#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC2	1244	genome.wustl.edu	37	10	101567177	101567177	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:101567177G>T	ENST00000370449.4	+	12	1680	c.1567G>T	c.(1567-1569)Gac>Tac	p.D523Y		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	523	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	TTCATTCAGAGACCAAGTACA	0.423																																																	0													152.0	156.0	155.0					10																	101567177		2203	4300	6503	SO:0001583	missense	0			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1567G>T	10.37:g.101567177G>T	ENSP00000359478:p.Asp523Tyr		B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.D523Y	ENST00000370449.4	37	c.1567	CCDS7484.1	10	.	.	.	.	.	.	.	.	.	.	G	14.48	2.549429	0.45383	.	.	ENSG00000023839	ENST00000370449	D	0.89939	-2.59	5.31	-0.871	0.10642	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	1.016130	0.07824	N	0.960281	D	0.92625	0.7657	M	0.84948	2.725	0.46749	D	0.999189	P	0.45240	0.854	P	0.53266	0.722	D	0.88874	0.3335	10	0.87932	D	0	-12.4789	10.1655	0.42877	0.6788:0.0:0.3212:0.0	.	523	Q92887	MRP2_HUMAN	Y	523	ENSP00000359478:D523Y	ENSP00000359478:D523Y	D	+	1	0	ABCC2	101557167	0.056000	0.20664	0.180000	0.23079	0.569000	0.35902	0.460000	0.21924	-0.093000	0.12396	0.561000	0.74099	GAC	ABCC2	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	ENSG00000023839		0.423	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	-	0.00	53	0	G	NM_000392		101567177	+1	tier1	-	no_errors	ENST00000370449	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.149	T
ABCC3	8714	genome.wustl.edu	37	17	48746804	48746804	+	Missense_Mutation	SNP	G	G	T	rs143749403		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:48746804G>T	ENST00000285238.8	+	17	2236	c.2156G>T	c.(2155-2157)cGc>cTc	p.R719L		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	719	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	AACCCCAAGCGCTACCAGCAG	0.577																																																	0								G	LEU/ARG	3,4403	6.2+/-15.9	0,3,2200	104.0	98.0	100.0		2156	4.4	1.0	17	dbSNP_134	100	0,8600		0,0,4300	no	missense	ABCC3	NM_003786.3	102	0,3,6500	TT,TG,GG		0.0,0.0681,0.0231	possibly-damaging	719/1528	48746804	3,13003	2203	4300	6503	SO:0001583	missense	0			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.2156G>T	17.37:g.48746804G>T	ENSP00000285238:p.Arg719Leu		B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.R719L	ENST00000285238.8	37	c.2156	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	G	8.950	0.968061	0.18659	6.81E-4	0.0	ENSG00000108846	ENST00000285238	D	0.90504	-2.68	4.36	4.36	0.52297	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.265811	0.32068	N	0.006631	D	0.86723	0.6001	L	0.35341	1.055	0.43069	D	0.994704	P	0.46395	0.877	P	0.50708	0.648	D	0.83613	0.0135	10	0.31617	T	0.26	-22.3821	5.4386	0.16496	0.2503:0.0:0.7497:0.0	.	719	O15438	MRP3_HUMAN	L	719	ENSP00000285238:R719L	ENSP00000285238:R719L	R	+	2	0	ABCC3	46101803	0.996000	0.38824	1.000000	0.80357	0.805000	0.45488	1.738000	0.38207	2.436000	0.82500	0.313000	0.20887	CGC	ABCC3	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc	ENSG00000108846		0.577	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	-	0.00	86	0	G	NM_020038		48746804	+1	tier1	-	no_errors	ENST00000285238	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
ABCC4	10257	genome.wustl.edu	37	13	95839035	95839035	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:95839035G>T	ENST00000376887.4	-	11	1579	c.1465C>A	c.(1465-1467)Ctg>Atg	p.L489M	ABCC4_ENST00000412704.1_Missense_Mutation_p.L489M|ABCC4_ENST00000536256.1_Missense_Mutation_p.L414M|ABCC4_ENST00000431522.1_Missense_Mutation_p.L489M|ABCC4_ENST00000538287.1_3'UTR	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	489	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	TTACTCCTCAGAGTTCCCGAG	0.468																																																	0													82.0	81.0	81.0					13																	95839035		2203	4300	6503	SO:0001583	missense	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1465C>A	13.37:g.95839035G>T	ENSP00000366084:p.Leu489Met		A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	p.L489M	ENST00000376887.4	37	c.1465	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	G	14.11	2.437654	0.43224	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.91894	-2.93;-2.93;-2.93;-2.93	5.81	0.868	0.19090	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.227179	0.44688	D	0.000426	D	0.92573	0.7641	M	0.81614	2.55	0.23537	N	0.997462	P;B;B;B;B	0.35192	0.489;0.07;0.026;0.07;0.009	B;B;B;B;B	0.42361	0.385;0.2;0.054;0.2;0.032	D	0.87308	0.2310	10	0.87932	D	0	.	12.6734	0.56880	0.0:0.4851:0.453:0.0619	.	414;489;489;489;489	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	M	489;489;414;489	ENSP00000388657:L489M;ENSP00000366084:L489M;ENSP00000442024:L414M;ENSP00000398562:L489M	ENSP00000366084:L489M	L	-	1	2	ABCC4	94637036	0.971000	0.33674	0.873000	0.34254	0.942000	0.58702	2.114000	0.41911	0.096000	0.17463	-0.139000	0.14373	CTG	ABCC4	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000125257		0.468	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2	-	0.00	57	0	G	NM_005845		95839035	-1	tier1	-	no_errors	ENST00000376887	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.872	T
ABLIM3	22885	genome.wustl.edu	37	5	148622066	148622066	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:148622066A>C	ENST00000506113.1	+	14	1798	c.1316A>C	c.(1315-1317)aAc>aCc	p.N439T	ABLIM3_ENST00000508983.1_Missense_Mutation_p.N406T|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000504238.1_Intron|ABLIM3_ENST00000517451.1_5'Flank|RP11-331K21.1_ENST00000522685.1_RNA|ABLIM3_ENST00000326685.7_Missense_Mutation_p.N344T|ABLIM3_ENST00000356541.3_Intron|AC012613.2_ENST00000523176.1_RNA|ABLIM3_ENST00000309868.7_Missense_Mutation_p.N439T			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	439					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGACAGTAACATCTACCGG	0.532																																																	0													113.0	102.0	106.0					5																	148622066		2203	4300	6503	SO:0001583	missense	0			AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.1316A>C	5.37:g.148622066A>C	ENSP00000425394:p.Asn439Thr		A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.N439T	ENST00000506113.1	37	c.1316	CCDS4294.1	5	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372788	0.82573	.	.	ENSG00000173210	ENST00000326685;ENST00000309868;ENST00000506113;ENST00000508983	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	5.41	4.25	0.50352	.	0.045117	0.85682	D	0.000000	T	0.48390	0.1497	M	0.66439	2.03	0.80722	D	1	B;P	0.37122	0.313;0.583	B;B	0.33750	0.124;0.169	T	0.56486	-0.7971	10	0.62326	D	0.03	.	10.9537	0.47345	0.9266:0.0:0.0734:0.0	.	344;439	O94929-3;O94929	.;ABLM3_HUMAN	T	344;439;439;406	ENSP00000315841:N344T;ENSP00000310309:N439T;ENSP00000425394:N439T;ENSP00000420855:N406T	ENSP00000310309:N439T	N	+	2	0	ABLIM3	148602259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.073000	0.76784	2.171000	0.68590	0.482000	0.46254	AAC	ABLIM3	-	NULL	ENSG00000173210		0.532	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABLIM3	HGNC	protein_coding	OTTHUMT00000373435.1		0.00	69	0	A	NM_014945		148622066	+1			no_errors	ENST00000309868	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	C
ACCSL	390110	genome.wustl.edu	37	11	44074280	44074280	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:44074280G>A	ENST00000378832.1	+	6	897	c.841G>A	c.(841-843)Gag>Aag	p.E281K		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	281					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						TGCAAAGGTTGAGTTGATTCC	0.542																																																	0													241.0	236.0	238.0					11																	44074280		1957	4147	6104	SO:0001583	missense	0				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.841G>A	11.37:g.44074280G>A	ENSP00000368109:p.Glu281Lys			Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.E281K	ENST00000378832.1	37	c.841	CCDS41636.1	11	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660606	0.29515	.	.	ENSG00000205126	ENST00000378832	D	0.90676	-2.71	5.49	2.51	0.30379	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.280089	0.39544	N	0.001335	T	0.76673	0.4020	N	0.11064	0.09	0.30381	N	0.781968	B	0.14012	0.009	B	0.21360	0.034	T	0.65376	-0.6183	10	0.22706	T	0.39	-19.1827	4.4994	0.11856	0.2704:0.1762:0.5534:0.0	.	281	Q4AC99	1A1L2_HUMAN	K	281	ENSP00000368109:E281K	ENSP00000368109:E281K	E	+	1	0	ACCSL	44030856	0.994000	0.37717	0.013000	0.15412	0.017000	0.09413	2.312000	0.43726	0.890000	0.36211	0.655000	0.94253	GAG	ACCSL	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000205126		0.542	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCSL	HGNC	protein_coding	OTTHUMT00000389717.1	-	0.00	82	0	G	NM_001031854		44074280	+1	tier1	-	no_errors	ENST00000378832	ensembl	human	known	74_37	missense	5.56	84	5	SNP	0.560	A
ACE2	59272	genome.wustl.edu	37	X	15584415	15584415	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:15584415G>A	ENST00000252519.3	-	16	2177	c.2075C>T	c.(2074-2076)tCt>tTt	p.S692F	ACE2_ENST00000427411.1_Missense_Mutation_p.S692F|ACE2_ENST00000471548.1_5'Flank			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2	692					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	AATGATATCAGACACATTTTT	0.383																																																	0													181.0	169.0	173.0					X																	15584415		2203	4300	6503	SO:0001583	missense	0			AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.2075C>T	X.37:g.15584415G>A	ENSP00000252519:p.Ser692Phe		C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Missense_Mutation	SNP	pfam_Peptidase_M2,prints_Peptidase_M2	p.S692F	ENST00000252519.3	37	c.2075	CCDS14169.1	X	.	.	.	.	.	.	.	.	.	.	G	14.92	2.677982	0.47886	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	D;D	0.88124	-2.34;-2.34	5.68	-1.02	0.10135	.	0.805437	0.11801	N	0.528149	D	0.91456	0.7303	M	0.84433	2.695	0.09310	N	1	P	0.42248	0.774	P	0.55545	0.778	D	0.84786	0.0776	10	0.87932	D	0	-3.7638	9.1675	0.37060	0.0:0.4559:0.2068:0.3373	.	692	Q9BYF1	ACE2_HUMAN	F	692	ENSP00000252519:S692F;ENSP00000389326:S692F	ENSP00000252519:S692F	S	-	2	0	ACE2	15494336	0.006000	0.16342	0.000000	0.03702	0.029000	0.11900	1.627000	0.37050	-0.356000	0.08187	-0.225000	0.12378	TCT	ACE2	-	NULL	ENSG00000130234		0.383	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE2	HGNC	protein_coding	OTTHUMT00000055867.1	-	0.00	49	0	G			15584415	-1	tier1	-	no_errors	ENST00000252519	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.000	A
ADAM12	8038	genome.wustl.edu	37	10	127726813	127726813	+	Silent	SNP	C	C	T	rs375026997		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:127726813C>T	ENST00000368679.4	-	20	2664	c.2355G>A	c.(2353-2355)ccG>ccA	p.P785P		NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	785					cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GACTCACCTTCGGTGGGTAGG	0.567																																																	0								C		0,4406		0,0,2203	50.0	38.0	42.0		2355	-9.8	0.0	10		42	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAM12	NM_003474.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		785/910	127726813	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.2355G>A	10.37:g.127726813C>T			O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.P785	ENST00000368679.4	37	c.2355	CCDS7653.1	10																																																																																			ADAM12	-	NULL	ENSG00000148848		0.567	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	-	0.00	39	0	C			127726813	-1	tier1	-	no_errors	ENST00000368679	ensembl	human	known	74_37	silent	20.69	46	12	SNP	0.000	T
ADAMTS2	9509	genome.wustl.edu	37	5	178566959	178566959	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:178566959C>T	ENST00000251582.7	-	11	1808	c.1707G>A	c.(1705-1707)ccG>ccA	p.P569P		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	569	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AGGAGCCAAACGGACTCCAAG	0.592																																																	0													141.0	146.0	144.0					5																	178566959		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1707G>A	5.37:g.178566959C>T				Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.P569	ENST00000251582.7	37	c.1707	CCDS4444.1	5																																																																																			ADAMTS2	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000087116		0.592	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	77	0	C	NM_014244		178566959	-1	tier1	-	no_errors	ENST00000251582	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.011	T
ADD2	119	genome.wustl.edu	37	2	70900406	70900406	+	Intron	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:70900406G>T	ENST00000264436.4	-	15	2186				ADD2_ENST00000407644.2_Intron|ADD2_ENST00000355733.3_Missense_Mutation_p.F598L	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GGGCAACGCTGAAGAACTCGC	0.542																																																	0													86.0	80.0	82.0					2																	70900406		2203	4300	6503	SO:0001627	intron_variant	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1742-268C>A	2.37:g.70900406G>T			A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.F598L	ENST00000264436.4	37	c.1794	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	G	3.318	-0.139358	0.06669	.	.	ENSG00000075340	ENST00000355733	T	0.06371	3.31	3.21	-2.22	0.06952	.	.	.	.	.	T	0.03390	0.0098	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44937	-0.9295	8	0.26408	T	0.33	.	3.5986	0.08016	0.4438:0.0:0.381:0.1752	.	598	P35612-3	.	L	598	ENSP00000347972:F598L	ENSP00000347972:F598L	F	-	3	2	ADD2	70753914	0.007000	0.16637	0.000000	0.03702	0.011000	0.07611	0.156000	0.16382	-0.563000	0.06078	0.460000	0.39030	TTC	ADD2	-	NULL	ENSG00000075340		0.542	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	-	0.00	61	0	G	NM_001617		70900406	-1	tier1	-	no_errors	ENST00000355733	ensembl	human	putative	74_37	missense	16.07	47	9	SNP	0.000	T
AKT2	208	genome.wustl.edu	37	19	40740796	40740796	+	Intron	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:40740796G>A	ENST00000392038.2	-	13	1665				AKT2_ENST00000424901.1_Intron|AKT2_ENST00000311278.6_Intron|AKT2_ENST00000579047.1_Missense_Mutation_p.P446S	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2						activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			GTCCAAAGAGGACCAACAGCA	0.607			A		"""ovarian, pancreatic """																																			Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	0																																										SO:0001627	intron_variant	0			M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.1366+155C>T	19.37:g.40740796G>A			B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom	p.P446S	ENST00000392038.2	37	c.1336	CCDS12552.1	19																																																																																			AKT2	-	NULL	ENSG00000105221		0.607	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT2	HGNC	protein_coding	OTTHUMT00000268029.1	-	0.00	181	0	G	NM_001626		40740796	-1	tier1	-	no_errors	ENST00000579047	ensembl	human	putative	74_37	missense	8.08	91	8	SNP	0.000	A
ALDH1A2	8854	genome.wustl.edu	37	15	58284937	58284937	+	Missense_Mutation	SNP	C	C	T	rs114474932		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:58284937C>T	ENST00000249750.4	-	7	1531	c.764G>A	c.(763-765)gGc>gAc	p.G255D	ALDH1A2_ENST00000559517.1_Missense_Mutation_p.G159D|ALDH1A2_ENST00000537372.1_Missense_Mutation_p.G234D|ALDH1A2_ENST00000347587.3_Intron|ALDH1A2_ENST00000558231.1_Missense_Mutation_p.G226D	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	255					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	CTTGTCTATGCCAATGTGAGA	0.478																																																	0													109.0	104.0	106.0					15																	58284937		2192	4292	6484	SO:0001583	missense	0			AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.764G>A	15.37:g.58284937C>T	ENSP00000249750:p.Gly255Asp		B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.G255D	ENST00000249750.4	37	c.764	CCDS10163.1	15	.	.	.	.	.	.	.	.	.	.	C	6.018	0.371650	0.11409	.	.	ENSG00000128918	ENST00000249750;ENST00000430119;ENST00000543386;ENST00000537372	T;T	0.75050	-0.9;-0.9	5.65	3.74	0.42951	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	N	0.01576	-0.805	0.58432	D	0.999999	B;B;B	0.18166	0.026;0.021;0.01	B;B;B	0.19148	0.004;0.002;0.024	T	0.48779	-0.9005	10	0.02654	T	1	.	11.8499	0.52405	0.0:0.857:0.0:0.143	.	226;234;255	B4DH89;F5H2Y9;O94788	.;.;AL1A2_HUMAN	D	255;159;226;234	ENSP00000249750:G255D;ENSP00000438296:G234D	ENSP00000249750:G255D	G	-	2	0	ALDH1A2	56072229	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	3.653000	0.54446	1.633000	0.50488	0.655000	0.94253	GGC	ALDH1A2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000128918		0.478	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A2	HGNC	protein_coding	OTTHUMT00000255869.1	-	0.00	79	0	C			58284937	-1	tier1	rs114474932	no_errors	ENST00000249750	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	T
ALKBH4	54784	genome.wustl.edu	37	7	102100206	102100206	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:102100206C>T	ENST00000292566.3	-	2	205	c.166G>A	c.(166-168)Gtg>Atg	p.V56M		NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	56					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			kidney(1)|lung(5)|skin(2)	8						TCTGTGCCCACGGCCCAGCCG	0.572																																																	0													70.0	68.0	69.0					7																	102100206		2203	4300	6503	SO:0001583	missense	0			BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.166G>A	7.37:g.102100206C>T	ENSP00000292566:p.Val56Met		Q53H92|Q9H6A4	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase	p.V56M	ENST00000292566.3	37	c.166	CCDS5723.1	7	.	.	.	.	.	.	.	.	.	.	C	2.688	-0.273760	0.05679	.	.	ENSG00000160993	ENST00000292566	T	0.50813	0.73	3.99	2.01	0.26516	.	1.100810	0.07023	N	0.827073	T	0.22820	0.0551	N	0.12746	0.255	0.09310	N	1	P	0.35226	0.491	B	0.17098	0.017	T	0.12477	-1.0546	10	0.27082	T	0.32	-15.6802	4.9417	0.13969	0.1672:0.6407:0.0:0.1921	.	56	Q9NXW9	ALKB4_HUMAN	M	56	ENSP00000292566:V56M	ENSP00000292566:V56M	V	-	1	0	ALKBH4	101887211	0.019000	0.18553	0.536000	0.28039	0.046000	0.14306	0.872000	0.28037	0.858000	0.35431	0.561000	0.74099	GTG	ALKBH4	-	NULL	ENSG00000160993		0.572	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH4	HGNC	protein_coding	OTTHUMT00000349503.1	-	0.00	150	0	C	NM_017621		102100206	-1	tier1	-	no_errors	ENST00000292566	ensembl	human	known	74_37	missense	8.60	85	8	SNP	0.019	T
ALOX15	246	genome.wustl.edu	37	17	4540525	4540525	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:4540525G>T	ENST00000570836.1	-	8	932	c.836C>A	c.(835-837)tCc>tAc	p.S279Y	ALOX15_ENST00000293761.3_Missense_Mutation_p.S279Y|ALOX15_ENST00000574640.1_Missense_Mutation_p.S240Y|ALOX15_ENST00000545513.1_Missense_Mutation_p.S301Y			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	279	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		ATCCAGCAGGGAGAAGTCAGC	0.542																																																	0													82.0	75.0	77.0					17																	4540525		2203	4300	6503	SO:0001583	missense	0			M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.836C>A	17.37:g.4540525G>T	ENSP00000458832:p.Ser279Tyr		A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.S301Y	ENST00000570836.1	37	c.902	CCDS11049.1	17	.	.	.	.	.	.	.	.	.	.	G	16.85	3.237640	0.58886	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.77358	-1.09;-1.09	3.74	1.67	0.24075	Lipoxygenase, C-terminal (3);	0.545188	0.17818	N	0.160973	T	0.77805	0.4185	M	0.63428	1.95	0.24250	N	0.995321	P;P;P	0.44260	0.83;0.774;0.774	P;P;P	0.52710	0.583;0.707;0.707	T	0.66991	-0.5783	10	0.54805	T	0.06	-2.8151	3.0336	0.06114	0.2467:0.0:0.5412:0.2121	.	301;240;279	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	Y	279;301	ENSP00000293761:S279Y;ENSP00000439855:S301Y	ENSP00000293761:S279Y	S	-	2	0	ALOX15	4487274	0.000000	0.05858	0.906000	0.35671	0.985000	0.73830	0.188000	0.17018	0.349000	0.23975	0.561000	0.74099	TCC	ALOX15	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000161905		0.542	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15	HGNC	protein_coding	OTTHUMT00000207487.2	-	0.00	76	0	G			4540525	-1	tier1	-	no_errors	ENST00000545513	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.972	T
ALPK3	57538	genome.wustl.edu	37	15	85370715	85370715	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:85370715G>T	ENST00000258888.5	+	3	956	c.789G>T	c.(787-789)agG>agT	p.R263S		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	263					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCTCTCTTAGGAGCACCTTCT	0.572																																																	0													96.0	77.0	84.0					15																	85370715		2203	4299	6502	SO:0001630	splice_region_variant	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.789-1G>T	15.37:g.85370715G>T			Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.R263S	ENST00000258888.5	37	c.789	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	17.70	3.453334	0.63290	.	.	ENSG00000136383	ENST00000258888	T	0.61742	0.08	5.52	4.61	0.57282	.	0.387563	0.24722	N	0.036132	T	0.59582	0.2204	L	0.29908	0.895	0.47308	D	0.999384	D	0.76494	0.999	P	0.60789	0.879	T	0.56860	-0.7909	9	.	.	.	.	11.8064	0.52158	0.0843:0.0:0.9157:0.0	.	263	Q96L96	ALPK3_HUMAN	S	263	ENSP00000258888:R263S	.	R	+	3	2	ALPK3	83171719	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.866000	0.75506	1.331000	0.45412	0.655000	0.94253	AGG	ALPK3	-	NULL	ENSG00000136383		0.572	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	-	0.00	55	0	G	NM_020778	Missense_Mutation	85370715	+1	tier1	-	no_errors	ENST00000258888	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
ALS2	57679	genome.wustl.edu	37	2	202622353	202622353	+	Missense_Mutation	SNP	C	C	A	rs376793598		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:202622353C>A	ENST00000264276.6	-	5	1615	c.1243G>T	c.(1243-1245)Gcc>Tcc	p.A415S		NM_020919.3	NP_065970.2	Q96Q42	ALS2_HUMAN	amyotrophic lateral sclerosis 2 (juvenile)	415					behavioral fear response (GO:0001662)|cell death (GO:0008219)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|locomotory behavior (GO:0007626)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Rab GTPase activity (GO:0032851)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rac protein signal transduction (GO:0035022)|positive regulation of Ran GTPase activity (GO:0032853)|protein localization (GO:0008104)|receptor recycling (GO:0001881)|regulation of endosome size (GO:0051036)|response to oxidative stress (GO:0006979)|synaptic transmission, glutamatergic (GO:0035249)|vesicle organization (GO:0016050)	centrosome (GO:0005813)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome (GO:0005769)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|ruffle (GO:0001726)|vesicle (GO:0031982)	protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activator activity (GO:0043539)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(22)|ovary(1)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	72						AGTGACAAGGCACCAGCTTCA	0.512																																																	0													80.0	79.0	79.0					2																	202622353		1974	4171	6145	SO:0001583	missense	0			AB053305	CCDS42800.1, CCDS46492.1	2q33-q35	2014-09-17	2004-06-23		ENSG00000003393	ENSG00000003393		"""Rho guanine nucleotide exchange factors"""	443	protein-coding gene	gene with protein product	"""alsin"""	606352	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 6"""	ALS2CR6		11586298	Standard	NM_020919		Approved		uc002uyo.3	Q96Q42	OTTHUMG00000154507	ENST00000264276.6:c.1243G>T	2.37:g.202622353C>A	ENSP00000264276:p.Ala415Ser		Q53TT1|Q53TV2|Q8N1E0|Q96PC4|Q96Q41|Q9H973|Q9HCK9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_MORN,pfam_VPS9,pfam_DH-domain,superfamily_RCC1/BLIP-II,superfamily_DH-domain,smart_MORN,pfscan_VPS9,pfscan_Reg_chr_condens,pfscan_DH-domain,prints_Reg_chr_condens	p.A415S	ENST00000264276.6	37	c.1243	CCDS42800.1	2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415397	0.83449	.	.	ENSG00000003393	ENST00000264276	T	0.59638	0.25	5.45	4.57	0.56435	.	0.142312	0.48767	D	0.000163	T	0.62429	0.2427	N	0.24115	0.695	0.80722	D	1	D;P;P	0.89917	1.0;0.825;0.533	D;B;B	0.83275	0.996;0.397;0.076	T	0.61013	-0.7148	10	0.30078	T	0.28	.	14.7993	0.69900	0.0:0.9301:0.0:0.0699	.	415;415;415	Q96Q42-3;Q6IQ41;Q96Q42	.;.;ALS2_HUMAN	S	415	ENSP00000264276:A415S	ENSP00000264276:A415S	A	-	1	0	ALS2	202330598	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.414000	0.66405	1.432000	0.47375	0.563000	0.77884	GCC	ALS2	-	NULL	ENSG00000003393		0.512	ALS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2	HGNC	protein_coding	OTTHUMT00000335562.3		0.00	34	0	C	NM_020919		202622353	-1			no_errors	ENST00000264276	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	A
AMOTL2	51421	genome.wustl.edu	37	3	134089688	134089688	+	Silent	SNP	C	C	T	rs200498719		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:134089688C>T	ENST00000422605.2	-	2	754	c.588G>A	c.(586-588)ctG>ctA	p.L196L	AMOTL2_ENST00000511759.1_Intron|AMOTL2_ENST00000514516.1_Silent_p.L254L|AMOTL2_ENST00000513145.1_Silent_p.L196L|AMOTL2_ENST00000249883.5_Silent_p.L196L			Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	196					hippo signaling (GO:0035329)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|tight junction (GO:0005923)				endometrium(8)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	19						GGGGGCCCCTCAGTGGGGGGC	0.662													C|||	1	0.000199681	0.0008	0.0	5008	,	,		14541	0.0		0.0	False		,,,				2504	0.0																0													26.0	34.0	32.0					3																	134089688		2192	4290	6482	SO:0001819	synonymous_variant	0			AF175966	CCDS33860.1, CCDS63783.1, CCDS63784.1	3q21-q22	2008-07-18			ENSG00000114019	ENSG00000114019			17812	protein-coding gene	gene with protein product	"""Leman coiled-coil protein"", ""angiomotin-like protein 2"""	614658					Standard	NM_016201		Approved	LCCP	uc003eqg.1	Q9Y2J4	OTTHUMG00000159777	ENST00000422605.2:c.588G>A	3.37:g.134089688C>T			A8K6F1|B7Z5Q1|E9PHW3|Q53EP1|Q96F99|Q9UKB4	Silent	SNP	pfam_Angiomotin_C,prints_Angiomotin	p.L196	ENST00000422605.2	37	c.588		3																																																																																			AMOTL2	-	NULL	ENSG00000114019		0.662	AMOTL2-014	KNOWN	basic|appris_candidate_longest	protein_coding	AMOTL2	HGNC	protein_coding	OTTHUMT00000358149.1		0.00	34	0	C	NM_016201		134089688	-1			no_errors	ENST00000249883	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.000	T
AMPH	273	genome.wustl.edu	37	7	38468286	38468286	+	Intron	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:38468286A>G	ENST00000356264.2	-	14	1398				AMPH_ENST00000325590.5_Intron|AMPH_ENST00000471913.1_5'UTR|AMPH_ENST00000428293.2_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin						endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GATGGATTCAAGATATCTGGG	0.398																																																	0																																										SO:0001627	intron_variant	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1182+1155T>C	7.37:g.38468286A>G			A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	RNA	SNP	-	NULL	ENST00000356264.2	37	NULL	CCDS5456.1	7																																																																																			AMPH	-	-	ENSG00000078053		0.398	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	-	0.00	49	0	A	NM_001635		38468286	-1	tier1	-	no_errors	ENST00000471913	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.067	G
ANKRD26P1	124149	genome.wustl.edu	37	16	46532145	46532145	+	RNA	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:46532145G>A	ENST00000571006.1	-	0	1085							Q6NSI1	AR26L_HUMAN	ankyrin repeat domain 26 pseudogene 1																		AGTTCTTGTTGAAGTTGTCTC	0.313																																																	0																																												0			BC070117		16q11.2	2014-03-18	2009-06-12		ENSG00000261239	ENSG00000261239			32955	pseudogene	pseudogene							Standard	NR_026556		Approved	FLJ43980	uc002eeb.3	Q6NSI1	OTTHUMG00000175593		16.37:g.46532145G>A				RNA	SNP	-	NULL	ENST00000571006.1	37	NULL		16																																																																																			ANKRD26P1	-	-	ENSG00000261239		0.313	ANKRD26P1-007	KNOWN	basic	processed_transcript	ANKRD26P1	HGNC	pseudogene	OTTHUMT00000437932.1		0.00	18	0	G	NR_026556		46532145	-1			no_errors	ENST00000566201	ensembl	human	known	74_37	rna	20.83	19	5	SNP	1.000	A
ANKRD30BP2	149992	genome.wustl.edu	37	21	14424175	14424175	+	IGR	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:14424175C>A								RNU6-614P (4165 upstream) : AL050302.1 (317755 downstream)																							GAACACCTGACACGGCTGAAA	0.438																																																	0																																										SO:0001628	intergenic_variant	0																															21.37:g.14424175C>A				RNA	SNP	-	NULL		37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309	0	0.438					ANKRD30BP2	HGNC			-	0.00	531	0	C			14424175	+1	tier1	-	no_errors	ENST00000471407	ensembl	human	known	74_37	rna	10.89	311	38	SNP	0.001	A
ANKRD31	256006	genome.wustl.edu	37	5	74441831	74441831	+	Silent	SNP	C	C	T	rs532389349		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:74441831C>T	ENST00000274361.3	-	14	3596	c.3405G>A	c.(3403-3405)aaG>aaA	p.K1135K	ANKRD31_ENST00000504022.1_Intron|ANKRD31_ENST00000506364.2_Silent_p.K1135K	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1135										endometrium(1)|kidney(4)	5						GAGAAATTTCCTTCTTTTCTC	0.289																																																	0													131.0	105.0	113.0					5																	74441831		692	1587	2279	SO:0001819	synonymous_variant	0			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.3405G>A	5.37:g.74441831C>T				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K1135	ENST00000274361.3	37	c.3405		5																																																																																			ANKRD31	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000145700		0.289	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		-	0.00	111	0	C	NM_001164443		74441831	-1	tier1	-	no_errors	ENST00000274361	ensembl	human	known	74_37	silent	14.16	96	16	SNP	0.003	T
ANO2	57101	genome.wustl.edu	37	12	5841762	5841762	+	Missense_Mutation	SNP	C	C	G	rs375457985		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:5841762C>G	ENST00000356134.5	-	16	1543	c.1472G>C	c.(1471-1473)cGa>cCa	p.R491P	ANO2_ENST00000546188.1_Missense_Mutation_p.R491P|ANO2_ENST00000327087.8_Missense_Mutation_p.R490P|ANO2_ENST00000538154.1_5'UTR	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	495					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CATTTTCTCTCGAACTTTGGT	0.448																																																	0													108.0	103.0	105.0					12																	5841762		1980	4163	6143	SO:0001583	missense	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1472G>C	12.37:g.5841762C>G	ENSP00000348453:p.Arg491Pro		C4N787|Q9H847	Missense_Mutation	SNP	pfam_Anoctamin	p.R491P	ENST00000356134.5	37	c.1472		12	.	.	.	.	.	.	.	.	.	.	C	16.88	3.243928	0.58995	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277;ENST00000545860	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	4.84	4.84	0.62591	.	0.064980	0.64402	D	0.000006	T	0.48677	0.1513	N	0.02685	-0.53	0.36347	D	0.859871	P	0.52692	0.955	P	0.53006	0.715	T	0.58787	-0.7575	10	0.25751	T	0.34	.	15.4822	0.75537	0.0:1.0:0.0:0.0	.	490	Q9NQ90-3	.	P	490;491;491;495;50	ENSP00000314048:R490P;ENSP00000348453:R491P;ENSP00000440981:R491P;ENSP00000443813:R50P	ENSP00000314048:R490P	R	-	2	0	ANO2	5712023	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.866000	0.56040	2.507000	0.84556	0.655000	0.94253	CGA	ANO2	-	pfam_Anoctamin	ENSG00000047617		0.448	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	-	0.00	106	0	C	NM_020373		5841762	-1	tier1	-	no_errors	ENST00000356134	ensembl	human	known	74_37	missense	14.75	104	18	SNP	0.999	G
AP5B1	91056	genome.wustl.edu	37	11	65546631	65546631	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:65546631G>A	ENST00000532090.2	-	2	1543	c.1333C>T	c.(1333-1335)Ctg>Ttg	p.L445L		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	445					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						AAGCCAGCCAGCAGCTCTTCC	0.667																																																	0													11.0	14.0	13.0					11																	65546631		1910	4092	6002	SO:0001819	synonymous_variant	0			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1333C>T	11.37:g.65546631G>A			A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Silent	SNP	NULL	p.L445	ENST00000532090.2	37	c.1333	CCDS58146.1	11																																																																																			AP5B1	-	NULL	ENSG00000254470		0.667	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	HGNC	protein_coding	OTTHUMT00000390636.2	-	0.00	42	0	G	NM_138368		65546631	-1	tier1	-	no_errors	ENST00000532090	ensembl	human	novel	74_37	silent	9.30	39	4	SNP	0.998	A
AP5M1	55745	genome.wustl.edu	37	14	57753022	57753022	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:57753022C>G	ENST00000261558.3	+	7	1781	c.1375C>G	c.(1375-1377)Cca>Gca	p.P459A	AP5M1_ENST00000431972.2_Missense_Mutation_p.P473A	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	459	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											ATCAGGAAAACCAAAAATAAG	0.323																																																	0													153.0	150.0	151.0					14																	57753022		2203	4299	6502	SO:0001583	missense	0			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.1375C>G	14.37:g.57753022C>G	ENSP00000261558:p.Pro459Ala		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	p.P459A	ENST00000261558.3	37	c.1375	CCDS9729.1	14	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630536	0.67015	.	.	ENSG00000053770	ENST00000261558;ENST00000431972	T;T	0.21191	2.02;2.02	5.76	5.76	0.90799	Clathrin adaptor, mu subunit, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.23532	0.0569	L	0.55481	1.735	0.80722	D	1	P	0.36086	0.536	B	0.32393	0.145	T	0.01925	-1.1246	10	0.27082	T	0.32	.	19.9607	0.97248	0.0:1.0:0.0:0.0	.	459	Q9H0R1	MUDEN_HUMAN	A	459;473	ENSP00000261558:P459A;ENSP00000390531:P473A	ENSP00000261558:P459A	P	+	1	0	MUDENG	56822775	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.419000	0.66435	2.713000	0.92767	0.585000	0.79938	CCA	AP5M1	-	superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	ENSG00000053770		0.323	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5M1	HGNC	protein_coding	OTTHUMT00000276922.1		0.00	46	0	C	NM_018229		57753022	+1			no_errors	ENST00000261558	ensembl	human	known	74_37	missense	9.68	56	6	SNP	1.000	G
ARHGAP40	343578	genome.wustl.edu	37	20	37255680	37255680	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:37255680C>T	ENST00000373345.4	+	3	389	c.221C>T	c.(220-222)tCg>tTg	p.S74L		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	74					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						ACAGGCCTGTCGGGCCTCCTT	0.617																																																	0													32.0	31.0	32.0					20																	37255680		692	1591	2283	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.221C>T	20.37:g.37255680C>T	ENSP00000362442:p.Ser74Leu			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S74L	ENST00000373345.4	37	c.221		20	.	.	.	.	.	.	.	.	.	.	C	11.10	1.539566	0.27563	.	.	ENSG00000124143	ENST00000373345	T	0.24538	1.85	4.58	1.43	0.22495	.	.	.	.	.	T	0.32823	0.0842	M	0.71871	2.18	0.09310	N	1	.	.	.	.	.	.	T	0.26883	-1.0090	7	0.66056	D	0.02	.	5.0023	0.14271	0.1264:0.6143:0.1676:0.0917	.	.	.	.	L	74	ENSP00000362442:S74L	ENSP00000362442:S74L	S	+	2	0	ARHGAP40	36689094	0.009000	0.17119	0.028000	0.17463	0.792000	0.44763	0.316000	0.19469	0.039000	0.15632	-0.235000	0.12190	TCG	ARHGAP40	-	NULL	ENSG00000124143		0.617	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP40	HGNC	protein_coding		-	0.00	67	0	C	XM_293123		37255680	+1	tier1	-	no_errors	ENST00000373345	ensembl	human	known	74_37	missense	11.39	70	9	SNP	0.035	T
ARFGEF2	10564	genome.wustl.edu	37	20	47587679	47587679	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:47587679G>A	ENST00000371917.4	+	10	1213	c.1213G>A	c.(1213-1215)Gtg>Atg	p.V405M		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	405					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GCGTTCCAAGGTGGTTTCCCT	0.443																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													126.0	119.0	121.0					20																	47587679		2203	4300	6503	SO:0001583	missense	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1213G>A	20.37:g.47587679G>A	ENSP00000360985:p.Val405Met		Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.V405M	ENST00000371917.4	37	c.1213	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	G	22.4	4.278441	0.80692	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.44482	0.92	5.76	5.76	0.90799	Armadillo-type fold (1);	0.174307	0.46758	N	0.000261	T	0.50837	0.1639	M	0.62209	1.925	0.44110	D	0.996885	P	0.46064	0.872	P	0.51615	0.675	T	0.53222	-0.8469	10	0.72032	D	0.01	.	9.8001	0.40759	0.1878:0.0:0.8122:0.0	.	405	Q9Y6D5	BIG2_HUMAN	M	405	ENSP00000360985:V405M	ENSP00000360985:V405M	V	+	1	0	ARFGEF2	47021086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.226000	0.58606	2.731000	0.93534	0.650000	0.86243	GTG	ARFGEF2	-	superfamily_ARM-type_fold	ENSG00000124198		0.443	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	-	0.00	77	0	G	NM_006420		47587679	+1	tier1	-	no_errors	ENST00000371917	ensembl	human	known	74_37	missense	19.20	101	24	SNP	1.000	A
ARHGEF1	9138	genome.wustl.edu	37	19	42408469	42408469	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:42408469G>C	ENST00000354532.3	+	22	2243	c.2095G>C	c.(2095-2097)Gat>Cat	p.D699H	ARHGEF1_ENST00000337665.4_Missense_Mutation_p.D714H|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.D755H|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.D666H|ARHGEF1_ENST00000378152.4_Missense_Mutation_p.D681H	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	699	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GCCCACGCCCGATGGCAAGAC	0.692																																																	0													22.0	21.0	21.0					19																	42408469		2200	4294	6494	SO:0001583	missense	0			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2095G>C	19.37:g.42408469G>C	ENSP00000346532:p.Asp699His		O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D714H	ENST00000354532.3	37	c.2140	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	19.92	3.916939	0.73098	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665;ENST00000378152	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	3.97	3.97	0.46021	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.066488	0.64402	D	0.000020	T	0.76212	0.3956	M	0.79614	2.46	0.58432	D	0.999998	D;D;D;D	0.71674	0.972;0.998;0.997;0.978	P;P;P;P	0.62089	0.641;0.898;0.884;0.705	T	0.80817	-0.1213	10	0.87932	D	0	-18.3934	13.9582	0.64162	0.0:0.0:1.0:0.0	.	681;714;666;699	Q6NX52;Q92888-3;Q92888-2;Q92888	.;.;.;ARHG1_HUMAN	H	699;666;714;681	ENSP00000346532:D699H;ENSP00000344429:D666H;ENSP00000337261:D714H;ENSP00000367394:D681H	ENSP00000337261:D714H	D	+	1	0	ARHGEF1	47100309	1.000000	0.71417	0.649000	0.29536	0.613000	0.37349	7.580000	0.82523	1.935000	0.56089	0.558000	0.71614	GAT	ARHGEF1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000076928		0.692	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	-	0.00	18	0	G	NM_199002		42408469	+1	tier1	-	no_errors	ENST00000337665	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	C
ARHGEF11	9826	genome.wustl.edu	37	1	156911690	156911690	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:156911690G>T	ENST00000361409.2	-	33	4040	c.3298C>A	c.(3298-3300)Cgg>Agg	p.R1100R	ARHGEF11_ENST00000487682.1_5'UTR|ARHGEF11_ENST00000315174.8_Silent_p.R516R|ARHGEF11_ENST00000368194.3_Silent_p.R1140R	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1100					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GCTGGCTCCCGGGGACCTGGG	0.642																																																	0													41.0	52.0	48.0					1																	156911690		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.3298C>A	1.37:g.156911690G>T			D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,pfam_RGS_dom,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal_superfam,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_DH-domain	p.R1140	ENST00000361409.2	37	c.3418	CCDS1162.1	1																																																																																			ARHGEF11	-	NULL	ENSG00000132694		0.642	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	-	0.00	54	0	G	NM_198236		156911690	-1	tier1	-	no_errors	ENST00000368194	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.983	T
ARHGEF17	9828	genome.wustl.edu	37	11	73020556	73020556	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:73020556G>A	ENST00000263674.3	+	1	1223	c.873G>A	c.(871-873)ggG>ggA	p.G291G	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	291					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						GCTGGGGAGGGAGGCCCGGGC	0.657																																																	0													22.0	29.0	27.0					11																	73020556		2176	4276	6452	SO:0001819	synonymous_variant	0			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.873G>A	11.37:g.73020556G>A			B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.G291	ENST00000263674.3	37	c.873	CCDS8221.1	11																																																																																			ARHGEF17	-	NULL	ENSG00000110237		0.657	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1	-	0.00	30	0	G	NM_014786		73020556	+1	tier1	-	no_errors	ENST00000263674	ensembl	human	known	74_37	silent	23.81	16	5	SNP	0.751	A
ARL5A	26225	genome.wustl.edu	37	2	152668909	152668909	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:152668909C>T	ENST00000295087.8	-	4	612	c.301G>A	c.(301-303)Gta>Ata	p.V101I	ARL5A_ENST00000428992.2_Missense_Mutation_p.V64I	NM_001037174.1|NM_012097.3	NP_001032251.1|NP_036229.1	Q9Y689	ARL5A_HUMAN	ADP-ribosylation factor-like 5A	101					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			breast(1)|large_intestine(2)|liver(1)|lung(2)	6				BRCA - Breast invasive adenocarcinoma(221;0.153)		TCTCTAGTTACAGAAATCCTC	0.303																																																	0													82.0	77.0	79.0					2																	152668909		2202	4296	6498	SO:0001583	missense	0			AF100740	CCDS2195.1, CCDS46425.1	2q23.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000162980	ENSG00000162980		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	696	protein-coding gene	gene with protein product		608960	"""ADP-ribosylation factor-like 5"""	ARL5			Standard	NM_012097		Approved		uc002txx.1	Q9Y689	OTTHUMG00000131887	ENST00000295087.8:c.301G>A	2.37:g.152668909C>T	ENSP00000295087:p.Val101Ile		Q580I5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V101I	ENST00000295087.8	37	c.301	CCDS2195.1	2	.	.	.	.	.	.	.	.	.	.	C	12.02	1.813661	0.32053	.	.	ENSG00000162980	ENST00000295087;ENST00000452215;ENST00000428992	D;D	0.82344	-1.6;-1.6	5.01	5.01	0.66863	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.70064	0.3181	N	0.05230	-0.09	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.66272	-0.5965	10	0.52906	T	0.07	-16.2384	18.3189	0.90231	0.0:1.0:0.0:0.0	.	101	Q9Y689	ARL5A_HUMAN	I	101;64;64	ENSP00000295087:V101I;ENSP00000415950:V64I	ENSP00000295087:V101I	V	-	1	0	ARL5A	152377155	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.862000	0.62976	2.327000	0.79052	0.460000	0.39030	GTA	ARL5A	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,tigrfam_Small_GTP-bd_dom	ENSG00000162980		0.303	ARL5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL5A	HGNC	protein_coding	OTTHUMT00000254837.1		0.00	114	0	C			152668909	-1			no_errors	ENST00000295087	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
ARL4C	10123	genome.wustl.edu	37	2	235405081	235405081	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:235405081C>T	ENST00000390645.2	-	1	616	c.150G>A	c.(148-150)gaG>gaA	p.E50E	ARL4C_ENST00000339728.3_Silent_p.E50E	NM_005737.3	NP_005728.2	P56559	ARL4C_HUMAN	ADP-ribosylation factor-like 4C	50					endocytic recycling (GO:0032456)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|ovary(1)|skin(1)|urinary_tract(1)	4		Breast(86;0.000596)|Renal(207;0.00339)|all_lung(227;0.00354)|all_hematologic(139;0.0494)|Lung NSC(271;0.0496)|Lung SC(224;0.164)|all_neural(83;0.173)		Epithelial(121;2.6e-19)|BRCA - Breast invasive adenocarcinoma(100;0.000296)|Lung(119;0.002)|LUSC - Lung squamous cell carcinoma(224;0.0048)		GCTTGATCTTCTCGGTGTTGA	0.617																																					Esophageal Squamous(157;1837 2534 13028 22831)												0													78.0	89.0	85.0					2																	235405081		2082	4221	6303	SO:0001819	synonymous_variant	0			AB016811	CCDS2512.1, CCDS63169.1	2q37.2	2014-05-09	2005-11-03	2005-11-03	ENSG00000188042	ENSG00000188042		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	698	protein-coding gene	gene with protein product		604787	"""ADP-ribosylation factor-like 7"""	ARL7			Standard	NM_005737		Approved	LAK	uc002vvn.3	P56559	OTTHUMG00000133291	ENST00000390645.2:c.150G>A	2.37:g.235405081C>T			Q4A519|Q53R10|Q9BVN1|Q9UQ34	Silent	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E50	ENST00000390645.2	37	c.150	CCDS2512.1	2																																																																																			ARL4C	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,tigrfam_Small_GTP-bd_dom	ENSG00000188042		0.617	ARL4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL4C	HGNC	protein_coding	OTTHUMT00000257073.1	-	0.00	76	0	C			235405081	-1	tier1	-	no_errors	ENST00000339728	ensembl	human	known	74_37	silent	14.55	46	8	SNP	1.000	T
ASAP1	50807	genome.wustl.edu	37	8	131199511	131199511	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:131199511G>T	ENST00000518721.1	-	7	728	c.501C>A	c.(499-501)gaC>gaA	p.D167E	ASAP1_ENST00000357668.1_Missense_Mutation_p.D167E	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	167					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TCCAGGCTTTGTCAAATGGCT	0.279																																																	0													75.0	77.0	76.0					8																	131199511		2203	4300	6503	SO:0001583	missense	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.501C>A	8.37:g.131199511G>T	ENSP00000429900:p.Asp167Glu		B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.D167E	ENST00000518721.1	37	c.501	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342303	0.41498	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721;ENST00000524367	T;T;T	0.04119	3.7;3.7;3.7	5.23	4.35	0.52113	IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.03348	0.0097	N	0.17474	0.49	0.80722	D	1	B;B	0.33212	0.402;0.402	B;B	0.23574	0.047;0.047	T	0.56056	-0.8042	10	0.32370	T	0.25	.	13.173	0.59611	0.0779:0.0:0.9221:0.0	.	167;167	B2RNV3;Q9ULH1	.;ASAP1_HUMAN	E	167;167;167;137	ENSP00000350297:D167E;ENSP00000429900:D167E;ENSP00000430588:D137E	ENSP00000344591:D167E	D	-	3	2	ASAP1	131268693	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.861000	0.87004	1.172000	0.42781	0.650000	0.86243	GAC	ASAP1	-	NULL	ENSG00000153317		0.279	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	-	0.00	85	0	G	NM_018482		131199511	-1	tier1	-	no_errors	ENST00000357668	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ASB1	51665	genome.wustl.edu	37	2	239353340	239353340	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:239353340G>T	ENST00000264607.4	+	4	1099	c.852G>T	c.(850-852)gaG>gaT	p.E284D	ASB1_ENST00000409297.1_Missense_Mutation_p.E183D	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	284					intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		TGGACCCTGAGGCCTTGCAGG	0.488																																																	0													61.0	70.0	67.0					2																	239353340		2203	4300	6503	SO:0001583	missense	0			AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.852G>T	2.37:g.239353340G>T	ENSP00000264607:p.Glu284Asp		A6NL50|Q4ZG29|Q9ULS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.E284D	ENST00000264607.4	37	c.852	CCDS33416.1	2	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586274	0.66105	.	.	ENSG00000065802	ENST00000264607;ENST00000409297	T;T	0.60424	0.19;1.78	5.77	2.61	0.31194	Ankyrin repeat-containing domain (1);	0.222920	0.46442	N	0.000293	T	0.47655	0.1457	M	0.72118	2.19	0.45979	D	0.998793	B	0.06786	0.001	B	0.04013	0.001	T	0.41251	-0.9519	9	.	.	.	.	2.1098	0.03700	0.2264:0.1471:0.4762:0.1503	.	284	Q9Y576	ASB1_HUMAN	D	284;183	ENSP00000264607:E284D;ENSP00000387025:E183D	.	E	+	3	2	ASB1	239018079	1.000000	0.71417	0.954000	0.39281	0.972000	0.66771	1.599000	0.36751	0.784000	0.33661	-0.304000	0.09214	GAG	ASB1	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000065802		0.488	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB1	HGNC	protein_coding	OTTHUMT00000328294.1	-	0.00	109	0	G	NM_001040445		239353340	+1	tier1	-	no_errors	ENST00000264607	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.999	T
ASB2	51676	genome.wustl.edu	37	14	94404059	94404059	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:94404059T>C	ENST00000315988.4	-	7	2100	c.1612A>G	c.(1612-1614)Atc>Gtc	p.I538V	ASB2_ENST00000556337.1_5'Flank|ASB2_ENST00000555019.1_Missense_Mutation_p.I586V|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	538	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		TTCTCCTTGATGACGGCCCAG	0.612																																																	0													111.0	94.0	100.0					14																	94404059		2203	4300	6503	SO:0001583	missense	0			AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1612A>G	14.37:g.94404059T>C	ENSP00000320675:p.Ile538Val		B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.I538V	ENST00000315988.4	37	c.1612	CCDS9915.1	14	.	.	.	.	.	.	.	.	.	.	T	15.85	2.954713	0.53293	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988	T;T	0.29917	1.55;1.55	5.13	5.13	0.70059	SOCS protein, C-terminal (1);	0.049339	0.85682	D	0.000000	T	0.46073	0.1374	L	0.45581	1.43	0.53688	D	0.999971	P;D;P	0.59357	0.744;0.985;0.744	B;D;B	0.67548	0.279;0.952;0.279	T	0.23904	-1.0175	10	0.26408	T	0.33	13.6678	14.9326	0.70929	0.0:0.0:0.0:1.0	.	554;586;538	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	V	586;554;538	ENSP00000451575:I586V;ENSP00000320675:I538V	ENSP00000320675:I538V	I	-	1	0	ASB2	93473812	0.631000	0.27164	0.997000	0.53966	0.973000	0.67179	0.969000	0.29370	1.933000	0.56026	0.379000	0.24179	ATC	ASB2	-	pfscan_SOCS_C	ENSG00000100628		0.612	ASB2-001	KNOWN	basic|CCDS	protein_coding	ASB2	HGNC	protein_coding	OTTHUMT00000412845.1	-	0.00	59	0	T			94404059	-1	tier1	-	no_errors	ENST00000315988	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.997	C
ASPHD2	57168	genome.wustl.edu	37	22	26830127	26830127	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr22:26830127C>T	ENST00000215906.5	+	2	984	c.546C>T	c.(544-546)gaC>gaT	p.D182D		NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	182					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						TCTCCCGGGACGCACAGAAAC	0.592																																																	0													42.0	43.0	43.0					22																	26830127		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.546C>T	22.37:g.26830127C>T			B2RCH3|Q7L0W3|Q9NSN3	Silent	SNP	pfam_Asp_Arg_b-Hydrxlase	p.D182	ENST00000215906.5	37	c.546	CCDS13834.2	22																																																																																			ASPHD2	-	NULL	ENSG00000128203		0.592	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPHD2	HGNC	protein_coding	OTTHUMT00000320422.1	-	0.00	74	0	C	NM_020437		26830127	+1	tier1	-	no_errors	ENST00000215906	ensembl	human	known	74_37	silent	24.62	49	16	SNP	0.234	T
ASXL1	171023	genome.wustl.edu	37	20	31024392	31024392	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:31024392G>A	ENST00000375687.4	+	13	4301	c.3877G>A	c.(3877-3879)Gat>Aat	p.D1293N	ASXL1_ENST00000306058.5_Missense_Mutation_p.D1288N	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1293					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GGCCCTGGGTGATCAGAGCAA	0.557			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													72.0	70.0	70.0					20																	31024392		2203	4300	6503	SO:0001583	missense	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3877G>A	20.37:g.31024392G>A	ENSP00000364839:p.Asp1293Asn		B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NULL	p.D1293N	ENST00000375687.4	37	c.3877	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	G	2.461	-0.324055	0.05350	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.15017	2.47;2.46	4.09	0.996	0.19844	.	0.677027	0.15922	N	0.238098	T	0.10594	0.0259	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.26950	-1.0088	10	0.30078	T	0.28	-0.4801	3.402	0.07327	0.427:0.0:0.3925:0.1804	.	1288;1293	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	N	1293;1293;1293;1214;1288	ENSP00000364839:D1293N;ENSP00000305119:D1288N	ENSP00000305119:D1288N	D	+	1	0	ASXL1	30488053	0.023000	0.18921	0.046000	0.18839	0.619000	0.37552	0.249000	0.18216	0.267000	0.21916	-0.215000	0.12644	GAT	ASXL1	-	NULL	ENSG00000171456		0.557	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	-	0.00	80	0	G	NM_015338		31024392	+1	tier1	-	no_errors	ENST00000375687	ensembl	human	known	74_37	missense	12.90	81	12	SNP	0.007	A
ATM	472	genome.wustl.edu	37	11	108216597	108216597	+	Missense_Mutation	SNP	G	G	A	rs587782202		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:108216597G>A	ENST00000452508.2	+	59	8735	c.8546G>A	c.(8545-8547)cGa>cAa	p.R2849Q	ATM_ENST00000278616.4_Missense_Mutation_p.R2849Q|C11orf65_ENST00000526725.1_Intron|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2849	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		R -> P (in AT). {ECO:0000269|PubMed:9887333}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTTGAGAAGCGATTGGCTTAT	0.358			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0			GRCh37	CM990219	ATM	M							150.0	154.0	153.0					11																	108216597		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8546G>A	11.37:g.108216597G>A	ENSP00000388058:p.Arg2849Gln		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R2849Q	ENST00000452508.2	37	c.8546	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.858083	0.97036	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.83992	-1.79;-1.79	5.54	5.54	0.83059	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.91033	0.7179	M	0.73372	2.23	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91565	0.5267	10	0.87932	D	0	.	19.4688	0.94954	0.0:0.0:1.0:0.0	.	2849	Q13315	ATM_HUMAN	Q	2849	ENSP00000278616:R2849Q;ENSP00000388058:R2849Q	ENSP00000278616:R2849Q	R	+	2	0	ATM	107721807	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.847000	0.99503	2.594000	0.87642	0.650000	0.86243	CGA	ATM	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000149311		0.358	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	89	0	G	NM_000051		108216597	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	7.95	81	7	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25928510	25928510	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:25928510C>T	ENST00000356865.6	-	17	3526	c.3415G>A	c.(3415-3417)Ggg>Agg	p.G1139R		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1139					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCCAGCACCCCAGTCACGAGC	0.537																																																	0													74.0	66.0	69.0					15																	25928510		2203	4300	6503	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.3415G>A	15.37:g.25928510C>T	ENSP00000349325:p.Gly1139Arg		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G1139R	ENST00000356865.6	37	c.3415	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006506	0.93287	.	.	ENSG00000206190	ENST00000356865	D	0.90444	-2.67	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.97495	0.9180	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.99774	1.1025	10	0.87932	D	0	-36.8958	17.8828	0.88845	0.0:1.0:0.0:0.0	.	1139	O60312	AT10A_HUMAN	R	1139	ENSP00000349325:G1139R	ENSP00000349325:G1139R	G	-	1	0	ATP10A	23479603	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.565000	0.82337	2.205000	0.71048	0.655000	0.94253	GGG	ATP10A	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000206190		0.537	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1		0.00	37	0	C	NM_024490		25928510	-1			no_errors	ENST00000356865	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
ATP12A	479	genome.wustl.edu	37	13	25272866	25272866	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:25272866G>T	ENST00000381946.3	+	12	1750	c.1583G>T	c.(1582-1584)cGc>cTc	p.R528L	ATP12A_ENST00000218548.6_Missense_Mutation_p.R534L			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	528					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)	p.R528H(1)		breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GCCCCTGAGCGCATCCTAGAG	0.572																																					Pancreas(156;1582 1935 18898 22665 26498)												1	Substitution - Missense(1)	large_intestine(1)											99.0	95.0	97.0					13																	25272866		2203	4300	6503	SO:0001583	missense	0			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1583G>T	13.37:g.25272866G>T	ENSP00000371372:p.Arg528Leu		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.R534L	ENST00000381946.3	37	c.1601	CCDS31948.1	13	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668617	0.47677	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	T;T	0.79749	-1.3;-1.3	5.72	4.88	0.63580	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.062472	0.64402	D	0.000006	T	0.80696	0.4672	M	0.70842	2.15	0.58432	D	0.999999	P;P	0.43973	0.823;0.722	B;B	0.42593	0.392;0.172	T	0.82774	-0.0291	10	0.87932	D	0	.	12.5302	0.56111	0.0806:0.0:0.9194:0.0	.	534;528	P54707-2;P54707	.;AT12A_HUMAN	L	534;528	ENSP00000218548:R534L;ENSP00000371372:R528L	ENSP00000218548:R534L	R	+	2	0	ATP12A	24170866	1.000000	0.71417	0.985000	0.45067	0.124000	0.20399	7.849000	0.86908	1.430000	0.47334	0.655000	0.94253	CGC	ATP12A	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000075673		0.572	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1		0.00	29	0	G	NM_001676		25272866	+1			no_errors	ENST00000218548	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
ATP13A1	57130	genome.wustl.edu	37	19	19760549	19760549	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:19760549C>T	ENST00000357324.6	-	18	2562		c.e18+1		ATP13A1_ENST00000291503.5_Splice_Site	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGTGCACATACCTTCTGCTTG	0.657																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													73.0	69.0	70.0					19																	19760549		2203	4300	6503	SO:0001630	splice_region_variant	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.2535+1G>A	19.37:g.19760549C>T			B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Splice_Site	SNP	-	e18+1	ENST00000357324.6	37	c.2535+1	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027407	0.54683	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6938	0.85329	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP13A1	19621549	1.000000	0.71417	0.996000	0.52242	0.374000	0.29953	7.376000	0.79658	2.557000	0.86248	0.561000	0.74099	.	ATP13A1	-	-	ENSG00000105726		0.657	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	-	0.00	30	0	C	NM_020410	Intron	19760549	-1	tier1	-	no_errors	ENST00000357324	ensembl	human	known	74_37	splice_site	11.43	31	4	SNP	1.000	T
ATP13A1	57130	genome.wustl.edu	37	19	19767686	19767686	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:19767686C>T	ENST00000357324.6	-	6	972	c.946G>A	c.(946-948)Gag>Aag	p.E316K	ATP13A1_ENST00000291503.5_Missense_Mutation_p.E198K|ATP13A1_ENST00000496082.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	316						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGTACGATCTCATCACTGGCA	0.662																																					Esophageal Squamous(142;920 1789 9047 14684 24777)												0													43.0	41.0	42.0					19																	19767686		2203	4299	6502	SO:0001583	missense	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.946G>A	19.37:g.19767686C>T	ENSP00000349877:p.Glu316Lys		B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.E316K	ENST00000357324.6	37	c.946	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883413	0.33255	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.91996	-2.95;-2.95	5.25	4.21	0.49690	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.142260	0.64402	N	0.000007	D	0.89986	0.6874	M	0.76002	2.32	0.58432	D	0.999999	P;P	0.37122	0.583;0.521	B;B	0.35813	0.159;0.211	D	0.86888	0.2046	10	0.24483	T	0.36	-22.6838	11.4182	0.49965	0.0:0.9116:0.0:0.0884	.	316;198	Q9HD20;Q9HD20-2	AT131_HUMAN;.	K	198;316	ENSP00000291503:E198K;ENSP00000349877:E316K	ENSP00000291503:E198K	E	-	1	0	ATP13A1	19628686	1.000000	0.71417	0.026000	0.17262	0.329000	0.28539	5.697000	0.68295	1.205000	0.43262	0.563000	0.77884	GAG	ATP13A1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000105726		0.662	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	-	0.00	144	0	C	NM_020410		19767686	-1	tier1	-	no_errors	ENST00000357324	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.998	T
ATP1A2	477	genome.wustl.edu	37	1	160098826	160098826	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:160098826C>T	ENST00000361216.3	+	10	1362	c.1273C>T	c.(1273-1275)Ctc>Ttc	p.L425F	ATP1A2_ENST00000392233.3_Missense_Mutation_p.L425F	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	425					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			AATTGCTGGTCTCTGCAACCG	0.572																																																	0													46.0	38.0	41.0					1																	160098826		2203	4300	6503	SO:0001583	missense	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1273C>T	1.37:g.160098826C>T	ENSP00000354490:p.Leu425Phe		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.L425F	ENST00000361216.3	37	c.1273	CCDS1196.1	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274176	0.80580	.	.	ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866	D;D	0.83335	-1.71;-1.71	4.13	4.13	0.48395	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.068496	0.64402	D	0.000010	D	0.90974	0.7162	M	0.88450	2.955	0.58432	D	0.999999	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.77004	0.989;0.981;0.989	D	0.92663	0.6143	10	0.87932	D	0	.	15.6667	0.77236	0.0:1.0:0.0:0.0	.	425;325;425	B1AKY9;F5GXJ7;P50993	.;.;AT1A2_HUMAN	F	425;425;128	ENSP00000354490:L425F;ENSP00000376066:L425F	ENSP00000354490:L425F	L	+	1	0	ATP1A2	158365450	0.998000	0.40836	0.999000	0.59377	0.963000	0.63663	3.835000	0.55805	2.306000	0.77630	0.561000	0.74099	CTC	ATP1A2	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000018625		0.572	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2		0.00	96	0	C	NM_000702		160098826	+1			no_errors	ENST00000361216	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
ATR	545	genome.wustl.edu	37	3	142218487	142218487	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:142218487C>A	ENST00000350721.4	-	31	5483	c.5362G>T	c.(5362-5364)Gaa>Taa	p.E1788*	ATR_ENST00000383101.3_Nonsense_Mutation_p.E1724*	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1788	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AAATAGTTTTCCACCAAATCC	0.433								Other conserved DNA damage response genes																																									0													137.0	133.0	135.0					3																	142218487		2203	4300	6503	SO:0001587	stop_gained	0			U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5362G>T	3.37:g.142218487C>A	ENSP00000343741:p.Glu1788*		Q59HB2|Q7KYL3|Q93051|Q9BXK4	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.E1788*	ENST00000350721.4	37	c.5362	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	C	46	12.924927	0.99706	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	.	.	.	4.95	4.95	0.65309	.	0.799496	0.11000	N	0.610606	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-16.3741	18.1893	0.89802	0.0:1.0:0.0:0.0	.	.	.	.	X	1788;1724	.	ENSP00000343741:E1788X	E	-	1	0	ATR	143701177	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.150000	0.58098	2.299000	0.77371	0.655000	0.94253	GAA	ATR	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000175054		0.433	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2		0.00	97	0	C	NM_001184		142218487	-1			no_errors	ENST00000350721	ensembl	human	known	74_37	nonsense	6.41	73	5	SNP	1.000	A
ATXN1L	342371	genome.wustl.edu	37	16	71885639	71885639	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:71885639G>T	ENST00000427980.2	+	3	2289	c.1996G>T	c.(1996-1998)Gcg>Tcg	p.A666S	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	666					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						GGCACGGGCTGCGCTGCTCCG	0.607																																																	0													21.0	24.0	23.0					16																	71885639		692	1591	2283	SO:0001583	missense	0				CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1996G>T	16.37:g.71885639G>T	ENSP00000415822:p.Ala666Ser			Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.A666S	ENST00000427980.2	37	c.1996	CCDS45523.1	16	.	.	.	.	.	.	.	.	.	.	G	12.28	1.889577	0.33348	.	.	ENSG00000224470	ENST00000427980	T	0.30981	1.51	5.7	1.32	0.21799	.	.	.	.	.	T	0.14787	0.0357	N	0.25647	0.755	0.31524	N	0.662017	B	0.02656	0.0	B	0.04013	0.001	T	0.28299	-1.0048	9	0.11794	T	0.64	0.0355	1.1877	0.01859	0.2984:0.1121:0.3762:0.2134	.	666	P0C7T5	ATX1L_HUMAN	S	666	ENSP00000415822:A666S	ENSP00000415822:A666S	A	+	1	0	ATXN1L	70443140	0.075000	0.21258	0.837000	0.33122	0.742000	0.42306	0.382000	0.20635	0.366000	0.24427	0.555000	0.69702	GCG	ATXN1L	-	NULL	ENSG00000224470		0.607	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1L	HGNC	protein_coding	OTTHUMT00000434171.1	-	0.00	62	0	G	NM_001137675.2		71885639	+1	tier1	-	no_errors	ENST00000427980	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.989	T
B4GALNT4	338707	genome.wustl.edu	37	11	373228	373228	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:373228G>A	ENST00000329962.6	+	6	573	c.573G>A	c.(571-573)tcG>tcA	p.S191S		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	191					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		ACGACAACTCGGAGTTCTGGC	0.657																																																	0													61.0	60.0	60.0					11																	373228		2199	4294	6493	SO:0001819	synonymous_variant	0			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.573G>A	11.37:g.373228G>A			Q96LV2	Silent	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.S191	ENST00000329962.6	37	c.573	CCDS7694.1	11																																																																																			B4GALNT4	-	pfam_PA14,smart_PA14	ENSG00000182272		0.657	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	-	0.00	57	0	G	NM_178537		373228	+1	tier1	-	no_errors	ENST00000329962	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.984	A
BANP	54971	genome.wustl.edu	37	16	88105097	88105097	+	Intron	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:88105097C>T	ENST00000393207.1	+	13	1565				BANP_ENST00000286122.7_Intron|BANP_ENST00000538234.1_Intron|BANP_ENST00000481948.1_3'UTR|BANP_ENST00000355163.5_Intron|BANP_ENST00000479780.2_Intron|BANP_ENST00000355022.4_Intron|BANP_ENST00000393208.2_Intron	NM_001173543.1	NP_001167014.1	Q8N9N5	BANP_HUMAN	BTG3 associated nuclear protein						cell cycle (GO:0007049)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of protein catabolic process (GO:0042177)|protein localization to nucleus (GO:0034504)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.00551)		GCGGGGCTCTCTGCCACCAGG	0.637																																																	0																																										SO:0001627	intron_variant	0			AK094158	CCDS10966.2, CCDS42215.1, CCDS54052.1, CCDS54053.1, CCDS54054.1	16q24	2012-11-22			ENSG00000172530	ENSG00000172530		"""BEN domain containing"""	13450	protein-coding gene	gene with protein product	"""BEN domain containing 1"""	611564				10940556, 10950932	Standard	NM_017869		Approved	SMARBP1, SMAR1, FLJ20538, DKFZp761H172, FLJ10177, BEND1	uc010vow.2	Q8N9N5	OTTHUMG00000137678	ENST00000393207.1:c.1345-578C>T	16.37:g.88105097C>T			A8MU25|A8MX25|B2RCF7|B4DNJ9|F5GZM0|Q96GJ7|Q9NWY1	RNA	SNP	-	NULL	ENST00000393207.1	37	NULL	CCDS54054.1	16																																																																																			BANP	-	-	ENSG00000172530		0.637	BANP-002	KNOWN	basic|CCDS	protein_coding	BANP	HGNC	protein_coding	OTTHUMT00000269166.1	-	0.00	34	0	C	NM_017869		88105097	+1	tier1	-	no_errors	ENST00000481948	ensembl	human	known	74_37	rna	9.62	47	5	SNP	0.022	T
BBS4	585	genome.wustl.edu	37	15	73002069	73002069	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:73002069G>T	ENST00000268057.4	+	3	146	c.105G>T	c.(103-105)caG>caT	p.Q35H	BBS4_ENST00000564239.1_3'UTR|BBS4_ENST00000539603.1_Missense_Mutation_p.Q23H|BBS4_ENST00000395205.2_Missense_Mutation_p.Q43H|BBS4_ENST00000542334.1_5'UTR	NM_033028.4	NP_149017.2	Q96RK4	BBS4_HUMAN	Bardet-Biedl syndrome 4	35	Required for localization to centrosomes.				adult behavior (GO:0030534)|brain morphogenesis (GO:0048854)|centrosome organization (GO:0051297)|cerebral cortex development (GO:0021987)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|dendrite development (GO:0016358)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|maintenance of protein location in nucleus (GO:0051457)|melanosome transport (GO:0032402)|metabolic process (GO:0008152)|microtubule anchoring at centrosome (GO:0034454)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of systemic arterial blood pressure (GO:0003085)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of cilium assembly (GO:0045724)|positive regulation of multicellular organism growth (GO:0040018)|protein localization to centrosome (GO:0071539)|protein localization to organelle (GO:0033365)|protein transport (GO:0015031)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of cytokinesis (GO:0032465)|regulation of lipid metabolic process (GO:0019216)|retina homeostasis (GO:0001895)|retinal rod cell development (GO:0046548)|sensory perception of smell (GO:0007608)|sensory processing (GO:0050893)|spermatid development (GO:0007286)|striatum development (GO:0021756)|visual perception (GO:0007601)	BBSome (GO:0034464)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary membrane (GO:0060170)|cilium (GO:0005929)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|pericentriolar material (GO:0000242)	alpha-tubulin binding (GO:0043014)|beta-tubulin binding (GO:0048487)|dynactin binding (GO:0034452)|microtubule motor activity (GO:0003777)|RNA polymerase II repressing transcription factor binding (GO:0001103)			autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(1)	19						TGGAGAAGCAGAACTGGTTGA	0.388									Bardet-Biedl syndrome																																								0													145.0	145.0	145.0					15																	73002069		2198	4297	6495	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	AF090947	CCDS10246.1, CCDS58377.1	15q22.3-q23	2013-01-10			ENSG00000140463	ENSG00000140463		"""Tetratricopeptide (TTC) repeat domain containing"""	969	protein-coding gene	gene with protein product		600374				7711739, 11381270	Standard	NM_033028		Approved		uc002avb.3	Q96RK4	OTTHUMG00000133510	ENST00000268057.4:c.105G>T	15.37:g.73002069G>T	ENSP00000268057:p.Gln35His		B4E178|Q53DZ5|Q8NHU9|Q96H45	Nonsense_Mutation	SNP	NULL	p.E55*	ENST00000268057.4	37	c.163	CCDS10246.1	15	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224294	0.79576	.	.	ENSG00000140463	ENST00000268057;ENST00000539603;ENST00000395205	T;T;T	0.54479	0.57;0.57;0.57	5.05	3.18	0.36537	.	0.165431	0.49916	D	0.000121	T	0.41259	0.1151	L	0.44542	1.39	0.80722	D	1	P;P;B	0.42123	0.526;0.771;0.26	B;B;B	0.43251	0.319;0.413;0.17	T	0.14952	-1.0454	10	0.15499	T	0.54	-2.1878	6.1381	0.20245	0.1696:0.1544:0.676:0.0	.	23;43;35	F5H7I8;Q96RK4-2;Q96RK4	.;.;BBS4_HUMAN	H	35;23;43	ENSP00000268057:Q35H;ENSP00000442492:Q23H;ENSP00000378631:Q43H	ENSP00000268057:Q35H	Q	+	3	2	BBS4	70789122	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.402000	0.44521	0.542000	0.28846	0.655000	0.94253	CAG	BBS4	-	NULL	ENSG00000140463		0.388	BBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBS4	HGNC	protein_coding	OTTHUMT00000257473.2	-	0.00	88	0	G	NM_033028		73002069	+1	tier1	-	no_errors	ENST00000567279	ensembl	human	known	74_37	nonsense	8.86	72	7	SNP	1.000	T
BCAN	63827	genome.wustl.edu	37	1	156621307	156621307	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:156621307G>C	ENST00000329117.5	+	7	1459	c.1123G>C	c.(1123-1125)Gat>Cat	p.D375H	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.D375H	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	375					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					cccagcctcTGATGGACTAGA	0.577																																																	0													47.0	46.0	46.0					1																	156621307		2203	4300	6503	SO:0001583	missense	0			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1123G>C	1.37:g.156621307G>C	ENSP00000331210:p.Asp375His		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom	p.D375H	ENST00000329117.5	37	c.1123	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342532	0.61073	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.17213	2.29;2.98	5.17	3.3	0.37823	.	0.179610	0.34268	N	0.004117	T	0.15219	0.0367	L	0.29908	0.895	0.44531	D	0.997489	P;D	0.71674	0.826;0.998	B;D	0.66716	0.341;0.946	T	0.01914	-1.1248	10	0.62326	D	0.03	-14.8327	10.3246	0.43785	0.1601:0.0:0.8399:0.0	.	375;375	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	H	314;375;375	ENSP00000331210:D375H;ENSP00000354925:D375H	ENSP00000255029:D314H	D	+	1	0	BCAN	154887931	1.000000	0.71417	0.977000	0.42913	0.892000	0.51952	3.720000	0.54933	0.766000	0.33244	-0.136000	0.14681	GAT	BCAN	-	NULL	ENSG00000132692		0.577	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	-	0.00	81	0	G	NM_021948		156621307	+1	tier1	-	no_errors	ENST00000329117	ensembl	human	known	74_37	missense	12.07	51	7	SNP	0.987	C
BCAN	63827	genome.wustl.edu	37	1	156621337	156621337	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:156621337G>A	ENST00000329117.5	+	7	1489	c.1153G>A	c.(1153-1155)Gag>Aag	p.E385K	RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.E385K	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	385	Glu-rich.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CACAGTGACAGAGACCCTGGA	0.607																																																	0													65.0	61.0	62.0					1																	156621337		2203	4300	6503	SO:0001583	missense	0			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.1153G>A	1.37:g.156621337G>A	ENSP00000331210:p.Glu385Lys		D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom	p.E385K	ENST00000329117.5	37	c.1153	CCDS1149.1	1	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933930	0.92458	.	.	ENSG00000132692	ENST00000255029;ENST00000329117;ENST00000361588	T;T	0.15372	2.43;3.14	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000009	T	0.25195	0.0612	L	0.36672	1.1	0.46279	D	0.998966	D;D	0.76494	0.999;0.986	D;P	0.80764	0.994;0.886	T	0.01428	-1.1357	10	0.72032	D	0.01	-18.8758	17.4015	0.87461	0.0:0.0:1.0:0.0	.	385;385	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	K	324;385;385	ENSP00000331210:E385K;ENSP00000354925:E385K	ENSP00000255029:E324K	E	+	1	0	BCAN	154887961	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	5.890000	0.69774	2.692000	0.91855	0.655000	0.94253	GAG	BCAN	-	NULL	ENSG00000132692		0.607	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	-	0.00	88	0	G	NM_021948		156621337	+1	tier1	-	no_errors	ENST00000329117	ensembl	human	known	74_37	missense	9.23	59	6	SNP	1.000	A
BCOR	54880	genome.wustl.edu	37	X	39914677	39914677	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:39914677G>C	ENST00000378444.4	-	12	4913	c.4685C>G	c.(4684-4686)tCa>tGa	p.S1562*	BCOR_ENST00000397354.3_Nonsense_Mutation_p.S1528*|BCOR_ENST00000342274.4_Nonsense_Mutation_p.S1528*|BCOR_ENST00000378455.4_Nonsense_Mutation_p.S1510*|BCOR_ENST00000378463.1_Nonsense_Mutation_p.S405*	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1562					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						GGTTCTACCTGAGTACGTAGC	0.418			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																																	Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													127.0	106.0	113.0					X																	39914677		2202	4300	6502	SO:0001587	stop_gained	0			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4685C>G	X.37:g.39914677G>C	ENSP00000367705:p.Ser1562*		D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1562*	ENST00000378444.4	37	c.4685	CCDS48093.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	47|47	13.111851|13.111851	0.99720|0.99720	.|.	.|.	ENSG00000183337|ENSG00000183337	ENST00000427012|ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	.|.	.|.	.|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	.|.	.|.	.|.	.|.	T|.	0.78742|.	0.4331|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.81437|.	-0.0933|.	3|.	.|0.72032	.|D	.|0.01	-14.4337|-14.4337	18.4686|18.4686	0.90765|0.90765	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	E|X	257|432;405;1510;1528;1562;1528;235	.|.	.|ENSP00000345923:S1528X	Q|S	-|-	1|2	0|0	BCOR|BCOR	39799621|39799621	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	9.476000|9.476000	0.97823|0.97823	2.301000|2.301000	0.77427|0.77427	0.600000|0.600000	0.82982|0.82982	CAG|TCA	BCOR	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183337		0.418	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	-	0.00	46	0	G	NM_017745		39914677	-1	tier1	-	no_errors	ENST00000378444	ensembl	human	known	74_37	nonsense	15.00	68	12	SNP	1.000	C
BIRC3	330	genome.wustl.edu	37	11	102201960	102201960	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:102201960G>T	ENST00000263464.3	+	6	4062	c.1312G>T	c.(1312-1314)Gaa>Taa	p.E438*	BIRC3_ENST00000532808.1_Nonsense_Mutation_p.E438*	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	438					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		AGCAACTGAGGAAAAAGAATC	0.318			T	MALT1	MALT																																			Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	0													64.0	72.0	69.0					11																	102201960		2203	4299	6502	SO:0001587	stop_gained	0			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1312G>T	11.37:g.102201960G>T	ENSP00000263464:p.Glu438*		Q16628|Q9HC27|Q9UP46	Nonsense_Mutation	SNP	pfam_BIR,pfam_CARD,superfamily_DEATH-like_dom,smart_BIR,smart_CARD,smart_Znf_RING,pfscan_CARD,pfscan_BIR,pfscan_Znf_RING	p.E438*	ENST00000263464.3	37	c.1312	CCDS8315.1	11	.	.	.	.	.	.	.	.	.	.	G	37	5.987186	0.97173	.	.	ENSG00000023445	ENST00000263464;ENST00000532808	.	.	.	5.31	4.4	0.53042	.	0.133205	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	14.2246	0.65850	0.0717:0.0:0.9283:0.0	.	.	.	.	X	438	.	ENSP00000263464:E438X	E	+	1	0	BIRC3	101707170	1.000000	0.71417	0.688000	0.30117	0.768000	0.43524	7.229000	0.78088	1.469000	0.48083	0.585000	0.79938	GAA	BIRC3	-	NULL	ENSG00000023445		0.318	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BIRC3	HGNC	protein_coding	OTTHUMT00000394159.1	-	0.00	84	0	G	NM_001165		102201960	+1	tier1	-	no_errors	ENST00000263464	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	1.000	T
BLM	641	genome.wustl.edu	37	15	91292721	91292721	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:91292721G>A	ENST00000355112.3	+	3	341	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	BLM_ENST00000560509.1_Missense_Mutation_p.E75K	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	75					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TTCCTTCAGTGAACCTCTACC	0.368			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																														yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													68.0	67.0	68.0					15																	91292721		2198	4298	6496	SO:0001583	missense	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.223G>A	15.37:g.91292721G>A	ENSP00000347232:p.Glu75Lys		Q52M96	Missense_Mutation	SNP	pfam_RQC_domain,pfam_BDHCT,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_HRDC-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.E75K	ENST00000355112.3	37	c.223	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124559	0.37533	.	.	ENSG00000197299	ENST00000355112	T	0.40225	1.04	5.91	3.67	0.42095	.	0.607325	0.15793	N	0.244341	T	0.32224	0.0822	L	0.55481	1.735	0.09310	N	1	B;B	0.33266	0.404;0.192	B;B	0.24848	0.056;0.033	T	0.12863	-1.0531	10	0.27082	T	0.32	-15.2641	8.1266	0.31003	0.0946:0.1647:0.7407:0.0	.	75;75	B2RAN0;P54132	.;BLM_HUMAN	K	75	ENSP00000347232:E75K	ENSP00000347232:E75K	E	+	1	0	BLM	89093725	0.940000	0.31905	0.171000	0.22900	0.398000	0.30690	2.678000	0.46900	1.461000	0.47929	0.655000	0.94253	GAA	BLM	-	NULL	ENSG00000197299		0.368	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	-	0.00	100	0	G			91292721	+1	tier1	-	no_errors	ENST00000355112	ensembl	human	known	74_37	missense	6.32	88	6	SNP	0.093	A
BRD4	23476	genome.wustl.edu	37	19	15366318	15366318	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:15366318C>T	ENST00000263377.2	-	10	2058	c.1837G>A	c.(1837-1839)Gag>Aag	p.E613K	BRD4_ENST00000371835.4_Missense_Mutation_p.E613K|BRD4_ENST00000602230.1_5'Flank|BRD4_ENST00000360016.5_Missense_Mutation_p.E613K	NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	613	NET. {ECO:0000255|PROSITE- ProRule:PRU00857}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			CGCTTCTCCTCATAGGACATA	0.592			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													125.0	111.0	116.0					19																	15366318		2203	4300	6503	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.1837G>A	19.37:g.15366318C>T	ENSP00000263377:p.Glu613Lys		O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.E613K	ENST00000263377.2	37	c.1837	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	C	34	5.402266	0.96030	.	.	ENSG00000141867	ENST00000263377;ENST00000371835;ENST00000360016	T;T;T	0.17854	2.25;2.25;2.25	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000009	T	0.45597	0.1350	M	0.81239	2.535	0.80722	D	1	D;D;D	0.69078	0.997;0.996;0.993	D;D;D	0.75020	0.985;0.981;0.978	T	0.50575	-0.8812	10	0.87932	D	0	-29.582	17.25	0.87040	0.0:1.0:0.0:0.0	.	613;613;613	Q4G0X8;O60885-2;O60885	.;.;BRD4_HUMAN	K	613	ENSP00000263377:E613K;ENSP00000360901:E613K;ENSP00000353112:E613K	ENSP00000263377:E613K	E	-	1	0	BRD4	15227318	1.000000	0.71417	0.946000	0.38457	0.997000	0.91878	7.818000	0.86416	2.368000	0.80403	0.591000	0.81541	GAG	BRD4	-	NULL	ENSG00000141867		0.592	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3	-	0.00	52	0	C	NM_058243		15366318	-1	tier1	-	no_errors	ENST00000263377	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	T
BRPF3	27154	genome.wustl.edu	37	6	36168850	36168850	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:36168850G>A	ENST00000357641.6	+	2	1004	c.751G>A	c.(751-753)Gag>Aag	p.E251K	BRPF3_ENST00000543502.1_Missense_Mutation_p.E251K|BRPF3_ENST00000534400.1_Missense_Mutation_p.E251K|BRPF3_ENST00000534694.1_Missense_Mutation_p.E251K|BRPF3_ENST00000339717.7_Missense_Mutation_p.E251K|BRPF3_ENST00000443324.2_Missense_Mutation_p.E251K	NM_015695.2	NP_056510.2	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	251					blood coagulation (GO:0007596)|histone H3 acetylation (GO:0043966)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	cytosol (GO:0005829)|extracellular region (GO:0005576)|MOZ/MORF histone acetyltransferase complex (GO:0070776)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	40						ATACATCCCTGAGGGCCAGTG	0.547																																																	0													90.0	81.0	84.0					6																	36168850		2203	4300	6503	SO:0001583	missense	0			AB033112	CCDS34437.1	6p21.31	2008-02-05			ENSG00000096070	ENSG00000096070			14256	protein-coding gene	gene with protein product						10574462	Standard	NM_015695		Approved	KIAA1286	uc003olv.4	Q9ULD4	OTTHUMG00000014589	ENST00000357641.6:c.751G>A	6.37:g.36168850G>A	ENSP00000350267:p.Glu251Lys		A6ND56|A6NJE2|B7ZLN5|E7EX85|Q17RB6|Q5R3K8	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.E251K	ENST00000357641.6	37	c.751	CCDS34437.1	6	.	.	.	.	.	.	.	.	.	.	G	29.1	4.981629	0.93044	.	.	ENSG00000096070	ENST00000357641;ENST00000339717;ENST00000534694;ENST00000543502;ENST00000443324;ENST00000534400	D;D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25;-2.25	5.79	5.79	0.91817	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.92479	0.7612	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.996;0.996;0.998	D	0.92466	0.5981	10	0.87932	D	0	.	20.0368	0.97565	0.0:0.0:1.0:0.0	.	251;251;251	B7ZLN5;Q17RB6;Q9ULD4	.;.;BRPF3_HUMAN	K	251	ENSP00000350267:E251K;ENSP00000345419:E251K;ENSP00000434501:E251K;ENSP00000445352:E251K;ENSP00000387368:E251K;ENSP00000436504:E251K	ENSP00000345419:E251K	E	+	1	0	BRPF3	36276828	1.000000	0.71417	0.988000	0.46212	0.994000	0.84299	9.414000	0.97362	2.735000	0.93741	0.563000	0.77884	GAG	BRPF3	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000096070		0.547	BRPF3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	BRPF3	HGNC	protein_coding	OTTHUMT00000040335.3	-	0.00	43	0	G	NM_015695		36168850	+1	tier1	-	no_errors	ENST00000357641	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	A
CFAP54	144535	genome.wustl.edu	37	12	97045517	97045517	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:97045517C>G	ENST00000524981.4	+	36	5047	c.5024C>G	c.(5023-5025)tCt>tGt	p.S1675C				Q96N23	CL055_HUMAN		0																	CTCTGCACCTCTGTTTTACCA	0.338																																																	0													88.0	84.0	85.0					12																	97045517		2203	4300	6503	SO:0001583	missense	0																														ENST00000524981.4:c.5024C>G	12.37:g.97045517C>G	ENSP00000431759:p.Ser1675Cys			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.S1675C	ENST00000524981.4	37	c.5024		12	.	.	.	.	.	.	.	.	.	.	C	1.931	-0.445976	0.04604	.	.	ENSG00000188596	ENST00000524981;ENST00000342887	.	.	.	5.0	0.364	0.16124	.	1.288730	0.05364	N	0.534357	T	0.10594	0.0259	N	0.00926	-1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.20042	-1.0287	9	0.46703	T	0.11	0.6394	4.0313	0.09710	0.0:0.2276:0.4238:0.3486	.	100	Q6ZTY8	CL063_HUMAN	C	1675;100	.	ENSP00000345466:S100C	S	+	2	0	C12orf63	95569648	0.001000	0.12720	0.021000	0.16686	0.282000	0.26991	0.645000	0.24782	0.219000	0.20840	0.563000	0.77884	TCT	C12orf55	-	NULL	ENSG00000188596		0.338	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	130	0	C			97045517	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	10.09	98	11	SNP	0.002	G
