#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA13	154664	genome.wustl.edu	37	7	48685035	48685035	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:48685035delA	ENST00000435803.1	+	62	15128	c.15104delA	c.(15103-15105)gagfs	p.E5035fs	ABCA13_ENST00000544596.1_Frame_Shift_Del_p.E765fs	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	5035					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTGCTTCTGAGCAGCAGCAA	0.358																																																	0													62.0	58.0	59.0					7																	48685035		1943	4160	6103	SO:0001589	frameshift_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.15104delA	7.37:g.48685035delA	ENSP00000411096:p.Glu5035fs		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E5035fs	ENST00000435803.1	37	c.15104	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.358	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2		0.00	57	0	A	NM_152701		48685035	+1	tier1		no_errors	ENST00000435803	ensembl	human	known	74_37	frame_shift_del	35.19	35	19	DEL	0.961	-
ABCB1	5243	genome.wustl.edu	37	7	87150134	87150134	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:87150134T>G	ENST00000265724.3	-	23	3161	c.2744A>C	c.(2743-2745)aAg>aCg	p.K915T	ABCB1_ENST00000488737.2_5'UTR|ABCB1_ENST00000543898.1_Missense_Mutation_p.K851T	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	915	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ATGTTCAAACTTCTGCTCCTG	0.413																																																	0													132.0	122.0	126.0					7																	87150134		2203	4300	6503	SO:0001583	missense	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2744A>C	7.37:g.87150134T>G	ENSP00000265724:p.Lys915Thr		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.K915T	ENST00000265724.3	37	c.2744	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	T	10.83	1.460035	0.26248	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.90069	-2.61;-2.61	5.28	4.13	0.48395	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.045379	0.85682	D	0.000000	D	0.88396	0.6425	L	0.35593	1.075	0.51012	D	0.999907	B;D	0.53885	0.003;0.963	B;D	0.75020	0.077;0.985	D	0.83935	0.0308	10	0.24483	T	0.36	-16.6982	5.1519	0.15015	0.1329:0.1469:0.0:0.7202	.	851;915	B5AK60;P08183	.;MDR1_HUMAN	T	696;915;851	ENSP00000265724:K915T;ENSP00000444095:K851T	ENSP00000265724:K915T	K	-	2	0	ABCB1	86988070	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.222000	0.32515	0.849000	0.35215	0.533000	0.62120	AAG	ABCB1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000085563		0.413	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	-	0.00	79	0	T	NM_000927		87150134	-1	tier1	-	no_errors	ENST00000265724	ensembl	human	known	74_37	missense	60.00	16	24	SNP	1.000	G
ABCC4	10257	genome.wustl.edu	37	13	95830267	95830267	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr13:95830267G>A	ENST00000376887.4	-	12	1738	c.1624C>T	c.(1624-1626)Cgg>Tgg	p.R542W	ABCC4_ENST00000536256.1_Missense_Mutation_p.R467W|ABCC4_ENST00000412704.1_Missense_Mutation_p.R542W|ABCC4_ENST00000431522.1_Missense_Mutation_p.R542W|ABCC4_ENST00000538287.1_3'UTR	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	542	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	AGGTTTACCCGTGCTTTCTGC	0.498																																																	0													161.0	133.0	142.0					13																	95830267		2203	4300	6503	SO:0001583	missense	0			U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1624C>T	13.37:g.95830267G>A	ENSP00000366084:p.Arg542Trp		A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM	p.R542W	ENST00000376887.4	37	c.1624	CCDS9474.1	13	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703146	0.48412	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.93763	-3.28;-3.28;-2.59;-3.28	5.8	4.93	0.64822	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.98124	0.9381	H	0.98802	4.335	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.98786	1.0734	10	0.87932	D	0	.	