064	5871	SO:0001819	synonymous_variant	0			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.220A>C	2.37:g.201399805A>C			Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Silent	SNP	NULL	p.R74	ENST00000357799.4	37	c.220	CCDS42796.1	2																																																																																			SGOL2	-	NULL	ENSG00000163535		0.313	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1	-	0.00	97	0	A	NM_152524		201399805	+1	tier1	-	no_errors	ENST00000357799	ensembl	human	known	74_37	silent	24.36	59	19	SNP	1.000	C
SH2B3	10019	genome.wustl.edu	37	12	111885533	111885533	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:111885533T>A	ENST00000341259.2	+	7	1667	c.1310T>A	c.(1309-1311)aTg>aAg	p.M437K	SH2B3_ENST00000538307.1_Missense_Mutation_p.M235K	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	437	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	GTCGTGGACATGCTCCACCAC	0.662																																																	0													64.0	55.0	58.0					12																	111885533		2203	4300	6503	SO:0001583	missense	0			AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1310T>A	12.37:g.111885533T>A	ENSP00000345492:p.Met437Lys		B9EGG5|O95184	Missense_Mutation	SNP	pfam_Phe_ZIP,pfam_SH2,pfam_Pleckstrin_homology,superfamily_Phe_ZIP,smart_Pleckstrin_homology,smart_SH2,pfscan_SH2,prints_SH2	p.M437K	ENST00000341259.2	37	c.1310	CCDS9153.1	12	.	.	.	.	.	.	.	.	.	.	T	24.5	4.541119	0.85917	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.64618	-0.11;-0.11	5.05	5.05	0.67936	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.83110	0.5183	M	0.93594	3.435	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	0.991;0.987;1.0	D	0.87158	0.2213	10	0.87932	D	0	-20.4872	12.289	0.54807	0.0:0.0:0.1411:0.8589	.	235;301;437	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	K	437;247;235	ENSP00000345492:M437K;ENSP00000440597:M235K	ENSP00000345492:M437K	M	+	2	0	SH2B3	110369916	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.633000	0.83260	2.040000	0.60383	0.379000	0.24179	ATG	SH2B3	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000111252		0.662	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	SH2B3	HGNC	protein_coding	OTTHUMT00000404779.1	-	0.00	41	0	T	NM_005475		111885533	+1	tier1	-	no_errors	ENST00000341259	ensembl	human	putative	74_37	missense	31.25	22	10	SNP	1.000	A
PDXP	57026	genome.wustl.edu	37	22	38061636	38061636	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr22:38061636T>C	ENST00000215904.6	+	2	705	c.649T>C	c.(649-651)Tac>Cac	p.Y217H	PDXP_ENST00000403251.1_5'UTR|SH3BP1_ENST00000599616.1_Missense_Mutation_p.Y526H	NM_020315.4	NP_064711.1	Q96GD0	PLPP_HUMAN	pyridoxal (pyridoxine, vitamin B6) phosphatase	217					actin rod assembly (GO:0031247)|cellular response to ATP (GO:0071318)|positive regulation of actin filament depolymerization (GO:0030836)|protein dephosphorylation (GO:0006470)|pyridoxal phosphate catabolic process (GO:0032361)|regulation of cytokinesis (GO:0032465)|regulation of mitosis (GO:0007088)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heat shock protein binding (GO:0031072)|magnesium ion binding (GO:0000287)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|pyridoxal phosphatase activity (GO:0033883)			kidney(1)|large_intestine(1)|lung(5)|ovary(2)	9	Melanoma(58;0.0574)					GCCCAGCCCCTACATGTTCGA	0.652																																																	0													85.0	73.0	77.0					22																	38061636		2203	4300	6503	SO:0001583	missense	0			BC064922	CCDS13953.1	22q12.3	2005-08-16			ENSG00000241360	ENSG00000241360			30259	protein-coding gene	gene with protein product		609246				14522954	Standard	NM_020315		Approved	dJ37E16.5, FLJ32703		Q96GD0	OTTHUMG00000044618	ENST00000215904.6:c.649T>C	22.37:g.38061636T>C	ENSP00000215904:p.Tyr217His		Q9UGY2	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,superfamily_HAD-like_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.Y526H	ENST00000215904.6	37	c.1576	CCDS13953.1	22	.	.	.	.	.	.	.	.	.	.	T	26.2	4.718542	0.89205	.	.	ENSG00000241360	ENST00000215904	T	0.29397	1.57	5.58	5.58	0.84498	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	.	.	.	.	T	0.43122	0.1233	L	0.31845	0.965	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.87578	0.987;0.998	T	0.15838	-1.0423	9	0.17369	T	0.5	-15.8293	15.7563	0.78030	0.0:0.0:0.0:1.0	.	217;526	Q96GD0;Q6ZT62	PLPP_HUMAN;.	H	217	ENSP00000215904:Y217H	ENSP00000215904:Y217H	Y	+	1	0	PDXP	36391582	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.955000	0.87856	2.121000	0.65114	0.459000	0.35465	TAC	SH3BP1	-	superfamily_HAD-like_dom	ENSG00000100092		0.652	PDXP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000104105.2	-	0.00	46	0	T	NM_020315		38061636	+1	tier1	-	no_errors	ENST00000599616	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	C
SIPA1L1	26037	genome.wustl.edu	37	14	72090894	72090894	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr14:72090894C>T	ENST00000555818.1	+	4	2107	c.1759C>T	c.(1759-1761)Cgg>Tgg	p.R587W	SIPA1L1_ENST00000381232.3_Missense_Mutation_p.R587W|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.R62W|SIPA1L1_ENST00000358550.2_Missense_Mutation_p.R587W	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	587					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		CCAGTGCCTGCGGTTGGCCTT	0.552																																																	0													162.0	135.0	144.0					14																	72090894		2203	4300	6503	SO:0001583	missense	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.1759C>T	14.37:g.72090894C>T	ENSP00000450832:p.Arg587Trp		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.R587W	ENST00000555818.1	37	c.1759	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324272	0.81580	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413;ENST00000555066	D;D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34;-3.34	5.29	4.34	0.51931	.	0.094163	0.64402	D	0.000001	D	0.96528	0.8867	M	0.86953	2.85	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0	D;P;D;D;D	0.87578	0.996;0.834;0.998;0.997;0.99	D	0.96226	0.9164	10	0.87932	D	0	-16.7653	11.1918	0.48690	0.3526:0.6474:0.0:0.0	.	62;587;62;587;587	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	W	587;587;587;62;88	ENSP00000370630:R587W;ENSP00000450832:R587W;ENSP00000351352:R587W;ENSP00000440682:R62W;ENSP00000452450:R88W	ENSP00000351352:R587W	R	+	1	2	SIPA1L1	71160647	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	1.517000	0.35867	2.752000	0.94435	0.655000	0.94253	CGG	SIPA1L1	-	NULL	ENSG00000197555		0.552	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	-	0.00	47	0	C	NM_015556		72090894	+1	tier1	-	no_errors	ENST00000555818	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	T
SIRPA	140885	genome.wustl.edu	37	20	1896101	1896101	+	Splice_Site	SNP	G	G	A	rs561231326		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr20:1896101G>A	ENST00000358771.4	+	2	588	c.436G>A	c.(436-438)Gcc>Acc	p.A146T	SIRPA_ENST00000356025.3_Splice_Site_p.A146T|SIRPA_ENST00000400068.3_Splice_Site_p.A146T	NM_001040023.1	NP_001035112.1	P78324	SHPS1_HUMAN	signal-regulatory protein alpha	146					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GTCTGTGCGCGGTGAGTACAG	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		17252	0.0		0.001	False		,,,				2504	0.0				GBM(155;1668 1920 5945 42733 48121)												0													99.0	89.0	92.0					20																	1896101		2203	4299	6502	SO:0001630	splice_region_variant	0			D86043	CCDS13022.1	20p13	2013-01-11	2006-03-29	2006-03-29	ENSG00000198053	ENSG00000198053		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	9662	protein-coding gene	gene with protein product		602461	"""protein tyrosine phosphatase, non-receptor type substrate 1"""	PTPNS1		9070220, 9062191, 16339511	Standard	XM_005260669		Approved	SHPS1, SIRP, MYD-1, BIT, P84, SHPS-1, SIRPalpha, CD172a, SIRPalpha2, MFR, SIRP-ALPHA-1	uc002wfr.3	P78324	OTTHUMG00000031682	ENST00000358771.4:c.436+1G>A	20.37:g.1896101G>A			A2A2E1|A8K411|B2R6C3|O00683|O43799|Q8N517|Q8TAL8|Q9H0Z2|Q9UDX2|Q9UIJ6|Q9Y4U9	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A146T	ENST00000358771.4	37	c.436	CCDS13022.1	20	.	.	.	.	.	.	.	.	.	.	G	16.45	3.125943	0.56721	.	.	ENSG00000198053	ENST00000400068;ENST00000356025;ENST00000358771	T;T;T	0.02301	4.35;4.35;4.35	5.11	5.11	0.69529	Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000018	T	0.12135	0.0295	M	0.80616	2.505	0.80722	D	1	D;D;P	0.89917	0.973;1.0;0.938	B;D;B	0.68039	0.376;0.955;0.331	T	0.00029	-1.2294	10	0.72032	D	0.01	.	13.9546	0.64140	0.0:0.0:1.0:0.0	.	126;146;146	B4DP97;P78324-2;P78324	.;.;SHPS1_HUMAN	T	146	ENSP00000382941:A146T;ENSP00000348307:A146T;ENSP00000351621:A146T	ENSP00000348307:A146T	A	+	1	0	SIRPA	1844101	0.999000	0.42202	0.962000	0.40283	0.038000	0.13279	3.746000	0.55127	2.682000	0.91365	0.555000	0.69702	GCC	SIRPA	-	NULL	ENSG00000198053		0.542	SIRPA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIRPA	HGNC	protein_coding	OTTHUMT00000077568.2	-	0.00	55	0	G	NM_080792	Missense_Mutation	1896101	+1	tier1	-	no_errors	ENST00000400068	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.976	A
SIRT5	23408	genome.wustl.edu	37	6	13595764	13595764	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:13595764G>T	ENST00000606117.1	+	6	827	c.531G>T	c.(529-531)aaG>aaT	p.K177N	SIRT5_ENST00000359782.3_Missense_Mutation_p.K177N|SIRT5_ENST00000397350.2_Missense_Mutation_p.K69N|SIRT5_ENST00000379262.4_Missense_Mutation_p.K177N	NM_012241.4	NP_036373.1			sirtuin 5											breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	11	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.176)			AGAATTACAAGAGTCCAATTT	0.343																																																	0													178.0	174.0	175.0					6																	13595764		2203	4300	6503	SO:0001583	missense	0			AF083110	CCDS4526.1, CCDS4527.1, CCDS54966.1, CCDS56398.1	6p23	2010-08-05	2010-06-25		ENSG00000124523	ENSG00000124523			14933	protein-coding gene	gene with protein product		604483	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 5"", ""sirtuin (silent mating type information regulation 2 homolog) 5 (S. cerevisiae)"""			10381378	Standard	NM_012241		Approved		uc003nay.3	Q9NXA8	OTTHUMG00000014278	ENST00000606117.1:c.531G>T	6.37:g.13595764G>T	ENSP00000476228:p.Lys177Asn			Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.K177N	ENST00000606117.1	37	c.531	CCDS4526.1	6	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270538	0.23221	.	.	ENSG00000124523	ENST00000359782;ENST00000379262;ENST00000397350;ENST00000379250	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.78	2.85	0.33270	.	0.188959	0.56097	D	0.000040	T	0.09905	0.0243	N	0.13272	0.32	0.44136	D	0.996922	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.06752	-1.0809	10	0.27785	T	0.31	-24.9844	6.7256	0.23355	0.1806:0.2562:0.5631:0.0	.	177;177;177	F5H5Z9;Q9NXA8;Q9NXA8-2	.;SIRT5_HUMAN;.	N	177;177;69;177	ENSP00000352830:K177N;ENSP00000368564:K177N;ENSP00000380509:K69N;ENSP00000368552:K177N	ENSP00000352830:K177N	K	+	3	2	SIRT5	13703743	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.791000	0.26915	1.412000	0.46977	0.585000	0.79938	AAG	SIRT5	-	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	ENSG00000124523		0.343	SIRT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT5	HGNC	protein_coding	OTTHUMT00000039908.2	-	0.00	45	0	G			13595764	+1	tier1	-	no_errors	ENST00000606117	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
SLC30A8	169026	genome.wustl.edu	37	8	118159330	118159330	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:118159330C>T	ENST00000456015.2	+	2	209	c.209C>T	c.(208-210)gCc>gTc	p.A70V	SLC30A8_ENST00000519688.1_Missense_Mutation_p.A21V|SLC30A8_ENST00000427715.2_Missense_Mutation_p.A21V|SLC30A8_ENST00000521243.1_Missense_Mutation_p.A21V	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	70					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TACGCCTATGCCAAGTGGAAA	0.493																																					Ovarian(162;1202 1922 6011 16223 52092)												0													181.0	153.0	162.0					8																	118159330		2203	4300	6503	SO:0001583	missense	0				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.209C>T	8.37:g.118159330C>T	ENSP00000415011:p.Ala70Val		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.A70V	ENST00000456015.2	37	c.209	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300715	0.81136	.	.	ENSG00000164756	ENST00000521243;ENST00000524274;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	5.97	5.08	0.68730	.	0.053201	0.85682	D	0.000000	T	0.69913	0.3164	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72450	-0.4290	10	0.52906	T	0.07	-15.0897	15.7869	0.78310	0.0:0.8633:0.1367:0.0	.	70	Q8IWU4	ZNT8_HUMAN	V	21;21;21;21;70	ENSP00000428545:A21V;ENSP00000427760:A21V;ENSP00000407505:A21V;ENSP00000431069:A21V;ENSP00000415011:A70V	ENSP00000407505:A21V	A	+	2	0	SLC30A8	118228511	1.000000	0.71417	0.996000	0.52242	0.290000	0.27261	4.981000	0.63819	1.497000	0.48584	0.655000	0.94253	GCC	SLC30A8	-	NULL	ENSG00000164756		0.493	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1		0.00	36	0	C	NM_173851		118159330	+1			no_errors	ENST00000456015	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