C19orf52	90580	genome.wustl.edu	37	19	11040151	11040151	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:11040151G>A	ENST00000270502.6	+	2	646	c.556G>A	c.(556-558)Gac>Aac	p.D186N	YIPF2_ENST00000590329.1_5'Flank|YIPF2_ENST00000253031.2_5'Flank|YIPF2_ENST00000586748.1_5'Flank	NM_138358.2	NP_612367.1	Q9BSF4	CS052_HUMAN	chromosome 19 open reading frame 52	186										prostate(1)	1						CGACATCAACGACGACGAATT	0.672																																																	0													29.0	33.0	32.0					19																	11040151		2202	4299	6501	SO:0001583	missense	0			BC011833	CCDS12252.1	19p13.2	2011-11-24			ENSG00000142444	ENSG00000142444			25152	protein-coding gene	gene with protein product						12477932	Standard	NM_138358		Approved		uc002mqd.2	Q9BSF4		ENST00000270502.6:c.556G>A	19.37:g.11040151G>A	ENSP00000270502:p.Asp186Asn		Q96EY6|Q96IT8	Missense_Mutation	SNP	pfam_DUF2366	p.D186N	ENST00000270502.6	37	c.556	CCDS12252.1	19	.	.	.	.	.	.	.	.	.	.	G	17.55	3.418168	0.62622	.	.	ENSG00000142444	ENST00000270502	.	.	.	4.55	3.48	0.39840	.	0.059683	0.64402	D	0.000004	T	0.47783	0.1464	L	0.50333	1.59	0.43103	D	0.994791	P	0.37663	0.604	B	0.28849	0.095	T	0.54970	-0.8213	9	0.54805	T	0.06	-22.8904	13.6831	0.62499	0.0:0.1564:0.8436:0.0	.	186	Q9BSF4	CS052_HUMAN	N	186	.	ENSP00000270502:D186N	D	+	1	0	C19orf52	10901151	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	4.971000	0.63749	1.225000	0.43566	0.655000	0.94253	GAC	C19orf52	-	pfam_DUF2366	ENSG00000142444		0.672	C19orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf52	HGNC	protein_coding	OTTHUMT00000452635.1	-	0.00	68	0	G	NM_138358		11040151	+1	tier1	-	no_errors	ENST00000270502	ensembl	human	known	74_37	missense	6.54	100	7	SNP	1.000	A
C1QTNF2	114898	genome.wustl.edu	37	5	159776454	159776454	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:159776454C>T	ENST00000393975.3	-	3	717	c.714G>A	c.(712-714)ggG>ggA	p.G238G		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	193	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGTAGTAGATCCCAGGCACGC	0.582																																																	0													88.0	92.0	91.0					5																	159776454		2203	4300	6503	SO:0001819	synonymous_variant	0			AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.714G>A	5.37:g.159776454C>T				Silent	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.G238	ENST00000393975.3	37	c.714	CCDS4351.2	5																																																																																			C1QTNF2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000145861		0.582	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF2	HGNC	protein_coding	OTTHUMT00000252672.2	-	0.00	43	0	C			159776454	-1	tier1	-	no_errors	ENST00000393975	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.089	T
C2orf71	388939	genome.wustl.edu	37	2	29297065	29297065	+	Silent	SNP	G	G	A	rs267599334		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:29297065G>A	ENST00000331664.5	-	1	62	c.63C>T	c.(61-63)ttC>ttT	p.F21F		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	21					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						GCTTTTTCAAGAACTGAATGC	0.488																																																	0													93.0	87.0	89.0					2																	29297065		1983	4172	6155	SO:0001819	synonymous_variant	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.63C>T	2.37:g.29297065G>A				Silent	SNP	NULL	p.F21	ENST00000331664.5	37	c.63	CCDS42669.1	2																																																																																			C2orf71	-	NULL	ENSG00000179270		0.488	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	-	0.00	87	0	G	NM_001029883		29297065	-1	tier1	-	no_errors	ENST00000331664	ensembl	human	known	74_37	silent	8.75	73	7	SNP	0.990	A
C6orf118	168090	genome.wustl.edu	37	6	165703509	165703509	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:165703509C>T	ENST00000230301.8	-	7	1188	c.1168G>A	c.(1168-1170)Gag>Aag	p.E390K	C6orf118_ENST00000494696.2_5'UTR|C6orf118_ENST00000543069.1_3'UTR	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	390										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		TCAACCTTCTCAGTAAGAGTA	0.303																																																	0													74.0	73.0	74.0					6																	165703509		2203	4296	6499	SO:0001583	missense	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.1168G>A	6.37:g.165703509C>T	ENSP00000230301:p.Glu390Lys		Q8TC11	Missense_Mutation	SNP	superfamily_Ribonuclease/ribotoxin	p.E390K	ENST00000230301.8	37	c.1168	CCDS5288.1	6	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587128	0.46110	.	.	ENSG00000112539	ENST00000230301	T	0.18502	2.21	5.44	2.51	0.30379	.	0.281201	0.29396	N	0.012265	T	0.15869	0.0382	L	0.58810	1.83	0.27591	N	0.949286	D	0.53312	0.959	P	0.54026	0.74	T	0.03684	-1.1013	10	0.72032	D	0.01	-29.8658	13.3416	0.60549	0.0:0.5329:0.4671:0.0	.	390	Q5T5N4	CF118_HUMAN	K	390	ENSP00000230301:E390K	ENSP00000230301:E390K	E	-	1	0	C6orf118	165623499	0.881000	0.30235	0.004000	0.12327	0.209000	0.24338	1.534000	0.36051	0.289000	0.22422	-0.181000	0.13052	GAG	C6orf118	-	NULL	ENSG00000112539		0.303	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	45	0	C	NM_144980		165703509	-1	tier1	-	no_errors	ENST00000230301	ensembl	human	known	74_37	missense	12.96	47	7	SNP	0.010	T
C8orf46	254778	genome.wustl.edu	37	8	67425869	67425869	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:67425869G>C	ENST00000305454.3	+	5	878	c.437G>C	c.(436-438)aGa>aCa	p.R146T	C8orf46_ENST00000521495.1_Intron|C8orf46_ENST00000480005.1_Missense_Mutation_p.R146T|C8orf46_ENST00000522977.1_Missense_Mutation_p.E125D	NM_152765.3	NP_689978.2	Q8TAG6	CH046_HUMAN	chromosome 8 open reading frame 46	146										endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(2)	6			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GTTCTGATGAGAGGGTAAGTG	0.597																																																	0													97.0	82.0	87.0					8																	67425869		2203	4300	6503	SO:0001583	missense	0			BC028400	CCDS6191.2	8q13.1	2005-08-09			ENSG00000169085	ENSG00000169085			28498	protein-coding gene	gene with protein product						12477932	Standard	NM_152765		Approved	MGC33510	uc003xwg.3	Q8TAG6	OTTHUMG00000156998	ENST00000305454.3:c.437G>C	8.37:g.67425869G>C	ENSP00000302260:p.Arg146Thr		B2RDC3|B4DFU4|C9J814|C9JCS3	Missense_Mutation	SNP	NULL	p.R146T	ENST00000305454.3	37	c.437	CCDS6191.2	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.48|16.48	3.134362|3.134362	0.56828|0.56828	.|.	.|.	ENSG00000169085|ENSG00000169085	ENST00000522977|ENST00000305454;ENST00000480005	.|.	.|.	.|.	4.31|4.31	3.39|3.39	0.38822|0.38822	.|.	.|0.435519	.|0.24240	.|N	.|0.040261	T|T	0.25791|0.25791	0.0628|0.0628	N|N	0.19112|0.19112	0.55|0.55	0.32970|0.32970	D|D	0.522255|0.522255	B|P	0.31817|0.40731	0.341|0.728	B|B	0.30646|0.41764	0.118|0.366	T|T	0.25779|0.25779	-1.0122|-1.0122	7|8	.|.	.|.	.|.	-3.6318|-3.6318	5.3918|5.3918	0.16247|0.16247	0.169:0.0:0.831:0.0|0.169:0.0:0.831:0.0	.|.	125|146	Q8TAG6-2|Q8TAG6	.|CH046_HUMAN	D|T	125|146	.|.	.|.	E|R	+|+	3|2	2|0	C8orf46|C8orf46	67588423|67588423	0.989000|0.989000	0.36119|0.36119	0.875000|0.875000	0.34327|0.34327	0.840000|0.840000	0.47671|0.47671	1.531000|1.531000	0.36018|0.36018	1.319000|1.319000	0.45190|0.45190	0.462000|0.462000	0.41574|0.41574	GAG|AGA	C8orf46	-	NULL	ENSG00000169085		0.597	C8orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf46	HGNC	protein_coding	OTTHUMT00000347010.1	-	0.00	56	0	G	NM_152765		67425869	+1	tier1	-	no_errors	ENST00000305454	ensembl	human	known	74_37	missense	31.51	50	23	SNP	0.919	C
C9orf84	158401	genome.wustl.edu	37	9	114510480	114510480	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:114510480C>T	ENST00000318737.4	-	7	799		c.e7-1		C9orf84_ENST00000394777.4_Splice_Site|C9orf84_ENST00000374287.3_Splice_Site|C9orf84_ENST00000394779.3_Splice_Site|C9orf84_ENST00000374283.5_Splice_Site	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84											breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						TTAGTAAGATCTGAAAAGGAA	0.343																																																	0													96.0	94.0	95.0					9																	114510480		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.671-1G>A	9.37:g.114510480C>T			A2A2V3|Q2M1H8|Q96M73	Splice_Site	SNP	-	e6-1	ENST00000318737.4	37	c.671-1	CCDS6781.3	9	.	.	.	.	.	.	.	.	.	.	C	13.48	2.251233	0.39797	.	.	ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000374287;ENST00000318737;ENST00000374283	.	.	.	4.05	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0254	0.53367	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C9orf84	113550301	1.000000	0.71417	0.982000	0.44146	0.643000	0.38383	1.553000	0.36255	2.543000	0.85770	0.637000	0.83480	.	C9orf84	-	-	ENSG00000165181		0.343	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf84	HGNC	protein_coding	OTTHUMT00000053656.2	-	0.00	50	0	C	NM_173521	Intron	114510480	-1	tier1	-	no_errors	ENST00000318737	ensembl	human	known	74_37	splice_site	10.71	50	6	SNP	0.988	T
CADM3	57863	genome.wustl.edu	37	1	159163319	159163319	+	Silent	SNP	C	C	T	rs554827373		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:159163319C>T	ENST00000368125.4	+	4	646	c.489C>T	c.(487-489)ctC>ctT	p.L163L	CADM3_ENST00000368124.4_Silent_p.L197L|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	163	Ig-like C2-type 1.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CAGCCCGGCTCACCTGGAGAA	0.522													C|||	1	0.000199681	0.0	0.0	5008	,	,		20618	0.001		0.0	False		,,,				2504	0.0																0													77.0	74.0	75.0					1																	159163319		2203	4300	6503	SO:0001819	synonymous_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.489C>T	1.37:g.159163319C>T			Q8IZQ9|Q9NVJ5|Q9UJP1	Silent	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.L197	ENST00000368125.4	37	c.591	CCDS44251.1	1																																																																																			CADM3	-	pfam_CD80_C2-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000162706		0.522	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CADM3	HGNC	protein_coding	OTTHUMT00000090330.1	-	0.00	60	0	C	NM_021189		159163319	+1	tier1	-	no_errors	ENST00000368124	ensembl	human	known	74_37	silent	13.89	31	5	SNP	1.000	T
CAMKV	79012	genome.wustl.edu	37	3	49897669	49897669	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:49897669C>G	ENST00000477224.1	-	10	1355	c.877G>C	c.(877-879)Gat>Cat	p.D293H	CAMKV_ENST00000498324.1_5'Flank|CAMKV_ENST00000467248.1_Missense_Mutation_p.D218H|CAMKV_ENST00000463537.1_Missense_Mutation_p.D293H|CAMKV_ENST00000488336.1_Missense_Mutation_p.D293H|CAMKV_ENST00000296471.7_Missense_Mutation_p.D265H|CAMKV_ENST00000466940.1_Missense_Mutation_p.D250H			Q8NCB2	CAMKV_HUMAN	CaM kinase-like vesicle-associated	293						cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			central_nervous_system(1)|large_intestine(2)|lung(2)|ovary(2)	7				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ATGTTCTTATCAGAAGCAGCA	0.488																																																	0													120.0	116.0	118.0					3																	49897669		2203	4300	6503	SO:0001583	missense	0			BC017363	CCDS33762.1	3p21.31	2005-03-04			ENSG00000164076	ENSG00000164076			28788	protein-coding gene	gene with protein product		614993				12477932	Standard	XM_005265478		Approved	MGC8407, VACAMKL	uc003cxt.1	Q8NCB2	OTTHUMG00000158288	ENST00000477224.1:c.877G>C	3.37:g.49897669C>G	ENSP00000419195:p.Asp293His		A6NFD4|Q6FIB8|Q8NBS8|Q8NC85|Q8NDU4|Q8WTT8|Q9BQC9|Q9H0Q5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D293H	ENST00000477224.1	37	c.877	CCDS33762.1	3	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325264	0.81580	.	.	ENSG00000164076	ENST00000296471;ENST00000488336;ENST00000463537;ENST00000477224;ENST00000467248;ENST00000466940	T;T;T;T;T;T	0.67865	0.26;-0.29;1.07;-0.28;0.76;1.51	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.43919	D	0.000501	T	0.77916	0.4202	L	0.51914	1.62	0.80722	D	1	P;D;D;D;D;D;D	0.89917	0.539;1.0;0.999;0.999;1.0;1.0;0.999	B;D;D;D;D;D;D	0.78314	0.209;0.984;0.962;0.962;0.983;0.991;0.962	T	0.70630	-0.4819	10	0.22109	T	0.4	.	19.3923	0.94587	0.0:1.0:0.0:0.0	.	250;256;293;218;265;293;293	E7ETR1;B4DMF2;B2RDF9;B4DM24;Q8NCB2-2;Q8NCB2-3;Q8NCB2	.;.;.;.;.;.;CAMKV_HUMAN	H	265;293;293;293;218;250	ENSP00000296471:D265H;ENSP00000418809:D293H;ENSP00000417614:D293H;ENSP00000419195:D293H;ENSP00000420053:D218H;ENSP00000420724:D250H	ENSP00000296471:D265H	D	-	1	0	CAMKV	49872673	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.825000	0.69286	2.882000	0.98803	0.655000	0.94253	GAT	CAMKV	-	superfamily_Kinase-like_dom	ENSG00000164076		0.488	CAMKV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKV	HGNC	protein_coding	OTTHUMT00000350584.4	-	0.00	76	0	C	NM_024046		49897669	-1	tier1	-	no_errors	ENST00000477224	ensembl	human	known	74_37	missense	19.70	53	13	SNP	1.000	G
CAMTA2	23125	genome.wustl.edu	37	17	4883117	4883117	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:4883117G>T	ENST00000348066.3	-	9	1623	c.1500C>A	c.(1498-1500)ccC>ccA	p.P500P	CAMTA2_ENST00000572543.1_Silent_p.P505P|CAMTA2_ENST00000381311.5_Silent_p.P502P|CAMTA2_ENST00000358183.4_Silent_p.P500P|CAMTA2_ENST00000571831.1_5'Flank|CAMTA2_ENST00000361571.5_Silent_p.P499P|CAMTA2_ENST00000414043.3_Silent_p.P523P	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	500					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						AAAGACTGAAGGGCTCCAGTT	0.587																																																	0													126.0	125.0	125.0					17																	4883117		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.1500C>A	17.37:g.4883117G>T			B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Silent	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.P523	ENST00000348066.3	37	c.1569	CCDS11063.1	17																																																																																			CAMTA2	-	NULL	ENSG00000108509		0.587	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	-	0.00	72	0	G	NM_015099		4883117	-1	tier1	-	no_errors	ENST00000414043	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.996	T
CAPRIN2	65981	genome.wustl.edu	37	12	30881712	30881712	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:30881712T>A	ENST00000395805.2	-	8	2199	c.1652A>T	c.(1651-1653)aAt>aTt	p.N551I	CAPRIN2_ENST00000298892.5_Missense_Mutation_p.N551I|CAPRIN2_ENST00000538387.1_5'UTR|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.N551I|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.N218I|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.N551I	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ACTCTCAACATTGTTTTCCCA	0.463																																																	0													223.0	211.0	215.0					12																	30881712		2203	4300	6503	SO:0001583	missense	0			AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.1652A>T	12.37:g.30881712T>A	ENSP00000379150:p.Asn551Ile			Missense_Mutation	SNP	pfam_Caprin-1_C,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.N551I	ENST00000395805.2	37	c.1652	CCDS55816.1	12	.	.	.	.	.	.	.	.	.	.	T	13.99	2.401464	0.42613	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000308433;ENST00000417045;ENST00000438006;ENST00000537108	T;T;T;T;T;T;T	0.75154	2.43;-0.63;2.84;-0.62;-0.91;2.83;2.44	5.12	-6.51	0.01878	.	1.494320	0.03615	N	0.235458	T	0.62048	0.2396	N	0.14661	0.345	0.09310	N	1	P;P;P;P;B;B;B	0.49559	0.799;0.925;0.855;0.911;0.309;0.017;0.309	B;P;B;P;B;B;B	0.48840	0.387;0.592;0.289;0.483;0.047;0.009;0.064	T	0.61262	-0.7098	10	0.44086	T	0.13	0.0336	8.8471	0.35177	0.0:0.5056:0.1176:0.3768	.	551;277;551;551;551;551;551	Q6IMN6-6;E9PAU5;Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;.;.;CAPR2_HUMAN;.;.	I	297;551;551;551;218;551;277;470	ENSP00000415407:N297I;ENSP00000298892:N551I;ENSP00000379150:N551I;ENSP00000251071:N551I;ENSP00000309785:N218I;ENSP00000391479:N551I;ENSP00000438010:N470I	ENSP00000251071:N551I	N	-	2	0	CAPRIN2	30772979	0.000000	0.05858	0.000000	0.03702	0.677000	0.39632	-1.054000	0.03496	-1.236000	0.02542	-0.379000	0.06801	AAT	CAPRIN2	-	NULL	ENSG00000110888		0.463	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CAPRIN2	HGNC	protein_coding	OTTHUMT00000403322.2	-	0.00	137	0	T	NM_023925		30881712	-1	tier1	-	no_errors	ENST00000251071	ensembl	human	known	74_37	missense	11.68	174	23	SNP	0.000	A
CASC5	57082	genome.wustl.edu	37	15	40947148	40947148	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:40947148G>T	ENST00000346991.5	+	23	6925	c.6535G>T	c.(6535-6537)Gat>Tat	p.D2179Y	CASC5_ENST00000399668.2_Missense_Mutation_p.D2153Y			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	2179	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		GAAGATTGTTGATGTCAATTT	0.363																																																	0													131.0	124.0	127.0					15																	40947148		1827	4082	5909	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.6535G>T	15.37:g.40947148G>T	ENSP00000335463:p.Asp2179Tyr		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.D2179Y	ENST00000346991.5	37	c.6535	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	G	10.23	1.294175	0.23564	.	.	ENSG00000137812	ENST00000346991;ENST00000399668	T;T	0.06449	3.3;3.3	5.81	4.89	0.63831	.	0.588311	0.17531	N	0.170878	T	0.15219	0.0367	L	0.47716	1.5	0.09310	N	1	D;D	0.71674	0.998;0.993	D;P	0.63113	0.911;0.891	T	0.06303	-1.0834	10	0.72032	D	0.01	.	8.9013	0.35497	0.1688:0.0:0.8312:0.0	.	2153;2179	Q8NG31-2;Q8NG31	.;CASC5_HUMAN	Y	2179;2153	ENSP00000335463:D2179Y;ENSP00000382576:D2153Y	ENSP00000335463:D2179Y	D	+	1	0	CASC5	38734440	0.948000	0.32251	0.059000	0.19551	0.250000	0.25880	1.489000	0.35562	1.451000	0.47736	0.655000	0.94253	GAT	CASC5	-	NULL	ENSG00000137812		0.363	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2		0.00	53	0	G	NM_144508		40947148	+1			no_errors	ENST00000346991	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.118	T
CCDC27	148870	genome.wustl.edu	37	1	3677928	3677928	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:3677928G>T	ENST00000294600.2	+	5	879	c.795G>T	c.(793-795)ctG>ctT	p.L265L		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	265										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		GGGAGGCCCTGAAGATGCAGC	0.582																																																	0													79.0	75.0	77.0					1																	3677928		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.795G>T	1.37:g.3677928G>T			Q5TBV3|Q96M50	Silent	SNP	superfamily_Prefoldin	p.L265	ENST00000294600.2	37	c.795	CCDS50.1	1																																																																																			CCDC27	-	NULL	ENSG00000162592		0.582	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1		0.00	72	0	G	NM_152492		3677928	+1			no_errors	ENST00000294600	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.006	T
CCDC93	54520	genome.wustl.edu	37	2	118732778	118732778	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:118732778G>A	ENST00000376300.2	-	9	873	c.736C>T	c.(736-738)Cga>Tga	p.R246*	CCDC93_ENST00000460781.1_5'UTR|CCDC93_ENST00000319432.5_Nonsense_Mutation_p.R245*	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	246										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						TCAGCTGCTCGAAGCTCATCT	0.502																																																	0													270.0	250.0	257.0					2																	118732778		2203	4300	6503	SO:0001587	stop_gained	0			BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.736C>T	2.37:g.118732778G>A	ENSP00000365477:p.Arg246*		A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Nonsense_Mutation	SNP	pfam_DUF2037	p.R246*	ENST00000376300.2	37	c.736	CCDS2121.2	2	.	.	.	.	.	.	.	.	.	.	G	38	6.997324	0.97990	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	.	.	.	4.99	4.99	0.66335	.	0.399829	0.27951	N	0.017199	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-6.0E-4	16.9832	0.86334	0.0:0.0:1.0:0.0	.	.	.	.	X	246;245	.	ENSP00000324135:R245X	R	-	1	2	CCDC93	118449248	1.000000	0.71417	0.821000	0.32701	0.918000	0.54935	6.091000	0.71406	2.752000	0.94435	0.557000	0.71058	CGA	CCDC93	-	NULL	ENSG00000125633		0.502	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC93	HGNC	protein_coding	OTTHUMT00000129615.1	-	0.00	46	0	G	NM_019044		118732778	-1	tier1	-	no_errors	ENST00000376300	ensembl	human	known	74_37	nonsense	10.87	41	5	SNP	0.977	A
CCIN	881	genome.wustl.edu	37	9	36169562	36169562	+	Missense_Mutation	SNP	G	G	T	rs145639010		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:36169562G>T	ENST00000335119.2	+	1	174	c.63G>T	c.(61-63)caG>caT	p.Q21H		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	21	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			TGAACAGACAGAGGAAACGCA	0.507																																																	0													149.0	141.0	144.0					9																	36169562		2203	4300	6503	SO:0001583	missense	0			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.63G>T	9.37:g.36169562G>T	ENSP00000334996:p.Gln21His		Q9BXG7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.Q21H	ENST00000335119.2	37	c.63	CCDS6599.1	9	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914254	0.52546	.	.	ENSG00000185972	ENST00000335119	T	0.71461	-0.57	5.69	5.69	0.88448	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.53938	D	0.000060	D	0.84951	0.5586	M	0.83692	2.655	0.38314	D	0.943339	D	0.62365	0.991	D	0.78314	0.991	D	0.88004	0.2758	10	0.87932	D	0	.	15.3016	0.73955	0.0:0.0:1.0:0.0	.	21	Q13939	CALI_HUMAN	H	21	ENSP00000334996:Q21H	ENSP00000334996:Q21H	Q	+	3	2	CCIN	36159562	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.234000	0.43035	2.690000	0.91761	0.561000	0.74099	CAG	CCIN	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold	ENSG00000185972		0.507	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCIN	HGNC	protein_coding	OTTHUMT00000052418.1	-	0.00	86	0	G	NM_005893		36169562	+1	tier1	-	no_errors	ENST00000335119	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
CD3EAP	10849	genome.wustl.edu	37	19	45912504	45912504	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:45912504G>T	ENST00000309424.3	+	3	1766	c.1278G>T	c.(1276-1278)aaG>aaT	p.K426N	PPP1R13L_ENST00000418234.2_5'Flank|ERCC1_ENST00000588738.1_5'Flank|ERCC1_ENST00000300853.3_3'UTR|ERCC1_ENST00000423698.2_3'UTR|CD3EAP_ENST00000589804.1_Missense_Mutation_p.K428N	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	426	Poly-Lys.				rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		agaagaagaagaagaaagaga	0.577																																																	0													41.0	49.0	46.0					19																	45912504		2199	4295	6494	SO:0001583	missense	0			U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.1278G>T	19.37:g.45912504G>T	ENSP00000310966:p.Lys426Asn		Q32N11|Q7Z5U2|Q9UPF6	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol1_su_RPA34	p.K428N	ENST00000309424.3	37	c.1284	CCDS12661.1	19	.	.	.	.	.	.	.	.	.	.	G	12.88	2.071390	0.36566	.	.	ENSG00000117877	ENST00000309424	T	0.19394	2.15	3.96	0.327	0.15913	.	0.376510	0.19203	N	0.120129	T	0.15435	0.0372	L	0.32530	0.975	0.58432	D	0.999999	P;P	0.50819	0.939;0.9	P;B	0.45538	0.484;0.291	T	0.06499	-1.0823	10	0.72032	D	0.01	-12.286	5.2642	0.15589	0.2076:0.1709:0.6216:0.0	.	428;426	O15446-2;O15446	.;RPA34_HUMAN	N	426	ENSP00000310966:K426N	ENSP00000310966:K426N	K	+	3	2	CD3EAP	50604344	0.988000	0.35896	0.785000	0.31869	0.808000	0.45660	0.550000	0.23345	0.683000	0.31428	-0.221000	0.12465	AAG	CD3EAP	-	NULL	ENSG00000117877		0.577	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD3EAP	HGNC	protein_coding	OTTHUMT00000459538.1		0.00	62	0	G	NM_012099		45912504	+1			no_errors	ENST00000589804	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.931	T
CDC27	996	genome.wustl.edu	37	17	45209685	45209685	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:45209685G>T	ENST00000066544.3	-	15	2062	c.1969C>A	c.(1969-1971)Cat>Aat	p.H657N	CDC27_ENST00000531206.1_Missense_Mutation_p.H663N|CDC27_ENST00000446365.2_Missense_Mutation_p.H596N|CDC27_ENST00000527547.1_Missense_Mutation_p.H656N	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	657					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.H663Y(1)|p.H657Y(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TTTTGGAAATGCATTTCTGCA	0.294																																																	2	Substitution - Missense(2)	kidney(2)											80.0	82.0	81.0					17																	45209685		2203	4299	6502	SO:0001583	missense	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1969C>A	17.37:g.45209685G>T	ENSP00000066544:p.His657Asn		G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.H663N	ENST00000066544.3	37	c.1987	CCDS11509.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.9|26.9	4.785072|4.785072	0.90282|0.90282	.|.	.|.	ENSG00000004897|ENSG00000004897	ENST00000526866|ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T|T;T;T;T	0.49720|0.60548	0.77|0.18;0.18;0.18;0.18	5.57|5.57	5.57|5.57	0.84162|0.84162	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68714|0.68714	0.3031|0.3031	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	.|D;P;P;P	.|0.63880	.|0.993;0.933;0.933;0.946	.|P;P;P;P	.|0.59761	.|0.863;0.693;0.693;0.796	T|T	0.69495|0.69495	-0.5130|-0.5130	7|10	0.39692|0.62326	T|D	0.17|0.03	-24.4514|-24.4514	17.3985|17.3985	0.87453|0.87453	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|596;656;663;657	.|B4DL80;G5EA36;G3V1C4;P30260	.|.;.;.;CDC27_HUMAN	E|N	338|657;663;596;656	ENSP00000432105:A338E|ENSP00000066544:H657N;ENSP00000434614:H663N;ENSP00000392802:H596N;ENSP00000437339:H656N	ENSP00000432105:A338E|ENSP00000066544:H657N	A|H	-|-	2|1	0|0	CDC27|CDC27	42564684|42564684	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.806000|9.806000	0.99153|0.99153	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	GCA|CAT	CDC27	-	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000004897		0.294	CDC27-001	KNOWN	basic|CCDS	protein_coding	CDC27	HGNC	protein_coding	OTTHUMT00000389742.2		0.00	91	0	G			45209685	-1			no_errors	ENST00000531206	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
C10orf105	414152	genome.wustl.edu	37	10	73492057	73492057	+	Intron	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:73492057C>T	ENST00000398786.2	-	1	97				CDH23_ENST00000224721.6_Silent_p.L1348L	NM_001168390.1	NP_001161862.1	Q8TEF2	CJ105_HUMAN	chromosome 10 open reading frame 105							integral component of membrane (GO:0016021)											TCGACAACCTCAACCAAATCA	0.587																																																	0													72.0	72.0	72.0					10																	73492057		2064	4212	6276	SO:0001627	intron_variant	0			AK074172	CCDS44430.1	10q22.1	2012-06-01			ENSG00000214688	ENSG00000214688			20304	protein-coding gene	gene with protein product							Standard	NM_001164375		Approved	FLJ00245	uc001jsa.2	Q8TEF2	OTTHUMG00000018427	ENST00000398786.2:c.4+5427G>A	10.37:g.73492057C>T				Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1348	ENST00000398786.2	37	c.4044	CCDS44430.1	10																																																																																			CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.587	C10orf105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000048551.2	-	0.00	101	0	C	NM_001164375		73492057	+1	tier1	-	no_errors	ENST00000224721	ensembl	human	putative	74_37	silent	11.63	38	5	SNP	1.000	T
CEP164	22897	genome.wustl.edu	37	11	117222658	117222658	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:117222658A>G	ENST00000278935.3	+	5	494	c.347A>G	c.(346-348)aAg>aGg	p.K116R		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	116	Interaction with ATRIP.|Lys-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		aaaaaaaaaaaggaaaagaaa	0.502																																																	0													33.0	34.0	34.0					11																	117222658		2201	4296	6497	SO:0001583	missense	0			AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.347A>G	11.37:g.117222658A>G	ENSP00000278935:p.Lys116Arg		Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.K116R	ENST00000278935.3	37	c.347	CCDS31683.1	11	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744661	0.49151	.	.	ENSG00000110274	ENST00000533153;ENST00000278935;ENST00000525416;ENST00000545330;ENST00000533570;ENST00000529538	T;T;T;T	0.76060	-0.34;-0.03;-0.29;-0.99	5.95	4.82	0.62117	.	0.243999	0.29172	N	0.012934	T	0.80221	0.4583	M	0.62723	1.935	0.34770	D	0.733632	D;P;B;D	0.56521	0.959;0.482;0.023;0.976	P;B;B;P	0.56960	0.65;0.11;0.01;0.81	D	0.85776	0.1358	10	0.62326	D	0.03	-27.2573	11.2799	0.49188	0.9276:0.0:0.0724:0.0	.	116;70;116;116	E9PI34;B7Z884;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	R	70;116;70;70;116;116	ENSP00000436034:K70R;ENSP00000278935:K116R;ENSP00000435759:K70R;ENSP00000431302:K116R	ENSP00000278935:K116R	K	+	2	0	CEP164	116727868	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	8.713000	0.91408	1.068000	0.40764	0.533000	0.62120	AAG	CEP164	-	NULL	ENSG00000110274		0.502	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP164	HGNC	protein_coding	OTTHUMT00000392893.1		0.00	102	0	A	NM_014956		117222658	+1			no_errors	ENST00000278935	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	G
CFH	3075	genome.wustl.edu	37	1	196715031	196715031	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:196715031C>T	ENST00000367429.4	+	21	3635	c.3395C>T	c.(3394-3396)tCa>tTa	p.S1132L		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	1132	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GCTCCAGCTTCATCAGTTGAG	0.413																																																	0													103.0	99.0	100.0					1																	196715031		2202	4281	6483	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.3395C>T	1.37:g.196715031C>T	ENSP00000356399:p.Ser1132Leu		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S1132L	ENST00000367429.4	37	c.3395	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	.	16.24	3.066975	0.55539	.	.	ENSG00000000971	ENST00000367429	T	0.68025	-0.3	4.97	4.97	0.65823	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.83727	0.5317	M	0.91717	3.235	0.26882	N	0.967529	D	0.76494	0.999	D	0.70016	0.967	T	0.76934	-0.2775	9	0.54805	T	0.06	.	11.3403	0.49529	0.1811:0.8189:0.0:0.0	.	1132	P08603	CFAH_HUMAN	L	1132	ENSP00000356399:S1132L	ENSP00000356399:S1132L	S	+	2	0	CFH	194981654	0.003000	0.15002	0.047000	0.18901	0.005000	0.04900	1.753000	0.38359	2.502000	0.84385	0.549000	0.68633	TCA	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.413	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2		0.00	124	0	C	NM_000186		196715031	+1			no_errors	ENST00000367429	ensembl	human	known	74_37	missense	6.80	96	7	SNP	0.024	T
CFP	5199	genome.wustl.edu	37	X	47489004	47489004	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:47489004delC	ENST00000396992.3	-	2	266	c.146delG	c.(145-147)ggtfs	p.G50fs	CFP_ENST00000247153.3_Frame_Shift_Del_p.G50fs|CFP_ENST00000377005.2_Frame_Shift_Del_p.G50fs|CFP_ENST00000480317.1_5'UTR	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	50	TSP type-1 0. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GCTGACACCACCCCCCAGGAG	0.612																																																	0													26.0	19.0	21.0					X																	47489004		2165	4241	6406	SO:0001589	frameshift_variant	0			M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.146delG	X.37:g.47489004delC	ENSP00000380189:p.Gly50fs		O15134|O15135|O15136|O75826	Frame_Shift_Del	DEL	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G49fs	ENST00000396992.3	37	c.146	CCDS14282.1	X																																																																																			CFP	-	NULL	ENSG00000126759		0.612	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	HGNC	protein_coding	OTTHUMT00000056435.2		0.00	69	0	C	NM_002621		47489004	-1	tier1		no_errors	ENST00000247153	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	0.000	-
CHADL	150356	genome.wustl.edu	37	22	41633274	41633274	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr22:41633274G>A	ENST00000216241.9	-	3	1854	c.1802C>T	c.(1801-1803)tCg>tTg	p.S601L		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	601						proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						TGGGTTGCCCGAGAGCTGCAG	0.672																																																	0													20.0	28.0	25.0					22																	41633274		692	1591	2283	SO:0001583	missense	0			BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.1802C>T	22.37:g.41633274G>A	ENSP00000216241:p.Ser601Leu		Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S601L	ENST00000216241.9	37	c.1802	CCDS46715.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.37|18.37	3.609933|3.609933	0.66558|0.66558	.|.	.|.	ENSG00000100399|ENSG00000100399	ENST00000417999|ENST00000216241;ENST00000455425	.|T;T	.|0.63096	.|-0.02;-0.02	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	.|0.060799	.|0.64402	.|D	.|0.000002	D|D	0.83440|0.83440	0.5255|0.5255	M|M	0.91872|0.91872	3.25|3.25	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.70227	.|0.925;0.968	D|D	0.87080|0.87080	0.2165|0.2165	5|10	.|0.59425	.|D	.|0.04	.|.	18.5866|18.5866	0.91192|0.91192	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|601;601	.|Q6NUI6-2;Q6NUI6	.|.;CHADL_HUMAN	W|L	599|601;98	.|ENSP00000216241:S601L;ENSP00000412359:S98L	.|ENSP00000216241:S601L	R|S	-|-	1|2	2|0	CHADL|CHADL	39963220|39963220	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.036000|0.036000	0.12997|0.12997	7.744000|7.744000	0.85034|0.85034	2.362000|2.362000	0.80069|0.80069	0.555000|0.555000	0.69702|0.69702	CGG|TCG	CHADL	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000100399		0.672	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHADL	HGNC	protein_coding	OTTHUMT00000320597.1	-	0.00	87	0	G	NM_138481		41633274	-1	tier1	-	no_errors	ENST00000216241	ensembl	human	known	74_37	missense	26.83	60	22	SNP	1.000	A
CLN8	2055	genome.wustl.edu	37	8	1728586	1728586	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:1728586G>T	ENST00000331222.4	+	3	961	c.714G>T	c.(712-714)ctG>ctT	p.L238L	CLN8_ENST00000523237.1_3'UTR	NM_018941.3	NP_061764.2	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)	238	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				adult walking behavior (GO:0007628)|age-dependent response to oxidative stress (GO:0001306)|associative learning (GO:0008306)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|ceramide biosynthetic process (GO:0046513)|ceramide metabolic process (GO:0006672)|cholesterol metabolic process (GO:0008203)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|lipid biosynthetic process (GO:0008610)|lipid transport (GO:0006869)|lysosome organization (GO:0007040)|mitochondrial membrane organization (GO:0007006)|musculoskeletal movement (GO:0050881)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteolysis (GO:0045861)|negative regulation of transferase activity (GO:0051348)|nervous system development (GO:0007399)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|phospholipid metabolic process (GO:0006644)|photoreceptor cell maintenance (GO:0045494)|protein catabolic process (GO:0030163)|regulation of cell size (GO:0008361)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic motor neuron differentiation (GO:0021523)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		TTGTCGGACTGGCTCTGCTTA	0.512																																					Pancreas(155;338 1942 6138 10888 50612)												0													218.0	156.0	177.0					8																	1728586		2203	4300	6503	SO:0001819	synonymous_variant	0			AF123761	CCDS5956.1	8p23.3	2014-09-17			ENSG00000182372	ENSG00000182372			2079	protein-coding gene	gene with protein product		607837	"""chromosome 8 open reading frame 61"""	EPMR, C8orf61		10508524	Standard	NM_018941		Approved	FLJ39417	uc003wpo.4	Q9UBY8	OTTHUMG00000090343	ENST00000331222.4:c.714G>T	8.37:g.1728586G>T			Q86U71|Q96I95	Silent	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.L238	ENST00000331222.4	37	c.714	CCDS5956.1	8																																																																																			CLN8	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000182372		0.512	CLN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN8	HGNC	protein_coding	OTTHUMT00000206715.2	-	0.00	67	0	G	NM_018941		1728586	+1	tier1	-	no_errors	ENST00000331222	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.423	T
CMTM8	152189	genome.wustl.edu	37	3	32398870	32398870	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:32398870G>T	ENST00000307526.3	+	2	447	c.153G>T	c.(151-153)ctG>ctT	p.L51L	CMTM8_ENST00000458535.2_Intron	NM_178868.3	NP_849199.2	Q8IZV2	CKLF8_HUMAN	CKLF-like MARVEL transmembrane domain containing 8	51	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|lung(1)	4						TACAGGTTCTGGGGCTGCTGG	0.463																																																	0													142.0	135.0	138.0					3																	32398870		2203	4300	6503	SO:0001819	synonymous_variant	0			AF474370	CCDS2652.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000170293	ENSG00000170293			19179	protein-coding gene	gene with protein product		607891	"""chemokine-like factor super family 8"", ""chemokine-like factor superfamily 8"""	CKLFSF8			Standard	NM_178868		Approved		uc003cex.3	Q8IZV2	OTTHUMG00000130753	ENST00000307526.3:c.153G>T	3.37:g.32398870G>T			A5D6I7|Q8IW01	Silent	SNP	pfam_Marvel,prints_MAL	p.L51	ENST00000307526.3	37	c.153	CCDS2652.1	3																																																																																			CMTM8	-	pfam_Marvel,prints_MAL	ENSG00000170293		0.463	CMTM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMTM8	HGNC	protein_coding	OTTHUMT00000253253.1	-	0.00	55	0	G	NM_178868		32398870	+1	tier1	-	no_errors	ENST00000307526	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.957	T
CNBD2	140894	genome.wustl.edu	37	20	34556687	34556687	+	Start_Codon_SNP	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:34556687G>A	ENST00000373973.3	+	1	176	c.3G>A	c.(1-3)atG>atA	p.M1I	CNBD2_ENST00000538900.1_Start_Codon_SNP_p.M1I|CNBD2_ENST00000349339.1_Start_Codon_SNP_p.M1I			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	1																	CAGGAACCATGAGGAGACATA	0.488																																																	0													60.0	51.0	54.0					20																	34556687		2203	4299	6502	SO:0001582	initiator_codon_variant	0			AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.3G>A	20.37:g.34556687G>A	ENSP00000363084:p.Met1Ile		Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.M1I	ENST00000373973.3	37	c.3		20	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729318	0.48833	.	.	ENSG00000149646	ENST00000373973;ENST00000349339;ENST00000538900	T;T;T	0.11712	2.75;2.75;2.76	4.02	4.02	0.46733	.	0.194209	0.26696	N	0.022969	T	0.13457	0.0326	.	.	.	0.21527	N	0.999651	P;P	0.44816	0.759;0.844	B;B	0.44278	0.259;0.445	T	0.07404	-1.0774	9	0.87932	D	0	-22.3059	11.9705	0.53062	0.0:0.0:1.0:0.0	.	1;1	Q96M20;Q96M20-2	CT152_HUMAN;.	I	1	ENSP00000363084:M1I;ENSP00000340954:M1I;ENSP00000442729:M1I	ENSP00000340954:M1I	M	+	3	0	C20orf152	34020101	0.996000	0.38824	0.982000	0.44146	0.091000	0.18340	2.244000	0.43124	2.530000	0.85305	0.655000	0.94253	ATG	CNBD2	-	NULL	ENSG00000149646		0.488	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CNBD2	HGNC	protein_coding	OTTHUMT00000078960.2	-	0.00	30	0	G	NM_080834	Missense_Mutation	34556687	+1	tier1	-	no_errors	ENST00000373973	ensembl	human	known	74_37	missense	12.77	41	6	SNP	0.986	A
CNGB3	54714	genome.wustl.edu	37	8	87588200	87588200	+	Silent	SNP	A	A	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:87588200A>C	ENST00000320005.5	-	18	2309	c.2262T>G	c.(2260-2262)ccT>ccG	p.P754P		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	754					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						CTGTACATTCAGGTCTGTCCA	0.393																																																	0													244.0	244.0	244.0					8																	87588200		2203	4300	6503	SO:0001819	synonymous_variant	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.2262T>G	8.37:g.87588200A>C			C9JA51|Q9NRE9	Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.P754	ENST00000320005.5	37	c.2262	CCDS6244.1	8																																																																																			CNGB3	-	NULL	ENSG00000170289		0.393	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	-	0.00	118	0	A	NM_019098		87588200	-1	tier1	-	no_errors	ENST00000320005	ensembl	human	known	74_37	silent	7.80	130	11	SNP	0.000	C
CNTN1	1272	genome.wustl.edu	37	12	41423007	41423007	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:41423007A>G	ENST00000551295.2	+	23	3083	c.2966A>G	c.(2965-2967)cAa>cGa	p.Q989R	CNTN1_ENST00000348761.2_Missense_Mutation_p.Q978R|CNTN1_ENST00000347616.1_Missense_Mutation_p.Q989R	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	989	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GTGGTGTCTCAAGTCAAAATT	0.458																																																	0													221.0	207.0	212.0					12																	41423007		2203	4300	6503	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2966A>G	12.37:g.41423007A>G	ENSP00000447006:p.Gln989Arg		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q989R	ENST00000551295.2	37	c.2966	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	A	16.42	3.117896	0.56505	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.54071	0.59;0.59;0.59	5.27	5.27	0.74061	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.122786	0.56097	D	0.000025	T	0.55816	0.1944	M	0.74647	2.275	0.80722	D	1	B;B	0.18741	0.03;0.017	B;B	0.17979	0.02;0.009	T	0.57843	-0.7741	10	0.66056	D	0.02	.	15.513	0.75798	1.0:0.0:0.0:0.0	.	978;989	Q12860-2;Q12860	.;CNTN1_HUMAN	R	989;989;978	ENSP00000447006:Q989R;ENSP00000325660:Q989R;ENSP00000261160:Q978R	ENSP00000325660:Q989R	Q	+	2	0	CNTN1	39709274	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.437000	0.73421	2.130000	0.65690	0.533000	0.62120	CAA	CNTN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000018236		0.458	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	-	0.00	73	0	A	NM_001843		41423007	+1	tier1	-	no_errors	ENST00000347616	ensembl	human	known	74_37	missense	14.29	36	6	SNP	1.000	G
COG4	25839	genome.wustl.edu	37	16	70551570	70551570	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:70551570C>A	ENST00000323786.5	-	3	349	c.328G>T	c.(328-330)Gag>Tag	p.E110*	COG4_ENST00000393612.4_Nonsense_Mutation_p.E106*|COG4_ENST00000564653.1_Nonsense_Mutation_p.E110*	NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	106	Interacts with STX5.				Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				GACACATTCTCAGCCAGGTTG	0.428																																																	0													143.0	128.0	133.0					16																	70551570		2198	4300	6498	SO:0001587	stop_gained	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.328G>T	16.37:g.70551570C>A	ENSP00000315775:p.Glu110*		B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Nonsense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.E110*	ENST00000323786.5	37	c.328	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	c	29.5	5.014902	0.93404	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000393612;ENST00000534772	.	.	.	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-16.5364	19.0495	0.93038	0.0:1.0:0.0:0.0	.	.	.	.	X	110;106;106;33	.	ENSP00000315775:E110X	E	-	1	0	COG4	69109071	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	7.556000	0.82233	2.496000	0.84212	0.450000	0.29827	GAG	COG4	-	NULL	ENSG00000103051		0.428	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3	-	0.00	61	0	C			70551570	-1	tier1	-	no_errors	ENST00000323786	ensembl	human	known	74_37	nonsense	11.86	52	7	SNP	1.000	A
COL4A4	1286	genome.wustl.edu	37	2	227872752	227872752	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:227872752G>A	ENST00000396625.3	-	47	4998	c.4791C>T	c.(4789-4791)atC>atT	p.I1597I	COL4A4_ENST00000329662.7_Silent_p.I1594I	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	1597	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ATGAATACCCGATCCAGAGGC	0.612																																																	0													30.0	33.0	32.0					2																	227872752		1923	4131	6054	SO:0001819	synonymous_variant	0				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.4791C>T	2.37:g.227872752G>A			A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.I1597	ENST00000396625.3	37	c.4791	CCDS42828.1	2																																																																																			COL4A4	-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	ENSG00000081052		0.612	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	-	0.00	131	0	G	NM_000092		227872752	-1	tier1	-	no_errors	ENST00000396625	ensembl	human	known	74_37	silent	8.24	78	7	SNP	0.010	A
COL6A2	1292	genome.wustl.edu	37	21	47542073	47542073	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:47542073G>A	ENST00000300527.4	+	19	1676		c.e19+1		COL6A2_ENST00000357838.4_Splice_Site|COL6A2_ENST00000409416.1_Splice_Site|COL6A2_ENST00000397763.1_Splice_Site|COL6A2_ENST00000310645.5_Splice_Site	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		AGGAGCACCCGTGAGTCACAG	0.627																																																	0			GRCh37	CS075105	COL6A2	S							35.0	36.0	36.0					21																	47542073		2198	4296	6494	SO:0001630	splice_region_variant	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1572+1G>A	21.37:g.47542073G>A			Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Splice_Site	SNP	-	e18+1	ENST00000300527.4	37	c.1572+1	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	G	15.35	2.807311	0.50421	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	.	.	.	4.46	4.46	0.54185	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4862	0.84184	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL6A2	46366501	1.000000	0.71417	0.565000	0.28409	0.436000	0.31835	6.487000	0.73633	2.209000	0.71365	0.491000	0.48974	.	COL6A2	-	-	ENSG00000142173		0.627	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	-	0.00	87	0	G		Intron	47542073	+1	tier1	-	no_errors	ENST00000300527	ensembl	human	known	74_37	splice_site	10.77	58	7	SNP	1.000	A
COPB1	1315	genome.wustl.edu	37	11	14487906	14487906	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:14487906C>G	ENST00000249923.3	-	17	2512	c.2212G>C	c.(2212-2214)Gat>Cat	p.D738H	COPB1_ENST00000439561.2_Missense_Mutation_p.D738H	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	738					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						AGGACAATATCATATTGGTTG	0.383																																																	0													208.0	190.0	196.0					11																	14487906		2200	4294	6494	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2212G>C	11.37:g.14487906C>G	ENSP00000249923:p.Asp738His		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.D738H	ENST00000249923.3	37	c.2212	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875568	0.91664	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.56275	0.47;0.47	5.48	5.48	0.80851	Coatomer, beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81936	0.4928	H	0.95780	3.72	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87259	0.2278	10	0.87932	D	0	.	19.3415	0.94344	0.0:1.0:0.0:0.0	.	738	P53618	COPB_HUMAN	H	738	ENSP00000249923:D738H;ENSP00000397873:D738H	ENSP00000249923:D738H	D	-	1	0	COPB1	14444482	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.576000	0.86940	0.655000	0.94253	GAT	COPB1	-	pfam_Coatomer_bsu_C,pirsf_COPB1	ENSG00000129083		0.383	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	-	0.00	57	0	C	NM_016451		14487906	-1	tier1	-	no_errors	ENST00000249923	ensembl	human	known	74_37	missense	12.16	65	9	SNP	1.000	G
CPAMD8	27151	genome.wustl.edu	37	19	17091354	17091354	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:17091354G>T	ENST00000443236.1	-	14	1710	c.1679C>A	c.(1678-1680)gCc>gAc	p.A560D	CPAMD8_ENST00000388925.4_Intron	NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	513						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						CAGGGCAGGGGCCGCCCGCTT	0.572																																																	0													56.0	63.0	60.0					19																	17091354		1968	4153	6121	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.1679C>A	19.37:g.17091354G>T	ENSP00000402505:p.Ala560Asp		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.A560D	ENST00000443236.1	37	c.1679	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.882|8.882	0.951846|0.951846	0.18431|0.18431	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000291440|ENST00000443236	.|.	.|.	.|.	2.9|2.9	1.81|1.81	0.25067|0.25067	Alpha-2-macroglobulin, N-terminal 2 (1);|.	0.090665|.	0.45126|.	U|.	0.000389|.	T|T	0.45696|0.45696	0.1355|0.1355	L|L	0.39898|0.39898	1.24|1.24	0.34251|0.34251	D|D	0.678752|0.678752	P|.	0.43542|.	0.81|.	P|.	0.49887|.	0.625|.	T|T	0.53920|0.53920	-0.8370|-0.8370	9|5	0.13853|.	T|.	0.58|.	.|.	6.9391|6.9391	0.24483|0.24483	0.1065:0.1728:0.7207:0.0|0.1065:0.1728:0.7207:0.0	.|.	513|.	Q8IZJ3|.	CPMD8_HUMAN|.	D|T	560|571	.|.	ENSP00000291440:A560D|.	A|P	-|-	2|1	0|0	CPAMD8|CPAMD8	16952354|16952354	0.429000|0.429000	0.25530|0.25530	0.013000|0.013000	0.15412|0.15412	0.024000|0.024000	0.10985|0.10985	3.717000|3.717000	0.54911|0.54911	1.184000|1.184000	0.42957|0.42957	0.467000|0.467000	0.42956|0.42956	GCC|CCC	CPAMD8	-	pfam_A2M_N_2	ENSG00000160111		0.572	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2		0.00	79	0	G	NM_015692		17091354	-1			no_errors	ENST00000443236	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.016	T
CPEB4	80315	genome.wustl.edu	37	5	173372061	173372061	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:173372061C>A	ENST00000265085.5	+	5	2828	c.1374C>A	c.(1372-1374)tgC>tgA	p.C458*	CPEB4_ENST00000519835.1_Nonsense_Mutation_p.C433*|CPEB4_ENST00000517880.1_Nonsense_Mutation_p.C51*|CPEB4_ENST00000519467.1_3'UTR|CPEB4_ENST00000334035.5_Nonsense_Mutation_p.C441*|CPEB4_ENST00000522336.1_Nonsense_Mutation_p.C68*|CPEB4_ENST00000520867.1_Nonsense_Mutation_p.C433*	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	458					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CACCTCACTGCTTCAGTCACC	0.473																																																	0													179.0	161.0	167.0					5																	173372061		2203	4300	6503	SO:0001587	stop_gained	0			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.1374C>A	5.37:g.173372061C>A	ENSP00000265085:p.Cys458*		B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.C458*	ENST00000265085.5	37	c.1374	CCDS4390.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.089574|4.089574	0.76756|0.76756	.|.	.|.	ENSG00000113742|ENSG00000113742	ENST00000519152|ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835;ENST00000522336;ENST00000517880	.|.	.|.	.|.	5.37|5.37	4.5|4.5	0.54988|0.54988	.|.	.|0.043271	.|0.85682	.|D	.|0.000000	T|.	0.33731|.	0.0873|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33979|.	-0.9847|.	3|.	.|0.02654	.|T	.|1	-13.2469|-13.2469	13.5199|13.5199	0.61561|0.61561	0.0:0.8635:0.0:0.1365|0.0:0.8635:0.0:0.1365	.|.	.|.	.|.	.|.	D|X	136|458;433;441;433;68;51	.|.	.|ENSP00000265085:C458X	A|C	+|+	2|3	0|2	CPEB4|CPEB4	173304667|173304667	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	2.183000|2.183000	0.42565|0.42565	0.781000|0.781000	0.33589|0.33589	-0.797000|-0.797000	0.03246|0.03246	GCT|TGC	CPEB4	-	NULL	ENSG00000113742		0.473	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPEB4	HGNC	protein_coding	OTTHUMT00000252964.2	-	0.00	124	0	C	NM_030627		173372061	+1	tier1	-	no_errors	ENST00000265085	ensembl	human	known	74_37	nonsense	5.19	73	4	SNP	1.000	A
CPNE1	8904	genome.wustl.edu	37	20	34219461	34219461	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:34219461G>C	ENST00000317619.3	-	10	1061	c.667C>G	c.(667-669)Ctc>Gtc	p.L223V	CPNE1_ENST00000397446.1_Missense_Mutation_p.L223V|CPNE1_ENST00000352393.4_Missense_Mutation_p.L223V|CPNE1_ENST00000317677.5_Missense_Mutation_p.L228V|CPNE1_ENST00000397445.1_Missense_Mutation_p.L223V|CPNE1_ENST00000397442.1_Missense_Mutation_p.L223V|CPNE1_ENST00000397443.1_Missense_Mutation_p.L223V			Q99829	CPNE1_HUMAN	copine I	223	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)	calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21	Lung NSC(9;0.0053)|all_lung(11;0.00785)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			GTACCGATGAGATCATGTGAC	0.547																																																	0													71.0	51.0	58.0					20																	34219461		2203	4300	6503	SO:0001583	missense	0			U83246	CCDS13260.1, CCDS46595.1	20q11.22	2009-06-01			ENSG00000214078	ENSG00000214078			2314	protein-coding gene	gene with protein product		604205				9430674	Standard	NM_152925		Approved	CPN1	uc002xdm.3	Q99829	OTTHUMG00000032356	ENST00000317619.3:c.667C>G	20.37:g.34219461G>C	ENSP00000326126:p.Leu223Val		E1P5Q4|Q6IBL3|Q9H243|Q9NTZ7	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.L228V	ENST00000317619.3	37	c.682	CCDS13260.1	20	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480724	0.63849	.	.	ENSG00000214078	ENST00000352393;ENST00000317677;ENST00000317619;ENST00000397446;ENST00000397445;ENST00000397443;ENST00000397442;ENST00000437340;ENST00000430570;ENST00000412056;ENST00000414664;ENST00000416778;ENST00000439806	T;T;T;T;T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.43	5.43	0.79202	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.088704	0.46758	U	0.000273	T	0.59555	0.2202	M	0.84433	2.695	0.43499	D	0.995744	P;P;P;D;D	0.60160	0.857;0.678;0.685;0.972;0.987	P;P;P;P;P	0.58970	0.597;0.458;0.479;0.706;0.849	T	0.64846	-0.6311	10	0.66056	D	0.02	-10.884	6.9575	0.24580	0.1998:0.0:0.8002:0.0	.	228;223;223;223;203	B0QZ18;E7ENH5;A6PVH9;Q99829;Q59EI4	.;.;.;CPNE1_HUMAN;.	V	223;228;223;223;223;223;223;223;199;199;223;199;223	ENSP00000336945:L223V;ENSP00000317257:L228V;ENSP00000326126:L223V;ENSP00000380588:L223V;ENSP00000380587:L223V;ENSP00000380585:L223V;ENSP00000380584:L223V;ENSP00000415597:L223V;ENSP00000390626:L199V;ENSP00000416962:L199V;ENSP00000404355:L223V;ENSP00000389662:L199V;ENSP00000387434:L223V	ENSP00000326126:L223V	L	-	1	0	CPNE1	33682875	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	2.710000	0.47169	2.813000	0.96785	0.655000	0.94253	CTC	CPNE1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000214078		0.547	CPNE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE1	HGNC	protein_coding	OTTHUMT00000078909.3	-	0.00	69	0	G	NM_152930		34219461	-1	tier1	-	no_errors	ENST00000317677	ensembl	human	known	74_37	missense	7.46	61	5	SNP	1.000	C
CPNE2	221184	genome.wustl.edu	37	16	57171066	57171066	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:57171066G>C	ENST00000535318.2	+	15	1535	c.1174G>C	c.(1174-1176)Gat>Cat	p.D392H	CPNE2_ENST00000565951.1_Intron|CPNE2_ENST00000537605.1_Missense_Mutation_p.D290H|CPNE2_ENST00000565874.1_Missense_Mutation_p.D392H|CPNE2_ENST00000290776.8_Missense_Mutation_p.D392H			Q96FN4	CPNE2_HUMAN	copine II	392	VWFA.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				GGCAGGTGTGGATGGTATTGC	0.567																																																	0													119.0	67.0	84.0					16																	57171066		2198	4300	6498	SO:0001583	missense	0				CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.1174G>C	16.37:g.57171066G>C	ENSP00000439018:p.Asp392His		Q68D19|Q719H8|Q86XP9	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.D392H	ENST00000535318.2	37	c.1174	CCDS10774.1	16	.	.	.	.	.	.	.	.	.	.	G	18.31	3.595655	0.66219	.	.	ENSG00000140848	ENST00000290776;ENST00000537605;ENST00000535318	T;T;T	0.23147	1.92;1.92;1.92	5.88	5.88	0.94601	von Willebrand factor, type A (1);Copine (1);	0.054852	0.64402	D	0.000001	T	0.46073	0.1374	M	0.71296	2.17	0.52099	D	0.999949	P;B	0.47484	0.896;0.109	P;B	0.52267	0.694;0.238	T	0.35773	-0.9775	10	0.66056	D	0.02	-21.7161	20.2422	0.98381	0.0:0.0:1.0:0.0	.	392;392	A8K8A4;Q96FN4	.;CPNE2_HUMAN	H	392;290;392	ENSP00000290776:D392H;ENSP00000445468:D290H;ENSP00000439018:D392H	ENSP00000290776:D392H	D	+	1	0	CPNE2	55728567	1.000000	0.71417	1.000000	0.80357	0.188000	0.23474	7.981000	0.88123	2.782000	0.95742	0.655000	0.94253	GAT	CPNE2	-	pfam_Copine,smart_VWF_A	ENSG00000140848		0.567	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPNE2	HGNC	protein_coding	OTTHUMT00000432986.2	-	0.00	119	0	G	NM_152727		57171066	+1	tier1	-	no_errors	ENST00000290776	ensembl	human	known	74_37	missense	10.32	113	13	SNP	1.000	C
CRIP2	1397	genome.wustl.edu	37	14	105945384	105945384	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:105945384G>A	ENST00000329146.4	+	5	1119	c.406G>A	c.(406-408)Gct>Act	p.A136T	CRIP2_ENST00000483017.3_Splice_Site_p.A210T|CRIP2_ENST00000548989.1_3'UTR	NM_001312.3	NP_001303.1	P52943	CRIP2_HUMAN	cysteine-rich protein 2	136	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	cell cortex (GO:0005938)	zinc ion binding (GO:0008270)			lung(2)	2		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.235)		GGTGTACTTCGGTGAGTGCGC	0.731																																																	0													5.0	5.0	5.0					14																	105945384		2060	4089	6149	SO:0001630	splice_region_variant	0				CCDS10003.1, CCDS59246.1	14q32.3	2008-08-11			ENSG00000182809	ENSG00000182809			2361	protein-coding gene	gene with protein product		601183				8843343, 10681529	Standard	NM_001312		Approved	CRP2, ESP1	uc031qqr.1	P52943	OTTHUMG00000029906	ENST00000329146.4:c.406+1G>A	14.37:g.105945384G>A			A1A4U1|B7Z6C0|E9PD13	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A136T	ENST00000329146.4	37	c.406	CCDS10003.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.5|20.5	4.001598|4.001598	0.74818|0.74818	.|.	.|.	ENSG00000182809|ENSG00000182809	ENST00000483017;ENST00000329146|ENST00000538259	T;T|.	0.61274|.	0.12;0.12|.	3.38|3.38	3.38|3.38	0.38709|0.38709	Zinc finger, LIM-type (5);|.	0.123264|.	0.36002|.	U|.	0.002854|.	T|T	0.74733|0.74733	0.3755|0.3755	M|M	0.81802|0.81802	2.56|2.56	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.999|.	D;D;D|.	0.87578|.	0.998;0.998;0.994|.	T|T	0.77525|0.77525	-0.2555|-0.2555	10|5	0.87932|.	D|.	0|.	-1.3635|-1.3635	13.4927|13.4927	0.61405|0.61405	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	210;136;136|.	B7Z6C0;Q53FN1;P52943|.	.;.;CRIP2_HUMAN|.	T|H	210;136|119	ENSP00000426119:A210T;ENSP00000328521:A136T|.	ENSP00000328521:A136T|.	A|R	+|+	1|2	0|0	CRIP2|CRIP2	105016429|105016429	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.063000|0.063000	0.16089|0.16089	6.940000|6.940000	0.75917|0.75917	1.727000|1.727000	0.51537|0.51537	0.282000|0.282000	0.19409|0.19409	GCT|CGC	CRIP2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000182809		0.731	CRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIP2	HGNC	protein_coding	OTTHUMT00000074597.3	-	0.00	9	0	G	NM_001312	Missense_Mutation	105945384	+1	tier1	-	no_errors	ENST00000329146	ensembl	human	known	74_37	missense	41.67	7	5	SNP	1.000	A
CSE1L	1434	genome.wustl.edu	37	20	47710696	47710697	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:47710696_47710697insA	ENST00000262982.2	+	23	2590_2591	c.2467_2468insA	c.(2467-2469)gaafs	p.E823fs	CSE1L_ENST00000396192.3_Frame_Shift_Ins_p.E767fs|CSE1L_ENST00000542325.1_Frame_Shift_Ins_p.E606fs|CSE1L_ENST00000469700.1_3'UTR	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	823					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			AATGGTTTTGGAAAAAATTATT	0.292																																																	0																																										SO:0001589	frameshift_variant	0			U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2473dupA	20.37:g.47710702_47710702dupA	ENSP00000262982:p.Glu823fs		A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Frame_Shift_Ins	INS	pfam_CAS_CSE1_C,pfam_Cse1,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.I825fs	ENST00000262982.2	37	c.2467_2468	CCDS13412.1	20																																																																																			CSE1L	-	pfam_CAS_CSE1_C,superfamily_ARM-type_fold	ENSG00000124207		0.292	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	HGNC	protein_coding	OTTHUMT00000080345.2		0.00	119	0	-	NM_001316		47710697	+1	tier1		no_errors	ENST00000262982	ensembl	human	known	74_37	frame_shift_ins	21.25	63	17	INS	1.000:1.000	A
CSF3R	1441	genome.wustl.edu	37	1	36931763	36931763	+	3'UTR	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:36931763C>G	ENST00000373106.1	-	0	3253				MRPS15_ENST00000373116.5_5'Flank|CSF3R_ENST00000487540.2_5'UTR|CSF3R_ENST00000331941.5_Missense_Mutation_p.Q762H|CSF3R_ENST00000338937.5_3'UTR|CSF3R_ENST00000418048.2_3'UTR|CSF3R_ENST00000361632.4_3'UTR|CSF3R_ENST00000373103.1_3'UTR|CSF3R_ENST00000373104.1_Missense_Mutation_p.Q762H	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)						cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGAGCATGATCTGGTCCTTAA	0.493																																																	0													95.0	97.0	96.0					1																	36931763		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.*195G>C	1.37:g.36931763C>G				Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q762H	ENST00000373106.1	37	c.2286	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298676	0.23650	.	.	ENSG00000119535	ENST00000373104;ENST00000331941	T;T	0.51817	0.69;0.69	3.53	-2.05	0.07321	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.27157	-1.0082	8	0.62326	D	0.03	.	5.7247	0.18006	0.0:0.3063:0.4871:0.2066	.	762	Q99062-4	.	H	762	ENSP00000362196:Q762H;ENSP00000332180:Q762H	ENSP00000332180:Q762H	Q	-	3	2	CSF3R	36704350	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.277000	0.08502	-0.392000	0.07751	-0.145000	0.13849	CAG	CSF3R	-	NULL	ENSG00000119535		0.493	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	-	0.00	76	0	C	NM_156039		36931763	-1	tier1	-	no_errors	ENST00000331941	ensembl	human	known	74_37	missense	12.50	63	9	SNP	0.000	G
CWF19L2	143884	genome.wustl.edu	37	11	107207409	107207409	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:107207409C>G	ENST00000282251.5	-	15	2260	c.2233G>C	c.(2233-2235)Gaa>Caa	p.E745Q		NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	745							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		CCTTTATCTTCAAACATCTTT	0.303																																																	0													72.0	68.0	70.0					11																	107207409		2199	4297	6496	SO:0001583	missense	0			AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.2233G>C	11.37:g.107207409C>G	ENSP00000282251:p.Glu745Gln		A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.E745Q	ENST00000282251.5	37	c.2233	CCDS8336.2	11	.	.	.	.	.	.	.	.	.	.	C	15.30	2.791503	0.50102	.	.	ENSG00000152404	ENST00000282251;ENST00000409771	T	0.10668	2.85	5.48	3.56	0.40772	Histidine triad motif (1);Histidine triad-like motif (1);Cwf19-like, C-terminal domain-1 (1);	0.044377	0.85682	D	0.000000	T	0.15825	0.0381	L	0.52126	1.63	0.80722	D	1	B	0.26547	0.152	B	0.36766	0.232	T	0.03306	-1.1050	10	0.40728	T	0.16	-23.1044	15.4186	0.74991	0.0:0.7368:0.2632:0.0	.	745	Q2TBE0	C19L2_HUMAN	Q	745;3	ENSP00000282251:E745Q	ENSP00000282251:E745Q	E	-	1	0	CWF19L2	106712619	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.893000	0.63199	0.752000	0.32923	0.655000	0.94253	GAA	CWF19L2	-	pfam_Cwf19-like_C_dom-1,superfamily_HIT-like	ENSG00000152404		0.303	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L2	HGNC	protein_coding	OTTHUMT00000328825.2	-	0.00	60	0	C	NM_152434		107207409	-1	tier1	-	no_errors	ENST00000282251	ensembl	human	known	74_37	missense	8.70	63	6	SNP	1.000	G
DAB2	1601	genome.wustl.edu	37	5	39390613	39390613	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:39390613C>T	ENST00000320816.6	-	5	862	c.395G>A	c.(394-396)cGg>cAg	p.R132Q	DAB2_ENST00000545653.1_Missense_Mutation_p.R132Q|DAB2_ENST00000512525.1_5'UTR|DAB2_ENST00000509337.1_Missense_Mutation_p.R132Q|DAB2_ENST00000339788.6_Missense_Mutation_p.R132Q	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	132	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)	p.R132Q(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			ACCAAATGCCCGGTTGTCTGT	0.408																																																	1	Substitution - Missense(1)	prostate(1)											90.0	92.0	91.0					5																	39390613		2203	4300	6503	SO:0001583	missense	0			U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.395G>A	5.37:g.39390613C>T	ENSP00000313391:p.Arg132Gln		A6NES5|Q13598|Q9BTY0|Q9UK04	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.R132Q	ENST00000320816.6	37	c.395	CCDS34149.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.921685	0.97105	.	.	ENSG00000153071	ENST00000320816;ENST00000339788;ENST00000545653;ENST00000509337	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.73	5.73	0.89815	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.78742	0.4331	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.968;0.995	T	0.78952	-0.2001	10	0.87932	D	0	-12.1185	20.2786	0.98501	0.0:1.0:0.0:0.0	.	132;132	P98082;P98082-3	DAB2_HUMAN;.	Q	132	ENSP00000313391:R132Q;ENSP00000345508:R132Q;ENSP00000439919:R132Q;ENSP00000426245:R132Q	ENSP00000313391:R132Q	R	-	2	0	DAB2	39426370	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.358000	0.79466	2.868000	0.98415	0.557000	0.71058	CGG	DAB2	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000153071		0.408	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAB2	HGNC	protein_coding	OTTHUMT00000367014.1	-	0.00	74	0	C	NM_001343		39390613	-1	tier1	-	no_errors	ENST00000320816	ensembl	human	known	74_37	missense	9.09	59	6	SNP	1.000	T
DAO	1610	genome.wustl.edu	37	12	109273444	109273444	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:109273444C>T	ENST00000228476.3	+	0	0				DAO_ENST00000548052.1_3'UTR|DAO_ENST00000551281.1_Intron	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase						cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	TCCTTGGCCTCATCTCCCCAG	0.662																																																	0																																										SO:0001631	upstream_gene_variant	0			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360		12.37:g.109273444C>T	Exception_encountered		B2R7I5|Q16758|Q8N6R2	RNA	SNP	-	NULL	ENST00000228476.3	37	NULL	CCDS9122.1	12																																																																																			DAO	-	-	ENSG00000110887		0.662	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAO	HGNC	protein_coding	OTTHUMT00000403682.1	-	0.00	99	0	C			109273444	+1	tier1	-	no_errors	ENST00000548052	ensembl	human	known	74_37	rna	13.92	68	11	SNP	0.000	T
DCLK1	9201	genome.wustl.edu	37	13	36382446	36382446	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:36382446T>G	ENST00000360631.3	-	14	1989	c.1778A>C	c.(1777-1779)gAc>gCc	p.D593A	DCLK1_ENST00000379893.1_Missense_Mutation_p.D286A|DCLK1_ENST00000255448.4_Missense_Mutation_p.D593A			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	593	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		CACCTCCTGGTCATCACCACT	0.453																																																	0													197.0	185.0	189.0					13																	36382446		2203	4300	6503	SO:0001583	missense	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1778A>C	13.37:g.36382446T>G	ENSP00000353846:p.Asp593Ala		B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.D593A	ENST00000360631.3	37	c.1778		13	.	.	.	.	.	.	.	.	.	.	T	17.89	3.499470	0.64298	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.42900	0.96;0.96;0.96	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.34106	0.0886	N	0.25144	0.715	0.80722	D	1	B;P;P;B	0.36183	0.22;0.542;0.486;0.22	B;B;B;B	0.42959	0.099;0.403;0.281;0.099	T	0.07731	-1.0757	10	0.08837	T	0.75	.	15.4449	0.75223	0.0:0.0:0.0:1.0	.	286;593;593;286	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	A	285;593;593;286;575	ENSP00000255448:D593A;ENSP00000353846:D593A;ENSP00000369223:D286A	ENSP00000255448:D593A	D	-	2	0	DCLK1	35280446	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.950000	0.87804	2.059000	0.61396	0.460000	0.39030	GAC	DCLK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000133083		0.453	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1		0.00	68	0	T	NM_004734		36382446	-1			no_errors	ENST00000360631	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	G
DGKD	8527	genome.wustl.edu	37	2	234355361	234355361	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:234355361G>A	ENST00000264057.2	+	12	1350	c.1338G>A	c.(1336-1338)tgG>tgA	p.W446*	DGKD_ENST00000409813.3_Nonsense_Mutation_p.W402*	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	446	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TGTGCAGGTGGAGCGTCATGG	0.617																																																	0													92.0	74.0	80.0					2																	234355361		2203	4300	6503	SO:0001587	stop_gained	0			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1338G>A	2.37:g.234355361G>A	ENSP00000264057:p.Trp446*		Q14158|Q6PK55|Q8NG53	Nonsense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.W446*	ENST00000264057.2	37	c.1338	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.655721	0.96724	.	.	ENSG00000077044	ENST00000264057;ENST00000409813	.	.	.	5.05	5.05	0.67936	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9815	0.92757	0.0:0.0:1.0:0.0	.	.	.	.	X	446;402	.	ENSP00000264057:W446X	W	+	3	0	DGKD	234020100	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.203000	0.95033	2.806000	0.96561	0.655000	0.94253	TGG	DGKD	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000077044		0.617	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	-	0.00	26	0	G	NM_003648		234355361	+1	tier1	-	no_errors	ENST00000264057	ensembl	human	known	74_37	nonsense	22.50	31	9	SNP	1.000	A
DNAH1	25981	genome.wustl.edu	37	3	52386669	52386669	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:52386669G>T	ENST00000420323.2	+	18	3234	c.2973G>T	c.(2971-2973)caG>caT	p.Q991H		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	991	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		ACTGCCAGCAGCTGGCCATGC	0.597																																																	0													45.0	50.0	49.0					3																	52386669		2153	4260	6413	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.2973G>T	3.37:g.52386669G>T	ENSP00000401514:p.Gln991His		B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	p.Q991H	ENST00000420323.2	37	c.2973	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	14.40	2.523992	0.44866	.	.	ENSG00000114841	ENST00000420323	T	0.24538	1.85	5.57	4.69	0.59074	.	0.264926	0.27076	N	0.021054	T	0.24122	0.0584	L	0.54323	1.7	0.37471	D	0.915599	B;B	0.14805	0.002;0.011	B;B	0.17979	0.005;0.02	T	0.13548	-1.0505	10	0.66056	D	0.02	.	7.3974	0.26944	0.1471:0.0:0.7077:0.1452	.	991;991	C9JXH6;Q9P2D7-3	.;.	H	991	ENSP00000401514:Q991H	ENSP00000401514:Q991H	Q	+	3	2	DNAH1	52361709	0.781000	0.28676	1.000000	0.80357	0.893000	0.52053	0.273000	0.18662	1.353000	0.45828	0.561000	0.74099	CAG	DNAH1	-	superfamily_P-loop_NTPase	ENSG00000114841		0.597	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	-	0.00	42	0	G	NM_015512		52386669	+1	tier1	-	no_errors	ENST00000420323	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.999	T
DNAH11	8701	genome.wustl.edu	37	7	21603811	21603811	+	Silent	SNP	C	C	G	rs376448045		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:21603811C>G	ENST00000409508.3	+	6	1021	c.990C>G	c.(988-990)ctC>ctG	p.L330L	DNAH11_ENST00000328843.6_Silent_p.L330L	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	330	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.L330L(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CAGCTCTTCTCGAAGCCCAAG	0.418									Kartagener syndrome																																								1	Substitution - coding silent(1)	endometrium(1)											92.0	86.0	88.0					7																	21603811		1854	4084	5938	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.990C>G	7.37:g.21603811C>G			Q9UJ82	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L330	ENST00000409508.3	37	c.990		7																																																																																			DNAH11	-	pfam_Dynein_heavy_dom-1	ENSG00000105877		0.418	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	-	0.00	46	0	C	NM_003777		21603811	+1	tier1	-	no_errors	ENST00000328843	ensembl	human	known	74_37	silent	11.36	39	5	SNP	0.004	G
DNAH6	1768	genome.wustl.edu	37	2	84934741	84934741	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:84934741G>T	ENST00000237449.6	+	53	8957	c.8949G>T	c.(8947-8949)caG>caT	p.Q2983H	DNAH6_ENST00000389394.3_Missense_Mutation_p.Q2983H			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2983					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AAAGCATACAGAAGTTTGAGG	0.478																																																	0													188.0	173.0	177.0					2																	84934741		692	1591	2283	SO:0001583	missense	0			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.8949G>T	2.37:g.84934741G>T	ENSP00000237449:p.Gln2983His		A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q2983H	ENST00000237449.6	37	c.8949	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	13.44	2.236901	0.39498	.	.	ENSG00000115423	ENST00000389394;ENST00000237449	T;T	0.75260	-0.92;-0.92	5.58	1.64	0.23874	Dynein heavy chain, coiled coil stalk (1);	1.780160	0.03041	N	0.153302	T	0.62171	0.2406	N	0.21545	0.675	0.43688	D	0.996138	B	0.19935	0.04	B	0.25759	0.063	T	0.51317	-0.8721	10	0.39692	T	0.17	.	4.1255	0.10125	0.0727:0.2571:0.4055:0.2646	.	2983	Q9C0G6	DYH6_HUMAN	H	2983	ENSP00000374045:Q2983H;ENSP00000237449:Q2983H	ENSP00000237449:Q2983H	Q	+	3	2	DNAH6	84788252	0.962000	0.33011	0.463000	0.27130	0.636000	0.38137	0.625000	0.24477	0.270000	0.21984	-0.189000	0.12847	CAG	DNAH6	-	superfamily_P-loop_NTPase	ENSG00000115423		0.478	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	-	0.00	97	0	G	NM_001370		84934741	+1	tier1	-	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.388	T
DNAJB11	51726	genome.wustl.edu	37	3	186299223	186299223	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:186299223G>C	ENST00000439351.1	+	6	1449	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	DNAJB11_ENST00000265028.3_Missense_Mutation_p.E174Q			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	174					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E174Q(1)		breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TTGTCGGCAAGAGATGCGGAC	0.517																																																	1	Substitution - Missense(1)	urinary_tract(1)											96.0	93.0	94.0					3																	186299223		2203	4300	6503	SO:0001583	missense	0			AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.520G>C	3.37:g.186299223G>C	ENSP00000414398:p.Glu174Gln		Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	p.E174Q	ENST00000439351.1	37	c.520	CCDS3277.1	3	.	.	.	.	.	.	.	.	.	.	G	28.4	4.919309	0.92249	.	.	ENSG00000090520	ENST00000439351;ENST00000265028	T;T	0.66995	-0.24;-0.24	5.85	4.98	0.66077	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.63331	0.2502	L	0.35249	1.045	0.80722	D	1	D	0.61080	0.989	P	0.52031	0.688	T	0.59322	-0.7476	10	0.21540	T	0.41	-27.0749	12.8604	0.57910	0.0787:0.0:0.9213:0.0	.	174	Q9UBS4	DJB11_HUMAN	Q	174	ENSP00000414398:E174Q;ENSP00000265028:E174Q	ENSP00000265028:E174Q	E	+	1	0	DNAJB11	187781917	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	9.869000	0.99810	1.469000	0.48083	0.655000	0.94253	GAG	DNAJB11	-	superfamily_HSP40/DnaJ_pept-bd	ENSG00000090520		0.517	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB11	HGNC	protein_coding	OTTHUMT00000344779.1		0.00	59	0	G			186299223	+1			no_errors	ENST00000265028	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	C
DNAJB11	51726	genome.wustl.edu	37	3	186314912	186314912	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:186314912T>A	ENST00000538831.1	+	1	160	c.148T>A	c.(148-150)Tta>Ata	p.L50I				Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	0	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		GCTTCAAGAGTTAGAGGAATT	0.562																																																	0																																										SO:0001583	missense	0			AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000538831.1:c.148T>A	3.37:g.186314912T>A	ENSP00000440189:p.Leu50Ile		Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	pfam_DUF2346	p.L50I	ENST00000538831.1	37	c.148		3	.	.	.	.	.	.	.	.	.	.	T	2.176	-0.388738	0.04932	.	.	ENSG00000090520	ENST00000538831	.	.	.	1.3	-2.6	0.06190	.	.	.	.	.	T	0.16557	0.0398	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23226	-1.0194	5	0.18276	T	0.48	.	2.46	0.04538	0.4925:0.3092:0.0:0.1982	.	.	.	.	I	50	.	ENSP00000440189:L50I	L	+	1	2	DNAJB11	187797606	0.321000	0.24625	0.004000	0.12327	0.063000	0.16089	-1.018000	0.03626	-1.394000	0.02077	-2.371000	0.00235	TTA	DNAJB11	-	pfam_DUF2346	ENSG00000090520		0.562	DNAJB11-202	KNOWN	basic	protein_coding	DNAJB11	HGNC	protein_coding		-	0.00	198	0	T			186314912	+1	tier1	-	no_errors	ENST00000538831	ensembl	human	known	74_37	missense	6.52	172	12	SNP	0.005	A
DSCR3	10311	genome.wustl.edu	37	21	38600650	38600650	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:38600650G>T	ENST00000309117.6	-	6	769	c.532C>A	c.(532-534)Ctt>Att	p.L178I	DSCR3_ENST00000398998.1_Missense_Mutation_p.L130I|DSCR3_ENST00000399001.1_Missense_Mutation_p.L53I|DSCR3_ENST00000399000.3_5'UTR|DSCR3_ENST00000476950.1_Missense_Mutation_p.L151I|DSCR3_ENST00000539844.1_Missense_Mutation_p.L101I|AP001432.14_ENST00000440629.1_lincRNA|DSCR3_ENST00000288304.5_Missense_Mutation_p.L136I	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3	178						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						TGTCCTCGAAGGAGAAATTTG	0.473																																																	0													64.0	65.0	65.0					21																	38600650		2203	4300	6503	SO:0001583	missense	0			D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.532C>A	21.37:g.38600650G>T	ENSP00000311399:p.Leu178Ile		B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	Missense_Mutation	SNP	pfam_VPS26,pfam_Arrestin-like_N,superfamily_Ig_E-set	p.L178I	ENST00000309117.6	37	c.532	CCDS33553.1	21	.	.	.	.	.	.	.	.	.	.	G	3.525	-0.096898	0.07010	.	.	ENSG00000157538	ENST00000309117;ENST00000288304;ENST00000539844;ENST00000399001;ENST00000476950;ENST00000398998	.	.	.	5.42	3.03	0.35002	.	0.219769	0.47093	N	0.000243	T	0.09113	0.0225	N	0.00666	-1.275	0.28428	N	0.91739	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.14023	0.004;0.01;0.001;0.002	T	0.36986	-0.9725	9	0.02654	T	1	-1.6949	8.5139	0.33235	0.0:0.0685:0.1336:0.7978	.	53;101;151;178	A8MY26;B7Z606;B7Z6B1;O14972	.;.;.;DSCR3_HUMAN	I	178;136;101;53;151;130	.	ENSP00000288304:L136I	L	-	1	0	DSCR3	37522520	1.000000	0.71417	0.893000	0.35052	0.949000	0.60115	2.758000	0.47565	0.452000	0.26830	-0.266000	0.10368	CTT	DSCR3	-	pfam_VPS26	ENSG00000157538		0.473	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR3	HGNC	protein_coding	OTTHUMT00000194807.1		0.00	33	0	G			38600650	-1			no_errors	ENST00000309117	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.993	T
DSG3	1830	genome.wustl.edu	37	18	29036436	29036436	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:29036436G>C	ENST00000257189.4	+	2	165	c.82G>C	c.(82-84)Gag>Cag	p.E28Q		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	28					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ATTGCGAATAGAGGTAAAGTA	0.229																																																	0													59.0	62.0	61.0					18																	29036436		2198	4283	6481	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.82G>C	18.37:g.29036436G>C	ENSP00000257189:p.Glu28Gln		A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.E28Q	ENST00000257189.4	37	c.82	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840117	0.32513	.	.	ENSG00000134757	ENST00000257189	T	0.60548	0.18	5.58	0.344	0.16006	.	0.638010	0.13637	N	0.373279	T	0.37679	0.1012	N	0.21194	0.64	0.23320	N	0.997917	B	0.20368	0.044	B	0.18871	0.023	T	0.19877	-1.0292	10	0.22109	T	0.4	.	8.2271	0.31575	0.1569:0.4328:0.4103:0.0	.	28	P32926	DSG3_HUMAN	Q	28	ENSP00000257189:E28Q	ENSP00000257189:E28Q	E	+	1	0	DSG3	27290434	1.000000	0.71417	0.636000	0.29352	0.756000	0.42949	1.004000	0.29822	0.010000	0.14839	0.655000	0.94253	GAG	DSG3	-	NULL	ENSG00000134757		0.229	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	-	0.00	201	0	G	NM_001944		29036436	+1	tier1	-	no_errors	ENST00000257189	ensembl	human	known	74_37	missense	11.20	110	14	SNP	0.813	C
DSG3	1830	genome.wustl.edu	37	18	29039116	29039116	+	Missense_Mutation	SNP	G	G	C	rs542631283		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:29039116G>C	ENST00000257189.4	+	5	576	c.493G>C	c.(493-495)Gaa>Caa	p.E165Q		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	165	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TTTCATGGGTGAAATTGAAGA	0.323																																																	0													62.0	66.0	65.0					18																	29039116		2202	4299	6501	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.493G>C	18.37:g.29039116G>C	ENSP00000257189:p.Glu165Gln		A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.E165Q	ENST00000257189.4	37	c.493	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171706	0.38315	.	.	ENSG00000134757	ENST00000257189	T	0.52983	0.64	5.39	4.46	0.54185	Cadherin (4);Cadherin-like (1);	0.135801	0.33327	N	0.005035	T	0.26882	0.0658	N	0.10664	0.02	0.29337	N	0.866306	B	0.32968	0.392	B	0.33960	0.173	T	0.15321	-1.0441	10	0.35671	T	0.21	.	10.5483	0.45072	0.0:0.1235:0.697:0.1795	.	165	P32926	DSG3_HUMAN	Q	165	ENSP00000257189:E165Q	ENSP00000257189:E165Q	E	+	1	0	DSG3	27293114	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	3.718000	0.54919	2.677000	0.91161	0.655000	0.94253	GAA	DSG3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000134757		0.323	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1	-	0.00	129	0	G	NM_001944		29039116	+1	tier1	-	no_errors	ENST00000257189	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	C
DST	667	genome.wustl.edu	37	6	56471743	56471743	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:56471743C>G	ENST00000361203.3	-	36	7057	c.7050G>C	c.(7048-7050)gtG>gtC	p.V2350V	DST_ENST00000370769.4_Silent_p.V2350V|DST_ENST00000370754.5_Silent_p.V2528V|DST_ENST00000312431.6_Silent_p.V2350V|DST_ENST00000370788.2_Intron|DST_ENST00000446842.2_Silent_p.V2024V|DST_ENST00000421834.2_Intron|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	2350					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CCCCTGGAGTCACAGCACAGG	0.433																																																	0													131.0	128.0	129.0					6																	56471743		2029	4179	6208	SO:0001819	synonymous_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.7050G>C	6.37:g.56471743C>G			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Silent	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.V2528	ENST00000361203.3	37	c.7584		6																																																																																			DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.433	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3		0.00	39	0	C	NM_001723		56471743	-1			no_errors	ENST00000370754	ensembl	human	known	74_37	silent	7.14	39	3	SNP	0.000	G
EFNA4	1945	genome.wustl.edu	37	1	155039318	155039318	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:155039318T>C	ENST00000368409.3	+	2	319	c.226T>C	c.(226-228)Tac>Cac	p.Y76H	EFNA3_ENST00000505139.1_Intron|EFNA3_ENST00000556931.1_Intron|EFNA4_ENST00000427683.2_Missense_Mutation_p.Y76H|EFNA4_ENST00000359751.4_Missense_Mutation_p.Y76H	NM_005227.2	NP_005218.1	P52798	EFNA4_HUMAN	ephrin-A4	76	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			GTTTGCTTTGTACATGGTGGA	0.627																																																	0													42.0	47.0	45.0					1																	155039318		2203	4300	6503	SO:0001583	missense	0			AJ006352	CCDS1089.1, CCDS41407.1, CCDS44237.1	1q21-q22	2011-03-09			ENSG00000243364	ENSG00000243364		"""Ephrins"""	3224	protein-coding gene	gene with protein product		601380		EPLG4		8660976	Standard	NM_182690		Approved	LERK4		P52798	OTTHUMG00000035309	ENST00000368409.3:c.226T>C	1.37:g.155039318T>C	ENSP00000357394:p.Tyr76His		C9JHJ8|G3XAK2|O95457|Q5SR71|Q6FI57	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.Y76H	ENST00000368409.3	37	c.226	CCDS1089.1	1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.407710	0.83340	.	.	ENSG00000243364	ENST00000368409;ENST00000359751;ENST00000427683	T;T;T	0.63580	-0.05;-0.05;-0.05	5.31	5.31	0.75309	Cupredoxin (2);	0.065668	0.64402	D	0.000007	T	0.76659	0.4018	M	0.87269	2.87	0.80722	D	1	D;D;D	0.76494	0.999;0.994;0.992	D;D;P	0.77004	0.989;0.93;0.905	T	0.81560	-0.0877	10	0.66056	D	0.02	-30.5454	13.2056	0.59793	0.0:0.0:0.0:1.0	.	76;76;76	P52798-2;P52798;G3XAK2	.;EFNA4_HUMAN;.	H	76	ENSP00000357394:Y76H;ENSP00000352789:Y76H;ENSP00000414378:Y76H	ENSP00000352789:Y76H	Y	+	1	0	EFNA4	153305942	0.996000	0.38824	0.895000	0.35142	0.871000	0.50021	4.851000	0.62896	2.014000	0.59158	0.459000	0.35465	TAC	EFNA4	-	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	ENSG00000243364		0.627	EFNA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EFNA4	HGNC	protein_coding	OTTHUMT00000085421.2		0.00	112	0	T	NM_005227		155039318	+1			no_errors	ENST00000427683	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.995	C
EME1	146956	genome.wustl.edu	37	17	48452978	48452978	+	Missense_Mutation	SNP	A	A	C	rs76993288|rs36080231|rs558756129|rs3060668	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:48452978A>C	ENST00000338165.4	+	2	491	c.409A>C	c.(409-411)Aag>Cag	p.K137Q	EME1_ENST00000393271.2_Missense_Mutation_p.K137Q|MRPL27_ENST00000507088.1_5'Flank|EME1_ENST00000511648.2_Missense_Mutation_p.K137Q|MRPL27_ENST00000225969.4_5'Flank|MRPL27_ENST00000442592.3_5'Flank|MRPL27_ENST00000503633.1_5'Flank	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	137					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			TGACTGGAAAAAGCCCTTTCC	0.473								Direct reversal of damage;Homologous recombination																																									0													77.0	81.0	80.0					17																	48452978		2203	4300	6503	SO:0001583	missense	0			BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.409A>C	17.37:g.48452978A>C	ENSP00000339897:p.Lys137Gln		Q96N62	Missense_Mutation	SNP	pfam_ERCC4_domain,smart_ERCC4_domain	p.K137Q	ENST00000338165.4	37	c.409	CCDS11565.1	17	.	.	.	.	.	.	.	.	.	.	A	10.79	1.448556	0.26074	.	.	ENSG00000154920	ENST00000338165;ENST00000393271;ENST00000511648	T;T;T	0.10573	2.87;2.86;2.86	4.58	1.04	0.20106	.	0.639993	0.14457	N	0.318426	T	0.05914	0.0154	L	0.29908	0.895	0.09310	N	0.999999	B;B	0.28850	0.225;0.144	B;B	0.20955	0.032;0.014	T	0.37314	-0.9711	10	0.21540	T	0.41	-21.2574	4.6392	0.12540	0.6446:0.1673:0.1881:0.0	.	137;137	Q96AY2-2;Q96AY2	.;EME1_HUMAN	Q	137	ENSP00000339897:K137Q;ENSP00000376952:K137Q;ENSP00000421700:K137Q	ENSP00000339897:K137Q	K	+	1	0	EME1	45807977	0.000000	0.05858	0.932000	0.37286	0.879000	0.50718	0.151000	0.16283	0.788000	0.33755	0.533000	0.62120	AAG	EME1	-	NULL	ENSG00000154920		0.473	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EME1	HGNC	protein_coding	OTTHUMT00000367118.3		0.00	74	0	A	NM_152463		48452978	+1			no_errors	ENST00000393271	ensembl	human	known	74_37	missense	9.72	65	7	SNP	0.140	C
LOC105372257	105372257	genome.wustl.edu	37	19	6957087	6957087	+	RNA	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:6957087G>T	ENST00000593558.1	+	0	1030				EMR4P_ENST00000600751.1_RNA																							ACCACAAAGAGCAACACTCCC	0.423																																																	0																																												0																															19.37:g.6957087G>T				RNA	SNP	-	NULL	ENST00000593558.1	37	NULL		19																																																																																			EMR4P	-	-	ENSG00000268758		0.423	RP11-1137G4.3-001	KNOWN	basic	antisense	EMR4P	HGNC	antisense	OTTHUMT00000458493.1	-	0.00	100	0	G			6957087	-1	tier1	-	no_errors	ENST00000600751	ensembl	human	known	74_37	rna	5.41	70	4	SNP	0.247	T