14.7244	0.69332	0.0:0.0:0.7423:0.2577	.	467;542;542;542;542	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	W	542;542;467;542	ENSP00000388657:R542W;ENSP00000366084:R542W;ENSP00000442024:R467W;ENSP00000398562:R542W	ENSP00000366084:R542W	R	-	1	2	ABCC4	94628268	1.000000	0.71417	0.971000	0.41717	0.224000	0.24922	2.967000	0.49216	2.735000	0.93741	0.655000	0.94253	CGG	ABCC4	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000125257		0.498	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC4	HGNC	protein_coding	OTTHUMT00000045478.2	-	0.00	81	0	G	NM_005845		95830267	-1	tier1	-	no_errors	ENST00000376887	ensembl	human	known	74_37	missense	14.29	48	8	SNP	0.856	A
ACAN	176	genome.wustl.edu	37	15	89395210	89395210	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:89395210A>G	ENST00000561243.1	+	10	2212	c.2212A>G	c.(2212-2214)Aac>Gac	p.N738D	ACAN_ENST00000352105.7_Missense_Mutation_p.N738D|ACAN_ENST00000559004.1_Missense_Mutation_p.N738D|ACAN_ENST00000439576.2_Missense_Mutation_p.N738D			P16112	PGCA_HUMAN	aggrecan	737	KS.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CGAGCCAGAAAACCAGACAGA	0.582																																																	0													33.0	41.0	39.0					15																	89395210		1997	4170	6167	SO:0001583	missense	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2212A>G	15.37:g.89395210A>G	ENSP00000453342:p.Asn738Asp		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.N738D	ENST00000561243.1	37	c.2212	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	A	15.80	2.940069	0.52972	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02369	4.56;4.32	5.77	5.77	0.91146	.	0.462300	0.16129	N	0.228263	T	0.05914	0.0154	M	0.63843	1.955	0.29992	N	0.816829	P;P	0.46395	0.877;0.877	B;B	0.43194	0.411;0.411	T	0.21177	-1.0253	10	0.23302	T	0.38	-11.4568	14.9055	0.70715	1.0:0.0:0.0:0.0	.	738;738	E7ENV9;E7EX88	.;.	D	738	ENSP00000387356:N738D;ENSP00000341615:N738D	ENSP00000268134:N738D	N	+	1	0	ACAN	87196214	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	5.769000	0.68865	2.207000	0.71202	0.418000	0.28097	AAC	ACAN	-	superfamily_C-type_lectin_fold	ENSG00000157766		0.582	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	-	0.00	73	0	A	NM_001135		89395210	+1	tier1	-	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	G
ACSL5	51703	genome.wustl.edu	37	10	114158683	114158683	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:114158683C>T	ENST00000393081.1	+	3	488	c.181C>T	c.(181-183)Cag>Tag	p.Q61*	ACSL5_ENST00000356116.1_Nonsense_Mutation_p.Q117*|ACSL5_ENST00000433418.1_Nonsense_Mutation_p.Q61*|ACSL5_ENST00000479936.1_3'UTR|ACSL5_ENST00000354273.4_Nonsense_Mutation_p.Q61*|ACSL5_ENST00000354655.4_Nonsense_Mutation_p.Q61*	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	61					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		GGGGGTTTCCCAGAAGAACAA	0.458																																																	0													171.0	144.0	153.0					10																	114158683		2203	4300	6503	SO:0001587	stop_gained	0			AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.181C>T	10.37:g.114158683C>T	ENSP00000376796:p.Gln61*		A6GV77|D3DRB3|Q6UX44|Q9UIU4	Nonsense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.Q117*	ENST00000393081.1	37	c.349	CCDS7573.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.617298	0.96649	.	.	ENSG00000197142	ENST00000354655;ENST00000393081;ENST00000356116;ENST00000433418;ENST00000354273	.	.	.	5.07	3.16	0.36331	.	0.194838	0.43260	D	0.000595	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-4.2237	14.4999	0.67714	0.0:0.7197:0.2802:0.0	.	.	.	.	X	61;61;117;61;61	.	ENSP00000346223:Q61X	Q	+	1	0	ACSL5	114148673	0.277000	0.24220	0.451000	0.26982	0.277000	0.26821	0.708000	0.25719	0.605000	0.29947	0.555000	0.69702	CAG	ACSL5	-	NULL	ENSG00000197142		0.458	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSL5	HGNC	protein_coding	OTTHUMT00000050386.1	-	0.00	60	0	C	NM_016234		114158683	+1	tier1	-	no_errors	ENST00000356116	ensembl	human	known	74_37	nonsense	34.38	41	22	SNP	0.768	T