SLC39A12	221074	genome.wustl.edu	37	10	18276412	18276412	+	Silent	SNP	C	C	T	rs549777540		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:18276412C>T	ENST00000377369.2	+	7	1374	c.1101C>T	c.(1099-1101)taC>taT	p.Y367Y	SLC39A12_ENST00000377374.4_Silent_p.Y367Y|SLC39A12_ENST00000377371.3_Silent_p.Y367Y|SLC39A12_ENST00000539911.1_Silent_p.Y233Y	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	367					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						ACTTAGAATACGGCTACAGCA	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		18388	0.0		0.0	False		,,,				2504	0.001																0													93.0	68.0	77.0					10																	18276412		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1101C>T	10.37:g.18276412C>T			B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Silent	SNP	pfam_ZIP	p.Y367	ENST00000377369.2	37	c.1101	CCDS44362.1	10																																																																																			SLC39A12	-	NULL	ENSG00000148482		0.527	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding			0.00	32	0	C	NM_152725		18276412	+1			no_errors	ENST00000377369	ensembl	human	known	74_37	silent	5.41	35	2	SNP	1.000	T
SLC4A4	8671	genome.wustl.edu	37	4	72425833	72425833	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:72425833delA	ENST00000264485.5	+	23	3078	c.2961delA	c.(2959-2961)agafs	p.R987fs	SLC4A4_ENST00000351898.6_Frame_Shift_Del_p.R903fs|SLC4A4_ENST00000340595.3_Frame_Shift_Del_p.R943fs|SLC4A4_ENST00000425175.1_Frame_Shift_Del_p.R987fs	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	987					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TAGCTGTCAGAAAAGGCATGG	0.413																																																	0													139.0	133.0	135.0					4																	72425833		2203	4300	6503	SO:0001589	frameshift_variant	0			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.2961delA	4.37:g.72425833delA	ENSP00000264485:p.Arg987fs		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Frame_Shift_Del	DEL	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.G989fs	ENST00000264485.5	37	c.2961	CCDS43236.1	4																																																																																			SLC4A4	-	tigrfam_HCO3_transpt_euk	ENSG00000080493		0.413	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1		0.00	41	0	A	NM_003759		72425833	+1	tier1		no_errors	ENST00000425175	ensembl	human	known	74_37	frame_shift_del	8.33	33	3	DEL	1.000	-
SLC6A10PB	653562	genome.wustl.edu	37	16	32896410	32896410	+	lincRNA	SNP	G	G	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:32896410G>C	ENST00000398669.2	+	0	0				SLC6A10P_ENST00000330048.5_RNA																							AGCAGCGGTGGACCAGGGGCG	0.786																																																	0																																												0																															16.37:g.32896410G>C				RNA	SNP	-	NULL	ENST00000398669.2	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.786	RP11-989E6.3-002	KNOWN	basic	lincRNA	SLC6A10P	HGNC	lincRNA	OTTHUMT00000432084.1	-	0.00	14	0	G			32896410	-1	tier1	-	no_errors	ENST00000330048	ensembl	human	known	74_37	rna	35.29	11	6	SNP	0.009	C
SLC6A5	9152	genome.wustl.edu	37	11	20628637	20628637	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:20628637C>T	ENST00000525748.1	+	4	1037	c.764C>T	c.(763-765)gCc>gTc	p.A255V		NM_004211.3	NP_004202.2	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 5	255					glycine import (GO:0036233)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)	p.A255V(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(34)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	63					Glycine(DB00145)	GGCCAGTTTGCCAGCCAGGGA	0.572																																																	1	Substitution - Missense(1)	prostate(1)											93.0	83.0	86.0					11																	20628637		2203	4300	6503	SO:0001583	missense	0			AF085412	CCDS7854.1	11p15.1	2013-07-19	2013-07-19		ENSG00000165970	ENSG00000165970		"""Solute carriers"""	11051	protein-coding gene	gene with protein product	"""glycine transporter 2"""	604159	"""solute carrier family 6 (neurotransmitter transporter, glycine), member 5"""	NET1		9845349	Standard	NM_004211		Approved	GLYT2	uc001mqd.3	Q9Y345	OTTHUMG00000166024	ENST00000525748.1:c.764C>T	11.37:g.20628637C>T	ENSP00000434364:p.Ala255Val		O95288|Q4VAM7|Q9BX77	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.A255V	ENST00000525748.1	37	c.764	CCDS7854.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.499525	0.96355	.	.	ENSG00000165970	ENST00000525748	T	0.74737	-0.87	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.81725	0.4883	L	0.45051	1.395	0.80722	D	1	D	0.54601	0.967	P	0.62014	0.897	T	0.82319	-0.0516	10	0.66056	D	0.02	.	19.456	0.94889	0.0:1.0:0.0:0.0	.	255	Q9Y345	SC6A5_HUMAN	V	255	ENSP00000434364:A255V	ENSP00000434364:A255V	A	+	2	0	SLC6A5	20585213	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.767000	0.95098	0.655000	0.94253	GCC	SLC6A5	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000165970		0.572	SLC6A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A5	HGNC	protein_coding	OTTHUMT00000387497.2	-	0.00	61	0	C	NM_004211		20628637	+1	tier1	-	no_errors	ENST00000525748	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
SLIT1	6585	genome.wustl.edu	37	10	98808783	98808783	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:98808783C>T	ENST00000266058.4	-	14	1639	c.1394G>A	c.(1393-1395)cGc>cAc	p.R465H	SLIT1_ENST00000371070.4_Missense_Mutation_p.R465H|ARHGAP19-SLIT1_ENST00000453547.2_3'UTR	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	465	LRRCT 2.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		ACTGGCACAGCGGGCACCACT	0.627																																																	0													94.0	84.0	88.0					10																	98808783		2203	4300	6503	SO:0001583	missense	0			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1394G>A	10.37:g.98808783C>T	ENSP00000266058:p.Arg465His		Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_EG-like_dom,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.R465H	ENST00000266058.4	37	c.1394	CCDS7453.1	10	.	.	.	.	.	.	.	.	.	.	C	32	5.184858	0.94885	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;T	0.81996	-1.56;-1.56;0.63	5.14	5.14	0.70334	Cysteine-rich flanking region, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.91666	0.7366	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.92493	0.6002	10	0.87932	D	0	.	18.7937	0.91985	0.0:1.0:0.0:0.0	.	475;465	E7EWQ8;O75093	.;SLIT1_HUMAN	H	465;475;465;458	ENSP00000266058:R465H;ENSP00000360109:R465H;ENSP00000315005:R458H	ENSP00000266058:R465H	R	-	2	0	SLIT1	98798773	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.647000	0.83462	2.662000	0.90505	0.557000	0.71058	CGC	SLIT1	-	pfam_Cys-rich_flank_reg_C,smart_Cys-rich_flank_reg_C	ENSG00000187122		0.627	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	HGNC	protein_coding	OTTHUMT00000049636.1	-	0.00	83	0	C	NM_003061		98808783	-1	tier1	-	no_errors	ENST00000266058	ensembl	human	known	74_37	missense	14.49	59	10	SNP	1.000	T
SMCHD1	23347	genome.wustl.edu	37	18	2688427	2688427	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:2688427C>T	ENST00000320876.6	+	6	1012	c.674C>T	c.(673-675)cCa>cTa	p.P225L	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.P225L	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	225					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GTACCAGTGCCACGCAGTTTA	0.348																																																	0													105.0	102.0	103.0					18																	2688427		1897	4116	6013	SO:0001583	missense	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.674C>T	18.37:g.2688427C>T	ENSP00000326603:p.Pro225Leu		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.P225L	ENST00000320876.6	37	c.674	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670605	0.47781	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.24723	1.84;1.85	5.08	5.08	0.68730	ATPase-like, ATP-binding domain (2);	0.136039	0.51477	D	0.000100	T	0.42245	0.1194	L	0.55481	1.735	0.46654	D	0.999148	D	0.64830	0.994	P	0.59357	0.856	T	0.29671	-1.0004	10	0.87932	D	0	.	14.5483	0.68047	0.147:0.853:0.0:0.0	.	225	A6NHR9	SMHD1_HUMAN	L	225	ENSP00000326603:P225L;ENSP00000261598:P225L	ENSP00000261598:P225L	P	+	2	0	SMCHD1	2678427	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.275000	0.51639	2.502000	0.84385	0.655000	0.94253	CCA	SMCHD1	-	superfamily_HATPase_ATP-bd	ENSG00000101596		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	-	0.00	82	0	C			2688427	+1	tier1	-	no_errors	ENST00000320876	ensembl	human	known	74_37	missense	11.29	110	14	SNP	0.997	T
SNHG14	104472715	genome.wustl.edu	37	15	25432513	25432513	+	RNA	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:25432513A>C	ENST00000424208.1	+	0	648				SNORD115-10_ENST00000365073.1_RNA|SNORD115-11_ENST00000363616.1_RNA|SNORD115-8_ENST00000363856.1_RNA|SNHG14_ENST00000414175.1_RNA|SNORD115-9_ENST00000362912.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		CTGTGGAGGAAGACTTGCCAT	0.612																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25432513A>C				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.612	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	26	0	A			25432513	+1	tier1	-	no_errors	ENST00000424208	ensembl	human	known	74_37	rna	50.00	15	15	SNP	0.000	C
MTCL1	23255	genome.wustl.edu	37	18	8793068	8793068	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr18:8793068G>A	ENST00000359865.3	+	8	2102	c.1960G>A	c.(1960-1962)Gcc>Acc	p.A654T	SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000306329.11_Intron|SOGA2_ENST00000400050.3_Intron|SOGA2_ENST00000517570.1_Intron|SOGA2_ENST00000518815.1_Intron	NM_015210.3	NP_056025.2												p.A654P(1)									CGTGCAGGCGGCCAGACTGCA	0.512																																																	1	Substitution - Missense(1)	kidney(1)											99.0	109.0	106.0					18																	8793068		2203	4300	6503	SO:0001583	missense	0																														ENST00000359865.3:c.1960G>A	18.37:g.8793068G>A	ENSP00000352927:p.Ala654Thr			Missense_Mutation	SNP	pfam_SOGA	p.A654T	ENST00000359865.3	37	c.1960	CCDS11841.1	18	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121579	0.37436	.	.	ENSG00000168502	ENST00000306329;ENST00000359865	T	0.35789	1.29	5.68	-1.89	0.07689	.	0.762462	0.11601	N	0.547742	T	0.09512	0.0234	N	0.00707	-1.245	0.52501	D	0.999957	B	0.02656	0.0	B	0.04013	0.001	T	0.32455	-0.9906	10	0.14252	T	0.57	.	8.3738	0.32432	0.4585:0.109:0.4325:0.0	.	654	Q9Y4B5-3	.	T	675;654	ENSP00000352927:A654T	ENSP00000305027:A675T	A	+	1	0	CCDC165	8783068	1.000000	0.71417	0.491000	0.27477	0.894000	0.52154	0.921000	0.28718	-0.615000	0.05679	0.561000	0.74099	GCC	SOGA2	-	NULL	ENSG00000168502		0.512	SOGA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000254476.1		0.00	36	0	G			8793068	+1			no_errors	ENST00000359865	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.711	A
SP8	221833	genome.wustl.edu	37	7	20824044	20824046	+	In_Frame_Del	DEL	GCC	GCC	-	rs367927423		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:20824044_20824046delGCC	ENST00000361443.4	-	3	1573_1575	c.1336_1338delGGC	c.(1336-1338)ggcdel	p.G446del	SP8_ENST00000418710.2_In_Frame_Del_p.G464del	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	446					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						AGCCCGCCGAgccgccgccgccg	0.714																																																	0																																										SO:0001651	inframe_deletion	0				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.1336_1338delGGC	7.37:g.20824053_20824055delGCC	ENSP00000354482:p.Gly446del		Q7Z615|Q7Z616|Q96MJ1	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Antifreeze_1	p.G464in_frame_del	ENST00000361443.4	37	c.1392_1390	CCDS5372.1	7																																																																																			SP8	-	NULL	ENSG00000164651		0.714	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP8	HGNC	protein_coding	OTTHUMT00000326904.2		0.00	20	0	GCC			20824046	-1	tier1		no_errors	ENST00000418710	ensembl	human	known	74_37	in_frame_del	27.27	8	3	DEL	1.000:1.000:1.000	-
SPAG17	200162	genome.wustl.edu	37	1	118624196	118624196	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:118624196T>A	ENST00000336338.5	-	14	1897	c.1832A>T	c.(1831-1833)gAg>gTg	p.E611V		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	611						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTCATCAACCTCAGAGAGCTT	0.448																																																	0													137.0	129.0	132.0					1																	118624196		2203	4300	6503	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1832A>T	1.37:g.118624196T>A	ENSP00000337804:p.Glu611Val		Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.E611V	ENST00000336338.5	37	c.1832	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	T	13.42	2.231707	0.39399	.	.	ENSG00000155761	ENST00000336338	T	0.19250	2.16	5.34	2.83	0.33086	.	0.796041	0.12231	N	0.487469	T	0.10165	0.0249	M	0.61703	1.905	0.24732	N	0.993081	P	0.45827	0.867	B	0.43103	0.408	T	0.13926	-1.0491	10	0.41790	T	0.15	.	5.5885	0.17287	0.0:0.1204:0.3:0.5796	.	611	Q6Q759	SPG17_HUMAN	V	611	ENSP00000337804:E611V	ENSP00000337804:E611V	E	-	2	0	SPAG17	118425719	0.762000	0.28451	1.000000	0.80357	0.969000	0.65631	0.499000	0.22546	0.964000	0.38108	0.482000	0.46254	GAG	SPAG17	-	NULL	ENSG00000155761		0.448	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1		0.00	46	0	T	NM_206996		118624196	-1			no_errors	ENST00000336338	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.947	A