EMR2	30817	genome.wustl.edu	37	19	14862359	14862359	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:14862359C>G	ENST00000315576.3	-	16	2364	c.1913G>C	c.(1912-1914)aGc>aCc	p.S638T	EMR2_ENST00000594076.1_Missense_Mutation_p.S545T|EMR2_ENST00000595839.1_Missense_Mutation_p.S496T|EMR2_ENST00000596991.2_Missense_Mutation_p.S627T|EMR2_ENST00000353876.1_Missense_Mutation_p.S545T|EMR2_ENST00000392967.2_Missense_Mutation_p.S627T|EMR2_ENST00000346057.1_Missense_Mutation_p.S589T|EMR2_ENST00000594294.1_Missense_Mutation_p.S589T|EMR2_ENST00000601345.1_Missense_Mutation_p.S627T|EMR2_ENST00000353005.1_Missense_Mutation_p.S496T|EMR2_ENST00000392965.3_Missense_Mutation_p.S580T|EMR2_ENST00000392964.3_3'UTR	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	638					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TCTGTTGATGCTTGAGTAGTT	0.547																																																	0													141.0	125.0	130.0					19																	14862359		2203	4300	6503	SO:0001583	missense	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1913G>C	19.37:g.14862359C>G	ENSP00000319883:p.Ser638Thr		B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.S638T	ENST00000315576.3	37	c.1913	CCDS32935.1	19	.	.	.	.	.	.	.	.	.	.	C	11.22	1.574203	0.28092	.	.	ENSG00000127507	ENST00000315576;ENST00000392967;ENST00000346057;ENST00000353876;ENST00000353005;ENST00000392965	T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31	4.62	3.33	0.38152	GPCR, family 2-like (1);	.	.	.	.	T	0.39145	0.1067	L	0.31752	0.955	0.09310	N	0.999992	P;B;P;B;P;P;B;P	0.52692	0.771;0.338;0.955;0.235;0.694;0.576;0.389;0.593	P;B;P;B;P;P;P;B	0.57009	0.673;0.373;0.811;0.203;0.452;0.588;0.507;0.281	T	0.15983	-1.0418	9	0.25751	T	0.34	.	10.873	0.46894	0.0:0.6988:0.3012:0.0	.	580;545;638;496;589;638;638;627	E7ESD7;Q9UHX3-4;A0JNV7;Q9UHX3-5;Q9UHX3-3;A8K6W1;Q9UHX3;Q9UHX3-2	.;.;.;.;.;.;EMR2_HUMAN;.	T	638;627;589;545;496;580	ENSP00000319883:S638T;ENSP00000376694:S627T;ENSP00000263380:S589T;ENSP00000319454:S545T;ENSP00000319838:S496T;ENSP00000376692:S580T	ENSP00000319883:S638T	S	-	2	0	EMR2	14723359	0.022000	0.18835	0.001000	0.08648	0.004000	0.04260	2.217000	0.42880	0.774000	0.33427	0.514000	0.50259	AGC	EMR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt	ENSG00000127507		0.547	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	-	0.00	73	0	C			14862359	-1	tier1	-	no_errors	ENST00000315576	ensembl	human	known	74_37	missense	13.73	44	7	SNP	0.002	G
MUC3A	4584	genome.wustl.edu	37	7	100608253	100608253	+	Intron	SNP	G	G	A	rs376612998		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:100608253G>A	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000420080.1_RNA|RP11-395B7.2_ENST00000434775.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						CTGCTTCCTGGCCCTAACCCC	0.592																																																	0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-54G>A	7.37:g.100608253G>A			O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	SNP	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-	ENSG00000225946		0.592	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	-	0.00	56	0	G	XM_001725354		100608253	-1	tier1	-	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	11.29	55	7	SNP	0.002	A
FBXO18	84893	genome.wustl.edu	37	10	5978603	5978603	+	Intron	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:5978603G>C	ENST00000362091.4	+	20	3076				FBXO18_ENST00000397269.3_Intron|RP11-536K7.3_ENST00000397264.4_RNA|FBXO18_ENST00000379999.5_Intron	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18						DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TTTTGCTTGTGAGCTCTGTGC	0.463																																																	0																																										SO:0001627	intron_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2961+53G>C	10.37:g.5978603G>C			Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	RNA	SNP	-	NULL	ENST00000362091.4	37	NULL	CCDS7072.1	10																																																																																			RP11-536K7.3	-	-	ENSG00000232807		0.463	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232807	Clone_based_vega_gene	protein_coding	OTTHUMT00000046596.1	-	0.00	48	0	G	NM_032807		5978603	-1	tier1	-	no_errors	ENST00000397264	ensembl	human	known	74_37	rna	20.00	56	14	SNP	0.000	C
BRINP3	339479	genome.wustl.edu	37	1	190449679	190449679	+	5'Flank	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:190449679G>A	ENST00000367462.3	-	0	0				RP11-161I10.1_ENST00000417409.1_lincRNA|RP11-547I7.2_ENST00000424735.1_lincRNA	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											GAGAGTTAGAGAGCATACTTT	0.368																																																	0																																										SO:0001631	upstream_gene_variant	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533		1.37:g.190449679G>A	Exception_encountered		B3KVP1|B7Z260|O95726|Q2M330	RNA	SNP	-	NULL	ENST00000367462.3	37	NULL	CCDS1373.1	1																																																																																			RP11-547I7.2	-	-	ENSG00000237457		0.368	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237457	Clone_based_vega_gene	protein_coding	OTTHUMT00000086278.1		0.00	18	0	G	NM_199051		190449679	+1			no_errors	ENST00000424735	ensembl	human	known	74_37	rna	12.00	22	3	SNP	0.000	A
FRG2DP	146481	genome.wustl.edu	37	16	34713056	34713056	+	RNA	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:34713056G>C	ENST00000569028.2	-	0	298																											ATGTGAGCTCGACTCTGGTTC	0.448																																																	0																																												0																															16.37:g.34713056G>C				RNA	SNP	-	NULL	ENST00000569028.2	37	NULL		16																																																																																			RP11-80F22.9	-	-	ENSG00000261711		0.448	RP11-80F22.9-002	KNOWN	basic	processed_transcript	ENSG00000261711	Clone_based_vega_gene	pseudogene	OTTHUMT00000431372.2	-	0.00	17	0	G			34713056	-1	tier1	-	no_errors	ENST00000564452	ensembl	human	known	74_37	rna	20.00	16	4	SNP	0.001	C
LOC440311	440311	genome.wustl.edu	37	15	95398993	95398993	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:95398993A>G	ENST00000602330.1	-	0	296																											CCAAGGAAAAAGGGCTAAGAA	0.542																																																	0																																												0																															15.37:g.95398993A>G				RNA	SNP	-	NULL	ENST00000602330.1	37	NULL		15																																																																																			CTD-2576F9.2	-	-	ENSG00000270017		0.542	CTD-2576F9.2-001	KNOWN	basic	lincRNA	ENSG00000270017	Clone_based_vega_gene	lincRNA	OTTHUMT00000467393.1	-	0.00	68	0	A			95398993	-1	tier1	-	no_errors	ENST00000602330	ensembl	human	known	74_37	rna	5.05	94	5	SNP	0.012	G
RP11-107C16.2	0	genome.wustl.edu	37	10	124580468	124580468	+	RNA	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:124580468C>T	ENST00000442370.1	+	0	327																											TCTTCCAAGCCGTCATTGACC	0.542																																																	0																																												0																															10.37:g.124580468C>T				RNA	SNP	-	NULL	ENST00000442370.1	37	NULL		10																																																																																			RP11-107C16.2	-	-	ENSG00000272135		0.542	RP11-107C16.2-004	KNOWN	basic	processed_transcript	ENSG00000272135	Clone_based_vega_gene	pseudogene	OTTHUMT00000331646.1	-	0.00	51	0	C			124580468	+1	tier1	-	no_errors	ENST00000442370	ensembl	human	known	74_37	rna	10.00	54	6	SNP	0.097	T
ERBB3	2065	genome.wustl.edu	37	12	56495395	56495395	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:56495395G>T	ENST00000267101.3	+	28	4025	c.3585G>T	c.(3583-3585)gaG>gaT	p.E1195D	PA2G4_ENST00000303305.6_5'Flank|ERBB3_ENST00000549832.1_Missense_Mutation_p.E315D|RP11-603J24.9_ENST00000548861.1_Intron|ERBB3_ENST00000450146.2_Missense_Mutation_p.E552D|ERBB3_ENST00000553131.1_Missense_Mutation_p.E436D|ERBB3_ENST00000415288.2_Missense_Mutation_p.E1136D|PA2G4_ENST00000552766.1_5'Flank	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1195					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ATGAAGATGAGGAGTATGAAT	0.527																																																	0													93.0	88.0	90.0					12																	56495395		2203	4300	6503	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3585G>T	12.37:g.56495395G>T	ENSP00000267101:p.Glu1195Asp		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E1195D	ENST00000267101.3	37	c.3585	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	12.14	1.848121	0.32699	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.80824	-1.23;-1.2;-1.22;-1.42;-1.19	5.5	1.63	0.23807	.	0.081077	0.51477	D	0.000100	T	0.66906	0.2837	L	0.32530	0.975	0.50039	D	0.999845	B;B;B	0.13145	0.005;0.007;0.001	B;B;B	0.16722	0.011;0.016;0.003	T	0.55927	-0.8063	10	0.54805	T	0.06	.	5.0761	0.14632	0.3807:0.1405:0.4787:0.0	.	1136;315;1195	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	D	1195;552;1136;318;436;315	ENSP00000267101:E1195D;ENSP00000399178:E552D;ENSP00000408340:E1136D;ENSP00000449129:E436D;ENSP00000448729:E315D	ENSP00000267101:E1195D	E	+	3	2	ERBB3	54781662	0.939000	0.31865	0.998000	0.56505	0.999000	0.98932	-0.022000	0.12480	0.030000	0.15379	0.561000	0.74099	GAG	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000065361		0.527	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3		0.00	156	0	G			56495395	+1			no_errors	ENST00000267101	ensembl	human	known	74_37	missense	5.81	81	5	SNP	1.000	T
EVL	51466	genome.wustl.edu	37	14	100604120	100604120	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:100604120C>T	ENST00000402714.2	+	11	1673	c.1069C>T	c.(1069-1071)Cag>Tag	p.Q357*	EVL_ENST00000392920.3_Nonsense_Mutation_p.Q359*|EVL_ENST00000544450.2_Nonsense_Mutation_p.Q363*			Q9UI08	EVL_HUMAN	Enah/Vasp-like	357	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)	p.Q359E(1)		cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				GAGCCCCCTTCAGTCGCAGCC	0.612																																																	1	Substitution - Missense(1)	cervix(1)											109.0	107.0	108.0					14																	100604120		2203	4300	6503	SO:0001587	stop_gained	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.1069C>T	14.37:g.100604120C>T	ENSP00000384720:p.Gln357*		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Nonsense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.Q359*	ENST00000402714.2	37	c.1075		14	.	.	.	.	.	.	.	.	.	.	C	39	7.468555	0.98302	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470	.	.	.	4.73	4.73	0.59995	.	0.690656	0.13220	N	0.404439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-13.282	17.6886	0.88263	0.0:1.0:0.0:0.0	.	.	.	.	X	357;363;359;322	.	ENSP00000376652:Q359X	Q	+	1	0	EVL	99673873	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.182000	0.65059	2.163000	0.67991	0.561000	0.74099	CAG	EVL	-	pirsf_Vasodilator_phosphoprotein	ENSG00000196405		0.612	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	-	0.00	74	0	C			100604120	+1	tier1	-	no_errors	ENST00000392920	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	T
FAM102A	399665	genome.wustl.edu	37	9	130710474	130710474	+	Silent	SNP	G	G	T	rs201396281		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:130710474G>T	ENST00000373095.1	-	6	867	c.492C>A	c.(490-492)atC>atA	p.I164I	FAM102A_ENST00000373084.4_Silent_p.I22I|FAM102A_ENST00000300434.3_Intron	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	164	Ser-rich.									breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						CCTGGCCTGGGATGGAGATGG	0.617																																																	0													93.0	82.0	85.0					9																	130710474		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.492C>A	9.37:g.130710474G>T			A2A329|Q8TEL4	Silent	SNP	pfam_NT-C2	p.I164	ENST00000373095.1	37	c.492	CCDS35150.1	9																																																																																			FAM102A	-	NULL	ENSG00000167106		0.617	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102A	HGNC	protein_coding	OTTHUMT00000054298.2		0.00	92	0	G			130710474	-1			no_errors	ENST00000373095	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	T
FAM107B	83641	genome.wustl.edu	37	10	14563922	14563922	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:14563922C>G	ENST00000378470.1	-	3	511	c.225G>C	c.(223-225)aaG>aaC	p.K75N	FAM107B_ENST00000378462.1_Missense_Mutation_p.K75N|FAM107B_ENST00000378467.4_Missense_Mutation_p.K75N|FAM107B_ENST00000479731.1_Missense_Mutation_p.K75N|FAM107B_ENST00000378458.2_Missense_Mutation_p.K75N|FAM107B_ENST00000478076.1_Missense_Mutation_p.K75N|FAM107B_ENST00000378465.3_Missense_Mutation_p.K75N|FAM107B_ENST00000181796.2_Missense_Mutation_p.K250N|FAM107B_ENST00000496330.1_Missense_Mutation_p.K75N|FAM107B_ENST00000468747.1_Missense_Mutation_p.K75N	NM_001282695.1|NM_001282696.1|NM_001282697.1|NM_001282698.1|NM_001282700.1|NM_001282701.1|NM_001282702.1|NM_001282703.1	NP_001269624.1|NP_001269625.1|NP_001269626.1|NP_001269627.1|NP_001269629.1|NP_001269630.1|NP_001269631.1|NP_001269632.1	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	75					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CAGATTTCTTCTTCTGTGCTT	0.423																																																	0													233.0	216.0	222.0					10																	14563922		2203	4300	6503	SO:0001583	missense	0			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000378470.1:c.225G>C	10.37:g.14563922C>G	ENSP00000367731:p.Lys75Asn		A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Missense_Mutation	SNP	pfam_DUF1151	p.K250N	ENST00000378470.1	37	c.750		10	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113978	0.56398	.	.	ENSG00000065809	ENST00000378470;ENST00000181796;ENST00000468747;ENST00000378467;ENST00000378465;ENST00000378458;ENST00000478076;ENST00000378462;ENST00000378461;ENST00000496330;ENST00000479731;ENST00000468492;ENST00000452706;ENST00000489100;ENST00000494865;ENST00000475786;ENST00000488576;ENST00000442012;ENST00000482277	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93	5.97	4.89	0.63831	.	0.043178	0.85682	D	0.000000	T	0.57681	0.2070	L	0.50333	1.59	0.51767	D	0.999933	D;P	0.89917	1.0;0.77	D;B	0.71870	0.975;0.327	T	0.57447	-0.7810	10	0.62326	D	0.03	-14.8998	15.1739	0.72896	0.0:0.9214:0.0:0.0786	.	250;75	Q9H098-2;Q9H098	.;F107B_HUMAN	N	75;250;75;75;75;75;75;75;75;75;75;75;75;75;75;75;75;75;75	ENSP00000367731:K75N;ENSP00000181796:K250N;ENSP00000418120:K75N;ENSP00000367728:K75N;ENSP00000367726:K75N;ENSP00000367719:K75N;ENSP00000417782:K75N;ENSP00000367723:K75N;ENSP00000418330:K75N;ENSP00000419603:K75N;ENSP00000420444:K75N;ENSP00000413676:K75N;ENSP00000420249:K75N;ENSP00000418395:K75N;ENSP00000417242:K75N;ENSP00000420314:K75N;ENSP00000397949:K75N;ENSP00000417845:K75N	ENSP00000181796:K250N	K	-	3	2	FAM107B	14603928	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.351000	0.52232	2.837000	0.97791	0.655000	0.94253	AAG	FAM107B	-	pfam_DUF1151	ENSG00000065809		0.423	FAM107B-002	KNOWN	basic|appris_principal	protein_coding	FAM107B	HGNC	protein_coding	OTTHUMT00000046899.1	-	0.00	134	0	C	NM_031453		14563922	-1	tier1	-	no_errors	ENST00000181796	ensembl	human	known	74_37	missense	8.06	114	10	SNP	1.000	G
FAM149B1	317662	genome.wustl.edu	37	10	74953335	74953335	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:74953335G>A	ENST00000242505.6	+	5	700	c.526G>A	c.(526-528)Gaa>Aaa	p.E176K	Y_RNA_ENST00000362331.1_RNA	NM_173348.1	NP_775483.1	Q96BN6	F149B_HUMAN	family with sequence similarity 149, member B1	176										breast(2)|endometrium(1)|kidney(1)|stomach(3)	7						CTTGTCTCAAGAAAGAGATTC	0.363																																																	0													145.0	109.0	120.0					10																	74953335		692	1591	2283	SO:0001583	missense	0			AB023191	CCDS44435.1	10q22.2	2008-10-27	2007-11-14	2007-11-14	ENSG00000138286	ENSG00000138286			29162	protein-coding gene	gene with protein product			"""KIAA0974"""	KIAA0974		10231032	Standard	NM_173348		Approved		uc009xqz.3	Q96BN6	OTTHUMG00000067794	ENST00000242505.6:c.526G>A	10.37:g.74953335G>A	ENSP00000242505:p.Glu176Lys		Q9Y2I0	Missense_Mutation	SNP	pfam_DUF3719	p.E176K	ENST00000242505.6	37	c.526	CCDS44435.1	10	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727035	0.69074	.	.	ENSG00000138286	ENST00000242505	T	0.48201	0.82	4.76	3.84	0.44239	.	0.457912	0.23316	N	0.049514	T	0.53722	0.1814	L	0.56769	1.78	0.80722	D	1	D;P;P	0.54207	0.965;0.885;0.86	P;P;P	0.55508	0.777;0.589;0.453	T	0.51076	-0.8751	10	0.37606	T	0.19	-8.6234	9.2639	0.37630	0.1038:0.0:0.8962:0.0	.	154;176;176	B4E0M2;Q96BN6;Q96BN6-2	.;F149B_HUMAN;.	K	176	ENSP00000242505:E176K	ENSP00000242505:E176K	E	+	1	0	FAM149B1	74623341	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.715000	0.47210	2.184000	0.69523	0.591000	0.81541	GAA	FAM149B1	-	pfam_DUF3719	ENSG00000138286		0.363	FAM149B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM149B1	HGNC	protein_coding	OTTHUMT00000145438.1	-	0.00	87	0	G	NM_173348		74953335	+1	tier1	-	no_errors	ENST00000242505	ensembl	human	known	74_37	missense	7.46	62	5	SNP	1.000	A
FAM86B2	653333	genome.wustl.edu	37	8	12283440	12283440	+	Silent	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:12283440A>G	ENST00000262365.4	-	8	950	c.951T>C	c.(949-951)taT>taC	p.Y317Y	FAM86B2_ENST00000351291.4_Silent_p.Y283Y|FAM86B2_ENST00000393715.3_3'UTR|AC087203.1_ENST00000580058.1_RNA|FAM86B2_ENST00000309608.5_3'UTR	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	317										endometrium(1)|kidney(2)	3						AGTGCTCTCCATAGGGAAACA	0.502																																																	0																																										SO:0001819	synonymous_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.951T>C	8.37:g.12283440A>G				Silent	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.Y317	ENST00000262365.4	37	c.951	CCDS59092.1	8																																																																																			FAM86B2	-	NULL	ENSG00000145002		0.502	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		-	0.00	13	0	A	XM_928336		12283440	-1	tier1	-	no_errors	ENST00000262365	ensembl	human	known	74_37	silent	33.33	6	3	SNP	0.108	G
FBN1	2200	genome.wustl.edu	37	15	48719785	48719785	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:48719785C>T	ENST00000316623.5	-	58	7638	c.7183G>A	c.(7183-7185)Gga>Aga	p.G2395R		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2395					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTCATGAATCCTCGGCCATGG	0.468																																																	0													77.0	76.0	76.0					15																	48719785		2198	4296	6494	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7183G>A	15.37:g.48719785C>T	ENSP00000325527:p.Gly2395Arg		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.G2395R	ENST00000316623.5	37	c.7183	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.267054	0.95399	.	.	ENSG00000166147	ENST00000316623	D	0.92397	-3.03	5.44	5.44	0.79542	Matrix fibril-associated (2);	0.103878	0.64402	D	0.000003	D	0.97056	0.9038	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97467	1.0038	10	0.72032	D	0.01	.	19.231	0.93841	0.0:1.0:0.0:0.0	.	2395	P35555	FBN1_HUMAN	R	2395	ENSP00000325527:G2395R	ENSP00000325527:G2395R	G	-	1	0	FBN1	46507077	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.720000	0.93068	0.650000	0.86243	GGA	FBN1	-	superfamily_TB_dom,pirsf_FBN	ENSG00000166147		0.468	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	-	0.00	68	0	C			48719785	-1	tier1	-	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
FBXO39	162517	genome.wustl.edu	37	17	6683203	6683203	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:6683203G>T	ENST00000321535.4	+	2	146	c.16G>T	c.(16-18)Gaa>Taa	p.E6*		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	6										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						CGAAGAAAGTGAACTGATCCA	0.532																																																	0													86.0	83.0	84.0					17																	6683203		2203	4300	6503	SO:0001587	stop_gained	0			BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.16G>T	17.37:g.6683203G>T	ENSP00000321386:p.Glu6*			Nonsense_Mutation	SNP	NULL	p.E6*	ENST00000321535.4	37	c.16	CCDS11082.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951383	0.73787	.	.	ENSG00000177294	ENST00000321535	.	.	.	5.29	3.27	0.37495	.	0.948982	0.08812	N	0.890071	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-2.0624	13.5911	0.61961	0.0:0.207:0.793:0.0	.	.	.	.	X	6	.	ENSP00000321386:E6X	E	+	1	0	FBXO39	6623927	0.053000	0.20554	0.001000	0.08648	0.675000	0.39556	1.624000	0.37018	0.712000	0.32039	0.561000	0.74099	GAA	FBXO39	-	NULL	ENSG00000177294		0.532	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO39	HGNC	protein_coding	OTTHUMT00000219866.2	-	0.00	79	0	G	NM_153230		6683203	+1	tier1	-	no_errors	ENST00000321535	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	0.002	T
FCHSD2	9873	genome.wustl.edu	37	11	72700022	72700022	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:72700022C>T	ENST00000409418.4	-	6	891	c.508G>A	c.(508-510)Gac>Aac	p.D170N	FCHSD2_ENST00000311172.7_Missense_Mutation_p.D114N|FCHSD2_ENST00000458644.2_Missense_Mutation_p.D10N|FCHSD2_ENST00000409853.1_Missense_Mutation_p.D114N|FCHSD2_ENST00000409314.1_Missense_Mutation_p.D170N	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	170										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			GCCTCGATGTCAGCTTTCTCT	0.338																																																	0													205.0	172.0	183.0					11																	72700022		2198	4291	6489	SO:0001583	missense	0			AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.508G>A	11.37:g.72700022C>T	ENSP00000386722:p.Asp170Asn		B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Missense_Mutation	SNP	pfam_SH3_domain,pfam_FCH_dom,pfam_SH3_2,superfamily_SH3_domain,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,prints_SH3_domain	p.D170N	ENST00000409418.4	37	c.508	CCDS8218.2	11	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931982	0.92389	.	.	ENSG00000137478	ENST00000311172;ENST00000409314;ENST00000409418;ENST00000458644;ENST00000409853	T;T;T;T;T	0.50277	2.36;2.44;2.41;2.09;0.75	5.5	5.5	0.81552	.	0.055354	0.64402	D	0.000001	T	0.63141	0.2486	M	0.64997	1.995	0.80722	D	1	D;D;D	0.71674	0.998;0.976;0.976	P;P;P	0.59825	0.864;0.631;0.677	T	0.59794	-0.7387	10	0.35671	T	0.21	-6.588	18.3847	0.90463	0.0:1.0:0.0:0.0	.	10;170;114	E7ENZ2;O94868;O94868-3	.;FCSD2_HUMAN;.	N	114;170;170;10;114	ENSP00000308978:D114N;ENSP00000386987:D170N;ENSP00000386722:D170N;ENSP00000402972:D10N;ENSP00000386314:D114N	ENSP00000308978:D114N	D	-	1	0	FCHSD2	72377670	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.463000	0.80869	2.589000	0.87451	0.462000	0.41574	GAC	FCHSD2	-	NULL	ENSG00000137478		0.338	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FCHSD2	HGNC	protein_coding	OTTHUMT00000329429.2	-	0.00	60	0	C	NM_014824		72700022	-1	tier1	-	no_errors	ENST00000409418	ensembl	human	known	74_37	missense	10.00	72	8	SNP	1.000	T
FCN2	2220	genome.wustl.edu	37	9	137774464	137774464	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:137774464G>T	ENST00000291744.6	+	2	203	c.193G>T	c.(193-195)Gca>Tca	p.A65S	FCN2_ENST00000350339.2_Intron	NM_004108.2	NP_004099.2	Q15485	FCN2_HUMAN	ficolin (collagen/fibrinogen domain containing lectin) 2	65	Collagen-like.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|opsonization (GO:0008228)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|urinary_tract(2)	20		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.58e-08)|Epithelial(140;6.41e-08)|all cancers(34;3.96e-07)		CAAGGGAGAGGCAGGCACCAA	0.612																																																	0													52.0	58.0	56.0					9																	137774464		2203	4300	6503	SO:0001583	missense	0			D49353	CCDS6983.1	9q34	2013-09-12	2013-09-12		ENSG00000160339	ENSG00000160339		"""Fibrinogen C domain containing"""	3624	protein-coding gene	gene with protein product	"""hucolin"", ""collagen/fibrinogen domain-containing protein 2"", ""ficolin B"", ""serum lectin p35"", ""L-ficolin"""	601624	"""ficolin (collagen/fibrinogen domain-containing lectin) 2 (hucolin)"""			8884275	Standard	XM_006717015		Approved	P35, FCNL, EBP-37, ficolin-2	uc004cfg.1	Q15485	OTTHUMG00000020892	ENST00000291744.6:c.193G>T	9.37:g.137774464G>T	ENSP00000291744:p.Ala65Ser		A6NFG7|A8K478|Q6IS69|Q7M4P4|Q9UC57	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.A65S	ENST00000291744.6	37	c.193	CCDS6983.1	9	.	.	.	.	.	.	.	.	.	.	G	11.64	1.700302	0.30142	.	.	ENSG00000160339	ENST00000291744	D	0.83163	-1.69	3.91	2.05	0.26809	.	0.402150	0.17754	U	0.163129	T	0.75671	0.3881	L	0.55834	1.745	0.80722	D	1	B	0.24258	0.1	B	0.28305	0.088	T	0.61028	-0.7145	10	0.15952	T	0.53	.	7.5837	0.27980	0.2178:0.0:0.7822:0.0	.	65	Q15485	FCN2_HUMAN	S	65	ENSP00000291744:A65S	ENSP00000291744:A65S	A	+	1	0	FCN2	136914285	0.000000	0.05858	0.606000	0.28943	0.606000	0.37113	-0.026000	0.12392	0.162000	0.19483	0.462000	0.41574	GCA	FCN2	-	pfam_Collagen	ENSG00000160339		0.612	FCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCN2	HGNC	protein_coding	OTTHUMT00000054960.1		0.00	54	0	G	NM_004108		137774464	+1			no_errors	ENST00000291744	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.949	T
FGD2	221472	genome.wustl.edu	37	6	36988338	36988338	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:36988338G>A	ENST00000274963.8	+	10	1315	c.1144G>A	c.(1144-1146)Gag>Aag	p.E382K		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	382	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						GATGGATGCTGAGTTTCCCCA	0.652																																																	0													37.0	34.0	35.0					6																	36988338		2203	4300	6503	SO:0001583	missense	0			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1144G>A	6.37:g.36988338G>A	ENSP00000274963:p.Glu382Lys		Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	pfam_DH-domain,pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.E382K	ENST00000274963.8	37	c.1144	CCDS4829.1	6	.	.	.	.	.	.	.	.	.	.	G	23.1	4.376358	0.82682	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	T	0.76186	-1.0	5.46	5.46	0.80206	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.42964	D	0.000638	T	0.75845	0.3905	L	0.41492	1.28	0.58432	D	0.999995	D	0.61697	0.99	P	0.61722	0.893	T	0.75314	-0.3361	10	0.44086	T	0.13	-20.2329	18.8995	0.92437	0.0:0.0:1.0:0.0	.	382	Q7Z6J4	FGD2_HUMAN	K	382;10	ENSP00000274963:E382K	ENSP00000274963:E382K	E	+	1	0	FGD2	37096316	1.000000	0.71417	0.953000	0.39169	0.157000	0.22087	4.446000	0.60014	2.569000	0.86673	0.585000	0.79938	GAG	FGD2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000146192		0.652	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD2	HGNC	protein_coding	OTTHUMT00000040398.2	-	0.00	113	0	G	NM_173558		36988338	+1	tier1	-	no_errors	ENST00000274963	ensembl	human	known	74_37	missense	7.00	93	7	SNP	1.000	A
FGF17	8822	genome.wustl.edu	37	8	21905658	21905658	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:21905658G>T	ENST00000359441.3	+	5	1052	c.549G>T	c.(547-549)ctG>ctT	p.L183L	FGF17_ENST00000518533.1_Silent_p.L172L|FGF17_ENST00000521709.1_3'UTR	NM_003867.2	NP_003858.1	O60258	FGF17_HUMAN	fibroblast growth factor 17	183					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	8				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		AAGGCCAGCTGCCCTTCCCCA	0.701																																																	0													27.0	28.0	28.0					8																	21905658		2203	4300	6503	SO:0001819	synonymous_variant	0			AB009249	CCDS6019.1	8p21.3	2005-10-30			ENSG00000158815	ENSG00000158815			3673	protein-coding gene	gene with protein product		603725				9514906, 9751161	Standard	XM_005273675		Approved	FGF-13	uc003xag.3	O60258	OTTHUMG00000097051	ENST00000359441.3:c.549G>T	8.37:g.21905658G>T			B7ZLG4|Q2M2W1	Silent	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.L183	ENST00000359441.3	37	c.549	CCDS6019.1	8																																																																																			FGF17	-	NULL	ENSG00000158815		0.701	FGF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF17	HGNC	protein_coding	OTTHUMT00000214154.2		0.00	25	0	G	NM_003867		21905658	+1			no_errors	ENST00000359441	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.999	T
FMO1	2326	genome.wustl.edu	37	1	171227264	171227264	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:171227264G>T	ENST00000354841.4	+	1	169	c.38G>T	c.(37-39)aGc>aTc	p.S13I	FMO1_ENST00000402921.2_Missense_Mutation_p.S13I|FMO1_ENST00000367750.3_Missense_Mutation_p.S13I|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	13					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GCTGGGGTCAGCGGCCTGGCC	0.567																																																	0													76.0	74.0	75.0					1																	171227264		2203	4300	6503	SO:0001583	missense	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.38G>T	1.37:g.171227264G>T	ENSP00000346901:p.Ser13Ile		A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.S13I	ENST00000354841.4	37	c.38	CCDS1294.1	1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281957	0.59867	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000402921;ENST00000354841	T;T;T;T	0.62105	0.05;0.05;0.05;0.05	5.56	3.64	0.41730	.	0.343476	0.35262	N	0.003336	T	0.81235	0.4780	H	0.97732	4.065	0.09310	N	1	P;D;D	0.89917	0.89;1.0;0.988	P;D;P	0.73380	0.771;0.98;0.879	T	0.79339	-0.1844	10	0.87932	D	0	-0.0789	15.0468	0.71833	0.0:0.2701:0.7299:0.0	.	13;13;13	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	I	13	ENSP00000356724:S13I;ENSP00000406982:S13I;ENSP00000385543:S13I;ENSP00000346901:S13I	ENSP00000346901:S13I	S	+	2	0	FMO1	169493888	0.982000	0.34865	0.636000	0.29352	0.719000	0.41307	3.756000	0.55205	0.663000	0.31027	0.655000	0.94253	AGC	FMO1	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000010932		0.567	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	-	0.00	80	0	G	NM_002021		171227264	+1	tier1	-	no_errors	ENST00000354841	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.138	T
FMN2	56776	genome.wustl.edu	37	1	240458161	240458161	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:240458161C>A	ENST00000319653.9	+	8	4423	c.4193C>A	c.(4192-4194)aCc>aAc	p.T1398N	FMN2_ENST00000545751.1_Intron	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1398	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GACCTGGAGACCCTTCAAGCT	0.363																																																	0													143.0	143.0	143.0					1																	240458161		2203	4300	6503	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4193C>A	1.37:g.240458161C>A	ENSP00000318884:p.Thr1398Asn		B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.T1398N	ENST00000319653.9	37	c.4193	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269814	0.80469	.	.	ENSG00000155816	ENST00000319653;ENST00000441342;ENST00000537355	T;T	0.18960	2.18;2.18	5.27	5.27	0.74061	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.64402	D	0.000006	T	0.41558	0.1164	L	0.46614	1.455	0.80722	D	1	B;D;P	0.89917	0.073;1.0;0.87	B;D;P	0.91635	0.075;0.999;0.8	T	0.12811	-1.0533	10	0.59425	D	0.04	.	17.4248	0.87524	0.0:1.0:0.0:0.0	.	44;27;1398	F5H2C1;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	N	1398;44;25	ENSP00000318884:T1398N;ENSP00000388922:T44N	ENSP00000318884:T1398N	T	+	2	0	FMN2	238524784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.372000	0.73123	2.640000	0.89533	0.650000	0.86243	ACC	FMN2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000155816		0.363	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	-	0.00	95	0	C	XM_371352		240458161	+1	tier1	-	no_errors	ENST00000319653	ensembl	human	known	74_37	missense	8.16	90	8	SNP	1.000	A
FOLH1	2346	genome.wustl.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame|FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																																	1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.R281H	ENST00000256999.2	37	c.842	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	FOLH1	-	NULL	ENSG00000086205		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	141	0	C	NM_004476		49204779	-1	tier1	rs116795343	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	5.80	130	8	SNP	0.843	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																																	0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	114	0	A	NM_004476		49204790	-1	tier1	rs76509850	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	7.81	118	10	SNP	1.000	G
FOXF2	2295	genome.wustl.edu	37	6	1390656	1390656	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:1390656C>T	ENST00000259806.1	+	1	588	c.474C>T	c.(472-474)ttC>ttT	p.F158F		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	158					embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		ACGAGTGCTTCATCAAGCTGC	0.647																																																	0													48.0	55.0	53.0					6																	1390656		2203	4300	6503	SO:0001819	synonymous_variant	0			U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.474C>T	6.37:g.1390656C>T			Q5TGJ1|Q9UQ85	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.F158	ENST00000259806.1	37	c.474	CCDS4472.1	6																																																																																			FOXF2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000137273		0.647	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXF2	HGNC	protein_coding	OTTHUMT00000043558.1	-	0.00	71	0	C			1390656	+1	tier1	-	no_errors	ENST00000259806	ensembl	human	known	74_37	silent	14.63	70	12	SNP	1.000	T
FOXR2	139628	genome.wustl.edu	37	X	55650499	55650499	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:55650499G>A	ENST00000339140.3	+	1	667	c.355G>A	c.(355-357)Ggg>Agg	p.G119R		NM_198451.3	NP_940853.1	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	119					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	19						AAAAGACGAAGGGTCTAACTG	0.527																																																	0													66.0	61.0	63.0					X																	55650499		2203	4300	6503	SO:0001583	missense	0			BC012934	CCDS35308.1	Xp11	2006-12-15			ENSG00000189299	ENSG00000189299		"""Forkhead boxes"""	30469	protein-coding gene	gene with protein product						15202009, 15202027	Standard	NM_198451		Approved	MGC21658, FOXN6	uc004duo.3	Q6PJQ5	OTTHUMG00000021661	ENST00000339140.3:c.355G>A	X.37:g.55650499G>A	ENSP00000427329:p.Gly119Arg			Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G119R	ENST00000339140.3	37	c.355	CCDS35308.1	X	.	.	.	.	.	.	.	.	.	.	G	2.720	-0.266775	0.05754	.	.	ENSG00000189299	ENST00000339140	D	0.93659	-3.26	3.42	1.55	0.23275	.	2.852280	0.01319	N	0.010879	D	0.84115	0.5401	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.74287	-0.3714	10	0.17832	T	0.49	.	3.799	0.08751	0.1482:0.2523:0.5995:0.0	.	119	Q6PJQ5	FOXR2_HUMAN	R	119	ENSP00000427329:G119R	ENSP00000427329:G119R	G	+	1	0	FOXR2	55667224	0.417000	0.25432	0.000000	0.03702	0.012000	0.07955	0.557000	0.23454	0.277000	0.22141	0.600000	0.82982	GGG	FOXR2	-	NULL	ENSG00000189299		0.527	FOXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXR2	HGNC	protein_coding	OTTHUMT00000056877.2	-	0.00	37	0	G	NM_198451		55650499	+1	tier1	-	no_errors	ENST00000339140	ensembl	human	known	74_37	missense	23.40	36	11	SNP	0.001	A
FREM2	341640	genome.wustl.edu	37	13	39424334	39424334	+	Missense_Mutation	SNP	G	G	T	rs140528316		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:39424334G>T	ENST00000280481.7	+	9	6755	c.6539G>T	c.(6538-6540)cGc>cTc	p.R2180L	FREM2_ENST00000482551.1_3'UTR	NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2180	Calx-beta 4.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TTTGAAGAACGCCCAAACACT	0.438																																																	0													95.0	86.0	89.0					13																	39424334		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6539G>T	13.37:g.39424334G>T	ENSP00000280481:p.Arg2180Leu		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.R2180L	ENST00000280481.7	37	c.6539	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	36	5.738328	0.96865	.	.	ENSG00000150893	ENST00000280481	T	0.25749	1.78	5.79	5.79	0.91817	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.65709	0.2717	H	0.94423	3.535	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.75187	-0.3406	10	0.87932	D	0	.	20.0373	0.97568	0.0:0.0:1.0:0.0	.	2180;2180	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	L	2180	ENSP00000280481:R2180L	ENSP00000280481:R2180L	R	+	2	0	FREM2	38322334	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	9.746000	0.98859	2.734000	0.93682	0.655000	0.94253	CGC	FREM2	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000150893		0.438	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	53	0	G	NM_207361		39424334	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
FRMPD3	84443	genome.wustl.edu	37	X	106841057	106841059	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:106841057_106841059delGAG	ENST00000276185.4	+	15	2047_2049	c.2047_2049delGAG	c.(2047-2049)gagdel	p.E689del				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	689	Poly-Glu.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						ACCTGGGAGTgaggaggaggagg	0.567																																																	0										335,2014		59,101,116,836,241						-0.1	1.0			9	594,3667		10,384,190,1224,835	no	coding	FRMPD3	XM_042978.7		69,485,306,2060,1076	A1A1,A1R,A1,RR,R		13.9404,14.2614,14.0545				929,5681				SO:0001651	inframe_deletion	0			AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.2047_2049delGAG	X.37:g.106841066_106841068delGAG	ENSP00000276185:p.Glu689del		Q96JK8	In_Frame_Del	DEL	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.E686in_frame_del	ENST00000276185.4	37	c.2047_2049		X																																																																																			FRMPD3	-	NULL	ENSG00000147234		0.567	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	HGNC	protein_coding			0.00	38	0	GAG	XM_042978		106841059	+1	tier1		no_errors	ENST00000276185	ensembl	human	known	74_37	in_frame_del	13.04	20	3	DEL	1.000:1.000:1.000	-
FYB	2533	genome.wustl.edu	37	5	39202037	39202037	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:39202037C>T	ENST00000351578.6	-	2	1216	c.1026G>A	c.(1024-1026)ccG>ccA	p.P342P	FYB_ENST00000505428.1_Silent_p.P342P|FYB_ENST00000540520.1_Silent_p.P352P|FYB_ENST00000512982.1_Silent_p.P342P|FYB_ENST00000515010.1_Silent_p.P342P	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	342					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			GCTTCTGTTTCGGGGTGGCTG	0.527																																																	0													141.0	143.0	142.0					5																	39202037		1925	4119	6044	SO:0001819	synonymous_variant	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1026G>A	5.37:g.39202037C>T			A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.P352	ENST00000351578.6	37	c.1056	CCDS47200.1	5																																																																																			FYB	-	NULL	ENSG00000082074		0.527	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	-	0.00	201	0	C	NM_001465		39202037	-1	tier1	-	no_errors	ENST00000540520	ensembl	human	known	74_37	silent	5.02	264	14	SNP	0.017	T
FZR1	51343	genome.wustl.edu	37	19	3525967	3525967	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:3525967G>A	ENST00000395095.3	+	2	171	c.171G>A	c.(169-171)tgG>tgA	p.W57*	FZR1_ENST00000313639.8_Nonsense_Mutation_p.W57*|FZR1_ENST00000441788.2_Nonsense_Mutation_p.W57*	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	57					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGCCAACTGGAGCGTGAACT	0.672																																																	0													37.0	37.0	37.0					19																	3525967		2201	4298	6499	SO:0001587	stop_gained	0			AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.171G>A	19.37:g.3525967G>A	ENSP00000378529:p.Trp57*		O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.W57*	ENST00000395095.3	37	c.171	CCDS45916.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.941390	0.97128	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	-25.3484	16.142	0.81534	0.0:0.0:1.0:0.0	.	.	.	.	X	57	.	ENSP00000321800:W57X	W	+	3	0	FZR1	3476967	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	9.525000	0.98039	2.130000	0.65690	0.561000	0.74099	TGG	FZR1	-	NULL	ENSG00000105325		0.672	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FZR1	HGNC	protein_coding	OTTHUMT00000452869.2	-	0.00	66	0	G	NM_016263		3525967	+1	tier1	-	no_errors	ENST00000395095	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	A
GALNT10	55568	genome.wustl.edu	37	5	153677529	153677529	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:153677529C>T	ENST00000297107.6	+	3	428	c.291C>T	c.(289-291)ccC>ccT	p.P97P	GALNT10_ENST00000425427.2_Silent_p.P97P|GALNT10_ENST00000377661.2_Silent_p.P97P	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	97					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			GACCTTACCCCATGACCGATG	0.433																																																	0													183.0	163.0	170.0					5																	153677529		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.291C>T	5.37:g.153677529C>T			B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.P97	ENST00000297107.6	37	c.291	CCDS4325.1	5																																																																																			GALNT10	-	NULL	ENSG00000164574		0.433	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT10	HGNC	protein_coding	OTTHUMT00000252453.1	-	0.00	65	0	C	NM_198321		153677529	+1	tier1	-	no_errors	ENST00000297107	ensembl	human	known	74_37	silent	15.07	62	11	SNP	0.996	T
GCM2	9247	genome.wustl.edu	37	6	10877413	10877413	+	Silent	SNP	C	C	T	rs387907432		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:10877413C>T	ENST00000379491.4	-	2	450	c.303G>A	c.(301-303)ctG>ctA	p.L101L	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	101					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				TGGCCGGCCTCAGCTGCAGGC	0.587																																																	0													75.0	72.0	73.0					6																	10877413		2202	4300	6502	SO:0001819	synonymous_variant	0			AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.303G>A	6.37:g.10877413C>T			D3GDV6|Q5THN5	Silent	SNP	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.L101	ENST00000379491.4	37	c.303	CCDS4517.1	6																																																																																			GCM2	-	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	ENSG00000124827		0.587	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	HGNC	protein_coding	OTTHUMT00000039844.1	-	0.00	38	0	C			10877413	-1	tier1	-	no_errors	ENST00000379491	ensembl	human	known	74_37	silent	11.54	46	6	SNP	0.997	T
MYZAP	100820829	genome.wustl.edu	37	15	57922037	57922037	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:57922037G>T	ENST00000267853.5	+	6	757	c.663G>T	c.(661-663)caG>caT	p.Q221H	GCOM1_ENST00000380569.2_Missense_Mutation_p.Q221H|GCOM1_ENST00000396180.1_Missense_Mutation_p.Q190H|GCOM1_ENST00000572390.1_Missense_Mutation_p.Q221H|GCOM1_ENST00000587652.1_Missense_Mutation_p.Q221H|GCOM1_ENST00000380560.2_Missense_Mutation_p.Q152H|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000380568.3_Missense_Mutation_p.Q221H|GCOM1_ENST00000380561.2_Missense_Mutation_p.Q190H|GCOM1_ENST00000574161.1_Missense_Mutation_p.Q221H|MYZAP_ENST00000380565.4_Missense_Mutation_p.Q221H			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	221					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											TTGAAAACCAGCTGCTAAAAA	0.413																																																	0													87.0	85.0	86.0					15																	57922037		2192	4292	6484	SO:0001583	missense	0			FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.663G>T	15.37:g.57922037G>T	ENSP00000267853:p.Gln221His		D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	NULL	p.Q221H	ENST00000267853.5	37	c.663	CCDS10162.1	15	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775338	0.70107	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44;1.44;1.44	5.43	4.51	0.55191	.	0.113770	0.64402	D	0.000009	T	0.46112	0.1376	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.51147	0.942;0.942;0.817;0.715	P;P;P;P	0.59595	0.785;0.86;0.785;0.785	T	0.41197	-0.9522	10	0.66056	D	0.02	-10.8445	13.5777	0.61883	0.078:0.0:0.922:0.0	.	221;221;221;221	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	H	221;190;190;152;221;221;221	ENSP00000369943:Q221H;ENSP00000369935:Q190H;ENSP00000379483:Q190H;ENSP00000369933:Q152H;ENSP00000267853:Q221H;ENSP00000369939:Q221H;ENSP00000369942:Q221H	ENSP00000267853:Q221H	Q	+	3	2	GCOM1	55709329	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.657000	0.54474	2.540000	0.85666	0.650000	0.86243	CAG	GCOM1	-	NULL	ENSG00000137878		0.413	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCOM1	HGNC	protein_coding	OTTHUMT00000255716.2		0.00	91	0	G	NM_001018100		57922037	+1			no_errors	ENST00000380569	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
GLG1	2734	genome.wustl.edu	37	16	74527017	74527017	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:74527017G>A	ENST00000422840.2	-	7	1071	c.1072C>T	c.(1072-1074)Cgc>Tgc	p.R358C	GLG1_ENST00000447066.2_Missense_Mutation_p.R347C|GLG1_ENST00000205061.5_Missense_Mutation_p.R358C	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	358					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						AGCTTTTGGCGGGTTGTAAGT	0.443																																																	0													135.0	122.0	126.0					16																	74527017		2198	4300	6498	SO:0001583	missense	0				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.1072C>T	16.37:g.74527017G>A	ENSP00000405984:p.Arg358Cys		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	pfam_Cys-rich_GLG1_repeat	p.R358C	ENST00000422840.2	37	c.1072	CCDS45527.1	16	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844204	0.71488	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.52	4.5	0.54988	.	0.000000	0.85682	D	0.000000	T	0.77425	0.4128	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.79334	-0.1846	9	0.72032	D	0.01	-3.7566	13.3514	0.60603	0.0:0.0:0.7256:0.2744	.	358;358;347	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	C	358;347;358	.	ENSP00000205061:R358C	R	-	1	0	GLG1	73084518	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.174000	0.50847	2.744000	0.94065	0.655000	0.94253	CGC	GLG1	-	pfam_Cys-rich_GLG1_repeat	ENSG00000090863		0.443	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	-	0.00	110	0	G	NM_012201		74527017	-1	tier1	-	no_errors	ENST00000205061	ensembl	human	known	74_37	missense	13.40	84	13	SNP	0.905	A
GLI3	2737	genome.wustl.edu	37	7	42085103	42085103	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:42085103C>T	ENST00000395925.3	-	6	790	c.706G>A	c.(706-708)Gaa>Aaa	p.E236K	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	236					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						TGATAGTATTCTGCTGGGCTG	0.547									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																																								0			GRCh37	CM990700	GLI3	M							60.0	64.0	62.0					7																	42085103		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.706G>A	7.37:g.42085103C>T	ENSP00000379258:p.Glu236Lys		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E236K	ENST00000395925.3	37	c.706	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530724	0.85706	.	.	ENSG00000106571	ENST00000395925	T	0.53423	0.62	5.49	5.49	0.81192	.	0.091026	0.85682	D	0.000000	T	0.57184	0.2036	M	0.66939	2.045	0.80722	D	1	P	0.45672	0.864	P	0.46543	0.52	T	0.60712	-0.7209	10	0.56958	D	0.05	.	19.3764	0.94512	0.0:1.0:0.0:0.0	.	236	P10071	GLI3_HUMAN	K	236	ENSP00000379258:E236K	ENSP00000379258:E236K	E	-	1	0	GLI3	42051628	1.000000	0.71417	0.926000	0.36857	0.881000	0.50899	7.478000	0.81082	2.582000	0.87167	0.591000	0.81541	GAA	GLI3	-	NULL	ENSG00000106571		0.547	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	-	0.00	74	0	C	NM_000168		42085103	-1	tier1	-	no_errors	ENST00000395925	ensembl	human	known	74_37	missense	15.15	84	15	SNP	1.000	T
GNG11	2791	genome.wustl.edu	37	7	93551468	93551468	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:93551468G>C	ENST00000248564.5	+	1	458	c.19G>C	c.(19-21)Gaa>Caa	p.E7Q		NM_004126.3	NP_004117.1	P61952	GBG11_HUMAN	guanine nucleotide binding protein (G protein), gamma 11	7					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|kidney(1)|lung(2)|skin(1)	6	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CCTTCACATCGAAGATTTGCC	0.537																																																	0													44.0	46.0	45.0					7																	93551468		2203	4300	6503	SO:0001583	missense	0				CCDS5634.1	7q31-q32	2008-07-18			ENSG00000127920	ENSG00000127920			4403	protein-coding gene	gene with protein product	"""G protein gamma-11 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(O) gamma-11 subunit"""	604390				7665596	Standard	NM_004126		Approved	GNGT11	uc003und.3	P61952	OTTHUMG00000023411	ENST00000248564.5:c.19G>C	7.37:g.93551468G>C	ENSP00000248564:p.Glu7Gln		P50152	Missense_Mutation	SNP	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom,prints_Gprotein-gamma	p.E7Q	ENST00000248564.5	37	c.19	CCDS5634.1	7	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537477	0.27475	.	.	ENSG00000127920	ENST00000248564	T	0.29397	1.57	4.48	4.48	0.54585	G-protein gamma domain (3);	0.126323	0.56097	D	0.000032	T	0.24661	0.0598	.	.	.	0.43179	D	0.994998	B	0.20459	0.045	B	0.30943	0.122	T	0.05801	-1.0863	9	0.22109	T	0.4	-39.3909	12.8421	0.57809	0.0:0.0:1.0:0.0	.	7	P61952	GBG11_HUMAN	Q	7	ENSP00000248564:E7Q	ENSP00000248564:E7Q	E	+	1	0	GNG11	93389404	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.407000	0.66363	2.490000	0.84030	0.491000	0.48974	GAA	GNG11	-	superfamily_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom	ENSG00000127920		0.537	GNG11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNG11	HGNC	protein_coding	OTTHUMT00000254719.3	-	0.00	134	0	G	NM_004126		93551468	+1	tier1	rs141442326	no_errors	ENST00000248564	ensembl	human	known	74_37	missense	8.49	97	9	SNP	1.000	C
GPBP1L1	60313	genome.wustl.edu	37	1	46121010	46121011	+	Intron	DEL	GA	GA	-			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:46121010_46121011delGA	ENST00000290795.3	-	4	1282				GPBP1L1_ENST00000355105.3_Intron			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ATGAAGTATGGAGAGGCAAATG	0.406																																																	0																																										SO:0001627	intron_variant	0				CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.61-19TC>-	1.37:g.46121012_46121013delGA			D3DQ10|Q9H751	RNA	DEL	-	NULL	ENST00000290795.3	37	NULL	CCDS528.1	1																																																																																			GPBP1L1	-	-	ENSG00000159592		0.406	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1		0.00	101	0	GA	NM_021639		46121011	-1	tier1		no_errors	ENST00000496278	ensembl	human	known	74_37	rna	13.95	74	12	DEL	0.000:0.013	-
GPR173	54328	genome.wustl.edu	37	X	53105819	53105819	+	Nonsense_Mutation	SNP	G	G	T	rs376160793		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:53105819G>T	ENST00000332582.4	+	2	507	c.16G>T	c.(16-18)Gga>Tga	p.G6*		NM_018969.5	NP_061842.1	Q9NS66	GP173_HUMAN	G protein-coupled receptor 173	6					negative regulation of neuron migration (GO:2001223)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|gonadotropin-releasing hormone receptor activity (GO:0004968)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)	16						CAACACTACCGGAGAGCCTGA	0.632																																																	0													56.0	41.0	46.0					X																	53105819		2203	4300	6503	SO:0001587	stop_gained	0			AB040801	CCDS14349.1	Xp11	2012-08-21	2006-02-15		ENSG00000184194	ENSG00000184194		"""GPCR / Class A : Orphans"""	18186	protein-coding gene	gene with protein product		300253	"""G-protein coupled receptor 173"", ""G protein coupled receptor 173"""			10833454	Standard	NM_018969		Approved	SREB3	uc004dru.3	Q9NS66	OTTHUMG00000021596	ENST00000332582.4:c.16G>T	X.37:g.53105819G>T	ENSP00000331600:p.Gly6*		B1B0A5	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G6*	ENST00000332582.4	37	c.16	CCDS14349.1	X	.	.	.	.	.	.	.	.	.	.	G	35	5.560552	0.96527	.	.	ENSG00000184194	ENST00000332582;ENST00000375466	.	.	.	4.12	4.12	0.48240	.	0.551409	0.16694	N	0.203422	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-2.031	10.7506	0.46207	0.0:0.0:1.0:0.0	.	.	.	.	X	6	.	ENSP00000331600:G6X	G	+	1	0	GPR173	53122544	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	3.311000	0.51919	1.901000	0.55032	0.529000	0.55759	GGA	GPR173	-	NULL	ENSG00000184194		0.632	GPR173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR173	HGNC	protein_coding	OTTHUMT00000056717.2	-	0.00	43	0	G	NM_018969		53105819	+1	tier1	-	no_errors	ENST00000332582	ensembl	human	known	74_37	nonsense	9.09	39	4	SNP	1.000	T
GRAMD4	23151	genome.wustl.edu	37	22	47069633	47069633	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr22:47069633G>A	ENST00000406902.1	+	15	1519	c.1306G>A	c.(1306-1308)Gcc>Acc	p.A436T	GRAMD4_ENST00000408031.1_5'Flank|GRAMD4_ENST00000361034.3_Missense_Mutation_p.A436T			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	436					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		AGAGGAGGACGCCGGTCGCTT	0.617																																																	0													93.0	101.0	98.0					22																	47069633		2203	4300	6503	SO:0001583	missense	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.1306G>A	22.37:g.47069633G>A	ENSP00000385689:p.Ala436Thr		A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.A436T	ENST00000406902.1	37	c.1306	CCDS33672.1	22	.	.	.	.	.	.	.	.	.	.	g	7.377	0.628034	0.14257	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.42131	0.98;0.98	4.97	-7.16	0.01516	.	0.677036	0.13785	N	0.362923	T	0.11024	0.0269	N	0.02916	-0.46	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.32587	-0.9901	10	0.05959	T	0.93	-4.6326	6.3502	0.21370	0.54:0.0:0.2398:0.2202	.	436	Q6IC98	GRAM4_HUMAN	T	436	ENSP00000385689:A436T;ENSP00000354313:A436T	ENSP00000354313:A436T	A	+	1	0	GRAMD4	45448297	0.000000	0.05858	0.000000	0.03702	0.840000	0.47671	-0.384000	0.07389	-1.205000	0.02645	0.313000	0.20887	GCC	GRAMD4	-	NULL	ENSG00000075240		0.617	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1	-	0.00	121	0	G	NM_015124		47069633	+1	tier1	-	no_errors	ENST00000361034	ensembl	human	known	74_37	missense	15.00	85	15	SNP	0.000	A
GRIK3	2899	genome.wustl.edu	37	1	37270660	37270660	+	Silent	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:37270660C>A	ENST00000373091.3	-	15	2509	c.2493G>T	c.(2491-2493)ggG>ggT	p.G831G	GRIK3_ENST00000373093.4_Silent_p.G831G	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	831					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AGAGGACCAGCCCGGCGGCCA	0.607																																																	0													58.0	66.0	63.0					1																	37270660		2203	4300	6503	SO:0001819	synonymous_variant	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2493G>T	1.37:g.37270660C>A			A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G831	ENST00000373091.3	37	c.2493	CCDS416.1	1																																																																																			GRIK3	-	pfam_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000163873		0.607	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1		0.00	55	0	C	NM_000831		37270660	-1			no_errors	ENST00000373091	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.995	A
GRPEL2	134266	genome.wustl.edu	37	5	148732528	148732528	+	3'UTR	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:148732528A>G	ENST00000329271.3	+	0	2471				GRPEL2_ENST00000507562.1_3'UTR|GRPEL2-AS1_ENST00000521295.1_RNA	NM_152407.3	NP_689620.2	Q8TAA5	GRPE2_HUMAN	GrpE-like 2, mitochondrial (E. coli)						cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)	adenyl-nucleotide exchange factor activity (GO:0000774)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTCTAGATTATATAGGTTTA	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL832325	CCDS4295.1	5q33.1	2008-02-05			ENSG00000164284	ENSG00000164284			21060	protein-coding gene	gene with protein product							Standard	NM_152407		Approved	DKFZp451C205, Mt-GrpE#2, FLJ23713	uc003lqj.3	Q8TAA5	OTTHUMG00000130048	ENST00000329271.3:c.*1683A>G	5.37:g.148732528A>G			B4DFA6|Q49AJ6	RNA	SNP	-	NULL	ENST00000329271.3	37	NULL	CCDS4295.1	5																																																																																			GRPEL2	-	-	ENSG00000164284		0.328	GRPEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRPEL2	HGNC	protein_coding	OTTHUMT00000252327.1	-	0.00	40	0	A	NM_152407		148732528	+1	tier1	-	no_errors	ENST00000507562	ensembl	human	known	74_37	rna	19.51	33	8	SNP	0.001	G
GSE1	23199	genome.wustl.edu	37	16	85682289	85682290	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:85682289_85682290insC	ENST00000253458.7	+	3	534_535	c.358_359insC	c.(358-360)accfs	p.T120fs	GSE1_ENST00000393243.1_Frame_Shift_Ins_p.T47fs|GSE1_ENST00000405402.2_Frame_Shift_Ins_p.T16fs	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	120								p.V123fs*2(1)									CGTGCCCAGCACCCCCCCCGTG	0.688																																																	1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.366dupC	16.37:g.85682297_85682297dupC	ENSP00000253458:p.Thr120fs		D3DUM4|Q8IY61|Q96GA4|Q9BW09	Frame_Shift_Ins	INS	pfam_GSE-like	p.V123fs	ENST00000253458.7	37	c.358_359	CCDS10952.1	16																																																																																			GSE1	-	pfam_GSE-like	ENSG00000131149		0.688	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSE1	HGNC	protein_coding	OTTHUMT00000325527.1		0.00	251	0	-	NM_014615		85682290	+1	tier1		no_errors	ENST00000253458	ensembl	human	known	74_37	frame_shift_ins	6.89	284	21	INS	1.000:0.999	C
H6PD	9563	genome.wustl.edu	37	1	9324422	9324422	+	Missense_Mutation	SNP	G	G	T	rs371828494		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:9324422G>T	ENST00000377403.2	+	5	2172	c.1870G>T	c.(1870-1872)Gtc>Ttc	p.V624F	H6PD_ENST00000602477.1_Missense_Mutation_p.V635F	NM_001282587.1|NM_004285.3	NP_001269516.1|NP_004276.2	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)	624	6-phosphogluconolactonase.				pentose-phosphate shunt (GO:0006098)|response to alcohol (GO:0097305)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	6-phosphogluconolactonase activity (GO:0017057)|carbohydrate binding (GO:0030246)|glucose 1-dehydrogenase [NAD(P)] activity (GO:0047936)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)		CGAGCGCTGCGTCCCACTCTC	0.677																																																	0													22.0	23.0	23.0					1																	9324422		2201	4296	6497	SO:0001583	missense	0			AJ012590	CCDS101.1, CCDS72697.1	1p36	2008-02-05	2003-10-10		ENSG00000049239	ENSG00000049239	1.1.1.47		4795	protein-coding gene	gene with protein product		138090	"""glucose dehyrogenase"""	GDH		10349511	Standard	NM_001282587		Approved		uc001apt.3	O95479	OTTHUMG00000001768	ENST00000377403.2:c.1870G>T	1.37:g.9324422G>T	ENSP00000366620:p.Val624Phe		Q4TT33|Q66I35|Q68DT3	Missense_Mutation	SNP	pfam_G6P_DH_C,pfam_G6P_DH_NAD-bd,prints_G6P_DH,tigrfam_6-phosphogluconolactonase_DevB	p.V624F	ENST00000377403.2	37	c.1870	CCDS101.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138220	0.77775	.	.	ENSG00000049239	ENST00000377403	T	0.63580	-0.05	5.16	5.16	0.70880	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.000000	0.85682	D	0.000000	D	0.88070	0.6338	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93061	0.6474	10	0.87932	D	0	-51.2425	17.6561	0.88178	0.0:0.0:1.0:0.0	.	624	O95479	G6PE_HUMAN	F	624	ENSP00000366620:V624F	ENSP00000366620:V624F	V	+	1	0	H6PD	9247009	1.000000	0.71417	0.998000	0.56505	0.764000	0.43329	7.440000	0.80464	2.420000	0.82092	0.561000	0.74099	GTC	H6PD	-	tigrfam_6-phosphogluconolactonase_DevB	ENSG00000049239		0.677	H6PD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H6PD	HGNC	protein_coding	OTTHUMT00000004928.2		0.00	23	0	G	NM_004285		9324422	+1			no_errors	ENST00000377403	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
HAUS5	23354	genome.wustl.edu	37	19	36106012	36106012	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:36106012G>A	ENST00000203166.5	+	5	313	c.288G>A	c.(286-288)caG>caA	p.Q96Q	HAUS5_ENST00000379045.2_Silent_p.Q96Q|AC002115.9_ENST00000589603.1_lincRNA	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	96					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						AACTCGACCAGAGCCTGGAGC	0.607																																																	0													22.0	28.0	26.0					19																	36106012		2042	4187	6229	SO:0001819	synonymous_variant	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.288G>A	19.37:g.36106012G>A			B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	NULL	p.Q96	ENST00000203166.5	37	c.288	CCDS42550.1	19																																																																																			HAUS5	-	NULL	ENSG00000249115		0.607	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	-	0.00	54	0	G			36106012	+1	tier1	-	no_errors	ENST00000203166	ensembl	human	known	74_37	silent	12.28	50	7	SNP	1.000	A
HCFC1	3054	genome.wustl.edu	37	X	153221703	153221703	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:153221703G>A	ENST00000310441.7	-	16	3761	c.2795C>T	c.(2794-2796)tCg>tTg	p.S932L	HCFC1_ENST00000354233.3_Missense_Mutation_p.S863L|HCFC1_ENST00000369984.4_Missense_Mutation_p.S932L	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	932					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGTGCGGCCGACACAGTGAT	0.657																																																	0													104.0	112.0	109.0					X																	153221703		2203	4300	6503	SO:0001583	missense	0				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2795C>T	X.37:g.153221703G>A	ENSP00000309555:p.Ser932Leu		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.S932L	ENST00000310441.7	37	c.2795	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934655	0.92458	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.04156	3.86;3.87;3.69	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.11067	0.0270	L	0.43152	1.355	0.49213	D	0.999768	D	0.69078	0.997	P	0.53006	0.715	T	0.01834	-1.1264	10	0.54805	T	0.06	.	16.6977	0.85340	0.0:0.0:1.0:0.0	.	932	P51610	HCFC1_HUMAN	L	932;932;863	ENSP00000309555:S932L;ENSP00000359001:S932L;ENSP00000346174:S863L	ENSP00000309555:S932L	S	-	2	0	HCFC1	152874897	1.000000	0.71417	0.402000	0.26371	0.691000	0.40173	8.916000	0.92745	2.201000	0.70794	0.529000	0.55759	TCG	HCFC1	-	NULL	ENSG00000172534		0.657	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	-	0.00	73	0	G	NM_005334		153221703	-1	tier1	-	no_errors	ENST00000310441	ensembl	human	known	74_37	missense	21.84	68	19	SNP	1.000	A
HELZ2	85441	genome.wustl.edu	37	20	62194139	62194139	+	Silent	SNP	G	G	A	rs140899217		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:62194139G>A	ENST00000467148.1	-	8	6105	c.6036C>T	c.(6034-6036)ctC>ctT	p.L2012L	HELZ2_ENST00000427522.2_Silent_p.L1443L	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2012					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCAGCCCCTCGAGCCGGATGC	0.701													G|||	1	0.000199681	0.0	0.0	5008	,	,		12788	0.0		0.0	False		,,,				2504	0.001																0								G	,	1,4327		0,1,2163	11.0	14.0	13.0		6036,4329	-8.6	0.7	20	dbSNP_134	13	0,8476		0,0,4238	no	coding-synonymous,coding-synonymous	PRIC285	NM_001037335.2,NM_033405.3	,	0,1,6401	AA,AG,GG		0.0,0.0231,0.0078	,	2012/2650,1443/2081	62194139	1,12803	2164	4238	6402	SO:0001819	synonymous_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6036C>T	20.37:g.62194139G>A			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	superfamily_P-loop_NTPase	p.L2012	ENST00000467148.1	37	c.6036	CCDS33508.1	20																																																																																			HELZ2	-	NULL	ENSG00000130589		0.701	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1		0.00	52	0	G	NM_001037335		62194139	-1			no_errors	ENST00000467148	ensembl	human	known	74_37	silent	6.17	76	5	SNP	0.326	A
HERC2	8924	genome.wustl.edu	37	15	28419589	28419589	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:28419589G>A	ENST00000261609.7	-	65	10117	c.10009C>T	c.(10009-10011)Ccc>Tcc	p.P3337S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAGAGGACGGGCTCGTGGACA	0.522																																																	0													34.0	29.0	31.0					15																	28419589		2203	4297	6500	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10009C>T	15.37:g.28419589G>A	ENSP00000261609:p.Pro3337Ser			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.P3337S	ENST00000261609.7	37	c.10009	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546106	0.65198	.	.	ENSG00000128731	ENST00000261609	T	0.51325	0.71	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.68274	0.2983	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.72704	-0.4213	10	0.72032	D	0.01	.	14.4954	0.67683	0.0704:0.0:0.9296:0.0	.	3337	O95714	HERC2_HUMAN	S	3337	ENSP00000261609:P3337S	ENSP00000261609:P3337S	P	-	1	0	HERC2	26093184	1.000000	0.71417	0.925000	0.36789	0.187000	0.23431	7.994000	0.88315	1.424000	0.47217	0.591000	0.81541	CCC	HERC2	-	NULL	ENSG00000128731		0.522	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	103	0	G	NM_004667		28419589	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	27.94	98	38	SNP	1.000	A
HGS	9146	genome.wustl.edu	37	17	79667621	79667621	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:79667621G>T	ENST00000329138.4	+	19	2142	c.2007G>T	c.(2005-2007)gcG>gcT	p.A669A	MRPL12_ENST00000333676.3_5'Flank|SLC25A10_ENST00000541223.1_5'Flank|SLC25A10_ENST00000571730.1_5'Flank|RP13-1032I1.7_ENST00000575312.1_RNA	NM_004712.4	NP_004703.1	O14964	HGS_HUMAN	hepatocyte growth factor-regulated tyrosine kinase substrate	669	Gln-rich.|Interaction with NF2.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|epidermal growth factor receptor signaling pathway (GO:0007173)|membrane invagination (GO:0010324)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of gene expression (GO:0010628)|protein localization to membrane (GO:0072657)|protein targeting to lysosome (GO:0006622)|regulation of protein catabolic process (GO:0042176)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|secretory granule (GO:0030141)	metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)	p.A669A(1)		endometrium(2)|kidney(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	12	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)			CTCCCACAGCGGGCTACCAGG	0.711																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											23.0	28.0	26.0					17																	79667621		2203	4296	6499	SO:0001819	synonymous_variant	0			D84064	CCDS11784.1	17q25	2009-04-29				ENSG00000185359		"""Zinc fingers, FYVE domain containing"""	4897	protein-coding gene	gene with protein product		604375				9407053, 9630564	Standard	NM_004712		Approved	Hrs, ZFYVE8, Vps27	uc002kbg.3	O14964		ENST00000329138.4:c.2007G>T	17.37:g.79667621G>T			Q9NR36	Silent	SNP	pfam_VHS,pfam_HRS_helical,pfam_Znf_FYVE,superfamily_ENTH_VHS,superfamily_Znf_FYVE_PHD,smart_VHS_subgr,smart_Znf_FYVE,pirsf_Ubi-bd_Hrs_VPS27,pfscan_Ubiquitin-int_motif,pfscan_VHS,pfscan_Znf_FYVE-rel	p.A669	ENST00000329138.4	37	c.2007	CCDS11784.1	17																																																																																			HGS	-	pirsf_Ubi-bd_Hrs_VPS27	ENSG00000185359		0.711	HGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGS	HGNC	protein_coding	OTTHUMT00000440541.1		0.00	44	0	G	NM_004712		79667621	+1			no_errors	ENST00000329138	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.866	T
HILPDA	29923	genome.wustl.edu	37	7	128098193	128098193	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:128098193G>T	ENST00000257696.4	+	0	1072				RP11-212P7.3_ENST00000462662.1_RNA|HILPDA_ENST00000481454.1_3'UTR|RP11-155G14.6_ENST00000493710.1_RNA	NM_001098786.1|NM_013332.3	NP_001092256.1|NP_037464.1	Q9Y5L2	HLPDA_HUMAN	hypoxia inducible lipid droplet-associated						autocrine signaling (GO:0035425)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of lipid storage (GO:0010884)|response to stress (GO:0006950)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|secretory granule (GO:0030141)	receptor binding (GO:0005102)										AGTCTTGAATGTCTTATGCTC	0.453																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF144755	CCDS5802.1	7q32.1	2011-11-02	2011-11-02	2011-11-02	ENSG00000135245	ENSG00000135245			28859	protein-coding gene	gene with protein product	"""hypoxia inducible gene 2"""		"""chromosome 7 open reading frame 68"""	C7orf68		10690527, 15930302	Standard	NM_001098786		Approved	FLJ21076, HIG-2, HIG2	uc010lli.3	Q9Y5L2	OTTHUMG00000157712	ENST00000257696.4:c.*679G>T	7.37:g.128098193G>T			A4D0Z5|Q52LY5|Q53HJ7	RNA	SNP	-	NULL	ENST00000257696.4	37	NULL	CCDS5802.1	7																																																																																			HILPDA	-	-	ENSG00000135245		0.453	HILPDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HILPDA	HGNC	protein_coding	OTTHUMT00000349450.1	-	0.00	42	0	G	NM_013332		128098193	+1	tier1	-	no_errors	ENST00000466473	ensembl	human	known	74_37	rna	11.25	71	9	SNP	0.002	T
HIPK2	28996	genome.wustl.edu	37	7	139416675	139416675	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:139416675C>G	ENST00000406875.3	-	2	253	c.159G>C	c.(157-159)caG>caC	p.Q53H	HIPK2_ENST00000342645.6_Missense_Mutation_p.Q53H|HIPK2_ENST00000428878.2_Missense_Mutation_p.Q53H	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	53					adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					TGTTCTTGCTCTGGCTATACA	0.537																																																	0													92.0	95.0	94.0					7																	139416675		1568	3582	5150	SO:0001583	missense	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.159G>C	7.37:g.139416675C>G	ENSP00000385571:p.Gln53His		Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q53H	ENST00000406875.3	37	c.159		7	.	.	.	.	.	.	.	.	.	.	C	7.064	0.566989	0.13560	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.51071	0.72;0.74;0.74	5.51	4.63	0.57726	.	.	.	.	.	T	0.30417	0.0764	.	.	.	0.41251	D	0.986711	B;B	0.06786	0.001;0.001	B;B	0.08055	0.002;0.003	T	0.13335	-1.0513	8	0.06891	T	0.86	.	16.3893	0.83528	0.0:0.8681:0.1318:0.0	.	53;53	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	H	53	ENSP00000385571:Q53H;ENSP00000413724:Q53H;ENSP00000343108:Q53H	ENSP00000343108:Q53H	Q	-	3	2	HIPK2	139063161	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.227000	0.51262	1.308000	0.44962	0.655000	0.94253	CAG	HIPK2	-	NULL	ENSG00000064393		0.537	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	-	0.00	124	0	C	NM_022740		139416675	-1	tier1	-	no_errors	ENST00000406875	ensembl	human	known	74_37	missense	6.67	84	6	SNP	1.000	G
HLTF	6596	genome.wustl.edu	37	3	148759441	148759441	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:148759441C>G	ENST00000310053.5	-	20	2405	c.2212G>C	c.(2212-2214)Gaa>Caa	p.E738Q	HLTF_ENST00000465259.1_Missense_Mutation_p.E737Q|HLTF_ENST00000392912.2_Missense_Mutation_p.E738Q|HLTF_ENST00000494055.1_Missense_Mutation_p.E738Q	NM_003071.3|NM_139048.2	NP_003062.2|NP_620636.1	Q14527	HLTF_HUMAN	helicase-like transcription factor	738					chromatin modification (GO:0016568)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CTCAGTTCTTCAGGTGTATCA	0.348																																																	0													109.0	104.0	106.0					3																	148759441		2203	4300	6503	SO:0001583	missense	0			L34673	CCDS33875.1	3q25.1-q26.1	2006-11-09	2006-11-09	2006-11-09	ENSG00000071794	ENSG00000071794		"""RING-type (C3HC4) zinc fingers"""	11099	protein-coding gene	gene with protein product		603257	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3"""	SNF2L3, SMARCA3		7558014	Standard	NM_139048		Approved	HIP116A, HLTF1, RNF80	uc003ewr.1	Q14527	OTTHUMG00000159534	ENST00000310053.5:c.2212G>C	3.37:g.148759441C>G	ENSP00000308944:p.Glu738Gln		D3DNH3|Q14536|Q16051|Q7KYJ6|Q86YA5|Q92652|Q96KM9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HIP116_Rad5p_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HIP116_Rad5p_N,smart_Helicase_ATP-bd,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E738Q	ENST00000310053.5	37	c.2212	CCDS33875.1	3	.	.	.	.	.	.	.	.	.	.	C	13.50	2.255438	0.39896	.	.	ENSG00000071794	ENST00000465259;ENST00000310053;ENST00000392912;ENST00000494055;ENST00000467858	T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04	6.03	6.03	0.97812	.	.	.	.	.	T	0.73289	0.3568	L	0.29908	0.895	0.35264	D	0.77984	D;D;B	0.56746	0.977;0.977;0.346	P;P;B	0.47603	0.551;0.551;0.056	T	0.72144	-0.4379	9	0.13853	T	0.58	-31.3019	20.1857	0.98214	0.0:1.0:0.0:0.0	.	738;738;738	Q59GQ7;A8K5B6;Q14527	.;.;HLTF_HUMAN	Q	737;738;738;738;206	ENSP00000420745:E737Q;ENSP00000308944:E738Q;ENSP00000376644:E738Q;ENSP00000420429:E738Q;ENSP00000420106:E206Q	ENSP00000308944:E738Q	E	-	1	0	HLTF	150242131	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.354000	0.52254	2.868000	0.98415	0.557000	0.71058	GAA	HLTF	-	superfamily_P-loop_NTPase	ENSG00000071794		0.348	HLTF-003	KNOWN	alternative_3_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HLTF	HGNC	protein_coding	OTTHUMT00000356064.1	-	0.00	70	0	C			148759441	-1	tier1	-	no_errors	ENST00000310053	ensembl	human	known	74_37	missense	18.57	57	13	SNP	1.000	G
HMCN2	256158	genome.wustl.edu	37	9	133274986	133274986	+	3'UTR	SNP	G	G	A	rs554164495		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:133274986G>A	ENST00000487727.2	+	0	2602				RN7SL665P_ENST00000578793.1_RNA|AL354898.1_ENST00000277491.7_5'UTR			Q8NDA2	HMCN2_HUMAN	hemicentin 2						response to stimulus (GO:0050896)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)										TGAGGTGGGCGAGGCCCACAG	0.687													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14780	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			AK074396		9q34.11	2013-01-29			ENSG00000148357	ENSG00000148357		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21293	protein-coding gene	gene with protein product							Standard	XM_006710218		Approved	DKFZp434P0216, FLJ23816		Q8NDA2	OTTHUMG00000140096	ENST00000487727.2:c.*2599G>A	9.37:g.133274986G>A			Q8N225|Q8TCI8	RNA	SNP	-	NULL	ENST00000487727.2	37	NULL		9																																																																																			HMCN2	-	-	ENSG00000148357		0.687	HMCN2-006	KNOWN	mRNA_start_NF|basic	processed_transcript	HMCN2	HGNC	protein_coding	OTTHUMT00000054659.3	-	0.00	100	0	G	XM_175125		133274986	+1	tier1	-	no_errors	ENST00000480829	ensembl	human	known	74_37	rna	12.99	67	10	SNP	0.953	A
HSH2D	84941	genome.wustl.edu	37	19	16268428	16268428	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:16268428G>A	ENST00000253680.6	+	9	1413	c.882G>A	c.(880-882)gaG>gaA	p.E294E	HSH2D_ENST00000397372.4_Silent_p.E204E|HSH2D_ENST00000593154.2_Missense_Mutation_p.E295K|HSH2D_ENST00000588246.1_Missense_Mutation_p.E295K			Q96JZ2	HSH2D_HUMAN	hematopoietic SH2 domain containing	294					negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of mitochondrial depolarization (GO:0051902)|positive regulation of signal transduction (GO:0009967)|T cell activation (GO:0042110)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|kidney(1)|large_intestine(2)	4						GGAAGGCCGAGAGGTCGGTCA	0.602																																																	0													44.0	48.0	47.0					19																	16268428		2017	4178	6195	SO:0001819	synonymous_variant	0			AK027792	CCDS74304.1	19p13.12	2013-02-14				ENSG00000196684		"""SH2 domain containing"""	24920	protein-coding gene	gene with protein product		608349				11700021	Standard	NM_032855		Approved	ALX, HSH2, FLJ14886	uc002ndp.4	Q96JZ2		ENST00000253680.6:c.882G>A	19.37:g.16268428G>A			B5ME72|Q6ZNG7	Missense_Mutation	SNP	pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	p.E295K	ENST00000253680.6	37	c.883		19																																																																																			HSH2D	-	NULL	ENSG00000196684		0.602	HSH2D-201	KNOWN	basic|appris_principal	protein_coding	HSH2D	HGNC	protein_coding		-	0.00	98	0	G	NM_032855		16268428	+1	tier1	-	no_errors	ENST00000588246	ensembl	human	putative	74_37	missense	7.02	53	4	SNP	0.000	A
HRC	3270	genome.wustl.edu	37	19	49657886	49657886	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:49657886C>T	ENST00000252825.4	-	1	795	c.609G>A	c.(607-609)gaG>gaA	p.E203E	HRC_ENST00000595625.1_Silent_p.E203E	NM_002152.2	NP_002143.1	P23327	SRCH_HUMAN	histidine rich calcium binding protein	203	4 X tandem repeats, acidic.|6 X approximate tandem repeats.|Glu-rich (acidic).				cytosolic calcium ion homeostasis (GO:0051480)|muscle contraction (GO:0006936)|positive regulation of heart contraction (GO:0045823)|positive regulation of heart rate (GO:0010460)|positive regulation of relaxation of cardiac muscle (GO:1901899)|regulation of calcium ion transmembrane transport (GO:1903169)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(10)|lung(10)|ovary(1)|prostate(3)|urinary_tract(2)	34		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		TGGAGGcctcctcttcctcct	0.572																																					Melanoma(37;75 1097 24567 25669 30645)												0													123.0	91.0	102.0					19																	49657886		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12759.1	19q13.3	2008-07-16	2001-11-28			ENSG00000130528			5178	protein-coding gene	gene with protein product		142705	"""histidine-rich calcium-binding protein"""			2037293	Standard	XR_243928		Approved	MGC133236	uc002pmv.3	P23327		ENST00000252825.4:c.609G>A	19.37:g.49657886C>T			Q504Y6	Silent	SNP	pfam_Hist_rich_Ca-bd	p.E203	ENST00000252825.4	37	c.609	CCDS12759.1	19																																																																																			HRC	-	NULL	ENSG00000130528		0.572	HRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRC	HGNC	protein_coding	OTTHUMT00000465649.1		0.00	24	0	C	NM_002152		49657886	-1			no_errors	ENST00000252825	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.000	T
HUNK	30811	genome.wustl.edu	37	21	33346945	33346945	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:33346945C>G	ENST00000270112.2	+	7	1449	c.1089C>G	c.(1087-1089)atC>atG	p.I363M	HUNK_ENST00000465574.1_3'UTR	NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	363					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						GCGACGTGATCAACACTGTGC	0.547																																																	0													117.0	101.0	107.0					21																	33346945		2203	4300	6503	SO:0001583	missense	0			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1089C>G	21.37:g.33346945C>G	ENSP00000270112:p.Ile363Met			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I363M	ENST00000270112.2	37	c.1089	CCDS13610.1	21	.	.	.	.	.	.	.	.	.	.	C	14.56	2.571217	0.45798	.	.	ENSG00000142149	ENST00000270112	T	0.70749	-0.51	4.51	4.51	0.55191	.	0.126578	0.52532	D	0.000061	T	0.61590	0.2359	L	0.29908	0.895	0.47698	D	0.999498	B	0.25441	0.126	B	0.27500	0.08	T	0.58515	-0.7623	10	0.32370	T	0.25	-15.9659	17.8055	0.88600	0.0:1.0:0.0:0.0	.	363	P57058	HUNK_HUMAN	M	363	ENSP00000270112:I363M	ENSP00000270112:I363M	I	+	3	3	HUNK	32268816	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.040000	0.57333	2.507000	0.84556	0.561000	0.74099	ATC	HUNK	-	NULL	ENSG00000142149		0.547	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1	-	0.00	28	0	C	NM_014586		33346945	+1	tier1	-	no_errors	ENST00000270112	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	G
IFT88	8100	genome.wustl.edu	37	13	21265264	21265264	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:21265264G>A	ENST00000319980.6	+	28	2779	c.2452G>A	c.(2452-2454)Gag>Aag	p.E818K	IFT88_ENST00000382778.4_3'UTR|IFT88_ENST00000351808.5_Missense_Mutation_p.E809K|IFT88_ENST00000537103.1_Missense_Mutation_p.E790K	NM_175605.3	NP_783195.2	Q13099	IFT88_HUMAN	intraflagellar transport 88	818					anterior/posterior pattern specification (GO:0009952)|cardiac muscle cell differentiation (GO:0055007)|cardiac septum morphogenesis (GO:0060411)|cilium morphogenesis (GO:0060271)|cochlea development (GO:0090102)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|embryonic digit morphogenesis (GO:0042733)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|epithelial cell morphogenesis (GO:0003382)|eye development (GO:0001654)|forebrain morphogenesis (GO:0048853)|heart formation (GO:0060914)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|liver development (GO:0001889)|lung vasculature development (GO:0060426)|negative regulation of epithelial cell proliferation (GO:0050680)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|protein localization (GO:0008104)|regulation of autophagic vacuole assembly (GO:2000785)|regulation of cilium assembly (GO:1902017)|regulation of fat cell differentiation (GO:0045598)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|regulation of protein processing (GO:0070613)|regulation of smoothened signaling pathway (GO:0008589)|response to fluid shear stress (GO:0034405)|smoothened signaling pathway (GO:0007224)|sperm axoneme assembly (GO:0007288)|spermatid nucleus elongation (GO:0007290)|spinal cord dorsal/ventral patterning (GO:0021513)|telencephalon development (GO:0021537)	acrosomal membrane (GO:0002080)|apical part of cell (GO:0045177)|axonemal basal plate (GO:0097541)|centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|kinocilium (GO:0060091)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	27		all_cancers(29;5.79e-25)|all_epithelial(30;2.57e-20)|all_lung(29;3.13e-16)|Lung SC(185;0.0262)|Ovarian(182;0.0825)|Hepatocellular(188;0.244)		all cancers(112;0.000667)|Epithelial(112;0.00119)|OV - Ovarian serous cystadenocarcinoma(117;0.0141)|Lung(94;0.0183)|LUSC - Lung squamous cell carcinoma(192;0.0528)		AAGGATCGATGAGGATGATTT	0.378																																																	0													85.0	89.0	88.0					13																	21265264		2203	4300	6503	SO:0001583	missense	0			AK058172	CCDS31944.1, CCDS31945.1	13q12.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000032742	ENSG00000032742		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	20606	protein-coding gene	gene with protein product	"""polaris homolog"""	600595	"""tetratricopeptide repeat domain 10"", ""intraflagellar transport 88 homolog (Chlamydomonas)"""	TTC10		7633404	Standard	XM_005266546		Approved	hTg737, Tg737, D13S1056E, MGC26259	uc001uni.3	Q13099	OTTHUMG00000016517	ENST00000319980.6:c.2452G>A	13.37:g.21265264G>A	ENSP00000323580:p.Glu818Lys		A2A491|B4DUS2|Q5SZJ6|Q8N719	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat,smart_Sel1-like,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E818K	ENST00000319980.6	37	c.2452	CCDS31944.1	13	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580150	0.86645	.	.	ENSG00000032742	ENST00000351808;ENST00000319980;ENST00000537103	T;T;T	0.75589	-0.95;-0.95;-0.95	5.56	5.56	0.83823	.	0.052419	0.85682	D	0.000000	D	0.83156	0.5193	M	0.61703	1.905	0.80722	D	1	P;D	0.67145	0.949;0.996	P;P	0.60415	0.465;0.874	T	0.82460	-0.0446	10	0.44086	T	0.13	-11.0097	19.1155	0.93336	0.0:0.0:1.0:0.0	.	790;818	F5H6C2;Q13099	.;IFT88_HUMAN	K	809;818;790	ENSP00000261632:E809K;ENSP00000323580:E818K;ENSP00000437719:E790K	ENSP00000323580:E818K	E	+	1	0	IFT88	20163264	1.000000	0.71417	0.950000	0.38849	0.525000	0.34531	8.949000	0.93012	2.598000	0.87819	0.655000	0.94253	GAG	IFT88	-	NULL	ENSG00000032742		0.378	IFT88-002	KNOWN	basic|CCDS	protein_coding	IFT88	HGNC	protein_coding	OTTHUMT00000044075.3	-	0.00	210	0	G	NM_006531		21265264	+1	tier1	-	no_errors	ENST00000319980	ensembl	human	known	74_37	missense	19.23	105	25	SNP	1.000	A
IKBKB	3551	genome.wustl.edu	37	8	42188469	42188469	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:42188469A>T	ENST00000520810.1	+	22	2429	c.2243A>T	c.(2242-2244)gAg>gTg	p.E748V	IKBKB_ENST00000379708.3_Missense_Mutation_p.E525V|IKBKB_ENST00000522147.1_Intron|IKBKB_ENST00000520835.1_Missense_Mutation_p.E746V|IKBKB_ENST00000416505.2_Missense_Mutation_p.E689V	NM_001556.2	NP_001547.1	O14920	IKKB_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta	748					B cell homeostasis (GO:0001782)|cellular response to tumor necrosis factor (GO:0071356)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cation channel activity (GO:2001259)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|serine phosphorylation of STAT protein (GO:0042501)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			breast(4)|lung(1)|ovary(2)|skin(1)	8	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Arsenic trioxide(DB01169)|Auranofin(DB00995)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	GAAGAAGAAGAGCACAGCTGC	0.547																																																	0													99.0	95.0	96.0					8																	42188469		2203	4300	6503	SO:0001583	missense	0			AF029684	CCDS6128.1, CCDS55228.1, CCDS56535.1	8p11.2	2008-08-18			ENSG00000104365	ENSG00000104365			5960	protein-coding gene	gene with protein product		603258				9878263, 9763654	Standard	NM_001556		Approved	IKK2, NFKBIKB, IKK-beta, IKKB	uc003xow.2	O14920	OTTHUMG00000164092	ENST00000520810.1:c.2243A>T	8.37:g.42188469A>T	ENSP00000430684:p.Glu748Val		B4DZ30|B4E0U4|O75327	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ubiquitin_supergroup,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E748V	ENST00000520810.1	37	c.2243	CCDS6128.1	8	.	.	.	.	.	.	.	.	.	.	A	11.18	1.562705	0.27915	.	.	ENSG00000104365	ENST00000520810;ENST00000416505;ENST00000520835;ENST00000379708	T;T;T;T	0.76709	-0.95;-1.04;-0.85;2.75	5.31	5.31	0.75309	.	0.250078	0.41396	D	0.000885	D	0.85392	0.5686	M	0.63428	1.95	0.25382	N	0.988607	D;P;D;P	0.76494	0.998;0.911;0.999;0.839	D;P;D;B	0.78314	0.987;0.555;0.991;0.329	T	0.78954	-0.2000	10	0.72032	D	0.01	.	12.6125	0.56558	1.0:0.0:0.0:0.0	.	689;746;525;748	B4E0U4;O14920-2;B3KRB7;O14920	.;.;.;IKKB_HUMAN	V	748;689;746;525	ENSP00000430684:E748V;ENSP00000404920:E689V;ENSP00000430868:E746V;ENSP00000369030:E525V	ENSP00000369030:E525V	E	+	2	0	IKBKB	42307626	0.986000	0.35501	0.101000	0.21167	0.021000	0.10359	4.894000	0.63206	2.011000	0.59026	0.482000	0.46254	GAG	IKBKB	-	NULL	ENSG00000104365		0.547	IKBKB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKB	HGNC	protein_coding	OTTHUMT00000377214.1	-	0.00	86	0	A			42188469	+1	tier1	-	no_errors	ENST00000520810	ensembl	human	known	74_37	missense	24.56	43	14	SNP	0.356	T