ACTN2	88	genome.wustl.edu	37	1	236917335	236917335	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:236917335C>A	ENST00000366578.4	+	16	2094	c.1928C>A	c.(1927-1929)gCt>gAt	p.A643D	ACTN2_ENST00000542672.1_Missense_Mutation_p.A643D|ACTN2_ENST00000546208.1_Missense_Mutation_p.A137D	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	643					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			CGCCAGTTTGCTGCCCAAGCC	0.602																																																	0													50.0	52.0	52.0					1																	236917335		2203	4300	6503	SO:0001583	missense	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1928C>A	1.37:g.236917335C>A	ENSP00000355537:p.Ala643Asp		B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A643D	ENST00000366578.4	37	c.1928	CCDS1613.1	1	.	.	.	.	.	.	.	.	.	.	c	32	5.188733	0.94923	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.52754	0.65;0.65;0.65	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.74581	0.3735	M	0.87682	2.9	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	T	0.79366	-0.1833	10	0.87932	D	0	.	19.2097	0.93748	0.0:1.0:0.0:0.0	.	428;643;413;643	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	D	643;643;137;412	ENSP00000443495:A643D;ENSP00000355537:A643D;ENSP00000438384:A137D	ENSP00000355537:A643D	A	+	2	0	ACTN2	234983958	1.000000	0.71417	0.976000	0.42696	0.948000	0.59901	7.727000	0.84838	2.535000	0.85469	0.645000	0.84053	GCT	ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.602	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	-	0.00	44	0	C	NM_001103		236917335	+1	tier1	-	no_errors	ENST00000366578	ensembl	human	known	74_37	missense	52.94	24	27	SNP	1.000	A
ADAM6	8755	genome.wustl.edu	37	14	106437867	106437867	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:106437867C>T	ENST00000452053.1	-	0	491					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		CACGTGTCGACGGTGACCATG	0.562																																																	0																																												0			AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106437867C>T				RNA	SNP	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			ADAM6	-	-	ENSG00000233988		0.562	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	HGNC	lincRNA	OTTHUMT00000325881.1	-	0.00	37	0	C	NR_002224		106437867	-1	tier1	-	no_errors	ENST00000452053	ensembl	human	known	74_37	rna	41.86	25	18	SNP	0.153	T
ADAM7	8756	genome.wustl.edu	37	8	24326334	24326334	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:24326334G>T	ENST00000175238.6	+	7	716		c.e7+1		RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Splice_Site	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TGATACTGTGGTAAGTTTTCA	0.323																																																	0													224.0	206.0	212.0					8																	24326334		2203	4300	6503	SO:0001630	splice_region_variant	0			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.633+1G>T	8.37:g.24326334G>T			A8K8X7|O75959|Q6PEJ6	Splice_Site	SNP	-	e7+1	ENST00000175238.6	37	c.633+1	CCDS6045.1	8	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800348	0.31869	.	.	ENSG00000069206	ENST00000175238;ENST00000380789	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4121	0.67121	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM7	24382224	1.000000	0.71417	1.000000	0.80357	0.230000	0.25150	4.063000	0.57499	2.767000	0.95098	0.563000	0.77884	.	ADAM7	-	-	ENSG00000069206		0.323	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	HGNC	protein_coding	OTTHUMT00000215150.1	-	0.00	96	0	G	NM_003817	Intron	24326334	+1	tier1	-	no_errors	ENST00000175238	ensembl	human	known	74_37	splice_site	66.67	11	22	SNP	1.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33576644	33576644	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:33576644T>C	ENST00000504830.1	-	19	3822	c.3487A>G	c.