SRFBP1	153443	genome.wustl.edu	37	5	121330324	121330324	+	Missense_Mutation	SNP	G	G	T	rs199655581		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:121330324G>T	ENST00000339397.4	+	4	301	c.229G>T	c.(229-231)Gct>Tct	p.A77S		NM_152546.2	NP_689759.2			serum response factor binding protein 1											central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|skin(1)	15		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000227)|Epithelial(69;0.000365)|all cancers(49;0.00517)		AACTAAATCTGCTCTTGGTGA	0.264																																																	0								G	SER/ALA	2,3572		0,2,1785	54.0	53.0	53.0		229	5.7	1.0	5		53	3,8075		0,3,4036	yes	missense	SRFBP1	NM_152546.2	99	0,5,5821	TT,TG,GG		0.0371,0.056,0.0429	probably-damaging	77/430	121330324	5,11647	1787	4039	5826	SO:0001583	missense	0			AK058015	CCDS43354.1	5q23.1	2006-12-21				ENSG00000151304			26333	protein-coding gene	gene with protein product	"""BUD22 homolog (S. cerevisiae)"""	610479				15492011	Standard	NM_152546		Approved	FLJ25286, p49, STRAP, BUD22, Rlb1	uc003kst.1	Q8NEF9		ENST00000339397.4:c.229G>T	5.37:g.121330324G>T	ENSP00000341324:p.Ala77Ser			Missense_Mutation	SNP	pfam_Bud-site_select_BUD22	p.A77S	ENST00000339397.4	37	c.229	CCDS43354.1	5	.	.	.	.	.	.	.	.	.	.	G	22.5	4.303032	0.81136	5.6E-4	3.71E-4	ENSG00000151304	ENST00000339397	.	.	.	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.78786	0.4338	M	0.75264	2.295	0.51482	D	0.999926	D	0.89917	1.0	D	0.80764	0.994	T	0.80303	-0.1439	9	0.87932	D	0	-18.4422	15.6262	0.76859	0.0:0.0:1.0:0.0	.	77	Q8NEF9	SRFB1_HUMAN	S	77	.	ENSP00000341324:A77S	A	+	1	0	SRFBP1	121358223	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	4.824000	0.62701	2.833000	0.97629	0.585000	0.79938	GCT	SRFBP1	-	NULL	ENSG00000151304		0.264	SRFBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRFBP1	HGNC	protein_coding	OTTHUMT00000371200.1		0.00	58	0	G	NM_152546		121330324	+1			no_errors	ENST00000339397	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
STAT3	6774	genome.wustl.edu	37	17	40475078	40475078	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:40475078C>T	ENST00000264657.5	-	20	2144	c.1832G>A	c.(1831-1833)aGt>aAt	p.S611N	STAT3_ENST00000585517.1_Missense_Mutation_p.S611N|STAT3_ENST00000404395.3_Missense_Mutation_p.S611N|STAT3_ENST00000389272.3_Missense_Mutation_p.S513N|STAT3_ENST00000588969.1_Missense_Mutation_p.S611N	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	611	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.		S -> N (in AD-HIES). {ECO:0000269|PubMed:17881745}.		acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		GCTGCTTTCACTGAATCTTAG	0.572									Hyperimmunoglobulin E Recurrent Infection Syndrome		OREG0024421	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0			GRCh37	CM076543	STAT3	M							141.0	132.0	135.0					17																	40475078		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1832G>A	17.37:g.40475078C>T	ENSP00000264657:p.Ser611Asn	893	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.S611N	ENST00000264657.5	37	c.1832	CCDS32656.1	17	.	.	.	.	.	.	.	.	.	.	C	23.0	4.357276	0.82243	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.95069	-3.6;-3.6;-3.6	5.29	5.29	0.74685	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.94272	0.8160	M	0.70108	2.13	0.80722	D	1	B;B;B	0.22983	0.063;0.078;0.078	B;B;B	0.25987	0.039;0.065;0.065	D	0.92076	0.5668	10	0.87932	D	0	-36.0514	19.12	0.93358	0.0:1.0:0.0:0.0	.	611;611;611	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	N	611;513;611	ENSP00000264657:S611N;ENSP00000373923:S513N;ENSP00000384943:S611N	ENSP00000264657:S611N	S	-	2	0	STAT3	37728604	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.912000	0.69948	2.752000	0.94435	0.655000	0.94253	AGT	STAT3	-	pfam_SH2,pfscan_SH2	ENSG00000168610		0.572	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	HGNC	protein_coding	OTTHUMT00000319353.3	-	0.00	44	0	C	NM_139276, NM_003150		40475078	-1	tier1	-	no_errors	ENST00000264657	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
STT3B	201595	genome.wustl.edu	37	3	31674472	31674472	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:31674472G>T	ENST00000295770.2	+	15	2442	c.2233G>T	c.(2233-2235)Gag>Tag	p.E745*		NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	745					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						ACGTAATGCTGAGATTGGAAA	0.368																																																	0													134.0	134.0	134.0					3																	31674472		2203	4300	6503	SO:0001587	stop_gained	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.2233G>T	3.37:g.31674472G>T	ENSP00000295770:p.Glu745*		Q96JZ4|Q96KY7	Nonsense_Mutation	SNP	pfam_Oligo_trans_STT3	p.E745*	ENST00000295770.2	37	c.2233	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	42	9.577115	0.99210	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-15.4458	19.7383	0.96217	0.0:0.0:1.0:0.0	.	.	.	.	X	745	.	ENSP00000295770:E745X	E	+	1	0	STT3B	31649476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.744000	0.94065	0.655000	0.94253	GAG	STT3B	-	NULL	ENSG00000163527		0.368	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2		0.00	65	0	G	NM_178862		31674472	+1			no_errors	ENST00000295770	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	T
SYNCRIP	10492	genome.wustl.edu	37	6	86332363	86332363	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:86332363T>A	ENST00000369622.3	-	8	1345	c.845A>T	c.(844-846)aAg>aTg	p.K282M	SYNCRIP_ENST00000355238.6_Missense_Mutation_p.K282M	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	282	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.K282T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		GTTTTTTTTCTTGTCATCCGG	0.418																																																	1	Substitution - Missense(1)	lung(1)											105.0	109.0	108.0					6																	86332363		2203	4300	6503	SO:0001583	missense	0			AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.845A>T	6.37:g.86332363T>A	ENSP00000358635:p.Lys282Met		E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.K282M	ENST00000369622.3	37	c.845	CCDS5005.1	6	.	.	.	.	.	.	.	.	.	.	T	28.8	4.954979	0.92726	.	.	ENSG00000135316	ENST00000355238;ENST00000369622	T;T	0.17370	2.28;2.28	5.95	5.95	0.96441	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	M	0.87971	2.92	0.80722	D	1	D;D;D;P;D;D;D	0.89917	1.0;1.0;1.0;0.849;1.0;1.0;1.0	D;D;D;P;D;D;D	0.85130	0.992;0.99;0.992;0.857;0.997;0.987;0.994	T	0.50074	-0.8870	10	0.87932	D	0	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	282;282;184;130;282;282;282	O60506;O60506-2;B7Z645;O60506-5;O60506-4;O60506-3;B2R8Z8	HNRPQ_HUMAN;.;.;.;.;.;.	M	282	ENSP00000347380:K282M;ENSP00000358635:K282M	ENSP00000347380:K282M	K	-	2	0	SYNCRIP	86389082	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.961000	0.87903	2.279000	0.76181	0.533000	0.62120	AAG	SYNCRIP	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000135316		0.418	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNCRIP	HGNC	protein_coding	OTTHUMT00000041396.1		0.00	49	0	T	NM_006372		86332363	-1			no_errors	ENST00000369622	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152473212	152473212	+	Missense_Mutation	SNP	C	C	T	rs201956180		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:152473212C>T	ENST00000367255.5	-	134	24795	c.24194G>A	c.(24193-24195)cGc>cAc	p.R8065H	SYNE1_ENST00000448038.1_Missense_Mutation_p.R7994H|SYNE1_ENST00000265368.4_Missense_Mutation_p.R8065H|SYNE1_ENST00000423061.1_Missense_Mutation_p.R7994H|SYNE1_ENST00000354674.4_Missense_Mutation_p.R220H|SYNE1_ENST00000539504.1_Missense_Mutation_p.R220H|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000341594.5_Missense_Mutation_p.R7677H|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2589H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8065					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTGGCCAGGCGGCGGTACTG	0.547										HNSCC(10;0.0054)																																							0								C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	115.0	88.0	97.0		23981,24194	5.7	1.0	6		97	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	SYNE1	NM_033071.3,NM_182961.3	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	7994/8750,8065/8798	152473212	1,13005	2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24194G>A	6.37:g.152473212C>T	ENSP00000356224:p.Arg8065His		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R8065H	ENST00000367255.5	37	c.24194	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	36	5.817958	0.96982	0.0	1.16E-4	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.51817	1.25;0.69;0.69;1.25;1.25;1.25;1.25;0.69;0.69;0.69	5.72	5.72	0.89469	.	0.000000	0.53938	D	0.000047	T	0.68311	0.2987	M	0.80982	2.52	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;1.0;0.999;0.996	T	0.71148	-0.4677	10	0.72032	D	0.01	.	19.8937	0.96942	0.0:1.0:0.0:0.0	.	8065;8065;7994;7994;267	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	H	8065;220;711;7994;8065;7994;7677;2589;227;222;987;220	ENSP00000356224:R8065H;ENSP00000441052:R220H;ENSP00000356226:R711H;ENSP00000396024:R7994H;ENSP00000265368:R8065H;ENSP00000390975:R7994H;ENSP00000341887:R7677H;ENSP00000349276:R2589H;ENSP00000356220:R987H;ENSP00000346701:R220H	ENSP00000265368:R8065H	R	-	2	0	SYNE1	152514905	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.625000	0.83145	2.716000	0.92895	0.650000	0.86243	CGC	SYNE1	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.547	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	57	0	C	NM_182961		152473212	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	30.77	27	12	SNP	1.000	T
TBC1D27	96597	genome.wustl.edu	37	17	16829387	16829387	+	RNA	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:16829387A>G	ENST00000261651.2	-	0	2993									TBC1 domain family, member 27																		AGACCCCTCCATGAGGCTGCG	0.612																																																	0																																												0			AK024458		17p11.2	2013-04-03			ENSG00000128438	ENSG00000128438			28104	other	unknown							Standard	XR_424798		Approved				OTTHUMG00000059260		17.37:g.16829387A>G				RNA	SNP	-	NULL	ENST00000261651.2	37	NULL		17																																																																																			TBC1D27	-	-	ENSG00000128438		0.612	TBC1D27-001	KNOWN	basic	processed_transcript	TBC1D27	HGNC	pseudogene	OTTHUMT00000131472.1	-	0.00	51	0	A	XM_002343481		16829387	-1	tier1	-	no_errors	ENST00000261651	ensembl	human	known	74_37	rna	29.79	33	14	SNP	0.004	G
TEAD4	7004	genome.wustl.edu	37	12	3104001	3104001	+	Silent	SNP	C	C	T	rs149191988		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:3104001C>T	ENST00000359864.2	+	3	259	c.69C>T	c.(67-69)acC>acT	p.T23T	TEAD4_ENST00000358409.2_Silent_p.T23T|TEAD4_ENST00000397122.2_Intron	NM_003213.3	NP_003204	Q15561	TEAD4_HUMAN	TEA domain family member 4	23					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			AGGGGAGCACCGCCTCTGGGG	0.652																																																	0								C	,,	0,4406		0,0,2203	73.0	78.0	76.0		69,69,	3.5	0.9	12	dbSNP_134	76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,intron	TEAD4	NM_003213.3,NM_201441.2,NM_201443.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	23/435,23/392,	3104001	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000359864.2:c.69C>T	12.37:g.3104001C>T			H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Silent	SNP	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.T23	ENST00000359864.2	37	c.69	CCDS31729.1	12																																																																																			TEAD4	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000197905		0.652	TEAD4-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	TEAD4	HGNC	protein_coding	OTTHUMT00000398475.1	-	0.00	63	0	C	NM_003213		3104001	+1	tier1	rs149191988	no_errors	ENST00000359864	ensembl	human	known	74_37	silent	17.39	38	8	SNP	0.993	T
TENM1	10178	genome.wustl.edu	37	X	123631044	123631044	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:123631044C>T	ENST00000371130.3	-	20	3580	c.3517G>A	c.(3517-3519)Ggt>Agt	p.G1173S	TENM1_ENST00000461429.1_5'Flank|TENM1_ENST00000422452.2_Missense_Mutation_p.G1173S	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1173					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGTCCATTACCCATTATGGTT	0.453																																																	0													114.0	96.0	102.0					X																	123631044		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3517G>A	X.37:g.123631044C>T	ENSP00000360171:p.Gly1173Ser		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.G1173S	ENST00000371130.3	37	c.3517	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173834	0.78452	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.97041	-4.22;-3.88	5.31	5.31	0.75309	.	0.056707	0.64402	D	0.000001	D	0.98713	0.9568	M	0.93016	3.37	0.80722	D	1	P;D;D	0.69078	0.813;0.977;0.997	B;P;D	0.63793	0.357;0.597;0.918	D	0.99748	1.1017	10	0.87932	D	0	.	18.0775	0.89432	0.0:1.0:0.0:0.0	.	1172;1173;1173	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	S	1173	ENSP00000360171:G1173S;ENSP00000403954:G1173S	ENSP00000360171:G1173S	G	-	1	0	ODZ1	123458725	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.772000	0.85439	2.204000	0.70986	0.600000	0.82982	GGT	TENM1	-	NULL	ENSG00000009694		0.453	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	43	0	C	NM_014253		123631044	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	43.90	23	18	SNP	1.000	T