IL10RB	3588	genome.wustl.edu	37	21	34655516	34655516	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:34655516G>C	ENST00000290200.2	+	5	724	c.616G>C	c.(616-618)Gag>Cag	p.E206Q	AP000295.9_ENST00000433395.2_Nonstop_Mutation_p.*333V	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	206	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						GGAATGGAGTGAGCCTGTCTG	0.488																																					Melanoma(67;315 1275 21667 21943 44564)												0													136.0	123.0	128.0					21																	34655516		2203	4300	6503	SO:0001583	missense	0			U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.616G>C	21.37:g.34655516G>C	ENSP00000290200:p.Glu206Gln		Q9BUU4	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.E206Q	ENST00000290200.2	37	c.616	CCDS13623.1	21	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051201	0.75960	.	.	ENSG00000243646	ENST00000290200;ENST00000539894	T	0.30981	1.51	5.49	0.463	0.16700	Fibronectin, type III (1);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	0.712402	0.13833	N	0.359590	T	0.14270	0.0345	N	0.13235	0.315	0.09310	N	0.999991	B;B;B;B	0.17268	0.021;0.01;0.021;0.004	B;B;B;B	0.14023	0.01;0.005;0.007;0.003	T	0.33317	-0.9873	10	0.15066	T	0.55	-9.8185	6.5638	0.22501	0.2821:0.2464:0.4715:0.0	.	208;206;206;206	Q6ZVU9;Q08334;B4DSX5;F5H766	.;I10R2_HUMAN;.;.	Q	206	ENSP00000290200:E206Q	ENSP00000290200:E206Q	E	+	1	0	IL10RB	33577386	0.007000	0.16637	0.202000	0.23494	0.718000	0.41266	-0.120000	0.10660	-0.190000	0.10465	0.561000	0.74099	GAG	IL10RB	-	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	ENSG00000243646		0.488	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RB	HGNC	protein_coding	OTTHUMT00000139831.3	-	0.00	56	0	G			34655516	+1	tier1	-	no_errors	ENST00000290200	ensembl	human	known	74_37	missense	7.95	81	7	SNP	0.396	C
IL16	3603	genome.wustl.edu	37	15	81558085	81558085	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:81558085C>T	ENST00000302987.4	+	3	507	c.507C>T	c.(505-507)ctC>ctT	p.L169L	IL16_ENST00000394660.2_Silent_p.L169L			Q14005	IL16_HUMAN	interleukin 16	169					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CTTACTCTCTCTGCAGTAACA	0.488											OREG0023362	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	48.0	49.0					15																	81558085		1901	4121	6022	SO:0001819	synonymous_variant	0			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.507C>T	15.37:g.81558085C>T		1207	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_IL-16	p.L169	ENST00000302987.4	37	c.507	CCDS42069.1	15																																																																																			IL16	-	NULL	ENSG00000172349		0.488	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	HGNC	protein_coding	OTTHUMT00000303952.1	-	0.00	86	0	C	NM_172217		81558085	+1	tier1	-	no_errors	ENST00000302987	ensembl	human	known	74_37	silent	6.98	80	6	SNP	0.951	T
IL16	3603	genome.wustl.edu	37	15	81561931	81561931	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:81561931C>G	ENST00000302987.4	+	4	617	c.617C>G	c.(616-618)tCt>tGt	p.S206C	IL16_ENST00000394660.2_Missense_Mutation_p.S206C			Q14005	IL16_HUMAN	interleukin 16	206	Interaction with GRIN2A.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						GTGCAGCCATCTGGGGGCCTC	0.577																																																	0													147.0	148.0	148.0					15																	81561931		1976	4156	6132	SO:0001583	missense	0			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.617C>G	15.37:g.81561931C>G	ENSP00000302935:p.Ser206Cys		A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_IL-16	p.S206C	ENST00000302987.4	37	c.617	CCDS42069.1	15	.	.	.	.	.	.	.	.	.	.	C	11.66	1.705156	0.30232	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000355368;ENST00000302987	T;T	0.40756	1.02;1.02	4.98	4.07	0.47477	PDZ/DHR/GLGF (1);	0.181187	0.27100	N	0.020937	T	0.29288	0.0729	N	0.19112	0.55	0.42859	D	0.994107	B;B	0.28783	0.142;0.222	B;B	0.27715	0.037;0.082	T	0.11275	-1.0594	10	0.44086	T	0.13	.	13.7304	0.62783	0.0:0.9257:0.0:0.0743	.	206;206	Q14005;Q14005-2	IL16_HUMAN;.	C	206;206;38;206	ENSP00000378155:S206C;ENSP00000302935:S206C	ENSP00000302935:S206C	S	+	2	0	IL16	79348986	0.086000	0.21541	0.093000	0.20910	0.161000	0.22273	2.566000	0.45948	1.338000	0.45544	0.561000	0.74099	TCT	IL16	-	superfamily_PDZ	ENSG00000172349		0.577	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	HGNC	protein_coding	OTTHUMT00000303952.1	-	0.00	64	0	C	NM_172217		81561931	+1	tier1	-	no_errors	ENST00000302987	ensembl	human	known	74_37	missense	11.11	64	8	SNP	0.047	G
IL16	3603	genome.wustl.edu	37	15	81595959	81595959	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:81595959G>A	ENST00000302987.4	+	15	3388	c.3388G>A	c.(3388-3390)Gga>Aga	p.G1130R	IL16_ENST00000394652.2_Missense_Mutation_p.G429R|IL16_ENST00000394660.2_Missense_Mutation_p.G1130R|RP11-761I4.4_ENST00000607019.1_RNA			Q14005	IL16_HUMAN	interleukin 16	1130	Interaction with PPP1R12A, PPP1R12B and PPP1R12C.|PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CAGCTTGGCAGGAGGAGCAGA	0.502																																																	0													170.0	152.0	158.0					15																	81595959		2203	4300	6503	SO:0001583	missense	0			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.3388G>A	15.37:g.81595959G>A	ENSP00000302935:p.Gly1130Arg		A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_IL-16	p.G1130R	ENST00000302987.4	37	c.3388	CCDS42069.1	15	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749745	0.89753	.	.	ENSG00000172349	ENST00000394660;ENST00000355368;ENST00000302987;ENST00000329842;ENST00000394653;ENST00000394652;ENST00000394656	T;T;T	0.37915	1.17;1.17;1.17	4.22	4.22	0.49857	PDZ/DHR/GLGF (4);	0.000000	0.42053	D	0.000770	T	0.72914	0.3520	H	0.96662	3.86	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.84256	0.0480	10	0.87932	D	0	.	16.8115	0.85722	0.0:0.0:1.0:0.0	.	962;623;667;520;1130;1130	F8W7Z5;Q6ZTT5;B7Z8M3;B3KY62;Q14005;Q14005-2	.;.;.;.;IL16_HUMAN;.	R	1130;962;1130;667;520;429;429	ENSP00000378155:G1130R;ENSP00000302935:G1130R;ENSP00000378147:G429R	ENSP00000302935:G1130R	G	+	1	0	IL16	79383014	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.841000	0.92131	2.176000	0.68965	0.655000	0.94253	GGA	IL16	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_IL-16	ENSG00000172349		0.502	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	HGNC	protein_coding	OTTHUMT00000303952.1	-	0.00	65	0	G	NM_172217		81595959	+1	tier1	-	no_errors	ENST00000302987	ensembl	human	known	74_37	missense	14.46	71	12	SNP	1.000	A
IL36B	27177	genome.wustl.edu	37	2	113788674	113788674	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:113788674C>G	ENST00000259213.4	-	3	179	c.72G>C	c.(70-72)ctG>ctC	p.L24L	IL36B_ENST00000327407.2_Silent_p.L24L	NM_014438.3	NP_055253.2	Q9NZH7	IL36B_HUMAN	interleukin 36, beta	24					immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	interleukin-1 receptor binding (GO:0005149)			kidney(1)|ovary(1)|pancreas(1)	3						AATTTCCACTCAGGACCCACA	0.473																																																	0													119.0	107.0	111.0					2																	113788674		2203	4300	6503	SO:0001819	synonymous_variant	0			AF201833	CCDS2109.1, CCDS2110.1	2q14	2011-07-14	2011-06-06	2011-06-06	ENSG00000136696	ENSG00000136696		"""Interleukins and interleukin receptors"""	15564	protein-coding gene	gene with protein product		605508	"""interleukin 1 family, member 8 (eta)"""	IL1F8		10625660, 10512743, 16646978	Standard	NM_173178		Approved	FIL1, IL-1H2, IL-1F8, FILI-(ETA), IL1-ETA, IL1H2, MGC126880, MGC126882	uc002tiq.1	Q9NZH7	OTTHUMG00000131338	ENST00000259213.4:c.72G>C	2.37:g.113788674C>G			Q3MIH0|Q53SR6|Q7RTZ7|Q9UHA5	Silent	SNP	superfamily_Cytokine_IL1-like	p.L24	ENST00000259213.4	37	c.72	CCDS2109.1	2																																																																																			IL36B	-	superfamily_Cytokine_IL1-like	ENSG00000136696		0.473	IL36B-001	KNOWN	basic|CCDS	protein_coding	IL36B	HGNC	protein_coding	OTTHUMT00000254110.1	-	0.00	115	0	C	NM_014438		113788674	-1	tier1	-	no_errors	ENST00000259213	ensembl	human	known	74_37	silent	7.69	84	7	SNP	0.009	G
IQGAP1	8826	genome.wustl.edu	37	15	90992790	90992790	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:90992790G>C	ENST00000268182.5	+	11	1201		c.e11-1		IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1						cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GCTTTGCTCAGAGTGGTCAGA	0.473																																																	0													73.0	73.0	73.0					15																	90992790		2198	4298	6496	SO:0001630	splice_region_variant	0			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.1078-1G>C	15.37:g.90992790G>C			A7MBM3	Splice_Site	SNP	-	e11-1	ENST00000268182.5	37	c.1078-1	CCDS10362.1	15	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395778	0.25205	.	.	ENSG00000140575	ENST00000268182	.	.	.	5.04	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1775	0.65552	0.0:0.0:0.8495:0.1505	.	.	.	.	.	-1	.	.	.	+	.	.	IQGAP1	88793794	1.000000	0.71417	0.484000	0.27391	0.269000	0.26545	5.834000	0.69361	1.354000	0.45846	0.557000	0.71058	.	IQGAP1	-	-	ENSG00000140575		0.473	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1		0.00	59	0	G	NM_003870	Intron	90992790	+1			no_errors	ENST00000268182	ensembl	human	known	74_37	splice_site	5.26	54	3	SNP	0.996	C
ITGAM	3684	genome.wustl.edu	37	16	31341910	31341910	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:31341910C>T	ENST00000287497.8	+	28	3335	c.3260C>T	c.(3259-3261)gCg>gTg	p.A1087V	ITGAM_ENST00000544665.3_Missense_Mutation_p.A1088V			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	1087					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GGACAGGGGGCGTTTGTGAGG	0.572																																																	0													42.0	41.0	42.0					16																	31341910		1948	4150	6098	SO:0001583	missense	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.3260C>T	16.37:g.31341910C>T	ENSP00000287497:p.Ala1087Val		Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A1088V	ENST00000287497.8	37	c.3263	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	C	16.31	3.087225	0.55968	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.58652	0.32;0.32	5.03	-3.38	0.04883	.	.	.	.	.	T	0.44685	0.1305	M	0.78049	2.395	0.09310	N	1	D;D	0.53619	0.961;0.961	B;B	0.29176	0.099;0.099	T	0.49560	-0.8927	9	0.72032	D	0.01	.	6.7037	0.23238	0.0:0.4248:0.1257:0.4495	.	1087;1087	Q4VAK1;P11215	.;ITAM_HUMAN	V	1088;1087	ENSP00000441691:A1088V;ENSP00000287497:A1087V	ENSP00000287497:A1087V	A	+	2	0	ITGAM	31249411	0.000000	0.05858	0.000000	0.03702	0.595000	0.36748	-0.939000	0.03933	-0.206000	0.10203	0.453000	0.30009	GCG	ITGAM	-	NULL	ENSG00000169896		0.572	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	-	0.00	53	0	C	NM_000632		31341910	+1	tier1	-	no_errors	ENST00000544665	ensembl	human	known	74_37	missense	11.67	53	7	SNP	0.000	T
KANSL1	284058	genome.wustl.edu	37	17	44109060	44109060	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:44109060G>A	ENST00000262419.6	-	15	3570	c.3100C>T	c.(3100-3102)Ccc>Tcc	p.P1034S	KANSL1_ENST00000572904.1_Missense_Mutation_p.P1034S|KANSL1_ENST00000432791.1_Missense_Mutation_p.P1034S|KANSL1_ENST00000393476.3_Missense_Mutation_p.P328S|KANSL1_ENST00000574590.1_Missense_Mutation_p.P1034S|KANSL1_ENST00000575318.1_Missense_Mutation_p.P970S	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	1034	Sufficient for interaction with KAT8.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CGCTCCCAGGGCTGGACAGAC	0.657																																																	0													21.0	21.0	21.0					17																	44109060		2201	4299	6500	SO:0001583	missense	0			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.3100C>T	17.37:g.44109060G>A	ENSP00000262419:p.Pro1034Ser		A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	NULL	p.P1034S	ENST00000262419.6	37	c.3100	CCDS11503.1	17	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716039	0.89205	.	.	ENSG00000120071	ENST00000262419;ENST00000432791;ENST00000393476	T;T;T	0.53640	0.61;0.61;0.61	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.57695	0.2071	L	0.29908	0.895	0.58432	D	0.999998	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.69479	0.964;0.964;0.948;0.948	T	0.56721	-0.7932	10	0.45353	T	0.12	-10.06	18.0627	0.89382	0.0:0.0:1.0:0.0	.	302;365;1034;1034	B3KT49;Q7Z3B3-2;C9JHY2;Q7Z3B3	.;.;.;K1267_HUMAN	S	1034;1034;328	ENSP00000262419:P1034S;ENSP00000387393:P1034S;ENSP00000377117:P328S	ENSP00000262419:P1034S	P	-	1	0	KIAA1267	41464907	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.460000	0.97641	2.604000	0.88044	0.561000	0.74099	CCC	KANSL1	-	NULL	ENSG00000120071		0.657	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KANSL1	HGNC	protein_coding	OTTHUMT00000440274.1	-	0.00	69	0	G	NM_015443		44109060	-1	tier1	-	no_errors	ENST00000262419	ensembl	human	known	74_37	missense	11.86	52	7	SNP	1.000	A
KCNA4	3739	genome.wustl.edu	37	11	30034880	30034880	+	5'UTR	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:30034880G>C	ENST00000328224.6	-	0	579				KCNA4_ENST00000526518.1_5'UTR	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	TAGAGGCAAAGACCCTGGGAG	0.468																																																	0																																										SO:0001623	5_prime_UTR_variant	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.-655C>G	11.37:g.30034880G>C				RNA	SNP	-	NULL	ENST00000328224.6	37	NULL	CCDS41629.1	11																																																																																			KCNA4	-	-	ENSG00000182255		0.468	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	-	0.00	72	0	G	NM_002233		30034880	-1	tier1	-	no_errors	ENST00000526518	ensembl	human	putative	74_37	rna	10.94	57	7	SNP	1.000	C
KCNC4	3749	genome.wustl.edu	37	1	110765753	110765753	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:110765753C>G	ENST00000369787.3	+	2	873	c.846C>G	c.(844-846)acC>acG	p.T282T	KCNC4_ENST00000438661.2_Silent_p.T282T|KCNC4_ENST00000413138.3_Silent_p.T282T|KCNC4_ENST00000412512.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	282					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCATCCTGACCTACATCGAGG	0.577																																																	0													333.0	247.0	276.0					1																	110765753		2203	4300	6503	SO:0001819	synonymous_variant	0			BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.846C>G	1.37:g.110765753C>G			Q3MIM4|Q5TBI6	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_K_chnl_volt-dep_Kv3_ID,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.4,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.T282	ENST00000369787.3	37	c.846	CCDS821.1	1																																																																																			KCNC4	-	NULL	ENSG00000116396		0.577	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	HGNC	protein_coding	OTTHUMT00000052146.2	-	0.00	33	0	C	NM_001039574		110765753	+1	tier1	-	no_errors	ENST00000369787	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	G
KCNH6	81033	genome.wustl.edu	37	17	61622620	61622620	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:61622620G>A	ENST00000583023.1	+	13	2697	c.2686G>A	c.(2686-2688)Gca>Aca	p.A896T	KCNH6_ENST00000456941.2_Missense_Mutation_p.A807T|KCNH6_ENST00000581784.1_Missense_Mutation_p.A807T|KCNH6_ENST00000314672.5_Missense_Mutation_p.A860T	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	896					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TCTGCCTCCTGCACAGGTAAG	0.617																																																	0													42.0	42.0	42.0					17																	61622620		2203	4300	6503	SO:0001583	missense	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2686G>A	17.37:g.61622620G>A	ENSP00000463533:p.Ala896Thr		Q9BRD7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.A896T	ENST00000583023.1	37	c.2686	CCDS11638.1	17	.	.	.	.	.	.	.	.	.	.	G	12.02	1.811791	0.32053	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99220	-5.58	5.08	4.11	0.48088	.	0.694155	0.13335	N	0.395628	D	0.97542	0.9195	L	0.44542	1.39	0.30146	N	0.803477	B;B;B;B	0.20887	0.001;0.003;0.002;0.049	B;B;B;B	0.21151	0.002;0.005;0.005;0.033	D	0.96257	0.9188	10	0.21014	T	0.42	.	12.8009	0.57586	0.0786:0.0:0.9214:0.0	.	737;860;807;896	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	T	896;807	ENSP00000396900:A807T	ENSP00000318212:A896T	A	+	1	0	KCNH6	58976352	0.004000	0.15560	0.982000	0.44146	0.195000	0.23768	0.072000	0.14617	1.509000	0.48786	0.655000	0.94253	GCA	KCNH6	-	NULL	ENSG00000173826		0.617	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	-	0.00	77	0	G	NM_030779		61622620	+1	tier1	-	no_errors	ENST00000583023	ensembl	human	known	74_37	missense	6.67	84	6	SNP	1.000	A
KCNK1	3775	genome.wustl.edu	37	1	233749986	233749986	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:233749986C>T	ENST00000366621.3	+	1	237	c.69C>T	c.(67-69)ttC>ttT	p.F23F		NM_002245.3	NP_002236.1	O00180	KCNK1_HUMAN	potassium channel, subfamily K, member 1	23					potassium ion transport (GO:0006813)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	11		all_cancers(173;0.00217)|all_epithelial(177;0.121)|Prostate(94;0.122)|Acute lymphoblastic leukemia(190;0.175)			Ibutilide(DB00308)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)	CCTGGTGCTTCGGCTTCCTGG	0.687																																																	0													33.0	33.0	33.0					1																	233749986		2203	4300	6503	SO:0001819	synonymous_variant	0			U33632	CCDS1599.1	1q42-q43	2012-03-07			ENSG00000135750	ENSG00000135750		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6272	protein-coding gene	gene with protein product		601745				8661042, 16382106	Standard	NM_002245		Approved	K2p1.1, DPK, TWIK-1	uc010pxo.1	O00180	OTTHUMG00000037923	ENST00000366621.3:c.69C>T	1.37:g.233749986C>T			Q13307|Q5T5E8	Silent	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TWIK1,prints_2pore_dom_K_chnl_TWIK,prints_2pore_dom_K_chnl	p.F23	ENST00000366621.3	37	c.69	CCDS1599.1	1																																																																																			KCNK1	-	pirsf_2pore_dom_K_chnl_TASK	ENSG00000135750		0.687	KCNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK1	HGNC	protein_coding	OTTHUMT00000092565.1		0.00	26	0	C	NM_002245		233749986	+1			no_errors	ENST00000366621	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.998	T
KCTD16	57528	genome.wustl.edu	37	5	143586748	143586748	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:143586748C>G	ENST00000507359.3	+	2	1562	c.471C>G	c.(469-471)ctC>ctG	p.L157L	KCTD16_ENST00000512467.1_Silent_p.L157L	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	157					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)				large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			CCTCCCTGCTCCCTGCCGACC	0.552																																																	0													72.0	77.0	75.0					5																	143586748		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.471C>G	5.37:g.143586748C>G			Q9P2M9	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L157	ENST00000507359.3	37	c.471	CCDS34260.1	5																																																																																			KCTD16	-	NULL	ENSG00000183775		0.552	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3	-	0.00	114	0	C	XM_098368		143586748	+1	tier1	-	no_errors	ENST00000507359	ensembl	human	known	74_37	silent	7.87	82	7	SNP	0.976	G
KCTD18	130535	genome.wustl.edu	37	2	201363707	201363707	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:201363707C>G	ENST00000359878.3	-	4	983	c.473G>C	c.(472-474)aGa>aCa	p.R158T	KCTD18_ENST00000409157.1_Missense_Mutation_p.R158T|KCTD18_ENST00000468413.1_5'UTR	NM_152387.2	NP_689600.2	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain containing 18	158					protein homooligomerization (GO:0051260)					endometrium(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						ACCAATAATTCTACTCTCACA	0.398																																																	0													112.0	109.0	110.0					2																	201363707		2203	4300	6503	SO:0001583	missense	0			AK055884	CCDS2330.1	2q33.1	2013-06-20	2013-06-20		ENSG00000155729	ENSG00000155729			26446	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 18"""				Standard	NM_152387		Approved	FLJ31322, 6530404F10Rik, FLJ37818	uc002uvs.3	Q6PI47	OTTHUMG00000132781	ENST00000359878.3:c.473G>C	2.37:g.201363707C>G	ENSP00000352941:p.Arg158Thr		Q53T21|Q6NW26|Q6PCD8|Q8N9B7|Q96N73	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.R158T	ENST00000359878.3	37	c.473	CCDS2330.1	2	.	.	.	.	.	.	.	.	.	.	C	15.16	2.751921	0.49362	.	.	ENSG00000155729	ENST00000359878;ENST00000409157	D;D	0.97404	-4.37;-4.37	5.42	4.55	0.56014	.	0.163819	0.43919	D	0.000505	D	0.94729	0.8299	L	0.27053	0.805	0.30113	N	0.806406	P;D	0.63880	0.59;0.993	B;P	0.53954	0.16;0.738	D	0.91444	0.5176	10	0.44086	T	0.13	-24.6542	6.2607	0.20899	0.0:0.7033:0.0:0.2967	.	158;158	Q6PI47-2;Q6PI47	.;KCD18_HUMAN	T	158	ENSP00000352941:R158T;ENSP00000386751:R158T	ENSP00000352941:R158T	R	-	2	0	KCTD18	201071952	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.290000	0.33319	1.524000	0.49035	0.563000	0.77884	AGA	KCTD18	-	NULL	ENSG00000155729		0.398	KCTD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD18	HGNC	protein_coding	OTTHUMT00000256188.1	-	0.00	80	0	C	NM_152387		201363707	-1	tier1	-	no_errors	ENST00000359878	ensembl	human	known	74_37	missense	10.19	97	11	SNP	1.000	G
KCTD7	154881	genome.wustl.edu	37	7	66103973	66103973	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:66103973C>T	ENST00000275532.3	+	4	808	c.624C>T	c.(622-624)aaC>aaT	p.N208N	KCTD7_ENST00000443322.1_Silent_p.N208N	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	208					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						CGCTCCTCAACTCCCTGCGAT	0.582																																																	0													121.0	107.0	112.0					7																	66103973		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.624C>T	7.37:g.66103973C>T			A4D2M4|Q8IVR0	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.N208	ENST00000275532.3	37	c.624	CCDS5534.1	7																																																																																			KCTD7	-	NULL	ENSG00000243335		0.582	KCTD7-001	KNOWN	basic|CCDS	protein_coding	KCTD7	HGNC	protein_coding	OTTHUMT00000251733.2	-	0.00	48	0	C	NM_153033		66103973	+1	tier1	-	no_errors	ENST00000275532	ensembl	human	known	74_37	silent	13.95	37	6	SNP	1.000	T
KDM4A	9682	genome.wustl.edu	37	1	44137335	44137335	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:44137335C>T	ENST00000372396.3	+	11	1657	c.1523C>T	c.(1522-1524)tCa>tTa	p.S508L		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	508					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						AAAAAGAAATCATCTTCTAGC	0.522																																																	0													98.0	99.0	99.0					1																	44137335		2203	4300	6503	SO:0001583	missense	0			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.1523C>T	1.37:g.44137335C>T	ENSP00000361473:p.Ser508Leu		Q5VVB1	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.S508L	ENST00000372396.3	37	c.1523	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	C	4.165	0.029110	0.08054	.	.	ENSG00000066135	ENST00000372396	T	0.15834	2.39	5.48	0.149	0.14863	.	1.719510	0.02818	N	0.125255	T	0.14227	0.0344	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24404	-1.0161	10	0.27082	T	0.32	1.6286	5.7939	0.18375	0.0:0.5877:0.1276:0.2848	.	508	O75164	KDM4A_HUMAN	L	508	ENSP00000361473:S508L	ENSP00000361473:S508L	S	+	2	0	KDM4A	43909922	0.001000	0.12720	0.000000	0.03702	0.040000	0.13550	1.509000	0.35780	0.109000	0.17891	-0.143000	0.13931	TCA	KDM4A	-	NULL	ENSG00000066135		0.522	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	HGNC	protein_coding	OTTHUMT00000019960.1	-	0.00	81	0	C	NM_014663		44137335	+1	tier1	-	no_errors	ENST00000372396	ensembl	human	known	74_37	missense	13.11	53	8	SNP	0.000	T
KEL	3792	genome.wustl.edu	37	7	142640001	142640001	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:142640001C>A	ENST00000355265.2	-	17	2376	c.1902G>T	c.(1900-1902)gaG>gaT	p.E634D		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	634					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.E634D(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CTGCAGCATTCTCTAAGAATG	0.517																																																	1	Substitution - Missense(1)	lung(1)											104.0	94.0	97.0					7																	142640001		2203	4300	6503	SO:0001583	missense	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1902G>T	7.37:g.142640001C>A	ENSP00000347409:p.Glu634Asp		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.E634D	ENST00000355265.2	37	c.1902	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940608	0.34283	.	.	ENSG00000197993	ENST00000355265	D	0.91945	-2.94	4.6	1.8	0.24995	Peptidase M13, neprilysin, C-terminal (2);	0.118992	0.37261	N	0.002178	D	0.94528	0.8238	M	0.86178	2.8	0.45621	D	0.998552	D	0.76494	0.999	D	0.64237	0.923	D	0.92194	0.5762	10	0.87932	D	0	-10.3722	5.8137	0.18479	0.0:0.6583:0.0:0.3417	.	634	P23276	KELL_HUMAN	D	634	ENSP00000347409:E634D	ENSP00000347409:E634D	E	-	3	2	KEL	142350123	0.994000	0.37717	0.132000	0.22025	0.016000	0.09150	0.360000	0.20250	0.181000	0.19994	0.650000	0.86243	GAG	KEL	-	pfam_Peptidase_M13_C,prints_Peptidase_M13_C	ENSG00000197993		0.517	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	HGNC	protein_coding	OTTHUMT00000347671.2		0.00	47	0	C	NM_000420		142640001	-1			no_errors	ENST00000355265	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.898	A
KIAA1109	84162	genome.wustl.edu	37	4	123128701	123128701	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:123128701C>G	ENST00000264501.4	+	17	2033	c.1660C>G	c.(1660-1662)Ctg>Gtg	p.L554V	KIAA1109_ENST00000455637.1_Missense_Mutation_p.L554V|KIAA1109_ENST00000388738.3_Missense_Mutation_p.L554V|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	554					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						tGTAGTGTATCTGGCAGCCTG	0.284																																																	0													129.0	112.0	117.0					4																	123128701		1810	4069	5879	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.1660C>G	4.37:g.123128701C>G	ENSP00000264501:p.Leu554Val		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.L554V	ENST00000264501.4	37	c.1660	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.135|7.135	0.580663|0.580663	0.13686|0.13686	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	T;T;T|.	0.30981|.	2.11;2.11;1.51|.	5.54|5.54	3.83|3.83	0.44106|0.44106	.|.	857.788000|.	0.00166|.	N|.	0.000000|.	T|T	0.53174|0.53174	0.1780|0.1780	L|L	0.43152|0.43152	1.355|1.355	0.45541|0.45541	D|D	0.998493|0.998493	B|.	0.06786|.	0.001|.	B|.	0.08055|.	0.003|.	T|T	0.44159|0.44159	-0.9346|-0.9346	10|5	0.35671|.	T|.	0.21|.	.|.	7.4962|7.4962	0.27490|0.27490	0.0:0.6728:0.1211:0.2061|0.0:0.6728:0.1211:0.2061	.|.	554|.	Q2LD37|.	K1109_HUMAN|.	V|C	554|386	ENSP00000264501:L554V;ENSP00000373390:L554V;ENSP00000389925:L554V|.	ENSP00000264501:L554V|.	L|S	+|+	1|2	2|0	KIAA1109|KIAA1109	123348151|123348151	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.258000|0.258000	0.26162|0.26162	2.101000|2.101000	0.41787|0.41787	0.705000|0.705000	0.31890|0.31890	-0.251000|-0.251000	0.11542|0.11542	CTG|TCT	KIAA1109	-	NULL	ENSG00000138688		0.284	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	-	0.00	71	0	C	NM_020797		123128701	+1	tier1	-	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	G
KIAA1109	84162	genome.wustl.edu	37	4	123176314	123176314	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:123176314G>T	ENST00000264501.4	+	40	6627	c.6254G>T	c.(6253-6255)aGt>aTt	p.S2085I	KIAA1109_ENST00000455637.1_Missense_Mutation_p.S2085I|KIAA1109_ENST00000388738.3_Missense_Mutation_p.S2085I			Q2LD37	K1109_HUMAN	KIAA1109	2085					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						CCCCTAAGAAGTAAATACAAC	0.328																																																	0													91.0	86.0	87.0					4																	123176314		1820	4075	5895	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.6254G>T	4.37:g.123176314G>T	ENSP00000264501:p.Ser2085Ile		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.S2085I	ENST00000264501.4	37	c.6254	CCDS43267.1	4	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	27.0|27.0|27.0	4.794573|4.794573|4.794573	0.90453|0.90453|0.90453	.|.|.	.|.|.	ENSG00000138688|ENSG00000138688|ENSG00000138688	ENST00000419325|ENST00000264501;ENST00000388738;ENST00000455637|ENST00000446180	.|T;T;T|.	.|0.33438|.	.|2.17;2.17;1.41|.	5.75|5.75|5.75	5.75|5.75|5.75	0.90469|0.90469|0.90469	.|.|.	.|0.000000|.	.|0.64402|.	.|U|.	.|0.000011|.	T|T|T	0.74650|0.74650|0.74650	0.3744|0.3744|0.3744	M|M|M	0.62723|0.62723|0.62723	1.935|1.935|1.935	0.58432|0.58432|0.58432	D|D|D	0.999999|0.999999|0.999999	.|D;D;D|.	.|0.69078|.	.|0.997;0.997;0.995|.	.|D;D;D|.	.|0.80764|.	.|0.994;0.994;0.986|.	T|T|T	0.71206|0.71206|0.71206	-0.4661|-0.4661|-0.4661	5|10|5	.|0.87932|.	.|D|.	.|0|.	.|.|.	19.9227|19.9227|19.9227	0.97093|0.97093|0.97093	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|2085;2084;2085|.	.|Q2LD37-6;Q2LD37-2;Q2LD37|.	.|.;.;K1109_HUMAN|.	N|I|L	42|2085|658	.|ENSP00000264501:S2085I;ENSP00000373390:S2085I;ENSP00000389925:S2085I|.	.|ENSP00000264501:S2085I|.	K|S|V	+|+|+	3|2|1	2|0|0	KIAA1109|KIAA1109|KIAA1109	123395764|123395764|123395764	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.991000|0.991000|0.991000	0.79684|0.79684|0.79684	7.821000|7.821000|7.821000	0.86641|0.86641|0.86641	2.703000|2.703000|2.703000	0.92315|0.92315|0.92315	0.585000|0.585000|0.585000	0.79938|0.79938|0.79938	AAG|AGT|GTA	KIAA1109	-	NULL	ENSG00000138688		0.328	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	-	0.00	59	0	G	NM_020797		123176314	+1	tier1	-	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KIAA1522	57648	genome.wustl.edu	37	1	33237497	33237497	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:33237497C>T	ENST00000373480.1	+	6	2643	c.2540C>T	c.(2539-2541)tCg>tTg	p.S847L	KIAA1522_ENST00000373481.3_Missense_Mutation_p.S858L|KIAA1522_ENST00000294521.3_Intron|KIAA1522_ENST00000401073.2_Missense_Mutation_p.S906L	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	847	Pro-rich.							p.S906L(2)		breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				CTGGGGCCATCGGCCCCCCAG	0.721																																																	2	Substitution - Missense(2)	lung(2)											7.0	9.0	9.0					1																	33237497		1845	4051	5896	SO:0001583	missense	0			AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.2540C>T	1.37:g.33237497C>T	ENSP00000362579:p.Ser847Leu		B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	NULL	p.S906L	ENST00000373480.1	37	c.2717	CCDS55588.1	1	.	.	.	.	.	.	.	.	.	.	C	7.618	0.676254	0.14841	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.13420	2.59;2.59;2.6	4.98	0.67	0.17923	.	1.220330	0.06128	N	0.670027	T	0.10551	0.0258	N	0.21448	0.665	0.09310	N	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.38887	-0.9640	10	0.40728	T	0.16	0.2419	9.2652	0.37636	0.0:0.6927:0.108:0.1993	.	858;847;906	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	L	906;858;847	ENSP00000383851:S906L;ENSP00000362580:S858L;ENSP00000362579:S847L	ENSP00000362579:S847L	S	+	2	0	KIAA1522	33010084	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.138000	0.16016	0.001000	0.14605	-0.813000	0.03139	TCG	KIAA1522	-	NULL	ENSG00000162522		0.721	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1522	HGNC	protein_coding	OTTHUMT00000022130.1	-	0.00	22	0	C			33237497	+1	tier1	-	no_errors	ENST00000401073	ensembl	human	known	74_37	missense	28.57	10	4	SNP	0.000	T
KIAA1755	85449	genome.wustl.edu	37	20	36855583	36855583	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:36855583G>A	ENST00000279024.4	-	7	2296	c.2025C>T	c.(2023-2025)ctC>ctT	p.L675L		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	675										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TCTGCAGCTGGAGAGCCGCCT	0.602																																																	0													46.0	44.0	45.0					20																	36855583		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.2025C>T	20.37:g.36855583G>A			Q9C0A8	Silent	SNP	superfamily_CRAL-TRIO_dom	p.L675	ENST00000279024.4	37	c.2025	CCDS33467.1	20																																																																																			KIAA1755	-	superfamily_CRAL-TRIO_dom	ENSG00000149633		0.602	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	-	0.00	83	0	G	NM_001029864		36855583	-1	tier1	-	no_errors	ENST00000279024	ensembl	human	known	74_37	silent	19.19	80	19	SNP	0.002	A
KIDINS220	57498	genome.wustl.edu	37	2	8890375	8890375	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:8890375C>T	ENST00000256707.3	-	24	3462	c.3281G>A	c.(3280-3282)gGg>gAg	p.G1094E	KIDINS220_ENST00000473731.1_Missense_Mutation_p.G1094E|KIDINS220_ENST00000427284.1_Missense_Mutation_p.G1094E|KIDINS220_ENST00000418530.1_Missense_Mutation_p.G1052E	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1094					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTGGCTGTACCCTGATGGCGC	0.592																																																	0													69.0	73.0	72.0					2																	8890375		1997	4165	6162	SO:0001583	missense	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3281G>A	2.37:g.8890375C>T	ENSP00000256707:p.Gly1094Glu		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G1094E	ENST00000256707.3	37	c.3281	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	C	5.846	0.340354	0.11069	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000459813	T;T;T;T;T;T	0.66280	1.01;-0.2;-0.16;-0.03;-0.16;-0.06	5.46	0.133	0.14766	.	0.784475	0.11961	N	0.512775	T	0.41119	0.1145	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B	0.31485	0.181;0.004;0.325;0.12;0.04	B;B;B;B;B	0.37650	0.092;0.004;0.13;0.255;0.13	T	0.31641	-0.9936	10	0.02654	T	1	.	10.064	0.42292	0.237:0.4056:0.3573:0.0	.	1095;1095;778;1052;1094	B4DK94;E9PH70;B4DGY1;Q9ULH0-2;Q9ULH0	.;.;.;.;KDIS_HUMAN	E	841;778;1094;1094;1052;1094;1095;103	ENSP00000420364:G841E;ENSP00000256707:G1094E;ENSP00000411849:G1094E;ENSP00000414923:G1052E;ENSP00000418974:G1094E;ENSP00000419964:G1095E	ENSP00000256707:G1094E	G	-	2	0	KIDINS220	8807826	0.004000	0.15560	0.055000	0.19348	0.092000	0.18411	1.365000	0.34182	0.073000	0.16731	-2.558000	0.00175	GGG	KIDINS220	-	NULL	ENSG00000134313		0.592	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2		0.00	65	0	C	NM_020738		8890375	-1			no_errors	ENST00000256707	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.004	T
KIF17	57576	genome.wustl.edu	37	1	21014222	21014222	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:21014222C>G	ENST00000247986.2	-	8	1907	c.1597G>C	c.(1597-1599)Gag>Cag	p.E533Q	KIF17_ENST00000400463.3_Missense_Mutation_p.E533Q|KIF17_ENST00000490034.1_Intron|KIF17_ENST00000375044.1_Missense_Mutation_p.E433Q			Q9P2E2	KIF17_HUMAN	kinesin family member 17	533					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		AGAGAAATCTCAGATTTGGAG	0.572																																																	0													64.0	64.0	64.0					1																	21014222		2203	4300	6503	SO:0001583	missense	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1597G>C	1.37:g.21014222C>G	ENSP00000247986:p.Glu533Gln		A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E533Q	ENST00000247986.2	37	c.1597	CCDS213.1	1	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295264	0.40594	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.71934	-0.61;-0.49;-0.49	5.18	5.18	0.71444	.	0.000000	0.32719	U	0.005729	T	0.72811	0.3507	L	0.55481	1.735	0.09310	N	1	P;B	0.35894	0.526;0.337	P;B	0.44732	0.459;0.063	T	0.69247	-0.5195	10	0.62326	D	0.03	.	14.0694	0.64851	0.0:1.0:0.0:0.0	.	533;533	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	Q	433;533;533	ENSP00000364184:E433Q;ENSP00000383311:E533Q;ENSP00000247986:E533Q	ENSP00000247986:E533Q	E	-	1	0	KIF17	20886809	0.289000	0.24334	0.025000	0.17156	0.063000	0.16089	3.201000	0.51059	2.688000	0.91661	0.591000	0.81541	GAG	KIF17	-	NULL	ENSG00000117245		0.572	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	-	0.00	53	0	C	NM_020816		21014222	-1	tier1	-	no_errors	ENST00000247986	ensembl	human	known	74_37	missense	21.74	36	10	SNP	0.041	G
KIF21A	55605	genome.wustl.edu	37	12	39696800	39696800	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:39696800C>A	ENST00000361418.5	-	36	4713	c.4698G>T	c.(4696-4698)aaG>aaT	p.K1566N	KIF21A_ENST00000361961.3_Missense_Mutation_p.K1553N|KIF21A_ENST00000541463.2_Missense_Mutation_p.K1513N|KIF21A_ENST00000395670.3_Missense_Mutation_p.K1567N|KIF21A_ENST00000544797.2_Missense_Mutation_p.K1529N			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1566					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				AGTCCCATTTCTTGATTCCAT	0.413																																																	0													160.0	148.0	152.0					12																	39696800		2203	4300	6503	SO:0001583	missense	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4698G>T	12.37:g.39696800C>A	ENSP00000354878:p.Lys1566Asn		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.K1567N	ENST00000361418.5	37	c.4701	CCDS53776.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.33|18.33	3.599736|3.599736	0.66332|0.66332	.|.	.|.	ENSG00000139116|ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463|ENST00000552961	D;D;D;T;D;T|.	0.83163|.	-1.69;-1.69;-1.69;1.97;-1.69;-0.14|.	5.18|5.18	4.29|4.29	0.51040|0.51040	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);|.	0.000000|.	0.53938|.	D|.	0.000041|.	T|T	0.77592|0.77592	0.4153|0.4153	M|M	0.89095|0.89095	3.005|3.005	0.41833|0.41833	D|D	0.990081|0.990081	D;D;D;D;D;D|.	0.89917|.	1.0;0.998;0.998;1.0;1.0;1.0|.	D;P;D;D;D;D|.	0.91635|.	0.996;0.898;0.969;0.996;0.999;0.999|.	T|T	0.80944|0.80944	-0.1156|-0.1156	10|5	0.72032|.	D|.	0.01|.	.|.	10.5532|10.5532	0.45101|0.45101	0.0:0.8521:0.0:0.1479|0.0:0.8521:0.0:0.1479	.|.	1529;1513;1566;1553;1519;553|.	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8|.	.;.;KI21A_HUMAN;.;.;.|.	N|I	1553;1567;1519;553;547;1529;1566;1513|867	ENSP00000354851:K1553N;ENSP00000379029:K1567N;ENSP00000448792:K547N;ENSP00000445606:K1529N;ENSP00000354878:K1566N;ENSP00000438075:K1513N|.	ENSP00000344501:K1519N|.	K|R	-|-	3|2	2|0	KIF21A|KIF21A	37983067|37983067	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.267000|1.267000	0.33050|0.33050	2.429000|2.429000	0.82318|0.82318	0.591000|0.591000	0.81541|0.81541	AAG|AGA	KIF21A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139116		0.413	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1	-	0.00	118	0	C	NM_017641		39696800	-1	tier1	-	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	8.33	77	7	SNP	1.000	A
KIF5B	3799	genome.wustl.edu	37	10	32327107	32327107	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:32327107C>T	ENST00000302418.4	-	6	939	c.482G>A	c.(481-483)cGa>cAa	p.R161Q		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	161	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				ATAGGGAACTCGGTTTTTGTC	0.348			T	"""RET, ALK"""	NSCLC																																			Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													110.0	120.0	117.0					10																	32327107		2203	4300	6503	SO:0001583	missense	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.482G>A	10.37:g.32327107C>T	ENSP00000307078:p.Arg161Gln		A0AVB2|Q5VZ85	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R161Q	ENST00000302418.4	37	c.482	CCDS7171.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.581286	0.96565	.	.	ENSG00000170759	ENST00000302418	T	0.75050	-0.9	5.38	5.38	0.77491	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.82540	0.5059	L	0.39397	1.21	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83734	0.0200	10	0.72032	D	0.01	.	19.4918	0.95052	0.0:1.0:0.0:0.0	.	161	P33176	KINH_HUMAN	Q	161	ENSP00000307078:R161Q	ENSP00000307078:R161Q	R	-	2	0	KIF5B	32367113	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.003000	0.70701	2.666000	0.90696	0.650000	0.86243	CGA	KIF5B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000170759		0.348	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	-	0.00	71	0	C	NM_004521		32327107	-1	tier1	-	no_errors	ENST00000302418	ensembl	human	known	74_37	missense	16.95	49	10	SNP	1.000	T
KIF7	374654	genome.wustl.edu	37	15	90193070	90193070	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:90193070G>A	ENST00000394412.3	-	3	507	c.431C>T	c.(430-432)tCc>tTc	p.S144F		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	144	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TTCCAGGTAGGACACATGTAC	0.587																																																	0													84.0	84.0	84.0					15																	90193070		689	1590	2279	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.431C>T	15.37:g.90193070G>A	ENSP00000377934:p.Ser144Phe		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S144F	ENST00000394412.3	37	c.431	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125132	0.56721	.	.	ENSG00000166813	ENST00000394412	T	0.79653	-1.29	5.0	4.07	0.47477	Kinesin, motor domain (4);	.	.	.	.	D	0.93380	0.7889	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.95576	0.8642	9	0.87932	D	0	.	15.3303	0.74203	0.0:0.1407:0.8593:0.0	.	144	Q2M1P5	KIF7_HUMAN	F	144	ENSP00000377934:S144F	ENSP00000377934:S144F	S	-	2	0	KIF7	87994074	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	9.795000	0.99099	1.072000	0.40860	-0.176000	0.13171	TCC	KIF7	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000166813		0.587	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	-	0.00	94	0	G	NM_198525		90193070	-1	tier1	-	no_errors	ENST00000394412	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
KLB	152831	genome.wustl.edu	37	4	39450011	39450011	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:39450011C>G	ENST00000257408.4	+	5	2937	c.2840C>G	c.(2839-2841)tCt>tGt	p.S947C		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	947	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						TTCTTCACATCTGATTTTAAA	0.373																																																	0													44.0	46.0	45.0					4																	39450011		2203	4300	6503	SO:0001583	missense	0			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2840C>G	4.37:g.39450011C>G	ENSP00000257408:p.Ser947Cys		Q2M3K8	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.S947C	ENST00000257408.4	37	c.2840	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	C	15.84	2.951393	0.53186	.	.	ENSG00000134962	ENST00000257408	T	0.32023	1.47	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.287529	0.40385	N	0.001106	T	0.53126	0.1777	L	0.57536	1.79	0.09310	N	1	D;D	0.71674	0.996;0.998	P;D	0.65773	0.898;0.938	T	0.44997	-0.9291	10	0.51188	T	0.08	-2.4774	20.0143	0.97474	0.0:1.0:0.0:0.0	.	938;947	B7ZL50;Q86Z14	.;KLOTB_HUMAN	C	947	ENSP00000257408:S947C	ENSP00000257408:S947C	S	+	2	0	KLB	39126406	0.838000	0.29461	0.266000	0.24541	0.969000	0.65631	3.445000	0.52921	2.740000	0.93945	0.313000	0.20887	TCT	KLB	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000134962		0.373	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	HGNC	protein_coding	OTTHUMT00000250429.1	-	0.00	100	0	C	NM_175737		39450011	+1	tier1	-	no_errors	ENST00000257408	ensembl	human	known	74_37	missense	11.84	66	9	SNP	0.042	G
KLHL33	123103	genome.wustl.edu	37	14	20898456	20898456	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:20898456C>T	ENST00000344581.4	-	2	601	c.379G>A	c.(379-381)Gag>Aag	p.E127K		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	127												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		ACATGGAGCTCATCACTATCC	0.607																																																	0													54.0	55.0	55.0					14																	20898456		692	1591	2283	SO:0001583	missense	0				CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.379G>A	14.37:g.20898456C>T	ENSP00000341549:p.Glu127Lys			Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BACK,smart_Kelch_1	p.E127K	ENST00000344581.4	37	c.379	CCDS53882.1	14	.	.	.	.	.	.	.	.	.	.	C	13.90	2.375782	0.42105	.	.	ENSG00000185271	ENST00000344581	T	0.69435	-0.4	4.58	4.58	0.56647	BTB/Kelch-associated (2);	0.222183	0.39407	N	0.001363	T	0.68357	0.2992	L	0.54323	1.7	0.27675	N	0.946621	P	0.47545	0.897	P	0.48488	0.579	T	0.65656	-0.6115	10	0.49607	T	0.09	.	14.3989	0.67029	0.0:1.0:0.0:0.0	.	127	A6NCF5	KLH33_HUMAN	K	127	ENSP00000341549:E127K	ENSP00000341549:E127K	E	-	1	0	KLHL33	19968296	0.750000	0.28316	0.886000	0.34754	0.950000	0.60333	2.280000	0.43443	2.360000	0.80028	0.655000	0.94253	GAG	KLHL33	-	pfam_BACK,smart_BACK	ENSG00000185271		0.607	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL33	HGNC	protein_coding	OTTHUMT00000411038.1	-	0.00	54	0	C	XM_063481		20898456	-1	tier1	-	no_errors	ENST00000344581	ensembl	human	known	74_37	missense	15.22	39	7	SNP	1.000	T
LAMB1	3912	genome.wustl.edu	37	7	107615724	107615724	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:107615724C>T	ENST00000222399.6	-	11	1554	c.1324G>A	c.(1324-1326)Gaa>Aaa	p.E442K	LAMB1_ENST00000393561.1_Missense_Mutation_p.E466K|LAMB1_ENST00000393560.1_Missense_Mutation_p.E442K	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	442	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TAGAAGCCTTCTTTGCAAACA	0.373																																																	0													108.0	101.0	103.0					7																	107615724		2203	4299	6502	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1324G>A	7.37:g.107615724C>T	ENSP00000222399:p.Glu442Lys		Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,superfamily_P-loop_NTPase,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E442K	ENST00000222399.6	37	c.1324	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124874	0.56613	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.61859	0.07;0.07;0.07	5.66	5.66	0.87406	EGF-like, laminin (4);	.	.	.	.	T	0.54078	0.1836	L	0.42581	1.335	0.48185	D	0.999605	B;B;B	0.26876	0.036;0.082;0.162	B;B;B	0.30572	0.026;0.117;0.023	T	0.46624	-0.9178	9	0.21014	T	0.42	.	19.7538	0.96281	0.0:1.0:0.0:0.0	.	442;442;466	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	K	466;442;442	ENSP00000377191:E466K;ENSP00000222399:E442K;ENSP00000377190:E442K	ENSP00000222399:E442K	E	-	1	0	LAMB1	107402960	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.646000	0.46630	2.690000	0.91761	0.655000	0.94253	GAA	LAMB1	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000091136		0.373	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	-	0.00	68	0	C	NM_002291		107615724	-1	tier1	-	no_errors	ENST00000222399	ensembl	human	known	74_37	missense	13.46	45	7	SNP	1.000	T
LANCL1	10314	genome.wustl.edu	37	2	211300158	211300158	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:211300158C>G	ENST00000443314.1	-	8	1418	c.1076G>C	c.(1075-1077)gGa>gCa	p.G359A	LANCL1_ENST00000233714.4_Missense_Mutation_p.G359A|LANCL1_ENST00000450366.2_Missense_Mutation_p.G359A|AC007970.1_ENST00000420418.1_RNA|LANCL1_ENST00000431941.2_Missense_Mutation_p.G359A|AC007970.1_ENST00000433296.1_RNA|LANCL1_ENST00000441020.3_Missense_Mutation_p.G359A			O43813	LANC1_HUMAN	LanC lantibiotic synthetase component C-like 1 (bacterial)	359					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|G-protein coupled receptor activity (GO:0004930)|glutathione binding (GO:0043295)|low-density lipoprotein particle receptor binding (GO:0050750)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		TCCATGTTCTCCATACTCTAA	0.373																																																	0													135.0	131.0	132.0					2																	211300158		2203	4300	6503	SO:0001583	missense	0			Y11395	CCDS2392.1	2q33-q35	2008-05-23	2001-12-04		ENSG00000115365	ENSG00000115365			6508	protein-coding gene	gene with protein product		604155	"""LanC (bacterial lantibiotic synthetase component C)-like 1"""	GPR69A		9512664	Standard	NM_001136574		Approved	p40	uc010zjh.2	O43813	OTTHUMG00000132991	ENST00000443314.1:c.1076G>C	2.37:g.211300158C>G	ENSP00000388713:p.Gly359Ala			Missense_Mutation	SNP	pfam_LANC-like,superfamily_6-hairpin_glycosidase-like,prints_LanC-like_prot_euk,prints_LANC-like	p.G359A	ENST00000443314.1	37	c.1076	CCDS2392.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.348538|5.348538	0.95807|0.95807	.|.	.|.	ENSG00000115365|ENSG00000115365	ENST00000443314;ENST00000441020;ENST00000450366;ENST00000233714;ENST00000431941|ENST00000412863	T;T;T;T;T|.	0.39787|.	1.06;1.06;1.06;1.06;1.06|.	6.16|6.16	6.16|6.16	0.99307|0.99307	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73102|0.73102	0.3544|0.3544	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.66536|0.66536	-0.5899|-0.5899	10|5	0.33141|.	T|.	0.24|.	.|.	20.8598|20.8598	0.99761|0.99761	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	359|.	O43813|.	LANC1_HUMAN|.	A|C	359|117	ENSP00000388713:G359A;ENSP00000393323:G359A;ENSP00000393597:G359A;ENSP00000233714:G359A;ENSP00000397646:G359A|.	ENSP00000233714:G359A|.	G|W	-|-	2|3	0|0	LANCL1|LANCL1	211008403|211008403	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.487000|7.487000	0.81328|0.81328	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GGA|TGG	LANCL1	-	pfam_LANC-like	ENSG00000115365		0.373	LANCL1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LANCL1	HGNC	protein_coding	OTTHUMT00000336817.1	-	0.00	126	0	C	NM_006055		211300158	-1	tier1	-	no_errors	ENST00000233714	ensembl	human	known	74_37	missense	8.82	93	9	SNP	1.000	G
LAP3	51056	genome.wustl.edu	37	4	17586670	17586670	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:17586670G>T	ENST00000226299.4	+	6	889	c.615G>T	c.(613-615)acG>acT	p.T205T	LAP3_ENST00000606142.1_Silent_p.T174T|AC006160.5_ENST00000511010.1_RNA	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	205					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						TGATGGAGACGCCAGCCAATG	0.468																																																	0													91.0	89.0	90.0					4																	17586670		2203	4300	6503	SO:0001819	synonymous_variant	0			AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.615G>T	4.37:g.17586670G>T			B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Silent	SNP	pfam_Peptidase_M17_C,pfam_Peptidase_M17_N,prints_Leucine_aapep/pepB	p.T205	ENST00000226299.4	37	c.615	CCDS3422.1	4																																																																																			LAP3	-	pfam_Peptidase_M17_C	ENSG00000002549		0.468	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAP3	HGNC	protein_coding	OTTHUMT00000250365.1		0.00	62	0	G			17586670	+1			no_errors	ENST00000226299	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.107	T
LCE1F	353137	genome.wustl.edu	37	1	152749016	152749016	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:152749016G>A	ENST00000334371.2	+	1	169	c.169G>A	c.(169-171)Ggg>Agg	p.G57R		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	57					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCAGCTCTGGGGGCTGCTG	0.682																																																	0													33.0	37.0	36.0					1																	152749016		2202	4300	6502	SO:0001583	missense	0				CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.169G>A	1.37:g.152749016G>A	ENSP00000334187:p.Gly57Arg			Missense_Mutation	SNP	NULL	p.G57R	ENST00000334371.2	37	c.169	CCDS1023.1	1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920001	0.33908	.	.	ENSG00000240386	ENST00000334371	T	0.06218	3.33	4.1	4.1	0.47936	.	.	.	.	.	T	0.15955	0.0384	M	0.81112	2.525	0.30334	N	0.786325	D	0.89917	1.0	D	0.91635	0.999	T	0.00679	-1.1613	9	0.87932	D	0	.	12.0222	0.53350	0.0:0.0:1.0:0.0	.	57	Q5T754	LCE1F_HUMAN	R	57	ENSP00000334187:G57R	ENSP00000334187:G57R	G	+	1	0	LCE1F	151015640	0.945000	0.32115	0.939000	0.37840	0.983000	0.72400	1.635000	0.37134	2.272000	0.75746	0.557000	0.71058	GGG	LCE1F	-	NULL	ENSG00000240386		0.682	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1F	HGNC	protein_coding	OTTHUMT00000034523.2	-	0.00	130	0	G	NM_178354		152749016	+1	tier1	-	no_errors	ENST00000334371	ensembl	human	known	74_37	missense	14.71	145	25	SNP	0.980	A
LEO1	123169	genome.wustl.edu	37	15	52239554	52239554	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:52239554C>A	ENST00000299601.5	-	11	1891	c.1831G>T	c.(1831-1833)Gat>Tat	p.D611Y	LEO1_ENST00000315141.5_Missense_Mutation_p.D551Y	NM_138792.2	NP_620147.1	Q8WVC0	LEO1_HUMAN	Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	611					endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	14				all cancers(107;0.00264)		GATCCCTCATCACTGTCTGAT	0.388																																					Esophageal Squamous(40;229 896 18505 32465 43844)|Ovarian(53;886 1123 14462 18432 23189)												0													203.0	184.0	191.0					15																	52239554		2195	4293	6488	SO:0001583	missense	0			AY302186	CCDS10146.1, CCDS66767.1	15q21.2	2008-02-05			ENSG00000166477	ENSG00000166477			30401	protein-coding gene	gene with protein product		610507				15632063	Standard	NM_001286430		Approved		uc002abo.3	Q8WVC0	OTTHUMG00000131843	ENST00000299601.5:c.1831G>T	15.37:g.52239554C>A	ENSP00000299601:p.Asp611Tyr		Q96N99	Missense_Mutation	SNP	pfam_Leo1	p.D611Y	ENST00000299601.5	37	c.1831	CCDS10146.1	15	.	.	.	.	.	.	.	.	.	.	.	27.3	4.822250	0.90873	.	.	ENSG00000166477	ENST00000299601;ENST00000538386;ENST00000315141	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.79009	0.4374	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	T	0.80553	-0.1331	9	0.87932	D	0	.	18.9907	0.92791	0.0:1.0:0.0:0.0	.	551;611	Q8WVC0-2;Q8WVC0	.;LEO1_HUMAN	Y	611;589;551	.	ENSP00000299601:D611Y	D	-	1	0	LEO1	50026846	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.593000	0.82686	2.601000	0.87937	0.561000	0.74099	GAT	LEO1	-	pfam_Leo1	ENSG00000166477		0.388	LEO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEO1	HGNC	protein_coding	OTTHUMT00000254791.2	-	0.00	59	0	C	NM_138792		52239554	-1	tier1	-	no_errors	ENST00000299601	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
LILRA2	11027	genome.wustl.edu	37	19	55087566	55087566	+	Silent	SNP	C	C	A	rs199807216		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:55087566C>A	ENST00000251377.3	+	7	1378	c.1245C>A	c.(1243-1245)ctC>ctA	p.L415L	LILRB1_ENST00000448689.1_Intron|LILRA2_ENST00000251376.3_Silent_p.L415L|LILRA2_ENST00000391738.3_Silent_p.L415L|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391737.1_Silent_p.L403L|LILRB1_ENST00000396321.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	415					defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCCTGGAGCTCGTGGTCTCAG	0.612																																																	0													82.0	76.0	78.0					19																	55087566		2203	4300	6503	SO:0001819	synonymous_variant	0			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.1245C>A	19.37:g.55087566C>A			O75020	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.L415	ENST00000251377.3	37	c.1245	CCDS46179.1	19																																																																																			LILRA2	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000239998		0.612	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	-	0.00	125	0	C			55087566	+1	tier1	-	no_errors	ENST00000251377	ensembl	human	known	74_37	silent	10.23	79	9	SNP	0.002	A
LIMK1	3984	genome.wustl.edu	37	7	73521432	73521432	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:73521432G>A	ENST00000336180.2	+	8	1025	c.974G>A	c.(973-975)cGc>cAc	p.R325H	LIMK1_ENST00000538333.3_Missense_Mutation_p.R291H|LIMK1_ENST00000418310.1_Missense_Mutation_p.R355H	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	325					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	GAGTCCCTCCGCGTAGTCTGC	0.692																																																	0													34.0	32.0	33.0					7																	73521432		2203	4299	6502	SO:0001583	missense	0			D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.974G>A	7.37:g.73521432G>A	ENSP00000336740:p.Arg325His		B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R325H	ENST00000336180.2	37	c.974	CCDS5563.1	7	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532029	0.85812	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.76709	-1.02;-1.0;-1.04	5.19	5.19	0.71726	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.72922	0.3521	M	0.61703	1.905	0.80722	D	1	B;P;P	0.42039	0.41;0.651;0.769	B;B;B	0.31869	0.046;0.088;0.137	T	0.78861	-0.2037	10	0.72032	D	0.01	-16.5485	16.2751	0.82640	0.0:0.0:1.0:0.0	.	220;291;325	Q59FA3;B7Z6I8;P53667	.;.;LIMK1_HUMAN	H	355;325;325;291	ENSP00000409717:R355H;ENSP00000336740:R325H;ENSP00000444452:R291H	ENSP00000336740:R325H	R	+	2	0	LIMK1	73159368	1.000000	0.71417	0.969000	0.41365	0.955000	0.61496	9.396000	0.97270	2.439000	0.82584	0.650000	0.86243	CGC	LIMK1	-	superfamily_Kinase-like_dom	ENSG00000106683		0.692	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	HGNC	protein_coding	OTTHUMT00000252335.2	-	0.00	115	0	G	NM_002314		73521432	+1	tier1	-	no_errors	ENST00000336180	ensembl	human	known	74_37	missense	6.67	154	11	SNP	0.999	A
TCP10L	140290	genome.wustl.edu	37	21	33946984	33946984	+	IGR	SNP	C	C	A	rs575483228		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:33946984C>A	ENST00000300258.3	-	0	984				LINC00846_ENST00000334165.4_lincRNA	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						GAGGAGCTTCCGTCTAAAAAG	0.383																																																	0																																										SO:0001628	intergenic_variant	0			AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901		21.37:g.33946984C>A			Q53EW0|Q96LN5	RNA	SNP	-	NULL	ENST00000300258.3	37	NULL	CCDS13616.1	21																																																																																			LINC00846	-	-	ENSG00000186842		0.383	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LINC00846	HGNC	protein_coding	OTTHUMT00000139350.1	-	0.00	61	0	C	NM_144659		33946984	-1	tier1	-	no_errors	ENST00000334165	ensembl	human	known	74_37	rna	6.49	72	5	SNP	0.021	A
LINGO1	84894	genome.wustl.edu	37	15	77907918	77907918	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:77907918C>G	ENST00000355300.6	-	2	505	c.331G>C	c.(331-333)Gag>Cag	p.E111Q	LINGO1_ENST00000561030.1_Missense_Mutation_p.E105Q	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	111					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GCGCCGGGCTCCACGGCGCTC	0.617																																																	0													39.0	44.0	42.0					15																	77907918		2053	4188	6241	SO:0001583	missense	0			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.331G>C	15.37:g.77907918C>G	ENSP00000347451:p.Glu111Gln		D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E111Q	ENST00000355300.6	37	c.331	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395987	0.83011	.	.	ENSG00000169783	ENST00000355300	T	0.80214	-1.35	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.88115	0.6350	L	0.54863	1.705	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86933	0.2074	10	0.45353	T	0.12	.	19.6704	0.95910	0.0:1.0:0.0:0.0	.	111	Q96FE5	LIGO1_HUMAN	Q	111	ENSP00000347451:E111Q	ENSP00000347451:E111Q	E	-	1	0	LINGO1	75694973	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.815000	0.86186	2.659000	0.90383	0.561000	0.74099	GAG	LINGO1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000169783		0.617	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	-	0.00	45	0	C	NM_032808		77907918	-1	tier1	-	no_errors	ENST00000355300	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	G
LINGO3	645191	genome.wustl.edu	37	19	2290967	2290967	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:2290967G>T	ENST00000585527.1	-	1	1056	c.809C>A	c.(808-810)gCg>gAg	p.A270E	LINGO3_ENST00000404279.1_Missense_Mutation_p.A270E			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	270						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GGTGAGGTGCGCCTGGTGCCG	0.731																																																	0													13.0	16.0	15.0					19																	2290967		2028	4106	6134	SO:0001583	missense	0			AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.809C>A	19.37:g.2290967G>T	ENSP00000467753:p.Ala270Glu			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A270E	ENST00000585527.1	37	c.809	CCDS45905.1	19	.	.	.	.	.	.	.	.	.	.	g	12.43	1.936706	0.34189	.	.	ENSG00000220008	ENST00000404279	T	0.55413	0.52	4.18	1.99	0.26369	.	.	.	.	.	T	0.39091	0.1065	N	0.17082	0.46	0.40264	D	0.978213	P	0.50617	0.937	P	0.58391	0.838	T	0.54227	-0.8325	9	0.02654	T	1	.	2.9723	0.05926	0.3124:0.0:0.4886:0.199	.	270	P0C6S8	LIGO3_HUMAN	E	270	ENSP00000384979:A270E	ENSP00000384979:A270E	A	-	2	0	LINGO3	2241967	0.997000	0.39634	0.888000	0.34837	0.869000	0.49853	2.591000	0.46163	0.222000	0.20900	-0.521000	0.04368	GCG	LINGO3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000220008		0.731	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	LINGO3	HGNC	protein_coding	OTTHUMT00000451291.2	-	0.00	11	0	G	NM_001101391		2290967	-1	tier1	-	no_errors	ENST00000404279	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.900	T
DAAM2	23500	genome.wustl.edu	37	6	39866755	39866755	+	Intron	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:39866755C>T	ENST00000398904.2	+	22	2861				DAAM2_ENST00000274867.4_Intron|RP11-61I13.3_ENST00000437947.1_RNA|RP11-61I13.3_ENST00000430595.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|DAAM2_ENST00000538976.1_Intron|RP11-61I13.3_ENST00000606829.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2						actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GGGCTGCTGTCAGCAAACACT	0.567																																																	0													66.0	77.0	74.0					6																	39866755		2065	4213	6278	SO:0001627	intron_variant	0			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2679+42C>T	6.37:g.39866755C>T			G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	RNA	SNP	-	NULL	ENST00000398904.2	37	NULL	CCDS56426.1	6																																																																																			RP11-61I13.3	-	-	ENSG00000235033		0.567	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LOC100505635	Clone_based_vega_gene	protein_coding	OTTHUMT00000280648.1	-	0.00	85	0	C			39866755	-1	tier1	-	no_errors	ENST00000437947	ensembl	human	known	74_37	rna	7.41	75	6	SNP	0.000	T
LAMA1	284217	genome.wustl.edu	37	18	6956516	6956516	+	Intron	SNP	C	C	T	rs11270496|rs72100822	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:6956516C>T	ENST00000389658.3	-	56	8188				RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1						axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				agctccagctccagctccagc	0.552																																																	0																																										SO:0001627	intron_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8094+118G>A	18.37:g.6956516C>T				RNA	SNP	-	NULL	ENST00000389658.3	37	NULL	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	7.582	0.668953	0.14776	.	.	ENSG00000101680	ENST00000344342	.	.	.	2.66	0.808	0.18719	.	.	.	.	.	T	0.38161	0.1030	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36866	-0.9730	5	0.87932	D	0	.	4.77	0.13151	0.0:0.6865:0.0:0.3135	.	.	.	.	E	189	.	ENSP00000341000:G189E	G	-	2	0	LAMA1	6946516	0.000000	0.05858	0.000000	0.03702	0.183000	0.23260	-0.078000	0.11375	0.184000	0.20083	0.655000	0.94253	GGA	RP11-781P6.1	-	-	ENSG00000265069		0.552	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927188	Clone_based_vega_gene	protein_coding	OTTHUMT00000257369.1	-	0.00	60	0	C	NM_005559		6956516	+1	tier1	-	no_errors	ENST00000584722	ensembl	human	known	74_37	rna	6.15	56	4	SNP	0.000	T
AATBC	284837	genome.wustl.edu	37	21	45231438	45231438	+	RNA	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr21:45231438G>T	ENST00000400385.2	-	0	1010				AP001053.11_ENST00000448247.1_RNA|AP001053.11_ENST00000543603.1_RNA|AP001053.11_ENST00000437258.1_RNA	NR_026961.1																						TCCGACTGTGGGGAAAACAGA	0.642																																																	0																																												0																															21.37:g.45231438G>T				RNA	SNP	-	NULL	ENST00000400385.2	37	NULL		21																																																																																			AP001053.11	-	-	ENSG00000215458		0.642	AP001053.11-002	KNOWN	basic	antisense	LOC284837	Clone_based_vega_gene	antisense	OTTHUMT00000195677.1	-	0.00	71	0	G			45231438	-1	tier1	-	no_errors	ENST00000400385	ensembl	human	known	74_37	rna	5.97	63	4	SNP	0.067	T
LOXL3	84695	genome.wustl.edu	37	2	74779641	74779641	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:74779641C>T	ENST00000264094.3	-	2	192	c.121G>A	c.(121-123)Ggg>Agg	p.G41R	DOK1_ENST00000340004.6_5'Flank|LOXL3_ENST00000484369.1_5'UTR|DOK1_ENST00000233668.5_5'Flank|LOXL3_ENST00000409249.1_Missense_Mutation_p.G41R|LOXL3_ENST00000409986.1_Missense_Mutation_p.G41R|LOXL3_ENST00000393937.2_Missense_Mutation_p.G41R|LOXL3_ENST00000409549.1_Missense_Mutation_p.G41R|DOK1_ENST00000409429.1_Intron	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	41					epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						AACCGAAGCCCCTGGCTCCCG	0.662																																																	0													19.0	21.0	20.0					2																	74779641		2185	4282	6467	SO:0001583	missense	0			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.121G>A	2.37:g.74779641C>T	ENSP00000264094:p.Gly41Arg		D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.G41R	ENST00000264094.3	37	c.121	CCDS1953.1	2	.	.	.	.	.	.	.	.	.	.	C	13.99	2.403039	0.42613	.	.	ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000393937;ENST00000409549;ENST00000409986;ENST00000413469	T;T;T;T;T;T	0.01295	5.17;5.04;5.13;5.21;5.12;5.04	3.94	3.94	0.45596	Speract/scavenger receptor-related (1);	0.600804	0.17454	N	0.173668	T	0.02230	0.0069	N	0.19112	0.55	0.80722	D	1	D;B;B;B	0.67145	0.996;0.0;0.086;0.077	P;B;B;B	0.56612	0.802;0.001;0.076;0.064	T	0.74054	-0.3788	10	0.17369	T	0.5	.	11.788	0.52053	0.0:1.0:0.0:0.0	.	41;41;41;41	B9A025;E7END4;Q6IPL7;P58215	.;.;.;LOXL3_HUMAN	R	41	ENSP00000264094:G41R;ENSP00000387103:G41R;ENSP00000377512:G41R;ENSP00000386696:G41R;ENSP00000386545:G41R;ENSP00000398260:G41R	ENSP00000264094:G41R	G	-	1	0	LOXL3	74633149	0.998000	0.40836	1.000000	0.80357	0.952000	0.60782	3.496000	0.53288	2.501000	0.84356	0.555000	0.69702	GGG	LOXL3	-	superfamily_Srcr_rcpt-rel	ENSG00000115318		0.662	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	HGNC	protein_coding	OTTHUMT00000252215.1	-	0.00	64	0	C	NM_032603		74779641	-1	tier1	-	no_errors	ENST00000264094	ensembl	human	known	74_37	missense	20.29	55	14	SNP	1.000	T
LRP12	29967	genome.wustl.edu	37	8	105503409	105503409	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:105503409G>T	ENST00000276654.5	-	7	2180	c.2072C>A	c.(2071-2073)gCa>gAa	p.A691E	LRP12_ENST00000424843.2_Missense_Mutation_p.A672E|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	691					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ACTTGCACATGCTCCTACTGT	0.522																																																	0													97.0	84.0	88.0					8																	105503409		2203	4300	6503	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2072C>A	8.37:g.105503409G>T	ENSP00000276654:p.Ala691Glu		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.A672E	ENST00000276654.5	37	c.2015	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724108	0.30593	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000520873	D;D	0.83992	-1.79;-1.73	5.49	5.49	0.81192	.	0.265106	0.43919	D	0.000517	T	0.72938	0.3523	N	0.19112	0.55	0.39485	D	0.967955	B;B	0.14012	0.009;0.005	B;B	0.21360	0.034;0.015	T	0.68629	-0.5358	10	0.38643	T	0.18	-13.3034	13.9926	0.64376	0.0725:0.0:0.9275:0.0	.	672;691	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	E	672;691;56	ENSP00000399148:A672E;ENSP00000276654:A691E	ENSP00000276654:A691E	A	-	2	0	LRP12	105572585	0.622000	0.27085	0.806000	0.32338	0.712000	0.41017	3.177000	0.50871	2.744000	0.94065	0.650000	0.86243	GCA	LRP12	-	NULL	ENSG00000147650		0.522	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	38	0	G	NM_013437		105503409	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.834	T
LRRC37A6P	387646	genome.wustl.edu	37	10	27539089	27539089	+	lincRNA	SNP	C	C	A	rs61737347	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:27539089C>A	ENST00000574842.1	+	0	358				LRRC37A6P_ENST00000284414.4_RNA																							GCTGTAGCCTCCTGGTGGACT	0.552																																																	0													75.0	64.0	67.0					10																	27539089		692	1591	2283			0																															10.37:g.27539089C>A				RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.552	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	-	0.00	165	0	C			27539089	-1	tier1	-	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	16.22	93	18	SNP	0.004	A
LRRC4C	57689	genome.wustl.edu	37	11	40137176	40137176	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:40137176C>G	ENST00000278198.2	-	2	2630	c.667G>C	c.(667-669)Gag>Cag	p.E223Q	LRRC4C_ENST00000528697.1_Missense_Mutation_p.E223Q|LRRC4C_ENST00000530763.1_Missense_Mutation_p.E223Q|LRRC4C_ENST00000527150.1_Missense_Mutation_p.E223Q			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	223					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				AGATCCAGCTCATCTAGTTTT	0.463																																																	0													82.0	81.0	81.0					11																	40137176		2203	4300	6503	SO:0001583	missense	0			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.667G>C	11.37:g.40137176C>G	ENSP00000278198:p.Glu223Gln		A8K0T1|Q7L0N3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E223Q	ENST00000278198.2	37	c.667	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974866	0.53720	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.04809	3.55;3.55;3.55;3.55	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.11452	0.0279	L	0.41492	1.28	0.80722	D	1	D	0.60160	0.987	P	0.56088	0.791	T	0.18999	-1.0319	10	0.26408	T	0.33	.	18.2645	0.90048	0.0:1.0:0.0:0.0	.	223	Q9HCJ2	LRC4C_HUMAN	Q	223	ENSP00000278198:E223Q;ENSP00000436976:E223Q;ENSP00000437132:E223Q;ENSP00000434761:E223Q	ENSP00000278198:E223Q	E	-	1	0	LRRC4C	40093752	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.818000	0.86416	2.561000	0.86390	0.650000	0.86243	GAG	LRRC4C	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000148948		0.463	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	-	0.00	33	0	C	NM_020929		40137176	-1	tier1	-	no_errors	ENST00000527150	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	G
MACF1	23499	genome.wustl.edu	37	1	39901420	39901420	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:39901420C>G	ENST00000372915.3	+	68	17750	c.17663C>G	c.(17662-17664)tCc>tGc	p.S5888C	MACF1_ENST00000545844.1_Missense_Mutation_p.S3930C|MACF1_ENST00000564288.1_Missense_Mutation_p.S5992C|MACF1_ENST00000539005.1_Missense_Mutation_p.S3800C|MACF1_ENST00000289893.4_Missense_Mutation_p.S4432C|MACF1_ENST00000567887.1_Missense_Mutation_p.S6029C|MACF1_ENST00000361689.2_Missense_Mutation_p.S3930C|MACF1_ENST00000317713.7_Missense_Mutation_p.S3930C			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5888					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAAGCCGTGTCCCAGTCCACA	0.483																																																	0													82.0	82.0	82.0					1																	39901420		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.17663C>G	1.37:g.39901420C>G	ENSP00000362006:p.Ser5888Cys		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.S3930C	ENST00000372915.3	37	c.11789		1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.751717	0.89753	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893	T;T;T;T;T;T	0.65549	-0.12;-0.04;-0.12;-0.16;0.07;1.04	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000015	T	0.80093	0.4560	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.984;0.997;0.993	T	0.80908	-0.1172	10	0.87932	D	0	.	19.9941	0.97377	0.0:1.0:0.0:0.0	.	5888;3930;3874	Q9UPN3;F8W8Q1;Q9UPN3-3	MACF1_HUMAN;.;.	C	3930;5888;3930;3930;3800;4432	ENSP00000439537:S3930C;ENSP00000362006:S5888C;ENSP00000354573:S3930C;ENSP00000313438:S3930C;ENSP00000444364:S3800C;ENSP00000289893:S4432C	ENSP00000289893:S4432C	S	+	2	0	MACF1	39674007	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.776000	0.85560	2.729000	0.93468	0.557000	0.71058	TCC	MACF1	-	NULL	ENSG00000127603		0.483	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	48	0	C	NM_033044		39901420	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	G
MAGEA6	4105	genome.wustl.edu	37	X	151869922	151869922	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:151869922C>T	ENST00000329342.5	+	3	837	c.612C>T	c.(610-612)atC>atT	p.I204I		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	204	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					TCCTGATAATCATCCTGGCCA	0.547																																																	0													132.0	127.0	129.0					X																	151869922		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.612C>T	X.37:g.151869922C>T			A8IF93|Q6NW44	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.I204	ENST00000329342.5	37	c.612	CCDS14708.1	X																																																																																			MAGEA6	-	pfam_MAGE,pfscan_MAGE	ENSG00000197172		0.547	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA6	HGNC	protein_coding	OTTHUMT00000058747.2	-	0.00	154	0	C	NM_005363		151869922	+1	tier1	-	no_errors	ENST00000329342	ensembl	human	known	74_37	silent	15.97	121	23	SNP	0.000	T
MALAT1	378938	genome.wustl.edu	37	11	65269230	65269230	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:65269230G>T	ENST00000534336.1	+	0	3998					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AGTCATCTCAGGAGAACTTCA	0.408																																																	0													56.0	53.0	54.0					11																	65269230		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65269230G>T				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.408	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	115	0	G	NR_002819		65269230	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	5.77	98	6	SNP	0.997	T
MAMLD1	10046	genome.wustl.edu	37	X	149638836	149638836	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:149638836C>G	ENST00000370401.2	+	4	1301	c.991C>G	c.(991-993)Ctg>Gtg	p.L331V	MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000262858.5_Missense_Mutation_p.L331V|MAMLD1_ENST00000426613.2_Missense_Mutation_p.L306V|MAMLD1_ENST00000432680.2_Missense_Mutation_p.L306V			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	331					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					TTGGTCTGGTCTGCCTCCTCC	0.647																																																	0													104.0	62.0	77.0					X																	149638836		2203	4300	6503	SO:0001583	missense	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.991C>G	X.37:g.149638836C>G	ENSP00000359428:p.Leu331Val		B2RCQ4|B4DG93|B9EGA5	Missense_Mutation	SNP	NULL	p.L306V	ENST00000370401.2	37	c.916	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	C	9.883	1.202203	0.22121	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	T;T;T;T	0.71461	-0.14;-0.57;-0.14;-0.14	5.17	3.19	0.36642	.	0.157695	0.42821	D	0.000645	T	0.78123	0.4234	M	0.66939	2.045	0.24520	N	0.994169	P;P;P;D	0.71674	0.891;0.851;0.94;0.998	B;P;P;D	0.77557	0.367;0.546;0.546;0.99	T	0.66329	-0.5951	9	.	.	.	-21.1284	5.635	0.17532	0.4764:0.4119:0.0:0.1117	.	293;306;306;331	F6WVG1;Q13495-4;Q13495-3;Q13495	.;.;.;MAMD1_HUMAN	V	293;331;306;331;306	ENSP00000359428:L331V;ENSP00000414517:L306V;ENSP00000262858:L331V;ENSP00000397438:L306V	.	L	+	1	2	MAMLD1	149389494	0.969000	0.33509	0.006000	0.13384	0.141000	0.21300	2.294000	0.43567	0.980000	0.38523	0.529000	0.55759	CTG	MAMLD1	-	NULL	ENSG00000013619		0.647	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	-	0.00	30	0	C	NM_005491		149638836	+1	tier1	-	no_errors	ENST00000432680	ensembl	human	known	74_37	missense	21.43	22	6	SNP	0.136	G
MAP2	4133	genome.wustl.edu	37	2	210543349	210543349	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:210543349C>A	ENST00000360351.4	+	5	822	c.316C>A	c.(316-318)Ctg>Atg	p.L106M	MAP2_ENST00000199940.6_Missense_Mutation_p.L106M|MAP2_ENST00000447185.1_Missense_Mutation_p.L106M|MAP2_ENST00000361559.4_Missense_Mutation_p.L106M|MAP2_ENST00000392194.1_Missense_Mutation_p.L106M	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	106					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TGTAGCAGTCCTGAAAGGTGA	0.418																																					Pancreas(27;423 979 28787 29963)												0													115.0	109.0	111.0					2																	210543349		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.316C>A	2.37:g.210543349C>A	ENSP00000353508:p.Leu106Met		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.L106M	ENST00000360351.4	37	c.316	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979785	0.74360	.	.	ENSG00000078018	ENST00000199940;ENST00000392193;ENST00000360351;ENST00000361559;ENST00000445941;ENST00000392194;ENST00000447185;ENST00000452717	T;T;T;T;T;T;T;T	0.62105	1.99;0.05;1.99;1.99;1.99;1.99;1.99;1.99	5.04	3.09	0.35607	.	0.000000	0.42172	D	0.000757	T	0.66386	0.2784	N	0.24115	0.695	0.40436	D	0.979996	D;P;D;P;D;D	0.89917	1.0;0.835;0.998;0.535;1.0;0.998	D;P;D;B;D;P	0.91635	0.999;0.718;0.99;0.309;0.999;0.896	T	0.69285	-0.5185	10	0.46703	T	0.11	-1.5695	14.6636	0.68891	0.0:0.7235:0.2764:0.0	.	106;106;107;106;106;106	P11137-3;P11137-2;Q59FX9;E7EV03;P11137;Q8IUX2	.;.;.;.;MAP2_HUMAN;.	M	106;106;106;106;106;106;106;32	ENSP00000199940:L106M;ENSP00000376031:L106M;ENSP00000353508:L106M;ENSP00000355290:L106M;ENSP00000409969:L106M;ENSP00000376032:L106M;ENSP00000392164:L106M;ENSP00000388824:L32M	ENSP00000199940:L106M	L	+	1	2	MAP2	210251594	0.998000	0.40836	1.000000	0.80357	0.991000	0.79684	3.029000	0.49712	1.070000	0.40811	0.643000	0.83706	CTG	MAP2	-	NULL	ENSG00000078018		0.418	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	42	0	C	NM_001039538		210543349	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	missense	11.11	48	6	SNP	1.000	A
MAP2K5	5607	genome.wustl.edu	37	15	67835662	67835662	+	5'UTR	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:67835662C>G	ENST00000178640.5	+	0	616				MAP2K5_ENST00000560591.1_3'UTR|RP11-502I4.3_ENST00000604760.1_lincRNA|MAP2K5_ENST00000395476.2_5'Flank	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5						activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						ATGTGAGCCTCTTTAACCTGT	0.572																																																	0													103.0	85.0	91.0					15																	67835662		2201	4298	6499	SO:0001623	5_prime_UTR_variant	0			U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.-12C>G	15.37:g.67835662C>G			B4DE43|Q92961|Q92962	RNA	SNP	-	NULL	ENST00000178640.5	37	NULL	CCDS10224.1	15																																																																																			MAP2K5	-	-	ENSG00000137764		0.572	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K5	HGNC	protein_coding	OTTHUMT00000257041.1	-	0.00	111	0	C	NM_145162		67835662	+1	tier1	-	no_errors	ENST00000560591	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.135	G
MAP3K3	4215	genome.wustl.edu	37	17	61735181	61735181	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:61735181G>T	ENST00000361733.3	+	5	615	c.295G>T	c.(295-297)Gat>Tat	p.D99Y	MAP3K3_ENST00000584573.1_Missense_Mutation_p.D130Y|MAP3K3_ENST00000577395.1_Missense_Mutation_p.D99Y|MAP3K3_ENST00000579585.1_Missense_Mutation_p.D130Y|MAP3K3_ENST00000361357.3_Missense_Mutation_p.D130Y	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	99	OPR.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)			breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						AAACCAAGATGATCTTGATAA	0.358																																																	0													89.0	81.0	84.0					17																	61735181		2203	4300	6503	SO:0001583	missense	0			U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.295G>T	17.37:g.61735181G>T	ENSP00000354485:p.Asp99Tyr		B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D130Y	ENST00000361733.3	37	c.388	CCDS32702.1	17	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585256	0.86748	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.50813	0.73;0.73	5.95	5.95	0.96441	Phox/Bem1p (2);	0.000000	0.85682	D	0.000000	T	0.71558	0.3354	M	0.75777	2.31	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.999;0.998	T	0.72494	-0.4276	10	0.87932	D	0	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	99;67;99;130	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	Y	130;99	ENSP00000354927:D130Y;ENSP00000354485:D99Y	ENSP00000354927:D130Y	D	+	1	0	MAP3K3	59088913	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.870000	0.87175	2.827000	0.97445	0.650000	0.86243	GAT	MAP3K3	-	pfam_OPR_PB1,smart_OPR_PB1	ENSG00000198909		0.358	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	MAP3K3	HGNC	protein_coding	OTTHUMT00000443867.1	-	0.00	82	0	G	NM_002401		61735181	+1	tier1	-	no_errors	ENST00000361357	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
BMS1P21	100288974	genome.wustl.edu	37	10	81664784	81664784	+	IGR	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:81664784G>A								NUTM2E (54152 upstream) : MBL1P (15149 downstream)																							AAGCGGACCTGAGGAGTTGCA	0.642																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.81664784G>A				RNA	SNP	-	NULL		37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600	0	0.642					MBL1P	HGNC			-	0.00	59	0	G			81664784	+1	tier1	-	no_errors	ENST00000453174	ensembl	human	known	74_37	rna	15.79	32	6	SNP	0.015	A
MCOLN3	55283	genome.wustl.edu	37	1	85506834	85506834	+	Silent	SNP	C	C	T	rs374738596		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:85506834C>T	ENST00000370589.2	-	3	307	c.255G>A	c.(253-255)caG>caA	p.Q85Q	MCOLN3_ENST00000341115.4_Intron|MCOLN3_ENST00000370587.1_Silent_p.Q85Q|WDR63_ENST00000370596.1_Intron	NM_018298.10	NP_060768.8	Q8TDD5	MCLN3_HUMAN	mucolipin 3	85					auditory receptor cell differentiation (GO:0042491)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|locomotory behavior (GO:0007626)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(6)|kidney(3)|large_intestine(9)|lung(12)|prostate(3)|skin(1)	34				all cancers(265;0.00957)|Epithelial(280;0.0254)		CTACCACCATCTGGTTACTTA	0.408																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	107.0	96.0	100.0		255	4.8	1.0	1		100	0,8600		0,0,4300	no	coding-synonymous	MCOLN3	NM_018298.9		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		85/554	85506834	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF475085	CCDS701.1, CCDS58009.1	1p22.3	2011-12-16			ENSG00000055732	ENSG00000055732		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13358	protein-coding gene	gene with protein product		607400				16382100	Standard	NM_018298		Approved	TRPML3, FLJ11006, TRP-ML3	uc001dkp.3	Q8TDD5	OTTHUMG00000009955	ENST00000370589.2:c.255G>A	1.37:g.85506834C>T			Q5T4H5|Q5T4H6|Q9NV09	Silent	SNP	pfam_PKD1_2_channel	p.Q85	ENST00000370589.2	37	c.255	CCDS701.1	1																																																																																			MCOLN3	-	NULL	ENSG00000055732		0.408	MCOLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN3	HGNC	protein_coding	OTTHUMT00000027569.2	-	0.00	37	0	C	NM_018298		85506834	-1	tier1	-	no_errors	ENST00000370589	ensembl	human	known	74_37	silent	17.02	39	8	SNP	1.000	T
MED1	5469	genome.wustl.edu	37	17	37565965	37565965	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:37565965C>G	ENST00000300651.6	-	17	2732	c.2509G>C	c.(2509-2511)Gat>Cat	p.D837H	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TCAGCTGGATCAGTGTATGGA	0.413										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													62.0	64.0	63.0					17																	37565965		2203	4300	6503	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2509G>C	17.37:g.37565965C>G	ENSP00000300651:p.Asp837His		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.D837H	ENST00000300651.6	37	c.2509	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333984	0.60853	.	.	ENSG00000125686	ENST00000300651	T	0.52754	0.65	6.03	6.03	0.97812	.	.	.	.	.	T	0.60353	0.2262	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.61377	-0.7075	9	0.66056	D	0.02	-11.3418	20.5666	0.99351	0.0:1.0:0.0:0.0	.	837	Q15648	MED1_HUMAN	H	837	ENSP00000300651:D837H	ENSP00000300651:D837H	D	-	1	0	MED1	34819491	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.786000	0.85741	2.854000	0.98071	0.655000	0.94253	GAT	MED1	-	NULL	ENSG00000125686		0.413	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	-	0.00	54	0	C	NM_004774		37565965	-1	tier1	-	no_errors	ENST00000300651	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	G
MED14	9282	genome.wustl.edu	37	X	40588605	40588606	+	Intron	INS	-	-	A	rs200699843|rs369436436		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:40588605_40588606insA	ENST00000324817.1	-	2	334					NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTCTAAGAAGAAAAAAAAAAA	0.322																																																	0																																										SO:0001627	intron_variant	0			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.216-8->T	X.37:g.40588616_40588616dupA			Q4KMR7|Q9UNB3	RNA	INS	-	NULL	ENST00000324817.1	37	NULL	CCDS14254.1	X																																																																																			MED14	-	-	ENSG00000180182		0.322	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1		0.00	24	0	-	NM_004229		40588606	-1	tier1		no_errors	ENST00000463072	ensembl	human	known	74_37	rna	12.82	34	5	INS	0.000:0.000	A
MEGF8	1954	genome.wustl.edu	37	19	42840240	42840240	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:42840240C>T	ENST00000251268.6	+	6	986	c.986C>T	c.(985-987)tCg>tTg	p.S329L	MEGF8_ENST00000334370.4_Missense_Mutation_p.S329L	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	329					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				TCCAGCTCCTCGGGGCCCCCA	0.682																																																	0													25.0	28.0	27.0					19																	42840240		1983	4138	6121	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.986C>T	19.37:g.42840240C>T	ENSP00000251268:p.Ser329Leu		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_CUB_dom,smart_EG-like_dom,smart_Plexin-like_fold,smart_EGF-like_Ca-bd_dom,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin	p.S329L	ENST00000251268.6	37	c.986		19	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.483562	0.01027	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.21191	2.02;2.02	4.43	-0.193	0.13244	.	.	.	.	.	T	0.04588	0.0125	N	0.00729	-1.24	0.20873	N	0.999834	B	0.02656	0.0	B	0.01281	0.0	T	0.41893	-0.9483	9	0.11485	T	0.65	.	4.0945	0.09985	0.0:0.5301:0.1727:0.2972	.	329	Q7Z7M0-2	.	L	329	ENSP00000334219:S329L;ENSP00000251268:S329L	ENSP00000251268:S329L	S	+	2	0	MEGF8	47532080	0.000000	0.05858	0.064000	0.19789	0.565000	0.35776	0.079000	0.14782	-0.077000	0.12752	-1.468000	0.01013	TCG	MEGF8	-	NULL	ENSG00000105429		0.682	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	-	0.00	57	0	C	NM_001410		42840240	+1	tier1	-	no_errors	ENST00000251268	ensembl	human	known	74_37	missense	10.00	54	6	SNP	0.045	T
MIR182	406958	genome.wustl.edu	37	7	129410292	129410292	+	RNA	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:129410292G>A	ENST00000385255.1	-	0	40					NR_029614.1				microRNA 182																		TCACCAGTGTGAGTTCTACCA	0.612																																																	0													42.0	43.0	43.0					7																	129410292		1568	3582	5150			0					7q32.2	2011-09-12		2008-12-18	ENSG00000207990	ENSG00000207990		"""ncRNAs / Micro RNAs"""	31553	non-coding RNA	RNA, micro		611607		MIRN182			Standard	NR_029614		Approved	hsa-mir-182	uc011kpb.1				7.37:g.129410292G>A				RNA	SNP	-	NULL	ENST00000385255.1	37	NULL		7																																																																																			MIR182	-	-	ENSG00000207990		0.612	MIR182-201	KNOWN	basic	miRNA	MIR182	HGNC	miRNA		-	0.00	153	0	G	NR_029614		129410292	-1	tier1	-	no_errors	ENST00000385255	ensembl	human	known	74_37	rna	11.36	78	10	SNP	1.000	A