(3487-3489)Aga>Gga	p.R1163G	ADAMTS12_ENST00000504582.1_5'Flank|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.R1078G	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1163	Spacer 2.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GGCTGTTCTCTTTCTTCCCCT	0.463										HNSCC(64;0.19)																																							0													170.0	155.0	160.0					5																	33576644		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.3487A>G	5.37:g.33576644T>C	ENSP00000422554:p.Arg1163Gly		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1163G	ENST00000504830.1	37	c.3487	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	T	2.482	-0.319472	0.05386	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.58506	0.33;0.33	5.18	1.42	0.22433	.	1.018500	0.07785	N	0.953960	T	0.31358	0.0794	N	0.04508	-0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.19386	-1.0307	10	0.25751	T	0.34	.	5.1698	0.15105	0.0:0.1579:0.1518:0.6903	.	1078;1163	P58397-3;P58397	.;ATS12_HUMAN	G	1163;1078	ENSP00000422554:R1163G;ENSP00000344847:R1078G	ENSP00000344847:R1078G	R	-	1	2	ADAMTS12	33612401	0.732000	0.28121	0.001000	0.08648	0.285000	0.27093	1.371000	0.34250	0.093000	0.17368	0.533000	0.62120	AGA	ADAMTS12	-	NULL	ENSG00000151388		0.463	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	26	0	T	NM_030955		33576644	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.003	C
ADCY2	108	genome.wustl.edu	37	5	7707876	7707876	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:7707876G>T	ENST00000338316.4	+	9	1415	c.1326G>T	c.(1324-1326)gaG>gaT	p.E442D	RP11-711G10.1_ENST00000514105.2_RNA|ADCY2_ENST00000537121.1_Missense_Mutation_p.E262D	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	442					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ATAAAGTGGAGGAGGGAGATG	0.403																																																	0													128.0	127.0	127.0					5																	7707876		2203	4300	6503	SO:0001583	missense	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1326G>T	5.37:g.7707876G>T	ENSP00000342952:p.Glu442Asp		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E442D	ENST00000338316.4	37	c.1326	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351971	0.82132	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.81739	-1.53;-1.53	5.96	-0.763	0.11030	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.85682	D	0.000000	D	0.86932	0.6052	M	0.80616	2.505	0.35202	D	0.774409	D;D	0.67145	0.965;0.996	P;D	0.70016	0.88;0.967	D	0.88082	0.2807	10	0.87932	D	0	.	10.1998	0.43075	0.5905:0.0:0.4095:0.0	.	262;442	B7Z2C1;Q08462	.;ADCY2_HUMAN	D	442;293;262	ENSP00000342952:E442D;ENSP00000444803:E262D	ENSP00000342952:E442D	E	+	3	2	ADCY2	7760876	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	1.864000	0.39469	-0.057000	0.13199	0.650000	0.86243	GAG	ADCY2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase	ENSG00000078295		0.403	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2		0.00	60	0	G	NM_020546		7707876	+1			no_errors	ENST00000338316	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.991	T
ADAMTS2	9509	genome.wustl.edu	37	5	178540976	178540976	+	Silent	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:178540976T>C	ENST00000251582.7	-	22	3629	c.3528A>G	c.(3526-3528)ccA>ccG	p.P1176P		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1176					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TTAGGTTGGGTGGCTGGACTT	0.502																																																	0													220.0	213.0	215.0					5																	178540976		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3528A>G	5.37:g.178540976T>C				Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.P1176	ENST00000251582.7	37	c.3528	CCDS4444.1	5																																																																																			ADAMTS2	-	NULL	ENSG00000087116		0.502	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	113	0	T	NM_014244		178540976	-1	tier1	-	no_errors	ENST00000251582	ensembl	human	known	74_37	silent	32.47	52	25	SNP	0.479	C