TF	7018	genome.wustl.edu	37	3	133476751	133476751	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:133476751G>T	ENST00000402696.3	+	8	1494	c.1009G>T	c.(1009-1011)Gag>Tag	p.E337*	TF_ENST00000264998.3_Nonsense_Mutation_p.E210*	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	337	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)	p.E337Q(2)		NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	CCTGGGCTATGAGTATGTCAC	0.537																																																	2	Substitution - Missense(2)	breast(2)											83.0	76.0	78.0					3																	133476751		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.1009G>T	3.37:g.133476751G>T	ENSP00000385834:p.Glu337*		O43890|Q1HBA5|Q9NQB8|Q9UHV0	Nonsense_Mutation	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.E337*	ENST00000402696.3	37	c.1009	CCDS3080.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.986321	0.97983	.	.	ENSG00000091513	ENST00000402696;ENST00000264998	.	.	.	5.1	-3.17	0.05202	.	0.948679	0.08974	N	0.866829	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-13.386	11.3979	0.49854	0.1469:0.5699:0.2833:0.0	.	.	.	.	X	337;210	.	ENSP00000264998:E210X	E	+	1	0	TF	134959441	0.000000	0.05858	0.001000	0.08648	0.792000	0.44763	-0.855000	0.04295	-0.342000	0.08363	0.561000	0.74099	GAG	TF	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	ENSG00000091513		0.537	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	HGNC	protein_coding	OTTHUMT00000317775.1		0.00	54	0	G	NM_001063		133476751	+1			no_errors	ENST00000402696	ensembl	human	known	74_37	nonsense	6.00	47	3	SNP	0.000	T
THOC2	57187	genome.wustl.edu	37	X	122802071	122802071	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chrX:122802071G>T	ENST00000245838.8	-	10	987	c.956C>A	c.(955-957)tCt>tAt	p.S319Y	THOC2_ENST00000355725.4_Missense_Mutation_p.S319Y|THOC2_ENST00000491737.1_Missense_Mutation_p.S204Y	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	319					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						tttttcAGAAGACAACACAAC	0.348																																																	0													198.0	175.0	182.0					X																	122802071		1825	4076	5901	SO:0001583	missense	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.956C>A	X.37:g.122802071G>T	ENSP00000245838:p.Ser319Tyr		A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.S319Y	ENST00000245838.8	37	c.956	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	G	17.46	3.395663	0.62177	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.38	5.38	0.77491	.	0.195954	0.35805	N	0.002963	T	0.66237	0.2769	L	0.57536	1.79	0.52501	D	0.999957	B;B	0.06786	0.0;0.001	B;B	0.09377	0.001;0.004	T	0.64470	-0.6400	9	0.72032	D	0.01	-7.6386	18.2651	0.90050	0.0:0.0:1.0:0.0	.	240;319	B4DKZ6;Q8NI27	.;THOC2_HUMAN	Y	319;319;204;240	.	ENSP00000245838:S319Y	S	-	2	0	THOC2	122629752	1.000000	0.71417	0.996000	0.52242	0.964000	0.63967	8.979000	0.93455	2.250000	0.74265	0.600000	0.82982	TCT	THOC2	-	NULL	ENSG00000125676		0.348	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	-	0.00	42	0	G			122802071	-1	tier1	-	no_errors	ENST00000245838	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
TIGD7	91151	genome.wustl.edu	37	16	3349697	3349697	+	Silent	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:3349697G>T	ENST00000396862.1	-	2	2746	c.918C>A	c.(916-918)tcC>tcA	p.S306S	TIGD7_ENST00000268674.2_Silent_p.S306S|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	306	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CACTGGTTAGGGATTCAGAGG	0.438																																																	0													50.0	50.0	50.0					16																	3349697		2197	4300	6497	SO:0001819	synonymous_variant	0			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.918C>A	16.37:g.3349697G>T			Q9BXZ0	Silent	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.S306	ENST00000396862.1	37	c.918	CCDS10500.1	16																																																																																			TIGD7	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000140993		0.438	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1		0.00	28	0	G	NM_033208		3349697	-1			no_errors	ENST00000268674	ensembl	human	known	74_37	silent	10.00	18	2	SNP	0.486	T
TKT	7086	genome.wustl.edu	37	3	53262291	53262291	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:53262291C>T	ENST00000462138.1	-	11	1568		c.e11+1		TKT_ENST00000296289.6_Splice_Site|TKT_ENST00000461139.1_Splice_Site|TKT_ENST00000423516.1_Splice_Site|TKT_ENST00000423525.2_Splice_Site			P29401	TKT_HUMAN	transketolase						carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		GAGGCACTGACCTTGGCTTGT	0.602																																					Colon(133;1506 2347 35238 42177)												0													126.0	120.0	122.0					3																	53262291		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.1479+1G>A	3.37:g.53262291C>T			A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Splice_Site	SNP	-	e11+1	ENST00000462138.1	37	c.1479+1	CCDS2871.1	3	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800906	0.90538	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289;ENST00000414014	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1431	0.93452	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TKT	53237331	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.731000	0.84895	2.590000	0.87494	0.563000	0.77884	.	TKT	-	-	ENSG00000163931		0.602	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKT	HGNC	protein_coding	OTTHUMT00000350356.1	-	0.00	56	0	C		Intron	53262291	-1	tier1	-	no_errors	ENST00000423525	ensembl	human	known	74_37	splice_site	8.00	46	4	SNP	1.000	T
TMEM117	84216	genome.wustl.edu	37	12	44783276	44783276	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:44783276A>C	ENST00000266534.3	+	0	2493				TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_3'UTR	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		AAGGAACTGAAGTTTTCATCA	0.398																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.*821A>C	12.37:g.44783276A>C				RNA	SNP	-	NULL	ENST00000266534.3	37	NULL	CCDS8745.1	12																																																																																			TMEM117	-	-	ENSG00000139173		0.398	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM117	HGNC	protein_coding	OTTHUMT00000403969.1	-	0.00	38	0	A	NM_032256		44783276	+1	tier1	-	no_errors	ENST00000546978	ensembl	human	known	74_37	rna	24.32	28	9	SNP	0.929	C
TMEM8B	51754	genome.wustl.edu	37	9	35835363	35835363	+	Intron	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:35835363C>A	ENST00000377991.4	+	4	565				TMEM8B_ENST00000439587.2_Intron|TMEM8B_ENST00000377996.1_Intron|TMEM8B_ENST00000473947.1_3'UTR|TMEM8B_ENST00000377988.2_Intron	NM_001042589.2	NP_001036054.1	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B						cell-matrix adhesion (GO:0007160)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle (GO:0007346)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	7						TAAAGGCCAGCAGGTCACCCA	0.612																																																	0																																										SO:0001627	intron_variant	0			BC043384	CCDS6595.1, CCDS43800.1	9p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000137103	ENSG00000137103			21427	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma expressed 6"""		"""chromosome 9 open reading frame 127"""	C9orf127		12918109, 8619474	Standard	NM_016446		Approved	NAG-5, NGX6	uc003zym.4	A6NDV4	OTTHUMG00000019885	ENST00000377991.4:c.-451+148C>A	9.37:g.35835363C>A			B3KQF3|O75539|Q49AB1|Q4KMX5|Q5TCW5|Q9HBY2|Q9P0U7	RNA	SNP	-	NULL	ENST00000377991.4	37	NULL	CCDS43800.1	9																																																																																			TMEM8B	-	-	ENSG00000137103		0.612	TMEM8B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM8B	HGNC	protein_coding	OTTHUMT00000052388.2	-	0.00	52	0	C	NM_016446		35835363	+1	tier1	-	no_errors	ENST00000464519	ensembl	human	known	74_37	rna	31.58	26	12	SNP	0.091	A
TMTC1	83857	genome.wustl.edu	37	12	29936404	29936404	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr12:29936404G>A	ENST00000539277.1	-	1	339	c.281C>T	c.(280-282)cCg>cTg	p.P94L	TMTC1_ENST00000256062.5_Intron|TMTC1_ENST00000552618.1_Missense_Mutation_p.P94L|TMTC1_ENST00000551659.1_Missense_Mutation_p.P94L|TMTC1_ENST00000381224.2_Intron	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	94						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GACGCAGAGCGGCCGGTAGGA	0.692																																																	0																																										SO:0001583	missense	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.281C>T	12.37:g.29936404G>A	ENSP00000442046:p.Pro94Leu		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P94L	ENST00000539277.1	37	c.281	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	G	21.5	4.162469	0.78226	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	D;D;D	0.94184	-3.37;-3.37;-3.37	3.16	2.24	0.28232	.	.	.	.	.	D	0.97167	0.9074	H	0.96805	3.885	0.80722	D	1	.	.	.	.	.	.	D	0.96217	0.9157	6	.	.	.	.	9.2945	0.37806	0.1142:0.0:0.8858:0.0	.	.	.	.	L	94	ENSP00000448112:P94L;ENSP00000449043:P94L;ENSP00000442046:P94L	.	P	-	2	0	TMTC1	29827671	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	8.421000	0.90259	0.493000	0.27837	0.484000	0.47621	CCG	TMTC1	-	NULL	ENSG00000133687		0.692	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	-	0.00	151	0	G	NM_031920		29936404	-1	tier1	-	no_errors	ENST00000539277	ensembl	human	putative	74_37	missense	24.11	107	34	SNP	1.000	A
TOP2B	7155	genome.wustl.edu	37	3	25675418	25675418	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:25675418C>T	ENST00000264331.4	-	8	939	c.940G>A	c.(940-942)Gca>Aca	p.A314T	TOP2B_ENST00000435706.2_Missense_Mutation_p.A309T	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	314					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	CTTTCATTTGCAAGCTCATGA	0.338																																																	0													131.0	125.0	127.0					3																	25675418		1849	4089	5938	SO:0001583	missense	0			X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.940G>A	3.37:g.25675418C>T	ENSP00000264331:p.Ala314Thr		Q13600|Q9UMG8|Q9UQP8	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.A314T	ENST00000264331.4	37	c.940		3	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362015	0.82353	.	.	ENSG00000077097	ENST00000435706;ENST00000264331;ENST00000424225	T;T	0.44083	0.93;0.93	5.49	5.49	0.81192	.	0.179749	0.50627	D	0.000115	T	0.33818	0.0876	N	0.17631	0.505	0.80722	D	1	B	0.12013	0.005	B	0.16722	0.016	T	0.07139	-1.0788	10	0.46703	T	0.11	-3.5866	19.3421	0.94347	0.0:1.0:0.0:0.0	.	309	Q02880-2	.	T	309;314;309	ENSP00000396704:A309T;ENSP00000264331:A314T	ENSP00000264331:A314T	A	-	1	0	TOP2B	25650422	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.590000	0.87494	0.650000	0.86243	GCA	TOP2B	-	pfam_Topo_IIA_bsu_dom2,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA	ENSG00000077097		0.338	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	TOP2B	HGNC	protein_coding		-	0.00	56	0	C			25675418	-1	tier1	-	no_errors	ENST00000264331	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