MIR205HG	642587	genome.wustl.edu	37	1	209605601	209605601	+	lincRNA	SNP	G	G	C	rs186821678	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:209605601G>C	ENST00000384891.1	+	0	220					NR_029622.1				MIR205 host gene (non-protein coding)																		ATGAGgcctcggcagccaccg	0.577																																																	0													39.0	34.0	36.0					1																	209605601		2203	4300	6503			0					1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605601G>C				RNA	SNP	-	NULL	ENST00000384891.1	37	NULL		1																																																																																			MIR205HG	-	-	ENSG00000230937		0.577	MIR205HG-202	KNOWN	basic	miRNA	MIR205HG	HGNC	lincRNA		-	0.00	70	0	G			209605601	+1	tier1	-	no_errors	ENST00000366437	ensembl	human	known	74_37	rna	10.00	72	8	SNP	0.004	C
MMP11	4320	genome.wustl.edu	37	22	24121532	24121532	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr22:24121532G>A	ENST00000215743.3	+	2	319	c.267G>A	c.(265-267)ctG>ctA	p.L89L	MMP11_ENST00000477567.1_3'UTR	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	89					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.L89L(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	CTGATGGGCTGAGTGCCCGCA	0.682																																																	1	Substitution - coding silent(1)	lung(1)											22.0	23.0	23.0					22																	24121532		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.267G>A	22.37:g.24121532G>A			Q5FX24|Q6PEZ6|Q9UC26	Silent	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.L89	ENST00000215743.3	37	c.267	CCDS13816.1	22																																																																																			MMP11	-	pirsf_Pept_M10A_Metazoans	ENSG00000099953		0.682	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP11	HGNC	protein_coding	OTTHUMT00000319891.2	-	0.00	79	0	G	NM_005940		24121532	+1	tier1	-	no_errors	ENST00000215743	ensembl	human	known	74_37	silent	20.00	80	20	SNP	0.010	A
MMP26	56547	genome.wustl.edu	37	11	5009524	5009524	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:5009524G>C	ENST00000380390.1	+	2	299	c.83G>C	c.(82-84)gGa>gCa	p.G28A	MMP26_ENST00000477339.1_3'UTR|MMP26_ENST00000300762.1_Missense_Mutation_p.G28A			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26	28					collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	GACCATAAAGGATGGGACTTT	0.483																																																	0													227.0	185.0	199.0					11																	5009524		2201	4298	6499	SO:0001583	missense	0			AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.83G>C	11.37:g.5009524G>C	ENSP00000369753:p.Gly28Ala		Q3MJ78|Q9GZS2|Q9NR87	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,prints_Pept_M10A	p.G28A	ENST00000380390.1	37	c.83	CCDS7752.1	11	.	.	.	.	.	.	.	.	.	.	G	9.844	1.191916	0.21954	.	.	ENSG00000167346	ENST00000380390;ENST00000300762	T;T	0.37915	1.17;1.17	3.3	1.39	0.22231	Metallopeptidase, catalytic domain (1);	0.582412	0.14332	N	0.326295	T	0.38799	0.1054	L	0.47716	1.5	0.22066	N	0.999382	D	0.61080	0.989	P	0.54759	0.76	T	0.14227	-1.0480	10	0.62326	D	0.03	-3.2973	4.8574	0.13566	0.2879:0.0:0.7121:0.0	.	28	Q9NRE1	MMP26_HUMAN	A	28	ENSP00000369753:G28A;ENSP00000300762:G28A	ENSP00000300762:G28A	G	+	2	0	MMP26	4966100	0.988000	0.35896	0.986000	0.45419	0.588000	0.36517	1.067000	0.30616	0.721000	0.32231	0.655000	0.94253	GGA	MMP26	-	superfamily_Peptidoglycan-bd-like	ENSG00000167346		0.483	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP26	HGNC	protein_coding	OTTHUMT00000142058.3	-	0.00	68	0	G	NM_021801		5009524	+1	tier1	-	no_errors	ENST00000300762	ensembl	human	known	74_37	missense	8.62	53	5	SNP	0.911	C
MOSPD2	158747	genome.wustl.edu	37	X	14921098	14921098	+	Silent	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:14921098G>C	ENST00000380492.3	+	7	637	c.549G>C	c.(547-549)gtG>gtC	p.V183V	MOSPD2_ENST00000495110.1_3'UTR|MOSPD2_ENST00000482354.1_Silent_p.V183V	NM_001177475.1|NM_152581.3	NP_001170946.1|NP_689794.1	Q8NHP6	MSPD2_HUMAN	motile sperm domain containing 2	183	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	Hepatocellular(33;0.183)					CAAAAATAGTGATCTTTGATA	0.289																																																	0													103.0	92.0	95.0					X																	14921098		2201	4296	6497	SO:0001819	synonymous_variant	0			AL834345	CCDS14162.1	Xp22.31	2006-03-16			ENSG00000130150	ENSG00000130150			28381	protein-coding gene	gene with protein product						15533722	Standard	NM_152581		Approved	MGC26706	uc004cwi.3	Q8NHP6	OTTHUMG00000021170	ENST00000380492.3:c.549G>C	X.37:g.14921098G>C			Q8N3H2|Q8NA83	Silent	SNP	pfam_CRAL-TRIO_dom,pfam_MSP_dom,superfamily_CRAL-TRIO_dom,superfamily_PapD-like,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_MSP_dom	p.V183	ENST00000380492.3	37	c.549	CCDS14162.1	X																																																																																			MOSPD2	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000130150		0.289	MOSPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOSPD2	HGNC	protein_coding	OTTHUMT00000055837.1	-	0.00	71	0	G	NM_152581		14921098	+1	tier1	-	no_errors	ENST00000380492	ensembl	human	known	74_37	silent	12.77	41	6	SNP	0.618	C
MPHOSPH8	54737	genome.wustl.edu	37	13	20216300	20216300	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:20216300G>A	ENST00000361479.5	+	2	327	c.259G>A	c.(259-261)Gat>Aat	p.D87N	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.D87N	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	87	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Histone H3K9me3 binding.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		TACATCGGATGATGATACCTG	0.388																																																	0													83.0	82.0	82.0					13																	20216300		2203	4300	6503	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.259G>A	13.37:g.20216300G>A	ENSP00000355388:p.Asp87Asn		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.D87N	ENST00000361479.5	37	c.259	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011000	0.75046	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.73575	-0.76;-0.76	5.24	5.24	0.73138	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);Chromo domain, conserved site (1);	0.246097	0.46758	N	0.000267	D	0.84629	0.5514	L	0.60904	1.88	0.80722	D	1	D;P;P	0.89917	1.0;0.95;0.865	D;P;P	0.78314	0.991;0.625;0.686	D	0.85323	0.1085	10	0.62326	D	0.03	.	19.241	0.93883	0.0:0.0:1.0:0.0	.	87;87;87	Q99549;Q99549-2;B3KS10	MPP8_HUMAN;.;.	N	87	ENSP00000414663:D87N;ENSP00000355388:D87N	ENSP00000355388:D87N	D	+	1	0	MPHOSPH8	19114300	1.000000	0.71417	0.934000	0.37439	0.047000	0.14425	8.992000	0.93519	2.619000	0.88677	0.650000	0.86243	GAT	MPHOSPH8	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000196199		0.388	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	-	0.00	229	0	G	NM_017520		20216300	+1	tier1	-	no_errors	ENST00000414242	ensembl	human	known	74_37	missense	21.19	93	25	SNP	1.000	A
MPO	4353	genome.wustl.edu	37	17	56349125	56349125	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:56349125C>G	ENST00000225275.3	-	11	2097	c.1921G>C	c.(1921-1923)Gac>Cac	p.D641H	MPO_ENST00000340482.3_Missense_Mutation_p.D673H	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	641					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	ATCCAGATGTCGATGTTGTTG	0.622																																																	0													103.0	70.0	81.0					17																	56349125		2203	4300	6503	SO:0001583	missense	0				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1921G>C	17.37:g.56349125C>G	ENSP00000225275:p.Asp641His		A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.D673H	ENST00000225275.3	37	c.2017	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961574	0.92791	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.80566	-1.39;-1.39	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.93396	0.7894	H	0.97051	3.93	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95561	0.8629	10	0.87932	D	0	-39.4228	17.6717	0.88220	0.0:1.0:0.0:0.0	.	641	P05164	PERM_HUMAN	H	673;641	ENSP00000344419:D673H;ENSP00000225275:D641H	ENSP00000225275:D641H	D	-	1	0	MPO	53704124	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	7.797000	0.85911	2.420000	0.82092	0.563000	0.77884	GAC	MPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	ENSG00000005381		0.622	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	-	0.00	71	0	C			56349125	-1	tier1	-	no_errors	ENST00000340482	ensembl	human	known	74_37	missense	29.41	48	20	SNP	1.000	G
MRPL43	84545	genome.wustl.edu	37	10	102739014	102739014	+	Missense_Mutation	SNP	G	G	T	rs374213077		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:102739014G>T	ENST00000318325.2	-	5	697	c.644C>A	c.(643-645)gCg>gAg	p.A215E	SEMA4G_ENST00000517724.1_Silent_p.T323T|SEMA4G_ENST00000370250.4_Silent_p.T323T|RP11-108L7.4_ENST00000447344.1_RNA|MRPL43_ENST00000370242.4_Missense_Mutation_p.S257R|SEMA4G_ENST00000210633.3_Silent_p.T323T|SEMA4G_ENST00000519756.1_3'UTR|MRPL43_ENST00000370241.3_Intron	NM_176792.2	NP_789762.1	Q8N983	RM43_HUMAN	mitochondrial ribosomal protein L43	215					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|skin(2)|upper_aerodigestive_tract(1)	4		Colorectal(252;0.234)		Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)		CAGCCTTCACGCTGAGCACAC	0.557																																																	0													105.0	87.0	93.0					10																	102739014		2203	4300	6503	SO:0001583	missense	0			AB049656	CCDS7502.1, CCDS7503.1, CCDS7504.1, CCDS7505.1	10q24.31	2012-09-13			ENSG00000055950	ENSG00000055950		"""Mitochondrial ribosomal proteins / large subunits"""	14517	protein-coding gene	gene with protein product		611848					Standard	NM_176792		Approved	bMRP36a	uc001ksa.1	Q8N983	OTTHUMG00000018920	ENST00000318325.2:c.644C>A	10.37:g.102739014G>T	ENSP00000315364:p.Ala215Glu		B1AL06|B1AL07|B1AL09|B1AL10|C9J5Q3|D3DR71|Q5JW06|Q7Z719|Q7Z7H6|Q86XN1|Q9BYC7	Missense_Mutation	SNP	pfam_Ribosome/NADH_DH,superfamily_Thioredoxin-like_fold,smart_Ribosome/NADH_DH	p.S257R	ENST00000318325.2	37	c.771	CCDS7502.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.65|16.65	3.182720|3.182720	0.57800|0.57800	.|.	.|.	ENSG00000055950|ENSG00000055950	ENST00000318325|ENST00000370242	.|.	.|.	.|.	5.82|5.82	-3.54|-3.54	0.04653|0.04653	.|.	.|.	.|.	.|.	.|.	T|T	0.43366|0.43366	0.1244|0.1244	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999997|0.999997	P|B	0.36010|0.18863	0.532|0.031	B|B	0.32090|0.15484	0.14|0.013	T|T	0.18587|0.18587	-1.0332|-1.0332	7|7	0.87932|0.87932	D|D	0|0	-15.904|-15.904	7.762|7.762	0.28957|0.28957	0.4908:0.2316:0.2776:0.0|0.4908:0.2316:0.2776:0.0	.|.	215|257	Q8N983|B1AL06	RM43_HUMAN|.	E|R	215|257	.|.	ENSP00000315364:A215E|ENSP00000359262:S257R	A|S	-|-	2|3	0|2	MRPL43|MRPL43	102729004|102729004	0.113000|0.113000	0.22115|0.22115	0.972000|0.972000	0.41901|0.41901	0.981000|0.981000	0.71138|0.71138	-0.729000|-0.729000	0.04920|0.04920	-0.504000|-0.504000	0.06577|0.06577	0.479000|0.479000	0.44913|0.44913	GCG|AGC	MRPL43	-	NULL	ENSG00000055950		0.557	MRPL43-002	KNOWN	basic|CCDS	protein_coding	MRPL43	HGNC	protein_coding	OTTHUMT00000049902.1	-	0.00	49	0	G			102739014	-1	tier1	-	no_errors	ENST00000370242	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.684	T
MRPS17	51373	genome.wustl.edu	37	7	56022736	56022736	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:56022736C>T	ENST00000285298.4	+	3	387	c.258C>T	c.(256-258)ttC>ttT	p.F86F	MRPS17_ENST00000426595.1_Silent_p.F181F	NM_015969.2	NP_057053.1	Q9Y2R5	RT17_HUMAN	mitochondrial ribosomal protein S17	86					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AGATCGTTTTCAAAGTTGGAA	0.478																																																	0													121.0	121.0	121.0					7																	56022736		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051352	CCDS5520.1	7p11-q11.21	2012-09-13			ENSG00000239789	ENSG00000239789		"""Mitochondrial ribosomal proteins / small subunits"""	14047	protein-coding gene	gene with protein product	"""28S ribosomal protein S17, mitochondrial"""	611980				11279123	Standard	NM_015969		Approved	HSPC011, RPMS17, MRP-S17	uc003trd.3	Q9Y2R5	OTTHUMG00000023153	ENST00000285298.4:c.258C>T	7.37:g.56022736C>T			Q86X15	Silent	SNP	pfam_Ribosomal_S17,superfamily_NA-bd_OB-fold	p.F86	ENST00000285298.4	37	c.258	CCDS5520.1	7																																																																																			MRPS17	-	superfamily_NA-bd_OB-fold	ENSG00000239789		0.478	MRPS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS17	HGNC	protein_coding	OTTHUMT00000251527.2	-	0.00	115	0	C	NM_015969		56022736	+1	tier1	-	no_errors	ENST00000285298	ensembl	human	known	74_37	silent	13.16	66	10	SNP	1.000	T
MRPS22	56945	genome.wustl.edu	37	3	139062880	139062880	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:139062880C>T	ENST00000495075.1	+	3	444	c.12C>T	c.(10-12)ctC>ctT	p.L4L	MRPS22_ENST00000478464.1_5'Flank|MRPS22_ENST00000310776.4_Silent_p.L4L|MRPS22_ENST00000465056.1_Silent_p.L4L			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	4						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						TGGCGCCCCTCGGAACAACTG	0.587																																																	0													51.0	51.0	51.0					3																	139062880		2203	4300	6503	SO:0001819	synonymous_variant	0			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.12C>T	3.37:g.139062880C>T			Q9H3I1	Silent	SNP	pfam_Ribosomal_S22_mit	p.L4	ENST00000495075.1	37	c.12	CCDS3107.1	3																																																																																			MRPS22	-	NULL	ENSG00000175110		0.587	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	HGNC	protein_coding	OTTHUMT00000358120.1	-	0.00	177	0	C	NM_020191		139062880	+1	tier1	-	no_errors	ENST00000310776	ensembl	human	known	74_37	silent	12.98	114	17	SNP	0.000	T
MSR1	4481	genome.wustl.edu	37	8	15998556	15998556	+	Intron	SNP	T	T	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:15998556T>G	ENST00000262101.5	-	8	1155				MSR1_ENST00000445506.2_Intron|MSR1_ENST00000381998.4_Splice_Site|MSR1_ENST00000355282.2_Intron|MSR1_ENST00000350896.3_Intron|MSR1_ENST00000536385.1_Splice_Site			P21757	MSRE_HUMAN	macrophage scavenger receptor 1						cholesterol transport (GO:0030301)|lipoprotein transport (GO:0042953)|plasma lipoprotein particle clearance (GO:0034381)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)	low-density lipoprotein particle binding (GO:0030169)|scavenger receptor activity (GO:0005044)			haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(7)|lung(14)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	37				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		GTACTGGTCCTGACACATATA	0.363																																																	0													86.0	86.0	86.0					8																	15998556		2203	4300	6503	SO:0001627	intron_variant	0			D13263	CCDS5995.1, CCDS5996.1, CCDS5997.1	8p22	2006-02-22			ENSG00000038945	ENSG00000038945		"""CD molecules"""	7376	protein-coding gene	gene with protein product		153622				2251254	Standard	NM_138715		Approved	SCARA1, CD204	uc003wwz.3	P21757	OTTHUMG00000094809	ENST00000262101.5:c.1033+2510A>C	8.37:g.15998556T>G			D3DSP3|O60505|P21759|Q45F10	Splice_Site	SNP	-	e8-2	ENST00000262101.5	37	c.1034-2	CCDS5995.1	8	.	.	.	.	.	.	.	.	.	.	T	9.648	1.140889	0.21205	.	.	ENSG00000038945	ENST00000381998;ENST00000536385	.	.	.	3.8	2.61	0.31194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6333	0.22869	0.2105:0.0:0.0:0.7895	.	.	.	.	.	-1	.	.	.	-	.	.	MSR1	16042927	1.000000	0.71417	0.917000	0.36280	0.435000	0.31806	1.560000	0.36331	0.777000	0.33496	0.528000	0.53228	.	MSR1	-	-	ENSG00000038945		0.363	MSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSR1	HGNC	protein_coding	OTTHUMT00000211627.2		0.00	72	0	T			15998556	-1			no_errors	ENST00000381998	ensembl	human	known	74_37	splice_site	12.20	36	5	SNP	0.948	G
MT-ND5	4540	genome.wustl.edu	37	M	12324	12324	+	5'Flank	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrM:12324C>A	ENST00000361567.2	+	0	0				MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TS2_ENST00000387449.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTGGTGCAACTCCAAATAAAA	0.418																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915			M.37:g.12324C>A	Exception_encountered		Q34773|Q8WCY3	RNA	SNP	-	NULL	ENST00000361567.2	37	NULL		MT																																																																																			MT-TL2	-	-	ENSG00000210191		0.418	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-TL2	HGNC	protein_coding		-	0.00	47	0	C	YP_003024036		12324	+1	tier1	-	no_errors	ENST00000387456	ensembl	human	known	74_37	rna	28.57	5	2	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	12525	12525	+	Silent	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrM:12525C>A	ENST00000361567.2	+	1	189	c.189C>A	c.(187-189)atC>atA	p.I63I	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TS2_ENST00000387449.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	63					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GAAGTTATTATCTCGAACTGA	0.413																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.189C>A	M.37:g.12525C>A			Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.I63M	ENST00000361567.2	37	c.189		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.413	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	46	0	C	YP_003024036		12525	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	16.67	10	2	SNP	NULL	A
MTAP	4507	genome.wustl.edu	37	9	21837923	21837923	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:21837923C>G	ENST00000460874.2	+	5	640	c.415C>G	c.(415-417)Cag>Gag	p.Q139E	MTAP_ENST00000580900.1_Missense_Mutation_p.Q122E|MTAP_ENST00000427788.2_3'UTR|RP11-145E5.5_ENST00000404796.2_Intron|MTAP_ENST00000380172.4_Missense_Mutation_p.Q122E					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		TATGAGACCTCAGTCCTTCTA	0.433																																																	2	Whole gene deletion(2)	lung(2)											246.0	248.0	247.0					9																	21837923		2203	4300	6503	SO:0001583	missense	0			AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.415C>G	9.37:g.21837923C>G	ENSP00000461932:p.Gln139Glu			Missense_Mutation	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_MTAP	p.Q122E	ENST00000460874.2	37	c.364		9	.	.	.	.	.	.	.	.	.	.	C	13.98	2.399462	0.42512	.	.	ENSG00000099810	ENST00000380172	D	0.86432	-2.12	5.7	5.7	0.88788	Nucleoside phosphorylase domain (1);	0.134994	0.53938	D	0.000047	D	0.87160	0.6108	M	0.74467	2.265	0.58432	D	0.999999	P;P	0.41041	0.734;0.736	B;B	0.37692	0.256;0.195	D	0.86287	0.1671	10	0.32370	T	0.25	-21.6389	18.6126	0.91291	0.0:1.0:0.0:0.0	.	139;122	B4DUC8;Q13126	.;MTAP_HUMAN	E	122	ENSP00000369519:Q122E	ENSP00000369519:Q122E	Q	+	1	0	MTAP	21827923	1.000000	0.71417	0.998000	0.56505	0.874000	0.50279	2.972000	0.49256	2.683000	0.91414	0.655000	0.94253	CAG	MTAP	-	pfam_Nucleoside_phosphorylase_d,tigrfam_MTAP	ENSG00000099810		0.433	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	MTAP	HGNC	protein_coding	OTTHUMT00000051929.2		0.00	49	0	C	NM_002451		21837923	+1			no_errors	ENST00000380172	ensembl	human	known	74_37	missense	11.32	47	6	SNP	0.998	G
MTMR10	54893	genome.wustl.edu	37	15	31253256	31253256	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:31253256G>A	ENST00000435680.1	-	7	683	c.586C>T	c.(586-588)Ccc>Tcc	p.P196S	MTMR10_ENST00000425768.1_Silent_p.F165F|MTMR10_ENST00000563714.1_Missense_Mutation_p.P114S|MTMR10_ENST00000314404.8_5'UTR	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	196							phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		tctcctGAGGGAATTCCATTA	0.463																																																	0													28.0	26.0	27.0					15																	31253256		1874	4075	5949	SO:0001583	missense	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.586C>T	15.37:g.31253256G>A	ENSP00000402537:p.Pro196Ser		Q6P4Q6	Missense_Mutation	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.P196S	ENST00000435680.1	37	c.586	CCDS45204.1	15	.	.	.	.	.	.	.	.	.	.	G	5.391	0.257343	0.10239	.	.	ENSG00000166912	ENST00000435680;ENST00000340566	D	0.84442	-1.85	5.15	-0.604	0.11626	.	0.257851	0.14629	N	0.307902	T	0.69124	0.3076	N	0.22421	0.69	0.40083	D	0.976167	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.51426	-0.8707	10	0.16420	T	0.52	.	6.0224	0.19636	0.4408:0.2886:0.2706:0.0	.	114;196	Q9NXD2-2;Q9NXD2	.;MTMRA_HUMAN	S	196;114	ENSP00000402537:P196S	ENSP00000340637:P114S	P	-	1	0	MTMR10	29040548	0.628000	0.27138	0.031000	0.17742	0.490000	0.33462	0.958000	0.29227	-0.067000	0.12976	-0.253000	0.11424	CCC	MTMR10	-	NULL	ENSG00000166912		0.463	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1		0.00	41	0	G	NM_017762		31253256	-1			no_errors	ENST00000435680	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.200	A
MTMR4	9110	genome.wustl.edu	37	17	56585555	56585555	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:56585555C>T	ENST00000323456.5	-	8	756	c.632G>A	c.(631-633)cGc>cAc	p.R211H	MTMR4_ENST00000579925.1_Missense_Mutation_p.R211H	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	211	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTTCCAGGAGCGGAAGGAAGC	0.537																																																	0													73.0	69.0	70.0					17																	56585555		2203	4300	6503	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.632G>A	17.37:g.56585555C>T	ENSP00000325285:p.Arg211His		D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.R211H	ENST00000323456.5	37	c.632	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.719483	0.96839	.	.	ENSG00000108389	ENST00000323456	D	0.94828	-3.53	5.53	5.53	0.82687	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	H	0.97918	4.105	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99425	1.0934	10	0.87932	D	0	.	18.8095	0.92053	0.0:1.0:0.0:0.0	.	211	Q9NYA4	MTMR4_HUMAN	H	211	ENSP00000325285:R211H	ENSP00000325285:R211H	R	-	2	0	MTMR4	53940554	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.758000	0.85224	2.775000	0.95449	0.650000	0.86243	CGC	MTMR4	-	pfam_Myotubularin-like_Pase_dom	ENSG00000108389		0.537	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	-	0.00	69	0	C	NM_004687		56585555	-1	tier1	-	no_errors	ENST00000323456	ensembl	human	known	74_37	missense	13.70	63	10	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9062471	9062471	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:9062471C>G	ENST00000397910.4	-	3	25178	c.24975G>C	c.(24973-24975)ttG>ttC	p.L8325F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8327	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGTGCTGCTCAAATTTGAAG	0.502																																																	0													148.0	141.0	143.0					19																	9062471		2017	4176	6193	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24975G>C	19.37:g.9062471C>G	ENSP00000381008:p.Leu8325Phe		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L8325F	ENST00000397910.4	37	c.24975	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	3.369	-0.128926	0.06753	.	.	ENSG00000181143	ENST00000397910	T	0.45668	0.89	2.5	-2.78	0.05859	.	.	.	.	.	T	0.32645	0.0836	L	0.46157	1.445	.	.	.	D	0.53462	0.96	P	0.47015	0.534	T	0.26985	-1.0087	8	0.87932	D	0	.	0.3547	0.00355	0.1965:0.3122:0.211:0.2803	.	8325	B5ME49	.	F	8325	ENSP00000381008:L8325F	ENSP00000381008:L8325F	L	-	3	2	MUC16	8923471	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.193000	0.03049	-0.511000	0.06514	-0.528000	0.04320	TTG	MUC16	-	NULL	ENSG00000181143		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	88	0	C	NM_024690		9062471	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	19.30	46	11	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9085587	9085587	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:9085587G>T	ENST00000397910.4	-	1	6431	c.6228C>A	c.(6226-6228)ggC>ggA	p.G2076G		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2076	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCCCAGAATGGCCTGAGGACA	0.468																																																	0													159.0	153.0	155.0					19																	9085587		1920	4128	6048	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6228C>A	19.37:g.9085587G>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.G2076	ENST00000397910.4	37	c.6228	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	78	0	G	NM_024690		9085587	-1			no_errors	ENST00000397910	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.006	T
MUC17	140453	genome.wustl.edu	37	7	100678697	100678697	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:100678697G>A	ENST00000306151.4	+	3	4064	c.4000G>A	c.(4000-4002)Gaa>Aaa	p.E1334K		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1334	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					AACTTATAGTGAAGGAAGAAC	0.458																																																	0													239.0	230.0	233.0					7																	100678697		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4000G>A	7.37:g.100678697G>A	ENSP00000302716:p.Glu1334Lys		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.E1334K	ENST00000306151.4	37	c.4000	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	g	3.185	-0.166999	0.06461	.	.	ENSG00000169876	ENST00000306151	T	0.02631	4.22	0.613	0.613	0.17597	.	.	.	.	.	T	0.01156	0.0038	N	0.08118	0	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.43988	-0.9357	8	0.09084	T	0.74	.	.	.	.	.	1334	Q685J3	MUC17_HUMAN	K	1334	ENSP00000302716:E1334K	ENSP00000302716:E1334K	E	+	1	0	MUC17	100465417	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-0.013000	0.12678	0.637000	0.30526	0.134000	0.15878	GAA	MUC17	-	NULL	ENSG00000169876		0.458	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	115	0	G	NM_001040105		100678697	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	7.45	86	7	SNP	0.023	A
MUC2	4583	genome.wustl.edu	37	11	1079734	1079734	+	Silent	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:1079734G>C	ENST00000441003.2	+	7	978	c.951G>C	c.(949-951)gtG>gtC	p.V317V	MUC2_ENST00000359061.5_Silent_p.V317V	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	317	TIL.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACCTGGAGGTGAGCAGCCTGT	0.667																																																	0													16.0	21.0	20.0					11																	1079734		2106	4192	6298	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.951G>C	11.37:g.1079734G>C			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V317	ENST00000441003.2	37	c.951		11																																																																																			MUC2	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000198788		0.667	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	-	0.00	111	0	G	NM_002457		1079734	+1	tier1	-	no_errors	ENST00000441003	ensembl	human	known	74_37	silent	7.50	111	9	SNP	0.006	C
MYBPC1	4604	genome.wustl.edu	37	12	102061574	102061574	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:102061574G>T	ENST00000550270.1	+	22	2400	c.2400G>T	c.(2398-2400)ctG>ctT	p.L800L	MYBPC1_ENST00000452455.2_Silent_p.L800L|MYBPC1_ENST00000549145.1_Silent_p.L813L|MYBPC1_ENST00000361466.2_Silent_p.L807L|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000547405.1_Silent_p.L756L|MYBPC1_ENST00000441232.1_Silent_p.L800L|MYBPC1_ENST00000361685.2_Silent_p.L807L|MYBPC1_ENST00000553190.1_Silent_p.L782L|MYBPC1_ENST00000547509.1_Silent_p.L768L|MYBPC1_ENST00000392934.3_Silent_p.L769L|MYBPC1_ENST00000360610.2_Silent_p.L800L|MYBPC1_ENST00000536007.1_Silent_p.L763L|MYBPC1_ENST00000545503.2_Silent_p.L782L|MYBPC1_ENST00000551300.1_Silent_p.L683L|MYBPC1_ENST00000541119.1_Silent_p.L770L			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	800	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.L807L(1)|p.L800L(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TCACAGGTCTGCCAACAGATG	0.458																																																	2	Substitution - coding silent(2)	endometrium(2)											105.0	92.0	97.0					12																	102061574		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.2400G>T	12.37:g.102061574G>T			B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L807	ENST00000550270.1	37	c.2421	CCDS9085.1	12																																																																																			MYBPC1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000196091		0.458	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1		0.00	70	0	G			102061574	+1			no_errors	ENST00000361466	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.990	T
MYEOV	26579	genome.wustl.edu	37	11	69063413	69063413	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:69063413G>A	ENST00000308946.3	+	3	946	c.496G>A	c.(496-498)Gga>Aga	p.G166R	MYEOV_ENST00000441339.2_Missense_Mutation_p.G166R|MYEOV_ENST00000535407.1_Missense_Mutation_p.G108R	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	166										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		TGCTCACCTGGGAGAAGCCTT	0.592																																																	0													220.0	211.0	214.0					11																	69063413		2200	4294	6494	SO:0001583	missense	0			AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.496G>A	11.37:g.69063413G>A	ENSP00000308330:p.Gly166Arg		Q9UGN6|Q9UGN7	Missense_Mutation	SNP	NULL	p.G166R	ENST00000308946.3	37	c.496	CCDS8190.1	11	.	.	.	.	.	.	.	.	.	.	G	9.124	1.009648	0.19277	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.28895	1.61;1.61;1.59	1.44	-1.96	0.07525	.	.	.	.	.	T	0.15869	0.0382	N	0.08118	0	0.09310	N	1	D	0.56035	0.974	P	0.45856	0.495	T	0.15780	-1.0425	9	0.87932	D	0	.	5.1807	0.15158	0.5778:0.0:0.4222:0.0	.	166	Q96EZ4	MYEOV_HUMAN	R	166;166;108	ENSP00000412482:G166R;ENSP00000308330:G166R;ENSP00000438100:G108R	ENSP00000308330:G166R	G	+	1	0	MYEOV	68819989	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.038000	0.12144	-0.680000	0.05211	0.436000	0.28706	GGA	MYEOV	-	NULL	ENSG00000172927		0.592	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MYEOV	HGNC	protein_coding	OTTHUMT00000396548.1	-	0.00	69	0	G			69063413	+1	tier1	-	no_errors	ENST00000308946	ensembl	human	known	74_37	missense	79.26	45	172	SNP	0.000	A
MYH1	4619	genome.wustl.edu	37	17	10416983	10416983	+	Silent	SNP	G	G	A	rs565550881		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:10416983G>A	ENST00000226207.5	-	9	859	c.765C>T	c.(763-765)ttC>ttT	p.F255F	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	255	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTGTGGTACCGAAGTGGATCC	0.388													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21800	0.0		0.0	False		,,,				2504	0.0																0													113.0	112.0	112.0					17																	10416983		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.765C>T	17.37:g.10416983G>A			Q14CA4|Q9Y622	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F255	ENST00000226207.5	37	c.765	CCDS11155.1	17																																																																																			MYH1	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000109061		0.388	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	-	0.00	76	0	G	NM_005963		10416983	-1	tier1	-	no_errors	ENST00000226207	ensembl	human	known	74_37	silent	13.89	62	10	SNP	0.999	A
MYO16	23026	genome.wustl.edu	37	13	109318403	109318403	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:109318403C>A	ENST00000357550.2	+	1	173	c.132C>A	c.(130-132)ttC>ttA	p.F44L	MYO16_ENST00000356711.2_Missense_Mutation_p.F44L|MYO16_ENST00000251041.5_Missense_Mutation_p.F44L	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			AGGAAGGGTTCCTGAAAAGGC	0.502																																																	0													80.0	71.0	74.0					13																	109318403		2203	4300	6503	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.132C>A	13.37:g.109318403C>A	ENSP00000350160:p.Phe44Leu			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F44L	ENST00000357550.2	37	c.132	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.154447	0.00325	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041	T;T;T	0.48201	0.82;0.82;0.82	5.37	2.52	0.30459	.	1.123880	0.07084	N	0.837515	T	0.25494	0.0620	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20371	-1.0277	9	.	.	.	.	5.7096	0.17927	0.1238:0.6332:0.1209:0.1222	.	44;44	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	L	44	ENSP00000349145:F44L;ENSP00000350160:F44L;ENSP00000251041:F44L	.	F	+	3	2	MYO16	108116404	0.008000	0.16893	0.137000	0.22149	0.006000	0.05464	-0.291000	0.08343	1.237000	0.43756	-0.182000	0.12963	TTC	MYO16	-	NULL	ENSG00000041515		0.502	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	-	0.00	90	0	C	NM_015011		109318403	+1	tier1	-	no_errors	ENST00000356711	ensembl	human	known	74_37	missense	33.90	39	20	SNP	0.000	A
MYO1A	4640	genome.wustl.edu	37	12	57422572	57422573	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:57422572_57422573insT	ENST00000442789.2	-	29	3385_3386	c.3098_3099insA	c.(3097-3099)aagfs	p.K1033fs	TAC3_ENST00000415231.1_5'UTR|MYO1A_ENST00000544473.1_Frame_Shift_Ins_p.K871fs|MYO1A_ENST00000300119.3_Frame_Shift_Ins_p.K1033fs	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	1033	Myosin tail. {ECO:0000255}.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.?(1)		breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						AATGACTCCCCTTTTTTTTGTA	0.559																																																	1	Unknown(1)	skin(1)																																								SO:0001589	frameshift_variant	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.3099dupA	12.37:g.57422580_57422580dupT	ENSP00000393392:p.Lys1033fs		Q9UQD7	Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.S1035fs	ENST00000442789.2	37	c.3099_3098	CCDS8929.1	12																																																																																			MYO1A	-	pfam_Myosin_tail_2	ENSG00000166866		0.559	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2		0.00	63	0	0	NM_005379		57422573	-1			no_errors	ENST00000300119	ensembl	human	known	74_37	frame_shift_ins	5.43	87	5	INS	1.000:1.000	T
MYOF	26509	genome.wustl.edu	37	10	95085666	95085666	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:95085666G>A	ENST00000359263.4	-	46	5187	c.5188C>T	c.(5188-5190)Cac>Tac	p.H1730Y	MYOF_ENST00000358334.5_Missense_Mutation_p.H1717Y|MYOF_ENST00000371502.4_Missense_Mutation_p.H1749Y|MYOF_ENST00000485212.1_5'UTR|MYOF_ENST00000371501.4_Missense_Mutation_p.H1730Y	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1730					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CTGAGGATGTGAAGAGCAAGC	0.547																																																	0													93.0	99.0	97.0					10																	95085666		1915	4121	6036	SO:0001583	missense	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.5188C>T	10.37:g.95085666G>A	ENSP00000352208:p.His1730Tyr		B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.H1730Y	ENST00000359263.4	37	c.5188	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707187	0.30232	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.86164	-2.08;-2.08;-2.08;-1.69	5.85	1.24	0.21308	.	0.196102	0.53938	N	0.000047	T	0.74974	0.3787	N	0.21142	0.635	0.42268	D	0.992041	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.62006	-0.6945	10	0.18276	T	0.48	-10.6606	10.3451	0.43901	0.4446:0.0:0.5554:0.0	.	1717;1730	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	Y	1717;1730;1730;1749	ENSP00000351094:H1717Y;ENSP00000352208:H1730Y;ENSP00000360556:H1730Y;ENSP00000360557:H1749Y	ENSP00000351094:H1717Y	H	-	1	0	MYOF	95075656	1.000000	0.71417	0.996000	0.52242	0.936000	0.57629	2.916000	0.48813	0.347000	0.23924	-0.355000	0.07637	CAC	MYOF	-	NULL	ENSG00000138119		0.547	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	-	0.00	71	0	G	NM_013451		95085666	-1	tier1	-	no_errors	ENST00000359263	ensembl	human	known	74_37	missense	12.07	51	7	SNP	0.977	A
NCOR1	9611	genome.wustl.edu	37	17	15995266	15995266	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:15995266T>G	ENST00000268712.3	-	22	3184	c.2927A>C	c.(2926-2928)cAg>cCg	p.Q976P	NCOR1_ENST00000395848.1_Missense_Mutation_p.Q883P|NCOR1_ENST00000395851.1_Missense_Mutation_p.Q992P	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	976					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCTCTGCCGCTGCTCCTCCAG	0.483																																																	0													150.0	140.0	144.0					17																	15995266		2203	4300	6503	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.2927A>C	17.37:g.15995266T>G	ENSP00000268712:p.Gln976Pro		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q976P	ENST00000268712.3	37	c.2927	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407308	0.62399	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395848	T;T;T	0.38722	1.12;1.12;1.12	4.84	4.84	0.62591	.	0.166543	0.53938	D	0.000049	T	0.49558	0.1564	L	0.31578	0.945	0.80722	D	1	D;D;D;D	0.59357	0.978;0.985;0.963;0.978	D;P;P;P	0.66196	0.942;0.541;0.527;0.719	T	0.43261	-0.9402	10	0.34782	T	0.22	-7.6675	14.294	0.66300	0.0:0.0:0.0:1.0	.	883;883;976;992	E9PGV6;Q7Z516;O75376;O75376-2	.;.;NCOR1_HUMAN;.	P	976;992;883;883	ENSP00000268712:Q976P;ENSP00000379192:Q992P;ENSP00000379189:Q883P	ENSP00000268712:Q976P	Q	-	2	0	NCOR1	15935991	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.155000	0.64900	2.102000	0.63906	0.528000	0.53228	CAG	NCOR1	-	NULL	ENSG00000141027		0.483	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	-	0.00	59	0	T	NM_006311		15995266	-1	tier1	-	no_errors	ENST00000268712	ensembl	human	known	74_37	missense	13.85	56	9	SNP	1.000	G
NEDD4	4734	genome.wustl.edu	37	15	56207921	56207921	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:56207921G>C	ENST00000508342.1	-	1	1408	c.1109C>G	c.(1108-1110)tCt>tGt	p.S370C	NEDD4_ENST00000338963.2_Missense_Mutation_p.S370C|NEDD4_ENST00000435532.3_Intron|NEDD4_ENST00000506154.1_Missense_Mutation_p.S370C	NM_001284338.1	NP_001271267.1	P46934	NEDD4_HUMAN	neural precursor cell expressed, developmentally down-regulated 4, E3 ubiquitin protein ligase	370					adaptive immune response (GO:0002250)|blood vessel morphogenesis (GO:0048514)|cellular response to UV (GO:0034644)|cytokine-mediated signaling pathway (GO:0019221)|development involved in symbiotic interaction (GO:0044111)|endocardial cushion development (GO:0003197)|glucocorticoid receptor signaling pathway (GO:0042921)|lysosomal transport (GO:0007041)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010768)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|neuromuscular junction development (GO:0007528)|neuron projection development (GO:0031175)|outflow tract morphogenesis (GO:0003151)|positive regulation of nucleocytoplasmic transport (GO:0046824)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein catabolic process (GO:0045732)|progesterone receptor signaling pathway (GO:0050847)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|protein targeting to lysosome (GO:0006622)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|receptor internalization (GO:0031623)|regulation of dendrite morphogenesis (GO:0048814)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of synapse organization (GO:0050807)|response to calcium ion (GO:0051592)|T cell activation (GO:0042110)|transmission of virus (GO:0019089)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	apicolateral plasma membrane (GO:0016327)|cell cortex (GO:0005938)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	beta-2 adrenergic receptor binding (GO:0031698)|ligase activity (GO:0016874)|phosphoserine binding (GO:0050815)|phosphothreonine binding (GO:0050816)|proline-rich region binding (GO:0070064)|protein domain specific binding (GO:0019904)|RNA polymerase binding (GO:0070063)|sodium channel inhibitor activity (GO:0019871)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	43				all cancers(107;0.0299)|GBM - Glioblastoma multiforme(80;0.113)		ATATCCTTCAGATGACTTTTC	0.403																																																	0													50.0	50.0	50.0					15																	56207921		2192	4291	6483	SO:0001583	missense	0			D42055	CCDS10156.1, CCDS45265.1, CCDS61643.1, CCDS61644.1	15q	2012-02-23	2012-02-23		ENSG00000069869	ENSG00000069869			7727	protein-coding gene	gene with protein product	"""receptor-potentiating factor 1"""	602278	"""neural precursor cell expressed, developmentally down-regulated 4"""			9073511, 8649367	Standard	XR_243101		Approved	KIAA0093, MGC176705, NEDD4-1, RPF1	uc002adi.3	P46934	OTTHUMG00000132015	ENST00000508342.1:c.1109C>G	15.37:g.56207921G>C	ENSP00000424827:p.Ser370Cys		A1KY35|A6ND72|A7MD29|B4E2R7|B7ZM59|B7ZM60|B9EGN5|D6RF89	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_WW_dom	p.S370C	ENST00000508342.1	37	c.1109		15	.	.	.	.	.	.	.	.	.	.	G	8.531	0.871108	0.17322	.	.	ENSG00000069869	ENST00000508342;ENST00000338963;ENST00000506154	T;T;T	0.47177	0.85;0.85;0.85	5.46	3.54	0.40534	.	.	.	.	.	T	0.38878	0.1057	L	0.47716	1.5	0.09310	N	1	P;P;P	0.44816	0.844;0.758;0.844	B;B;B	0.39379	0.298;0.156;0.298	T	0.22871	-1.0204	9	0.59425	D	0.04	.	7.2893	0.26356	0.0774:0.0:0.617:0.3056	.	370;370;370	P46934-2;P46934;P46934-3	.;NEDD4_HUMAN;.	C	370	ENSP00000424827:S370C;ENSP00000345530:S370C;ENSP00000422705:S370C	ENSP00000345530:S370C	S	-	2	0	NEDD4	53995213	0.995000	0.38212	0.002000	0.10522	0.122000	0.20287	8.126000	0.89592	0.653000	0.30826	-0.535000	0.04281	TCT	NEDD4	-	NULL	ENSG00000069869		0.403	NEDD4-002	KNOWN	basic	protein_coding	NEDD4	HGNC	protein_coding	OTTHUMT00000359817.1	-	0.00	43	0	G	NM_198400		56207921	-1	tier1	-	no_errors	ENST00000508342	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.002	C
NELFE	7936	genome.wustl.edu	37	6	31922195	31922195	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:31922195C>T	ENST00000375429.3	-	8	993	c.767G>A	c.(766-768)cGa>cAa	p.R256Q	NELFE_ENST00000444811.2_Missense_Mutation_p.R226Q|MIR1236_ENST00000408340.1_RNA|NELFE_ENST00000375425.5_Missense_Mutation_p.R263Q	NM_002904.5	NP_002895.3	P18615	NELFE_HUMAN	negative elongation factor complex member E	256					gene expression (GO:0010467)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										CCTAGGGGCTCGCCGTTCAGG	0.483																																																	0													94.0	86.0	89.0					6																	31922195		2203	4300	6503	SO:0001583	missense	0			M33230	CCDS4730.1	6p21.3	2013-02-12	2013-01-31	2013-01-31	ENSG00000204356	ENSG00000204356		"""RNA binding motif (RRM) containing"""	13974	protein-coding gene	gene with protein product		154040	"""RD RNA-binding protein"", ""RD RNA binding protein"""	RDBP			Standard	XM_006715205		Approved	RD, D6S45, NELF-E, RDP	uc003nyk.3	P18615	OTTHUMG00000031046	ENST00000375429.3:c.767G>A	6.37:g.31922195C>T	ENSP00000364578:p.Arg256Gln		A2BE08|B4DUN1|B4DYX9|Q5JP74|Q5JP75|Q96F56|Q9NPK2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R256Q	ENST00000375429.3	37	c.767	CCDS4730.1	6	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812152	0.90707	.	.	ENSG00000204356	ENST00000375429;ENST00000375425;ENST00000444811;ENST00000441998;ENST00000454913;ENST00000436289	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.42	5.42	0.78866	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	L	0.34521	1.04	0.58432	D	0.99999	D;D;D	0.63880	0.993;0.993;0.993	P;P;P	0.47827	0.558;0.558;0.558	T	0.04090	-1.0978	10	0.45353	T	0.12	-14.3846	18.002	0.89200	0.0:1.0:0.0:0.0	.	226;251;256	B4DUN1;E9PCL7;P18615	.;.;NELFE_HUMAN	Q	256;263;226;251;256;251	ENSP00000364578:R256Q;ENSP00000364574:R263Q;ENSP00000388400:R226Q;ENSP00000397914:R251Q;ENSP00000409389:R256Q	ENSP00000364574:R263Q	R	-	2	0	RDBP	32030174	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	5.421000	0.66447	2.549000	0.85964	0.655000	0.94253	CGA	NELFE	-	NULL	ENSG00000204356		0.483	NELFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NELFE	HGNC	protein_coding	OTTHUMT00000076047.4	-	0.00	55	0	C			31922195	-1	tier1	-	no_errors	ENST00000375429	ensembl	human	known	74_37	missense	20.75	42	11	SNP	1.000	T
NEMF	9147	genome.wustl.edu	37	14	50319482	50319482	+	5'UTR	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:50319482G>A	ENST00000298310.5	-	0	439				RN7SL3_ENST00000578231.1_RNA|NEMF_ENST00000545773.1_5'UTR|NEMF_ENST00000556672.1_5'UTR|NEMF_ENST00000546046.1_5'UTR			O60524	NEMF_HUMAN	nuclear export mediator factor						nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						GGCGAGGCCCGAGGGTCACTA	0.637											OREG0022668	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													53.0	52.0	52.0					14																	50319482		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.-11C>T	14.37:g.50319482G>A		968	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	RNA	SNP	-	NULL	ENST00000298310.5	37	NULL	CCDS9694.1	14																																																																																			NEMF	-	-	ENSG00000165525		0.637	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEMF	HGNC	protein_coding	OTTHUMT00000410798.1	-	0.00	25	0	G	NM_004713		50319482	-1	tier1	-	no_errors	ENST00000554162	ensembl	human	known	74_37	rna	27.27	24	9	SNP	0.000	A
NEU1	4758	genome.wustl.edu	37	6	31828301	31828301	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:31828301G>A	ENST00000375631.4	-	4	842	c.713C>T	c.(712-714)gCc>gTc	p.A238V		NM_000434.3	NP_000425.1	Q99519	NEUR1_HUMAN	sialidase 1 (lysosomal sialidase)	238					glycosphingolipid metabolic process (GO:0006687)|lipid catabolic process (GO:0016042)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10					Oseltamivir(DB00198)	GCGCCAGGAGGCACCATGATC	0.597																																																	0													138.0	123.0	128.0					6																	31828301		2203	4300	6503	SO:0001583	missense	0			AF040958	CCDS4723.1	6p21	2012-10-02			ENSG00000204386	ENSG00000204386	3.2.1.18		7758	protein-coding gene	gene with protein product		608272		NEU		9054950	Standard	NM_000434		Approved		uc003nxq.4	Q99519	OTTHUMG00000031284	ENST00000375631.4:c.713C>T	6.37:g.31828301G>A	ENSP00000364782:p.Ala238Val			Missense_Mutation	SNP	superfamily_Sialidases	p.A238V	ENST00000375631.4	37	c.713	CCDS4723.1	6	.	.	.	.	.	.	.	.	.	.	G	3.006	-0.204974	0.06180	.	.	ENSG00000204386	ENST00000375631	D	0.84146	-1.81	5.32	3.51	0.40186	Neuraminidase (2);	0.795833	0.11898	N	0.518967	T	0.47857	0.1468	N	0.11651	0.15	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.003	T	0.36286	-0.9754	10	0.27785	T	0.31	-18.2575	4.0511	0.09796	0.0855:0.1605:0.588:0.166	.	238;238	E9PIF4;Q99519	.;NEUR1_HUMAN	V	238	ENSP00000364782:A238V	ENSP00000364782:A238V	A	-	2	0	NEU1	31936280	0.001000	0.12720	0.325000	0.25375	0.184000	0.23303	0.403000	0.20982	0.796000	0.33947	0.655000	0.94253	GCC	NEU1	-	superfamily_Sialidases	ENSG00000204386		0.597	NEU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEU1	HGNC	protein_coding	OTTHUMT00000076616.2	-	0.00	50	0	G			31828301	-1	tier1	-	no_errors	ENST00000375631	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.001	A
NLRC4	58484	genome.wustl.edu	37	2	32475208	32475208	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:32475208A>T	ENST00000404025.2	-	5	2213	c.1725T>A	c.(1723-1725)ttT>ttA	p.F575L	NLRC4_ENST00000402280.1_Missense_Mutation_p.F575L|NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Missense_Mutation_p.F575L			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	575					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					AGAAAGCTTCAAATTCTTGGC	0.383																																																	0													99.0	96.0	97.0					2																	32475208		2203	4300	6503	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1725T>A	2.37:g.32475208A>T	ENSP00000385090:p.Phe575Leu		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_CARD	p.F575L	ENST00000404025.2	37	c.1725	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	A	6.521	0.464347	0.12402	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000404025	T;T;T	0.48836	0.8;0.8;0.8	3.0	0.645	0.17782	.	0.000000	0.49916	D	0.000129	T	0.29914	0.0748	L	0.29908	0.895	0.32240	N	0.572908	P	0.51057	0.941	B	0.42916	0.402	T	0.39354	-0.9618	9	0.23302	T	0.38	.	6.7097	0.23270	0.7777:0.0:0.2223:0.0	.	575	Q9NPP4	NLRC4_HUMAN	L	575	ENSP00000354159:F575L;ENSP00000385428:F575L;ENSP00000385090:F575L	ENSP00000354159:F575L	F	-	3	2	NLRC4	32328712	1.000000	0.71417	0.839000	0.33178	0.002000	0.02628	1.690000	0.37711	0.140000	0.18849	-0.451000	0.05528	TTT	NLRC4	-	NULL	ENSG00000091106		0.383	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	-	0.00	69	0	A	NM_021209		32475208	-1	tier1	-	no_errors	ENST00000360906	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.996	T
NGEF	25791	genome.wustl.edu	37	2	233785105	233785105	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:233785105G>A	ENST00000264051.3	-	5	995	c.717C>T	c.(715-717)atC>atT	p.I239I	NGEF_ENST00000409079.1_Silent_p.I147I|NGEF_ENST00000373552.4_Silent_p.I147I	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	239	Regulatory region; modulates activity toward RHOA, RAC1 and CDC42. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		TGAGCAGGCAGATCTGGGGCA	0.617																																																	0													65.0	69.0	67.0					2																	233785105		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.717C>T	2.37:g.233785105G>A			B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.I239	ENST00000264051.3	37	c.717	CCDS2500.1	2																																																																																			NGEF	-	NULL	ENSG00000066248		0.617	NGEF-001	KNOWN	basic|CCDS	protein_coding	NGEF	HGNC	protein_coding	OTTHUMT00000257051.2	-	0.00	42	0	G	XM_044799		233785105	-1	tier1	-	no_errors	ENST00000264051	ensembl	human	known	74_37	silent	11.11	56	7	SNP	1.000	A
NLRP7	199713	genome.wustl.edu	37	19	55451629	55451629	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:55451629C>T	ENST00000590030.1	-	3	598	c.558G>A	c.(556-558)acG>acA	p.T186T	NLRP7_ENST00000448121.2_Silent_p.T186T|NLRP7_ENST00000588756.1_Silent_p.T186T|NLRP7_ENST00000592784.1_Silent_p.T186T|NLRP7_ENST00000340844.2_Silent_p.T186T|NLRP7_ENST00000446217.1_Silent_p.T214T|NLRP7_ENST00000328092.5_Silent_p.T186T			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	186	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TTTTGGCCAGCGTGGTTTTCC	0.577																																																	0													121.0	121.0	121.0					19																	55451629		2203	4300	6503	SO:0001819	synonymous_variant	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.558G>A	19.37:g.55451629C>T			E9PE16|Q32MH8|Q7RTR1	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.T214	ENST00000590030.1	37	c.642	CCDS33109.1	19																																																																																			NLRP7	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000167634		0.577	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1		0.00	77	0	C	NM_139176		55451629	-1			no_errors	ENST00000446217	ensembl	human	known	74_37	silent	5.06	75	4	SNP	0.010	T
NPIPB4	440345	genome.wustl.edu	37	16	21858850	21858850	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:21858850G>C	ENST00000415645.2	-	2	172	c.133C>G	c.(133-135)Ctg>Gtg	p.L45V	NPIPB4_ENST00000451409.1_5'UTR|NPIPB4_ENST00000357370.5_Missense_Mutation_p.L45V|NPIPB4_ENST00000539318.1_5'UTR			C9JG80	NPIB4_HUMAN	nuclear pore complex interacting protein family, member B4	45						integral component of membrane (GO:0016021)											TGGTCAGCCAGAGTATTGATA	0.378																																																	0																																										SO:0001583	missense	0					16p12.2	2013-06-11			ENSG00000185864	ENSG00000185864			41985	protein-coding gene	gene with protein product							Standard	XM_006721108		Approved			C9JG80	OTTHUMG00000163555	ENST00000415645.2:c.133C>G	16.37:g.21858850G>C	ENSP00000404439:p.Leu45Val			Missense_Mutation	SNP	NULL	p.L45V	ENST00000415645.2	37	c.133		16	.	.	.	.	.	.	.	.	.	.	.	9.337	1.062143	0.19987	.	.	ENSG00000185864	ENST00000415645;ENST00000357370;ENST00000341400;ENST00000518761;ENST00000543654	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	0.589	-0.797	0.10909	.	.	.	.	.	T	0.60818	0.2298	.	.	.	.	.	.	P;P	0.44776	0.843;0.569	D;P	0.63957	0.92;0.831	T	0.65269	-0.6209	6	0.56958	D	0.05	.	.	.	.	.	45;45	C9JG80;Q92617	.;NPPL3_HUMAN	V	45;45;45;45;26	ENSP00000404439:L45V;ENSP00000349936:L45V;ENSP00000339196:L45V;ENSP00000429543:L45V;ENSP00000439732:L26V	ENSP00000339196:L45V	L	-	1	2	RP11-645C24.1	21766351	0.005000	0.15991	0.003000	0.11579	0.016000	0.09150	-0.213000	0.09305	-0.272000	0.09259	0.175000	0.17021	CTG	NPIPB4	-	NULL	ENSG00000185864		0.378	NPIPB4-202	KNOWN	basic|appris_principal	protein_coding	NPIPB4	HGNC	protein_coding		-	0.00	341	0	G			21858850	-1	tier1	-	no_errors	ENST00000415645	ensembl	human	known	74_37	missense	12.20	223	31	SNP	0.003	C
NPTX1	4884	genome.wustl.edu	37	17	78445639	78445639	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:78445639C>T	ENST00000306773.4	-	4	1127	c.970G>A	c.(970-972)Ggg>Agg	p.G324R	NPTX1_ENST00000575212.1_5'Flank	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	324	Pentaxin.				axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			TCCCAGACCCCGTCCCGGGTG	0.622																																																	0													56.0	45.0	49.0					17																	78445639		2203	4300	6503	SO:0001583	missense	0			U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.970G>A	17.37:g.78445639C>T	ENSP00000307549:p.Gly324Arg		B3KXH3|Q5FWE6	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.G324R	ENST00000306773.4	37	c.970	CCDS32762.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.262824	0.95399	.	.	ENSG00000171246	ENST00000306773;ENST00000535681	T	0.22945	1.93	5.02	5.02	0.67125	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.63248	0.2495	M	0.93420	3.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74203	-0.3741	10	0.87932	D	0	-31.6303	18.1318	0.89604	0.0:1.0:0.0:0.0	.	324	Q15818	NPTX1_HUMAN	R	324;86	ENSP00000307549:G324R	ENSP00000307549:G324R	G	-	1	0	NPTX1	76060234	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	7.582000	0.82546	2.607000	0.88179	0.561000	0.74099	GGG	NPTX1	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	ENSG00000171246		0.622	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX1	HGNC	protein_coding	OTTHUMT00000438051.1	-	0.00	130	0	C			78445639	-1	tier1	-	no_errors	ENST00000306773	ensembl	human	known	74_37	missense	10.53	102	12	SNP	1.000	T
NSUN4	387338	genome.wustl.edu	37	1	46808187	46808187	+	Intron	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:46808187G>T	ENST00000474844.1	+	1	743				NSUN4_ENST00000536062.1_Intron|NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_Intron	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					AGGCTCCCAGGAAGGCTTGCA	0.592																																																	0																																										SO:0001627	intron_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.93+1596G>T	1.37:g.46808187G>T			A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			NSUN4	-	-	ENSG00000117481		0.592	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1	-	0.00	87	0	G	NM_199044		46808187	+1	tier1	-	no_errors	ENST00000498008	ensembl	human	known	74_37	rna	7.81	59	5	SNP	0.000	T
NTM	50863	genome.wustl.edu	37	11	132205624	132205624	+	3'UTR	DEL	T	T	-			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:132205624delT	ENST00000374786.1	+	0	2098				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						ACCGTTAAACTTTTTTTTTTT	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*584T>-	11.37:g.132205624delT			A0MTT2|Q6UXJ3|Q86VJ9	RNA	DEL	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.294	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1		0.00	22	0	T	NM_016522		132205624	+1	tier1		no_errors	ENST00000474900	ensembl	human	known	74_37	rna	13.51	32	5	DEL	0.000	-
NUGGC	389643	genome.wustl.edu	37	8	27925049	27925049	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:27925049G>T	ENST00000413272.2	-	6	835	c.693C>A	c.(691-693)atC>atA	p.I231I	NUGGC_ENST00000341513.6_Silent_p.I231I	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	231					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										CCTTGAGGGTGATGACTCTGG	0.478																																																	0													65.0	65.0	65.0					8																	27925049		1984	4162	6146	SO:0001819	synonymous_variant	0			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.693C>A	8.37:g.27925049G>T			Q6ZP73	Silent	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.I231	ENST00000413272.2	37	c.693	CCDS47833.1	8																																																																																			NUGGC	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	ENSG00000189233		0.478	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1	-	0.00	107	0	G	NM_001010906		27925049	-1	tier1	-	no_errors	ENST00000341513	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	153994695	153994695	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:153994695G>T	ENST00000368559.3	-	32	4494	c.4423C>A	c.(4423-4425)Cct>Act	p.P1475T	NUP210L_ENST00000271854.3_Missense_Mutation_p.P1475T|NUP210L_ENST00000368553.1_Missense_Mutation_p.P408T	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1475					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ACAGCAACAGGAATATAATCT	0.488																																																	0													128.0	126.0	127.0					1																	153994695		2022	4188	6210	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.4423C>A	1.37:g.153994695G>T	ENSP00000357547:p.Pro1475Thr		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.P1475T	ENST00000368559.3	37	c.4423	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110449	0.77210	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.23950	3.47;1.88;3.21	6.08	6.08	0.98989	.	0.000000	0.64402	D	0.000003	T	0.37945	0.1022	M	0.69358	2.11	0.42936	D	0.994338	D;D	0.89917	1.0;1.0	D;D	0.85130	0.986;0.997	T	0.05989	-1.0852	10	0.11182	T	0.66	-19.2793	18.4451	0.90681	0.0:0.0:1.0:0.0	.	1475;1475	E7EP56;Q5VU65	.;P210L_HUMAN	T	1475;408;1475	ENSP00000357547:P1475T;ENSP00000357541:P408T;ENSP00000271854:P1475T	ENSP00000271854:P1475T	P	-	1	0	NUP210L	152261319	1.000000	0.71417	0.991000	0.47740	0.981000	0.71138	4.343000	0.59348	2.894000	0.99253	0.591000	0.81541	CCT	NUP210L	-	NULL	ENSG00000143552		0.488	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	-	0.00	92	0	G	NM_207308		153994695	-1	tier1	-	no_errors	ENST00000368559	ensembl	human	known	74_37	missense	8.99	81	8	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228529252	228529252	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:228529252A>T	ENST00000422127.1	+	74	18015	c.17971A>T	c.(17971-17973)Atc>Ttc	p.I5991F	OBSCN_ENST00000366707.4_Missense_Mutation_p.I3625F|OBSCN_ENST00000570156.2_Missense_Mutation_p.I6948F|OBSCN_ENST00000366709.4_Missense_Mutation_p.I3110F|OBSCN_ENST00000284548.11_Missense_Mutation_p.I5991F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5991	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GACAGCCATTATCAAGAGCTC	0.652																																																	0													46.0	58.0	54.0					1																	228529252		2177	4270	6447	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.17971A>T	1.37:g.228529252A>T	ENSP00000409493:p.Ile5991Phe		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.I5991F	ENST00000422127.1	37	c.17971	CCDS58065.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.20|18.20	3.572130|3.572130	0.65765|0.65765	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	T;T;T;T|.	0.11930|.	2.73;2.73;2.73;2.73|.	5.48|5.48	4.36|4.36	0.52297|0.52297	Pleckstrin homology-type (1);Pleckstrin homology domain (2);|.	0.138751|.	0.47093|.	D|.	0.000258|.	T|T	0.65407|0.65407	0.2688|0.2688	M|M	0.69358|0.69358	2.11|2.11	0.42535|0.42535	D|D	0.993055|0.993055	D;D|.	0.54397|.	0.966;0.958|.	P;P|.	0.53809|.	0.603;0.735|.	T|T	0.66006|0.66006	-0.6030|-0.6030	10|5	0.45353|.	T|.	0.12|.	.|.	10.7718|10.7718	0.46327|0.46327	0.9257:0.0:0.0743:0.0|0.9257:0.0:0.0743:0.0	.|.	5991;5991|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	F|F	5991;5991;3625;3110|607	ENSP00000284548:I5991F;ENSP00000409493:I5991F;ENSP00000355668:I3625F;ENSP00000355670:I3110F|.	ENSP00000284548:I5991F|.	I|Y	+|+	1|2	0|0	OBSCN|OBSCN	226595875|226595875	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.071000|0.071000	0.16799|0.16799	3.615000|3.615000	0.54167|0.54167	2.086000|2.086000	0.62901|0.62901	0.460000|0.460000	0.39030|0.39030	ATC|TAT	OBSCN	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000154358		0.652	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	124	0	A	NM_052843		228529252	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	11.59	122	16	SNP	1.000	T
ODF2	4957	genome.wustl.edu	37	9	131260855	131260855	+	Splice_Site	SNP	G	G	T	rs373500213		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:131260855G>T	ENST00000434106.3	+	19	2538		c.e19+1		ODF2_ENST00000351030.3_Splice_Site|ODF2_ENST00000372807.5_Splice_Site|ODF2_ENST00000604420.1_Splice_Site|ODF2_ENST00000444119.2_Splice_Site|ODF2_ENST00000393527.3_Splice_Site	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						gaggaggcaggtcagtcccga	0.522																																																	0													59.0	48.0	52.0					9																	131260855		2203	4299	6502	SO:0001630	splice_region_variant	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.2175+1G>T	9.37:g.131260855G>T			B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Splice_Site	SNP	-	e18+1	ENST00000434106.3	37	c.2175+1	CCDS56588.1	9																																																																																			ODF2	-	-	ENSG00000136811		0.522	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3		0.00	88	0	G		Intron	131260855	+1			no_errors	ENST00000434106	ensembl	human	known	74_37	splice_site	5.48	69	4	SNP	1.000	T
ODF2L	57489	genome.wustl.edu	37	1	86820363	86820363	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:86820363C>T	ENST00000359242.3	-	16	1898	c.1617G>A	c.(1615-1617)caG>caA	p.Q539Q	ODF2L_ENST00000317336.7_Silent_p.Q539Q|ODF2L_ENST00000294678.2_Silent_p.Q523Q|ODF2L_ENST00000370566.3_Silent_p.Q457Q|ODF2L_ENST00000394731.1_Silent_p.Q379Q|ODF2L_ENST00000370567.1_Silent_p.Q510Q|ODF2L_ENST00000524695.1_5'Flank	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	539						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		CTGCGTCCATCTGTTCTAATT	0.308																																																	0													96.0	95.0	95.0					1																	86820363		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1617G>A	1.37:g.86820363C>T			A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Silent	SNP	NULL	p.Q539	ENST00000359242.3	37	c.1617	CCDS41354.2	1	.	.	.	.	.	.	.	.	.	.	C	7.104	0.574599	0.13623	.	.	ENSG00000122417	ENST00000459999	.	.	.	6.17	4.31	0.51392	.	.	.	.	.	T	0.45196	0.1330	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43925	-0.9361	4	.	.	.	-10.4934	8.3674	0.32395	0.1275:0.7373:0.0:0.1352	.	.	.	.	K	306	.	.	R	-	2	0	ODF2L	86592951	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.656000	0.24948	0.933000	0.37291	0.655000	0.94253	AGA	ODF2L	-	NULL	ENSG00000122417		0.308	ODF2L-001	KNOWN	basic|CCDS	protein_coding	ODF2L	HGNC	protein_coding	OTTHUMT00000027873.2	-	0.00	45	0	C			86820363	-1	tier1	-	no_errors	ENST00000317336	ensembl	human	known	74_37	silent	17.28	67	14	SNP	1.000	T
OGFOD1	55239	genome.wustl.edu	37	16	56485471	56485471	+	5'UTR	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:56485471C>A	ENST00000566157.1	+	0	70				NUDT21_ENST00000300291.5_5'Flank|OGFOD1_ENST00000568397.1_5'Flank	NM_018233.3	NP_060703.3	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 1						cell proliferation (GO:0008283)|peptidyl-proline hydroxylation (GO:0019511)|protein hydroxylation (GO:0018126)|regulation of translational termination (GO:0006449)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|peptidyl-proline 3-dioxygenase activity (GO:0031544)|peptidyl-proline dioxygenase activity (GO:0031543)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8					Vitamin C(DB00126)	TTGCAGTACCCTCAGGAAGGT	0.592																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC032919	CCDS10761.2	16q12.2	2010-11-23			ENSG00000087263	ENSG00000087263			25585	protein-coding gene	gene with protein product	"""TPA1, termination and polyadenylation 1, homolog (S. cerevisiae)"""	615857				10997877	Standard	NM_018233		Approved	KIAA1612, FLJ10826, TPA1	uc002ejb.3	Q8N543	OTTHUMG00000133237	ENST00000566157.1:c.-54C>A	16.37:g.56485471C>A			H3BUQ2|Q9H7U5|Q9H9J9|Q9HA87|Q9HCG0|Q9NVB6	RNA	SNP	-	NULL	ENST00000566157.1	37	NULL	CCDS10761.2	16																																																																																			OGFOD1	-	-	ENSG00000087263		0.592	OGFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFOD1	HGNC	protein_coding	OTTHUMT00000256976.3	-	0.00	119	0	C	NM_018233		56485471	+1	tier1	-	no_errors	ENST00000568172	ensembl	human	known	74_37	rna	5.71	66	4	SNP	0.000	A
OR56A3	390083	genome.wustl.edu	37	11	5969263	5969263	+	Silent	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:5969263G>C	ENST00000329564.6	+	1	694	c.687G>C	c.(685-687)gtG>gtC	p.V229V		NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V229V(1)		endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCGAGCTGTGCTGAGACTCA	0.512																																																	1	Substitution - coding silent(1)	lung(1)											202.0	197.0	198.0					11																	5969263		2186	4286	6472	SO:0001819	synonymous_variant	0				CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.687G>C	11.37:g.5969263G>C			A6NN77|Q6IFF7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V229	ENST00000329564.6	37	c.687	CCDS41614.1	11																																																																																			OR56A3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000184478		0.512	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR56A3	HGNC	protein_coding	OTTHUMT00000383753.1	-	0.00	42	0	G	NM_001003443		5969263	+1	tier1	-	no_errors	ENST00000329564	ensembl	human	known	74_37	silent	17.78	37	8	SNP	0.937	C
OR5T1	390155	genome.wustl.edu	37	11	56044027	56044027	+	Missense_Mutation	SNP	C	C	T	rs374592813	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:56044027C>T	ENST00000313033.2	+	1	999	c.913C>T	c.(913-915)Cgg>Tgg	p.R305W		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	305						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R305W(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					CTACAGTTTGCGGAACAAAGA	0.338													c|||	4	0.000798722	0.0015	0.0	5008	,	,		20909	0.0		0.0	False		,,,				2504	0.002																1	Substitution - Missense(1)	kidney(1)						C	TRP/ARG	1,4401	2.1+/-5.4	0,1,2200	99.0	94.0	95.0		913	2.5	1.0	11		95	0,8592		0,0,4296	no	missense	OR5T1	NM_001004745.1	101	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	305/327	56044027	1,12993	2201	4296	6497	SO:0001583	missense	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.913C>T	11.37:g.56044027C>T	ENSP00000323612:p.Arg305Trp		B2RNM9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R305W	ENST00000313033.2	37	c.913	CCDS31525.1	11	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707520	0.48412	2.27E-4	0.0	ENSG00000181698	ENST00000313033	T	0.41065	1.01	3.63	2.48	0.30137	.	0.000000	0.52532	D	0.000078	T	0.66877	0.2834	M	0.92026	3.265	0.20307	N	0.999912	D	0.89917	1.0	D	0.91635	0.999	T	0.58864	-0.7561	10	0.87932	D	0	.	8.4943	0.33119	0.8021:0.1979:0.0:0.0	.	305	Q8NG75	OR5T1_HUMAN	W	305	ENSP00000323612:R305W	ENSP00000323612:R305W	R	+	1	2	OR5T1	55800603	0.132000	0.22450	1.000000	0.80357	0.953000	0.61014	1.223000	0.32527	0.576000	0.29452	-0.607000	0.04081	CGG	OR5T1	-	prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000181698		0.338	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1		0.00	56	0	C	NM_001004745		56044027	+1			no_errors	ENST00000313033	ensembl	human	known	74_37	missense	16.13	52	10	SNP	0.475	T
PADI1	29943	genome.wustl.edu	37	1	17557135	17557135	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:17557135G>T	ENST00000375471.4	+	10	1214	c.1122G>T	c.(1120-1122)agG>agT	p.R374S	PADI1_ENST00000537499.1_5'Flank|PADI1_ENST00000536552.1_5'Flank|PADI1_ENST00000413717.2_5'Flank	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	374					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	ACTCCCCCAGGAACAGGGGCC	0.562																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0													43.0	43.0	43.0					1																	17557135		2203	4300	6503	SO:0001583	missense	0			AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1122G>T	1.37:g.17557135G>T	ENSP00000364620:p.Arg374Ser		A1L4K6|Q70SX6	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.R374S	ENST00000375471.4	37	c.1122	CCDS178.1	1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548779	0.65311	.	.	ENSG00000142623	ENST00000375471	T	0.33865	1.39	5.63	-2.56	0.06268	Protein-arginine deiminase, C-terminal (1);	0.000000	0.64402	D	0.000006	T	0.50905	0.1643	M	0.84156	2.68	0.80722	D	1	D	0.60575	0.988	P	0.61940	0.896	T	0.50996	-0.8761	10	0.87932	D	0	-8.7611	7.0215	0.24916	0.5194:0.0:0.3712:0.1094	.	374	Q9ULC6	PADI1_HUMAN	S	374	ENSP00000364620:R374S	ENSP00000364620:R374S	R	+	3	2	PADI1	17429722	0.000000	0.05858	0.715000	0.30552	0.936000	0.57629	-0.520000	0.06252	-0.779000	0.04560	-0.302000	0.09304	AGG	PADI1	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub	ENSG00000142623		0.562	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	HGNC	protein_coding	OTTHUMT00000006621.1	-	0.00	94	0	G	NM_013358		17557135	+1	tier1	-	no_errors	ENST00000375471	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.593	T
PARP14	54625	genome.wustl.edu	37	3	122420099	122420099	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:122420099G>T	ENST00000474629.2	+	6	2964	c.2698G>T	c.(2698-2700)Gct>Tct	p.A900S		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	900	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		ATTAAGGAGAGCTGTGCAACT	0.542																																																	0													52.0	49.0	50.0					3																	122420099		1957	4140	6097	SO:0001583	missense	0			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.2698G>T	3.37:g.122420099G>T	ENSP00000418194:p.Ala900Ser		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	pfam_Macro_dom,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.A900S	ENST00000474629.2	37	c.2698	CCDS46894.1	3	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494711	0.44352	.	.	ENSG00000173193	ENST00000474629;ENST00000398162	T	0.26957	1.7	5.46	3.68	0.42216	Appr-1-p processing (3);	0.751892	0.12395	N	0.472618	T	0.33323	0.0859	L	0.56396	1.775	0.09310	N	1	B;B	0.31640	0.047;0.333	B;B	0.40825	0.048;0.341	T	0.26677	-1.0096	10	0.45353	T	0.12	.	11.1196	0.48281	0.1504:0.0:0.8496:0.0	.	900;900	Q460N5-4;Q460N5	.;PAR14_HUMAN	S	900;819	ENSP00000418194:A900S	ENSP00000381228:A819S	A	+	1	0	PARP14	123902789	0.181000	0.23161	0.001000	0.08648	0.009000	0.06853	2.708000	0.47152	0.874000	0.35823	-0.183000	0.12914	GCT	PARP14	-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	ENSG00000173193		0.542	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2	-	0.00	75	0	G	NM_017554		122420099	+1	tier1	-	no_errors	ENST00000474629	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.045	T
PCCA	5095	genome.wustl.edu	37	13	100909873	100909873	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:100909873C>T	ENST00000376285.1	+	9	700	c.662C>T	c.(661-663)tCa>tTa	p.S221L	PCCA_ENST00000376279.3_Missense_Mutation_p.S221L|PCCA_ENST00000376286.4_Missense_Mutation_p.S195L	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	221	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	ATCAAGGCCTCAGCAGGTGGT	0.453																																																	0													126.0	102.0	110.0					13																	100909873		2203	4300	6503	SO:0001583	missense	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.662C>T	13.37:g.100909873C>T	ENSP00000365462:p.Ser221Leu		B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.S221L	ENST00000376285.1	37	c.662	CCDS9496.2	13	.	.	.	.	.	.	.	.	.	.	C	32	5.159852	0.94727	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.97620	-4.46;-4.46;-4.46	4.82	4.82	0.62117	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (2);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.98651	0.9548	M	0.88906	2.99	0.80722	D	1	D;D;D	0.89917	0.994;1.0;0.994	D;D;D	0.97110	0.914;1.0;0.914	D	0.99809	1.1040	10	0.72032	D	0.01	.	17.8754	0.88824	0.0:1.0:0.0:0.0	.	221;195;221	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	L	195;221;221	ENSP00000365463:S195L;ENSP00000365456:S221L;ENSP00000365462:S221L	ENSP00000365456:S221L	S	+	2	0	PCCA	99707874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.313000	0.78978	2.212000	0.71576	0.563000	0.77884	TCA	PCCA	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom	ENSG00000175198		0.453	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	-	0.00	71	0	C			100909873	+1	tier1	-	no_errors	ENST00000376285	ensembl	human	known	74_37	missense	21.69	65	18	SNP	1.000	T
PCDHGB6	56100	genome.wustl.edu	37	5	140787790	140787790	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:140787790G>T	ENST00000520790.1	+	1	21	c.21G>T	c.(19-21)caG>caT	p.Q7H	PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	7					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGCGCGCAGAggcgccggg	0.632											OREG0016861	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													11.0	14.0	13.0					5																	140787790		1782	3962	5744	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.21G>T	5.37:g.140787790G>T	ENSP00000428603:p.Gln7His	1659	Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q7H	ENST00000520790.1	37	c.21	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	g	8.638	0.895327	0.17613	.	.	ENSG00000253305	ENST00000520790	T	0.50277	0.75	5.38	0.715	0.18186	.	.	.	.	.	T	0.26340	0.0643	N	0.08118	0	0.09310	N	1	B;B	0.12630	0.004;0.006	B;B	0.20767	0.014;0.031	T	0.22591	-1.0212	9	0.37606	T	0.19	.	8.8363	0.35115	0.1208:0.3703:0.5089:0.0	.	7;7	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	H	7	ENSP00000428603:Q7H	ENSP00000428603:Q7H	Q	+	3	2	PCDHGB6	140767974	0.000000	0.05858	0.672000	0.29872	0.582000	0.36321	0.530000	0.23036	0.186000	0.20125	0.467000	0.42956	CAG	PCDHGB6	-	NULL	ENSG00000253305		0.632	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	-	0.00	103	0	G	NM_018926		140787790	+1	tier1	-	no_errors	ENST00000520790	ensembl	human	known	74_37	missense	10.75	83	10	SNP	0.000	T
PCSK6	5046	genome.wustl.edu	37	15	101853633	101853633	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:101853633C>A	ENST00000348070.1	-	21	2643	c.2644G>T	c.(2644-2646)Gag>Tag	p.E882*	PCSK6_ENST00000561177.1_5'UTR|PCSK6_ENST00000358417.3_Nonsense_Mutation_p.E869*	NM_002570.3|NM_138320.1	NP_002561.1|NP_612193.1	P29122	PCSK6_HUMAN	proprotein convertase subtilisin/kexin type 6	883	CRM (Cys-rich motif).				determination of left/right symmetry (GO:0007368)|glycoprotein metabolic process (GO:0009100)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|regulation of BMP signaling pathway (GO:0030510)|secretion by cell (GO:0032940)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|nerve growth factor binding (GO:0048406)|serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TAGAAGCCCTCACCACAGGCT	0.577																																																	0													65.0	69.0	68.0					15																	101853633		2023	4192	6215	SO:0001587	stop_gained	0				CCDS73789.1, CCDS73790.1, CCDS73791.1, CCDS73792.1, CCDS73793.1	15q26	2008-07-18	2004-06-14	2004-06-16		ENSG00000140479			8569	protein-coding gene	gene with protein product	"""subtilisin-like protease"", ""subtilisin-like proprotein convertase 4"", ""subtilisin/kexin-like protease PACE4"""	167405	"""paired basic amino acid cleaving system 4"""	PACE4		1741956	Standard	NM_002570		Approved	SPC4	uc002bwy.3	P29122		ENST00000348070.1:c.2644G>T	15.37:g.101853633C>A	ENSP00000305056:p.Glu882*		Q15099|Q15100|Q9UEG7|Q9UEJ1|Q9UEJ2|Q9UEJ7|Q9UEJ8|Q9UEJ9|Q9Y4G9|Q9Y4H0|Q9Y4H1	Nonsense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,pfam_PLAC,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,pfscan_PLAC,prints_Peptidase_S8_subtilisin-rel	p.E882*	ENST00000348070.1	37	c.2644		15	.	.	.	.	.	.	.	.	.	.	C	40	8.295089	0.98747	.	.	ENSG00000140479	ENST00000348070;ENST00000358417;ENST00000398185	.	.	.	5.77	3.85	0.44370	.	0.415574	0.25938	N	0.027322	.	.	.	.	.	.	0.39344	D	0.965639	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-27.9735	9.278	0.37711	0.154:0.5478:0.2982:0.0	.	.	.	.	X	882;869;713	.	ENSP00000305056:E882X	E	-	1	0	PCSK6	99671156	0.748000	0.28294	0.525000	0.27900	0.930000	0.56654	1.217000	0.32455	0.744000	0.32741	0.655000	0.94253	GAG	PCSK6	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000140479		0.577	PCSK6-203	KNOWN	basic|appris_candidate_longest	protein_coding	PCSK6	HGNC	protein_coding		-	0.00	64	0	C	NM_002570		101853633	-1	tier1	-	no_errors	ENST00000348070	ensembl	human	known	74_37	nonsense	9.33	68	7	SNP	0.550	A
PDCD6IP	10015	genome.wustl.edu	37	3	33840163	33840163	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:33840163C>T	ENST00000307296.3	+	0	320				RP11-10C24.3_ENST00000604982.1_lincRNA|PDCD6IP_ENST00000457054.2_5'UTR|RP11-10C24.1_ENST00000605513.1_lincRNA			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein						apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						TCTCTCTCCTCGGCCCTCGTA	0.647																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.-58C>T	3.37:g.33840163C>T			C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	RNA	SNP	-	NULL	ENST00000307296.3	37	NULL	CCDS2660.1	3																																																																																			PDCD6IP	-	-	ENSG00000170248		0.647	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	-	0.00	114	0	C			33840163	+1	tier1	-	no_errors	ENST00000477798	ensembl	human	known	74_37	rna	9.78	83	9	SNP	0.000	T
PDE10A	10846	genome.wustl.edu	37	6	165752833	165752833	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:165752833C>A	ENST00000366882.1	-	21	2236	c.2082G>T	c.(2080-2082)aaG>aaT	p.K694N	PDE10A_ENST00000539869.2_Missense_Mutation_p.K704N|PDE10A_ENST00000354448.4_Missense_Mutation_p.K694N			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	694					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TTCCCAATTTCTTCATTTCAT	0.333																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0													119.0	121.0	120.0					6																	165752833		2203	4300	6503	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.2082G>T	6.37:g.165752833C>A	ENSP00000355847:p.Lys694Asn		Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.K704N	ENST00000366882.1	37	c.2112		6	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807744	0.70797	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	T;T	0.78924	-1.22;-1.22	5.78	5.78	0.91487	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.87229	0.6125	M	0.89095	3.005	0.58432	D	0.999994	D;P	0.89917	1.0;0.866	D;P	0.83275	0.996;0.544	D	0.88909	0.3358	10	0.87932	D	0	.	11.3738	0.49715	0.0:0.8608:0.0:0.1392	.	704;694	Q9ULW9;Q9Y233	.;PDE10_HUMAN	N	694;722;704;694;693	ENSP00000355847:K694N;ENSP00000346435:K694N	ENSP00000341187:K704N	K	-	3	2	PDE10A	165672823	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	1.425000	0.34859	2.749000	0.94314	0.655000	0.94253	AAG	PDE10A	-	pfam_PDEase_catalytic_dom	ENSG00000112541		0.333	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	-	0.00	112	0	C			165752833	-1	tier1	-	no_errors	ENST00000539869	ensembl	human	known	74_37	missense	14.14	85	14	SNP	1.000	A
PDPR	55066	genome.wustl.edu	37	16	70154466	70154466	+	Missense_Mutation	SNP	C	C	T	rs368906299		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:70154466C>T	ENST00000288050.4	+	3	1028	c.71C>T	c.(70-72)tCt>tTt	p.S24F	PDPR_ENST00000568530.1_Missense_Mutation_p.S24F|PDPR_ENST00000398122.3_Intron	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	24					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		AACTGGTCCTCTGCAAGAAAC	0.562																																																	0								C	PHE/SER	0,4234		0,0,2117	48.0	51.0	50.0		71	0.1	0.0	16		50	2,8482		0,2,4240	no	missense	PDPR	NM_017990.3	155	0,2,6357	TT,TC,CC		0.0236,0.0,0.0157	benign	24/880	70154466	2,12716	2117	4242	6359	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.71C>T	16.37:g.70154466C>T	ENSP00000288050:p.Ser24Phe		A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.S24F	ENST00000288050.4	37	c.71	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	C	10.53	1.375486	0.24857	0.0	2.36E-4	ENSG00000090857	ENST00000288050	T	0.70516	-0.49	4.13	0.105	0.14535	.	0.747332	0.11727	N	0.535324	T	0.50222	0.1603	N	0.19112	0.55	0.09310	N	1	B	0.20550	0.046	B	0.18263	0.021	T	0.41805	-0.9488	10	0.56958	D	0.05	.	4.7108	0.12872	0.1969:0.5871:0.1264:0.0896	.	24	Q8NCN5	PDPR_HUMAN	F	24	ENSP00000288050:S24F	ENSP00000288050:S24F	S	+	2	0	PDPR	68711967	0.005000	0.15991	0.000000	0.03702	0.191000	0.23601	1.114000	0.31196	0.288000	0.22398	0.502000	0.49764	TCT	PDPR	-	NULL	ENSG00000090857		0.562	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	-	0.00	65	0	C	NM_017990		70154466	+1	tier1	-	no_errors	ENST00000288050	ensembl	human	known	74_37	missense	9.80	92	10	SNP	0.000	T
PDS5B	23047	genome.wustl.edu	37	13	33275576	33275576	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:33275576G>T	ENST00000315596.10	+	17	2042		c.e17+1			NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)						cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		AATCTATCAGGTATTTGTATA	0.393																																																	0													59.0	56.0	57.0					13																	33275576		1839	4082	5921	SO:0001630	splice_region_variant	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1856+1G>T	13.37:g.33275576G>T			Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Splice_Site	SNP	-	e16+1	ENST00000315596.10	37	c.1856+1	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	23.2	4.392470	0.83011	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.18	5.18	0.71444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0456	0.93018	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDS5B	32173576	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.700000	0.98707	2.580000	0.87095	0.655000	0.94253	.	PDS5B	-	-	ENSG00000083642		0.393	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	-	0.00	79	0	G	NM_015032	Intron	33275576	+1	tier1	-	no_errors	ENST00000315596	ensembl	human	known	74_37	splice_site	11.63	38	5	SNP	1.000	T
PEAK1	79834	genome.wustl.edu	37	15	77425505	77425505	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:77425505C>T	ENST00000560626.2	-	6	4394	c.3919G>A	c.(3919-3921)Gac>Aac	p.D1307N	PEAK1_ENST00000312493.4_Missense_Mutation_p.D1307N			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1307					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										ATGAAAAGGTCTTCGCATTTA	0.483																																																	0													123.0	123.0	123.0					15																	77425505		1910	4116	6026	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.3919G>A	15.37:g.77425505C>T	ENSP00000452796:p.Asp1307Asn		Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.D1307N	ENST00000560626.2	37	c.3919	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	33	5.199060	0.94997	.	.	ENSG00000173517	ENST00000312493	T	0.32023	1.47	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.54647	0.1871	L	0.56769	1.78	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	T	0.54702	-0.8254	10	0.62326	D	0.03	-5.685	19.1871	0.93648	0.0:1.0:0.0:0.0	.	1307	Q9H792	PEAK1_HUMAN	N	1307	ENSP00000309230:D1307N	ENSP00000309230:D1307N	D	-	1	0	AC087465.1	75212560	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.818000	0.86416	2.536000	0.85505	0.655000	0.94253	GAC	PEAK1	-	NULL	ENSG00000173517		0.483	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	HGNC	protein_coding	OTTHUMT00000419483.3	-	0.00	132	0	C			77425505	-1	tier1	-	no_errors	ENST00000312493	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
PHAX	51808	genome.wustl.edu	37	5	125939526	125939526	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:125939526G>T	ENST00000297540.4	+	2	1056	c.361G>T	c.(361-363)Gtg>Ttg	p.V121L	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	121	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						ATGGGGTGCTGTGCTGCAGGA	0.473																																																	0													75.0	71.0	72.0					5																	125939526		2203	4300	6503	SO:0001583	missense	0			AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.361G>T	5.37:g.125939526G>T	ENSP00000297540:p.Val121Leu		Q9H8W1	Missense_Mutation	SNP	pfam_PHAX_RNA-binding_domain	p.V121L	ENST00000297540.4	37	c.361	CCDS4138.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.318035	0.95682	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	T	0.24151	1.87	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.53916	0.1826	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.53718	-0.8399	10	0.72032	D	0.01	-28.3459	19.9279	0.97110	0.0:0.0:1.0:0.0	.	121	Q9H814	PHAX_HUMAN	L	121	ENSP00000297540:V121L	ENSP00000297540:V121L	V	+	1	0	PHAX	125967425	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.748000	0.98867	2.715000	0.92844	0.655000	0.94253	GTG	PHAX	-	NULL	ENSG00000164902		0.473	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHAX	HGNC	protein_coding	OTTHUMT00000250924.1	-	0.00	60	0	G	NM_032177		125939526	+1	tier1	-	no_errors	ENST00000297540	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
PHF11	51131	genome.wustl.edu	37	13	50099996	50099996	+	Intron	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:50099996G>T	ENST00000378319.3	+	9	810				PHF11_ENST00000357596.3_Intron|PHF11_ENST00000488958.1_Intron	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		cagagattctgattcagtaca	0.537																																																	0																																										SO:0001627	intron_variant	0			AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.770-527G>T	13.37:g.50099996G>T			Q5W0A4|Q5W0A6|Q9Y5A2	RNA	SNP	-	NULL	ENST00000378319.3	37	NULL	CCDS31975.1	13																																																																																			PHF11	-	-	ENSG00000136147		0.537	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF11	HGNC	protein_coding	OTTHUMT00000044915.1	-	0.00	79	0	G	NM_016119		50099996	+1	tier1	-	no_errors	ENST00000495157	ensembl	human	known	74_37	rna	7.84	47	4	SNP	0.003	T