ADCY7	113	genome.wustl.edu	37	16	50342659	50342659	+	Missense_Mutation	SNP	G	G	T	rs557056202		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:50342659G>T	ENST00000394697.2	+	17	2357	c.2017G>T	c.(2017-2019)Gtc>Ttc	p.V673F	ADCY7_ENST00000537579.1_3'UTR|ADCY7_ENST00000566433.2_Missense_Mutation_p.V673F|ADCY7_ENST00000538642.1_Missense_Mutation_p.V673F|ADCY7_ENST00000254235.3_Missense_Mutation_p.V673F			P51828	ADCY7_HUMAN	adenylate cyclase 7	673					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		GACCCTGGCCGTCCTGACCAT	0.647																																																	0													52.0	48.0	49.0					16																	50342659		2198	4300	6498	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.2017G>T	16.37:g.50342659G>T	ENSP00000378187:p.Val673Phe		A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V673F	ENST00000394697.2	37	c.2017	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	G	9.796	1.179221	0.21787	.	.	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000254235	T;D;D	0.82619	0.81;-1.63;-1.63	5.27	-0.775	0.10988	.	0.817887	0.10184	U	0.705471	D	0.84220	0.5424	M	0.63843	1.955	0.27005	N	0.964818	B;P	0.50272	0.015;0.933	B;P	0.52823	0.018;0.71	T	0.74484	-0.3650	10	0.25751	T	0.34	.	11.5183	0.50536	0.3843:0.0:0.6157:0.0	.	673;673	P51828;F5H4D1	ADCY7_HUMAN;.	F	673	ENSP00000445046:V673F;ENSP00000378187:V673F;ENSP00000254235:V673F	ENSP00000254235:V673F	V	+	1	0	ADCY7	48900160	0.228000	0.23718	0.011000	0.14972	0.495000	0.33615	0.672000	0.25187	-0.326000	0.08564	-1.134000	0.01955	GTC	ADCY7	-	NULL	ENSG00000121281		0.647	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3		0.00	110	0	G			50342659	+1			no_errors	ENST00000254235	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.074	T
ADCY8	114	genome.wustl.edu	37	8	131964145	131964145	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:131964145G>A	ENST00000286355.5	-	3	3302	c.1210C>T	c.(1210-1212)Cgg>Tgg	p.R404W	RP11-737F9.1_ENST00000523318.1_RNA|ADCY8_ENST00000377928.3_Missense_Mutation_p.R404W	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	404					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATGTAGATCCGATGGAACTGG	0.527										HNSCC(32;0.087)																																							0													179.0	134.0	149.0					8																	131964145		2203	4300	6503	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.1210C>T	8.37:g.131964145G>A	ENSP00000286355:p.Arg404Trp			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R404W	ENST00000286355.5	37	c.1210	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	G	19.48	3.835664	0.71373	.	.	ENSG00000155897	ENST00000286355;ENST00000377928;ENST00000522949	D;D;D	0.84873	-1.91;-1.91;-1.91	5.22	1.79	0.24919	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.181563	0.46442	D	0.000289	T	0.81517	0.4839	L	0.46157	1.445	0.31537	N	0.660458	D;D	0.61080	0.975;0.989	B;P	0.45428	0.303;0.48	T	0.83249	-0.0054	10	0.87932	D	0	.	12.5809	0.56390	0.0:0.0:0.3261:0.6739	.	404;404	E7EVL1;P40145	.;ADCY8_HUMAN	W	404;404;19	ENSP00000286355:R404W;ENSP00000367161:R404W;ENSP00000428010:R19W	ENSP00000286355:R404W	R	-	1	2	ADCY8	132033327	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	2.510000	0.45468	0.630000	0.30394	-0.181000	0.13052	CGG	ADCY8	-	superfamily_A/G_cyclase,smart_A/G_cyclase	ENSG00000155897		0.527	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	48	0	G			131964145	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	missense	46.97	35	31	SNP	0.996	A