TOPBP1	11073	genome.wustl.edu	37	3	133362168	133362168	+	Missense_Mutation	SNP	G	G	T	rs374554497		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:133362168G>T	ENST00000260810.5	-	12	2028	c.1897C>A	c.(1897-1899)Ctc>Atc	p.L633I	TOPBP1_ENST00000511439.1_5'Flank	NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	633	BRCT 4. {ECO:0000255|PROSITE- ProRule:PRU00033}.				cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)	p.L633F(1)|p.L546F(1)		breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						GGTGTGAAGAGAGGATTCGAC	0.373								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												2	Substitution - Missense(2)	lung(2)											83.0	78.0	80.0					3																	133362168		1863	4102	5965	SO:0001583	missense	0			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.1897C>A	3.37:g.133362168G>T	ENSP00000260810:p.Leu633Ile		B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.L633I	ENST00000260810.5	37	c.1897	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166762	0.78339	.	.	ENSG00000163781	ENST00000260810	T	0.15139	2.45	5.86	4.98	0.66077	BRCT (2);	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	M	0.66939	2.045	0.51233	D	0.999913	D	0.89917	1.0	D	0.83275	0.996	T	0.22941	-1.0202	10	0.41790	T	0.15	.	16.9902	0.86351	0.0:0.1275:0.8725:0.0	.	633	Q92547	TOPB1_HUMAN	I	633	ENSP00000260810:L633I	ENSP00000260810:L633I	L	-	1	0	TOPBP1	134844858	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.219000	0.72231	1.462000	0.47948	0.655000	0.94253	CTC	TOPBP1	-	superfamily_BRCT_dom,pfscan_BRCT_dom	ENSG00000163781		0.373	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1		0.00	46	0	G	NM_007027		133362168	-1			no_errors	ENST00000260810	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578395	7578395	+	Missense_Mutation	SNP	G	G	A	rs587780070		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr17:7578395G>A	ENST00000269305.4	-	5	724	c.535C>T	c.(535-537)Cat>Tat	p.H179Y	TP53_ENST00000445888.2_Missense_Mutation_p.H179Y|TP53_ENST00000359597.4_Missense_Mutation_p.H179Y|TP53_ENST00000455263.2_Missense_Mutation_p.H179Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000413465.2_Missense_Mutation_p.H179Y|TP53_ENST00000420246.2_Missense_Mutation_p.H179Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179Y(98)|p.H179N(16)|p.H179D(13)|p.P177_C182delPHHERC(8)|p.0?(8)|p.H47Y(6)|p.H86Y(6)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.P177fs*3(2)|p.V173fs*59(2)|p.R174fs*1(2)|p.H179fs*68(1)|p.C176fs*65(1)|p.C176fs*68(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.H179del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.H47D(1)|p.R174fs*3(1)|p.H86D(1)|p.H178_H179>QY(1)|p.H47N(1)|p.H86N(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCGCTCATGGTGGGGGCAG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	197	Substitution - Missense(143)|Deletion - In frame(25)|Deletion - Frameshift(19)|Whole gene deletion(8)|Complex - deletion inframe(1)|Complex - compound substitution(1)	skin(28)|upper_aerodigestive_tract(27)|large_intestine(27)|lung(27)|breast(18)|haematopoietic_and_lymphoid_tissue(11)|oesophagus(11)|central_nervous_system(8)|ovary(8)|stomach(7)|liver(7)|bone(5)|urinary_tract(3)|soft_tissue(2)|pancreas(2)|cervix(1)|vulva(1)|eye(1)|kidney(1)|endometrium(1)|prostate(1)	GRCh37	CM067054	TP53	M							47.0	47.0	47.0					17																	7578395		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.535C>T	17.37:g.7578395G>A	ENSP00000269305:p.His179Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H179Y	ENST00000269305.4	37	c.535	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.137178	0.94517	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.59	5.59	0.84812	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	D	0.000000	D	0.99914	0.9959	M	0.88640	2.97	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.992;1.0;0.989;1.0;0.999;1.0;0.997	D;D;D;D;D;D;D	0.97110	0.953;0.997;0.941;1.0;0.993;0.995;0.958	D	0.96190	0.9137	10	0.87932	D	0	-15.4889	17.4784	0.87667	0.0:0.0:1.0:0.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179Y;ENSP00000352610:H179Y;ENSP00000269305:H179Y;ENSP00000398846:H179Y;ENSP00000391127:H179Y;ENSP00000391478:H179Y;ENSP00000425104:H47Y;ENSP00000423862:H86Y	ENSP00000269305:H179Y	H	-	1	0	TP53	7519120	1.000000	0.71417	0.990000	0.47175	0.864000	0.49448	9.813000	0.99286	2.804000	0.96469	0.655000	0.94253	CAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	36	0	G	NM_000546		7578395	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	A
CROT	54677	genome.wustl.edu	37	7	86974517	86974517	+	5'Flank	SNP	T	T	C			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:86974517T>C	ENST00000331536.3	+	0	0				CROT_ENST00000412227.2_5'Flank|CROT_ENST00000442291.1_5'Flank|TP53TG1_ENST00000359941.5_lincRNA|CROT_ENST00000419147.2_5'Flank	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase						carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	AGCGGCTCACTGGGAATGGGG	0.522																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653		7.37:g.86974517T>C	Exception_encountered		A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	RNA	SNP	-	NULL	ENST00000331536.3	37	NULL	CCDS5604.1	7																																																																																			TP53TG1	-	-	ENSG00000182165		0.522	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53TG1	HGNC	protein_coding	OTTHUMT00000253485.1	-	0.00	49	0	T	NM_021151		86974517	-1	tier1	-	no_errors	ENST00000359941	ensembl	human	known	74_37	rna	36.73	31	18	SNP	0.000	C
TRAP1	10131	genome.wustl.edu	37	16	3722755	3722755	+	Missense_Mutation	SNP	G	G	T	rs139081468	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:3722755G>T	ENST00000246957.5	-	10	1199	c.1111C>A	c.(1111-1113)Ctc>Atc	p.L371I	TRAP1_ENST00000538171.1_Missense_Mutation_p.L318I|TRAP1_ENST00000573872.1_Intron|TRAP1_ENST00000575671.1_Missense_Mutation_p.L162I	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	371					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				GTCTGGATGAGGACTTTGCGG	0.617																																																	0													139.0	96.0	111.0					16																	3722755		2196	4300	6496	SO:0001583	missense	0			AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1111C>A	16.37:g.3722755G>T	ENSP00000246957:p.Leu371Ile		B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	p.L371I	ENST00000246957.5	37	c.1111	CCDS10508.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.195860	0.94960	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	T;T	0.21932	1.98;1.98	5.35	5.35	0.76521	Ribosomal protein S5 domain 2-type fold (1);	0.000000	0.85682	D	0.000000	T	0.60327	0.2260	H	0.94542	3.55	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.996;0.998	T	0.72207	-0.4360	10	0.87932	D	0	-38.8695	18.3915	0.90485	0.0:0.0:1.0:0.0	.	318;371	F5H897;Q12931	.;TRAP1_HUMAN	I	371;318	ENSP00000246957:L371I;ENSP00000442070:L318I	ENSP00000246957:L371I	L	-	1	0	TRAP1	3662756	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.338000	0.96553	2.665000	0.90641	0.491000	0.48974	CTC	TRAP1	-	pfam_Hsp90_fam,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Hsp90_fam	ENSG00000126602		0.617	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAP1	HGNC	protein_coding	OTTHUMT00000251586.2	-	0.00	50	0	G	NM_016292		3722755	-1	tier1	-	no_errors	ENST00000246957	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
TRIM63	84676	genome.wustl.edu	37	1	26386784	26386784	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:26386784C>T	ENST00000374272.3	-	4	708	c.570G>A	c.(568-570)caG>caA	p.Q190Q	TRIM63_ENST00000483052.1_5'Flank	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	190	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		AATCCTCCAGCTGAGTGATGA	0.572																																																	0													127.0	117.0	121.0					1																	26386784		2203	4300	6503	SO:0001819	synonymous_variant	0			AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.570G>A	1.37:g.26386784C>T			B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Silent	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q190	ENST00000374272.3	37	c.570	CCDS273.1	1																																																																																			TRIM63	-	NULL	ENSG00000158022		0.572	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM63	HGNC	protein_coding	OTTHUMT00000019750.1	-	0.00	51	0	C	NM_032588		26386784	-1	tier1	-	no_errors	ENST00000374272	ensembl	human	known	74_37	silent	20.00	32	8	SNP	1.000	T
TRIP12	9320	genome.wustl.edu	37	2	230683196	230683196	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:230683196G>T	ENST00000283943.5	-	8	1517	c.1339C>A	c.(1339-1341)Caa>Aaa	p.Q447K	TRIP12_ENST00000389045.3_Missense_Mutation_p.Q150K|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.Q495K	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	447					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCACTGGCTTGCAATCCTTGT	0.388																																																	0													121.0	119.0	120.0					2																	230683196		2203	4300	6503	SO:0001583	missense	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1339C>A	2.37:g.230683196G>T	ENSP00000283943:p.Gln447Lys		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.Q447K	ENST00000283943.5	37	c.1339	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020311	0.93462	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.34472	1.36;1.36;1.36	5.73	5.73	0.89815	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	L	0.38692	1.165	0.80722	D	1	P;P;P;P	0.49447	0.924;0.713;0.713;0.713	P;P;P;P	0.62298	0.9;0.761;0.761;0.761	T	0.39860	-0.9593	10	0.46703	T	0.11	.	19.8984	0.96975	0.0:0.0:1.0:0.0	.	453;150;495;447	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	K	447;150;495	ENSP00000283943:Q447K;ENSP00000373697:Q150K;ENSP00000373696:Q495K	ENSP00000283943:Q447K	Q	-	1	0	TRIP12	230391440	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.706000	0.98722	2.712000	0.92718	0.555000	0.69702	CAA	TRIP12	-	superfamily_ARM-type_fold	ENSG00000153827		0.388	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3		0.00	73	0	G	NM_004238		230683196	-1			no_errors	ENST00000283943	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
TSKU	25987	genome.wustl.edu	37	11	76506652	76506652	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:76506652G>A	ENST00000527881.1	+	2	1018		c.e2-1		TSKU_ENST00000333090.4_Splice_Site			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan						anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					TCTCTTTCTAGCCCCCACCAT	0.602																																																	0													29.0	33.0	32.0					11																	76506652		2200	4292	6492	SO:0001630	splice_region_variant	0			AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.-8-1G>A	11.37:g.76506652G>A			B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Splice_Site	SNP	-	e1-1	ENST00000527881.1	37	c.1-1	CCDS8246.1	11																																																																																			TSKU	-	-	ENSG00000182704		0.602	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSKU	HGNC	protein_coding	OTTHUMT00000382871.1		0.00	51	0	G	NM_015516	Intron	76506652	+1			no_errors	ENST00000333090	ensembl	human	known	74_37	splice_site	8.51	43	4	SNP	0.940	A
TTN	7273	genome.wustl.edu	37	2	179471802	179471802	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:179471802A>T	ENST00000591111.1	-	228	48828	c.48604T>A	c.(48604-48606)Ttt>Att	p.F16202I	TTN_ENST00000342175.6_Missense_Mutation_p.F8970I|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.F8778I|TTN_ENST00000589042.1_Missense_Mutation_p.F17843I|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.F8903I|TTN_ENST00000342992.6_Missense_Mutation_p.F15275I|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16202	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCACAGCCAAACTTGTTCTTG	0.403																																																	0													175.0	169.0	171.0					2																	179471802		1890	4114	6004	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48604T>A	2.37:g.179471802A>T	ENSP00000465570:p.Phe16202Ile		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.F15275I	ENST00000591111.1	37	c.45823		2	.	.	.	.	.	.	.	.	.	.	A	13.90	2.376238	0.42105	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.35	5.35	0.76521	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49064	0.1535	N	0.10972	0.075	0.51482	D	0.999925	D;D;D;D	0.57571	0.961;0.961;0.961;0.98	P;P;P;P	0.55749	0.783;0.783;0.783;0.783	T	0.59516	-0.7440	9	0.87932	D	0	.	15.3434	0.74314	1.0:0.0:0.0:0.0	.	8778;8903;8970;16202	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	15275;8778;8970;8903;8778	ENSP00000343764:F15275I;ENSP00000434586:F8778I;ENSP00000340554:F8970I;ENSP00000352154:F8903I	ENSP00000340554:F8970I	F	-	1	0	TTN	179180047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.281000	0.95811	2.035000	0.60131	0.459000	0.35465	TTT	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	33	0	A	NM_133378		179471802	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179602912	179602912	+	Silent	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:179602912G>A	ENST00000591111.1	-	47	13541	c.13317C>T	c.(13315-13317)agC>agT	p.S4439S	TTN_ENST00000342175.6_Silent_p.S4585S|TTN_ENST00000460472.2_Silent_p.S4393S|TTN_ENST00000589042.1_Silent_p.S4756S|TTN_ENST00000359218.5_Silent_p.S4518S|TTN_ENST00000342992.6_Silent_p.S3512S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12195	Ig-like 24.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGATTTCAAGGCTGGAGATAT	0.463																																																	0													69.0	67.0	68.0					2																	179602912		1890	4116	6006	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.13317C>T	2.37:g.179602912G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S3512	ENST00000591111.1	37	c.10536		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	81	0	G	NM_133378		179602912	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.41	68	4	SNP	0.701	A
TUBBP5	643224	genome.wustl.edu	37	9	141071577	141071577	+	RNA	SNP	C	C	T	rs576699661		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr9:141071577C>T	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		CACTGGTACACGGGCGAGGGC	0.527													.|||	1	0.000199681	0.0	0.0014	5008	,	,		20681	0.0		0.0	False		,,,				2504	0.0																0																																												0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071577C>T				RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.527	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	-	0.00	138	0	C	NR_027156		141071577	+1	tier1	-	no_errors	ENST00000290377	ensembl	human	known	74_37	rna	16.89	122	25	SNP	1.000	T