PHF6	84295	genome.wustl.edu	37	X	133547596	133547596	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:133547596G>T	ENST00000332070.3	+	6	696	c.494G>T	c.(493-495)gGa>gTa	p.G165V	PHF6_ENST00000370799.1_Missense_Mutation_p.G166V|PHF6_ENST00000416404.2_Missense_Mutation_p.G131V|PHF6_ENST00000370803.3_Missense_Mutation_p.G165V|PHF6_ENST00000394292.1_Missense_Mutation_p.G166V|PHF6_ENST00000370800.4_Missense_Mutation_p.G166V	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					AGTCGCAAAGGAAGGCCAAGA	0.358			"""F, N, Splice, Mis"""		ETP ALL																																Colon(100;666 1493 6344 21231 35807)			Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	0													94.0	91.0	92.0					X																	133547596		2202	4300	6502	SO:0001583	missense	0			AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.494G>T	X.37:g.133547596G>T	ENSP00000329097:p.Gly165Val		A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.G166V	ENST00000332070.3	37	c.497	CCDS14639.1	X	.	.	.	.	.	.	.	.	.	.	G	17.53	3.413283	0.62511	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	D;D;D;D;D;D	0.90504	-2.68;-2.68;-2.1;-2.68;-1.7;-2.17	5.71	4.85	0.62838	.	0.095122	0.64402	D	0.000001	D	0.88351	0.6413	L	0.29908	0.895	0.80722	D	1	P;D;P;P;D	0.58268	0.917;0.969;0.917;0.917;0.982	B;P;B;B;P	0.51866	0.348;0.483;0.348;0.401;0.682	D	0.86311	0.1686	10	0.30078	T	0.28	-12.1044	12.9718	0.58517	0.0793:0.0:0.9207:0.0	.	131;165;165;166;166	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	V	165;165;166;166;131;166	ENSP00000359839:G165V;ENSP00000329097:G165V;ENSP00000377831:G166V;ENSP00000359835:G166V;ENSP00000394480:G131V;ENSP00000359836:G166V	ENSP00000329097:G165V	G	+	2	0	PHF6	133375262	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.838000	0.75359	1.292000	0.44672	0.594000	0.82650	GGA	PHF6	-	NULL	ENSG00000156531		0.358	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF6	HGNC	protein_coding	OTTHUMT00000058367.1	-	0.00	108	0	G	NM_032458		133547596	+1	tier1	-	no_errors	ENST00000394292	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
PID1	55022	genome.wustl.edu	37	2	229890767	229890767	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:229890767C>T	ENST00000354069.6	-	3	364	c.334G>A	c.(334-336)Gaa>Aaa	p.E112K	PID1_ENST00000482518.2_Intron|PID1_ENST00000409462.1_Missense_Mutation_p.E30K|PID1_ENST00000392055.3_Missense_Mutation_p.E79K|PID1_ENST00000392054.3_Missense_Mutation_p.E110K			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	112	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		ACTGGCTTTTCTGTGCAGCCT	0.532																																																	0													76.0	73.0	74.0					2																	229890767		2203	4300	6503	SO:0001583	missense	0			AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.334G>A	2.37:g.229890767C>T	ENSP00000283937:p.Glu112Lys		B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.E112K	ENST00000354069.6	37	c.334		2	.	.	.	.	.	.	.	.	.	.	C	36	5.772611	0.96922	.	.	ENSG00000153823	ENST00000392054;ENST00000409462;ENST00000392055;ENST00000542363;ENST00000354069	.	.	.	5.3	5.3	0.74995	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.74068	0.3668	L	0.48642	1.525	0.80722	D	1	D;D;D;D	0.76494	0.988;0.988;0.998;0.999	P;P;D;D	0.81914	0.908;0.908;0.994;0.995	T	0.71676	-0.4521	8	.	.	.	-28.3374	18.3095	0.90194	0.0:1.0:0.0:0.0	.	30;79;110;112	Q7Z2X4-3;Q7Z2X4-4;Q7Z2X4-2;Q7Z2X4	.;.;.;PCLI1_HUMAN	K	110;30;79;112;112	.	.	E	-	1	0	PID1	229599011	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.276000	0.78559	2.645000	0.89757	0.655000	0.94253	GAA	PID1	-	smart_PTB/PI_dom	ENSG00000153823		0.532	PID1-005	KNOWN	basic	protein_coding	PID1	HGNC	protein_coding	OTTHUMT00000331810.2	-	0.00	54	0	C	NM_017933		229890767	-1	tier1	-	no_errors	ENST00000354069	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	T
PIK3CB	5291	genome.wustl.edu	37	3	138478028	138478028	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:138478028G>A	ENST00000477593.1	-	2	231	c.158C>T	c.(157-159)tCt>tTt	p.S53F	PIK3CB_ENST00000289153.2_Missense_Mutation_p.S53F			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	53	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	CTTAATATAAGAAATGGTAGC	0.373																																																	0													55.0	54.0	54.0					3																	138478028		2203	4300	6503	SO:0001583	missense	0				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.158C>T	3.37:g.138478028G>A	ENSP00000418143:p.Ser53Phe		D3DNF0|Q24JU2	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,superfamily_ARM-type_fold,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.S53F	ENST00000477593.1	37	c.158	CCDS3104.1	3	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229089	0.79688	.	.	ENSG00000051382	ENST00000477593;ENST00000289153;ENST00000483968;ENST00000461451;ENST00000465581	T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79	5.84	5.84	0.93424	Phosphatidylinositol 3-kinase, p85-binding (2);	0.186118	0.49916	D	0.000135	T	0.75737	0.3890	N	0.25890	0.77	0.80722	D	1	P	0.45531	0.86	P	0.54590	0.756	T	0.77846	-0.2436	10	0.72032	D	0.01	-13.8881	16.4042	0.83652	0.0:0.1313:0.8687:0.0	.	53	P42338	PK3CB_HUMAN	F	53	ENSP00000418143:S53F;ENSP00000289153:S53F;ENSP00000419857:S53F;ENSP00000420399:S53F	ENSP00000289153:S53F	S	-	2	0	PIK3CB	139960718	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	3.920000	0.56446	2.760000	0.94817	0.655000	0.94253	TCT	PIK3CB	-	pfam_PI3K_adapt-bd_dom,smart_PI3K_adapt-bd_dom	ENSG00000051382		0.373	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	HGNC	protein_coding	OTTHUMT00000358019.1	-	0.00	90	0	G			138478028	-1	tier1	-	no_errors	ENST00000289153	ensembl	human	known	74_37	missense	8.33	55	5	SNP	1.000	A
PDXDC1	23042	genome.wustl.edu	37	16	15229188	15229188	+	Intron	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:15229188G>A	ENST00000535621.2	+	17	1587							Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1						carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CGGTGAGGCTGAAGGTGTACT	0.697																																																	0																																										SO:0001627	intron_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000535621.2:c.1400-3548G>A	16.37:g.15229188G>A			B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	RNA	SNP	-	NULL	ENST00000535621.2	37	NULL		16																																																																																			PKD1P6	-	-	ENSG00000250251		0.697	PDXDC1-016	PUTATIVE	basic	protein_coding	PKD1P6	HGNC	protein_coding	OTTHUMT00000422421.1	-	0.00	117	0	G	NM_015027		15229188	-1	tier1	-	no_errors	ENST00000538100	ensembl	human	known	74_37	rna	22.84	152	45	SNP	0.998	A
PKIG	11142	genome.wustl.edu	37	20	43243230	43243230	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:43243230C>T	ENST00000372889.1	+	5	618	c.33C>T	c.(31-33)ttC>ttT	p.F11F	PKIG_ENST00000372882.3_Silent_p.F11F|PKIG_ENST00000372891.3_Silent_p.F11F|PKIG_ENST00000372892.3_Silent_p.F11F|PKIG_ENST00000349959.3_Silent_p.F11F|PKIG_ENST00000477390.1_3'UTR|PKIG_ENST00000372887.1_Silent_p.F11F|Z97053.1_ENST00000597250.1_Intron|PKIG_ENST00000372894.3_Silent_p.F11F|PKIG_ENST00000372886.1_Silent_p.F11F	NM_001281444.1	NP_001268373.1	Q9Y2B9	IPKG_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor gamma	11					negative regulation of protein import into nucleus (GO:0042308)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|signal transduction (GO:0007165)		cAMP-dependent protein kinase inhibitor activity (GO:0004862)			breast(1)|urinary_tract(1)	2		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.001)|COAD - Colon adenocarcinoma(18;0.00189)			ACTCGGACTTCATCTCCTGTG	0.612																																																	0													112.0	93.0	100.0					20																	43243230		2203	4300	6503	SO:0001819	synonymous_variant	0			AB019517	CCDS13334.1	20q13.12-q13.13	2008-07-03			ENSG00000168734	ENSG00000168734			9019	protein-coding gene	gene with protein product		604932				10880337	Standard	NM_181805		Approved		uc002xmi.3	Q9Y2B9	OTTHUMG00000033065	ENST00000372889.1:c.33C>T	20.37:g.43243230C>T				Silent	SNP	pfam_cAMP_dep_PKI	p.F11	ENST00000372889.1	37	c.33	CCDS13334.1	20																																																																																			PKIG	-	pfam_cAMP_dep_PKI	ENSG00000168734		0.612	PKIG-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PKIG	HGNC	protein_coding	OTTHUMT00000127804.1	-	0.00	58	0	C			43243230	+1	tier1	-	no_errors	ENST00000349959	ensembl	human	known	74_37	silent	10.29	61	7	SNP	1.000	T
C10orf55	414236	genome.wustl.edu	37	10	75672811	75672811	+	5'UTR	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:75672811G>A	ENST00000409178.1	-	0	290				PLAU_ENST00000446342.1_Missense_Mutation_p.R91K|PLAU_ENST00000494287.1_3'UTR|PLAU_ENST00000372764.3_Missense_Mutation_p.R108K|PLAU_ENST00000372762.4_Missense_Mutation_p.R72K|C10orf55_ENST00000412307.2_5'UTR	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					CATGCCCACAGATCTGATGCT	0.567																																																	0													70.0	65.0	67.0					10																	75672811		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.-51C>T	10.37:g.75672811G>A			Q3KRG4|Q8NAK4	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Kringle,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R108K	ENST00000409178.1	37	c.323	CCDS53541.1	10	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309528	0.60414	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	T;T;T	0.65178	-0.14;-0.14;-0.14	5.58	4.64	0.57946	Kringle (4);Kringle-like fold (1);	0.729653	0.13669	N	0.371006	T	0.56529	0.1991	L	0.52759	1.655	0.25351	N	0.988861	B;B;P;B	0.43231	0.088;0.051;0.801;0.03	B;B;B;B	0.39971	0.053;0.088;0.315;0.038	T	0.52646	-0.8548	9	.	.	.	.	11.8873	0.52610	0.0:0.0:0.8269:0.1731	.	91;72;108;108	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	K	91;108;72;72	ENSP00000388474:R91K;ENSP00000361850:R108K;ENSP00000361848:R72K	.	R	+	2	0	PLAU	75342817	0.027000	0.19231	0.828000	0.32881	0.967000	0.64934	0.809000	0.27168	2.625000	0.88918	0.650000	0.86243	AGA	PLAU	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000122861		0.567	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAU	HGNC	protein_coding	OTTHUMT00000048746.1	-	0.00	85	0	G	NM_001001791		75672811	+1	tier1	-	no_errors	ENST00000372764	ensembl	human	known	74_37	missense	11.11	56	7	SNP	0.151	A
PLCG1	5335	genome.wustl.edu	37	20	39791013	39791013	+	Intron	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:39791013G>T	ENST00000373271.1	+	5	917				PLCG1_ENST00000244007.3_Intron|PLCG1_ENST00000373272.2_Intron	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1						activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				tacctgtccagccCCAGGTGG	0.542																																																	0																																										SO:0001627	intron_variant	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.513-79G>T	20.37:g.39791013G>T			B7ZLY7|B9EGH4|E1P5W4|Q2V575	Splice_Site	SNP	-	NULL	ENST00000373271.1	37	c.NULL	CCDS13314.1	20																																																																																			PLCG1	-	-	ENSG00000124181		0.542	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3		0.00	25	0	G	NM_182811		39791013	+1			no_errors	ENST00000483646	ensembl	human	known	74_37	splice_site	10.00	36	4	SNP	0.464	T
PLD5	200150	genome.wustl.edu	37	1	242263986	242263986	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:242263986A>T	ENST00000536534.2	-	9	1579	c.1338T>A	c.(1336-1338)gaT>gaA	p.D446E	PLD5_ENST00000427495.1_Missense_Mutation_p.D384E|PLD5_ENST00000442594.2_Missense_Mutation_p.D354E			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	446	PLD phosphodiesterase 2.					integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			AAGCTGCTCCATCTGTCACCA	0.478																																																	0													236.0	194.0	208.0					1																	242263986		2203	4300	6503	SO:0001583	missense	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1338T>A	1.37:g.242263986A>T	ENSP00000440896:p.Asp446Glu		A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	smart_PLipase_D/transphosphatidylase	p.D446E	ENST00000536534.2	37	c.1338	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	A	17.09	3.300953	0.60195	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	D;D;D	0.83163	-1.69;-1.69;-1.69	5.64	-4.43	0.03568	Phospholipase D/Transphosphatidylase (1);	0.047339	0.85682	D	0.000000	T	0.81626	0.4862	L	0.33189	0.99	0.43084	D	0.994746	D;D;P	0.76494	0.999;0.999;0.946	D;D;P	0.71870	0.975;0.912;0.706	T	0.78388	-0.2223	10	0.25751	T	0.34	-13.6585	12.8503	0.57855	0.4893:0.0:0.5107:0.0	.	354;446;384	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	E	384;354;446	ENSP00000401285:D384E;ENSP00000414188:D354E;ENSP00000440896:D446E	ENSP00000401285:D384E	D	-	3	2	PLD5	240330609	0.899000	0.30636	0.945000	0.38365	0.997000	0.91878	0.091000	0.15046	-0.855000	0.04125	0.528000	0.53228	GAT	PLD5	-	smart_PLipase_D/transphosphatidylase	ENSG00000180287		0.478	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	-	0.00	115	0	A	NM_152666		242263986	-1	tier1	-	no_errors	ENST00000536534	ensembl	human	known	74_37	missense	7.83	106	9	SNP	0.965	T
PLOD3	8985	genome.wustl.edu	37	7	100859262	100859262	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:100859262C>T	ENST00000223127.3	-	5	940	c.542G>A	c.(541-543)cGc>cAc	p.R181H	ZNHIT1_ENST00000305105.2_5'Flank	NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	181					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CTTCCACTGGCGCACGATTTG	0.612																																																	0													162.0	140.0	147.0					7																	100859262		2203	4300	6503	SO:0001583	missense	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.542G>A	7.37:g.100859262C>T	ENSP00000223127:p.Arg181His		B2R6W6|Q540C3	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.R181H	ENST00000223127.3	37	c.542	CCDS5715.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.40|12.40	1.926851|1.926851	0.34002|0.34002	.|.	.|.	ENSG00000106397|ENSG00000106397	ENST00000421736|ENST00000223127;ENST00000541462	.|T	.|0.18502	.|2.21	5.23|5.23	3.43|3.43	0.39272|0.39272	.|.	.|0.129739	.|0.53938	.|N	.|0.000053	T|T	0.12008|0.12008	0.0292|0.0292	L|L	0.29908|0.29908	0.895|0.895	0.23144|0.23144	N|N	0.998228|0.998228	.|B	.|0.11235	.|0.004	.|B	.|0.06405	.|0.002	T|T	0.20438|0.20438	-1.0275|-1.0275	5|10	.|0.54805	.|T	.|0.06	-11.2366|-11.2366	7.9577|7.9577	0.30053|0.30053	0.0:0.8112:0.0:0.1888|0.0:0.8112:0.0:0.1888	.|.	.|181	.|O60568	.|PLOD3_HUMAN	T|H	14|181;85	.|ENSP00000223127:R181H	.|ENSP00000223127:R181H	A|R	-|-	1|2	0|0	PLOD3|PLOD3	100645982|100645982	0.005000|0.005000	0.15991|0.15991	0.944000|0.944000	0.38274|0.38274	0.821000|0.821000	0.46438|0.46438	0.439000|0.439000	0.21575|0.21575	0.599000|0.599000	0.29845|0.29845	0.561000|0.561000	0.74099|0.74099	GCC|CGC	PLOD3	-	NULL	ENSG00000106397		0.612	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1	-	0.00	43	0	C			100859262	-1	tier1	-	no_errors	ENST00000223127	ensembl	human	known	74_37	missense	13.95	37	6	SNP	0.487	T
PPARGC1B	133522	genome.wustl.edu	37	5	149206271	149206271	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:149206271C>T	ENST00000309241.5	+	3	320	c.288C>T	c.(286-288)ctC>ctT	p.L96L	PPARGC1B_ENST00000360453.4_Silent_p.L96L|PPARGC1B_ENST00000403750.1_Silent_p.L71L|PPARGC1B_ENST00000394320.3_Silent_p.L96L	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	96					actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TGGCAGAGCTCACCAAGACCC	0.582																																																	0													124.0	105.0	111.0					5																	149206271		2203	4300	6503	SO:0001819	synonymous_variant	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.288C>T	5.37:g.149206271C>T			A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L96	ENST00000309241.5	37	c.288	CCDS4298.1	5																																																																																			PPARGC1B	-	NULL	ENSG00000155846		0.582	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	-	0.00	118	0	C	NM_133263		149206271	+1	tier1	-	no_errors	ENST00000309241	ensembl	human	known	74_37	silent	6.33	74	5	SNP	1.000	T
PPFIBP1	8496	genome.wustl.edu	37	12	27829365	27829365	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:27829365G>C	ENST00000318304.8	+	18	1749	c.1466G>C	c.(1465-1467)aGa>aCa	p.R489T	PPFIBP1_ENST00000542629.1_Missense_Mutation_p.R458T|PPFIBP1_ENST00000537927.1_Missense_Mutation_p.R336T|PPFIBP1_ENST00000228425.6_Missense_Mutation_p.R472T	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	489					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					TCTCAGGACAGAGCTCCGGCA	0.552																																																	0													59.0	61.0	61.0					12																	27829365		2203	4300	6503	SO:0001583	missense	0			AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.1466G>C	12.37:g.27829365G>C	ENSP00000314724:p.Arg489Thr		O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R489T	ENST00000318304.8	37	c.1466	CCDS55812.1	12	.	.	.	.	.	.	.	.	.	.	G	8.307	0.821156	0.16678	.	.	ENSG00000110841	ENST00000540114;ENST00000537927;ENST00000318304;ENST00000542629;ENST00000228425;ENST00000537261	T;T;T;T;T	0.29917	1.57;1.55;1.96;1.97;1.95	5.81	0.482	0.16815	.	0.779422	0.10490	U	0.668491	T	0.10809	0.0264	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.33085	-0.9882	10	0.22706	T	0.39	-15.0609	6.0093	0.19567	0.4498:0.3814:0.1688:0.0	.	336;489;472;458	Q86W92-3;Q86W92;Q86W92-2;Q86W92-4	.;LIPB1_HUMAN;.;.	T	320;336;489;458;472;164	ENSP00000444304:R320T;ENSP00000445425:R336T;ENSP00000314724:R489T;ENSP00000443442:R458T;ENSP00000228425:R472T	ENSP00000228425:R472T	R	+	2	0	PPFIBP1	27720632	0.936000	0.31750	0.168000	0.22838	0.044000	0.14063	1.154000	0.31688	0.445000	0.26639	-0.302000	0.09304	AGA	PPFIBP1	-	NULL	ENSG00000110841		0.552	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	PPFIBP1	HGNC	protein_coding	OTTHUMT00000402877.1	-	0.00	43	0	G	NM_003622		27829365	+1	tier1	-	no_errors	ENST00000318304	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.001	C
PPIB	5479	genome.wustl.edu	37	15	64452363	64452363	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:64452363G>A	ENST00000300026.3	-	3	501	c.283C>T	c.(283-285)Cgt>Tgt	p.R95C	PPIB_ENST00000558492.1_5'UTR	NM_000942.4	NP_000933.1	P23284	PPIB_HUMAN	peptidylprolyl isomerase B (cyclophilin B)	95	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				bone development (GO:0060348)|chaperone-mediated protein folding (GO:0061077)|extracellular matrix organization (GO:0030198)|positive regulation of multicellular organism growth (GO:0040018)|protein peptidyl-prolyl isomerization (GO:0000413)|protein stabilization (GO:0050821)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)	peptide binding (GO:0042277)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(6)	10					L-Proline(DB00172)	TTGATTACACGATGGAATTTG	0.478																																					GBM(105;399 1481 32889 33051 36637)												0													183.0	146.0	159.0					15																	64452363		2203	4300	6503	SO:0001583	missense	0				CCDS10191.1	15q21-q22	2014-09-17			ENSG00000166794	ENSG00000166794	5.2.1.8		9255	protein-coding gene	gene with protein product		123841				2000394, 20089953	Standard	NM_000942		Approved	CYPB, OI9	uc002and.3	P23284	OTTHUMG00000133018	ENST00000300026.3:c.283C>T	15.37:g.64452363G>A	ENSP00000300026:p.Arg95Cys		A8K534|Q6IBH5|Q9BVK5	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.R95C	ENST00000300026.3	37	c.283	CCDS10191.1	15	.	.	.	.	.	.	.	.	.	.	G	23.8	4.459428	0.84317	.	.	ENSG00000166794	ENST00000300026	T	0.59083	0.29	5.14	5.14	0.70334	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);Peptidyl-prolyl cis-trans isomerase, cyclophilin-type, conserved site (1);	0.047913	0.85682	D	0.000000	D	0.86830	0.6027	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.92734	0.6202	10	0.87932	D	0	.	18.1996	0.89833	0.0:0.0:1.0:0.0	.	95	P23284	PPIB_HUMAN	C	95	ENSP00000300026:R95C	ENSP00000300026:R95C	R	-	1	0	PPIB	62239416	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.873000	0.69644	2.380000	0.81148	0.561000	0.74099	CGT	PPIB	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	ENSG00000166794		0.478	PPIB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIB	HGNC	protein_coding	OTTHUMT00000256604.1	-	0.00	103	0	G			64452363	-1	tier1	-	no_errors	ENST00000300026	ensembl	human	known	74_37	missense	13.92	67	11	SNP	1.000	A
PPL	5493	genome.wustl.edu	37	16	4935905	4935905	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:4935905C>A	ENST00000345988.2	-	22	2840	c.2751G>T	c.(2749-2751)caG>caT	p.Q917H	PPL_ENST00000590782.2_Missense_Mutation_p.Q915H	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	917					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						AGATTTCTTCCTGGGTGCTCT	0.602																																																	0													89.0	94.0	92.0					16																	4935905		2197	4300	6497	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2751G>T	16.37:g.4935905C>A	ENSP00000340510:p.Gln917His		O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.Q917H	ENST00000345988.2	37	c.2751	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	C	12.75	2.030299	0.35797	.	.	ENSG00000118898	ENST00000345988	T	0.53206	0.63	5.07	5.07	0.68467	.	0.068693	0.64402	D	0.000012	T	0.60117	0.2244	M	0.67953	2.075	0.41580	D	0.988735	D	0.61080	0.989	P	0.57283	0.817	T	0.64728	-0.6339	10	0.72032	D	0.01	.	11.8881	0.52615	0.0:0.9197:0.0:0.0803	.	917	O60437	PEPL_HUMAN	H	917	ENSP00000340510:Q917H	ENSP00000340510:Q917H	Q	-	3	2	PPL	4875906	1.000000	0.71417	1.000000	0.80357	0.034000	0.12701	2.016000	0.40971	2.368000	0.80403	0.455000	0.32223	CAG	PPL	-	NULL	ENSG00000118898		0.602	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	-	0.00	54	0	C	NM_002705		4935905	-1	tier1	-	no_errors	ENST00000345988	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
PPP1R16B	26051	genome.wustl.edu	37	20	37536771	37536771	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:37536771C>T	ENST00000299824.1	+	10	1318	c.1129C>T	c.(1129-1131)Cag>Tag	p.Q377*	PPP1R16B_ENST00000373331.2_Nonsense_Mutation_p.Q335*	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	377					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				AGCTGAGGATCAGCGGACCTC	0.607																																																	0													115.0	98.0	104.0					20																	37536771		2203	4300	6503	SO:0001587	stop_gained	0			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1129C>T	20.37:g.37536771C>T	ENSP00000299824:p.Gln377*		A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q377*	ENST00000299824.1	37	c.1129	CCDS13309.1	20	.	.	.	.	.	.	.	.	.	.	C	37	6.580890	0.97680	.	.	ENSG00000101445	ENST00000299824;ENST00000373331	.	.	.	5.79	5.79	0.91817	.	0.198944	0.40302	N	0.001124	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	16.5672	0.84601	0.0:0.8612:0.1387:0.0	.	.	.	.	X	377;335	.	ENSP00000299824:Q377X	Q	+	1	0	PPP1R16B	36970185	0.988000	0.35896	0.981000	0.43875	0.857000	0.48899	2.766000	0.47629	2.771000	0.95319	0.644000	0.83932	CAG	PPP1R16B	-	pirsf_Pase-1_reg_su_16AB_euk	ENSG00000101445		0.607	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16B	HGNC	protein_coding	OTTHUMT00000079220.2	-	0.00	121	0	C	NM_015568		37536771	+1	tier1	-	no_errors	ENST00000299824	ensembl	human	known	74_37	nonsense	15.00	68	12	SNP	0.991	T
PPY	5539	genome.wustl.edu	37	17	42018993	42018993	+	Silent	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:42018993C>A	ENST00000591228.1	-	2	117	c.30G>T	c.(28-30)ctG>ctT	p.L10L	PPY_ENST00000587006.1_Silent_p.L10L|PPY_ENST00000225992.3_Silent_p.L10L			P01298	PAHO_HUMAN	pancreatic polypeptide	10					digestion (GO:0007586)|protein secretion (GO:0009306)	extracellular region (GO:0005576)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(1)|skin(1)	4		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		ACAGGAGCAGCAGGGAGAGGC	0.657																																																	0													47.0	41.0	43.0					17																	42018993		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS11472.1	17q21.31	2013-02-28			ENSG00000108849	ENSG00000108849		"""Endogenous ligands"""	9327	protein-coding gene	gene with protein product	"""pancreatic polypeptide Y"", ""prepro-PP (prepropancreatic polypeptide)"""	167780				3753985	Standard	NM_002722		Approved	PNP	uc002iep.3	P01298		ENST00000591228.1:c.30G>T	17.37:g.42018993C>A				Silent	SNP	pfam_Pancreatic_hormone-like,smart_Pancreatic_hormone-like,pfscan_Pancreatic_hormone-like,prints_Pancreatic_hormone-like	p.L10	ENST00000591228.1	37	c.30	CCDS11472.1	17																																																																																			PPY	-	NULL	ENSG00000108849		0.657	PPY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPY	HGNC	protein_coding	OTTHUMT00000457656.1		0.00	42	0	C	NM_002722		42018993	-1			no_errors	ENST00000225992	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.997	A
PRKAA1	5562	genome.wustl.edu	37	5	40771927	40771927	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:40771927G>A	ENST00000397128.2	-	4	410	c.402C>T	c.(400-402)atC>atT	p.I134I	PRKAA1_ENST00000296800.4_Silent_p.I125I|PRKAA1_ENST00000354209.3_Silent_p.I149I	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	CACCAGAAAGGATCTGTTGGA	0.393																																																	0													113.0	106.0	108.0					5																	40771927		1881	4136	6017	SO:0001819	synonymous_variant	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.402C>T	5.37:g.40771927G>A			A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I149	ENST00000397128.2	37	c.447	CCDS3932.2	5																																																																																			PRKAA1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000132356		0.393	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2	-	0.00	85	0	G	NM_006251		40771927	-1	tier1	-	no_errors	ENST00000354209	ensembl	human	known	74_37	silent	7.29	89	7	SNP	1.000	A
PRKCD	5580	genome.wustl.edu	37	3	53212438	53212438	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:53212438C>T	ENST00000394729.2	+	0	328				PRKCD_ENST00000477794.2_3'UTR|PRKCD_ENST00000330452.3_5'UTR	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta						activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	CAGGCCCCACCATGGCGCCGT	0.687																																																	0													32.0	32.0	32.0					3																	53212438		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0				CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.-1C>T	3.37:g.53212438C>T			B0KZ81|B2R834|Q15144|Q86XJ6	RNA	SNP	-	NULL	ENST00000394729.2	37	NULL	CCDS2870.1	3																																																																																			PRKCD	-	-	ENSG00000163932		0.687	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCD	HGNC	protein_coding	OTTHUMT00000257818.1	-	0.00	58	0	C			53212438	+1	tier1	-	no_errors	ENST00000477794	ensembl	human	known	74_37	rna	14.61	76	13	SNP	0.963	T
PRPSAP1	5635	genome.wustl.edu	37	17	74326692	74326692	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:74326692G>A	ENST00000446526.3	-	5	964	c.519C>T	c.(517-519)ttC>ttT	p.F173F	PRPSAP1_ENST00000324684.4_Silent_p.F70F	NM_002766.2	NP_002757.2	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate synthetase-associated protein 1	144					negative regulation of kinase activity (GO:0033673)|nucleobase-containing compound metabolic process (GO:0006139)|nucleotide biosynthetic process (GO:0009165)	ribose phosphate diphosphokinase complex (GO:0002189)	enzyme inhibitor activity (GO:0004857)|magnesium ion binding (GO:0000287)|ribose phosphate diphosphokinase activity (GO:0004749)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	17						CAGGAAAGCTGAAAAAGCCTT	0.393																																																	0													93.0	90.0	91.0					17																	74326692		2203	4300	6503	SO:0001819	synonymous_variant	0			D61391	CCDS11743.2	17q24-q25	2008-07-18			ENSG00000161542	ENSG00000161542			9466	protein-coding gene	gene with protein product		601249				8660991	Standard	NM_002766		Approved	PAP39	uc010wta.1	Q14558	OTTHUMG00000155969	ENST00000446526.3:c.519C>T	17.37:g.74326692G>A			B2R6M4|Q96H06	Silent	SNP	tigrfam_Rib-P_diPkinase	p.F173	ENST00000446526.3	37	c.519	CCDS11743.2	17																																																																																			PRPSAP1	-	tigrfam_Rib-P_diPkinase	ENSG00000161542		0.393	PRPSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPSAP1	HGNC	protein_coding	OTTHUMT00000342480.2	-	0.00	116	0	G	NM_002766		74326692	-1	tier1	-	no_errors	ENST00000446526	ensembl	human	known	74_37	silent	22.73	68	20	SNP	1.000	A
PSME4	23198	genome.wustl.edu	37	2	54092485	54092486	+	3'UTR	INS	-	-	A	rs398080264|rs56006630	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:54092485_54092486insA	ENST00000404125.1	-	0	5816_5817				PSME4_ENST00000421748.2_3'UTR|PSME4_ENST00000476586.1_5'UTR	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TCAGATGCCTCAAAAAAAAAAA	0.391																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.*230->T	2.37:g.54092496_54092496dupA			Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	RNA	INS	-	NULL	ENST00000404125.1	37	NULL	CCDS33197.2	2																																																																																			PSME4	-	-	ENSG00000068878		0.391	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1		0.00	20	0	-	XM_040158		54092486	-1	tier1		no_errors	ENST00000476586	ensembl	human	known	74_37	rna	14.29	24	4	INS	0.999:0.998	A
PSMG2	56984	genome.wustl.edu	37	18	12725469	12725469	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:12725469G>C	ENST00000317615.6	+	7	1416	c.734G>C	c.(733-735)tGg>tCg	p.W245S	PSMG2_ENST00000585331.2_Missense_Mutation_p.W214S	NM_020232.4	NP_064617.2			proteasome (prosome, macropain) assembly chaperone 2											lung(1)|prostate(2)|skin(1)	4						GCCTCACGGTGGAAAATACCA	0.358																																																	0													155.0	156.0	156.0					18																	12725469		2203	4300	6503	SO:0001583	missense	0			AF276707	CCDS11862.1, CCDS67440.1	18p11.21	2012-01-25	2007-10-23	2007-10-23	ENSG00000128789	ENSG00000128789			24929	protein-coding gene	gene with protein product	"""hepatocellular carcinoma susceptibility protein"", ""CD40 ligand-activated specific transcript 3"""	609702	"""tumor necrosis factor superfamily, member 5-induced protein 1"""	TNFSF5IP1		11854909, 12147697, 17189198	Standard	NM_147163		Approved	HCCA3, MDS003, MGC15092, CLAST3, HsT1707, PAC2	uc002krk.3	Q969U7	OTTHUMG00000131703	ENST00000317615.6:c.734G>C	18.37:g.12725469G>C	ENSP00000325919:p.Trp245Ser			Missense_Mutation	SNP	pfam_Proteasome_assmbl_chaperone_2,pirsf_Proteasome_assmbl_chp_2_euk	p.W245S	ENST00000317615.6	37	c.734	CCDS11862.1	18	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250111	0.80024	.	.	ENSG00000128789	ENST00000317615	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.84101	0.5398	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85652	0.1283	9	0.87932	D	0	-3.5278	19.4842	0.95022	0.0:0.0:1.0:0.0	.	245	Q969U7	PSMG2_HUMAN	S	245	.	ENSP00000325919:W245S	W	+	2	0	PSMG2	12715469	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	7.354000	0.79424	2.777000	0.95525	0.591000	0.81541	TGG	PSMG2	-	pirsf_Proteasome_assmbl_chp_2_euk	ENSG00000128789		0.358	PSMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG2	HGNC	protein_coding	OTTHUMT00000254615.1	-	0.00	155	0	G	NM_020232		12725469	+1	tier1	-	no_errors	ENST00000317615	ensembl	human	known	74_37	missense	12.32	121	17	SNP	1.000	C
PTCH1	5727	genome.wustl.edu	37	9	98222023	98222023	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:98222023G>T	ENST00000331920.6	-	17	3045	c.2746C>A	c.(2746-2748)Ccc>Acc	p.P916T	PTCH1_ENST00000430669.2_Missense_Mutation_p.P850T|PTCH1_ENST00000429896.2_Missense_Mutation_p.P765T|PTCH1_ENST00000375274.2_Missense_Mutation_p.P915T|PTCH1_ENST00000437951.1_Missense_Mutation_p.P850T|PTCH1_ENST00000418258.1_Missense_Mutation_p.P765T|PTCH1_ENST00000421141.1_Missense_Mutation_p.P765T	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	916					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)			NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				AAAGCGCTGGGATTAATGATG	0.542																																																	0													94.0	82.0	86.0					9																	98222023		2203	4300	6503	SO:0001583	missense	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.2746C>A	9.37:g.98222023G>T	ENSP00000332353:p.Pro916Thr		A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.P916T	ENST00000331920.6	37	c.2746	CCDS6714.1	9	.	.	.	.	.	.	.	.	.	.	G	19.49	3.837900	0.71373	.	.	ENSG00000185920	ENST00000331920;ENST00000437951;ENST00000421141;ENST00000418258;ENST00000375275;ENST00000430669;ENST00000429896;ENST00000375274	D;D;D;D;D;D;D	0.90844	-2.74;-2.73;-2.72;-2.72;-2.73;-2.72;-2.74	5.0	5.0	0.66597	.	0.050999	0.85682	D	0.000000	D	0.92893	0.7739	M	0.62154	1.92	0.80722	D	1	D;D;P	0.53312	0.959;0.958;0.885	P;P;P	0.54346	0.749;0.693;0.665	D	0.92631	0.6116	10	0.46703	T	0.11	-22.9664	18.4744	0.90786	0.0:0.0:1.0:0.0	.	850;915;916	Q13635-3;Q13635-2;Q13635	.;.;PTC1_HUMAN	T	916;850;765;765;352;850;765;915	ENSP00000332353:P916T;ENSP00000389744:P850T;ENSP00000399981:P765T;ENSP00000396135:P765T;ENSP00000410287:P850T;ENSP00000414823:P765T;ENSP00000364423:P915T	ENSP00000332353:P916T	P	-	1	0	PTCH1	97261844	1.000000	0.71417	0.981000	0.43875	0.998000	0.95712	9.263000	0.95617	2.600000	0.87896	0.563000	0.77884	CCC	PTCH1	-	pfam_Patched,tigrfam_TM_rcpt_patched	ENSG00000185920		0.542	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2	-	0.00	78	0	G	NM_000264		98222023	-1	tier1	-	no_errors	ENST00000331920	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
PTGDR2	11251	genome.wustl.edu	37	11	60621068	60621068	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:60621068G>A	ENST00000332539.4	-	2	239	c.128C>T	c.(127-129)tCg>tTg	p.S43L	RP11-804A23.4_ENST00000538705.1_RNA	NM_004778.2	NP_004769.2	Q9Y5Y4	PD2R2_HUMAN	prostaglandin D2 receptor 2	43					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|calcium-mediated signaling (GO:0019722)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|prostaglandin D receptor activity (GO:0004956)|prostaglandin F receptor activity (GO:0004958)|prostaglandin J receptor activity (GO:0001785)									Indomethacin(DB00328)|Sulindac(DB00605)	GCCCAGCAGCGAGGCCAGCCC	0.667																																																	0													46.0	37.0	40.0					11																	60621068		2182	4261	6443	SO:0001583	missense	0			AF118265	CCDS7994.1	11q12-q13.3	2012-08-08	2011-11-11	2011-11-11		ENSG00000183134		"""CD molecules"", ""GPCR / Class A : Prostanoid receptors"""	4502	protein-coding gene	gene with protein product	"""chemoattractant receptor homologous molecule expressed on T helper type 2 cells"""	604837	"""G protein-coupled receptor 44"""	GPR44		10036181	Standard	NM_004778		Approved	CRTH2, CD294, DP2	uc001nqc.2	Q9Y5Y4		ENST00000332539.4:c.128C>T	11.37:g.60621068G>A	ENSP00000332812:p.Ser43Leu		O94765|Q4QRI6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt,prints_Anphylx_rcpt	p.S43L	ENST00000332539.4	37	c.128	CCDS7994.1	11	.	.	.	.	.	.	.	.	.	.	G	8.731	0.916739	0.17907	.	.	ENSG00000183134	ENST00000332539	T	0.37752	1.18	4.63	0.127	0.14727	.	0.217679	0.30028	U	0.010597	T	0.17534	0.0421	N	0.12569	0.235	0.09310	N	1	P	0.51240	0.943	B	0.35240	0.198	T	0.16600	-1.0397	10	0.33940	T	0.23	.	16.1475	0.81580	0.0:0.6453:0.3547:0.0	.	43	Q9Y5Y4	GPR44_HUMAN	L	43	ENSP00000332812:S43L	ENSP00000332812:S43L	S	-	2	0	GPR44	60377644	0.000000	0.05858	0.004000	0.12327	0.247000	0.25773	0.252000	0.18278	-0.142000	0.11354	-0.304000	0.09214	TCG	PTGDR2	-	prints_GPCR_Rhodpsn	ENSG00000183134		0.667	PTGDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDR2	HGNC	protein_coding	OTTHUMT00000396328.1	-	0.00	67	0	G	NM_004778		60621068	-1	tier1	-	no_errors	ENST00000332539	ensembl	human	known	74_37	missense	7.22	90	7	SNP	0.002	A
PTH2R	5746	genome.wustl.edu	37	2	209307162	209307162	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:209307162C>A	ENST00000272847.2	+	5	698	c.485C>A	c.(484-486)gCt>gAt	p.A162D	PTH2R_ENST00000413482.1_3'UTR	NM_005048.2	NP_005039.1	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor	162					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	parathyroid hormone receptor activity (GO:0004991)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(21)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)	Preotact(DB05829)	TTGGCTGTGGCTATTCTCATC	0.448																																																	0													370.0	310.0	330.0					2																	209307162		2203	4300	6503	SO:0001583	missense	0			BC036811	CCDS2383.1	2q33	2012-08-10	2007-08-24	2007-08-24	ENSG00000144407	ENSG00000144407		"""GPCR / Class B : Parathyroid hormone receptors"""	9609	protein-coding gene	gene with protein product		601469	"""parathyroid hormone receptor 2"""	PTHR2			Standard	NM_005048		Approved		uc002vdb.4	P49190	OTTHUMG00000132960	ENST00000272847.2:c.485C>A	2.37:g.209307162C>A	ENSP00000272847:p.Ala162Asp		Q8N429	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.A162D	ENST00000272847.2	37	c.485	CCDS2383.1	2	.	.	.	.	.	.	.	.	.	.	C	18.16	3.561842	0.65538	.	.	ENSG00000144407	ENST00000272847	T	0.38560	1.13	5.13	4.22	0.49857	GPCR, family 2-like (1);	0.000000	0.45606	U	0.000346	T	0.73410	0.3583	H	0.95611	3.695	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.83275	0.995;0.996	T	0.81446	-0.0929	10	0.87932	D	0	.	13.2318	0.59947	0.0:0.8388:0.1612:0.0	.	51;162	B4DFN8;P49190	.;PTH2R_HUMAN	D	162	ENSP00000272847:A162D	ENSP00000272847:A162D	A	+	2	0	PTH2R	209015407	1.000000	0.71417	0.999000	0.59377	0.468000	0.32798	5.369000	0.66138	1.112000	0.41740	0.655000	0.94253	GCT	PTH2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000144407		0.448	PTH2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	HGNC	protein_coding	OTTHUMT00000256519.2	-	0.00	62	0	C	NM_005048		209307162	+1	tier1	-	no_errors	ENST00000272847	ensembl	human	known	74_37	missense	8.00	92	8	SNP	1.000	A
PTPN13	5783	genome.wustl.edu	37	4	87556416	87556416	+	Missense_Mutation	SNP	G	G	T	rs201697573		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:87556416G>T	ENST00000411767.2	+	2	70	c.7G>T	c.(7-9)Gtg>Ttg	p.V3L	PTPN13_ENST00000511467.1_Missense_Mutation_p.V3L|PTPN13_ENST00000316707.6_Missense_Mutation_p.V3L|PTPN13_ENST00000427191.2_Missense_Mutation_p.V3L|PTPN13_ENST00000436978.1_Missense_Mutation_p.V3L|PTPN13_ENST00000502971.1_Missense_Mutation_p.V3L			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	3	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TAATATGCACGTGTCACTAGC	0.428																																																	0													58.0	58.0	58.0					4																	87556416		1933	4136	6069	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.7G>T	4.37:g.87556416G>T	ENSP00000407249:p.Val3Leu		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.V3L	ENST00000411767.2	37	c.7	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769469	0.90020	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000502971;ENST00000316707;ENST00000411767;ENST00000507902;ENST00000511467	T;T;T;T;T;T;T	0.32753	2.15;2.15;1.44;2.15;2.15;2.15;2.15	5.65	4.81	0.61882	KIND (2);	0.000000	0.46145	D	0.000316	T	0.58921	0.2156	M	0.82323	2.585	0.53005	D	0.999963	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.91635	0.983;0.999;0.998;0.999	T	0.66073	-0.6014	10	0.87932	D	0	.	14.4557	0.67416	0.0716:0.0:0.9284:0.0	.	3;3;3;3	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	L	3	ENSP00000408368:V3L;ENSP00000394794:V3L;ENSP00000423531:V3L;ENSP00000322675:V3L;ENSP00000407249:V3L;ENSP00000422835:V3L;ENSP00000426626:V3L	ENSP00000322675:V3L	V	+	1	0	PTPN13	87775440	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	9.039000	0.93777	1.379000	0.46325	0.650000	0.86243	GTG	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,smart_KIND	ENSG00000163629		0.428	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	77	0	G			87556416	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
PTPN14	5784	genome.wustl.edu	37	1	214705695	214705695	+	Intron	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:214705695C>A	ENST00000366956.5	-	1	41				PTPN14_ENST00000491277.1_5'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TCTGGGATGGCTTGGGGTCCC	0.637																																					Colon(92;557 1424 24372 34121 40073)												0																																										SO:0001627	intron_variant	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.153+18830G>T	1.37:g.214705695C>A			Q5VSI0	RNA	SNP	-	NULL	ENST00000366956.5	37	NULL	CCDS1514.1	1																																																																																			PTPN14	-	-	ENSG00000152104		0.637	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	-	0.00	75	0	C	NM_005401		214705695	-1	tier1	-	no_errors	ENST00000491277	ensembl	human	putative	74_37	rna	7.69	48	4	SNP	0.061	A
PURG	29942	genome.wustl.edu	37	8	30890189	30890189	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:30890189G>T	ENST00000475541.1	-	1	1042	c.110C>A	c.(109-111)tCc>tAc	p.S37Y	PURG_ENST00000339382.2_Missense_Mutation_p.S37Y|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	37						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		GGGGTAGTGGGAGTGCTGGGC	0.662																																																	0													19.0	22.0	21.0					8																	30890189		2203	4300	6503	SO:0001583	missense	0			AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.110C>A	8.37:g.30890189G>T	ENSP00000418721:p.Ser37Tyr		Q8TE64	Missense_Mutation	SNP	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	p.S37Y	ENST00000475541.1	37	c.110	CCDS6081.1	8	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920481	0.33908	.	.	ENSG00000172733	ENST00000339382;ENST00000475541	T;T	0.25912	1.77;1.78	4.68	4.68	0.58851	.	0.588808	0.14226	N	0.333070	T	0.13884	0.0336	N	0.08118	0	0.26996	N	0.965025	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.10497	-1.0627	10	0.36615	T	0.2	.	10.5929	0.45321	0.0:0.0:0.7534:0.2466	.	37;37	Q9UJV8;Q9UJV8-2	PURG_HUMAN;.	Y	37	ENSP00000345168:S37Y;ENSP00000418721:S37Y	ENSP00000345168:S37Y	S	-	2	0	PURG	31009731	0.998000	0.40836	1.000000	0.80357	0.915000	0.54546	1.442000	0.35046	2.138000	0.66242	0.313000	0.20887	TCC	PURG	-	NULL	ENSG00000172733		0.662	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PURG	HGNC	protein_coding	OTTHUMT00000348565.1	-	0.00	41	0	G	NM_013357		30890189	-1	tier1	-	no_errors	ENST00000475541	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
PXDC1	221749	genome.wustl.edu	37	6	3722977	3722977	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:3722977G>A	ENST00000380283.4	-	0	2066				PXDC1_ENST00000477592.2_5'UTR	NM_183373.3	NP_899229.2	Q5TGL8	PXDC1_HUMAN	PX domain containing 1								phosphatidylinositol binding (GO:0035091)										ACTGAGCAGAGAAGCTTGAAG	0.418																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ420534	CCDS4486.1	6p25.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000168994	ENSG00000168994			21361	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 145"""	C6orf145			Standard	NM_183373		Approved		uc003mvt.2	Q5TGL8	OTTHUMG00000014146	ENST00000380283.4:c.*876C>T	6.37:g.3722977G>A			A8K0N3|Q6PGP0|Q86XB7	RNA	SNP	-	NULL	ENST00000380283.4	37	NULL	CCDS4486.1	6																																																																																			PXDC1	-	-	ENSG00000168994		0.418	PXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDC1	HGNC	protein_coding	OTTHUMT00000039688.1	-	0.00	119	0	G	NM_183373		3722977	-1	tier1	-	no_errors	ENST00000477592	ensembl	human	known	74_37	rna	13.49	109	17	SNP	0.000	A
PYGB	5834	genome.wustl.edu	37	20	25239910	25239910	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:25239910G>A	ENST00000216962.4	+	2	391	c.281G>A	c.(280-282)cGc>cAc	p.R94H		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	94					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TACATGGGTCGCACGCTGCAG	0.493																																																	0													111.0	112.0	111.0					20																	25239910		2203	4300	6503	SO:0001583	missense	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.281G>A	20.37:g.25239910G>A	ENSP00000216962:p.Arg94His		Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.R94H	ENST00000216962.4	37	c.281	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	G	31	5.101962	0.94245	.	.	ENSG00000100994	ENST00000216962	D	0.93076	-3.16	4.38	4.38	0.52667	.	0.110634	0.64402	D	0.000012	D	0.97845	0.9292	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.99113	1.0847	10	0.87932	D	0	-19.5793	16.214	0.82191	0.0:0.0:1.0:0.0	.	94	P11216	PYGB_HUMAN	H	94	ENSP00000216962:R94H	ENSP00000216962:R94H	R	+	2	0	PYGB	25187910	1.000000	0.71417	0.981000	0.43875	0.983000	0.72400	9.044000	0.93805	2.431000	0.82371	0.655000	0.94253	CGC	PYGB	-	pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.493	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2		0.00	22	0	G	NM_002862		25239910	+1			no_errors	ENST00000216962	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
RABEPK	10244	genome.wustl.edu	37	9	127994943	127994943	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:127994943G>T	ENST00000373538.3	+	7	1055	c.745G>T	c.(745-747)Gtg>Ttg	p.V249L	RABEPK_ENST00000259460.8_Missense_Mutation_p.V198L|RABEPK_ENST00000394125.4_Missense_Mutation_p.V249L|RABEPK_ENST00000394124.4_3'UTR	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	249					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						CCACTCAGCTGTGGCCATGGG	0.537																																																	0													73.0	66.0	68.0					9																	127994943		2203	4300	6503	SO:0001583	missense	0			BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.745G>T	9.37:g.127994943G>T	ENSP00000362639:p.Val249Leu		A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.V249L	ENST00000373538.3	37	c.745	CCDS6862.1	9	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910683	0.92107	.	.	ENSG00000136933	ENST00000394125;ENST00000259460;ENST00000373538	T;T;T	0.81078	-1.45;-1.45;-1.45	5.39	5.39	0.77823	Kelch-type beta propeller (1);	0.238547	0.42053	D	0.000780	D	0.87676	0.6237	M	0.79123	2.44	0.80722	D	1	P;D;P	0.57899	0.472;0.981;0.472	B;P;B	0.56042	0.396;0.79;0.396	D	0.87852	0.2658	10	0.46703	T	0.11	-8.3003	18.1568	0.89694	0.0:0.0:1.0:0.0	.	249;198;249	A8K403;Q7Z6M1-2;Q7Z6M1	.;.;RABEK_HUMAN	L	249;198;249	ENSP00000377683:V249L;ENSP00000259460:V198L;ENSP00000362639:V249L	ENSP00000259460:V198L	V	+	1	0	RABEPK	127034764	1.000000	0.71417	0.917000	0.36280	0.918000	0.54935	9.432000	0.97498	2.515000	0.84797	0.655000	0.94253	GTG	RABEPK	-	pfam_Kelch_2,pfam_Kelch_1	ENSG00000136933		0.537	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEPK	HGNC	protein_coding	OTTHUMT00000054064.1		0.00	67	0	G	NM_005833		127994943	+1			no_errors	ENST00000373538	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.999	T
RARG	5916	genome.wustl.edu	37	12	53613943	53613943	+	Intron	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:53613943C>T	ENST00000425354.2	-	4	672				RARG_ENST00000327550.3_Intron|RARG_ENST00000394426.1_Intron|RARG_ENST00000338561.5_5'UTR|RARG_ENST00000543726.1_Missense_Mutation_p.E20K|RARG_ENST00000543762.1_Intron	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma						anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	GCAGCCGATTCCCCCTCCTCC	0.692																																																	0																																										SO:0001627	intron_variant	0			M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.185-4365G>A	12.37:g.53613943C>T			B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4	p.E20K	ENST00000425354.2	37	c.58	CCDS8850.1	12	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869780	0.72065	.	.	ENSG00000172819	ENST00000543726;ENST00000550265	D	0.92249	-3.0	4.03	4.03	0.46877	.	.	.	.	.	D	0.85270	0.5658	.	.	.	0.80722	D	1	P;B	0.40731	0.728;0.345	B;B	0.35353	0.201;0.074	D	0.83509	0.0079	8	0.20046	T	0.44	.	13.5586	0.61775	0.0:1.0:0.0:0.0	.	20;20	F8VR45;B7Z4F1	.;.	K	20	ENSP00000444335:E20K	ENSP00000444335:E20K	E	-	1	0	RARG	51900210	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.677000	0.37576	2.251000	0.74343	0.563000	0.77884	GAA	RARG	-	NULL	ENSG00000172819		0.692	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARG	HGNC	protein_coding	OTTHUMT00000109404.2	-	0.00	150	0	C	NM_000966		53613943	-1	tier1	-	no_errors	ENST00000543726	ensembl	human	known	74_37	missense	9.71	93	10	SNP	1.000	T
RBP4	5950	genome.wustl.edu	37	10	95353631	95353631	+	Missense_Mutation	SNP	G	G	A	rs139534453	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:95353631G>A	ENST00000371467.1	-	5	836	c.517C>T	c.(517-519)Cgg>Tgg	p.R173W	FFAR4_ENST00000604414.1_Intron|RBP4_ENST00000371464.3_Missense_Mutation_p.R173W|RBP4_ENST00000371469.2_Missense_Mutation_p.R171W			P02753	RET4_HUMAN	retinol binding protein 4, plasma	173					cardiac muscle tissue development (GO:0048738)|detection of light stimulus involved in visual perception (GO:0050908)|embryonic organ morphogenesis (GO:0048562)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic skeletal system development (GO:0048706)|eye development (GO:0001654)|female genitalia morphogenesis (GO:0048807)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|lung development (GO:0030324)|maintenance of gastrointestinal epithelium (GO:0030277)|male gonad development (GO:0008584)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|phototransduction, visible light (GO:0007603)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of insulin secretion (GO:0032024)|response to ethanol (GO:0045471)|response to insulin (GO:0032868)|response to retinoic acid (GO:0032526)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|retinol transport (GO:0034633)|spermatogenesis (GO:0007283)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	retinal binding (GO:0016918)|retinol binding (GO:0019841)|retinol transporter activity (GO:0034632)			large_intestine(1)|lung(3)|skin(1)	5		Colorectal(252;0.122)			Vitamin A(DB00162)	TCCTCCTGCCGCTGCCTTACA	0.622																																					Pancreas(5;160 256 1117 46697 50185)												0								G	TRP/ARG	0,4406		0,0,2203	93.0	96.0	95.0		517	2.5	1.0	10	dbSNP_134	95	1,8599	1.2+/-3.3	0,1,4299	no	missense	RBP4	NM_006744.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	173/202	95353631	1,13005	2203	4300	6503	SO:0001583	missense	0			BC020633	CCDS31249.1	10q23.33	2014-01-22	2001-11-28		ENSG00000138207	ENSG00000138207		"""Lipocalins"""	9922	protein-coding gene	gene with protein product		180250	"""retinol-binding protein 4, plasma"""				Standard	XM_005270023		Approved		uc001kit.3	P02753	OTTHUMG00000018773	ENST00000371467.1:c.517C>T	10.37:g.95353631G>A	ENSP00000360522:p.Arg173Trp		D3DR38|O43478|O43479|Q5VY24|Q8WWA3|Q9P178	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,pirsf_Lipocalin_ApoD,prints_Retinol-bd/Purpurin,prints_Lipocalin	p.R173W	ENST00000371467.1	37	c.517	CCDS31249.1	10	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497483	0.85069	0.0	1.16E-4	ENSG00000138207	ENST00000371464;ENST00000371469;ENST00000371467;ENST00000371463	D;D	0.83075	-1.68;-1.68	5.95	2.55	0.30701	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.137559	0.64402	D	0.000003	D	0.89406	0.6706	M	0.70595	2.14	0.49915	D	0.999835	D	0.89917	1.0	D	0.81914	0.995	D	0.88996	0.3418	10	0.72032	D	0.01	-19.2335	13.8124	0.63270	0.0:0.0:0.3447:0.6553	.	173	P02753	RET4_HUMAN	W	173;171;173;171	ENSP00000360519:R173W;ENSP00000360522:R173W	ENSP00000360518:R171W	R	-	1	2	RBP4	95343621	1.000000	0.71417	0.997000	0.53966	0.969000	0.65631	3.623000	0.54224	0.238000	0.21222	0.655000	0.94253	CGG	RBP4	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,pirsf_Lipocalin_ApoD	ENSG00000138207		0.622	RBP4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBP4	HGNC	protein_coding	OTTHUMT00000049431.1	-	0.00	65	0	G	NM_006744		95353631	-1	tier1	rs139534453	no_errors	ENST00000371464	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	A
RBM20	282996	genome.wustl.edu	37	10	112541325	112541325	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:112541325G>T	ENST00000369519.3	+	2	1016	c.958G>T	c.(958-960)Gag>Tag	p.E320*		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	320					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						CAGCCAATGGGAGAGCCCCCA	0.612																																																	0													68.0	71.0	70.0					10																	112541325		692	1591	2283	SO:0001587	stop_gained	0			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.958G>T	10.37:g.112541325G>T	ENSP00000358532:p.Glu320*		A6NIP5|B5A868|Q5JVI1	Nonsense_Mutation	SNP	smart_Znf_U1,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.E320*	ENST00000369519.3	37	c.958	CCDS44477.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.569906	0.96540	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	.	.	.	5.31	5.31	0.75309	.	0.299893	0.26069	N	0.026540	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	18.9637	0.92687	0.0:0.0:1.0:0.0	.	.	.	.	X	320	.	ENSP00000358532:E320X	E	+	1	0	RBM20	112531315	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	4.396000	0.59684	2.478000	0.83669	0.467000	0.42956	GAG	RBM20	-	NULL	ENSG00000203867		0.612	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM20	HGNC	protein_coding	OTTHUMT00000050339.2		0.00	88	0	G	NM_001134363		112541325	+1			no_errors	ENST00000369519	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	1.000	T
REM2	161253	genome.wustl.edu	37	14	23354124	23354124	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:23354124C>G	ENST00000267396.4	+	2	468	c.345C>G	c.(343-345)ttC>ttG	p.F115L	REM2_ENST00000536884.1_Missense_Mutation_p.F115L	NM_173527.2	NP_775798.2	Q8IYK8	REM2_HUMAN	RAS (RAD and GEM)-like GTP binding 2	115					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|large_intestine(2)|ovary(1)	5	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.012)		ATGGCATCTTCAAGGTCATGC	0.597																																																	0													49.0	55.0	53.0					14																	23354124		2160	4260	6420	SO:0001583	missense	0				CCDS45082.1	14q11.2	2014-05-09	2006-12-14		ENSG00000139890	ENSG00000139890			20248	protein-coding gene	gene with protein product			"""RAS (RAD and GEM) like GTP binding 2"""			10727423	Standard	NM_173527		Approved	FLJ38964	uc001whf.1	Q8IYK8	OTTHUMG00000170277	ENST00000267396.4:c.345C>G	14.37:g.23354124C>G	ENSP00000267396:p.Phe115Leu		B7Z5P1|Q8N8R8	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase	p.F115L	ENST00000267396.4	37	c.345	CCDS45082.1	14	.	.	.	.	.	.	.	.	.	.	C	16.97	3.269665	0.59540	.	.	ENSG00000139890	ENST00000267396;ENST00000536884	T;T	0.79749	-1.3;1.51	5.72	4.82	0.62117	.	0.114823	0.64402	D	0.000010	T	0.74137	0.3677	L	0.27053	0.805	0.45216	D	0.998227	P;P	0.46859	0.885;0.814	P;B	0.45610	0.487;0.229	T	0.76995	-0.2752	10	0.59425	D	0.04	.	13.0956	0.59190	0.0:0.9203:0.0:0.0797	.	115;115	B7Z5P1;Q8IYK8	.;REM2_HUMAN	L	115	ENSP00000267396:F115L;ENSP00000442774:F115L	ENSP00000267396:F115L	F	+	3	2	REM2	22423964	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.158000	0.50723	1.533000	0.49186	0.655000	0.94253	TTC	REM2	-	superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase	ENSG00000139890		0.597	REM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REM2	HGNC	protein_coding	OTTHUMT00000408290.1	-	0.00	62	0	C	NM_173527		23354124	+1	tier1	-	no_errors	ENST00000267396	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	G
REV3L	5980	genome.wustl.edu	37	6	111695431	111695431	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:111695431G>A	ENST00000358835.3	-	14	4581	c.4127C>T	c.(4126-4128)tCt>tTt	p.S1376F	REV3L_ENST00000368805.1_Missense_Mutation_p.S1376F|REV3L_ENST00000368802.3_Missense_Mutation_p.S1376F|REV3L_ENST00000435970.1_Missense_Mutation_p.S1298F			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1376					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GGACATACCAGAAGATATCTG	0.308								DNA polymerases (catalytic subunits)																																									0													63.0	67.0	66.0					6																	111695431		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4127C>T	6.37:g.111695431G>A	ENSP00000351697:p.Ser1376Phe		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S1376F	ENST00000358835.3	37	c.4127	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	3.085	-0.188200	0.06299	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01548	4.87;4.87;4.87;4.78	5.99	2.93	0.34026	Ribonuclease H-like (1);	0.344998	0.22676	N	0.057019	T	0.00552	0.0018	L	0.40543	1.245	0.19300	N	0.99998	B	0.34181	0.44	B	0.31191	0.125	T	0.50030	-0.8875	10	0.35671	T	0.21	.	3.3072	0.07003	0.3722:0.0:0.3957:0.2321	.	1376	O60673	DPOLZ_HUMAN	F	1376;1376;1376;1298	ENSP00000357792:S1376F;ENSP00000357795:S1376F;ENSP00000351697:S1376F;ENSP00000402003:S1298F	ENSP00000351697:S1376F	S	-	2	0	REV3L	111802124	0.995000	0.38212	0.569000	0.28460	0.540000	0.34992	2.686000	0.46968	0.881000	0.35993	-0.137000	0.14449	TCT	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.308	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	42	0	G	NM_002912		111695431	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.205	A
REV3L	5980	genome.wustl.edu	37	6	111696179	111696179	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:111696179G>A	ENST00000358835.3	-	14	3833	c.3379C>T	c.(3379-3381)Cgc>Tgc	p.R1127C	REV3L_ENST00000368805.1_Missense_Mutation_p.R1127C|REV3L_ENST00000368802.3_Missense_Mutation_p.R1127C|REV3L_ENST00000435970.1_Missense_Mutation_p.R1049C			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1127					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		GACCAGCAGCGAGGTGGAGAA	0.413								DNA polymerases (catalytic subunits)																																									0													109.0	114.0	113.0					6																	111696179		2200	4297	6497	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3379C>T	6.37:g.111696179G>A	ENSP00000351697:p.Arg1127Cys		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.R1127C	ENST00000358835.3	37	c.3379	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085042	0.55861	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.07800	3.25;3.25;3.25;3.16	5.64	5.64	0.86602	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.20901	0.0503	L	0.59436	1.845	0.58432	D	0.99999	D	0.89917	1.0	D	0.85130	0.997	T	0.00542	-1.1680	10	0.87932	D	0	.	19.6921	0.96007	0.0:0.0:1.0:0.0	.	1127	O60673	DPOLZ_HUMAN	C	1127;1127;1127;1049	ENSP00000357792:R1127C;ENSP00000357795:R1127C;ENSP00000351697:R1127C;ENSP00000402003:R1049C	ENSP00000351697:R1127C	R	-	1	0	REV3L	111802872	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.329000	0.79170	2.655000	0.90218	0.585000	0.79938	CGC	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.413	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	65	0	G	NM_002912		111696179	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	9.52	57	6	SNP	1.000	A
RGL2	5863	genome.wustl.edu	37	6	33263890	33263890	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:33263890A>G	ENST00000497454.1	-	6	1178	c.683T>C	c.(682-684)cTc>cCc	p.L228P	PFDN6_ENST00000463584.1_Intron|RGL2_ENST00000444031.2_Missense_Mutation_p.L146P|RGL2_ENST00000437840.2_5'UTR	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	228					positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						ATCGCCGGGGAGGGCCAGGGG	0.682																																																	0													60.0	73.0	69.0					6																	33263890		2203	4300	6503	SO:0001583	missense	0				CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.683T>C	6.37:g.33263890A>G	ENSP00000420211:p.Leu228Pro		B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L228P	ENST00000497454.1	37	c.683	CCDS4774.1	6	.	.	.	.	.	.	.	.	.	.	A	8.616	0.890252	0.17613	.	.	ENSG00000237441	ENST00000497454;ENST00000421215;ENST00000444031	T;T	0.32023	1.47;1.47	5.4	3.25	0.37280	Guanine-nucleotide dissociation stimulator CDC25 (1);Ras guanine nucleotide exchange factor, domain (1);	0.769405	0.12143	N	0.495705	T	0.04634	0.0126	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.33954	-0.9848	10	0.23891	T	0.37	.	3.4077	0.07347	0.5613:0.22:0.2188:0.0	.	146;228	B4DG72;O15211	.;RGL2_HUMAN	P	228;92;146	ENSP00000420211:L228P;ENSP00000403070:L146P	ENSP00000400083:L92P	L	-	2	0	RGL2	33371868	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.154000	0.31688	0.339000	0.23719	0.523000	0.50628	CTC	RGL2	-	superfamily_Ras_GEF_dom	ENSG00000237441		0.682	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL2	HGNC	protein_coding	OTTHUMT00000076098.2		0.00	71	0	A			33263890	-1			no_errors	ENST00000497454	ensembl	human	known	74_37	missense	6.49	72	5	SNP	1.000	G
RFX6	222546	genome.wustl.edu	37	6	117249991	117249991	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:117249991C>T	ENST00000332958.2	+	18	2484	c.2468C>T	c.(2467-2469)tCt>tTt	p.S823F		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	823					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)	p.S823F(1)		cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						CAGCACGTTTCTGTCATCAGC	0.438																																																	1	Substitution - Missense(1)	skin(1)											171.0	148.0	156.0					6																	117249991		2203	4300	6503	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2468C>T	6.37:g.117249991C>T	ENSP00000332208:p.Ser823Phe		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.S823F	ENST00000332958.2	37	c.2468	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	C	25.5	4.646648	0.87958	.	.	ENSG00000185002	ENST00000332958	T	0.62639	0.01	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.67841	0.2936	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.70483	-0.4859	10	0.87932	D	0	-19.841	20.0442	0.97604	0.0:1.0:0.0:0.0	.	823	Q8HWS3	RFX6_HUMAN	F	823	ENSP00000332208:S823F	ENSP00000332208:S823F	S	+	2	0	RFX6	117356684	1.000000	0.71417	0.856000	0.33681	0.847000	0.48162	7.398000	0.79919	2.814000	0.96858	0.655000	0.94253	TCT	RFX6	-	NULL	ENSG00000185002		0.438	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	-	0.00	121	0	C	NM_173560		117249991	+1	tier1	-	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	10.71	75	9	SNP	1.000	T
RGS6	9628	genome.wustl.edu	37	14	72985113	72985113	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:72985113G>T	ENST00000553530.1	+	15	1353	c.1146G>T	c.(1144-1146)aaG>aaT	p.K382N	RGS6_ENST00000406236.4_Missense_Mutation_p.K382N|RGS6_ENST00000553525.1_Missense_Mutation_p.K382N|RGS6_ENST00000556437.1_Missense_Mutation_p.K382N|RGS6_ENST00000402788.2_Missense_Mutation_p.K382N|RGS6_ENST00000355512.6_Missense_Mutation_p.K382N|RGS6_ENST00000554782.1_Missense_Mutation_p.K243N|RGS6_ENST00000407322.4_Missense_Mutation_p.K382N|RGS6_ENST00000434263.2_Missense_Mutation_p.K313N|RGS6_ENST00000343854.6_Missense_Mutation_p.K345N|RGS6_ENST00000404301.2_Missense_Mutation_p.K382N|RGS6_ENST00000555571.1_Missense_Mutation_p.K382N	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	382	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		ATGTGGCCAAGAGGGTAGAAG	0.498																																					Ovarian(143;1926 2468 21071 48641)												0													75.0	77.0	76.0					14																	72985113		2203	4300	6503	SO:0001583	missense	0			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.1146G>T	14.37:g.72985113G>T	ENSP00000452331:p.Lys382Asn		C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.K382N	ENST00000553530.1	37	c.1146	CCDS9808.1	14	.	.	.	.	.	.	.	.	.	.	G	9.514	1.106612	0.20714	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000343854;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T;T	0.01918	4.56;4.56;4.56;4.56;4.56;4.56;4.56;4.56;4.56;4.56;4.56;4.56	5.41	2.42	0.29668	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.251824	0.46758	D	0.000269	T	0.01765	0.0056	L	0.29908	0.895	0.29423	N	0.860431	B;B;B;B	0.32425	0.371;0.0;0.233;0.0	B;B;B;B	0.34452	0.183;0.001;0.095;0.001	T	0.35649	-0.9780	10	0.28530	T	0.3	-4.7064	3.3691	0.07213	0.1586:0.2022:0.5167:0.1226	.	313;382;387;382	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	N	382;382;382;382;382;382;382;382;382;345;354;313;243;243	ENSP00000451030:K382N;ENSP00000450936:K382N;ENSP00000452331:K382N;ENSP00000451855:K382N;ENSP00000347699:K382N;ENSP00000385243:K382N;ENSP00000384218:K382N;ENSP00000384612:K382N;ENSP00000383953:K382N;ENSP00000341199:K345N;ENSP00000412144:K313N;ENSP00000451912:K243N	ENSP00000341199:K345N	K	+	3	2	RGS6	72054866	0.166000	0.22962	1.000000	0.80357	0.994000	0.84299	0.049000	0.14099	1.417000	0.47077	0.561000	0.74099	AAG	RGS6	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000182732		0.498	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	RGS6	HGNC	protein_coding	OTTHUMT00000413033.2	-	0.00	50	0	G			72985113	+1	tier1	-	no_errors	ENST00000553525	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.964	T
RIMS2	9699	genome.wustl.edu	37	8	104898096	104898096	+	Silent	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:104898096T>C	ENST00000436393.2	+	2	844	c.603T>C	c.(601-603)tcT>tcC	p.S201S	RIMS2_ENST00000507740.1_Silent_p.S231S|RIMS2_ENST00000406091.3_Silent_p.S423S|RIMS2_ENST00000262231.10_Silent_p.S231S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S231S(3)|p.S459S(2)|p.S201S(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACCAAGTTCTTATGCACAAA	0.478										HNSCC(12;0.0054)																																							7	Substitution - coding silent(7)	large_intestine(7)											85.0	80.0	81.0					8																	104898096		1935	4137	6072	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.603T>C	8.37:g.104898096T>C			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.S423	ENST00000436393.2	37	c.1269		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	32	0	T	NM_001100117		104898096	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	silent	34.62	17	9	SNP	0.998	C
RIN2	54453	genome.wustl.edu	37	20	19981579	19981579	+	Nonstop_Mutation	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:19981579A>G	ENST00000255006.6	+	12	2983	c.2834A>G	c.(2833-2835)tAg>tGg	p.*945W	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Nonstop_Mutation_p.*463W	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						ACCACCTCCTAGAAGACAGGC	0.532																																																	0													42.0	43.0	43.0					20																	19981579		1964	4158	6122	SO:0001578	stop_lost	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2834A>G	20.37:g.19981579A>G	ENSP00000255006:p.*945Trpext*25		Q00425|Q5TFT8|Q9BQL3|Q9H071	Nonstop_Mutation	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.*945W	ENST00000255006.6	37	c.2834	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	A	8.657	0.899682	0.17686	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6249	0.68614	1.0:0.0:0.0:0.0	.	.	.	.	W	945;463	.	.	X	+	2	0	RIN2	19929579	1.000000	0.71417	0.179000	0.23059	0.129000	0.20672	4.110000	0.57831	2.272000	0.75746	0.460000	0.39030	TAG	RIN2	-	NULL	ENSG00000132669		0.532	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1		0.00	53	0	A			19981579	+1			no_errors	ENST00000255006	ensembl	human	known	74_37	nonstop	5.41	35	2	SNP	0.796	G
RNF145	153830	genome.wustl.edu	37	5	158603819	158603819	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:158603819G>T	ENST00000424310.2	-	5	801	c.442C>A	c.(442-444)Ctg>Atg	p.L148M	RNF145_ENST00000519865.1_Missense_Mutation_p.L148M|RNF145_ENST00000274542.2_Missense_Mutation_p.L176M|RNF145_ENST00000521606.2_Missense_Mutation_p.L165M|RNF145_ENST00000518802.1_Missense_Mutation_p.L178M|RNF145_ENST00000520638.1_Missense_Mutation_p.L162M	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	148						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTGAAAACAGCCAAATCTGC	0.368																																																	0													42.0	39.0	40.0					5																	158603819		2202	4299	6501	SO:0001583	missense	0			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.442C>A	5.37:g.158603819G>T	ENSP00000409064:p.Leu148Met		B7Z903|B7Z949|E7EVI7|Q8IVP7	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.L178M	ENST00000424310.2	37	c.532	CCDS56390.1	5	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651559	0.88056	.	.	ENSG00000145860	ENST00000274542;ENST00000519865;ENST00000424310;ENST00000521606;ENST00000413445;ENST00000518802;ENST00000535312;ENST00000520638	T;T;T;T;T;T;T	0.79352	-1.26;-1.24;-1.24;-1.25;-1.25;-1.26;-1.25	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.84946	0.5585	L	0.44542	1.39	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.999	D;D;D;D;D;D	0.77004	0.989;0.989;0.989;0.989;0.979;0.98	D	0.84890	0.0836	10	0.54805	T	0.06	-16.3093	19.6763	0.95934	0.0:0.0:1.0:0.0	.	164;165;162;178;148;176	E7EW26;B7Z949;B7Z903;E7EVI7;Q96MT1;Q96MT1-2	.;.;.;.;RN145_HUMAN;.	M	176;148;148;164;165;178;148;162	ENSP00000274542:L176M;ENSP00000430397:L148M;ENSP00000409064:L148M;ENSP00000430753:L164M;ENSP00000445115:L165M;ENSP00000430955:L178M;ENSP00000429071:L162M	ENSP00000274542:L176M	L	-	1	2	RNF145	158536397	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.869000	0.99810	2.725000	0.93324	0.460000	0.39030	CTG	RNF145	-	NULL	ENSG00000145860		0.368	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1	-	0.00	157	0	G	NM_144726		158603819	-1	tier1	-	no_errors	ENST00000518802	ensembl	human	known	74_37	missense	18.75	64	15	SNP	1.000	T
RNF148	378925	genome.wustl.edu	37	7	122342265	122342265	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:122342265C>G	ENST00000434824.1	-	1	756	c.540G>C	c.(538-540)ggG>ggC	p.G180G	CADPS2_ENST00000313070.7_Intron|RNF148_ENST00000447240.1_Silent_p.G82G|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron	NM_198085.1	NP_932351.1	Q8N7C7	RN148_HUMAN	ring finger protein 148	180						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|lung(7)	16						TGTGCATTCTCCCCACTTCAA	0.433																																																	0													238.0	239.0	239.0					7																	122342265		2086	4215	6301	SO:0001819	synonymous_variant	0			BC029264	CCDS47692.1	7q31.33	2013-01-09			ENSG00000235631	ENSG00000235631		"""RING-type (C3HC4) zinc fingers"""	22411	protein-coding gene	gene with protein product						8744354	Standard	NM_198085		Approved	MGC35222	uc003vkk.1	Q8N7C7	OTTHUMG00000157099	ENST00000434824.1:c.540G>C	7.37:g.122342265C>G			A4D0X4|Q8N308	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.G180	ENST00000434824.1	37	c.540	CCDS47692.1	7																																																																																			RNF148	-	NULL	ENSG00000235631		0.433	RNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF148	HGNC	protein_coding	OTTHUMT00000347424.1	-	0.00	56	0	C	NM_198085		122342265	-1	tier1	-	no_errors	ENST00000434824	ensembl	human	known	74_37	silent	10.00	44	5	SNP	0.853	G
RNF213	57674	genome.wustl.edu	37	17	78306030	78306030	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:78306030delA	ENST00000582970.1	+	21	3885	c.3742delA	c.(3742-3744)aagfs	p.K1248fs	RNF213_ENST00000508628.2_Frame_Shift_Del_p.K1297fs|RNF213_ENST00000456466.1_Frame_Shift_Del_p.K1248fs	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1248					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GAGTGAGCCTAAGGAGGACCA	0.537																																																	0													19.0	20.0	20.0					17																	78306030		692	1591	2283	SO:0001589	frameshift_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.3742delA	17.37:g.78306030delA	ENSP00000464087:p.Lys1248fs		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Frame_Shift_Del	DEL	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.K1248fs	ENST00000582970.1	37	c.3742	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.537	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	78	0	A	NM_020914		78306030	+1	tier1		no_errors	ENST00000582970	ensembl	human	known	74_37	frame_shift_del	5.26	36	2	DEL	0.000	-
RNF213	57674	genome.wustl.edu	37	17	78311486	78311486	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:78311486G>C	ENST00000582970.1	+	24	4771	c.4628G>C	c.(4627-4629)aGa>aCa	p.R1543T	RNF213_ENST00000508628.2_Missense_Mutation_p.R1592T|RNF213_ENST00000336301.6_5'Flank	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1543					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ATCAACCAAAGAGGCATCTAT	0.607																																																	0													42.0	39.0	40.0					17																	78311486		692	1591	2283	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.4628G>C	17.37:g.78311486G>C	ENSP00000464087:p.Arg1543Thr		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.R1543T	ENST00000582970.1	37	c.4628	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	3.624	-0.076962	0.07184	.	.	ENSG00000173821	ENST00000508628;ENST00000411702	.	.	.	4.66	-4.48	0.03515	.	.	.	.	.	T	0.41789	0.1174	L	0.43152	1.355	0.30193	N	0.799326	.	.	.	.	.	.	T	0.53634	-0.8411	6	0.62326	D	0.03	.	8.1165	0.30946	0.5089:0.1055:0.3856:0.0	.	.	.	.	T	1543;1592	.	ENSP00000396478:R1592T	R	+	2	0	RNF213	75926081	0.192000	0.23301	0.000000	0.03702	0.029000	0.11900	0.502000	0.22594	-0.775000	0.04584	-0.258000	0.10820	AGA	RNF213	-	NULL	ENSG00000173821		0.607	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	57	0	G	NM_020914		78311486	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.201	C
RNF214	257160	genome.wustl.edu	37	11	117117537	117117537	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:117117537G>T	ENST00000531452.1	+	6	878	c.832G>T	c.(832-834)Gct>Tct	p.A278S	RNF214_ENST00000531287.1_Missense_Mutation_p.A123S|RNF214_ENST00000300650.4_Missense_Mutation_p.A278S|RNF214_ENST00000530849.1_Missense_Mutation_p.A123S	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	278							zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		GATATTAAAGGCTATTCAGGA	0.348																																																	0													202.0	198.0	200.0					11																	117117537		1842	4083	5925	SO:0001583	missense	0			AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.832G>T	11.37:g.117117537G>T	ENSP00000431643:p.Ala278Ser		B2RUW0|B4DTD1	Missense_Mutation	SNP	pfscan_Znf_RING	p.A278S	ENST00000531452.1	37	c.832	CCDS41720.1	11	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526783	0.44969	.	.	ENSG00000167257	ENST00000531287;ENST00000531452;ENST00000530849;ENST00000300650	T;T;T;T	0.39592	2.58;1.07;1.07;1.07	5.84	5.84	0.93424	.	0.210084	0.41823	D	0.000806	T	0.39545	0.1082	L	0.46157	1.445	0.36872	D	0.888942	P;P	0.44946	0.518;0.846	B;P	0.45310	0.303;0.476	T	0.26916	-1.0089	10	0.09843	T	0.71	-6.3008	14.0188	0.64541	0.0:0.0:0.8491:0.1509	.	123;278	B4DTD1;Q8ND24	.;RN214_HUMAN	S	123;278;123;278	ENSP00000435361:A123S;ENSP00000431643:A278S;ENSP00000432903:A123S;ENSP00000300650:A278S	ENSP00000300650:A278S	A	+	1	0	RNF214	116622747	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.719000	0.61937	2.764000	0.94973	0.655000	0.94253	GCT	RNF214	-	NULL	ENSG00000167257		0.348	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF214	HGNC	protein_coding	OTTHUMT00000392884.1	-	0.00	59	0	G	NM_001077239		117117537	+1	tier1	-	no_errors	ENST00000300650	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
RNF220	55182	genome.wustl.edu	37	1	45110739	45110739	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:45110739G>A	ENST00000355387.2	+	10	1746	c.1296G>A	c.(1294-1296)cgG>cgA	p.R432R	TMEM53_ENST00000372244.3_Intron|RNF220_ENST00000372247.2_Silent_p.R432R|TMEM53_ENST00000372242.3_Intron|TMEM53_ENST00000372243.3_Intron|RNF220_ENST00000443020.2_Silent_p.R219R|RNF220_ENST00000361799.2_Silent_p.R432R|RNF220_ENST00000480686.1_3'UTR			Q5VTB9	RN220_HUMAN	ring finger protein 220	432					protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						AGGCACTTCGGGGCGCAGTCC	0.597																																																	0													72.0	75.0	74.0					1																	45110739		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.1296G>A	1.37:g.45110739G>A			B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	Silent	SNP	superfamily_Peptidase_M20_dimer,pfscan_Znf_RING	p.R432	ENST00000355387.2	37	c.1296	CCDS510.1	1																																																																																			RNF220	-	superfamily_Peptidase_M20_dimer	ENSG00000187147		0.597	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	HGNC	protein_coding	OTTHUMT00000020683.4	-	0.00	52	0	G	NM_018150		45110739	+1	tier1	-	no_errors	ENST00000355387	ensembl	human	known	74_37	silent	6.85	68	5	SNP	1.000	A
RPA4	29935	genome.wustl.edu	37	X	96139347	96139347	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:96139347C>G	ENST00000373040.3	+	1	441	c.38C>G	c.(37-39)tCt>tGt	p.S13C	DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000373061.3_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000324765.8_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	13					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						GGCAGCATTTCTGCTGCTGAT	0.542								Other identified genes with known or suspected DNA repair function																																									0													88.0	73.0	78.0					X																	96139347		2203	4300	6503	SO:0001583	missense	0			U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.38C>G	X.37:g.96139347C>G	ENSP00000362131:p.Ser13Cys		Q3SY03	Missense_Mutation	SNP	pfam_RPA_C,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_RPA32	p.S13C	ENST00000373040.3	37	c.38	CCDS35345.1	X	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765000	0.31228	.	.	ENSG00000204086	ENST00000373040	T	0.19394	2.15	3.34	0.783	0.18572	.	.	.	.	.	T	0.23054	0.0557	L	0.38175	1.15	0.09310	N	1	D	0.69078	0.997	P	0.53912	0.737	T	0.12116	-1.0560	9	0.87932	D	0	.	4.9429	0.13975	0.0:0.5137:0.0:0.4863	.	13	Q13156	RFA4_HUMAN	C	13	ENSP00000362131:S13C	ENSP00000362131:S13C	S	+	2	0	RPA4	96026003	0.000000	0.05858	0.015000	0.15790	0.007000	0.05969	-0.488000	0.06497	0.021000	0.15133	0.600000	0.82982	TCT	RPA4	-	pirsf_RPA32	ENSG00000204086		0.542	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA4	HGNC	protein_coding	OTTHUMT00000057464.1		0.00	41	0	C	NM_013347		96139347	+1			no_errors	ENST00000373040	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.014	G
RPL36	25873	genome.wustl.edu	37	19	5691620	5691620	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:5691620C>G	ENST00000577222.1	+	6	850	c.306C>G	c.(304-306)gcC>gcG	p.A102A	RPL36_ENST00000347512.3_Silent_p.A102A|RPL36_ENST00000579446.1_3'UTR|RPL36_ENST00000579649.1_Silent_p.A102A|RPL36_ENST00000394580.2_Silent_p.A102A			Q9Y3U8	RL36_HUMAN	ribosomal protein L36	102					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|upper_aerodigestive_tract(1)	2						AAGCTGCTGCCAAGAAAGACT	0.632											OREG0025183	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													13.0	14.0	14.0					19																	5691620		2177	4249	6426	SO:0001819	synonymous_variant	0				CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8		ENST00000577222.1:c.306C>G	19.37:g.5691620C>G		628	B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Silent	SNP	pfam_Ribosomal_L36e	p.A102	ENST00000577222.1	37	c.306	CCDS12147.1	19																																																																																			RPL36	-	NULL	ENSG00000130255		0.632	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	RPL36	HGNC	protein_coding	OTTHUMT00000442561.1	-	0.00	91	0	C	NM_015414		5691620	+1	tier1	-	no_errors	ENST00000347512	ensembl	human	known	74_37	silent	5.63	66	4	SNP	1.000	G
RPS6KL1	83694	genome.wustl.edu	37	14	75388118	75388118	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:75388118C>T	ENST00000555647.1	-	3	414	c.127G>A	c.(127-129)Gac>Aac	p.D43N	RPS6KL1_ENST00000354625.2_Missense_Mutation_p.D43N|RPS6KL1_ENST00000358328.4_Missense_Mutation_p.D43N|RPS6KL1_ENST00000554900.1_Intron|RPS6KL1_ENST00000557413.1_Missense_Mutation_p.D43N			Q9Y6S9	RPKL1_HUMAN	ribosomal protein S6 kinase-like 1	43						ribosome (GO:0005840)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(234;0.00658)		TTTGTCATGTCAGGCACTCCC	0.617																																																	0													142.0	127.0	132.0					14																	75388118		2203	4300	6503	SO:0001583	missense	0			BC004540	CCDS9834.1, CCDS9834.2	14q24.2	2011-04-05				ENSG00000198208			20222	protein-coding gene	gene with protein product							Standard	NM_031464		Approved	MGC11287	uc010tux.2	Q9Y6S9		ENST00000555647.1:c.127G>A	14.37:g.75388118C>T	ENSP00000452027:p.Asp43Asn		A6NGM9|Q69YT9|Q6ZMQ6|Q96NR9|Q9BSU9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_MIT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D43N	ENST00000555647.1	37	c.127	CCDS9834.2	14	.	.	.	.	.	.	.	.	.	.	C	19.32	3.804394	0.70682	.	.	ENSG00000198208	ENST00000555647;ENST00000354625;ENST00000557413;ENST00000358328	T;T;T;T	0.58940	0.3;1.57;0.3;0.3	4.18	4.18	0.49190	.	0.102616	0.40385	N	0.001117	T	0.63604	0.2525	L	0.27053	0.805	0.09310	N	1	D;D;D	0.89917	1.0;0.988;1.0	D;P;D	0.87578	0.963;0.871;0.998	T	0.57619	-0.7780	10	0.62326	D	0.03	-21.1244	13.7997	0.63192	0.0:1.0:0.0:0.0	.	43;43;43	Q9Y6S9;Q9Y6S9-4;Q9Y6S9-2	RPKL1_HUMAN;.;.	N	43	ENSP00000452027:D43N;ENSP00000346644:D43N;ENSP00000450567:D43N;ENSP00000351086:D43N	ENSP00000346644:D43N	D	-	1	0	RPS6KL1	74457871	0.940000	0.31905	0.055000	0.19348	0.023000	0.10783	5.003000	0.63959	2.053000	0.61076	0.561000	0.74099	GAC	RPS6KL1	-	NULL	ENSG00000198208		0.617	RPS6KL1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPS6KL1	HGNC	protein_coding	OTTHUMT00000413732.1	-	0.00	26	0	C			75388118	-1	tier1	-	no_errors	ENST00000358328	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.063	T
RRN3	54700	genome.wustl.edu	37	16	15165077	15165077	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:15165077C>A	ENST00000198767.6	-	13	1243	c.1160G>T	c.(1159-1161)tGg>tTg	p.W387L	RRN3_ENST00000540462.1_Missense_Mutation_p.W205L|RRN3_ENST00000563559.1_Missense_Mutation_p.W387L|PDXDC1_ENST00000535621.2_Intron|RRN3_ENST00000327307.7_Missense_Mutation_p.W354L|RRN3_ENST00000429751.2_Missense_Mutation_p.W357L	NM_018427.3	NP_060897.3	Q9NYV6	RRN3_HUMAN	RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)	387					cell proliferation (GO:0008283)|cytoplasm organization (GO:0007028)|gene expression (GO:0010467)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of intrinsic apoptotic signaling pathway by p53 class mediator (GO:1902254)|nucleolus organization (GO:0007000)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, initiation (GO:2000142)|ribosome biogenesis (GO:0042254)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(2)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)	20						CAATTTTTTCCAGAGATGTTC	0.403																																																	0													86.0	95.0	92.0					16																	15165077		2197	4300	6497	SO:0001583	missense	0			AF227156	CCDS10559.1, CCDS73833.1	16p13.11	2009-10-26	2006-04-04		ENSG00000085721	ENSG00000085721			30346	protein-coding gene	gene with protein product		605121	"""RRN3 RNA polymerase I transcription factor homolog (yeast)"""			10758157, 11250903	Standard	XM_005255375		Approved	DKFZp566E104	uc002dde.3	Q9NYV6	OTTHUMG00000129847	ENST00000198767.6:c.1160G>T	16.37:g.15165077C>A	ENSP00000198767:p.Trp387Leu		A2RTY9|B4E0J7|B4E3T2|Q3MHU9|Q6IPL4|Q9H4F0	Missense_Mutation	SNP	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	p.W387L	ENST00000198767.6	37	c.1160	CCDS10559.1	16	.	.	.	.	.	.	.	.	.	.	.	27.4	4.830336	0.91036	.	.	ENSG00000085721	ENST00000198767;ENST00000429751;ENST00000327307;ENST00000540462	T;T;T;T	0.39229	1.09;1.09;1.09;1.09	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	L	0.54323	1.7	0.80722	D	1	B;P;D	0.58620	0.184;0.805;0.983	B;P;D	0.63381	0.148;0.688;0.914	T	0.41645	-0.9497	10	0.08837	T	0.75	.	19.0097	0.92868	0.0:1.0:0.0:0.0	.	357;288;387	F5H148;B4DZL9;Q9NYV6	.;.;RRN3_HUMAN	L	387;357;354;205	ENSP00000198767:W387L;ENSP00000402027:W357L;ENSP00000318484:W354L;ENSP00000437963:W205L	ENSP00000198767:W387L	W	-	2	0	RRN3	15072578	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.943000	0.75934	2.798000	0.96311	0.579000	0.79373	TGG	RRN3	-	pfam_RNA_pol_I_trans_ini_fac_RRN3,superfamily_ARM-type_fold	ENSG00000085721		0.403	RRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRN3	HGNC	protein_coding	OTTHUMT00000252087.2	-	0.00	139	0	C	NM_018427		15165077	-1	tier1	-	no_errors	ENST00000198767	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	A
RUNX2	860	genome.wustl.edu	37	6	45514825	45514825	+	Missense_Mutation	SNP	C	C	T	rs369481795		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:45514825C>T	ENST00000371438.1	+	8	1707	c.1349C>T	c.(1348-1350)tCg>tTg	p.S450L	RUNX2_ENST00000359524.5_Missense_Mutation_p.S436L|RUNX2_ENST00000465038.2_Missense_Mutation_p.S450L|RUNX2_ENST00000541979.1_Missense_Mutation_p.S496L|RUNX2_ENST00000371436.6_Missense_Mutation_p.S428L|RUNX2_ENST00000371432.3_Missense_Mutation_p.S414L|RUNX2_ENST00000576263.1_Intron|RUNX2_ENST00000352853.5_Missense_Mutation_p.S518L	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	450	Interaction with KAT6B.|Pro/Ser/Thr-rich.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						TATGGCACTTCGTCAGGATCC	0.577																																																	0								C	LEU/SER,LEU/SER,LEU/SER	1,4405	2.1+/-5.4	0,1,2202	102.0	90.0	94.0		1283,1349,1307	5.8	1.0	6		94	0,8600		0,0,4300	no	missense,missense,missense	RUNX2	NM_001015051.3,NM_001024630.3,NM_004348.3	145,145,145	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	428/500,450/522,436/508	45514825	1,13005	2203	4300	6503	SO:0001583	missense	0			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.1349C>T	6.37:g.45514825C>T	ENSP00000360493:p.Ser450Leu		O14614|O14615|O95181	Missense_Mutation	SNP	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pfscan_Runt_dom,prints_AML1_Runt	p.S518L	ENST00000371438.1	37	c.1553	CCDS43467.2	6	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269376	0.80469	2.27E-4	0.0	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.77	5.77	0.91146	Runx inhibition (1);	0.000000	0.85682	D	0.000000	T	0.52025	0.1709	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.96;0.992;0.983	T	0.51872	-0.8650	10	0.87932	D	0	-5.1805	20.3627	0.98863	0.0:1.0:0.0:0.0	.	496;450;436	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	L	450;518;496;450;428;436;414	ENSP00000420707:S450L;ENSP00000319087:S518L;ENSP00000446290:S496L;ENSP00000360493:S450L;ENSP00000360491:S428L;ENSP00000352514:S436L;ENSP00000360486:S414L	ENSP00000319087:S518L	S	+	2	0	RUNX2	45622803	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.677000	0.68142	2.885000	0.99019	0.655000	0.94253	TCG	RUNX2	-	pfam_RunxI_C_dom,prints_AML1_Runt	ENSG00000124813		0.577	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2		0.00	39	0	C	NM_004348		45514825	+1			no_errors	ENST00000352853	ensembl	human	known	74_37	missense	9.68	27	3	SNP	1.000	T
RUVBL2	10856	genome.wustl.edu	37	19	49513245	49513245	+	Silent	SNP	C	C	T	rs200114612		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:49513245C>T	ENST00000595090.1	+	8	1049	c.585C>T	c.(583-585)atC>atT	p.I195I	RUVBL2_ENST00000413176.2_Silent_p.I150I|RUVBL2_ENST00000601968.1_Silent_p.I150I	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	195					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		TGATCACCATCGACAAGGCGA	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		19268	0.0		0.0	False		,,,				2504	0.001																0								C		1,4155		0,1,2077	65.0	69.0	68.0		585	-1.2	1.0	19		68	5,8367		0,5,4181	no	coding-synonymous	RUVBL2	NM_006666.1		0,6,6258	TT,TC,CC		0.0597,0.0241,0.0479		195/464	49513245	6,12522	2078	4186	6264	SO:0001819	synonymous_variant	0			AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.585C>T	19.37:g.49513245C>T			B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Nonsense_Mutation	SNP	pfam_TIP49_C,pfam_DNA_helicase_DnaB-like_C,pfam_ATPase_AAA_core,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase	p.R192*	ENST00000595090.1	37	c.574	CCDS42588.1	19																																																																																			RUVBL2	-	superfamily_NA-bd_OB-fold	ENSG00000183207		0.667	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL2	HGNC	protein_coding	OTTHUMT00000466235.1	-	0.00	73	0	C			49513245	+1	tier1	rs200114612	no_errors	ENST00000221413	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	0.989	T