ADRA2B	151	genome.wustl.edu	37	2	96781560	96781560	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:96781560C>T	ENST00000409345.3	-	1	424	c.329G>A	c.(328-330)cGc>cAc	p.R110H		NM_000682.5	NP_000673	P18089	ADA2B_HUMAN	adrenoceptor alpha 2B	110					activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase B activity (GO:0032148)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|MAPK cascade (GO:0000165)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of norepinephrine secretion (GO:0010700)|platelet activation (GO:0030168)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of vascular smooth muscle contraction (GO:0003056)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)			endometrium(2)|large_intestine(2)|lung(9)|ovary(3)	16					Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Etomidate(DB00292)|Fenoldopam(DB00800)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Loxapine(DB00408)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGCCCAGTAGCGGTCCAGGCT	0.647																																																	0													35.0	38.0	37.0					2																	96781560		2202	4299	6501	SO:0001583	missense	0			M34041	CCDS56129.1	2q11.1	2014-05-06	2012-05-09		ENSG00000222040	ENSG00000274286		"""GPCR / Class A : Adrenoceptors : alpha"""	282	protein-coding gene	gene with protein product		104260	"""adrenergic, alpha-2B-, receptor"""	ADRA2L1, ADRA2RL1		2164221	Standard	NM_000682		Approved	ADRARL1	uc021vlh.1	P18089	OTTHUMG00000188276	ENST00000409345.3:c.329G>A	2.37:g.96781560C>T	ENSP00000387281:p.Arg110His		Q4TUH9|Q53RF2|Q9BZK0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA2B_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.R110H	ENST00000409345.3	37	c.329	CCDS56129.1	2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.978104	0.92982	.	.	ENSG00000222040	ENST00000409345	D	0.97161	-4.27	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	D	0.99293	0.9753	H	0.99935	4.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97947	1.0329	9	0.87932	D	0	.	14.7699	0.69668	0.0:1.0:0.0:0.0	.	110	P18089	ADA2B_HUMAN	H	110	ENSP00000387281:R110H	ENSP00000387281:R110H	R	-	2	0	ADRA2B	96145287	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.651000	0.83577	2.337000	0.79520	0.456000	0.33151	CGC	ADRA2B	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000222040		0.647	ADRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA2B	HGNC	protein_coding	OTTHUMT00000334990.1	-	0.00	49	0	C			96781560	-1	tier1	-	no_errors	ENST00000409345	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	T
AGAP2	116986	genome.wustl.edu	37	12	58130970	58130970	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:58130970T>C	ENST00000547588.1	-	1	1059	c.1060A>G	c.(1060-1062)Aag>Gag	p.K354E	AGAP2_ENST00000257897.3_Intron	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	354	Interaction with PLCG1. {ECO:0000250}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						CCTGTGCTCTTGGTGAAGATG	0.692																																																	0													10.0	13.0	12.0					12																	58130970		1555	3568	5123	SO:0001583	missense	0			AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1060A>G	12.37:g.58130970T>C	ENSP00000449241:p.Lys354Glu		A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.K354E	ENST00000547588.1	37	c.1060	CCDS44932.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.50|19.50	3.839837|3.839837	0.71488|0.71488	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000547588|ENST00000328568	T|.	0.38560|.	1.13|.	4.51|4.51	4.51|4.51	0.55191|0.55191	.|.	0.325536|.	0.30565|.	N|.	0.009360|.	T|T	0.43033|0.43033	0.1229|0.1229	N|N	0.19112|0.19112	0.55|0.55	0.42037|0.42037	D|D	0.991059|0.991059	D;D|.	0.67145|.	0.996;0.993|.	D;D|.	0.73708|.	0.981;0.956|.	T|T	0.31503|0.31503	-0.9941|-0.9941	10|5	0.87932|.	D|.	0|.	.|.	11.7392|11.7392	0.51784|0.51784	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	354;354|.	F8VVT9;Q99490|.	.;AGAP2_HUMAN|.	E|R	354|217	ENSP00000449241:K354E|.	ENSP00000449241:K354E|.	K|Q	-|-	1|2	0|0	AGAP2|AGAP2	56417237|56417237	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.496000|3.496000	0.53288|0.53288	2.026000|2.026000	0.59711|0.59711	0.454000|0.454000	0.30748|0.30748	AAG|CAA	AGAP2	-	NULL	ENSG00000135439		0.692	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	HGNC	protein_coding	OTTHUMT00000408367.1	-	0.00	123	0	T	NM_014770		58130970	-1	tier1	-	no_errors	ENST00000547588	ensembl	human	known	74_37	missense	15.22	77	14	SNP	1.000	C