TYRO3	7301	genome.wustl.edu	37	15	41870083	41870083	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:41870083G>T	ENST00000263798.3	+	19	2506		c.e19-1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CTCCACCCCAGGTATGATCTC	0.517																																																	0													40.0	43.0	42.0					15																	41870083		2198	4286	6484	SO:0001630	splice_region_variant	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2283-1G>T	15.37:g.41870083G>T			O14953|Q86VR3	Splice_Site	SNP	-	e19-1	ENST00000263798.3	37	c.2283-1	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801139	0.70567	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39657375	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	9.682000	0.98655	2.824000	0.97209	0.655000	0.94253	.	TYRO3	-	-	ENSG00000092445		0.517	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2		0.00	74	0	G		Intron	41870083	+1			no_errors	ENST00000263798	ensembl	human	known	74_37	splice_site	7.32	38	3	SNP	1.000	T
UFC1	51506	genome.wustl.edu	37	1	161126856	161126856	+	Intron	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:161126856A>G	ENST00000368003.5	+	2	437				USP21_ENST00000368002.3_5'Flank|RP11-297K8.2_ENST00000420498.1_RNA|USP21_ENST00000368001.1_5'Flank|USP21_ENST00000289865.8_5'Flank|UFC1_ENST00000473766.1_Intron	NM_016406.3	NP_057490.2	Q9Y3C8	UFC1_HUMAN	ubiquitin-fold modifier conjugating enzyme 1						protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	extracellular vesicular exosome (GO:0070062)	UFM1 conjugating enzyme activity (GO:0071568)			endometrium(1)|lung(9)	10	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TATATGAGTTAGGCAATTTGG	0.527																																																	0													77.0	78.0	78.0					1																	161126856		2203	4300	6503	SO:0001627	intron_variant	0			AF161504	CCDS1220.1	1q23.3	2008-02-05			ENSG00000143222	ENSG00000143222			26941	protein-coding gene	gene with protein product		610554				15071506, 11042152	Standard	NM_016406		Approved	HSPC155	uc001fyd.4	Q9Y3C8	OTTHUMG00000033155	ENST00000368003.5:c.191+49A>G	1.37:g.161126856A>G			A8K9R1|D3DVF9|Q549X0|Q5VTX1|Q9BS96|Q9P009	RNA	SNP	-	NULL	ENST00000368003.5	37	NULL	CCDS1220.1	1																																																																																			UFC1	-	-	ENSG00000143222		0.527	UFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFC1	HGNC	protein_coding	OTTHUMT00000080810.1	-	0.00	42	0	A	NM_016406		161126856	+1	tier1	-	no_errors	ENST00000482672	ensembl	human	known	74_37	rna	18.18	27	6	SNP	0.000	G
UNC93B1	81622	genome.wustl.edu	37	11	67770600	67770600	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:67770600C>A	ENST00000227471.2	-	3	363	c.284G>T	c.(283-285)cGc>cTc	p.R95L	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	95					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)											CTTCACCTCGCGGTAGGTCTC	0.617																																																	0													109.0	113.0	112.0					11																	67770600		2179	4275	6454	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.284G>T	11.37:g.67770600C>A	ENSP00000227471:p.Arg95Leu		O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.R95L	ENST00000227471.2	37	c.284		11	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321275	0.81580	.	.	ENSG00000110057	ENST00000227471;ENST00000528423	T	0.09073	3.02	4.55	4.55	0.56014	.	0.059646	0.64402	D	0.000004	T	0.20740	0.0499	.	.	.	0.52099	D	0.999942	D	0.65815	0.995	P	0.59357	0.856	T	0.01635	-1.1307	9	0.27082	T	0.32	-0.9571	16.2337	0.82360	0.0:1.0:0.0:0.0	.	95	Q9H1C4	UN93B_HUMAN	L	95;24	ENSP00000227471:R95L	ENSP00000227471:R95L	R	-	2	0	UNC93B1	67527176	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.611000	0.82962	2.224000	0.72417	0.561000	0.74099	CGC	UNC93B1	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000110057		0.617	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		-	0.00	25	0	C	NM_030930		67770600	-1	tier1	-	no_errors	ENST00000227471	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	A
USP7	7874	genome.wustl.edu	37	16	8989526	8989527	+	Frame_Shift_Ins	INS	-	-	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:8989526_8989527insG	ENST00000344836.4	-	27	3089_3090	c.2891_2892insC	c.(2890-2892)cctfs	p.P964fs	USP7_ENST00000381886.4_Frame_Shift_Ins_p.P948fs|USP7_ENST00000535863.1_Frame_Shift_Ins_p.P865fs	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	964					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						GGCTCGTTGCAGGAGATAAACA	0.411																																																	0																																										SO:0001589	frameshift_variant	0			Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2892dupC	16.37:g.8989528_8989528dupG	ENSP00000343535:p.Pro964fs		A6NMY8|B7Z815|H0Y3G8	Frame_Shift_Ins	INS	pfam_Peptidase_C19/C67,pfam_MATH,pfam_USP7_ICP0-binding_dom,superfamily_TRAF-like,smart_MATH,pfscan_MATH,pfscan_Peptidase_C19/C67	p.A965fs	ENST00000344836.4	37	c.2892_2891	CCDS32385.1	16																																																																																			USP7	-	NULL	ENSG00000187555		0.411	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP7	HGNC	protein_coding	OTTHUMT00000434268.2		0.00	48	0	-			8989527	-1	tier1		no_errors	ENST00000344836	ensembl	human	known	74_37	frame_shift_ins	15.52	49	9	INS	0.071:1.000	G
UST	10090	genome.wustl.edu	37	6	149208144	149208144	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr6:149208144C>T	ENST00000367463.4	+	2	373	c.270C>T	c.(268-270)gaC>gaT	p.D90D		NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	90					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		ACTTGGATGACCATGGACCAC	0.353																																																	0													201.0	198.0	199.0					6																	149208144		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.270C>T	6.37:g.149208144C>T			B2RCX6	Silent	SNP	pfam_Sulfotransferase,pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	p.D90	ENST00000367463.4	37	c.270	CCDS5213.1	6																																																																																			UST	-	superfamily_P-loop_NTPase	ENSG00000111962		0.353	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UST	HGNC	protein_coding	OTTHUMT00000043363.1		0.00	63	0	C	NM_005715		149208144	+1			no_errors	ENST00000367463	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
VIL1	7429	genome.wustl.edu	37	2	219296821	219296821	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:219296821G>A	ENST00000248444.5	+	12	1344	c.1256G>A	c.(1255-1257)gGc>gAc	p.G419D	VIL1_ENST00000392114.2_Missense_Mutation_p.G108D	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	419	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGTGGCTAGGCCACTTCTAT	0.587																																																	0													94.0	74.0	81.0					2																	219296821		2203	4300	6503	SO:0001583	missense	0			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1256G>A	2.37:g.219296821G>A	ENSP00000248444:p.Gly419Asp		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.G419D	ENST00000248444.5	37	c.1256	CCDS2417.1	2	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376348	0.61735	.	.	ENSG00000127831	ENST00000248444;ENST00000392114	T;T	0.15952	2.38;2.38	4.57	4.57	0.56435	Gelsolin domain (1);	0.000000	0.64402	D	0.000001	T	0.60830	0.2299	H	0.98426	4.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78942	-0.2005	10	0.87932	D	0	-23.8373	17.5455	0.87860	0.0:0.0:1.0:0.0	.	419	P09327	VILI_HUMAN	D	419;108	ENSP00000248444:G419D;ENSP00000375962:G108D	ENSP00000248444:G419D	G	+	2	0	VIL1	219005065	1.000000	0.71417	0.994000	0.49952	0.016000	0.09150	9.526000	0.98042	2.387000	0.81309	0.561000	0.74099	GGC	VIL1	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	ENSG00000127831		0.587	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3		0.00	36	0	G	NM_007127		219296821	+1			no_errors	ENST00000248444	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
VPRBP	9730	genome.wustl.edu	37	3	51456251	51456251	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr3:51456251G>A	ENST00000335891.5	-	8	1978	c.1969C>T	c.(1969-1971)Cgg>Tgg	p.R657W				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1106					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		ATCAGGAACCGCTCCCGTGCT	0.498																																																	0													60.0	64.0	63.0					3																	51456251		1970	4168	6138	SO:0001583	missense	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.1969C>T	3.37:g.51456251G>A	ENSP00000338857:p.Arg657Trp		Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.R657W	ENST00000335891.5	37	c.1969		3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067293	0.76301	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	T;T	0.01446	4.88;4.88	5.99	2.93	0.34026	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.053669	0.64402	D	0.000001	T	0.06872	0.0175	L	0.43923	1.385	0.58432	D	0.999996	D	0.89917	1.0	D	0.79108	0.992	T	0.20338	-1.0278	10	0.72032	D	0.01	-13.252	16.4851	0.84182	0.0:0.0:0.5853:0.4147	.	1106	Q9Y4B6	VPRBP_HUMAN	W	677;657	ENSP00000393183:R677W;ENSP00000338857:R657W	ENSP00000338857:R657W	R	-	1	2	VPRBP	51431291	1.000000	0.71417	0.995000	0.50966	0.971000	0.66376	2.712000	0.47186	0.837000	0.34925	0.655000	0.94253	CGG	VPRBP	-	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold	ENSG00000145041		0.498	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		-	0.00	34	0	G	NM_014703		51456251	-1	tier1	-	no_errors	ENST00000335891	ensembl	human	known	74_37	missense	35.48	20	11	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100829828	100829828	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:100829828G>T	ENST00000358544.2	+	45	8344	c.8233G>T	c.(8233-8235)Gtc>Ttc	p.V2745F	VPS13B_ENST00000357162.2_Missense_Mutation_p.V2720F|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2745					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGAACTAAAAGTCGTTCAGCA	0.373																																					Colon(161;2205 2542 7338 31318)												0													89.0	88.0	89.0					8																	100829828		2203	4300	6503	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8233G>T	8.37:g.100829828G>T	ENSP00000351346:p.Val2745Phe		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.V2745F	ENST00000358544.2	37	c.8233	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566995	0.86439	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.72942	-0.7;-0.69	5.61	5.61	0.85477	.	0.224701	0.36519	N	0.002550	T	0.74928	0.3781	N	0.24115	0.695	0.80722	D	1	D;D	0.67145	0.996;0.981	P;P	0.61201	0.885;0.691	T	0.77648	-0.2509	10	0.72032	D	0.01	.	19.9938	0.97376	0.0:0.0:1.0:0.0	.	2720;2745	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	F	2720;2745	ENSP00000349685:V2720F;ENSP00000351346:V2745F	ENSP00000349685:V2720F	V	+	1	0	VPS13B	100899004	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.154000	0.58125	2.796000	0.96246	0.655000	0.94253	GTC	VPS13B	-	NULL	ENSG00000132549		0.373	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	55	0	G	NM_184042		100829828	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
VWDE	221806	genome.wustl.edu	37	7	12396913	12396913	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:12396913G>A	ENST00000275358.3	-	17	3691	c.3503C>T	c.(3502-3504)gCt>gTt	p.A1168V		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1168						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TCTAGTTTCAGCATCGCAGTC	0.363																																																	0													116.0	100.0	105.0					7																	12396913		692	1591	2283	SO:0001583	missense	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3503C>T	7.37:g.12396913G>A	ENSP00000275358:p.Ala1168Val		B7ZM77|Q96SQ3	Missense_Mutation	SNP	pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.A1168V	ENST00000275358.3	37	c.3503	CCDS47544.1	7	.	.	.	.	.	.	.	.	.	.	g	19.94	3.920130	0.73098	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.84070	-1.8	3.96	3.08	0.35506	Epidermal growth factor-like (1);	0.246891	0.39834	N	0.001247	D	0.87935	0.6303	M	0.83774	2.66	0.28081	N	0.93221	D	0.64830	0.994	P	0.54706	0.759	T	0.82870	-0.0243	10	0.62326	D	0.03	.	11.7855	0.52039	0.0872:0.0:0.9128:0.0	.	1168	Q8N2E2	VWDE_HUMAN	V	1168;622	ENSP00000275358:A1168V	ENSP00000275358:A1168V	A	-	2	0	VWDE	12363438	0.998000	0.40836	0.064000	0.19789	0.051000	0.14879	3.947000	0.56652	1.015000	0.39444	0.650000	0.86243	GCT	VWDE	-	superfamily_Cadherin-like,smart_EG-like_dom	ENSG00000146530		0.363	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3	-	0.00	62	0	G	XM_371878		12396913	-1	tier1	-	no_errors	ENST00000452576	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.909	A