RUVBL2	10856	genome.wustl.edu	37	19	49513866	49513866	+	Nonsense_Mutation	SNP	C	C	G	rs375101517		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:49513866C>G	ENST00000595090.1	+	9	1249	c.785C>G	c.(784-786)tCa>tGa	p.S262*	RUVBL2_ENST00000413176.2_Nonsense_Mutation_p.S217*|RUVBL2_ENST00000601968.1_Nonsense_Mutation_p.S217*	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	262					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		GCGCTCTTCTCAGGTGAGGCC	0.667																																																	0													55.0	62.0	60.0					19																	49513866		2106	4220	6326	SO:0001587	stop_gained	0			AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.785C>G	19.37:g.49513866C>G	ENSP00000473172:p.Ser262*		B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Nonsense_Mutation	SNP	pfam_TIP49_C,pfam_ATPase_AAA_core,pfam_DNA_helicase_DnaB-like_C,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_AAA+_ATPase,prints_DNA_repair_RadA	p.S262*	ENST00000595090.1	37	c.785	CCDS42588.1	19	.	.	.	.	.	.	.	.	.	.	C	48	13.899041	0.99769	.	.	ENSG00000183207	ENST00000221413;ENST00000413176	.	.	.	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-11.0449	14.8187	0.70055	0.0:1.0:0.0:0.0	.	.	.	.	X	262;217	.	ENSP00000221413:S262X	S	+	2	0	RUVBL2	54205678	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.224000	0.65288	2.446000	0.82766	0.650000	0.86243	TCA	RUVBL2	-	pfam_TIP49_C,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000183207		0.667	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL2	HGNC	protein_coding	OTTHUMT00000466235.1	-	0.00	40	0	C			49513866	+1	tier1	-	no_errors	ENST00000595090	ensembl	human	known	74_37	nonsense	21.05	14	4	SNP	1.000	G
RYR2	6262	genome.wustl.edu	37	1	237893570	237893570	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:237893570G>T	ENST00000366574.2	+	77	11166	c.10849G>T	c.(10849-10851)Gtc>Ttc	p.V3617F	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.V3601F|RYR2_ENST00000360064.6_Missense_Mutation_p.V3615F	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3617					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.V3615L(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCATCGGGCTGTCAATCTCTT	0.333																																																	1	Substitution - Missense(1)	lung(1)											77.0	72.0	74.0					1																	237893570		1827	4078	5905	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10849G>T	1.37:g.237893570G>T	ENSP00000355533:p.Val3617Phe		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V3615F	ENST00000366574.2	37	c.10843	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.217469	0.79352	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.96913	-4.17;-4.14;-4.17	5.52	5.52	0.82312	.	0.000000	0.56097	D	0.000028	D	0.94827	0.8329	L	0.29908	0.895	0.80722	D	1	P;D	0.58268	0.911;0.982	P;P	0.50970	0.467;0.655	D	0.95050	0.8186	10	0.72032	D	0.01	-20.9798	14.6196	0.68574	0.0:0.0:0.8542:0.1458	.	572;3617	B4DGV4;Q92736	.;RYR2_HUMAN	F	3617;3615;3601;572	ENSP00000355533:V3617F;ENSP00000353174:V3615F;ENSP00000443798:V3601F	ENSP00000353174:V3615F	V	+	1	0	RYR2	235960193	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.913000	0.39956	2.757000	0.94681	0.585000	0.79938	GTC	RYR2	-	NULL	ENSG00000198626		0.333	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	91	0	G	NM_001035		237893570	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
SAP130	79595	genome.wustl.edu	37	2	128757988	128757988	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:128757988T>A	ENST00000259235.3	-	8	1117	c.988A>T	c.(988-990)Atc>Ttc	p.I330F	SAP130_ENST00000357702.5_Missense_Mutation_p.I330F|SAP130_ENST00000259234.6_Missense_Mutation_p.I304F	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	330					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TGAATACTGATTGCTGCAGAT	0.463																																																	0													209.0	183.0	192.0					2																	128757988		2203	4300	6503	SO:0001583	missense	0			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.988A>T	2.37:g.128757988T>A	ENSP00000259235:p.Ile330Phe		B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NULL	p.I330F	ENST00000259235.3	37	c.988	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	T	17.35	3.367184	0.61513	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.38	4.23	0.50019	.	0.103999	0.64402	D	0.000004	T	0.54127	0.1839	N	0.24115	0.695	0.52501	D	0.999954	D;P;P	0.67145	0.996;0.879;0.879	P;P;P	0.62184	0.899;0.572;0.448	T	0.56751	-0.7927	9	0.62326	D	0.03	-13.6753	11.154	0.48476	0.0:0.0722:0.0:0.9278	.	330;303;330	B7ZLM3;Q96DP1;Q9H0E3	.;.;SP130_HUMAN	F	330;330;304	.	ENSP00000259234:I304F	I	-	1	0	SAP130	128474458	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	3.471000	0.53107	0.991000	0.38814	0.528000	0.53228	ATC	SAP130	-	NULL	ENSG00000136715		0.463	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3	-	0.00	80	0	T	NM_024545		128757988	-1	tier1	-	no_errors	ENST00000357702	ensembl	human	known	74_37	missense	10.42	86	10	SNP	0.992	A
SEC23A	10484	genome.wustl.edu	37	14	39502532	39502532	+	Splice_Site	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr14:39502532C>A	ENST00000307712.6	-	20	2726	c.2209G>T	c.(2209-2211)Gag>Tag	p.E737*	SEC23A_ENST00000545328.2_Splice_Site_p.E708*|SEC23A_ENST00000536508.1_Splice_Site_p.E635*|SEC23A_ENST00000537403.1_Splice_Site_p.E535*	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	737					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		GCTCCAGACTCCTAGAGGAAA	0.338																																																	0													75.0	80.0	79.0					14																	39502532		2203	4298	6501	SO:0001630	splice_region_variant	0			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.2209-1G>T	14.37:g.39502532C>A			B2R5P4|B3KXI2|Q8NE16	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.E737*	ENST00000307712.6	37	c.2209	CCDS9668.1	14	.	.	.	.	.	.	.	.	.	.	C	42	9.514824	0.99192	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	.	.	.	5.58	5.58	0.84498	.	0.051193	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-16.7518	19.579	0.95458	0.0:1.0:0.0:0.0	.	.	.	.	X	535;737;635;708	.	ENSP00000306881:E737X	E	-	1	0	SEC23A	38572283	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	7.601000	0.82783	2.617000	0.88574	0.591000	0.81541	GAG	SEC23A	-	NULL	ENSG00000100934		0.338	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	HGNC	protein_coding	OTTHUMT00000276728.2	-	0.00	171	0	C		Nonsense_Mutation	39502532	-1	tier1	-	no_errors	ENST00000307712	ensembl	human	known	74_37	nonsense	10.24	149	17	SNP	1.000	A
SENP1	29843	genome.wustl.edu	37	12	48491881	48491881	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:48491881C>G	ENST00000004980.5	-	3	509	c.31G>C	c.(31-33)Gat>Cat	p.D11H	SENP1_ENST00000339976.6_Missense_Mutation_p.D43H|SENP1_ENST00000547886.1_5'Flank|SENP1_ENST00000448372.1_Missense_Mutation_p.D11H|SENP1_ENST00000551330.1_Missense_Mutation_p.D11H|SENP1_ENST00000549518.1_Missense_Mutation_p.D11H|SENP1_ENST00000549595.1_Missense_Mutation_p.D11H			Q9P0U3	SENP1_HUMAN	SUMO1/sentrin specific peptidase 1	11					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cellular protein metabolic process (GO:0044267)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|proteolysis (GO:0006508)|regulation of definitive erythrocyte differentiation (GO:0010724)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|SUMO-specific protease activity (GO:0016929)			large_intestine(3)|lung(1)|pancreas(2)|stomach(1)	7		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)				TCTCCAGCATCCATCCTCATC	0.428																																																	0													86.0	92.0	90.0					12																	48491881		1947	4145	6092	SO:0001583	missense	0			AF149770	CCDS44868.1, CCDS44868.2	12q13.1	2008-02-05	2005-08-17			ENSG00000079387			17927	protein-coding gene	gene with protein product		612157	"""SUMO1/sentrin specific protease 1"""			10652325, 14563852	Standard	NM_001267595		Approved		uc009zkx.4	Q9P0U3	OTTHUMG00000169896	ENST00000004980.5:c.31G>C	12.37:g.48491881C>G	ENSP00000004980:p.Asp11His		A8K7P5|Q86XC8	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.D11H	ENST00000004980.5	37	c.31	CCDS44868.2	12	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489335	0.64074	.	.	ENSG00000079387	ENST00000004980;ENST00000339976;ENST00000448372;ENST00000551330;ENST00000549595;ENST00000549518;ENST00000551798	T;T;T;T;T	0.18016	2.24;2.24;2.24;2.24;2.24	5.22	5.22	0.72569	.	0.341025	0.28538	N	0.014982	T	0.24431	0.0592	N	0.14661	0.345	0.34729	D	0.729595	D;D	0.69078	0.995;0.997	P;D	0.63877	0.831;0.919	T	0.24012	-1.0172	10	0.87932	D	0	-15.603	16.1836	0.81929	0.0:1.0:0.0:0.0	.	11;11	Q9P0U3;Q9P0U3-2	SENP1_HUMAN;.	H	11;43;11;11;11;11;4	ENSP00000004980:D11H;ENSP00000394791:D11H;ENSP00000446681:D11H;ENSP00000450076:D11H;ENSP00000447328:D11H	ENSP00000004980:D11H	D	-	1	0	SENP1	46778148	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.918000	0.56432	2.885000	0.99019	0.655000	0.94253	GAT	SENP1	-	NULL	ENSG00000079387		0.428	SENP1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP1	HGNC	protein_coding	OTTHUMT00000406471.1	-	0.00	130	0	C	NM_014554		48491881	-1	tier1	-	no_errors	ENST00000004980	ensembl	human	known	74_37	missense	10.71	150	18	SNP	1.000	G
SENP8	123228	genome.wustl.edu	37	15	72432295	72432295	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr15:72432295G>C	ENST00000542035.2	+	2	664	c.331G>C	c.(331-333)Gat>Cat	p.D111H	SENP8_ENST00000544171.1_Missense_Mutation_p.D111H|SENP8_ENST00000340912.4_Missense_Mutation_p.D111H|RP11-2I17.4_ENST00000568984.1_RNA|SENP8_ENST00000544411.1_Missense_Mutation_p.D111H	NM_001166340.1	NP_001159812.1	Q96LD8	SENP8_HUMAN	SUMO/sentrin specific peptidase family member 8	111	Protease.						cysteine-type peptidase activity (GO:0008234)			breast(1)|kidney(2)|lung(1)|ovary(1)|skin(1)	6						CTACCTCCAAGATAAAAATAG	0.443																																																	0													61.0	66.0	64.0					15																	72432295		2199	4297	6496	SO:0001583	missense	0			BC031411	CCDS10240.1	15q22.33	2005-08-17	2005-08-17	2004-01-30	ENSG00000166192	ENSG00000166192			22992	protein-coding gene	gene with protein product	"""NEDD8-specific protease 1"", ""sentrin/SUMO-specific protease SENP8"", ""deneddylase 1"""	608659	"""protease, cysteine, 2 (NEDD8 specific)"", ""SUMO/sentrin specific protease family member 8"""	PRSC2		12730221, 12759362	Standard	NM_145204		Approved	NEDP1, DEN1, HsT17512	uc021spt.1	Q96LD8	OTTHUMG00000133441	ENST00000542035.2:c.331G>C	15.37:g.72432295G>C	ENSP00000446057:p.Asp111His		Q96QA4	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.D111H	ENST00000542035.2	37	c.331	CCDS10240.1	15	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518398	0.27211	.	.	ENSG00000166192	ENST00000542035;ENST00000544411;ENST00000340912;ENST00000544171	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.57	5.57	0.84162	.	0.583714	0.19155	N	0.121350	T	0.27967	0.0689	L	0.38175	1.15	0.47476	D	0.999434	B	0.06786	0.001	B	0.10450	0.005	T	0.02378	-1.1168	10	0.45353	T	0.12	-3.2274	15.4007	0.74838	0.0:0.1387:0.8613:0.0	.	111	Q96LD8	SENP8_HUMAN	H	111	ENSP00000446057:D111H;ENSP00000441753:D111H;ENSP00000340505:D111H;ENSP00000439415:D111H	ENSP00000340505:D111H	D	+	1	0	SENP8	70219349	1.000000	0.71417	0.999000	0.59377	0.816000	0.46133	3.539000	0.53604	2.773000	0.95371	0.655000	0.94253	GAT	SENP8	-	pfam_Peptidase_C48,pfscan_Peptidase_C48	ENSG00000166192		0.443	SENP8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SENP8	HGNC	protein_coding	OTTHUMT00000420036.1	-	0.00	67	0	G	NM_145204		72432295	+1	tier1	-	no_errors	ENST00000340912	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.996	C
SEPHS1	22929	genome.wustl.edu	37	10	13380806	13380806	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:13380806T>C	ENST00000327347.5	-	3	571	c.196A>G	c.(196-198)Att>Gtt	p.I66V	SEPHS1_ENST00000494329.1_5'UTR|SEPHS1_ENST00000537130.1_5'UTR|SEPHS1_ENST00000378614.4_Missense_Mutation_p.I66V|SEPHS1_ENST00000545675.1_Missense_Mutation_p.I66V	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	66					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						TCCATTCCAATGCCTGTGGAG	0.423																																																	0													99.0	89.0	92.0					10																	13380806		2203	4300	6503	SO:0001583	missense	0			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.196A>G	10.37:g.13380806T>C	ENSP00000367893:p.Ile66Val		B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.I66V	ENST00000327347.5	37	c.196	CCDS7098.1	10	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137678	0.56936	.	.	ENSG00000086475	ENST00000327347;ENST00000319684;ENST00000378614;ENST00000545675;ENST00000413411	T;T;T	0.44881	0.94;0.91;0.93	5.45	5.45	0.79879	PurM, N-terminal-like (1);	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	L	0.53249	1.67	0.80722	D	1	B;B;B;B;B	0.18013	0.001;0.0;0.025;0.004;0.025	B;B;B;B;B	0.12156	0.007;0.001;0.005;0.004;0.005	T	0.19877	-1.0292	10	0.19147	T	0.46	-18.6911	15.542	0.76057	0.0:0.0:0.0:1.0	.	18;66;66;66;66	B4DLS1;Q5T5U9;P49903;D6PSQ9;D3DRS9	.;.;SPS1_HUMAN;.;.	V	66	ENSP00000367893:I66V;ENSP00000367877:I66V;ENSP00000441119:I66V	ENSP00000367887:I66V	I	-	1	0	SEPHS1	13420812	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	8.040000	0.89188	2.064000	0.61679	0.533000	0.62120	ATT	SEPHS1	-	superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	ENSG00000086475		0.423	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPHS1	HGNC	protein_coding	OTTHUMT00000046856.1	-	0.00	83	0	T	NM_012247		13380806	-1	tier1	-	no_errors	ENST00000327347	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	C
SERGEF	26297	genome.wustl.edu	37	11	18014501	18014501	+	Nonsense_Mutation	SNP	G	G	C	rs552461036		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:18014501G>C	ENST00000265965.5	-	7	813	c.662C>G	c.(661-663)tCa>tGa	p.S221*	SERGEF_ENST00000528200.1_Nonsense_Mutation_p.S221*|SERGEF_ENST00000532265.1_Nonsense_Mutation_p.S107*	NM_012139.2	NP_036271.1	Q9UGK8	SRGEF_HUMAN	secretion regulating guanine nucleotide exchange factor	221					negative regulation of protein secretion (GO:0050709)|positive regulation of Ran GTPase activity (GO:0032853)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)	Ran guanyl-nucleotide exchange factor activity (GO:0005087)			autonomic_ganglia(1)|central_nervous_system(1)|large_intestine(5)|lung(5)	12						TGAGTGGTCTGAGCCAGCAAG	0.398																																																	0													125.0	111.0	116.0					11																	18014501		2200	4293	6493	SO:0001587	stop_gained	0			AJ243950	CCDS7828.1	11p14.3	2006-03-09			ENSG00000129158	ENSG00000129158			17499	protein-coding gene	gene with protein product		606051				10571079, 12459492	Standard	NM_012139		Approved	DelGEF, Gnefr	uc001mnm.3	Q9UGK8	OTTHUMG00000166420	ENST00000265965.5:c.662C>G	11.37:g.18014501G>C	ENSP00000265965:p.Ser221*		Q9UGK9	Nonsense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,prints_Reg_chr_condens,pfscan_Reg_chr_condens	p.S221*	ENST00000265965.5	37	c.662	CCDS7828.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.94|15.94	2.980459|2.980459	0.53827|0.53827	.|.	.|.	ENSG00000129158|ENSG00000129158	ENST00000529151|ENST00000265965;ENST00000528200;ENST00000525920;ENST00000532265;ENST00000529728;ENST00000530613;ENST00000532389	.|.	.|.	.|.	5.19|5.19	4.27|4.27	0.50696|0.50696	.|.	.|0.135477	.|0.52532	.|D	.|0.000073	T|.	0.42314|.	0.1197|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.48822|.	-0.9001|.	3|.	.|0.11485	.|T	.|0.65	-5.9694|-5.9694	11.6372|11.6372	0.51211|0.51211	0.0847:0.0:0.9153:0.0|0.0847:0.0:0.9153:0.0	.|.	.|.	.|.	.|.	E|X	85|221;221;91;107;107;107;107	.|.	.|ENSP00000265965:S221X	Q|S	-|-	1|2	0|0	SERGEF|SERGEF	17971077|17971077	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.985000|0.985000	0.73830|0.73830	4.022000|4.022000	0.57203|0.57203	1.537000|1.537000	0.49254|0.49254	0.655000|0.655000	0.94253|0.94253	CAG|TCA	SERGEF	-	superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000129158		0.398	SERGEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERGEF	HGNC	protein_coding	OTTHUMT00000389538.1	-	0.00	100	0	G	NM_012139		18014501	-1	tier1	-	no_errors	ENST00000265965	ensembl	human	known	74_37	nonsense	6.33	74	5	SNP	0.791	C
SETBP1	26040	genome.wustl.edu	37	18	42529939	42529940	+	Frame_Shift_Ins	INS	-	-	A	rs79615803		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:42529939_42529940insA	ENST00000282030.5	+	4	930_931	c.634_635insA	c.(634-636)caafs	p.Q212fs		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	212						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAAGCACCAGCAAAAAAGCAGC	0.525									Schinzel-Giedion syndrome																																								0																																										SO:0001589	frameshift_variant	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.640dupA	18.37:g.42529945_42529945dupA	ENSP00000282030:p.Gln212fs		A6H8W5|Q6P6C3|Q9UEF3	Frame_Shift_Ins	INS	smart_AT_hook_DNA-bd_motif	p.S214fs	ENST00000282030.5	37	c.634_635	CCDS11923.2	18																																																																																			SETBP1	-	NULL	ENSG00000152217		0.525	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4		0.00	58	0	-	NM_001130110		42529940	+1	tier1		no_errors	ENST00000282030	ensembl	human	known	74_37	frame_shift_ins	5.26	36	2	INS	1.000:1.000	A
SGK223	157285	genome.wustl.edu	37	8	8239172	8239172	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:8239172G>A	ENST00000520004.1	-	2	350	c.86C>T	c.(85-87)tCc>tTc	p.S29F	SGK223_ENST00000330777.4_Missense_Mutation_p.S29F			Q86YV5	SG223_HUMAN		29							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										GTTCTTGCAGGACCCGGGTTT	0.662																																					GBM(34;731 755 10259 33573 33867)												0													36.0	37.0	37.0					8																	8239172		2009	4156	6165	SO:0001583	missense	0																														ENST00000520004.1:c.86C>T	8.37:g.8239172G>A	ENSP00000428054:p.Ser29Phe		Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.S29F	ENST00000520004.1	37	c.86	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	25.3	4.621814	0.87460	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.61627	0.09;0.09	4.83	4.83	0.62350	.	0.096565	0.41097	D	0.000942	T	0.72374	0.3452	L	0.53249	1.67	0.52501	D	0.99995	D	0.71674	0.998	D	0.79784	0.993	T	0.75599	-0.3262	10	0.87932	D	0	.	17.356	0.87336	0.0:0.0:1.0:0.0	.	29	Q86YV5	SG223_HUMAN	F	29	ENSP00000330930:S29F;ENSP00000428054:S29F	ENSP00000330930:S29F	S	-	2	0	AC068353.1	8276582	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.434000	0.97515	2.406000	0.81754	0.558000	0.71614	TCC	SGK223	-	NULL	ENSG00000182319		0.662	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	-	0.00	82	0	G			8239172	-1	tier1	-	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	33.09	91	45	SNP	1.000	A
SLC17A2	10246	genome.wustl.edu	37	6	25916027	25916027	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:25916027C>T	ENST00000265425.3	-	8	1020	c.1000G>A	c.(1000-1002)Gat>Aat	p.D334N	SLC17A2_ENST00000377850.3_Missense_Mutation_p.D334N|SLC17A2_ENST00000360488.3_Missense_Mutation_p.D334N			O00624	NPT3_HUMAN	solute carrier family 17, member 2	334					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			endometrium(3)|kidney(1)|large_intestine(9)|lung(12)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	31						AAAAGGAAATCTGCCAGCTGA	0.443																																																	0													68.0	66.0	67.0					6																	25916027		2203	4300	6503	SO:0001583	missense	0			U90544	CCDS4567.1, CCDS69060.1	6p22.2	2013-07-18	2013-07-18		ENSG00000112337	ENSG00000112337		"""Solute carriers"""	10930	protein-coding gene	gene with protein product		611049	"""solute carrier family 17 (sodium phosphate), member 2"""			9149941	Standard	NM_001286123		Approved	NPT3	uc003nfl.3	O00624	OTTHUMG00000014413	ENST00000265425.3:c.1000G>A	6.37:g.25916027C>T	ENSP00000265425:p.Asp334Asn		A6NK81|A6NLD6|Q5TB84|Q76P85	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D334N	ENST00000265425.3	37	c.1000		6	.	.	.	.	.	.	.	.	.	.	C	26.3	4.723421	0.89298	.	.	ENSG00000112337	ENST00000360488;ENST00000377850;ENST00000265425	T;T;T	0.69435	-0.4;-0.4;-0.4	4.93	4.93	0.64822	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.56097	D	0.000031	D	0.86184	0.5872	H	0.97491	4.015	0.42936	D	0.994335	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.98;0.999	D	0.89921	0.4059	10	0.87932	D	0	.	13.9025	0.63815	0.0:1.0:0.0:0.0	.	334;334;334	O00624;A6NK81;O00624-2	NPT3_HUMAN;.;.	N	334	ENSP00000353677:D334N;ENSP00000367081:D334N;ENSP00000265425:D334N	ENSP00000265425:D334N	D	-	1	0	SLC17A2	26024006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.801000	0.62532	2.730000	0.93505	0.650000	0.86243	GAT	SLC17A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000112337		0.443	SLC17A2-002	KNOWN	basic|appris_principal	protein_coding	SLC17A2	HGNC	protein_coding	OTTHUMT00000040075.1	-	0.00	87	0	C			25916027	-1	tier1	-	no_errors	ENST00000377850	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	T
SIM1	6492	genome.wustl.edu	37	6	100841766	100841766	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:100841766C>G	ENST00000369208.3	-	11	1950		c.e11-1		SIM1_ENST00000262901.4_Splice_Site			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1						cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		ATCCCGAATACTGAAACCGAG	0.468																																																	0													27.0	28.0	28.0					6																	100841766		2184	4252	6436	SO:0001630	splice_region_variant	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1168-1G>C	6.37:g.100841766C>G			Q5TDP7	Splice_Site	SNP	-	e10-1	ENST00000369208.3	37	c.1168-1	CCDS5045.1	6	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107538	0.77096	.	.	ENSG00000112246	ENST00000369208;ENST00000262901	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.607	0.95585	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIM1	100948487	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.827000	0.55745	2.629000	0.89072	0.655000	0.94253	.	SIM1	-	-	ENSG00000112246		0.468	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	-	0.00	29	0	C	NM_005068	Intron	100841766	-1	tier1	-	no_errors	ENST00000262901	ensembl	human	known	74_37	splice_site	44.00	13	11	SNP	1.000	G
SLC38A1	81539	genome.wustl.edu	37	12	46594904	46594904	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:46594904A>G	ENST00000398637.5	-	13	1674	c.980T>C	c.(979-981)aTt>aCt	p.I327T	SLC38A1_ENST00000439706.1_Missense_Mutation_p.I327T|SLC38A1_ENST00000546893.1_Missense_Mutation_p.I327T|SLC38A1_ENST00000549633.1_5'UTR|SLC38A1_ENST00000549049.1_Missense_Mutation_p.I327T|SLC38A1_ENST00000552197.1_Missense_Mutation_p.I327T	NM_001077484.1|NM_001278387.1|NM_001278388.1|NM_001278389.1|NM_030674.3	NP_001070952.1|NP_001265316.1|NP_001265317.1|NP_001265318.1|NP_109599.3	Q9H2H9	S38A1_HUMAN	solute carrier family 38, member 1	327					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|neutral amino acid transport (GO:0015804)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neutral amino acid transmembrane transporter activity (GO:0015175)|sodium:amino acid symporter activity (GO:0005283)			NS(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(2)	23	Lung SC(27;0.137)|Renal(347;0.236)		all cancers(1;0.00805)|OV - Ovarian serous cystadenocarcinoma(5;0.0106)|Epithelial(2;0.0344)			GTAGCCAAAAATGGCAGTCAA	0.274																																																	0													67.0	61.0	63.0					12																	46594904		1811	4079	5890	SO:0001583	missense	0			AF271070	CCDS41774.1, CCDS61106.1	12q13.11	2013-05-22				ENSG00000111371		"""Solute carriers"""	13447	protein-coding gene	gene with protein product		608490				10891391	Standard	NM_030674		Approved	ATA1, NAT2, SAT1	uc001rpc.3	Q9H2H9		ENST00000398637.5:c.980T>C	12.37:g.46594904A>G	ENSP00000381634:p.Ile327Thr		Q8NC61|Q8NCF8|Q96JX2|Q9H2Q2	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.I327T	ENST00000398637.5	37	c.980	CCDS41774.1	12	.	.	.	.	.	.	.	.	.	.	A	15.36	2.811572	0.50527	.	.	ENSG00000111371	ENST00000549049;ENST00000439706;ENST00000398637;ENST00000546893;ENST00000552197	T;T;T;T;T	0.02280	4.36;4.36;4.36;4.36;4.36	5.53	5.53	0.82687	.	0.089518	0.47455	D	0.000227	T	0.02848	0.0085	L	0.31578	0.945	0.41057	D	0.985343	B;P;B	0.35944	0.132;0.529;0.205	B;B;B	0.36922	0.065;0.236;0.155	T	0.64373	-0.6423	10	0.30854	T	0.27	-23.5861	15.6633	0.77206	1.0:0.0:0.0:0.0	.	327;327;327	B5MEC5;F8VX04;Q9H2H9	.;.;S38A1_HUMAN	T	327	ENSP00000449607:I327T;ENSP00000398142:I327T;ENSP00000381634:I327T;ENSP00000447853:I327T;ENSP00000449756:I327T	ENSP00000381634:I327T	I	-	2	0	SLC38A1	44881171	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.090000	0.63153	0.455000	0.32223	ATT	SLC38A1	-	pfam_AA_transpt_TM	ENSG00000111371		0.274	SLC38A1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A1	HGNC	protein_coding	OTTHUMT00000404218.2	-	0.00	257	0	A			46594904	-1	tier1	-	no_errors	ENST00000398637	ensembl	human	known	74_37	missense	8.04	183	16	SNP	0.996	G
SLC3A1	6519	genome.wustl.edu	37	2	44547672	44547672	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:44547672A>T	ENST00000260649.6	+	10	2028	c.1952A>T	c.(1951-1953)aAc>aTc	p.N651I	SLC3A1_ENST00000409380.1_Missense_Mutation_p.N373I|PREPL_ENST00000541738.1_3'UTR|SLC3A1_ENST00000409740.3_Missense_Mutation_p.N282I|PREPL_ENST00000409411.1_3'UTR|PREPL_ENST00000409957.1_3'UTR|PREPL_ENST00000409936.1_3'UTR	NM_000341.3	NP_000332.2	Q07837	SLC31_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 1	651					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|basic amino acid transport (GO:0015802)|carbohydrate metabolic process (GO:0005975)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)|vacuolar membrane (GO:0005774)	amino acid transmembrane transporter activity (GO:0015171)|basic amino acid transmembrane transporter activity (GO:0015174)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|L-cystine transmembrane transporter activity (GO:0015184)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(3)	26		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	TTTGAACACAACACGAAGAAT	0.418																																																	0													104.0	89.0	94.0					2																	44547672		2203	4300	6503	SO:0001583	missense	0				CCDS1819.1	2p16.3	2013-07-19	2013-07-19		ENSG00000138079	ENSG00000138079		"""Solute carriers"""	11025	protein-coding gene	gene with protein product		104614	"""solute carrier family 3 (cystine, dibasic and neutral amino acid transporters, activator of cystine, dibasic and neutral amino acid transport), member 1"""			8486766, 9186880	Standard	NM_000341		Approved	CSNU1, D2H, RBAT, ATR1, NBAT	uc002ruc.4	Q07837	OTTHUMG00000128759	ENST00000260649.6:c.1952A>T	2.37:g.44547672A>T	ENSP00000260649:p.Asn651Ile		A8K0S1|O00658|Q15295|Q4J6B4|Q4J6B5|Q4J6B6|Q4J6B7|Q4J6B8|Q4J6B9|Q52M92|Q52M94	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.N651I	ENST00000260649.6	37	c.1952	CCDS1819.1	2	.	.	.	.	.	.	.	.	.	.	A	18.62	3.663108	0.67700	.	.	ENSG00000138079	ENST00000260649;ENST00000540334;ENST00000409380;ENST00000409740	D;D;D	0.99105	-5.43;-4.86;-4.52	5.99	0.419	0.16438	.	0.636516	0.17209	N	0.182836	D	0.95802	0.8634	L	0.33485	1.01	0.09310	N	1	P	0.39903	0.694	B	0.36134	0.218	D	0.92236	0.5796	10	0.46703	T	0.11	-2.2702	6.9945	0.24774	0.5478:0.1428:0.3094:0.0	.	651	Q07837	SLC31_HUMAN	I	651;587;373;282	ENSP00000260649:N651I;ENSP00000386709:N373I;ENSP00000386677:N282I	ENSP00000260649:N651I	N	+	2	0	SLC3A1	44401176	0.020000	0.18652	0.054000	0.19295	0.868000	0.49771	0.316000	0.19469	0.131000	0.18576	0.533000	0.62120	AAC	SLC3A1	-	NULL	ENSG00000138079		0.418	SLC3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC3A1	HGNC	protein_coding	OTTHUMT00000250676.1	-	0.00	63	0	A	NM_000341		44547672	+1	tier1	-	no_errors	ENST00000260649	ensembl	human	known	74_37	missense	14.00	43	7	SNP	0.012	T
SLC9C1	285335	genome.wustl.edu	37	3	111999598	111999598	+	Missense_Mutation	SNP	T	T	A	rs528974870		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:111999598T>A	ENST00000305815.5	-	3	373	c.121A>T	c.(121-123)Att>Ttt	p.I41F	SLC9C1_ENST00000487372.1_Missense_Mutation_p.I41F|SLC9C1_ENST00000467397.1_5'UTR	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	41					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										GGGACAGGAATTGGAAAGTCT	0.323																																																	0													63.0	66.0	65.0					3																	111999598		2203	4300	6503	SO:0001583	missense	0			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.121A>T	3.37:g.111999598T>A	ENSP00000306627:p.Ile41Phe		Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.I41F	ENST00000305815.5	37	c.121	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	T	15.63	2.890755	0.52014	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.19250	2.16;2.16	5.65	1.46	0.22682	Cation/H+ exchanger (1);	0.243962	0.29355	N	0.012392	T	0.14141	0.0342	L	0.38531	1.155	0.33151	D	0.545645	B;P	0.42078	0.43;0.77	B;B	0.41764	0.095;0.366	T	0.19160	-1.0314	10	0.27785	T	0.31	.	4.4988	0.11855	0.1565:0.1767:0.0:0.6667	.	41;41	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	F	41	ENSP00000306627:I41F;ENSP00000420688:I41F	ENSP00000306627:I41F	I	-	1	0	SLC9A10	113482288	0.291000	0.24352	1.000000	0.80357	0.985000	0.73830	-0.129000	0.10515	0.425000	0.26087	0.397000	0.26171	ATT	SLC9C1	-	pfam_Cation/H_exchanger	ENSG00000172139		0.323	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1		0.00	66	0	T	NM_183061		111999598	-1			no_errors	ENST00000305815	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.924	A
SLC41A3	54946	genome.wustl.edu	37	3	125745256	125745256	+	Missense_Mutation	SNP	C	C	G	rs373931665		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr3:125745256C>G	ENST00000315891.6	-	5	758	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	SLC41A3_ENST00000383598.2_Missense_Mutation_p.E148Q|SLC41A3_ENST00000514023.1_5'UTR|SLC41A3_ENST00000346785.5_Missense_Mutation_p.E138Q|SLC41A3_ENST00000508835.1_Missense_Mutation_p.E57Q|SLC41A3_ENST00000360370.4_Missense_Mutation_p.E174Q	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		TCCACTTCCTCTCGAGACACC	0.612																																																	0													92.0	67.0	76.0					3																	125745256		2194	4291	6485	SO:0001583	missense	0				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.520G>C	3.37:g.125745256C>G	ENSP00000326070:p.Glu174Gln		A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	pfam_SLC41_membr_dom,superfamily_Acyl_Trfase/lysoPLipase	p.E174Q	ENST00000315891.6	37	c.520	CCDS33843.1	3	.	.	.	.	.	.	.	.	.	.	C	6.145	0.394987	0.11638	.	.	ENSG00000114544	ENST00000360370;ENST00000346785;ENST00000383598;ENST00000458524;ENST00000315891;ENST00000508835;ENST00000514677;ENST00000513723;ENST00000512470;ENST00000510651	T;T;T;T;T;T;T;T	0.32515	1.45;1.48;1.46;1.45;1.5;1.5;1.46;1.52	4.58	0.423	0.16463	MgtE magnesium transporter, integral membrane (1);	0.342406	0.32548	N	0.005953	T	0.10508	0.0257	N	0.02802	-0.49	0.09310	N	1	B;B;B;B;B;B	0.27853	0.011;0.028;0.034;0.191;0.116;0.005	B;B;B;B;B;B	0.30316	0.016;0.067;0.068;0.069;0.114;0.017	T	0.31943	-0.9925	10	0.18710	T	0.47	-9.1856	6.334	0.21287	0.0:0.5092:0.3044:0.1865	.	57;174;174;138;174;148	B7Z4Y2;A8MQ22;E7ENY4;Q96GZ6-3;Q96GZ6;Q96GZ6-7	.;.;.;.;S41A3_HUMAN;.	Q	174;138;148;165;174;57;189;226;174;165	ENSP00000353533:E174Q;ENSP00000264471:E138Q;ENSP00000373092:E148Q;ENSP00000326070:E174Q;ENSP00000422828:E189Q;ENSP00000425373:E226Q;ENSP00000421008:E174Q;ENSP00000423524:E165Q	ENSP00000326070:E174Q	E	-	1	0	SLC41A3	127227946	0.698000	0.27777	0.105000	0.21289	0.003000	0.03518	2.488000	0.45276	0.174000	0.19809	0.491000	0.48974	GAG	SLC41A3	-	pfam_SLC41_membr_dom	ENSG00000114544		0.612	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	HGNC	protein_coding	OTTHUMT00000370886.1	-	0.00	82	0	C	NM_017836		125745256	-1	tier1	-	no_errors	ENST00000315891	ensembl	human	known	74_37	missense	7.14	78	6	SNP	0.008	G
SMCO2	341346	genome.wustl.edu	37	12	27628521	27628521	+	Silent	SNP	G	G	A	rs77197438	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:27628521G>A	ENST00000535986.1	+	4	369	c.369G>A	c.(367-369)ctG>ctA	p.L123L	SMCO2_ENST00000298876.4_Intron|SMCO2_ENST00000538647.1_3'UTR|SMCO2_ENST00000416383.1_Silent_p.L123L			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	123						integral component of membrane (GO:0016021)											GCAGGTGTCTGAAGGGCATGT	0.408																																																	0													77.0	65.0	68.0					12																	27628521		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.369G>A	12.37:g.27628521G>A				Silent	SNP	NULL	p.L123	ENST00000535986.1	37	c.369	CCDS44852.1	12																																																																																			SMCO2	-	NULL	ENSG00000165935		0.408	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO2	HGNC	protein_coding	OTTHUMT00000402867.1	-	0.00	149	0	G	NM_001145010		27628521	+1	tier1	-	no_errors	ENST00000416383	ensembl	human	known	74_37	silent	11.46	85	11	SNP	0.000	A
SMG7	9887	genome.wustl.edu	37	1	183515266	183515267	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:183515266_183515267insA	ENST00000347615.2	+	17	2655_2656	c.2536_2537insA	c.(2536-2538)gaafs	p.E846fs	SMG7_ENST00000456731.2_Frame_Shift_Ins_p.E758fs|SMG7_ENST00000367537.3_Frame_Shift_Ins_p.E829fs|SMG7_ENST00000515829.2_Frame_Shift_Ins_p.E800fs|SMG7_ENST00000507469.1_Frame_Shift_Ins_p.E800fs|SMG7_ENST00000508461.1_Frame_Shift_Ins_p.E804fs	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	846					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GCAGCCTCTAGAAAAAAAAATG	0.45																																																	1	Unknown(1)	skin(1)																																								SO:0001589	frameshift_variant	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2545dupA	1.37:g.183515275_183515275dupA	ENSP00000340766:p.Glu846fs		B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Frame_Shift_Ins	INS	pfam_EST1	p.M803fs	ENST00000347615.2	37	c.2398_2399	CCDS1355.1	1																																																																																			SMG7	-	NULL	ENSG00000116698		0.450	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1		0.00	67	0	-	NM_014837		183515267	+1	tier1		no_errors	ENST00000507469	ensembl	human	known	74_37	frame_shift_ins	10.64	42	5	INS	1.000:1.000	A
SMIM9	100132963	genome.wustl.edu	37	X	154059006	154059006	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:154059006C>T	ENST00000369529.1	-	2	322	c.126G>A	c.(124-126)tcG>tcA	p.S42S	SMIM9_ENST00000478043.1_5'UTR	NM_001162936.1	NP_001156408.1	A6NGZ8	SMIM9_HUMAN	small integral membrane protein 9	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AGCGTGGTTTCGATCCTGTTT	0.418																																																	0													141.0	113.0	121.0					X																	154059006		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS55546.1	Xq28	2012-11-29	2012-11-29	2012-11-29	ENSG00000203870	ENSG00000203870			41915	protein-coding gene	gene with protein product			"""chromosome X open reading frame 68"""	CXorf68			Standard	NM_001162936		Approved		uc022cik.1	A6NGZ8	OTTHUMG00000024243	ENST00000369529.1:c.126G>A	X.37:g.154059006C>T				Silent	SNP	NULL	p.S42	ENST00000369529.1	37	c.126	CCDS55546.1	X																																																																																			SMIM9	-	NULL	ENSG00000203870		0.418	SMIM9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMIM9	HGNC	protein_coding	OTTHUMT00000061185.2	-	0.00	47	0	C	NM_001162936		154059006	-1	tier1	-	no_errors	ENST00000369529	ensembl	human	known	74_37	silent	16.00	42	8	SNP	0.000	T
SMR3A	26952	genome.wustl.edu	37	4	71227835	71227835	+	Start_Codon_SNP	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:71227835G>T	ENST00000226460.4	+	2	99	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_012390.3	NP_036522.3	Q99954	SMR3A_HUMAN	submaxillary gland androgen regulated protein 3A	1						extracellular region (GO:0005576)		p.M1I(1)		endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)	15		all_hematologic(202;0.196)				CTGAAAGGATGAAATCACTGA	0.348																																																	1	Substitution - Missense(1)	skin(1)											186.0	162.0	170.0					4																	71227835		2202	4280	6482	SO:0001582	initiator_codon_variant	0			D89501	CCDS34000.1	4q13.3	2009-04-17	2008-02-27	2005-02-07	ENSG00000109208	ENSG00000109208			19216	protein-coding gene	gene with protein product			"""proline rich 5 (salivary)"", ""submaxillary gland androgen regulated protein 3 homolog A (mouse)"""	PROL5		9354371, 17512016	Standard	NM_012390		Approved	PBI, PRL5	uc003hfg.1	Q99954	OTTHUMG00000160839	ENST00000226460.4:c.3G>T	4.37:g.71227835G>T	ENSP00000226460:p.Met1Ile			Missense_Mutation	SNP	NULL	p.M1I	ENST00000226460.4	37	c.3	CCDS34000.1	4	.	.	.	.	.	.	.	.	.	.	G	8.502	0.864579	0.17250	.	.	ENSG00000109208	ENST00000226460	T	0.63744	-0.06	3.19	3.19	0.36642	.	.	.	.	.	T	0.75474	0.3854	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.77763	-0.2466	8	0.87932	D	0	.	10.1412	0.42736	0.0:0.0:1.0:0.0	.	1	Q99954	SMR3A_HUMAN	I	1	ENSP00000226460:M1I	ENSP00000226460:M1I	M	+	3	0	SMR3A	71262424	1.000000	0.71417	0.986000	0.45419	0.031000	0.12232	3.238000	0.51352	2.106000	0.64143	0.563000	0.77884	ATG	SMR3A	-	NULL	ENSG00000109208		0.348	SMR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMR3A	HGNC	protein_coding	OTTHUMT00000362574.1	-	0.00	104	0	G	NM_012390	Missense_Mutation	71227835	+1	tier1	-	no_errors	ENST00000226460	ensembl	human	known	74_37	missense	7.22	90	7	SNP	0.990	T
SMTN	6525	genome.wustl.edu	37	22	31494798	31494798	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr22:31494798G>A	ENST00000347557.2	+	17	2523	c.2305G>A	c.(2305-2307)Gag>Aag	p.E769K	SMTN_ENST00000404574.1_Missense_Mutation_p.E292K|SMTN_ENST00000358743.1_Missense_Mutation_p.E769K|SMTN_ENST00000333137.7_Missense_Mutation_p.E769K	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	769					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GGCCATGATTGAGAAGCTGGA	0.657																																																	0													12.0	17.0	15.0					22																	31494798		2197	4278	6475	SO:0001583	missense	0			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.2305G>A	22.37:g.31494798G>A	ENSP00000328635:p.Glu769Lys		O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Missense_Mutation	SNP	pfam_Smoothelin,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E769K	ENST00000347557.2	37	c.2305	CCDS13886.1	22	.	.	.	.	.	.	.	.	.	.	G	36	5.692685	0.96793	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496;ENST00000455608;ENST00000404574;ENST00000403419	T;T;T;T;D	0.93426	-0.13;-0.52;-0.53;1.78;-3.22	5.34	5.34	0.76211	.	0.000000	0.38381	N	0.001702	D	0.96470	0.8848	M	0.69823	2.125	0.80722	D	1	P;D;D;D;D;P;D;P	0.76494	0.863;0.998;0.997;0.997;0.999;0.751;0.999;0.916	P;D;D;D;D;P;D;P	0.78314	0.644;0.989;0.985;0.985;0.991;0.644;0.991;0.805	D	0.96578	0.9428	10	0.72032	D	0.01	-29.813	19.4284	0.94754	0.0:0.0:1.0:0.0	.	825;854;149;292;792;769;769;769	E7ETT8;B4E229;B5MBZ4;B5MCI0;B5MC56;E7EWD0;P53814;P53814-5	.;.;.;.;.;.;SMTN_HUMAN;.	K	769;769;769;767;792;170;292;149	ENSP00000351593:E769K;ENSP00000328635:E769K;ENSP00000329532:E769K;ENSP00000392329:E170K;ENSP00000383919:E292K	ENSP00000329393:E767K	E	+	1	0	SMTN	29824798	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	6.269000	0.72558	2.686000	0.91538	0.561000	0.74099	GAG	SMTN	-	NULL	ENSG00000183963		0.657	SMTN-001	KNOWN	basic|CCDS	protein_coding	SMTN	HGNC	protein_coding	OTTHUMT00000321766.1	-	0.00	99	0	G	NM_134270		31494798	+1	tier1	-	no_errors	ENST00000347557	ensembl	human	known	74_37	missense	31.67	41	19	SNP	1.000	A
SNRNP40	9410	genome.wustl.edu	37	1	31754335	31754335	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:31754335G>T	ENST00000263694.4	-	5	558	c.540C>A	c.(538-540)gaC>gaA	p.D180E	SNRNP40_ENST00000489853.1_5'UTR|SNRNP40_ENST00000446633.2_Missense_Mutation_p.D180E	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)	180					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						TCTTCCGGATGTCCCAAAGCT	0.428																																																	0													133.0	103.0	113.0					1																	31754335		2203	4300	6503	SO:0001583	missense	0			AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.540C>A	1.37:g.31754335G>T	ENSP00000263694:p.Asp180Glu		B4DQJ1|O75938|O95320	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D180E	ENST00000263694.4	37	c.540	CCDS340.1	1	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768377	0.69878	.	.	ENSG00000060688	ENST00000263694;ENST00000446633	T;T	0.68331	-0.32;-0.32	5.07	0.269	0.15631	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75547	0.3864	M	0.64676	1.99	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74097	-0.3775	10	0.56958	D	0.05	.	10.8336	0.46675	0.4213:0.0:0.5787:0.0	.	180;180	B4DQJ1;Q96DI7	.;SNR40_HUMAN	E	180	ENSP00000263694:D180E;ENSP00000406841:D180E	ENSP00000263694:D180E	D	-	3	2	SNRNP40	31526922	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.381000	0.34362	0.134000	0.18681	0.491000	0.48974	GAC	SNRNP40	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000060688		0.428	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	HGNC	protein_coding	OTTHUMT00000010657.1	-	0.00	68	0	G	NM_004814		31754335	-1	tier1	-	no_errors	ENST00000446633	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.999	T
SORCS1	114815	genome.wustl.edu	37	10	108439438	108439438	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:108439438C>G	ENST00000263054.6	-	11	1622	c.1615G>C	c.(1615-1617)Ggg>Cgg	p.G539R	SORCS1_ENST00000344440.6_Missense_Mutation_p.G539R|SORCS1_ENST00000369698.1_Missense_Mutation_p.G74R	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	539					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCAATGATCCCTGATGTGTAG	0.413																																																	0													115.0	94.0	101.0					10																	108439438		2203	4300	6503	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1615G>C	10.37:g.108439438C>G	ENSP00000263054:p.Gly539Arg		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.G539R	ENST00000263054.6	37	c.1615	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084412	0.76642	.	.	ENSG00000108018	ENST00000369698;ENST00000263054;ENST00000344440	T;T;T	0.28454	1.61;1.61;1.61	6.17	5.27	0.74061	VPS10 (1);	0.051020	0.85682	D	0.000000	T	0.62417	0.2426	M	0.88906	2.99	0.58432	D	0.999997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.998;0.999	T	0.70278	-0.4916	9	.	.	.	-24.6934	15.4423	0.75195	0.0:0.9341:0.0:0.0659	.	539;539;539;539;539	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	R	74;539;539	ENSP00000358712:G74R;ENSP00000263054:G539R;ENSP00000345964:G539R	.	G	-	1	0	SORCS1	108429428	1.000000	0.71417	0.938000	0.37757	0.780000	0.44128	7.487000	0.81328	1.627000	0.50400	0.655000	0.94253	GGG	SORCS1	-	smart_VPS10	ENSG00000108018		0.413	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	-	0.00	51	0	C	NM_052918		108439438	-1	tier1	-	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	8.45	65	6	SNP	1.000	G
SPATA31D1	389763	genome.wustl.edu	37	9	84605340	84605340	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:84605340G>A	ENST00000344803.2	+	3	288	c.241G>A	c.(241-243)Gac>Aac	p.D81N		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	81					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGGTTTCCCAGACTGGAAAAG	0.433																																																	0													81.0	75.0	77.0					9																	84605340		1850	4095	5945	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.241G>A	9.37:g.84605340G>A	ENSP00000341988:p.Asp81Asn			Missense_Mutation	SNP	NULL	p.D81N	ENST00000344803.2	37	c.241	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	G	6.581	0.475523	0.12521	.	.	ENSG00000214929	ENST00000344803	T	0.05925	3.37	2.82	2.82	0.32997	.	3.369830	0.01098	N	0.005300	T	0.10208	0.0250	L	0.43152	1.355	0.09310	N	1	P	0.50528	0.936	P	0.44477	0.451	T	0.29119	-1.0022	10	0.45353	T	0.12	-4.8475	9.3553	0.38161	0.0:0.0:1.0:0.0	.	81	Q6ZQQ2	F75D1_HUMAN	N	81	ENSP00000341988:D81N	ENSP00000341988:D81N	D	+	1	0	FAM75D1	83795160	0.150000	0.22732	0.017000	0.16124	0.003000	0.03518	2.678000	0.46900	1.909000	0.55274	0.650000	0.86243	GAC	SPATA31D1	-	NULL	ENSG00000214929		0.433	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	57	0	G	NM_001001670		84605340	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	8.11	68	6	SNP	0.018	A
SPATA32	124783	genome.wustl.edu	37	17	43333340	43333340	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:43333340G>A	ENST00000331780.4	-	4	304	c.209C>T	c.(208-210)cCg>cTg	p.P70L	MAP3K14-AS1_ENST00000588698.1_RNA|MAP3K14-AS1_ENST00000592422.1_RNA|MAP3K14-AS1_ENST00000591263.1_RNA|SPATA32_ENST00000543122.1_Missense_Mutation_p.P49L|MAP3K14-AS1_ENST00000588160.1_RNA|MAP3K14-AS1_ENST00000588504.1_RNA|MAP3K14-AS1_ENST00000585346.1_RNA|MAP3K14-AS1_ENST00000590100.1_RNA	NM_152343.2	NP_689556.2	Q96LK8	SPT32_HUMAN	spermatogenesis associated 32	70					spermatogenesis (GO:0007283)	perinuclear region of cytoplasm (GO:0048471)											CAGTAAAGCCGGCACCTGTCC	0.572																																																	0													60.0	58.0	59.0					17																	43333340		2203	4300	6503	SO:0001583	missense	0			AK058143	CCDS32669.1	17q21.31	2013-10-11	2012-10-08	2012-10-08	ENSG00000184361	ENSG00000184361			26349	protein-coding gene	gene with protein product	"""acrosome expressed 2"""		"""chromosome 17 open reading frame 46"", ""testis expressed 34"""	C17orf46, TEX34		18621766	Standard	NM_152343		Approved	FLJ25414, AEP2, VAD1.2	uc002iis.1	Q96LK8	OTTHUMG00000180363	ENST00000331780.4:c.209C>T	17.37:g.43333340G>A	ENSP00000331532:p.Pro70Leu		Q7Z4U1|Q8N6V6	Missense_Mutation	SNP	NULL	p.P70L	ENST00000331780.4	37	c.209	CCDS32669.1	17	.	.	.	.	.	.	.	.	.	.	G	13.38	2.218896	0.39201	.	.	ENSG00000184361	ENST00000331780;ENST00000543122	T;T	0.69806	-0.43;0.28	2.93	-1.14	0.09741	.	3.570230	0.00897	N	0.002307	T	0.40956	0.1138	N	0.14661	0.345	0.09310	N	1	P	0.42757	0.789	B	0.30251	0.113	T	0.42616	-0.9441	10	0.48119	T	0.1	.	2.0465	0.03561	0.3937:0.0:0.352:0.2542	.	70	Q96LK8	CQ046_HUMAN	L	70;49	ENSP00000331532:P70L;ENSP00000442724:P49L	ENSP00000331532:P70L	P	-	2	0	C17orf46	40689123	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.560000	0.05964	-0.041000	0.13558	-0.378000	0.06908	CCG	SPATA32	-	NULL	ENSG00000184361		0.572	SPATA32-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA32	HGNC	protein_coding	OTTHUMT00000450946.1		0.00	25	0	G	NM_152343		43333340	-1			no_errors	ENST00000331780	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.000	A
SPATA9	83890	genome.wustl.edu	37	5	95018270	95018270	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:95018270C>G	ENST00000274432.8	-	2	253	c.112G>C	c.(112-114)Gaa>Caa	p.E38Q	RFESD_ENST00000508206.1_Intron|SPATA9_ENST00000477047.2_5'UTR|SPATA9_ENST00000395899.3_Missense_Mutation_p.E38Q	NM_031952.3	NP_114158.2	Q9BWV2	SPAT9_HUMAN	spermatogenesis associated 9	38					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				large_intestine(3)|lung(4)	7		all_cancers(142;1.28e-06)|all_epithelial(76;1.55e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.91e-16)		GTGGGAAATTCATCTTTAAAC	0.313																																																	0													100.0	103.0	102.0					5																	95018270		2203	4300	6503	SO:0001583	missense	0			AK093225	CCDS4076.1	5q15	2008-02-05			ENSG00000145757	ENSG00000145757			22988	protein-coding gene	gene with protein product		608039				12493713	Standard	NM_031952		Approved	NYD-SP16, FLJ35906	uc003klj.1	Q9BWV2	OTTHUMG00000121169	ENST00000274432.8:c.112G>C	5.37:g.95018270C>G	ENSP00000274432:p.Glu38Gln		A8K8H3|Q4G122|Q86X33|Q8NA28	Missense_Mutation	SNP	NULL	p.E38Q	ENST00000274432.8	37	c.112	CCDS4076.1	5	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311529	0.40895	.	.	ENSG00000145757	ENST00000274432;ENST00000395899	T	0.53206	0.63	4.7	4.7	0.59300	.	0.510136	0.16769	N	0.200297	T	0.39517	0.1081	N	0.19112	0.55	0.26906	N	0.967013	B	0.29301	0.241	B	0.37422	0.249	T	0.44651	-0.9314	10	0.66056	D	0.02	-5.9019	13.0112	0.58731	0.0:1.0:0.0:0.0	.	38	Q9BWV2	SPAT9_HUMAN	Q	38	ENSP00000274432:E38Q	ENSP00000274432:E38Q	E	-	1	0	SPATA9	95044026	1.000000	0.71417	0.974000	0.42286	0.740000	0.42216	3.775000	0.55349	2.429000	0.82318	0.563000	0.77884	GAA	SPATA9	-	NULL	ENSG00000145757		0.313	SPATA9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA9	HGNC	protein_coding	OTTHUMT00000304036.1	-	0.00	90	0	C	NM_031952		95018270	-1	tier1	-	no_errors	ENST00000274432	ensembl	human	known	74_37	missense	8.33	77	7	SNP	0.994	G
SPDYC	387778	genome.wustl.edu	37	11	64940167	64940167	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:64940167G>C	ENST00000377185.2	+	6	611	c.529G>C	c.(529-531)Gag>Cag	p.E177Q	AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C											breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						CATGGCAAAGGAGCCATTCCA	0.657																																																	0													45.0	46.0	46.0					11																	64940167		2201	4297	6498	SO:0001583	missense	0			AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.529G>C	11.37:g.64940167G>C	ENSP00000366390:p.Glu177Gln			Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.E177Q	ENST00000377185.2	37	c.529	CCDS31606.1	11	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890482	0.52014	.	.	ENSG00000204710	ENST00000377185	.	.	.	5.43	1.23	0.21249	.	0.234064	0.28047	N	0.016820	T	0.30135	0.0755	L	0.35723	1.085	0.09310	N	1	B	0.24768	0.111	B	0.30495	0.116	T	0.26883	-1.0090	9	0.15066	T	0.55	.	10.0449	0.42180	0.0747:0.3866:0.5387:0.0	.	177	Q5MJ68	SPDYC_HUMAN	Q	177	.	ENSP00000366390:E177Q	E	+	1	0	SPDYC	64696743	0.870000	0.30015	0.000000	0.03702	0.967000	0.64934	1.055000	0.30467	-0.022000	0.13986	0.655000	0.94253	GAG	SPDYC	-	pfam_Cell_cycle_regulatory_Spy1	ENSG00000204710		0.657	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYC	HGNC	protein_coding	OTTHUMT00000385299.1	-	0.00	128	0	G	NM_001008778		64940167	+1	tier1	-	no_errors	ENST00000377185	ensembl	human	known	74_37	missense	13.95	74	12	SNP	0.046	C
SPHKAP	80309	genome.wustl.edu	37	2	228883348	228883348	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:228883348G>A	ENST00000392056.3	-	7	2268	c.2222C>T	c.(2221-2223)aCc>aTc	p.T741I	SPHKAP_ENST00000344657.5_Missense_Mutation_p.T741I	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	741						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)	p.T741N(2)		NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCTTCTGATGGTCTCCTTAGA	0.473																																																	2	Substitution - Missense(2)	lung(2)											148.0	140.0	143.0					2																	228883348		2203	4300	6503	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.2222C>T	2.37:g.228883348G>A	ENSP00000375909:p.Thr741Ile		Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.T741I	ENST00000392056.3	37	c.2222	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	4.946	0.175827	0.09443	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12147	2.71;2.71	5.53	1.39	0.22231	.	0.632105	0.15867	N	0.240709	T	0.10937	0.0267	L	0.54323	1.7	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.09377	0.002;0.004	T	0.26985	-1.0087	10	0.35671	T	0.21	.	2.7333	0.05233	0.2254:0.1251:0.5213:0.1282	.	741;741	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	I	741	ENSP00000375909:T741I;ENSP00000339886:T741I	ENSP00000339886:T741I	T	-	2	0	SPHKAP	228591592	0.002000	0.14202	0.065000	0.19835	0.553000	0.35397	0.960000	0.29253	0.356000	0.24157	0.655000	0.94253	ACC	SPHKAP	-	NULL	ENSG00000153820		0.473	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	-	0.00	38	0	G	NM_030623		228883348	-1	tier1	-	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.000	A
SPTAN1	6709	genome.wustl.edu	37	9	131345085	131345085	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:131345085G>T	ENST00000372731.4	+	14	1873	c.1763G>T	c.(1762-1764)tGg>tTg	p.W588L	SPTAN1_ENST00000358161.5_Missense_Mutation_p.W588L|SPTAN1_ENST00000372739.3_Missense_Mutation_p.W588L	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	588					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CTCAAGAGTTGGGTCAATGAG	0.473																																					NSCLC(120;833 1744 2558 35612 37579)												0													107.0	106.0	106.0					9																	131345085		2203	4300	6503	SO:0001583	missense	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1763G>T	9.37:g.131345085G>T	ENSP00000361816:p.Trp588Leu		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.W588L	ENST00000372731.4	37	c.1763	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254445	0.80135	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.70164	-0.46;-0.46;-0.46	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.87180	0.6113	M	0.93328	3.405	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.985;1.0;0.995;1.0	D;D;D;D;D	0.97110	0.998;0.982;0.999;0.984;1.0	D	0.89734	0.3928	10	0.87932	D	0	.	19.0811	0.93182	0.0:0.0:1.0:0.0	.	588;588;588;588;588	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	L	588	ENSP00000350882:W588L;ENSP00000361816:W588L;ENSP00000361824:W588L	ENSP00000350882:W588L	W	+	2	0	SPTAN1	130384906	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.476000	0.97823	2.756000	0.94617	0.561000	0.74099	TGG	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.473	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	-	0.00	51	0	G	NM_003127		131345085	+1	tier1	-	no_errors	ENST00000358161	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
SRPX	8406	genome.wustl.edu	37	X	38079995	38079995	+	Silent	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:38079995C>A	ENST00000378533.3	-	1	157	c.51G>T	c.(49-51)ctG>ctT	p.L17L	RP13-43E11.1_ENST00000423919.1_RNA|SRPX_ENST00000544439.1_Silent_p.L17L|SRPX_ENST00000343800.6_Intron|SRPX_ENST00000538295.1_Silent_p.L17L|SRPX_ENST00000432886.2_Silent_p.L17L|TM4SF2_ENST00000465127.1_Intron	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	17					autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						gcagcagcagcagaggcggca	0.736											OREG0019726	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													3.0	3.0	3.0					X																	38079995		1576	3245	4821	SO:0001819	synonymous_variant	0			U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.51G>T	X.37:g.38079995C>A		875	A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Silent	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.L17	ENST00000378533.3	37	c.51	CCDS14245.1	X																																																																																			SRPX	-	NULL	ENSG00000101955		0.736	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX	HGNC	protein_coding	OTTHUMT00000056243.1		0.00	25	0	C	NM_006307		38079995	-1			no_errors	ENST00000378533	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.004	A
SSPO	23145	genome.wustl.edu	37	7	149522965	149522965	+	RNA	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:149522965C>T	ENST00000378016.2	+	0	14187							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GTGGCCTCCCCAGTGCCAATG	0.672																																																	0													23.0	26.0	25.0					7																	149522965		2000	4163	6163			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149522965C>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.672	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	35	0	C			149522965	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	19.35	25	6	SNP	0.981	T
ST8SIA3	51046	genome.wustl.edu	37	18	55020185	55020185	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:55020185G>A	ENST00000324000.3	+	1	2142	c.108G>A	c.(106-108)gaG>gaA	p.E36E		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	36					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		TGAAAAAGGAGAACATCTTCA	0.597																																																	0													78.0	77.0	77.0					18																	55020185		2203	4300	6503	SO:0001819	synonymous_variant	0			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.108G>A	18.37:g.55020185G>A			A8K0F2|Q6B085|Q9NS41	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.E36	ENST00000324000.3	37	c.108	CCDS32834.1	18																																																																																			ST8SIA3	-	pirsf_Sialyl_trans	ENSG00000177511		0.597	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	-	0.00	78	0	G	NM_015879		55020185	+1	tier1	-	no_errors	ENST00000324000	ensembl	human	known	74_37	silent	8.89	41	4	SNP	1.000	A
STAG3	10734	genome.wustl.edu	37	7	99799644	99799644	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:99799644G>C	ENST00000426455.1	+	23	2781	c.2374G>C	c.(2374-2376)Gat>Cat	p.D792H	STAG3_ENST00000394018.2_Missense_Mutation_p.D734H|GATS_ENST00000543273.1_RNA|STAG3_ENST00000317296.5_Missense_Mutation_p.D792H|STAG3_ENST00000440830.1_3'UTR|GATS_ENST00000436886.2_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	792					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTCAGATGTGGATACTGAGAT	0.522																																																	0													101.0	93.0	95.0					7																	99799644		2203	4300	6503	SO:0001583	missense	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.2374G>C	7.37:g.99799644G>C	ENSP00000400359:p.Asp792His		A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.D792H	ENST00000426455.1	37	c.2374	CCDS34703.1	7	.	.	.	.	.	.	.	.	.	.	.	13.81	2.349145	0.41599	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000317296	T;T;T	0.35421	1.31;1.31;1.31	5.33	4.45	0.53987	Armadillo-like helical (1);Armadillo-type fold (1);	0.386750	0.21593	N	0.072061	T	0.47930	0.1472	L	0.56769	1.78	0.80722	D	1	B;D;P	0.71674	0.04;0.998;0.823	B;P;P	0.57244	0.045;0.816;0.566	T	0.44590	-0.9318	10	0.52906	T	0.07	-4.3353	10.1213	0.42623	0.0933:0.0:0.9067:0.0	.	734;792;792	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	H	792;734;792	ENSP00000400359:D792H;ENSP00000377586:D734H;ENSP00000319318:D792H	ENSP00000319318:D792H	D	+	1	0	STAG3	99637580	0.989000	0.36119	0.989000	0.46669	0.872000	0.50106	2.456000	0.44997	1.254000	0.44035	0.467000	0.42956	GAT	STAG3	-	superfamily_ARM-type_fold	ENSG00000066923		0.522	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2		0.00	61	0	G	NM_012447		99799644	+1			no_errors	ENST00000317296	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.980	C
STAT4	6775	genome.wustl.edu	37	2	191896228	191896228	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:191896228C>G	ENST00000392320.2	-	22	2373	c.2059G>C	c.(2059-2061)Gaa>Caa	p.E687Q	STAT4_ENST00000358470.4_Missense_Mutation_p.E687Q|AC067945.4_ENST00000456176.1_RNA	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	687					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TCACCCCTTTCTGTTGGTCTT	0.318																																																	0													88.0	84.0	85.0					2																	191896228		2203	4300	6503	SO:0001583	missense	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.2059G>C	2.37:g.191896228C>G	ENSP00000376134:p.Glu687Gln		Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.E687Q	ENST00000392320.2	37	c.2059	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	C	14.29	2.489883	0.44249	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	D;D	0.96587	-4.06;-4.06	5.13	5.13	0.70059	SH2 motif (1);	0.998944	0.08100	N	0.997999	D	0.94062	0.8097	L	0.43923	1.385	0.80722	D	1	P;P	0.38395	0.487;0.629	B;B	0.29440	0.102;0.102	D	0.88751	0.3250	10	0.36615	T	0.2	-41.9419	19.1356	0.93426	0.0:1.0:0.0:0.0	.	596;687	Q53S87;Q14765	.;STAT4_HUMAN	Q	687	ENSP00000351255:E687Q;ENSP00000376134:E687Q	ENSP00000351255:E687Q	E	-	1	0	STAT4	191604473	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	3.487000	0.53222	2.826000	0.97356	0.655000	0.94253	GAA	STAT4	-	NULL	ENSG00000138378		0.318	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	-	0.00	150	0	C	NM_003151		191896228	-1	tier1	-	no_errors	ENST00000358470	ensembl	human	known	74_37	missense	13.39	97	15	SNP	1.000	G
SUMF2	25870	genome.wustl.edu	37	7	56140697	56140697	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:56140697G>T	ENST00000413756.1	+	3	255	c.232G>T	c.(232-234)Gtc>Ttc	p.V78F	SUMF2_ENST00000395435.2_Missense_Mutation_p.V97F|SUMF2_ENST00000434526.2_Missense_Mutation_p.V97F|SUMF2_ENST00000395436.2_Missense_Mutation_p.V97F|SUMF2_ENST00000437307.2_Missense_Mutation_p.V78F|SUMF2_ENST00000275607.9_5'UTR|SUMF2_ENST00000342190.6_Missense_Mutation_p.V97F			Q8NBJ7	SUMF2_HUMAN	sulfatase modifying factor 2	78					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum lumen (GO:0005788)	metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	14	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TAGGGATTTTGTCAGGGAGAA	0.483																																																	0													112.0	115.0	114.0					7																	56140697		2203	4300	6503	SO:0001583	missense	0			AK075477	CCDS5524.2, CCDS43588.2, CCDS43589.2, CCDS47589.1, CCDS55111.1	7q11.1	2004-04-30			ENSG00000129103	ENSG00000129103			20415	protein-coding gene	gene with protein product		607940				12757706	Standard	NM_015411		Approved	DKFZp566I1024	uc003trv.3	Q8NBJ7	OTTHUMG00000129373	ENST00000413756.1:c.232G>T	7.37:g.56140697G>T	ENSP00000406445:p.Val78Phe		B4DU41|B4DWQ0|Q14DW5|Q53ZE3|Q96BH2|Q9BRN3|Q9BWI1|Q9Y405	Missense_Mutation	SNP	pfam_FGE_dom,superfamily_C-type_lectin_fold	p.V97F	ENST00000413756.1	37	c.289		7	.	.	.	.	.	.	.	.	.	.	G	11.81	1.748870	0.30955	.	.	ENSG00000129103	ENST00000395436;ENST00000434526;ENST00000395435;ENST00000413952;ENST00000342190;ENST00000437307;ENST00000413756;ENST00000451338	D;D;D;D;D;D;D;D	0.95622	-3.76;-3.76;-3.76;-3.76;-3.76;-3.76;-3.76;-3.76	5.24	2.44	0.29823	C-type lectin fold (1);Formylglycine-generating sulphatase enzyme domain (2);	0.175437	0.50627	D	0.000110	D	0.97971	0.9332	H	0.94306	3.52	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.998;0.998;0.997;1.0;0.998	D;D;D;D;D;D	0.78314	0.973;0.948;0.975;0.975;0.974;0.991	D	0.97587	1.0114	10	0.87932	D	0	0.2709	10.7153	0.46008	0.2137:0.0:0.7863:0.0	.	78;97;100;78;97;100	Q8NBJ7-5;A8MXB9;E7EMF9;Q8NBJ7;F8WA42;C9JL30	.;.;.;SUMF2_HUMAN;.;.	F	97;97;97;100;97;78;78;75	ENSP00000378824:V97F;ENSP00000400922:V97F;ENSP00000378823:V97F;ENSP00000414434:V100F;ENSP00000341938:V97F;ENSP00000415989:V78F;ENSP00000406445:V78F;ENSP00000410796:V75F	ENSP00000341938:V97F	V	+	1	0	SUMF2	56108191	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	5.113000	0.64640	0.421000	0.25980	-0.137000	0.14449	GTC	SUMF2	-	pfam_FGE_dom,superfamily_C-type_lectin_fold	ENSG00000129103		0.483	SUMF2-013	NOVEL	basic|exp_conf	protein_coding	SUMF2	HGNC	protein_coding	OTTHUMT00000341457.2	-	0.00	79	0	G	NM_015411		56140697	+1	tier1	-	no_errors	ENST00000342190	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
SYCE1	93426	genome.wustl.edu	37	10	135371408	135371408	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:135371408G>C	ENST00000343131.5	-	6	438	c.334C>G	c.(334-336)Ctc>Gtc	p.L112V	SYCE1_ENST00000432597.2_Missense_Mutation_p.L76V|SYCE1_ENST00000368517.3_Missense_Mutation_p.L76V|SPRN_ENST00000541506.1_Intron	NM_001143764.1	NP_001137236.1	Q8N0S2	SYCE1_HUMAN	synaptonemal complex central element protein 1	112					synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|stomach(3)|urinary_tract(1)	19		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		TGCAGCCGGAGGATCCTCAGG	0.522																																																	0													98.0	78.0	84.0					10																	135371408		2203	4300	6503	SO:0001583	missense	0			AY027808	CCDS7687.1, CCDS44500.1, CCDS44501.1	10q26.3	2009-03-12	2005-09-27	2005-09-27	ENSG00000171772	ENSG00000171772			28852	protein-coding gene	gene with protein product	"""cancer/testis antigen 76"""	611486	"""chromosome 10 open reading frame 94"""	C10orf94		11829491	Standard	NM_130784		Approved	bA108K14.6, CT76	uc001lno.2	Q8N0S2	OTTHUMG00000019321	ENST00000343131.5:c.334C>G	10.37:g.135371408G>C	ENSP00000341282:p.Leu112Val		B2RC80|Q9BWU3|Q9BWU4	Missense_Mutation	SNP	NULL	p.L112V	ENST00000343131.5	37	c.334	CCDS44501.1	10	.	.	.	.	.	.	.	.	.	.	G	9.618	1.133019	0.21041	.	.	ENSG00000171772	ENST00000303903;ENST00000432597;ENST00000368517;ENST00000343131	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	4.44	2.53	0.30540	.	0.127625	0.36555	N	0.002521	T	0.38983	0.1061	L	0.57536	1.79	0.20307	N	0.999917	P;B	0.41102	0.738;0.356	B;B	0.38562	0.276;0.104	T	0.36456	-0.9747	10	0.66056	D	0.02	-1.9	5.2539	0.15537	0.1043:0.0:0.6855:0.2102	.	112;76	Q8N0S2;Q8N0S2-2	SYCE1_HUMAN;.	V	112;76;76;112	ENSP00000303978:L112V;ENSP00000411779:L76V;ENSP00000357503:L76V;ENSP00000341282:L112V	ENSP00000303978:L112V	L	-	1	0	SYCE1	135221398	0.971000	0.33674	0.745000	0.31077	0.441000	0.31987	1.322000	0.33689	0.767000	0.33267	-0.136000	0.14681	CTC	SYCE1	-	NULL	ENSG00000171772		0.522	SYCE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYCE1	HGNC	protein_coding		-	0.00	55	0	G	NM_201564		135371408	-1	tier1	-	no_errors	ENST00000343131	ensembl	human	known	74_37	missense	8.82	62	6	SNP	0.791	C
SYCP2L	221711	genome.wustl.edu	37	6	10924739	10924739	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:10924739G>T	ENST00000283141.6	+	15	1379	c.1083G>T	c.(1081-1083)aaG>aaT	p.K361N	SYCP2L_ENST00000543878.1_Missense_Mutation_p.K202N|RP11-637O19.3_ENST00000480294.1_3'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	361						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AAACGGAGAAGATAAAGATAT	0.284																																																	0													61.0	56.0	58.0					6																	10924739		1801	4063	5864	SO:0001583	missense	0			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1083G>T	6.37:g.10924739G>T	ENSP00000283141:p.Lys361Asn		A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	NULL	p.K361N	ENST00000283141.6	37	c.1083	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	G	4.418	0.077236	0.08485	.	.	ENSG00000153157	ENST00000543878;ENST00000283141	T;T	0.46451	0.87;2.18	5.24	1.3	0.21679	.	1.146100	0.06229	N	0.688283	T	0.04679	0.0127	N	0.04508	-0.205	0.09310	N	1	B;B	0.11235	0.002;0.004	B;B	0.14023	0.003;0.01	T	0.29579	-1.0007	10	0.07813	T	0.8	0.0309	2.0335	0.03534	0.2179:0.1476:0.4836:0.1509	.	202;361	B4DFB8;Q5T4T6	.;SYC2L_HUMAN	N	202;361	ENSP00000440676:K202N;ENSP00000283141:K361N	ENSP00000283141:K361N	K	+	3	2	SYCP2L	11032725	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.014000	0.12656	0.274000	0.22072	0.655000	0.94253	AAG	SYCP2L	-	NULL	ENSG00000153157		0.284	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	HGNC	protein_coding	OTTHUMT00000039845.3	-	0.00	48	0	G	NM_194299		10924739	+1	tier1	-	no_errors	ENST00000283141	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.000	T
SYNE1	23345	genome.wustl.edu	37	6	152784608	152784608	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:152784608G>T	ENST00000367255.5	-	19	2578	c.1977C>A	c.(1975-1977)gcC>gcA	p.A659A	SYNE1_ENST00000466159.2_Silent_p.A659A|SYNE1_ENST00000367248.3_Silent_p.A649A|SYNE1_ENST00000423061.1_Silent_p.A666A|SYNE1_ENST00000448038.1_Silent_p.A666A|SYNE1_ENST00000495090.2_Silent_p.A226A|SYNE1_ENST00000367253.4_Silent_p.A659A|SYNE1_ENST00000413186.2_Silent_p.A659A|SYNE1_ENST00000341594.5_Silent_p.A666A|SYNE1_ENST00000265368.4_Silent_p.A659A	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	659					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATCGTTCATGGCAGTATGCT	0.388										HNSCC(10;0.0054)																																							0													77.0	71.0	73.0					6																	152784608		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1977C>A	6.37:g.152784608G>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A659	ENST00000367255.5	37	c.1977	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	90	0	G	NM_182961		152784608	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.970	T
SYNE1	23345	genome.wustl.edu	37	6	152831447	152831447	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:152831447G>A	ENST00000367255.5	-	8	1063	c.462C>T	c.(460-462)tcC>tcT	p.S154S	SYNE1_ENST00000466159.2_Silent_p.S154S|SYNE1_ENST00000367248.3_Silent_p.S161S|SYNE1_ENST00000423061.1_Silent_p.S161S|SYNE1_ENST00000448038.1_Silent_p.S161S|SYNE1_ENST00000367253.4_Silent_p.S154S|SYNE1_ENST00000413186.2_Silent_p.S154S|SYNE1_ENST00000341594.5_Silent_p.S154S|SYNE1_ENST00000265368.4_Silent_p.S154S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	154	Actin-binding.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGCTGTCCACGGAGGATGCGC	0.478										HNSCC(10;0.0054)																																							0													130.0	114.0	119.0					6																	152831447		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.462C>T	6.37:g.152831447G>A			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S154	ENST00000367255.5	37	c.462	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_CH-domain	ENSG00000131018		0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	58	0	G	NM_182961		152831447	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	21.05	60	16	SNP	0.007	A
T	6862	genome.wustl.edu	37	6	166578287	166578287	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:166578287C>T	ENST00000296946.2	-	5	1137		c.e5+1		T_ENST00000366871.3_Splice_Site	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)						anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		AATTCTCTCACCTTTCCTTTG	0.318									Chordoma, Familial Clustering of																																								0													52.0	56.0	55.0					6																	166578287		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database		AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.668+1G>A	6.37:g.166578287C>T			E7ERD6|Q4KMP4	Splice_Site	SNP	-	e4+1	ENST00000296946.2	37	c.668+1	CCDS5290.1	6	.	.	.	.	.	.	.	.	.	.	C	23.0	4.359799	0.82353	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5482	0.87869	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	T	166498277	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.180000	0.65048	2.380000	0.81148	0.650000	0.86243	.	T	-	-	ENSG00000164458		0.318	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	T	HGNC	protein_coding	OTTHUMT00000043037.2	-	0.00	82	0	C	NM_003181	Intron	166578287	-1	tier1	-	no_errors	ENST00000296946	ensembl	human	known	74_37	splice_site	6.80	96	7	SNP	1.000	T
TANK	10010	genome.wustl.edu	37	2	162061209	162061209	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:162061209C>T	ENST00000392749.2	+	4	471	c.232C>T	c.(232-234)Ctg>Ttg	p.L78L	TANK_ENST00000457476.1_Silent_p.L78L|TANK_ENST00000402568.1_Silent_p.L137L|TANK_ENST00000406287.1_Silent_p.L136L|TANK_ENST00000259075.2_Silent_p.L78L|TANK_ENST00000403609.1_Silent_p.L78L|TANK_ENST00000405852.1_Silent_p.L78L	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	78					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						CTGTGTTCCTCTGCTTGAAGA	0.353																																																	0													71.0	75.0	74.0					2																	162061209		2203	4300	6503	SO:0001819	synonymous_variant	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.232C>T	2.37:g.162061209C>T			D3DPB5|Q7Z4J6|Q92885	Silent	SNP	NULL	p.L78	ENST00000392749.2	37	c.232	CCDS2215.1	2																																																																																			TANK	-	NULL	ENSG00000136560		0.353	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	-	0.00	73	0	C	NM_133484		162061209	+1	tier1	-	no_errors	ENST00000259075	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.131	T
TCN2	6948	genome.wustl.edu	37	22	31010381	31010381	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr22:31010381G>T	ENST00000215838.3	+	4	967	c.473G>T	c.(472-474)gGc>gTc	p.G158V	TCN2_ENST00000407817.3_Missense_Mutation_p.G131V|TCN2_ENST00000405742.3_Missense_Mutation_p.G154V			P20062	TCO2_HUMAN	transcobalamin II	158					cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|prostate(2)|urinary_tract(1)	22					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TACCAGTATGGCCTGGGCATT	0.587																																																	0													109.0	84.0	93.0					22																	31010381		2203	4300	6503	SO:0001583	missense	0				CCDS13881.1, CCDS54519.1	22q12.2	2014-09-17	2010-05-11		ENSG00000185339	ENSG00000185339			11653	protein-coding gene	gene with protein product	"""macrocytic anemia"""	613441	"""transcobalamin II; macrocytic anemia"""			1708393, 7742531	Standard	NM_000355		Approved	D22S676, D22S750, TC2	uc003aip.2	P20062	OTTHUMG00000151095	ENST00000215838.3:c.473G>T	22.37:g.31010381G>T	ENSP00000215838:p.Gly158Val		Q96FD4|Q9BVI8|Q9UCI5|Q9UCI6|Q9UDM0	Missense_Mutation	SNP	pfam_Cbl-bd_transpt_euk,superfamily_Terpenoid_cyclase/PrenylTrfase	p.G158V	ENST00000215838.3	37	c.473	CCDS13881.1	22	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663308	0.67700	.	.	ENSG00000185339	ENST00000215838;ENST00000405742;ENST00000407817	T;T;T	0.37752	1.18;1.18;1.18	5.18	5.18	0.71444	.	0.443292	0.28088	N	0.016642	T	0.56077	0.1961	M	0.68317	2.08	0.80722	D	1	P;D;D	0.65815	0.942;0.991;0.995	P;P;D	0.63283	0.798;0.788;0.913	T	0.57476	-0.7805	10	0.54805	T	0.06	-14.7073	15.6115	0.76721	0.0:0.0:1.0:0.0	.	131;154;158	Q96FD4;B5MBX2;P20062	.;.;TCO2_HUMAN	V	158;154;131	ENSP00000215838:G158V;ENSP00000385914:G154V;ENSP00000384914:G131V	ENSP00000215838:G158V	G	+	2	0	TCN2	29340381	1.000000	0.71417	0.990000	0.47175	0.741000	0.42261	5.653000	0.67967	2.428000	0.82296	0.555000	0.69702	GGC	TCN2	-	pfam_Cbl-bd_transpt_euk,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000185339		0.587	TCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCN2	HGNC	protein_coding	OTTHUMT00000321282.2		0.00	131	0	G	NM_000355		31010381	+1			no_errors	ENST00000215838	ensembl	human	known	74_37	missense	5.49	86	5	SNP	0.996	T
TDRD15	100129278	genome.wustl.edu	37	2	21360421	21360421	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:21360421C>G	ENST00000405799.1	+	4	412	c.82C>G	c.(82-84)Ctg>Gtg	p.L28V				B5MCY1	TDR15_HUMAN	tudor domain containing 15	28							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										CAAGGATATTCTGGTGAAATT	0.308																																																	0																																										SO:0001583	missense	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.82C>G	2.37:g.21360421C>G	ENSP00000384376:p.Leu28Val			Missense_Mutation	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.L28V	ENST00000405799.1	37	c.82		2	.	.	.	.	.	.	.	.	.	.	C	3.243	-0.154867	0.06544	.	.	ENSG00000218819	ENST00000405799	T	0.09350	2.99	5.24	-0.103	0.13609	.	.	.	.	.	T	0.05410	0.0143	.	.	.	.	.	.	.	.	.	.	.	.	T	0.40664	-0.9551	5	0.20519	T	0.43	-2.1882	1.7139	0.02897	0.1132:0.3777:0.2221:0.287	.	.	.	.	V	28	ENSP00000384376:L28V	ENSP00000384376:L28V	L	+	1	2	AC010872.2	21213926	0.420000	0.25457	0.723000	0.30687	0.600000	0.36913	-0.021000	0.12504	0.141000	0.18875	0.544000	0.68410	CTG	TDRD15	-	pfam_Tudor	ENSG00000218819		0.308	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	HGNC	protein_coding	OTTHUMT00000323948.1	-	0.00	90	0	C			21360421	+1	tier1	-	no_errors	ENST00000405799	ensembl	human	novel	74_37	missense	7.25	64	5	SNP	0.034	G
TDRD6	221400	genome.wustl.edu	37	6	46656919	46656919	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:46656919G>A	ENST00000316081.6	+	1	1054	c.1054G>A	c.(1054-1056)Gag>Aag	p.E352K	TDRD6_ENST00000544460.1_Missense_Mutation_p.E352K|RP11-446F17.3_ENST00000571590.1_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000422284.2_RNA	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	352	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			TGGAAGGAAGGAGTTAGTGAG	0.537																																																	0													121.0	111.0	114.0					6																	46656919		2203	4300	6503	SO:0001583	missense	0			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1054G>A	6.37:g.46656919G>A	ENSP00000346065:p.Glu352Lys		B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.E352K	ENST00000316081.6	37	c.1054	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803556	0.70682	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.13420	2.59;2.59	5.45	5.45	0.79879	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.340416	0.33813	N	0.004525	T	0.25082	0.0609	M	0.62088	1.915	0.38878	D	0.956847	D;D	0.76494	0.999;0.999	D;D	0.77004	0.974;0.989	T	0.01053	-1.1467	10	0.19590	T	0.45	-16.1434	19.0814	0.93185	0.0:0.0:1.0:0.0	.	352;352	F5H5M3;O60522	.;TDRD6_HUMAN	K	352	ENSP00000443299:E352K;ENSP00000346065:E352K	ENSP00000346065:E352K	E	+	1	0	TDRD6	46764878	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.067000	0.64357	2.836000	0.97738	0.655000	0.94253	GAG	TDRD6	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000180113		0.537	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	-	0.00	70	0	G	XM_166443		46656919	+1	tier1	-	no_errors	ENST00000316081	ensembl	human	known	74_37	missense	11.90	37	5	SNP	1.000	A
THAP6	152815	genome.wustl.edu	37	4	76465090	76465090	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:76465090G>C	ENST00000507556.1	+	5	504	c.436G>C	c.(436-438)Gaa>Caa	p.E146Q	THAP6_ENST00000502620.1_Intron|THAP6_ENST00000507557.1_Intron|THAP6_ENST00000507885.1_Missense_Mutation_p.E105Q|THAP6_ENST00000504190.1_Missense_Mutation_p.E63Q			Q8TBB0	THAP6_HUMAN	THAP domain containing 6	0						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AAGGAAACAAGAACAGGAAGA	0.398																																																	0																																										SO:0001583	missense	0			BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000507556.1:c.436G>C	4.37:g.76465090G>C	ENSP00000427651:p.Glu146Gln		B4E146|Q5HYJ7|Q5JPC6	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.E146Q	ENST00000507556.1	37	c.436		4	.	.	.	.	.	.	.	.	.	.	G	3.569	-0.087957	0.07097	.	.	ENSG00000174796	ENST00000504190;ENST00000507556;ENST00000507885	D	0.98531	-4.98	2.22	-0.607	0.11615	.	.	.	.	.	D	0.94178	0.8132	.	.	.	0.09310	N	0.999999	B	0.19445	0.036	B	0.08055	0.003	D	0.87167	0.2218	8	0.33141	T	0.24	.	5.3903	0.16240	0.4454:0.0:0.5546:0.0	.	146	B4E146	.	Q	63;146;105	ENSP00000427651:E146Q	ENSP00000426581:E63Q	E	+	1	0	THAP6	76684114	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	-0.186000	0.09670	-0.224000	0.09928	-0.964000	0.02622	GAA	THAP6	-	NULL	ENSG00000174796		0.398	THAP6-006	PUTATIVE	basic	protein_coding	THAP6	HGNC	protein_coding	OTTHUMT00000362552.1	-	0.00	78	0	G	NM_144721		76465090	+1	tier1	-	no_errors	ENST00000507556	ensembl	human	putative	74_37	missense	11.76	60	8	SNP	0.003	C
THOC2	57187	genome.wustl.edu	37	X	122799634	122799634	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:122799634C>G	ENST00000245838.8	-	12	1276	c.1245G>C	c.(1243-1245)aaG>aaC	p.K415N	THOC2_ENST00000491737.1_Missense_Mutation_p.K300N|THOC2_ENST00000355725.4_Missense_Mutation_p.K415N	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	415					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						TTGGTGCTCTCTTGTTTTGCA	0.343																																																	0													169.0	156.0	160.0					X																	122799634		1848	4093	5941	SO:0001583	missense	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.1245G>C	X.37:g.122799634C>G	ENSP00000245838:p.Lys415Asn		A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.K415N	ENST00000245838.8	37	c.1245	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	C	8.866	0.948226	0.18356	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.7	3.93	0.45458	.	0.000000	0.64402	D	0.000001	T	0.51109	0.1655	L	0.46157	1.445	0.54753	D	0.999987	B;B	0.10296	0.001;0.003	B;B	0.12156	0.002;0.007	T	0.41466	-0.9507	9	0.15499	T	0.54	-11.3569	10.9497	0.47321	0.0:0.8458:0.0:0.1542	.	336;415	B4DKZ6;Q8NI27	.;THOC2_HUMAN	N	415;415;300;336	.	ENSP00000245838:K415N	K	-	3	2	THOC2	122627315	1.000000	0.71417	0.986000	0.45419	0.578000	0.36192	1.293000	0.33353	1.159000	0.42565	0.600000	0.82982	AAG	THOC2	-	NULL	ENSG00000125676		0.343	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	-	0.00	33	0	C			122799634	-1	tier1	-	no_errors	ENST00000245838	ensembl	human	known	74_37	missense	26.53	36	13	SNP	0.988	G
TIE1	7075	genome.wustl.edu	37	1	43783580	43783580	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:43783580C>T	ENST00000372476.3	+	17	2838	c.2759C>T	c.(2758-2760)gCc>gTc	p.A920V	TIE1_ENST00000433781.2_Missense_Mutation_p.A565V|TIE1_ENST00000473014.1_3'UTR	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	920	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A920V(2)		breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ATTGAATATGCCCCCTACGGG	0.527																																																	2	Substitution - Missense(2)	urinary_tract(2)											280.0	295.0	290.0					1																	43783580		2203	4300	6503	SO:0001583	missense	0			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2759C>T	1.37:g.43783580C>T	ENSP00000361554:p.Ala920Val		B5A949|B5A950	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A920V	ENST00000372476.3	37	c.2759	CCDS482.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.505865	0.96371	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	T;T	0.68331	-0.32;-0.32	6.06	6.06	0.98353	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39985	N	0.001215	T	0.72350	0.3449	N	0.13198	0.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.76130	-0.3072	10	0.72032	D	0.01	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	875;565;920	B4DTW8;B4DKW0;P35590	.;.;TIE1_HUMAN	V	920;323;203;565	ENSP00000361554:A920V;ENSP00000411728:A565V	ENSP00000361553:A323V	A	+	2	0	TIE1	43556167	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.757000	0.85209	2.882000	0.98803	0.655000	0.94253	GCC	TIE1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000066056		0.527	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	HGNC	protein_coding	OTTHUMT00000019011.1	-	0.00	68	0	C	NM_005424		43783580	+1	tier1	-	no_errors	ENST00000372476	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
TIMM50	92609	genome.wustl.edu	37	19	39979191	39979191	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:39979191A>G	ENST00000607714.1	+	10	888	c.866A>G	c.(865-867)aAt>aGt	p.N289S	TIMM50_ENST00000599794.1_Missense_Mutation_p.N93S|TIMM50_ENST00000314349.4_Missense_Mutation_p.N392S|TIMM50_ENST00000544017.1_Missense_Mutation_p.N176S			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)	289					cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			ATTGCACTGAATGGTGTGGAG	0.632																																																	0													135.0	136.0	136.0					19																	39979191		2203	4300	6503	SO:0001583	missense	0			BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8		ENST00000607714.1:c.866A>G	19.37:g.39979191A>G	ENSP00000475531:p.Asn289Ser		Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF	p.N392S	ENST00000607714.1	37	c.1175		19	.	.	.	.	.	.	.	.	.	.	A	0.771	-0.765674	0.02996	.	.	ENSG00000105197	ENST00000314349;ENST00000544017	.	.	.	4.89	4.89	0.63831	NLI interacting factor (1);HAD-like domain (2);	0.095949	0.64402	D	0.000001	T	0.11793	0.0287	N	0.00280	-1.71	0.47123	D	0.99932	B;B	0.20052	0.012;0.041	B;B	0.15484	0.006;0.013	T	0.17228	-1.0376	8	.	.	.	-27.9508	5.9951	0.19489	0.8187:0.0:0.1813:0.0	.	289;392	Q3ZCQ8;Q3ZCQ8-2	TIM50_HUMAN;.	S	392;176	.	.	N	+	2	0	TIMM50	44671031	1.000000	0.71417	0.759000	0.31340	0.436000	0.31835	5.828000	0.69307	2.052000	0.61016	0.459000	0.35465	AAT	TIMM50	-	pfam_NIF,superfamily_HAD-like_dom	ENSG00000105197		0.632	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	TIMM50	HGNC	protein_coding	OTTHUMT00000470728.1	-	0.00	57	0	A	NM_001001563		39979191	+1	tier1	-	no_errors	ENST00000314349	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.983	G
TMEM128	85013	genome.wustl.edu	37	4	4248035	4248035	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr4:4248035G>C	ENST00000382753.4	-	2	142	c.133C>G	c.(133-135)Ctt>Gtt	p.L45V	TMEM128_ENST00000254742.2_Missense_Mutation_p.L21V|TMEM128_ENST00000540397.1_Missense_Mutation_p.L45V|TMEM128_ENST00000538516.1_Missense_Mutation_p.L45V			Q5BJH2	TM128_HUMAN	transmembrane protein 128	45						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.166)		AGTCTTGGAAGAGGTTTCTCC	0.353																																																	0													124.0	133.0	130.0					4																	4248035		2203	4300	6503	SO:0001583	missense	0			BC007729	CCDS3373.1, CCDS75099.1	4p16.3	2008-02-05			ENSG00000132406	ENSG00000132406			28201	protein-coding gene	gene with protein product							Standard	XM_005248034		Approved	MGC13159	uc003ghq.1	Q5BJH2	OTTHUMG00000125475	ENST00000382753.4:c.133C>G	4.37:g.4248035G>C	ENSP00000372201:p.Leu45Val		B4DHS7|D3DVS3|Q5H9U6|Q96I94	Missense_Mutation	SNP	NULL	p.L45V	ENST00000382753.4	37	c.133		4	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958007	0.53400	.	.	ENSG00000132406	ENST00000254742;ENST00000382753;ENST00000538516;ENST00000540397	D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6	5.83	4.96	0.65561	.	0.213395	0.40144	N	0.001178	D	0.87091	0.6091	M	0.71581	2.175	0.48696	D	0.999694	D;D;D;P	0.67145	0.996;0.996;0.98;0.944	P;P;P;B	0.54924	0.764;0.764;0.554;0.415	D	0.85925	0.1448	10	0.36615	T	0.2	-33.1173	15.2345	0.73419	0.0:0.0:0.8589:0.1411	.	45;45;45;21	B7Z3K1;Q5BJH2;D3DVS1;Q5BJH2-2	.;TM128_HUMAN;.;.	V	21;45;45;45	ENSP00000254742:L21V;ENSP00000372201:L45V;ENSP00000442300:L45V;ENSP00000439174:L45V	ENSP00000254742:L21V	L	-	1	0	TMEM128	4298936	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.868000	0.63021	2.769000	0.95229	0.655000	0.94253	CTT	TMEM128	-	NULL	ENSG00000132406		0.353	TMEM128-002	KNOWN	basic|appris_principal	protein_coding	TMEM128	HGNC	protein_coding	OTTHUMT00000246798.2		0.00	61	0	G	NM_032927		4248035	-1			no_errors	ENST00000382753	ensembl	human	known	74_37	missense	9.26	47	5	SNP	1.000	C
TMEM86A	144110	genome.wustl.edu	37	11	18723435	18723435	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr11:18723435C>T	ENST00000280734.2	+	3	698	c.602C>T	c.(601-603)cCt>cTt	p.P201L		NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A	201						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						TTCTGTTTTCCTGTGCCCTAC	0.572																																																	0													104.0	89.0	95.0					11																	18723435		2199	4293	6492	SO:0001583	missense	0			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4		ENST00000280734.2:c.602C>T	11.37:g.18723435C>T	ENSP00000280734:p.Pro201Leu		Q96AJ0	Missense_Mutation	SNP	pfam_YhhN	p.P201L	ENST00000280734.2	37	c.602	CCDS7844.1	11	.	.	.	.	.	.	.	.	.	.	C	15.27	2.782950	0.49891	.	.	ENSG00000151117	ENST00000535380;ENST00000280734	T	0.24350	1.86	5.55	4.62	0.57501	.	0.109393	0.64402	N	0.000004	T	0.35393	0.0930	M	0.86178	2.8	0.80722	D	1	B	0.19331	0.035	B	0.24541	0.054	T	0.19647	-1.0299	9	.	.	.	-4.2971	13.7142	0.62687	0.0:0.9239:0.0:0.0761	.	201	Q8N2M4	TM86A_HUMAN	L	201	ENSP00000280734:P201L	.	P	+	2	0	TMEM86A	18680011	1.000000	0.71417	0.289000	0.24876	0.985000	0.73830	5.615000	0.67702	1.520000	0.48965	0.655000	0.94253	CCT	TMEM86A	-	pfam_YhhN	ENSG00000151117		0.572	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM86A	HGNC	protein_coding	OTTHUMT00000387812.1		0.00	33	0	C	NM_153347		18723435	+1			no_errors	ENST00000280734	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.996	T