AKAP4	8852	genome.wustl.edu	37	X	49957519	49957519	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:49957519C>T	ENST00000376056.2	-	5	1968	c.1818G>A	c.(1816-1818)gaG>gaA	p.E606E	AKAP4_ENST00000376064.3_Silent_p.E606E|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Silent_p.E232E|AKAP4_ENST00000358526.2_Silent_p.E615E					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GGTGTTGGTTCTCCTTTTGAC	0.443																																																	0													128.0	109.0	115.0					X																	49957519		2203	4300	6503	SO:0001819	synonymous_variant	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1818G>A	X.37:g.49957519C>T				Silent	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.E615	ENST00000376056.2	37	c.1845	CCDS14330.1	X																																																																																			AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.443	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	-	0.00	121	0	C	NM_003886		49957519	-1	tier1	-	no_errors	ENST00000358526	ensembl	human	known	74_37	silent	12.99	67	10	SNP	0.005	T
ALAS2	212	genome.wustl.edu	37	X	55041349	55041349	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:55041349A>G	ENST00000330807.5	-	9	1405	c.1268T>C	c.(1267-1269)cTg>cCg	p.L423P	ALAS2_ENST00000396198.3_Missense_Mutation_p.L410P|ALAS2_ENST00000335854.4_Missense_Mutation_p.L386P|ALAS2_ENST00000498636.1_5'UTR	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	423					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	CATGGGGGGCAGAGAAGTGGT	0.607																																																	0													38.0	34.0	35.0					X																	55041349		2203	4299	6502	SO:0001583	missense	0				CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.1268T>C	X.37:g.55041349A>G	ENSP00000332369:p.Leu423Pro		A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth	p.L423P	ENST00000330807.5	37	c.1268	CCDS14366.1	X	.	.	.	.	.	.	.	.	.	.	A	16.08	3.021605	0.54576	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.92348	-3.02;-3.02;-3.02	5.64	5.64	0.86602	Aminotransferase, class I/classII (1);Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.071506	0.56097	D	0.000023	D	0.96049	0.8713	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96555	0.9411	10	0.87932	D	0	-5.2564	13.9791	0.64291	1.0:0.0:0.0:0.0	.	386;410;423	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	P	423;410;386	ENSP00000332369:L423P;ENSP00000379501:L410P;ENSP00000337131:L386P	ENSP00000332369:L423P	L	-	2	0	ALAS2	55058074	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	9.265000	0.95647	2.014000	0.59158	0.486000	0.48141	CTG	ALAS2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth	ENSG00000158578		0.607	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	HGNC	protein_coding	OTTHUMT00000056843.3	-	0.00	66	0	A	NM_000032		55041349	-1	tier1	-	no_errors	ENST00000330807	ensembl	human	known	74_37	missense	32.65	33	16	SNP	1.000	G
AMBP	259	genome.wustl.edu	37	9	116832112	116832112	+	Intron	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:116832112T>C	ENST00000265132.3	-	6	819					NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor						cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	TTGGTGAGCATCGTGCTGGGA	0.537																																																	0																																										SO:0001627	intron_variant	0			X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.557-87A>G	9.37:g.116832112T>C			P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_A1-microglobln,prints_PstgldnD_synth,prints_Lipocalin	p.M211V	ENST00000265132.3	37	c.631	CCDS6800.1	9																																																																																			AMBP	-	NULL	ENSG00000106927		0.537	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBP	HGNC	protein_coding	OTTHUMT00000053758.2	-	0.00	51	0	T	NM_001633		116832112	-1	tier1	-	no_errors	ENST00000603230	ensembl	human	known	74_37	missense	31.43	24	11	SNP	0.000	C