WAC	51322	genome.wustl.edu	37	10	28899699	28899699	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:28899699G>A	ENST00000354911.4	+	9	1398	c.1237G>A	c.(1237-1239)Gct>Act	p.A413T	WAC_ENST00000375646.1_Missense_Mutation_p.A261T|WAC_ENST00000347934.4_Missense_Mutation_p.A310T|WAC_ENST00000375664.4_Missense_Mutation_p.A368T|WAC_ENST00000428935.1_Missense_Mutation_p.A368T	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	413					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						TGGACCATCTGCTTTCAACAT	0.363																																																	0													178.0	171.0	174.0					10																	28899699		2203	4300	6503	SO:0001583	missense	0			AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1237G>A	10.37:g.28899699G>A	ENSP00000346986:p.Ala413Thr		A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Missense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.A413T	ENST00000354911.4	37	c.1237	CCDS7159.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.555692	0.96514	.	.	ENSG00000095787	ENST00000375664;ENST00000375646;ENST00000347934;ENST00000354911;ENST00000428935	T;T;T;T;T	0.43688	1.53;1.62;1.4;1.52;0.94	5.45	5.45	0.79879	.	0.096961	0.64402	D	0.000001	T	0.55000	0.1893	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.71674	0.996;0.998;0.993;0.998	D;D;D;D	0.81914	0.993;0.995;0.984;0.991	T	0.52953	-0.8506	10	0.45353	T	0.12	-18.7691	19.6568	0.95845	0.0:0.0:1.0:0.0	.	368;310;413;368	Q9BTA9-2;Q9BTA9-5;Q9BTA9;Q9BTA9-3	.;.;WAC_HUMAN;.	T	368;261;310;413;368	ENSP00000364816:A368T;ENSP00000364797:A261T;ENSP00000311106:A310T;ENSP00000346986:A413T;ENSP00000399706:A368T	ENSP00000311106:A310T	A	+	1	0	WAC	28939705	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.710000	0.92621	0.557000	0.71058	GCT	WAC	-	NULL	ENSG00000095787		0.363	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	WAC	HGNC	protein_coding	OTTHUMT00000047371.1	-	0.00	80	0	G	NM_100264		28899699	+1	tier1	-	no_errors	ENST00000354911	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	A
WBSCR17	64409	genome.wustl.edu	37	7	70885995	70885995	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr7:70885995A>T	ENST00000333538.5	+	5	1500	c.866A>T	c.(865-867)gAg>gTg	p.E289V	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	289					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.E289G(1)		NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAGCGGTACGAGAACTCGGCC	0.582																																																	1	Substitution - Missense(1)	large_intestine(1)											138.0	127.0	130.0					7																	70885995		2203	4300	6503	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.866A>T	7.37:g.70885995A>T	ENSP00000329654:p.Glu289Val		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.E289V	ENST00000333538.5	37	c.866	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	A	21.1	4.102542	0.76983	.	.	ENSG00000185274	ENST00000333538	T	0.59638	0.25	5.32	5.32	0.75619	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.56366	0.1980	L	0.38733	1.17	0.80722	D	1	P	0.51933	0.949	P	0.50537	0.643	T	0.53718	-0.8399	10	0.30078	T	0.28	.	14.4767	0.67551	1.0:0.0:0.0:0.0	.	289	Q6IS24	GLTL3_HUMAN	V	289	ENSP00000329654:E289V	ENSP00000329654:E289V	E	+	2	0	WBSCR17	70523931	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	8.962000	0.93254	2.015000	0.59207	0.455000	0.32223	GAG	WBSCR17	-	pfam_Glyco_trans_2	ENSG00000185274		0.582	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	-	0.00	68	0	A	NM_022479		70885995	+1	tier1	-	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	16.44	61	12	SNP	1.000	T
WDR72	256764	genome.wustl.edu	37	15	54003577	54003577	+	Silent	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:54003577G>A	ENST00000396328.1	-	8	1052	c.813C>T	c.(811-813)atC>atT	p.I271I	WDR72_ENST00000360509.5_Silent_p.I271I|WDR72_ENST00000559418.1_Silent_p.I271I|WDR72_ENST00000557913.1_Silent_p.I270I	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	271										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		CTTCTGTCCAGATGAGGATTC	0.433																																																	0													121.0	110.0	114.0					15																	54003577		2194	4293	6487	SO:0001819	synonymous_variant	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.813C>T	15.37:g.54003577G>A			Q7Z3I3|Q8N8X2	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I271	ENST00000396328.1	37	c.813	CCDS10151.1	15																																																																																			WDR72	-	superfamily_WD40_repeat_dom	ENSG00000166415		0.433	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	-	0.00	58	0	G	NM_182758		54003577	-1	tier1	-	no_errors	ENST00000360509	ensembl	human	known	74_37	silent	8.70	42	4	SNP	1.000	A
WT1	7490	genome.wustl.edu	37	11	32456254	32456254	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr11:32456254C>A	ENST00000332351.3	-	1	922	c.638G>T	c.(637-639)cGc>cTc	p.R213L	WT1-AS_ENST00000459866.1_RNA|WT1_ENST00000448076.3_Missense_Mutation_p.R213L|WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000478367.1_RNA|WT1-AS_ENST00000395900.1_RNA|WT1-AS_ENST00000525436.1_RNA	NM_024424.3|NM_024426.4	NP_077742.2|NP_077744	P19544	WT1_HUMAN	Wilms tumor 1	145					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ACCCTGATTGCGAATAGCGGG	0.677			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	0													18.0	21.0	20.0					11																	32456254		2196	4283	6479	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000332351.3:c.638G>T	11.37:g.32456254C>A	ENSP00000331327:p.Arg213Leu		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Wilms_tumour	p.R213L	ENST00000332351.3	37	c.638	CCDS7878.2	11	.	.	.	.	.	.	.	.	.	.	C	30	5.049957	0.93740	.	.	ENSG00000184937	ENST00000332351;ENST00000452863;ENST00000448076	D;D;D	0.89552	-2.53;-2.53;-2.53	3.24	3.24	0.37175	Wilm&apos (1);s tumour protein, N-terminal (1);	0.000000	0.64402	U	0.000004	D	0.90707	0.7084	L	0.54323	1.7	0.80722	D	1	D;D;D	0.63880	0.993;0.968;0.993	P;P;P	0.59171	0.853;0.851;0.853	D	0.91419	0.5157	10	0.87932	D	0	.	12.0933	0.53739	0.0:1.0:0.0:0.0	.	218;145;218	P19544-8;P19544;P19544-7	.;WT1_HUMAN;.	L	213	ENSP00000331327:R213L;ENSP00000415516:R213L;ENSP00000413452:R213L	ENSP00000331327:R213L	R	-	2	0	WT1	32412830	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.918000	0.75788	1.795000	0.52594	0.462000	0.41574	CGC	WT1	-	pfam_Wilms_tumour_N	ENSG00000184937		0.677	WT1-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095436.2	-	0.00	40	0	C	NM_000378		32456254	-1	tier1	-	no_errors	ENST00000332351	ensembl	human	known	74_37	missense	13.33	39	6	SNP	1.000	A
WWC2	80014	genome.wustl.edu	37	4	184182451	184182451	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr4:184182451G>T	ENST00000403733.3	+	11	1874	c.1675G>T	c.(1675-1677)Ggc>Tgc	p.G559C	WWC2_ENST00000378925.3_Missense_Mutation_p.G461C|WWC2_ENST00000513834.1_Missense_Mutation_p.G559C|WWC2_ENST00000504005.1_Missense_Mutation_p.G241C|WWC2_ENST00000448232.2_Missense_Mutation_p.G559C	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	559					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		GTCTCCTCCAGGCTCTCCCTT	0.562																																																	0													104.0	76.0	86.0					4																	184182451		2203	4300	6503	SO:0001583	missense	0			BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.1675G>T	4.37:g.184182451G>T	ENSP00000384222:p.Gly559Cys		Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.G559C	ENST00000403733.3	37	c.1675	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	G	16.54	3.150525	0.57151	.	.	ENSG00000151718	ENST00000403733;ENST00000378925;ENST00000513834;ENST00000448232;ENST00000504005	T;T;T;T;T	0.11063	3.57;2.81;3.62;3.45;3.46	5.07	3.31	0.37934	.	0.228496	0.38548	N	0.001648	T	0.14013	0.0339	L	0.28556	0.865	0.48571	D	0.999676	D;B	0.71674	0.998;0.17	P;B	0.56700	0.804;0.067	T	0.10474	-1.0628	10	0.21540	T	0.41	-14.8862	11.4905	0.50379	0.1469:0.0:0.8531:0.0	.	559;559	Q6AWC2;Q6AWC2-4	WWC2_HUMAN;.	C	559;461;559;559;241	ENSP00000384222:G559C;ENSP00000368205:G461C;ENSP00000425054:G559C;ENSP00000398577:G559C;ENSP00000427569:G241C	ENSP00000368205:G461C	G	+	1	0	WWC2	184419445	1.000000	0.71417	0.926000	0.36857	0.997000	0.91878	4.644000	0.61397	1.373000	0.46208	0.650000	0.86243	GGC	WWC2	-	NULL	ENSG00000151718		0.562	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2	HGNC	protein_coding	OTTHUMT00000319608.1	-	0.00	48	0	G	NM_024949		184182451	+1	tier1	-	no_errors	ENST00000448232	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.952	T
WWOX	51741	genome.wustl.edu	37	16	78142384	78142384	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr16:78142384G>A	ENST00000566780.1	+	2	538	c.172G>A	c.(172-174)Gat>Aat	p.D58N	WWOX_ENST00000408984.3_Splice_Site_p.D58N|WWOX_ENST00000406884.2_Splice_Site_p.D58N|WWOX_ENST00000539474.2_Splice_Site_p.D58N|WWOX_ENST00000355860.3_Splice_Site_p.D58N|WWOX_ENST00000402655.2_Splice_Site_p.D58N	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	58	WW 2. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		AGTGGCAGGAGGTTTGTATGT	0.408																																																	0													98.0	114.0	109.0					16																	78142384		1897	4122	6019	SO:0001630	splice_region_variant	0			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.172+1G>A	16.37:g.78142384G>A			A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	pfam_WW_dom,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom,prints_Glc/ribitol_DH	p.D58N	ENST00000566780.1	37	c.172	CCDS42196.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.260909	0.95368	.	.	ENSG00000186153	ENST00000408984;ENST00000355860;ENST00000402655;ENST00000406884;ENST00000539474	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	5.42	5.42	0.78866	WW/Rsp5/WWP (4);	0.123896	0.53938	D	0.000054	T	0.67373	0.2886	L	0.51422	1.61	0.54753	D	0.999988	D;P;P;P	0.61697	0.99;0.949;0.846;0.811	D;B;B;P	0.63488	0.915;0.415;0.398;0.668	T	0.67948	-0.5538	10	0.56958	D	0.05	.	19.2155	0.93776	0.0:0.0:1.0:0.0	.	58;58;58;58	Q9NZC7-6;Q9NZC7-5;Q9NZC7;Q9NZC7-3	.;.;WWOX_HUMAN;.	N	58	ENSP00000386161:D58N;ENSP00000348119:D58N;ENSP00000384238:D58N;ENSP00000384495:D58N;ENSP00000445210:D58N	ENSP00000348119:D58N	D	+	1	0	WWOX	76699885	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.358000	0.97109	2.553000	0.86117	0.655000	0.94253	GAT	WWOX	-	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	ENSG00000186153		0.408	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WWOX	HGNC	protein_coding	OTTHUMT00000434328.1	-	0.00	56	0	G		Missense_Mutation	78142384	+1	tier1	-	no_errors	ENST00000566780	ensembl	human	known	74_37	missense	9.26	49	5	SNP	1.000	A
XPO1	7514	genome.wustl.edu	37	2	61726050	61726051	+	Splice_Site	INS	-	-	A	rs372688892		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr2:61726050_61726051insA	ENST00000401558.2	-	8	1318		c.e8-2		XPO1_ENST00000406957.1_Splice_Site|XPO1_ENST00000404992.2_Splice_Site	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1						gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TTGCACATGCTAAAAAAAAAAA	0.262			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0																																										SO:0001630	splice_region_variant	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.591-2->T	2.37:g.61726061_61726061dupA			A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Splice_Site	INS	-	e7-2	ENST00000401558.2	37	c.591-3_591-2	CCDS33205.1	2																																																																																			XPO1	-	-	ENSG00000082898		0.262	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3		0.00	17	0	-	NM_003400	Intron	61726051	-1	tier1		no_errors	ENST00000401558	ensembl	human	known	74_37	splice_site_ins	15.79	16	3	INS	1.000:0.996	A
XPO4	64328	genome.wustl.edu	37	13	21417073	21417073	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:21417073C>T	ENST00000255305.6	-	6	759	c.688G>A	c.(688-690)Gcc>Acc	p.A230T	XPO4_ENST00000400602.2_Missense_Mutation_p.A230T			Q9C0E2	XPO4_HUMAN	exportin 4	230					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		ACTTGATTGGCGAGTGCAAGG	0.388																																																	0													66.0	66.0	66.0					13																	21417073		1918	4147	6065	SO:0001583	missense	0			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.688G>A	13.37:g.21417073C>T	ENSP00000255305:p.Ala230Thr		Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A230T	ENST00000255305.6	37	c.688	CCDS41872.1	13	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038437	0.93630	.	.	ENSG00000132953	ENST00000400602;ENST00000456108;ENST00000255305	T;T	0.24723	1.89;1.84	6.07	6.07	0.98685	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.29749	0.0743	L	0.52573	1.65	0.80722	D	1	D	0.58970	0.984	B	0.43478	0.421	T	0.01587	-1.1318	10	0.20046	T	0.44	-15.1927	20.6593	0.99626	0.0:1.0:0.0:0.0	.	230	Q9C0E2	XPO4_HUMAN	T	230;100;230	ENSP00000383444:A230T;ENSP00000255305:A230T	ENSP00000255305:A230T	A	-	1	0	XPO4	20315073	1.000000	0.71417	0.982000	0.44146	0.989000	0.77384	7.487000	0.81328	2.885000	0.99019	0.655000	0.94253	GCC	XPO4	-	superfamily_ARM-type_fold	ENSG00000132953		0.388	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	-	0.00	139	0	C	NM_022459		21417073	-1	tier1	-	no_errors	ENST00000255305	ensembl	human	known	74_37	missense	24.14	65	21	SNP	1.000	T