TNRC6C	57690	genome.wustl.edu	37	17	76046827	76046827	+	Missense_Mutation	SNP	G	G	T	rs200217894		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:76046827G>T	ENST00000588061.1	+	5	2411	c.1684G>T	c.(1684-1686)Gca>Tca	p.A562S	TNRC6C_ENST00000335749.4_Missense_Mutation_p.A562S|TNRC6C_ENST00000541771.1_Missense_Mutation_p.A562S|TNRC6C_ENST00000588847.1_Missense_Mutation_p.A562S|TNRC6C_ENST00000301624.4_Missense_Mutation_p.A562S|TNRC6C_ENST00000544502.1_Missense_Mutation_p.A562S			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	562	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GAGTGGGGCCGCAAATCAGGA	0.582																																																	0													53.0	59.0	57.0					17																	76046827		2028	4188	6216	SO:0001583	missense	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1684G>T	17.37:g.76046827G>T	ENSP00000468647:p.Ala562Ser		G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.A562S	ENST00000588061.1	37	c.1684	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	2.587	-0.296180	0.05532	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.14266	2.52;2.53;2.53;2.52	5.75	3.79	0.43588	.	0.922167	0.09205	N	0.834117	T	0.10895	0.0266	L	0.29908	0.895	0.25749	N	0.98507	B;B;B	0.27068	0.123;0.167;0.104	B;B;B	0.28849	0.082;0.095;0.027	T	0.37478	-0.9704	10	0.09843	T	0.71	0.8073	10.4778	0.44676	0.2076:0.0:0.7924:0.0	.	562;562;562	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	S	562	ENSP00000336783:A562S;ENSP00000301624:A562S;ENSP00000440310:A562S;ENSP00000442421:A562S	ENSP00000301624:A562S	A	+	1	0	TNRC6C	73558422	0.864000	0.29904	0.557000	0.28306	0.995000	0.86356	3.175000	0.50855	0.800000	0.34041	0.655000	0.94253	GCA	TNRC6C	-	NULL	ENSG00000078687		0.582	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	-	0.00	58	0	G	NM_018996		76046827	+1	tier1	-	no_errors	ENST00000335749	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.723	T
TNS3	64759	genome.wustl.edu	37	7	47408374	47408374	+	Silent	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:47408374G>C	ENST00000398879.1	-	17	2235	c.1869C>G	c.(1867-1869)gtC>gtG	p.V623V	TNS3_ENST00000311160.9_Silent_p.V623V|TNS3_ENST00000355730.3_Silent_p.V383V			Q68CZ2	TENS3_HUMAN	tensin 3	623					cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						GCTGGGCCTGGACGAGGCCAG	0.662																																																	0													39.0	45.0	43.0					7																	47408374		2046	4203	6249	SO:0001819	synonymous_variant	0			AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.1869C>G	7.37:g.47408374G>C			B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Silent	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.V623	ENST00000398879.1	37	c.1869	CCDS5506.2	7																																																																																			TNS3	-	NULL	ENSG00000136205		0.662	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	HGNC	protein_coding	OTTHUMT00000157253.1	-	0.00	44	0	G	NM_022748		47408374	-1	tier1	-	no_errors	ENST00000311160	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.000	C
TOX3	27324	genome.wustl.edu	37	16	52480132	52480132	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:52480132G>T	ENST00000219746.9	-	5	964	c.680C>A	c.(679-681)gCc>gAc	p.A227D	TOX3_ENST00000407228.3_Splice_Site_p.A222D	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	227					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						CTCTCCAATGGCCTGCAAAGC	0.423																																																	0													30.0	28.0	29.0					16																	52480132		1863	4132	5995	SO:0001630	splice_region_variant	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.679-1C>A	16.37:g.52480132G>T			B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A227D	ENST00000219746.9	37	c.680	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470718	0.43942	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.10573	2.87;2.86	5.9	5.9	0.94986	.	0.222293	0.41823	D	0.000801	T	0.06735	0.0172	N	0.08118	0	0.37599	D	0.920491	P;B	0.35433	0.501;0.309	B;B	0.32289	0.143;0.107	T	0.45086	-0.9285	10	0.13108	T	0.6	.	20.2822	0.98520	0.0:0.0:1.0:0.0	.	222;227	B4DRD0;O15405	.;TOX3_HUMAN	D	227;222	ENSP00000219746:A227D;ENSP00000385705:A222D	ENSP00000219746:A227D	A	-	2	0	TOX3	51037633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.029000	0.64121	2.806000	0.96561	0.655000	0.94253	GCC	TOX3	-	NULL	ENSG00000103460		0.423	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	-	0.00	67	0	G	XM_049037	Missense_Mutation	52480132	-1	tier1	-	no_errors	ENST00000219746	ensembl	human	known	74_37	missense	5.33	70	4	SNP	1.000	T
TOX3	27324	genome.wustl.edu	37	16	52553367	52553367	+	Intron	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:52553367G>T	ENST00000219746.9	-	1	372				TOX3_ENST00000407228.3_Missense_Mutation_p.A9D	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3						apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						AATGCGCCTGGCTCCCGAGCG	0.478																																																	0													155.0	144.0	147.0					16																	52553367		692	1591	2283	SO:0001627	intron_variant	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.87+27181C>A	16.37:g.52553367G>T			B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A9D	ENST00000219746.9	37	c.26	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	3.509	-0.100158	0.07010	.	.	ENSG00000103460	ENST00000407228	T	0.10573	2.86	2.94	-1.58	0.08479	.	.	.	.	.	T	0.05227	0.0139	.	.	.	0.09310	N	1	B	0.23891	0.093	B	0.18561	0.022	T	0.41805	-0.9488	8	0.26408	T	0.33	.	2.9119	0.05739	0.3639:0.0:0.4379:0.1982	.	9	B4DRD0	.	D	9	ENSP00000385705:A9D	ENSP00000385705:A9D	A	-	2	0	TOX3	51110868	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.375000	0.20518	-0.292000	0.08999	0.563000	0.77884	GCC	TOX3	-	NULL	ENSG00000103460		0.478	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	-	0.00	98	0	G	XM_049037		52553367	-1	tier1	-	no_errors	ENST00000407228	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7578235	7578235	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:7578235T>C	ENST00000269305.4	-	6	803	c.614A>G	c.(613-615)tAt>tGt	p.Y205C	TP53_ENST00000420246.2_Missense_Mutation_p.Y205C|TP53_ENST00000455263.2_Missense_Mutation_p.Y205C|TP53_ENST00000359597.4_Missense_Mutation_p.Y205C|TP53_ENST00000413465.2_Missense_Mutation_p.Y205C|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.Y205C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	205	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y205C(68)|p.Y205S(14)|p.Y205F(8)|p.0?(8)|p.Y112C(5)|p.?(5)|p.Y73C(5)|p.Y73S(1)|p.Y112S(1)|p.E204fs*39(1)|p.E204_N210delEYLDDRN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATCCAAATACTCCACACG	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	117	Substitution - Missense(102)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(1)|Deletion - Frameshift(1)	lung(20)|upper_aerodigestive_tract(19)|central_nervous_system(10)|large_intestine(9)|biliary_tract(8)|breast(6)|ovary(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|urinary_tract(5)|bone(5)|soft_tissue(4)|oesophagus(4)|stomach(3)|liver(3)|pancreas(2)|vulva(1)|skin(1)|prostate(1)											136.0	121.0	126.0					17																	7578235		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.614A>G	17.37:g.7578235T>C	ENSP00000269305:p.Tyr205Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y205C	ENST00000269305.4	37	c.614	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.85	3.490024	0.64074	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99872	-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36;-7.36	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88906	2.99	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.995;0.998;0.995;0.997;0.999;0.997;0.996	D	0.97320	0.9943	10	0.87932	D	0	-5.8058	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	166;205;205;112;205;205;205	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	205;205;205;205;205;205;194;112;73;112;73	ENSP00000410739:Y205C;ENSP00000352610:Y205C;ENSP00000269305:Y205C;ENSP00000398846:Y205C;ENSP00000391127:Y205C;ENSP00000391478:Y205C;ENSP00000425104:Y73C;ENSP00000423862:Y112C	ENSP00000269305:Y205C	Y	-	2	0	TP53	7518960	1.000000	0.71417	0.137000	0.22149	0.045000	0.14185	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	127	0	T	NM_000546		7578235	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	20.00	60	15	SNP	0.989	C
TPO	7173	genome.wustl.edu	37	2	1480921	1480921	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:1480921G>T	ENST00000345913.4	+	8	974	c.883G>T	c.(883-885)Gcc>Tcc	p.A295S	TPO_ENST00000346956.3_Missense_Mutation_p.A295S|TPO_ENST00000329066.4_Missense_Mutation_p.A295S|TPO_ENST00000382201.3_Missense_Mutation_p.A295S|TPO_ENST00000382198.1_Intron|TPO_ENST00000349624.3_Intron|TPO_ENST00000337415.3_Missense_Mutation_p.A295S|TPO_ENST00000497517.2_Intron	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	295					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CTCTTCGGCCGCCTGCGGCAC	0.706																																																	0													12.0	14.0	13.0					2																	1480921		2192	4275	6467	SO:0001583	missense	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.883G>T	2.37:g.1480921G>T	ENSP00000318820:p.Ala295Ser		P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd_dom,superfamily_Haem_peroxidase,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.A295S	ENST00000345913.4	37	c.883	CCDS1643.1	2	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185320	0.38609	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000329066;ENST00000382201;ENST00000422464	T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	4.99	4.11	0.48088	.	0.223965	0.45606	D	0.000357	T	0.76807	0.4039	M	0.65677	2.01	0.80722	D	1	D;D;D	0.59357	0.985;0.961;0.968	P;P;P	0.61477	0.882;0.822;0.889	T	0.76814	-0.2820	10	0.42905	T	0.14	-20.3944	13.6977	0.62589	0.0756:0.0:0.9244:0.0	.	295;295;295	P07202-4;P07202-2;P07202	.;.;PERT_HUMAN	S	295;295;295;295;295;224	ENSP00000337263:A295S;ENSP00000318820:A295S;ENSP00000263886:A295S;ENSP00000329869:A295S;ENSP00000371636:A295S;ENSP00000405788:A224S	ENSP00000329869:A295S	A	+	1	0	TPO	1459928	0.326000	0.24669	0.607000	0.28956	0.013000	0.08279	3.117000	0.50407	1.089000	0.41292	0.460000	0.39030	GCC	TPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000115705		0.706	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2		0.00	85	0	G	NM_000547		1480921	+1			no_errors	ENST00000329066	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.969	T
TRAF5	7188	genome.wustl.edu	37	1	211533401	211533401	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:211533401G>T	ENST00000261464.5	+	5	580	c.526G>T	c.(526-528)Gta>Tta	p.V176L	TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000336184.2_Missense_Mutation_p.V176L|TRAF5_ENST00000367004.3_Missense_Mutation_p.V176L	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	176					apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		AAAGGATGTGGTAGTCATCAA	0.433																																																	0													115.0	106.0	109.0					1																	211533401		2203	4300	6503	SO:0001583	missense	0			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.526G>T	1.37:g.211533401G>T	ENSP00000261464:p.Val176Leu		B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.V176L	ENST00000261464.5	37	c.526	CCDS1497.1	1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844371	0.32606	.	.	ENSG00000082512	ENST00000336184;ENST00000261464;ENST00000367004	T;T;T	0.20598	2.06;2.06;2.06	5.09	4.17	0.49024	Zinc finger, TRAF-type (1);TRAF-like (1);	0.522698	0.19843	N	0.104819	T	0.18467	0.0443	L	0.42632	1.34	0.28446	N	0.916585	B;P	0.36354	0.202;0.549	B;B	0.40134	0.197;0.32	T	0.07849	-1.0751	10	0.08599	T	0.76	-25.298	10.9177	0.47146	0.1528:0.0:0.8472:0.0	.	187;176	B4E0A2;O00463	.;TRAF5_HUMAN	L	176	ENSP00000336825:V176L;ENSP00000261464:V176L;ENSP00000355971:V176L	ENSP00000261464:V176L	V	+	1	0	TRAF5	209600024	0.999000	0.42202	0.602000	0.28890	0.992000	0.81027	2.501000	0.45389	1.133000	0.42147	0.591000	0.81541	GTA	TRAF5	-	superfamily_TRAF-like,pirsf_TNF_rcpt--assoc_TRAF,pfscan_Znf_TRAF	ENSG00000082512		0.433	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1	-	0.00	56	0	G	NM_004619		211533401	+1	tier1	-	no_errors	ENST00000261464	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.222	T
TRERF1	55809	genome.wustl.edu	37	6	42224820	42224820	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:42224820C>G	ENST00000372922.4	-	11	2919	c.2357G>C	c.(2356-2358)aGa>aCa	p.R786T	TRERF1_ENST00000340840.2_Missense_Mutation_p.R703T|TRERF1_ENST00000354325.2_Missense_Mutation_p.R703T|TRERF1_ENST00000372917.4_Missense_Mutation_p.R703T|TRERF1_ENST00000541110.1_Missense_Mutation_p.R806T	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	786	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGCTTGGAATCTCAAGCCAAT	0.468																																																	0													145.0	139.0	141.0					6																	42224820		2203	4300	6503	SO:0001583	missense	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.2357G>C	6.37:g.42224820C>G	ENSP00000362013:p.Arg786Thr		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.R806T	ENST00000372922.4	37	c.2417	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996578	0.74818	.	.	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48	5.74	5.74	0.90152	ELM2 domain (2);	0.000000	0.64402	D	0.000004	T	0.52092	0.1713	M	0.73962	2.25	0.42626	D	0.99336	D;D;D;D;B	0.89917	1.0;0.999;0.999;0.999;0.198	D;D;D;D;B	0.83275	0.996;0.996;0.996;0.994;0.132	T	0.44159	-0.9346	10	0.45353	T	0.12	-15.1337	20.2982	0.98569	0.0:1.0:0.0:0.0	.	703;806;786;542;542	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	T	806;703;786;703;703	ENSP00000439689:R806T;ENSP00000362008:R703T;ENSP00000362013:R786T;ENSP00000339438:R703T;ENSP00000346285:R703T	ENSP00000339438:R703T	R	-	2	0	TRERF1	42332798	0.946000	0.32159	1.000000	0.80357	0.998000	0.95712	2.797000	0.47877	2.873000	0.98535	0.563000	0.77884	AGA	TRERF1	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000124496		0.468	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	-	0.00	56	0	C	NM_033502		42224820	-1	tier1	-	no_errors	ENST00000541110	ensembl	human	known	74_37	missense	14.81	46	8	SNP	1.000	G
TRIO	7204	genome.wustl.edu	37	5	14391097	14391097	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr5:14391097G>A	ENST00000344204.4	+	27	4240	c.4216G>A	c.(4216-4218)Gac>Aac	p.D1406N	TRIO_ENST00000537187.1_Missense_Mutation_p.D1406N|TRIO_ENST00000509967.2_Missense_Mutation_p.D1357N	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1406	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GTCCTATTTTGACGTAAGTAA	0.348																																																	0													80.0	79.0	79.0					5																	14391097		2202	4300	6502	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4216G>A	5.37:g.14391097G>A	ENSP00000339299:p.Asp1406Asn		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.D1406N	ENST00000344204.4	37	c.4216	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	23.0	4.362799	0.82353	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.62498	0.02;0.02;0.02	5.29	5.29	0.74685	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.69251	0.3090	N	0.21583	0.68	0.80722	D	1	P;P;D	0.61080	0.844;0.918;0.989	P;B;D	0.75020	0.62;0.412;0.985	T	0.70619	-0.4822	10	0.46703	T	0.11	.	19.3048	0.94157	0.0:0.0:1.0:0.0	.	1357;1406;1406	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	N	1406;1406;1357;1093	ENSP00000339299:D1406N;ENSP00000446348:D1406N;ENSP00000445592:D1357N	ENSP00000339299:D1406N	D	+	1	0	TRIO	14444097	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.813000	0.99286	2.622000	0.88805	0.650000	0.86243	GAC	TRIO	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000038382		0.348	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	-	0.00	62	0	G	NM_007118		14391097	+1	tier1	-	no_errors	ENST00000344204	ensembl	human	known	74_37	missense	10.14	62	7	SNP	1.000	A
TRPC4	7223	genome.wustl.edu	37	13	38211354	38211354	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:38211354G>A	ENST00000379705.3	-	11	3477	c.2620C>T	c.(2620-2622)Caa>Taa	p.Q874*	TRPC4_ENST00000355779.2_Nonsense_Mutation_p.Q733*|TRPC4_ENST00000358477.2_Nonsense_Mutation_p.Q790*|TRPC4_ENST00000379673.2_Nonsense_Mutation_p.Q725*|TRPC4_ENST00000379681.3_Nonsense_Mutation_p.Q879*|TRPC4_ENST00000447043.1_Nonsense_Mutation_p.Q733*|TRPC4_ENST00000338947.5_Nonsense_Mutation_p.Q701*|TRPC4_ENST00000379679.1_Nonsense_Mutation_p.Q701*|TRPC4_ENST00000426868.2_3'UTR			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	874	Binds to ITPR1, ITPR2 and ITPR3.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		GCAGCCTGTTGACGAGCAACT	0.428																																																	0													84.0	80.0	82.0					13																	38211354		2203	4299	6502	SO:0001587	stop_gained	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2620C>T	13.37:g.38211354G>A	ENSP00000369027:p.Gln874*		B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.Q879*	ENST00000379705.3	37	c.2635	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	G	39	7.879917	0.98539	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	.	.	.	5.76	5.76	0.90799	.	3.984360	0.00424	N	0.000067	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-12.2542	19.9628	0.97258	0.0:0.0:1.0:0.0	.	.	.	.	X	874;879;701;701;733;790;725;733	.	ENSP00000342580:Q701X	Q	-	1	0	TRPC4	37109354	1.000000	0.71417	0.953000	0.39169	0.994000	0.84299	7.623000	0.83113	2.695000	0.91970	0.563000	0.77884	CAA	TRPC4	-	NULL	ENSG00000133107		0.428	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	-	0.00	72	0	G	NM_003306		38211354	-1	tier1	-	no_errors	ENST00000379681	ensembl	human	known	74_37	nonsense	31.33	57	26	SNP	0.999	A
TRRAP	8295	genome.wustl.edu	37	7	98529082	98529082	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:98529082C>T	ENST00000359863.4	+	26	3855	c.3646C>T	c.(3646-3648)Cgg>Tgg	p.R1216W	TRRAP_ENST00000446306.3_Missense_Mutation_p.R1215W|TRRAP_ENST00000355540.3_Missense_Mutation_p.R1216W	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1216					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GCTTCTGATGCGGTGCGCAAC	0.547																																																	0													52.0	46.0	48.0					7																	98529082		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3646C>T	7.37:g.98529082C>T	ENSP00000352925:p.Arg1216Trp		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R1216W	ENST00000359863.4	37	c.3646	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923949	0.73213	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.66099	3.45;-0.19	6.06	3.67	0.42095	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.53029	0.1771	N	0.19112	0.55	0.58432	D	0.999999	D;B;D	0.69078	0.98;0.039;0.997	P;B;B	0.46975	0.533;0.007;0.409	T	0.57306	-0.7834	10	0.66056	D	0.02	.	14.9705	0.71229	0.4175:0.5825:0.0:0.0	.	1216;930;1216	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	W	1216;1216;1214	ENSP00000352925:R1216W;ENSP00000347733:R1216W	ENSP00000347733:R1216W	R	+	1	2	TRRAP	98367018	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	2.170000	0.42443	0.484000	0.27630	-0.271000	0.10264	CGG	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.547	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	40	0	C	NM_003496		98529082	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
TSKS	60385	genome.wustl.edu	37	19	50251727	50251727	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:50251727C>G	ENST00000246801.3	-	3	482		c.e3-1		TSKS_ENST00000358830.3_5'Flank	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate						negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		TGACCCCACTCTGGGGAAGAA	0.542																																																	0													80.0	68.0	72.0					19																	50251727		2203	4300	6503	SO:0001630	splice_region_variant	0			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.400-1G>C	19.37:g.50251727C>G			Q8WXJ0	Splice_Site	SNP	-	e3-1	ENST00000246801.3	37	c.400-1	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	C	18.30	3.592842	0.66219	.	.	ENSG00000126467	ENST00000246801	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9962	0.71433	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSKS	54943539	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.860000	0.55995	2.525000	0.85131	0.462000	0.41574	.	TSKS	-	-	ENSG00000126467		0.542	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	-	0.00	73	0	C	NM_021733	Intron	50251727	-1	tier1	-	no_errors	ENST00000246801	ensembl	human	known	74_37	splice_site	18.52	66	15	SNP	1.000	G
TTLL6	284076	genome.wustl.edu	37	17	46882291	46882291	+	Nonsense_Mutation	SNP	C	C	A	rs533233446	byFrequency	TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr17:46882291C>A	ENST00000393382.3	-	2	307	c.166G>T	c.(166-168)Gaa>Taa	p.E56*	TTLL6_ENST00000470462.2_5'Flank	NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						TCCTGGCTTTCCAAAGTCGGG	0.577											OREG0024527	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													71.0	64.0	66.0					17																	46882291		692	1591	2283	SO:0001587	stop_gained	0			AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.166G>T	17.37:g.46882291C>A	ENSP00000377043:p.Glu56*	942		Nonsense_Mutation	SNP	pfam_TTL/TTLL_fam	p.E56*	ENST00000393382.3	37	c.166	CCDS45724.1	17	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725815	0.48833	.	.	ENSG00000170703	ENST00000440941;ENST00000393382;ENST00000456415;ENST00000418322	.	.	.	5.08	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.5117	0.50496	0.0:0.8193:0.1807:0.0	.	.	.	.	X	56;8;8;58	.	ENSP00000365871:E8X	E	-	1	0	TTLL6	44237290	0.009000	0.17119	0.016000	0.15963	0.043000	0.13939	1.189000	0.32114	1.460000	0.47911	0.655000	0.94253	GAA	TTLL6	-	NULL	ENSG00000170703		0.577	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	HGNC	protein_coding	OTTHUMT00000346939.3	-	0.00	80	0	C	NM_173623		46882291	-1	tier1	-	no_errors	ENST00000393382	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	0.066	A
TTN	7273	genome.wustl.edu	37	2	179415774	179415774	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:179415774C>G	ENST00000591111.1	-	286	86785	c.86561G>C	c.(86560-86562)aGa>aCa	p.R28854T	TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R21430T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R27927T|TTN_ENST00000342175.6_Missense_Mutation_p.R21622T|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R21555T|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R30495T|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28854	Fibronectin type-III 110. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCAATTATTCTGAACTCATA	0.428																																																	0													80.0	76.0	77.0					2																	179415774		1889	4114	6003	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86561G>C	2.37:g.179415774C>G	ENSP00000465570:p.Arg28854Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R27927T	ENST00000591111.1	37	c.83780		2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.713786	0.89112	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	5.9	5.9	0.94986	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.81079	0.4748	M	0.86805	2.84	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.83056	-0.0150	9	0.87932	D	0	.	20.2787	0.98501	0.0:1.0:0.0:0.0	.	21430;21555;21622;28854	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	27927;21430;21622;21555;21427	ENSP00000343764:R27927T;ENSP00000434586:R21430T;ENSP00000340554:R21622T;ENSP00000352154:R21555T	ENSP00000340554:R21622T	R	-	2	0	TTN	179124020	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.798000	0.96311	0.650000	0.86243	AGA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	72	0	C	NM_133378		179415774	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	10.77	58	7	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179547519	179547519	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:179547519A>T	ENST00000591111.1	-	133	32272	c.32048T>A	c.(32047-32049)tTt>tAt	p.F10683Y	TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.F9756Y|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.F11000Y|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATACTCCTCAAATTCTTTATA	0.368																																																	0													254.0	232.0	239.0					2																	179547519		1840	4082	5922	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.32048T>A	2.37:g.179547519A>T	ENSP00000465570:p.Phe10683Tyr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.F9756Y	ENST00000591111.1	37	c.29267		2	.	.	.	.	.	.	.	.	.	.	A	1.784	-0.481174	0.04383	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T;T	0.68903	-0.36;-0.1	4.52	-9.04	0.00734	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.43100	0.1232	N	0.14661	0.345	0.24826	N	0.99256	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43458	-0.9390	9	0.87932	D	0	.	9.9834	0.41828	0.1412:0.0:0.1361:0.7227	.	10683;10419	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	Y	9756;614	ENSP00000343764:F9756Y;ENSP00000401501:F614Y	ENSP00000343764:F9756Y	F	-	2	0	TTN	179255764	0.121000	0.22262	0.482000	0.27366	0.778000	0.44026	-0.881000	0.04179	-1.752000	0.01325	-0.516000	0.04426	TTT	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	64	0	A	NM_133378		179547519	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	17.02	78	16	SNP	0.293	T
TTPA	7274	genome.wustl.edu	37	8	63985593	63985593	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:63985593G>T	ENST00000260116.4	-	2	290	c.259C>A	c.(259-261)Cta>Ata	p.L87I	TTPA_ENST00000521138.1_Intron	NM_000370.3	NP_000361.1	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	87					embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)	15	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	CTAGGGTGTAGATCTGCACTT	0.383																																																	0													117.0	118.0	118.0					8																	63985593		2203	4300	6503	SO:0001583	missense	0			BC058000	CCDS6178.1	8q12.3	2007-07-18	2007-07-16			ENSG00000137561			12404	protein-coding gene	gene with protein product		600415	"""ataxia (Friedreich-like) with vitamin E deficiency"""	AVED		7719340, 7887897	Standard	NM_000370		Approved		uc003xux.2	P49638		ENST00000260116.4:c.259C>A	8.37:g.63985593G>T	ENSP00000260116:p.Leu87Ile		Q71V64	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.L87I	ENST00000260116.4	37	c.259	CCDS6178.1	8	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636610	0.87760	.	.	ENSG00000137561	ENST00000260116	D	0.89415	-2.51	5.8	5.8	0.92144	Cellular retinaldehyde-binding/triple function, C-terminal (1);Phosphatidylinositol transfer protein-like, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91222	0.7234	M	0.63208	1.945	0.49915	D	0.999831	P	0.37141	0.584	P	0.51079	0.658	D	0.90768	0.4670	10	0.62326	D	0.03	.	11.0492	0.47876	0.1114:0.0:0.8886:0.0	.	87	P49638	TTPA_HUMAN	I	87	ENSP00000260116:L87I	ENSP00000260116:L87I	L	-	1	2	TTPA	64148147	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.744000	0.62118	2.736000	0.93811	0.643000	0.83706	CTA	TTPA	-	superfamily_CRAL/TRIO_N_dom	ENSG00000137561		0.383	TTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTPA	HGNC	protein_coding	OTTHUMT00000378460.1	-	0.00	38	0	G	NM_000370		63985593	-1	tier1	-	no_errors	ENST00000260116	ensembl	human	known	74_37	missense	28.95	27	11	SNP	1.000	T
TUBGCP3	10426	genome.wustl.edu	37	13	113212681	113212681	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr13:113212681G>T	ENST00000261965.3	-	5	563	c.377C>A	c.(376-378)gCc>gAc	p.A126D	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.A126D	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	126					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					GGTTGAGTGGGCATCTCTTGG	0.527																																																	0													125.0	118.0	120.0					13																	113212681		2203	4300	6503	SO:0001583	missense	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.377C>A	13.37:g.113212681G>T	ENSP00000261965:p.Ala126Asp		O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	pfam_TUBGCP	p.A126D	ENST00000261965.3	37	c.377	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793753	0.50102	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.26810	1.71;1.73	5.34	5.34	0.76211	.	0.164919	0.53938	D	0.000045	T	0.44008	0.1273	M	0.62723	1.935	0.58432	D	0.999997	P;D;P;P	0.58268	0.843;0.982;0.773;0.905	B;P;B;B	0.56751	0.202;0.805;0.232;0.322	T	0.11891	-1.0569	10	0.27082	T	0.32	-25.9783	19.1289	0.93397	0.0:0.0:1.0:0.0	.	116;126;126;126	B4DYP7;Q96CW5-3;Q96CW5-2;Q96CW5	.;.;.;GCP3_HUMAN	D	126	ENSP00000261965:A126D;ENSP00000364821:A126D	ENSP00000261965:A126D	A	-	2	0	TUBGCP3	112260682	1.000000	0.71417	0.919000	0.36401	0.348000	0.29142	6.930000	0.75858	2.513000	0.84729	0.543000	0.68304	GCC	TUBGCP3	-	NULL	ENSG00000126216		0.527	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	-	0.00	115	0	G	NM_006322		113212681	-1	tier1	-	no_errors	ENST00000261965	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.999	T
TULP2	7288	genome.wustl.edu	37	19	49385305	49385305	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:49385305G>T	ENST00000221399.3	-	12	1575	c.1431C>A	c.(1429-1431)atC>atA	p.I477I		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	477					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		TGGGATCCACGATTTGGAAGT	0.547																																																	0													134.0	108.0	117.0					19																	49385305		2203	4300	6503	SO:0001819	synonymous_variant	0			U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.1431C>A	19.37:g.49385305G>T			Q8TC50	Silent	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.I477	ENST00000221399.3	37	c.1431	CCDS12739.1	19																																																																																			TULP2	-	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C	ENSG00000104804		0.547	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP2	HGNC	protein_coding	OTTHUMT00000378633.1	-	0.00	158	0	G	NM_003323		49385305	-1	tier1	-	no_errors	ENST00000221399	ensembl	human	known	74_37	silent	21.74	72	20	SNP	0.064	T
UNC50	25972	genome.wustl.edu	37	2	99226460	99226460	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:99226460G>T	ENST00000357765.2	+	2	390	c.238G>T	c.(238-240)Gat>Tat	p.D80Y	COA5_ENST00000328709.3_5'Flank|UNC50_ENST00000409347.1_Missense_Mutation_p.D97Y|UNC50_ENST00000409975.1_Missense_Mutation_p.D97Y|COA5_ENST00000483527.1_5'Flank|COA5_ENST00000409997.1_5'Flank	NM_014044.5	NP_054763.2	Q53HI1	UNC50_HUMAN	unc-50 homolog (C. elegans)	80					cell surface receptor signaling pathway (GO:0007166)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)	RNA binding (GO:0003723)			breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)	10						GTGGGCCAGAGATGACCCTGC	0.428																																																	0													49.0	53.0	51.0					2																	99226460		2203	4300	6503	SO:0001583	missense	0				CCDS2035.1	2q12.2	2008-02-05			ENSG00000115446	ENSG00000115446			16046	protein-coding gene	gene with protein product						10980252	Standard	NM_014044		Approved	URP, UNCL, GMH1	uc002szc.4	Q53HI1	OTTHUMG00000130562	ENST00000357765.2:c.238G>T	2.37:g.99226460G>T	ENSP00000350409:p.Asp80Tyr		D3DVH4|Q53S98|Q53TD6|Q5U5U2|Q6X7B9|Q9UQF4|Q9Y4S6	Missense_Mutation	SNP	pfam_UNC-50	p.D97Y	ENST00000357765.2	37	c.289	CCDS2035.1	2	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739324	0.89573	.	.	ENSG00000115446	ENST00000357765;ENST00000409975;ENST00000409347	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.86393	0.5922	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89639	0.3861	9	0.87932	D	0	-6.7177	18.0646	0.89387	0.0:0.0:1.0:0.0	.	80	Q53HI1	UNC50_HUMAN	Y	80;97;97	.	ENSP00000350409:D80Y	D	+	1	0	UNC50	98592892	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.284000	0.95882	2.505000	0.84491	0.591000	0.81541	GAT	UNC50	-	pfam_UNC-50	ENSG00000115446		0.428	UNC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC50	HGNC	protein_coding	OTTHUMT00000252987.1	-	0.00	47	0	G	NM_014044		99226460	+1	tier1	-	no_errors	ENST00000409347	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
UPF2	26019	genome.wustl.edu	37	10	12071195	12071195	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:12071195G>A	ENST00000356352.2	-	2	1167	c.694C>T	c.(694-696)Cgt>Tgt	p.R232C	UPF2_ENST00000357604.5_Missense_Mutation_p.R232C|UPF2_ENST00000397053.2_Missense_Mutation_p.R232C			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	232	MIF4G 1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				TCAGCATAACGCTGGTGAAAG	0.423																																																	0													84.0	92.0	90.0					10																	12071195		2203	4300	6503	SO:0001583	missense	0			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.694C>T	10.37:g.12071195G>A	ENSP00000348708:p.Arg232Cys		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.R232C	ENST00000356352.2	37	c.694	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799736	0.70567	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000379172;ENST00000397053;ENST00000313977	T;T;T	0.24350	1.86;1.86;1.86	5.87	4.96	0.65561	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.000000	0.85682	D	0.000000	T	0.57888	0.2084	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.98	T	0.67795	-0.5578	10	0.87932	D	0	.	16.735	0.85444	0.0:0.0:0.8696:0.1304	.	202;232	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	C	232;232;202;232;202	ENSP00000348708:R232C;ENSP00000350221:R232C;ENSP00000380244:R232C	ENSP00000313617:R202C	R	-	1	0	UPF2	12111201	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	5.478000	0.66806	1.606000	0.50161	-0.182000	0.12963	CGT	UPF2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000151461		0.423	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1		0.00	54	0	G			12071195	-1			no_errors	ENST00000356352	ensembl	human	known	74_37	missense	5.71	32	2	SNP	1.000	A
USP11	8237	genome.wustl.edu	37	X	47101642	47101642	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chrX:47101642C>G	ENST00000218348.3	+	10	1470	c.1470C>G	c.(1468-1470)atC>atG	p.I490M	USP11_ENST00000377107.2_Missense_Mutation_p.I447M	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	490	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CACTGCCTATCAGCCACAAGA	0.582																																																	0													64.0	55.0	58.0					X																	47101642		2203	4300	6503	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1470C>G	X.37:g.47101642C>G	ENSP00000218348:p.Ile490Met		B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.I490M	ENST00000218348.3	37	c.1470	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	C	4.788	0.146509	0.09134	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.31247	1.5;1.5	5.6	2.68	0.31781	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.070871	0.56097	D	0.000033	T	0.20210	0.0486	N	0.12637	0.245	0.23834	N	0.996718	B;P	0.39022	0.0;0.655	B;P	0.46629	0.002;0.522	T	0.21177	-1.0253	10	0.08837	T	0.75	-13.961	10.6661	0.45731	0.0:0.557:0.3594:0.0837	.	217;490	B3KP28;P51784	.;UBP11_HUMAN	M	447;490	ENSP00000366311:I447M;ENSP00000218348:I490M	ENSP00000218348:I490M	I	+	3	3	USP11	46986586	0.995000	0.38212	1.000000	0.80357	0.982000	0.71751	0.463000	0.21972	0.538000	0.28769	0.600000	0.82982	ATC	USP11	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000102226		0.582	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		-	0.00	49	0	C	NM_004651		47101642	+1	tier1	-	no_errors	ENST00000218348	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	G
USP31	57478	genome.wustl.edu	37	16	23080832	23080832	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr16:23080832G>T	ENST00000219689.7	-	16	2593	c.2594C>A	c.(2593-2595)cCt>cAt	p.P865H	USP31_ENST00000567975.1_Missense_Mutation_p.P158H	NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GGACCATGAAGGTCTCATGCA	0.498																																																	0													47.0	41.0	43.0					16																	23080832		2197	4300	6497	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.2594C>A	16.37:g.23080832G>T	ENSP00000219689:p.Pro865His		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.P865H	ENST00000219689.7	37	c.2594	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	G	18.87	3.716170	0.68844	.	.	ENSG00000103404	ENST00000219689;ENST00000381162	T	0.10005	2.92	6.16	5.22	0.72569	.	0.305993	0.30510	N	0.009469	T	0.28566	0.0707	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.991;0.947;0.995	T	0.01156	-1.1434	10	0.62326	D	0.03	-10.746	14.6245	0.68611	0.069:0.0:0.931:0.0	.	168;865;158	Q70CQ4-2;Q70CQ4;B3KS48	.;UBP31_HUMAN;.	H	865;168	ENSP00000219689:P865H	ENSP00000219689:P865H	P	-	2	0	USP31	22988333	1.000000	0.71417	0.886000	0.34754	0.990000	0.78478	9.476000	0.97823	1.631000	0.50456	0.650000	0.86243	CCT	USP31	-	NULL	ENSG00000103404		0.498	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1		0.00	74	0	G	NM_020718		23080832	-1			no_errors	ENST00000219689	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.999	T
USP39	10713	genome.wustl.edu	37	2	85843346	85843346	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:85843346C>G	ENST00000323701.6	+	1	38	c.28C>G	c.(28-30)Cgc>Ggc	p.R10G	USP39_ENST00000409470.1_Missense_Mutation_p.R10G|USP39_ENST00000459775.1_Intron|USP39_ENST00000409766.3_Missense_Mutation_p.R10G|USP39_ENST00000450066.2_Intron|USP39_ENST00000409025.1_Missense_Mutation_p.R10G	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	10	Arg-rich.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						GCGGGAGTCTCGCGGTTCCAC	0.701																																																	0													7.0	8.0	8.0					2																	85843346		2167	4247	6414	SO:0001583	missense	0			AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.28C>G	2.37:g.85843346C>G	ENSP00000312981:p.Arg10Gly		A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R10G	ENST00000323701.6	37	c.28	CCDS33234.1	2	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927005	0.73327	.	.	ENSG00000168883	ENST00000409268;ENST00000409025;ENST00000409470;ENST00000323701;ENST00000409766	T;T;T;T	0.20200	2.11;2.4;2.4;2.09	5.27	5.27	0.74061	.	0.135356	0.34314	N	0.004070	T	0.13200	0.0320	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.30281	0.275;0.013;0.013;0.004	B;B;B;B	0.24974	0.057;0.011;0.011;0.011	T	0.07809	-1.0753	10	0.44086	T	0.13	-10.3015	14.2543	0.66040	0.0:1.0:0.0:0.0	.	10;10;10;10	G5E9H0;B3KM40;B9A018;Q53GS9	.;.;.;SNUT2_HUMAN	G	10	ENSP00000386572:R10G;ENSP00000386864:R10G;ENSP00000312981:R10G;ENSP00000386803:R10G	ENSP00000312981:R10G	R	+	1	0	USP39	85696857	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	3.601000	0.54059	2.746000	0.94184	0.561000	0.74099	CGC	USP39	-	NULL	ENSG00000168883		0.701	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	USP39	HGNC	protein_coding	OTTHUMT00000329892.1	-	0.00	34	0	C	NM_006590		85843346	+1	tier1	-	no_errors	ENST00000409470	ensembl	human	known	74_37	missense	10.91	49	6	SNP	0.999	G
VAPA	9218	genome.wustl.edu	37	18	9945046	9945046	+	Intron	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr18:9945046G>A	ENST00000400000.2	+	5	672				VAPA_ENST00000584796.1_Intron|VAPA_ENST00000340541.4_Silent_p.E181E	NM_003574.5|NM_194434.2	NP_003565.4|NP_919415.2	Q9P0L0	VAPA_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa						cell death (GO:0008219)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein localization to endoplasmic reticulum (GO:0070972)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein heterodimerization activity (GO:0046982)|signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(1)|lung(2)|prostate(1)	4						TGAAACAGGAGAAACAGAAGG	0.433																																																	0													129.0	116.0	120.0					18																	9945046		1904	4121	6025	SO:0001627	intron_variant	0				CCDS11847.2, CCDS11848.2	18p11.2	2008-07-28	2002-08-29		ENSG00000101558	ENSG00000101558			12648	protein-coding gene	gene with protein product		605703	"""VAMP (vesicle-associated membrane protein)-associated protein A (33kD)"""			9920726, 9657962	Standard	NM_003574		Approved	hVAP-33, VAP-A	uc002koj.3	Q9P0L0	OTTHUMG00000131603	ENST00000400000.2:c.418-5346G>A	18.37:g.9945046G>A			A6NDZ0|D3DUI3|O75453|Q5U0E7|Q9UBZ2	Silent	SNP	pfam_MSP_dom,superfamily_PapD-like,pirsf_Vesicle-associated_membrane,pfscan_MSP_dom	p.E181	ENST00000400000.2	37	c.543	CCDS11848.2	18																																																																																			VAPA	-	pirsf_Vesicle-associated_membrane	ENSG00000101558		0.433	VAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAPA	HGNC	protein_coding	OTTHUMT00000254490.1	-	0.00	90	0	G			9945046	+1	tier1	-	no_errors	ENST00000340541	ensembl	human	known	74_37	silent	10.11	80	9	SNP	1.000	A
VPS54	51542	genome.wustl.edu	37	2	64211108	64211108	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:64211108G>A	ENST00000272322.4	-	2	180	c.26C>T	c.(25-27)cCa>cTa	p.P9L	VPS54_ENST00000409558.4_Missense_Mutation_p.P9L			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	9					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TTGAGGCACTGGTGAAGAACT	0.408																																																	0													129.0	128.0	128.0					2																	64211108		2203	4300	6503	SO:0001583	missense	0			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.26C>T	2.37:g.64211108G>A	ENSP00000272322:p.Pro9Leu		Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	pfam_Vps54,pfam_Vacuolar_sorting-assoc_54	p.P9L	ENST00000272322.4	37	c.26	CCDS33208.1	2	.	.	.	.	.	.	.	.	.	.	G	16.19	3.053652	0.55218	.	.	ENSG00000143952	ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T	0.32515	1.45;1.46	5.76	5.76	0.90799	.	0.097256	0.64402	D	0.000001	T	0.20981	0.0505	N	0.16478	0.41	0.80722	D	1	B;B	0.13594	0.005;0.008	B;B	0.13407	0.004;0.009	T	0.03202	-1.1061	10	0.44086	T	0.13	.	13.1933	0.59723	0.0725:0.0:0.9275:0.0	.	9;9	Q9P1Q0;Q9P1Q0-4	VPS54_HUMAN;.	L	9	ENSP00000272322:P9L;ENSP00000386980:P9L	ENSP00000272322:P9L	P	-	2	0	VPS54	64064612	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.298000	0.72763	2.722000	0.93159	0.650000	0.86243	CCA	VPS54	-	NULL	ENSG00000143952		0.408	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS54	HGNC	protein_coding	OTTHUMT00000327062.2	-	0.00	35	0	G	NM_016516		64211108	-1	tier1	-	no_errors	ENST00000272322	ensembl	human	known	74_37	missense	21.05	30	8	SNP	1.000	A
WBSCR28	135886	genome.wustl.edu	37	7	73279612	73279612	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:73279612G>T	ENST00000320531.2	+	2	398	c.362G>T	c.(361-363)gGc>gTc	p.G121V		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	121						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				GAGCAGCTGGGCCTGTCTGTG	0.612																																																	0													57.0	57.0	57.0					7																	73279612		2147	4247	6394	SO:0001583	missense	0			BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.362G>T	7.37:g.73279612G>T	ENSP00000316775:p.Gly121Val		Q6UE04|Q8NHP4	Missense_Mutation	SNP	NULL	p.G121V	ENST00000320531.2	37	c.362	CCDS43597.1	7	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890844	0.52014	.	.	ENSG00000175877	ENST00000320531	T	0.36878	1.23	4.48	4.48	0.54585	.	0.000000	0.46758	D	0.000280	T	0.47266	0.1436	L	0.32530	0.975	0.22639	N	0.998908	D	0.76494	0.999	D	0.78314	0.991	T	0.32375	-0.9909	10	0.87932	D	0	-10.2027	12.5946	0.56461	0.0:0.0:1.0:0.0	.	121	Q6UE05	WBS28_HUMAN	V	121	ENSP00000316775:G121V	ENSP00000316775:G121V	G	+	2	0	WBSCR28	72917548	0.924000	0.31332	0.021000	0.16686	0.030000	0.12068	2.535000	0.45685	2.341000	0.79615	0.650000	0.86243	GGC	WBSCR28	-	NULL	ENSG00000175877		0.612	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR28	HGNC	protein_coding	OTTHUMT00000348130.1	-	0.00	51	0	G	NM_182504		73279612	+1	tier1	-	no_errors	ENST00000320531	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.052	T
WDR31	114987	genome.wustl.edu	37	9	116085328	116085328	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:116085328G>A	ENST00000374193.4	-	6	678	c.432C>T	c.(430-432)ggC>ggT	p.G144G	WDR31_ENST00000341761.4_Silent_p.G143G|WDR31_ENST00000374195.3_Silent_p.G19G|WDR31_ENST00000461942.1_5'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	144										NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						CCATGGCATGGCCACACAATT	0.532																																																	0													108.0	90.0	96.0					9																	116085328		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.432C>T	9.37:g.116085328G>A			Q5W0T9|Q96EG8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G144	ENST00000374193.4	37	c.432	CCDS35110.1	9																																																																																			WDR31	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000148225		0.532	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR31	HGNC	protein_coding	OTTHUMT00000053734.2	-	0.00	84	0	G	NM_145241		116085328	-1	tier1	-	no_errors	ENST00000374193	ensembl	human	known	74_37	silent	21.15	41	11	SNP	1.000	A
XPO5	57510	genome.wustl.edu	37	6	43528002	43528002	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:43528002G>A	ENST00000265351.7	-	11	1344	c.1134C>T	c.(1132-1134)ctC>ctT	p.L378L	XPO5_ENST00000424378.2_5'Flank|RP3-337H4.10_ENST00000607635.1_RNA	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	378					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			CATGCCTGAAGAGGGCTCCCC	0.378																																																	0													54.0	50.0	51.0					6																	43528002		1839	4072	5911	SO:0001819	synonymous_variant	0			AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.1134C>T	6.37:g.43528002G>A			Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Silent	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.L378	ENST00000265351.7	37	c.1134	CCDS47430.1	6																																																																																			XPO5	-	superfamily_ARM-type_fold	ENSG00000124571		0.378	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	HGNC	protein_coding	OTTHUMT00000040657.2	-	0.00	108	0	G	NM_020750		43528002	-1	tier1	-	no_errors	ENST00000265351	ensembl	human	known	74_37	silent	22.08	60	17	SNP	0.863	A
YTHDF1	54915	genome.wustl.edu	37	20	61834342	61834342	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr20:61834342T>A	ENST00000370339.3	-	4	1291	c.950A>T	c.(949-951)tAt>tTt	p.Y317F	YTHDF1_ENST00000370333.4_Missense_Mutation_p.Y267F|YTHDF1_ENST00000370334.4_Intron	NM_017798.3	NP_060268.2	Q9BYJ9	YTHD1_HUMAN	YTH domain family, member 1	317	Gln/Pro-rich.						N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)	24						AGGGCTCTGATACTGCGGTTG	0.672																																																	0													24.0	29.0	27.0					20																	61834342		2198	4284	6482	SO:0001583	missense	0			AK000398	CCDS13511.1	20q13.33	2010-03-15	2004-11-16	2004-06-04	ENSG00000149658	ENSG00000149658			15867	protein-coding gene	gene with protein product			"""YTH domain family 1"""	C20orf21			Standard	NM_017798		Approved	FLJ20391	uc002yeh.3	Q9BYJ9	OTTHUMG00000032955	ENST00000370339.3:c.950A>T	20.37:g.61834342T>A	ENSP00000359364:p.Tyr317Phe		Q8N3G5|Q8TBT1|Q96AN4|Q96S57|Q9BTI7|Q9NX79	Missense_Mutation	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.Y317F	ENST00000370339.3	37	c.950	CCDS13511.1	20	.	.	.	.	.	.	.	.	.	.	T	3.250	-0.153467	0.06585	.	.	ENSG00000149658	ENST00000370339;ENST00000370333;ENST00000342761	T;T	0.44881	0.91;0.91	4.7	4.7	0.59300	.	0.804488	0.12293	N	0.481854	T	0.40347	0.1113	L	0.57536	1.79	0.36478	D	0.867641	B	0.20671	0.047	B	0.22386	0.039	T	0.38520	-0.9657	10	0.11182	T	0.66	-5.0832	14.4695	0.67506	0.0:0.0:0.0:1.0	.	317	Q9BYJ9	YTHD1_HUMAN	F	317;267;133	ENSP00000359364:Y317F;ENSP00000359358:Y267F	ENSP00000339489:Y133F	Y	-	2	0	YTHDF1	61304787	1.000000	0.71417	0.550000	0.28217	0.149000	0.21700	5.985000	0.70556	1.889000	0.54706	0.472000	0.43445	TAT	YTHDF1	-	NULL	ENSG00000149658		0.672	YTHDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF1	HGNC	protein_coding	OTTHUMT00000080110.2	-	0.00	44	0	T	NM_017798		61834342	-1	tier1	-	no_errors	ENST00000370339	ensembl	human	known	74_37	missense	17.39	57	12	SNP	1.000	A
YTHDF3	253943	genome.wustl.edu	37	8	64124829	64124829	+	3'UTR	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:64124829C>G	ENST00000517371.1	+	0	2948				YTHDF3_ENST00000542911.2_3'UTR|YTHDF3_ENST00000539294.1_3'UTR|YTHDF3_ENST00000521674.1_3'UTR			Q7Z739	YTHD3_HUMAN	YTH domain family, member 3								N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			TAGTATTTCTCTATACGTATT	0.259																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000517371.1:c.*2565C>G	8.37:g.64124829C>G			B3KXL4|Q63Z37|Q659A3	RNA	SNP	-	NULL	ENST00000517371.1	37	NULL		8																																																																																			YTHDF3	-	-	ENSG00000185728		0.259	YTHDF3-010	PUTATIVE	basic	protein_coding	YTHDF3	HGNC	protein_coding	OTTHUMT00000378466.4	-	0.00	83	0	C	NM_152758		64124829	+1	tier1	-	no_errors	ENST00000521674	ensembl	human	known	74_37	rna	25.29	64	22	SNP	1.000	G
YWHAQ	10971	genome.wustl.edu	37	2	9770479	9770479	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr2:9770479C>T	ENST00000381844.4	-	1	266	c.103G>A	c.(103-105)Gag>Aag	p.E35K	YWHAQ_ENST00000238081.3_Missense_Mutation_p.E35K			P27348	1433T_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta	35					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|small GTPase mediated signal transduction (GO:0007264)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|protein complex (GO:0043234)	protein N-terminus binding (GO:0047485)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		TTGGACAGCTCGGCGCCCTGC	0.642																																																	0													43.0	42.0	42.0					2																	9770479		2203	4300	6503	SO:0001583	missense	0			AF070556	CCDS1666.1	2p25.2-p25.1	2013-12-03	2013-12-03		ENSG00000134308	ENSG00000134308			12854	protein-coding gene	gene with protein product	"""protein tau"""	609009	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide"""			11080204	Standard	NM_006826		Approved	HS1, 14-3-3	uc002qzx.3	P27348	OTTHUMG00000013848	ENST00000381844.4:c.103G>A	2.37:g.9770479C>T	ENSP00000371267:p.Glu35Lys		D6W4Z5|Q567U5|Q5TZU8|Q9UP48	Missense_Mutation	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.E35K	ENST00000381844.4	37	c.103	CCDS1666.1	2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980998	0.74474	.	.	ENSG00000134308	ENST00000238081;ENST00000381844;ENST00000446619	T;T;T	0.46819	0.86;0.86;0.86	5.2	4.33	0.51752	14-3-3 domain (4);	0.076618	0.50627	N	0.000119	T	0.45597	0.1350	L	0.58925	1.835	0.50813	D	0.999895	B	0.24426	0.103	B	0.20955	0.032	T	0.46775	-0.9167	10	0.87932	D	0	.	13.6769	0.62460	0.0:0.9252:0.0:0.0748	.	35	P27348	1433T_HUMAN	K	35	ENSP00000238081:E35K;ENSP00000371267:E35K;ENSP00000398990:E35K	ENSP00000238081:E35K	E	-	1	0	YWHAQ	9687930	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.644000	0.83416	1.185000	0.42971	0.491000	0.48974	GAG	YWHAQ	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	ENSG00000134308		0.642	YWHAQ-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YWHAQ	HGNC	protein_coding	OTTHUMT00000039014.4	-	0.00	40	0	C	NM_006826		9770479	-1	tier1	-	no_errors	ENST00000238081	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	T
ZEB1	6935	genome.wustl.edu	37	10	31791292	31791292	+	Silent	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr10:31791292C>T	ENST00000320985.10	+	4	446	c.336C>T	c.(334-336)tgC>tgT	p.C112C	ZEB1_ENST00000560721.2_Silent_p.C92C|ZEB1_ENST00000361642.5_Silent_p.C113C|ZEB1_ENST00000446923.2_Silent_p.C96C|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000542815.3_Silent_p.C45C			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	112					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.C112C(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				ATGATGAATGCGAGTCAGATG	0.338																																					Ovarian(40;423 959 14296 36701 49589)												1	Substitution - coding silent(1)	large_intestine(1)											95.0	87.0	90.0					10																	31791292		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.336C>T	10.37:g.31791292C>T			B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.C113	ENST00000320985.10	37	c.339	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	C	9.843	1.191691	0.21954	.	.	ENSG00000148516	ENST00000543514	.	.	.	5.92	-4.35	0.03656	.	.	.	.	.	T	0.69566	0.3125	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.74830	-0.3531	5	0.87932	D	0	-10.5085	13.9391	0.64043	0.0:0.2781:0.0:0.7219	.	.	.	.	V	4	.	ENSP00000443742:A4V	A	+	2	0	ZEB1	31831298	0.691000	0.27709	0.986000	0.45419	0.998000	0.95712	-0.181000	0.09740	-0.731000	0.04862	0.650000	0.86243	GCG	ZEB1	-	NULL	ENSG00000148516		0.338	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2		0.00	75	0	C	NM_030751		31791292	+1			no_errors	ENST00000361642	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.990	T
ZFP37	7539	genome.wustl.edu	37	9	115812134	115812134	+	Missense_Mutation	SNP	G	G	T	rs142182003		TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:115812134G>T	ENST00000374227.3	-	2	178	c.151C>A	c.(151-153)Cct>Act	p.P51T	ZFP37_ENST00000553380.1_Missense_Mutation_p.P66T|ZFP37_ENST00000555206.1_Missense_Mutation_p.P52T	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CTCTGAGCAGGATCCAGTTGC	0.413																																																	0													216.0	174.0	189.0					9																	115812134		2203	4300	6503	SO:0001583	missense	0			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.151C>A	9.37:g.115812134G>T	ENSP00000363344:p.Pro51Thr		A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P66T	ENST00000374227.3	37	c.196	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	G	16.19	3.051724	0.55218	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.02472	4.28;4.28;4.28	3.82	2.93	0.34026	Krueppel-associated box (4);	0.000000	0.41823	D	0.000820	T	0.05410	0.0143	L	0.58101	1.795	0.31857	N	0.621493	P;P;P	0.41420	0.705;0.705;0.749	B;B;P	0.45195	0.342;0.342;0.473	T	0.04961	-1.0915	10	0.44086	T	0.13	-7.623	10.0303	0.42096	0.1028:0.0:0.8972:0.0	.	52;66;51	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	T	51;52;66	ENSP00000363344:P51T;ENSP00000451310:P52T;ENSP00000452552:P66T	ENSP00000363344:P51T	P	-	1	0	ZFP37	114851955	0.880000	0.30214	1.000000	0.80357	0.773000	0.43773	0.670000	0.25157	1.199000	0.43173	0.555000	0.69702	CCT	ZFP37	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000136866		0.413	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	-	0.00	88	0	G	NM_003408		115812134	-1	tier1	-	no_errors	ENST00000553380	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
ZFP37	7539	genome.wustl.edu	37	9	115812183	115812183	+	Intron	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr9:115812183G>C	ENST00000374227.3	-	2	160				ZFP37_ENST00000553380.1_Missense_Mutation_p.F49L|ZFP37_ENST00000555206.1_Intron	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TCACATGTTTGAATGTTACTG	0.403																																																	0													140.0	114.0	123.0					9																	115812183		2203	4300	6503	SO:0001627	intron_variant	0			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.133-31C>G	9.37:g.115812183G>C			A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F49L	ENST00000374227.3	37	c.147	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685976	0.47991	.	.	ENSG00000136866	ENST00000553380	T	0.07114	3.22	3.8	1.96	0.26148	.	.	.	.	.	T	0.05456	0.0144	.	.	.	0.20563	N	0.999882	B	0.09022	0.002	B	0.11329	0.006	T	0.43540	-0.9385	7	.	.	.	.	8.5026	0.33168	0.1761:0.0:0.8239:0.0	.	49	Q9Y6Q3-2	.	L	49	ENSP00000452552:F49L	.	F	-	3	2	ZFP37	114852004	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	1.187000	0.32090	0.602000	0.29896	0.549000	0.68633	TTC	ZFP37	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000136866		0.403	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	-	0.00	58	0	G	NM_003408		115812183	-1	tier1	-	no_errors	ENST00000553380	ensembl	human	known	74_37	missense	18.97	47	11	SNP	1.000	C
ZIM3	114026	genome.wustl.edu	37	19	57647388	57647388	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:57647388G>A	ENST00000269834.1	-	5	702	c.317C>T	c.(316-318)tCa>tTa	p.S106L	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CTTATTGATTGATGGGACTTC	0.408																																																	0													184.0	181.0	182.0					19																	57647388		2203	4300	6503	SO:0001583	missense	0			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.317C>T	19.37:g.57647388G>A	ENSP00000269834:p.Ser106Leu		Q14CA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S106L	ENST00000269834.1	37	c.317	CCDS33125.1	19	.	.	.	.	.	.	.	.	.	.	G	8.192	0.796139	0.16327	.	.	ENSG00000141946	ENST00000269834	T	0.04603	3.59	2.18	2.18	0.27775	.	.	.	.	.	T	0.03390	0.0098	L	0.27053	0.805	0.09310	N	1	P	0.39216	0.664	B	0.33295	0.161	T	0.44174	-0.9345	9	0.21014	T	0.42	.	10.0512	0.42216	0.0:0.0:1.0:0.0	.	106	Q96PE6	ZIM3_HUMAN	L	106	ENSP00000269834:S106L	ENSP00000269834:S106L	S	-	2	0	ZIM3	62339200	0.000000	0.05858	0.003000	0.11579	0.198000	0.23893	-0.233000	0.09041	1.523000	0.49018	0.313000	0.20887	TCA	ZIM3	-	NULL	ENSG00000141946		0.408	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM3	HGNC	protein_coding	OTTHUMT00000465078.1	-	0.00	90	0	G			57647388	-1	tier1	-	no_errors	ENST00000269834	ensembl	human	known	74_37	missense	9.86	127	14	SNP	0.002	A
ZMYM6	9204	genome.wustl.edu	37	1	35480750	35480750	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:35480750G>C	ENST00000357182.4	-	5	669	c.442C>G	c.(442-444)Cct>Gct	p.P148A	ZMYM6_ENST00000373340.2_Missense_Mutation_p.P148A|ZMYM6_ENST00000487874.1_Missense_Mutation_p.P148A|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	148					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				ACATCCTTAGGATTTAAAATG	0.333																																																	0													40.0	39.0	39.0					1																	35480750		2203	4300	6503	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.442C>G	1.37:g.35480750G>C	ENSP00000349708:p.Pro148Ala		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.P148A	ENST00000357182.4	37	c.442	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047309	0.55110	.	.	ENSG00000163867	ENST00000373340;ENST00000357182;ENST00000415531	T;T;T	0.33438	1.9;3.03;1.41	4.27	3.33	0.38152	TRASH (1);Zinc finger, MYM-type (1);	0.199708	0.43579	D	0.000549	T	0.47783	0.1464	M	0.63428	1.95	0.39504	D	0.968243	D;D	0.63046	0.989;0.992	D;P	0.67103	0.949;0.886	T	0.44892	-0.9298	10	0.20046	T	0.44	-4.2054	14.3011	0.66352	0.0:0.1498:0.8502:0.0	.	148;148	O95789;O95789-1	ZMYM6_HUMAN;.	A	148	ENSP00000362437:P148A;ENSP00000349708:P148A;ENSP00000391337:P148A	ENSP00000349708:P148A	P	-	1	0	ZMYM6	35253337	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.734000	0.55037	1.109000	0.41680	0.467000	0.42956	CCT	ZMYM6	-	pfam_Znf_MYM,smart_TRASH_dom	ENSG00000163867		0.333	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	48	0	G	NM_007167		35480750	-1	tier1	-	no_errors	ENST00000357182	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	C
ZMYM6	9204	genome.wustl.edu	37	1	35480759	35480759	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:35480759T>C	ENST00000357182.4	-	5	660	c.433A>G	c.(433-435)Att>Gtt	p.I145V	ZMYM6_ENST00000373340.2_Missense_Mutation_p.I145V|ZMYM6_ENST00000487874.1_Missense_Mutation_p.I145V|ZMYM6_ENST00000493328.1_5'UTR	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	145					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				GGATTTAAAATGTCTCTAAAA	0.348																																																	0													33.0	33.0	33.0					1																	35480759		2203	4298	6501	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.433A>G	1.37:g.35480759T>C	ENSP00000349708:p.Ile145Val		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.I145V	ENST00000357182.4	37	c.433	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	T	19.77	3.890209	0.72524	.	.	ENSG00000163867	ENST00000373340;ENST00000357182;ENST00000415531	T;T;T	0.39406	1.34;2.37;1.08	4.27	4.27	0.50696	TRASH (1);Zinc finger, MYM-type (1);	0.000000	0.85682	D	0.000000	T	0.64271	0.2583	M	0.79475	2.455	0.58432	D	0.999998	D;D	0.71674	0.998;0.998	D;D	0.87578	0.994;0.998	T	0.68700	-0.5339	10	0.56958	D	0.05	-16.6544	13.8421	0.63446	0.0:0.0:0.0:1.0	.	145;145	O95789;O95789-1	ZMYM6_HUMAN;.	V	145	ENSP00000362437:I145V;ENSP00000349708:I145V;ENSP00000391337:I145V	ENSP00000349708:I145V	I	-	1	0	ZMYM6	35253346	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.751000	0.62169	1.927000	0.55829	0.383000	0.25322	ATT	ZMYM6	-	pfam_Znf_MYM,smart_TRASH_dom	ENSG00000163867		0.348	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	46	0	T	NM_007167		35480759	-1	tier1	-	no_errors	ENST00000357182	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	C
ZMYND12	84217	genome.wustl.edu	37	1	42902173	42902173	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:42902173C>G	ENST00000372565.3	-	5	905	c.636G>C	c.(634-636)agG>agC	p.R212S	ZMYND12_ENST00000433602.2_Missense_Mutation_p.R102S|ZMYND12_ENST00000475426.1_5'Flank	NM_032257.4	NP_115633.3	Q9H0C1	ZMY12_HUMAN	zinc finger, MYND-type containing 12	212						intracellular (GO:0005622)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|skin(2)	17	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTCCTGAAGTCCTAATGTCCT	0.423																																																	0													114.0	109.0	110.0					1																	42902173		2203	4300	6503	SO:0001583	missense	0			AK057384	CCDS467.1	1p34.1	2008-02-05			ENSG00000066185	ENSG00000066185		"""Zinc fingers, MYND-type"""	21192	protein-coding gene	gene with protein product						11230166	Standard	NM_032257		Approved	DKFZp434N2435	uc001chj.3	Q9H0C1	OTTHUMG00000007333	ENST00000372565.3:c.636G>C	1.37:g.42902173C>G	ENSP00000361646:p.Arg212Ser		Q5VUS6|Q8TC87|Q96M51	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.R212S	ENST00000372565.3	37	c.636	CCDS467.1	1	.	.	.	.	.	.	.	.	.	.	C	14.38	2.517454	0.44763	.	.	ENSG00000066185	ENST00000372565;ENST00000433602	T;T	0.62498	0.02;0.02	5.88	1.49	0.22878	Tetratricopeptide-like helical (1);	0.338379	0.37095	N	0.002259	T	0.44414	0.1292	L	0.54323	1.7	0.30460	N	0.774415	P;P	0.36144	0.539;0.473	B;B	0.35688	0.208;0.056	T	0.37686	-0.9695	10	0.06757	T	0.87	-8.061	3.0568	0.06187	0.2969:0.4205:0.0:0.2826	.	102;212	E9PFV0;Q9H0C1	.;ZMY12_HUMAN	S	212;102	ENSP00000361646:R212S;ENSP00000398340:R102S	ENSP00000361646:R212S	R	-	3	2	ZMYND12	42674760	0.997000	0.39634	1.000000	0.80357	0.857000	0.48899	0.261000	0.18442	0.834000	0.34852	0.655000	0.94253	AGG	ZMYND12	-	NULL	ENSG00000066185		0.423	ZMYND12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND12	HGNC	protein_coding	OTTHUMT00000019170.1	-	0.00	93	0	C	NM_032257		42902173	-1	tier1	-	no_errors	ENST00000372565	ensembl	human	known	74_37	missense	7.22	90	7	SNP	1.000	G
ZNF117	51351	genome.wustl.edu	37	7	64438943	64438943	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:64438943C>G	ENST00000282869.6	-	4	2290	c.1006G>C	c.(1006-1008)Gag>Cag	p.E336Q		NM_015852.3	NP_056936.2	Q03924	ZN117_HUMAN	zinc finger protein 117	336					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(1)|skin(1)	22		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CCACATTCCTCACATTTGTAG	0.368																																																	0													45.0	48.0	47.0					7																	64438943		2141	4260	6401	SO:0001583	missense	0			M27879	CCDS43593.1	7q11.2	2013-01-08	2006-06-12		ENSG00000152926	ENSG00000152926		"""Zinc fingers, C2H2-type"""	12897	protein-coding gene	gene with protein product		194624	"""zinc finger protein 117 (HPF9)"""			1427907	Standard	NM_015852		Approved	HPF9, H-plk	uc003ttr.2	Q03924	OTTHUMG00000156631	ENST00000282869.6:c.1006G>C	7.37:g.64438943C>G	ENSP00000282869:p.Glu336Gln		Q02313|Q7Z7Q7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E336Q	ENST00000282869.6	37	c.1006	CCDS43593.1	7	.	.	.	.	.	.	.	.	.	.	.	11.02	1.517243	0.27123	.	.	ENSG00000152926	ENST00000398695;ENST00000282869	T	0.07444	3.19	1.11	-0.927	0.10451	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07052	0.0179	N	0.25789	0.76	0.09310	N	1	B	0.30763	0.294	B	0.40410	0.328	T	0.44174	-0.9345	9	0.72032	D	0.01	.	1.668	0.02805	0.2914:0.2748:0.0:0.4337	.	336	Q03924	ZN117_HUMAN	Q	336	ENSP00000282869:E336Q	ENSP00000282869:E336Q	E	-	1	0	ZNF117	64076378	0.000000	0.05858	0.010000	0.14722	0.008000	0.06430	-2.842000	0.00737	-0.307000	0.08804	0.313000	0.20887	GAG	ZNF117	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152926		0.368	ZNF117-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF117	HGNC	protein_coding	OTTHUMT00000344863.3		0.00	96	0	C	NM_024498		64438943	-1			no_errors	ENST00000282869	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.133	G
ZNF184	7738	genome.wustl.edu	37	6	27420279	27420279	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:27420279C>G	ENST00000211936.6	-	6	1343	c.1059G>C	c.(1057-1059)caG>caC	p.Q353H	ZNF184_ENST00000377419.1_Missense_Mutation_p.Q353H	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						TATGAATTTTCTGATGTTCCA	0.393																																																	0													52.0	51.0	51.0					6																	27420279		2203	4300	6503	SO:0001583	missense	0			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1059G>C	6.37:g.27420279C>G	ENSP00000211936:p.Gln353His		B2R715|O60792|Q8TBA9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q353H	ENST00000211936.6	37	c.1059	CCDS4624.1	6	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778597	0.49786	.	.	ENSG00000096654	ENST00000211936;ENST00000377419;ENST00000341087;ENST00000538681	T;T	0.18502	2.21;2.21	5.12	5.12	0.69794	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45126	D	0.000397	T	0.15739	0.0379	M	0.64997	1.995	0.40487	D	0.980501	P	0.41008	0.735	B	0.43301	0.415	T	0.00934	-1.1509	10	0.48119	T	0.1	.	16.1059	0.81220	0.0:1.0:0.0:0.0	.	353	Q99676	ZN184_HUMAN	H	353;353;353;41	ENSP00000211936:Q353H;ENSP00000366636:Q353H	ENSP00000211936:Q353H	Q	-	3	2	ZNF184	27528258	0.183000	0.23186	1.000000	0.80357	0.997000	0.91878	0.804000	0.27098	2.660000	0.90430	0.557000	0.71058	CAG	ZNF184	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000096654		0.393	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF184	HGNC	protein_coding	OTTHUMT00000040146.1	-	0.00	87	0	C	NM_007149		27420279	-1	tier1	-	no_errors	ENST00000211936	ensembl	human	known	74_37	missense	14.29	102	17	SNP	1.000	G
ZNF283	284349	genome.wustl.edu	37	19	44351849	44351849	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:44351849C>A	ENST00000324461.7	+	7	1393	c.1096C>A	c.(1096-1098)Cag>Aag	p.Q366K	ZNF283_ENST00000588797.1_Missense_Mutation_p.Q227K	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	366					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TACTCAGCATCAGAAAATCCA	0.378																																																	0													80.0	95.0	90.0					19																	44351849		2169	4284	6453	SO:0001583	missense	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1096C>A	19.37:g.44351849C>A	ENSP00000327314:p.Gln366Lys		B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q366K	ENST00000324461.7	37	c.1096	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	C	8.447	0.852095	0.17034	.	.	ENSG00000167637	ENST00000324461	T	0.07216	3.21	2.99	0.686	0.18015	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04003	0.0112	N	0.11673	0.155	0.48511	D	0.999667	B	0.20164	0.042	B	0.15870	0.014	T	0.41161	-0.9524	9	0.45353	T	0.12	.	5.6393	0.17554	0.0:0.4915:0.3871:0.1214	.	366	Q8N7M2	ZN283_HUMAN	K	366	ENSP00000327314:Q366K	ENSP00000327314:Q366K	Q	+	1	0	ZNF283	49043689	0.066000	0.20996	0.861000	0.33841	0.701000	0.40568	1.010000	0.29898	0.103000	0.17682	-0.502000	0.04539	CAG	ZNF283	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167637		0.378	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1		0.00	113	0	C	NM_181845		44351849	+1			no_errors	ENST00000324461	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.715	A
ZNF292	23036	genome.wustl.edu	37	6	87969973	87969973	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr6:87969973C>T	ENST00000369577.3	+	8	6669	c.6626C>T	c.(6625-6627)gCt>gTt	p.A2209V	ZNF292_ENST00000339907.4_Missense_Mutation_p.A2204V	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2209						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AGTATGACTGCTTCAGTGGAT	0.383																																																	0													169.0	169.0	169.0					6																	87969973		1874	4098	5972	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6626C>T	6.37:g.87969973C>T	ENSP00000358590:p.Ala2209Val		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A2209V	ENST00000369577.3	37	c.6626	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	15.02	2.710182	0.48517	.	.	ENSG00000188994	ENST00000369577;ENST00000339907;ENST00000496806	T;T;T	0.48522	3.18;3.19;0.81	5.42	4.5	0.54988	.	0.424075	0.28176	N	0.016310	T	0.17916	0.0430	N	0.14661	0.345	0.29241	N	0.872653	B	0.17038	0.02	B	0.16722	0.016	T	0.11916	-1.0568	10	0.51188	T	0.08	.	14.929	0.70900	0.1437:0.8562:0.0:0.0	.	2209	O60281	ZN292_HUMAN	V	2209;2204;127	ENSP00000358590:A2209V;ENSP00000342847:A2204V;ENSP00000428857:A127V	ENSP00000342847:A2204V	A	+	2	0	ZNF292	88026692	0.772000	0.28567	1.000000	0.80357	0.993000	0.82548	3.665000	0.54532	2.541000	0.85698	0.591000	0.81541	GCT	ZNF292	-	NULL	ENSG00000188994		0.383	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	59	0	C	NM_015021		87969973	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.808	T
ZNF384	171017	genome.wustl.edu	37	12	6787385	6787385	+	Silent	SNP	C	C	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:6787385C>G	ENST00000396801.3	-	6	801	c.594G>C	c.(592-594)cgG>cgC	p.R198R	ZNF384_ENST00000319770.3_Silent_p.R182R|ZNF384_ENST00000396795.1_Silent_p.R198R|ZNF384_ENST00000355772.4_Silent_p.R143R|ZNF384_ENST00000396799.2_Silent_p.R198R|ZNF384_ENST00000361959.3_Silent_p.R198R	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	198					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						ATTCCAGCATCCGCTTCTTCT	0.577			T	"""EWSR1, TAF15 """	ALL																																			Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	0													103.0	102.0	103.0					12																	6787385		2203	4300	6503	SO:0001819	synonymous_variant	0			U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.594G>C	12.37:g.6787385C>G			O15407|Q7Z722|Q8N938	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R198	ENST00000396801.3	37	c.594	CCDS44817.1	12																																																																																			ZNF384	-	NULL	ENSG00000126746		0.577	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF384	HGNC	protein_coding	OTTHUMT00000400712.1		0.00	49	0	C			6787385	-1			no_errors	ENST00000361959	ensembl	human	known	74_37	silent	9.68	28	3	SNP	1.000	G
ZNF395	55893	genome.wustl.edu	37	8	28210186	28210186	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr8:28210186G>T	ENST00000344423.5	-	6	955	c.824C>A	c.(823-825)tCt>tAt	p.S275Y	ZNF395_ENST00000523095.1_Missense_Mutation_p.S275Y|ZNF395_ENST00000523202.1_Missense_Mutation_p.S275Y	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395	275					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.S275F(1)		cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CACCTTCACAGAGTTCTACAG	0.527																																																	1	Substitution - Missense(1)	lung(1)											141.0	120.0	127.0					8																	28210186		2203	4300	6503	SO:0001583	missense	0			AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.824C>A	8.37:g.28210186G>T	ENSP00000340494:p.Ser275Tyr		B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.S275Y	ENST00000344423.5	37	c.824	CCDS6067.1	8	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319857	0.81469	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	T;T;T	0.63580	-0.05;-0.05;-0.05	5.27	5.27	0.74061	.	0.056860	0.64402	D	0.000001	T	0.80341	0.4605	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82950	-0.0203	10	0.72032	D	0.01	-21.5064	16.4092	0.83701	0.0:0.0:1.0:0.0	.	275	Q9H8N7	ZN395_HUMAN	Y	275	ENSP00000340494:S275Y;ENSP00000429640:S275Y;ENSP00000428452:S275Y	ENSP00000340494:S275Y	S	-	2	0	ZNF395	28266105	1.000000	0.71417	0.952000	0.39060	0.744000	0.42396	9.593000	0.98250	2.466000	0.83321	0.561000	0.74099	TCT	ZNF395	-	NULL	ENSG00000186918		0.527	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF395	HGNC	protein_coding	OTTHUMT00000219976.1		0.00	79	0	G			28210186	-1			no_errors	ENST00000344423	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
ZNF436	80818	genome.wustl.edu	37	1	23688650	23688650	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr1:23688650G>A	ENST00000314011.4	-	4	1361	c.1225C>T	c.(1225-1227)Cag>Tag	p.Q409*	ZNF436_ENST00000374608.3_Nonsense_Mutation_p.Q409*	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TGGGTTCTCTGATGTTTAATT	0.473																																																	0													104.0	110.0	108.0					1																	23688650		2203	4300	6503	SO:0001587	stop_gained	0			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.1225C>T	1.37:g.23688650G>A	ENSP00000313582:p.Gln409*		Q658I9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q409*	ENST00000314011.4	37	c.1225	CCDS233.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.341960	0.95783	.	.	ENSG00000125945	ENST00000314011;ENST00000374608	.	.	.	6.17	6.17	0.99709	.	0.000000	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-37.2412	18.3732	0.90420	0.0:0.0:1.0:0.0	.	.	.	.	X	409	.	ENSP00000313582:Q409X	Q	-	1	0	ZNF436	23561237	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.873000	0.48475	2.941000	0.99782	0.655000	0.94253	CAG	ZNF436	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000125945		0.473	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF436	HGNC	protein_coding	OTTHUMT00000008908.1	-	0.00	70	0	G	NM_030634		23688650	-1	tier1	-	no_errors	ENST00000314011	ensembl	human	known	74_37	nonsense	10.59	76	9	SNP	1.000	A
ZNF559	84527	genome.wustl.edu	37	19	9449954	9449954	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:9449954G>C	ENST00000393883.2	+	4	767	c.119G>C	c.(118-120)aGa>aCa	p.R40T	ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000585352.1_Missense_Mutation_p.R40T|ZNF559_ENST00000587557.1_Missense_Mutation_p.R104T|ZNF177_ENST00000446085.4_Intron|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000592896.1_Missense_Mutation_p.R68T|ZNF559_ENST00000586255.1_Missense_Mutation_p.R68T|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000317221.7_Missense_Mutation_p.R40T|ZNF559_ENST00000538743.1_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.R40T|ZNF559_ENST00000592504.1_Missense_Mutation_p.R40T	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	40	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						AACTTATACAGAGATGTGATG	0.413																																																	0													195.0	174.0	181.0					19																	9449954		2203	4300	6503	SO:0001583	missense	0			AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.119G>C	19.37:g.9449954G>C	ENSP00000377461:p.Arg40Thr		K7EMG6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R40T	ENST00000393883.2	37	c.119	CCDS12211.1	19	.	.	.	.	.	.	.	.	.	.	G	14.49	2.549646	0.45383	.	.	ENSG00000188321	ENST00000317221;ENST00000393883	T;T	0.02709	4.19;4.19	2.32	1.28	0.21552	Krueppel-associated box (4);	.	.	.	.	T	0.15219	0.0367	M	0.93978	3.48	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.00509	-1.1698	9	0.54805	T	0.06	.	4.3099	0.10965	0.3322:0.0:0.6678:0.0	.	40	Q9BR84	ZN559_HUMAN	T	40	ENSP00000325393:R40T;ENSP00000377461:R40T	ENSP00000325393:R40T	R	+	2	0	ZNF559	9310954	0.852000	0.29690	0.992000	0.48379	0.937000	0.57800	0.336000	0.19823	0.536000	0.28733	0.313000	0.20887	AGA	ZNF559	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000188321		0.413	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF559	HGNC	protein_coding	OTTHUMT00000449021.1	-	0.00	139	0	G	NM_032497		9449954	+1	tier1	-	no_errors	ENST00000393883	ensembl	human	known	74_37	missense	11.03	129	16	SNP	0.998	C
ZNF44	51710	genome.wustl.edu	37	19	12383473	12383473	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:12383473C>T	ENST00000356109.5	-	5	1859	c.1741G>A	c.(1741-1743)Gaa>Aaa	p.E581K	ZNF44_ENST00000355684.5_Missense_Mutation_p.E533K	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		TGCTTACATTCATATGGCTTC	0.403																																																	0													48.0	52.0	50.0					19																	12383473		2180	4294	6474	SO:0001583	missense	0			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.1741G>A	19.37:g.12383473C>T	ENSP00000348419:p.Glu581Lys		B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E581K	ENST00000356109.5	37	c.1741	CCDS54223.1	19	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901034	0.52227	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.19250	2.16;2.16;2.16	0.955	-0.258	0.12975	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15176	0.0366	N	0.02674	-0.535	.	.	.	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	T	0.24368	-1.0162	8	0.26408	T	0.33	.	4.2656	0.10761	0.2342:0.2987:0.4671:0.0	.	581;533	P15621;F8W7T7	ZNF44_HUMAN;.	K	581;581;533;533	ENSP00000377008:E581K;ENSP00000348419:E581K;ENSP00000347910:E533K	ENSP00000347910:E533K	E	-	1	0	ZNF44	12244473	0.000000	0.05858	0.003000	0.11579	0.970000	0.65996	-2.860000	0.00726	-0.020000	0.14032	0.305000	0.20034	GAA	ZNF44	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197857		0.403	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF44	HGNC	protein_coding	OTTHUMT00000344132.1	-	0.00	69	0	C	NM_016264		12383473	-1	tier1	-	no_errors	ENST00000393337	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.003	T
ZNF626	199777	genome.wustl.edu	37	19	20807474	20807474	+	Silent	SNP	G	G	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:20807474G>T	ENST00000601440.1	-	4	1355	c.1209C>A	c.(1207-1209)ggC>ggA	p.G403G	CTC-513N18.7_ENST00000595094.1_lincRNA	NM_001076675.2	NP_001070143.1	Q68DY1	ZN626_HUMAN	zinc finger protein 626	403					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|lung(3)|skin(1)	6						TAAAAGCTTTGCCACATTCTT	0.398																																																	0													58.0	62.0	61.0					19																	20807474		2152	4276	6428	SO:0001819	synonymous_variant	0			BC007116	CCDS32976.1, CCDS42535.1	19p13.11	2013-01-08				ENSG00000188171		"""Zinc fingers, C2H2-type"", ""-"""	30461	protein-coding gene	gene with protein product						12477932	Standard	NM_145297		Approved		uc002npb.1	Q68DY1		ENST00000601440.1:c.1209C>A	19.37:g.20807474G>T			Q8N8T4|Q96QM1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G403	ENST00000601440.1	37	c.1209	CCDS42535.1	19																																																																																			ZNF626	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188171		0.398	ZNF626-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF626	HGNC	protein_coding	OTTHUMT00000447845.2		0.00	87	0	G	NM_145297		20807474	-1			no_errors	ENST00000601440	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.970	T
ZNF655	79027	genome.wustl.edu	37	7	99171528	99171528	+	3'UTR	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr7:99171528A>G	ENST00000394163.2	+	0	1980				ZNF655_ENST00000424881.1_3'UTR|ZNF655_ENST00000252713.4_3'UTR|ZNF655_ENST00000419215.2_3'UTR|GS1-259H13.10_ENST00000455905.1_Intron|GS1-259H13.10_ENST00000486324.1_Intron|ZNF655_ENST00000425063.1_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655						negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					TCACATGGGAATAAAATTCCA	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.*321A>G	7.37:g.99171528A>G			A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	RNA	SNP	-	NULL	ENST00000394163.2	37	NULL	CCDS5669.1	7																																																																																			ZNF655	-	-	ENSG00000197343		0.313	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	-	0.00	60	0	A	NM_138494		99171528	+1	tier1	-	no_errors	ENST00000419215	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.078	G
ZNF676	163223	genome.wustl.edu	37	19	22363273	22363273	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:22363273T>C	ENST00000397121.2	-	3	1563	c.1246A>G	c.(1246-1248)Act>Gct	p.T416A		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TTCTCTCCAGTATGAATTCTC	0.433																																																	0																																										SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1246A>G	19.37:g.22363273T>C	ENSP00000380310:p.Thr416Ala		A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T416A	ENST00000397121.2	37	c.1246	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	9.100	1.003959	0.19199	.	.	ENSG00000196109	ENST00000397121	T	0.26518	1.73	0.81	-1.62	0.08372	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17534	0.0421	L	0.37561	1.115	0.27220	N	0.959679	B	0.23650	0.089	B	0.24006	0.05	T	0.32079	-0.9920	9	0.66056	D	0.02	.	5.3966	0.16273	0.0:0.0:0.2782:0.7218	.	416	Q8N7Q3	ZN676_HUMAN	A	416	ENSP00000380310:T416A	ENSP00000380310:T416A	T	-	1	0	ZNF676	22155113	0.088000	0.21588	0.095000	0.20976	0.095000	0.18619	0.149000	0.16243	0.156000	0.19299	0.155000	0.16302	ACT	ZNF676	-	pfscan_Znf_C2H2	ENSG00000196109		0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	69	0	T	NM_001001411		22363273	-1	tier1	rs77927748	no_errors	ENST00000397121	ensembl	human	known	74_37	missense	10.71	75	9	SNP	1.000	C
ZNF676	163223	genome.wustl.edu	37	19	22363286	22363286	+	Silent	SNP	A	A	G			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:22363286A>G	ENST00000397121.2	-	3	1550	c.1233T>C	c.(1231-1233)caT>caC	p.H411H		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GAATTCTCTTATGTTCCATGA	0.428																																																	0													71.0	74.0	73.0					19																	22363286		2119	4256	6375	SO:0001819	synonymous_variant	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1233T>C	19.37:g.22363286A>G			A8MVX5	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H411	ENST00000397121.2	37	c.1233	CCDS42539.1	19																																																																																			ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.428	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	76	0	A	NM_001001411		22363286	-1	tier1	rs78144725	no_errors	ENST00000397121	ensembl	human	known	74_37	silent	11.24	79	10	SNP	0.208	G
ZNF705A	440077	genome.wustl.edu	37	12	8329832	8329832	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr12:8329832C>T	ENST00000359286.4	+	5	645	c.556C>T	c.(556-558)Cgc>Tgc	p.R186C	FAM66C_ENST00000544214.1_RNA|FAM66C_ENST00000456135.2_RNA|FAM66C_ENST00000454799.2_RNA	NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	186			R -> H (in dbSNP:rs11043758).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		TAATTGCTTTCGCCTTAGACG	0.388																																																	0													86.0	87.0	86.0					12																	8329832		2198	4290	6488	SO:0001583	missense	0			AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.556C>T	12.37:g.8329832C>T	ENSP00000352233:p.Arg186Cys			Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R186C	ENST00000359286.4	37	c.556	CCDS31737.1	12	.	.	.	.	.	.	.	.	.	.	.	1.393	-0.580312	0.03854	.	.	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.08102	3.13;3.13	1.35	-1.48	0.08745	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03390	0.0098	N	0.20530	0.585	0.09310	N	1	P	0.35050	0.482	B	0.20384	0.029	T	0.41752	-0.9491	8	.	.	.	.	3.1487	0.06480	0.5658:0.2536:0.1806:0.0	.	186	Q6ZN79	Z705A_HUMAN	C	186	ENSP00000379816:R186C;ENSP00000352233:R186C	.	R	+	1	0	ZNF705A	8221099	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.219000	0.02973	-0.408000	0.07565	-0.755000	0.03482	CGC	ZNF705A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196946		0.388	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF705A	HGNC	protein_coding	OTTHUMT00000400449.1		0.00	271	0	C	NM_001004328		8329832	+1			no_errors	ENST00000359286	ensembl	human	known	74_37	missense	5.58	220	13	SNP	0.000	T
ZNF792	126375	genome.wustl.edu	37	19	35451802	35451802	+	Silent	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:35451802G>A	ENST00000404801.1	-	2	516	c.130C>T	c.(130-132)Ctg>Ttg	p.L44L	ZNF792_ENST00000605484.1_5'Flank	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	44	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			AAGTTTTCCAGCATCACATCG	0.572																																					GBM(1;7 183 21053 22581 22847)												0													148.0	141.0	143.0					19																	35451802		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.130C>T	19.37:g.35451802G>A			B4E333|Q495L1|Q495L3|Q8N932	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L44	ENST00000404801.1	37	c.130	CCDS12440.2	19																																																																																			ZNF792	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000180884		0.572	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF792	HGNC	protein_coding	OTTHUMT00000317673.1	-	0.00	151	0	G	NM_175872		35451802	-1	tier1	-	no_errors	ENST00000404801	ensembl	human	known	74_37	silent	11.11	96	12	SNP	1.000	A
ZNF850	342892	genome.wustl.edu	37	19	37238823	37238823	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NQ-01A-11D-A36J-09	TCGA-L5-A8NQ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	bedbcf17-d6e0-440f-9220-39b66b81492a	3e5cde29-49bf-4b79-89c3-ebe736c6c733	g.chr19:37238823G>A	ENST00000591344.1	-	5	3277	c.3119C>T	c.(3118-3120)cCg>cTg	p.P1040L	ZNF850_ENST00000589390.1_Intron	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850	1040					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CCCACATTCCGGACATTGATA	0.438																																																	0																																										SO:0001583	missense	0			BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14		ENST00000591344.1:c.3119C>T	19.37:g.37238823G>A	ENSP00000464976:p.Pro1040Leu			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P1040L	ENST00000591344.1	37	c.3119	CCDS59379.1	19																																																																																			ZNF850	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267041		0.438	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF850	HGNC	protein_coding	OTTHUMT00000453557.1	-	0.00	94	0	G	XM_001720258		37238823	-1	tier1	-	no_errors	ENST00000591344	ensembl	human	known	74_37	missense	14.29	66	11	SNP	0.002	A