ZC3H13	23091	genome.wustl.edu	37	13	46559440	46559440	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr13:46559440G>T	ENST00000242848.4	-	10	2060	c.1712C>A	c.(1711-1713)cCt>cAt	p.P571H	ZC3H13_ENST00000282007.3_Missense_Mutation_p.P571H			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	571	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ACCCTTTTCAGGTAACTCAGG	0.358																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0													64.0	65.0	65.0					13																	46559440		2203	4300	6503	SO:0001583	missense	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1712C>A	13.37:g.46559440G>T	ENSP00000242848:p.Pro571His		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P571H	ENST00000242848.4	37	c.1712		13	.	.	.	.	.	.	.	.	.	.	G	12.48	1.952071	0.34471	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.31510	2.49;1.49	5.73	5.73	0.89815	.	0.097389	0.45867	D	0.000331	T	0.42899	0.1223	L	0.27053	0.805	0.80722	D	1	D;D	0.71674	0.997;0.998	P;P	0.61592	0.781;0.891	T	0.17653	-1.0362	10	0.49607	T	0.09	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	571;571	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	H	571;571;387	ENSP00000242848:P571H;ENSP00000282007:P571H	ENSP00000242848:P571H	P	-	2	0	ZC3H13	45457441	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.592000	0.67543	2.861000	0.98227	0.655000	0.94253	CCT	ZC3H13	-	NULL	ENSG00000123200		0.358	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1	-	0.00	63	0	G	NM_015070		46559440	-1	tier1	-	no_errors	ENST00000242848	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	T
ZFAT	57623	genome.wustl.edu	37	8	135545194	135545194	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr8:135545194G>A	ENST00000377838.3	-	12	3172	c.2998C>T	c.(2998-3000)Cat>Tat	p.H1000Y	ZFAT_ENST00000520356.1_Missense_Mutation_p.H988Y|ZFAT_ENST00000523399.1_Missense_Mutation_p.H938Y|ZFAT_ENST00000517307.1_5'UTR|ZFAT_ENST00000429442.2_Missense_Mutation_p.H988Y|ZFAT_ENST00000520727.1_Missense_Mutation_p.H988Y|ZFAT_ENST00000520214.1_Missense_Mutation_p.H988Y	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	1000					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CAGGAGTAATGGCAATGGGCA	0.587																																																	0													55.0	58.0	57.0					8																	135545194		2067	4189	6256	SO:0001583	missense	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.2998C>T	8.37:g.135545194G>A	ENSP00000367069:p.His1000Tyr		B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1000Y	ENST00000377838.3	37	c.2998	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468813	0.84533	.	.	ENSG00000066827	ENST00000520356;ENST00000520727;ENST00000429442;ENST00000377838;ENST00000520214;ENST00000318135;ENST00000523399	T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62	5.38	5.38	0.77491	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.098046	0.64402	D	0.000002	T	0.47911	0.1471	L	0.36672	1.1	0.54753	D	0.999985	D;D;D;D	0.76494	0.997;0.998;0.999;0.998	D;D;D;D	0.80764	0.992;0.962;0.994;0.924	T	0.46624	-0.9178	10	0.72032	D	0.01	-8.1753	18.1676	0.89733	0.0:0.0:1.0:0.0	.	119;938;988;1000	B7Z741;E9PER3;E9PBN4;Q9P243	.;.;.;ZFAT_HUMAN	Y	988;988;988;1000;988;887;938	ENSP00000427879:H988Y;ENSP00000427831:H988Y;ENSP00000394501:H988Y;ENSP00000367069:H1000Y;ENSP00000428483:H988Y;ENSP00000429091:H938Y	ENSP00000326997:H887Y	H	-	1	0	ZFAT	135614376	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.131000	0.94446	2.530000	0.85305	0.585000	0.79938	CAT	ZFAT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000066827		0.587	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	-	0.00	67	0	G	NM_001029939		135545194	-1	tier1	-	no_errors	ENST00000377838	ensembl	human	known	74_37	missense	25.45	40	14	SNP	1.000	A
ZNF219	51222	genome.wustl.edu	37	14	21561155	21561155	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr14:21561155G>T	ENST00000360947.3	-	3	712	c.301C>A	c.(301-303)Cgc>Agc	p.R101S	ZNF219_ENST00000421093.2_Missense_Mutation_p.R101S|ZNF219_ENST00000556101.1_5'Flank|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000451119.2_Missense_Mutation_p.R101S	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	101					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		AGGTGCGAGCGCAGCAGAGCC	0.687											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													11.0	13.0	12.0					14																	21561155		2190	4265	6455	SO:0001583	missense	0			AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.301C>A	14.37:g.21561155G>T	ENSP00000354206:p.Arg101Ser	749	D3DS16|Q53Y57|Q8IYC1|Q9BW28	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Histamine_H3_rcpt	p.R101S	ENST00000360947.3	37	c.301	CCDS9568.1	14	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764015	0.69878	.	.	ENSG00000165804	ENST00000360947;ENST00000451119;ENST00000421093;ENST00000555270;ENST00000554478;ENST00000556174;ENST00000554923;ENST00000553296	T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	4.81	4.81	0.61882	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.084306	0.47852	D	0.000211	T	0.41236	0.1150	N	0.20357	0.565	0.34063	D	0.657485	D	0.57571	0.98	P	0.56216	0.794	T	0.36939	-0.9727	10	0.10636	T	0.68	-23.2708	10.4713	0.44638	0.0:0.0:0.8064:0.1936	.	101	Q9P2Y4	ZN219_HUMAN	S	101;101;101;101;147;101;138;101	ENSP00000354206:R101S;ENSP00000388558:R101S;ENSP00000392401:R101S;ENSP00000450803:R101S;ENSP00000451212:R147S;ENSP00000450609:R101S;ENSP00000451890:R138S;ENSP00000450900:R101S	ENSP00000354206:R101S	R	-	1	0	ZNF219	20630995	0.961000	0.32948	1.000000	0.80357	0.993000	0.82548	0.942000	0.29017	2.495000	0.84180	0.655000	0.94253	CGC	ZNF219	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000165804		0.687	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF219	HGNC	protein_coding	OTTHUMT00000073931.2		0.00	14	0	G			21561155	-1			no_errors	ENST00000360947	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
ZNF280D	54816	genome.wustl.edu	37	15	56981230	56981230	+	Intron	SNP	G	G	T	rs537404180	byFrequency	TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr15:56981230G>T	ENST00000267807.7	-	9	997				ZNF280D_ENST00000396245.1_Intron|ZNF280D_ENST00000559000.1_Intron|ZNF280D_ENST00000559237.1_Intron	NM_017661.2	NP_060131.2	Q6N043	Z280D_HUMAN	zinc finger protein 280D						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(4)|large_intestine(7)|lung(12)|ovary(1)|skin(1)	30				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		AATTTTGAAAGAGTTTTACCT	0.294																																																	0													39.0	43.0	42.0					15																	56981230		2190	4285	6475	SO:0001627	intron_variant	0			AB046804	CCDS32245.1, CCDS42041.1, CCDS58364.1	15q21.2	2008-05-02	2007-09-20	2007-09-20					25953	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 4 (Drosophila)"""	SUHW4		10997877	Standard	XM_005254481		Approved	FLJ20086, ZNF634	uc002adu.3	Q6N043		ENST00000267807.7:c.780+8C>A	15.37:g.56981230G>T			A1L495|B2RMT6|Q6MZM6|Q6N085|Q6P2R6|Q7Z6J5|Q9H0U5|Q9HCI8|Q9NXS0	RNA	SNP	-	NULL	ENST00000267807.7	37	NULL	CCDS32245.1	15																																																																																			ZNF280D	-	-	ENSG00000137871		0.294	ZNF280D-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF280D	HGNC	protein_coding	OTTHUMT00000418891.2	-	0.00	94	0	G	XM_370867		56981230	-1	tier1	-	no_errors	ENST00000561126	ensembl	human	putative	74_37	rna	5.71	66	4	SNP	0.173	T
ZNF488	118738	genome.wustl.edu	37	10	48371120	48371120	+	Silent	SNP	C	C	A	rs149528341		TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr10:48371120C>A	ENST00000395702.2	+	2	815	c.588C>A	c.(586-588)ctC>ctA	p.L196L	ZNF488_ENST00000586537.1_Silent_p.L89L|ZNF488_ENST00000494156.1_3'UTR			Q96MN9	ZN488_HUMAN	zinc finger protein 488	196					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L196L(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						CTGGACTCCTCAACACTACAG	0.532																																																	1	Substitution - coding silent(1)	lung(1)											116.0	109.0	111.0					10																	48371120		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.588C>A	10.37:g.48371120C>A			Q05CE0	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L196	ENST00000395702.2	37	c.588	CCDS7217.1	10																																																																																			ZNF488	-	NULL	ENSG00000165388		0.532	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF488	HGNC	protein_coding	OTTHUMT00000314632.1		0.00	50	0	C	NM_153034		48371120	+1			no_errors	ENST00000395702	ensembl	human	known	74_37	silent	6.82	41	3	SNP	0.001	A
ZNF561	93134	genome.wustl.edu	37	19	9727893	9727893	+	Intron	SNP	C	C	A			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:9727893C>A	ENST00000302851.3	-	4	478				ZNF561_ENST00000326044.5_Intron|ZNF561_ENST00000495503.1_Intron|ZNF561_ENST00000424629.1_Intron|ZNF561_ENST00000354661.4_Intron	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						AACACTTCCACCAATATTCAC	0.468																																																	0													62.0	53.0	56.0					19																	9727893		692	1591	2283	SO:0001627	intron_variant	0			AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.115-46G>T	19.37:g.9727893C>A			B4E2Q8|Q6PJS0	RNA	SNP	-	NULL	ENST00000302851.3	37	NULL	CCDS12216.2	19																																																																																			ZNF561	-	-	ENSG00000171469		0.468	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF561	HGNC	protein_coding	OTTHUMT00000347272.2	-	0.00	85	0	C	NM_152289		9727893	-1	tier1	-	no_errors	ENST00000470932	ensembl	human	known	74_37	rna	25.76	49	17	SNP	0.000	A
ZNF420	147923	genome.wustl.edu	37	19	37605982	37605982	+	Intron	SNP	A	A	G			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr19:37605982A>G	ENST00000337995.3	+	5	351				ZNF585A_ENST00000588723.1_5'UTR|ZNF420_ENST00000304239.7_Intron	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			tgagcgcacaagtttaccgca	0.453																																																	0																																										SO:0001627	intron_variant	0			AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.137-12048A>G	19.37:g.37605982A>G			B2RDY6|Q96ML5	RNA	SNP	-	NULL	ENST00000337995.3	37	NULL	CCDS12498.1	19																																																																																			ZNF585A	-	-	ENSG00000196967		0.453	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000109587.3	-	0.00	70	0	A	NM_144689		37605982	-1	tier1	-	no_errors	ENST00000588723	ensembl	human	known	74_37	rna	13.33	39	6	SNP	0.136	G
ZNF695	57116	genome.wustl.edu	37	1	247150387	247150387	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr1:247150387G>T	ENST00000339986.7	-	4	1577	c.1430C>A	c.(1429-1431)tCa>tAa	p.S477*	ZNF695_ENST00000487338.2_Intron|ZNF695_ENST00000498046.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	477					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AGAAAGGTGTGAGCTCTGGCC	0.393																																																	0													96.0	101.0	100.0					1																	247150387		2103	4251	6354	SO:0001587	stop_gained	0				CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.1430C>A	1.37:g.247150387G>T	ENSP00000341236:p.Ser477*		Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S477*	ENST00000339986.7	37	c.1430	CCDS44344.1	1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.626794	0.87560	.	.	ENSG00000197472	ENST00000339986	.	.	.	0.642	0.642	0.17765	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.0678	0.25161	1.0E-4:0.0:0.9999:0.0	.	.	.	.	X	477	.	ENSP00000341236:S477X	S	-	2	0	ZNF695	245217010	0.000000	0.05858	0.003000	0.11579	0.588000	0.36517	0.579000	0.23788	0.638000	0.30545	0.205000	0.17691	TCA	ZNF695	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197472		0.393	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000097823.5	-	0.00	68	0	G	NM_020394		247150387	-1	tier1	-	no_errors	ENST00000339986	ensembl	human	known	74_37	nonsense	7.04	66	5	SNP	0.011	T
ZSWIM6	57688	genome.wustl.edu	37	5	60821679	60821679	+	Silent	SNP	C	C	T			TCGA-L5-A8NL-01A-12D-A37C-09	TCGA-L5-A8NL-11A-12D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b6b94782-491a-4150-bcb6-7c4cc2d0ef25	46ff075c-bad7-476a-8841-bb8e7378c3b9	g.chr5:60821679C>T	ENST00000252744.5	+	6	1566	c.1566C>T	c.(1564-1566)tgC>tgT	p.C522C		NM_020928.1	NP_065979.1	Q9HCJ5	ZSWM6_HUMAN	zinc finger, SWIM-type containing 6	522					neuron projection morphogenesis (GO:0048812)|regulation of neuron migration (GO:2001222)		zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	8						TCGAGGCATGCGATCTCCACT	0.478																																																	0													129.0	102.0	110.0					5																	60821679		692	1591	2283	SO:0001819	synonymous_variant	0			BC039438	CCDS47215.1	5q12.1	2011-03-17			ENSG00000130449	ENSG00000130449		"""Zinc fingers, SWIM-type"""	29316	protein-coding gene	gene with protein product		615951				10997877, 16427614	Standard	NM_020928		Approved	KIAA1577	uc003jsr.3	Q9HCJ5	OTTHUMG00000162388	ENST00000252744.5:c.1566C>T	5.37:g.60821679C>T				Silent	SNP	pfscan_Znf_SWIM,prints_Antifreeze_1	p.C522	ENST00000252744.5	37	c.1566	CCDS47215.1	5																																																																																			ZSWIM6	-	NULL	ENSG00000130449		0.478	ZSWIM6-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZSWIM6	HGNC	protein_coding	OTTHUMT00000368710.1	-	0.00	33	0	C	NM_020928		60821679	+1	tier1	-	no_errors	ENST00000252744	ensembl	human	novel	74_37	silent	9.30	39	4	SNP	0.576	T