GMPPB	29925	genome.wustl.edu	37	3	49755961	49755961	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:49755961G>A	ENST00000480687.1	-	0	4423				AMIGO3_ENST00000535833.1_Missense_Mutation_p.S313L|RNF123_ENST00000327697.6_Intron|RNF123_ENST00000497099.1_3'UTR|AMIGO3_ENST00000320431.7_Missense_Mutation_p.S313L|RNF123_ENST00000433785.1_Intron			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CTGCTGCGGCGAAACCCAGGC	0.662																																																	0													37.0	39.0	39.0					3																	49755961		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3224C>T	3.37:g.49755961G>A			A8K6N5|Q9H7U3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S313L	ENST00000480687.1	37	c.938	CCDS2803.1	3	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787733	0.70337	.	.	ENSG00000176020	ENST00000320431;ENST00000535833	T;T	0.78481	-1.18;-1.18	5.4	5.4	0.78164	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.132843	0.52532	D	0.000064	T	0.60090	0.2242	L	0.37561	1.115	0.80722	D	1	D	0.56968	0.978	B	0.35727	0.209	T	0.62378	-0.6867	10	0.07990	T	0.79	-21.0304	11.252	0.49031	0.0846:0.0:0.9154:0.0	.	313	Q86WK7	AMGO3_HUMAN	L	313	ENSP00000323096:S313L;ENSP00000439268:S313L	ENSP00000323096:S313L	S	-	2	0	AMIGO3	49730965	1.000000	0.71417	0.136000	0.22124	0.411000	0.31082	8.004000	0.88535	2.530000	0.85305	0.462000	0.41574	TCG	AMIGO3	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000176020		0.662	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1	-	0.00	38	0	G	NM_013334		49755961	-1	tier1	-	no_errors	ENST00000320431	ensembl	human	known	74_37	missense	76.92	6	20	SNP	0.878	A
ANXA7	310	genome.wustl.edu	37	10	75135834	75135834	+	3'UTR	DEL	A	A	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:75135834delA	ENST00000372921.5	-	0	1476					NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7						autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					ttttttcattaaaaaaaaaaa	0.408																																																	0													17.0	18.0	18.0					10																	75135834		2195	4277	6472	SO:0001624	3_prime_UTR_variant	0			J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.*19T>-	10.37:g.75135834delA			Q5F2H3|Q5T0M6|Q5T0M7	RNA	DEL	-	NULL	ENST00000372921.5	37	NULL	CCDS7325.1	10																																																																																			ANXA7	-	-	ENSG00000138279		0.408	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA7	HGNC	protein_coding	OTTHUMT00000048646.2		0.00	33	0	A	NM_001156		75135834	-1	tier1		no_errors	ENST00000463788	ensembl	human	known	74_37	rna	12.90	27	4	DEL	0.003	-
APC	324	genome.wustl.edu	37	5	112177305	112177305	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:112177305C>T	ENST00000457016.1	+	16	6394	c.6014C>T	c.(6013-6015)tCa>tTa	p.S2005L	APC_ENST00000508376.2_Missense_Mutation_p.S2005L|APC_ENST00000257430.4_Missense_Mutation_p.S2005L|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	2005	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.S2005*(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CCTCAAGCatcaggctatgct	0.408		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Substitution - Nonsense(1)|Unknown(1)	ovary(1)|skin(1)											81.0	80.0	80.0					5																	112177305		2200	4299	6499	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.6014C>T	5.37:g.112177305C>T	ENSP00000413133:p.Ser2005Leu		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S2005L	ENST00000457016.1	37	c.6014	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953868	0.53293	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.89939	-2.59;-2.59;-2.59	5.86	5.86	0.93980	.	0.293920	0.37577	N	0.002030	D	0.91402	0.7287	L	0.29908	0.895	0.50039	D	0.99984	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	D	0.89710	0.3911	9	.	.	.	-13.0943	20.1986	0.98248	0.0:1.0:0.0:0.0	.	2007;2005	Q4LE70;P25054	.;APC_HUMAN	L	2005	ENSP00000413133:S2005L;ENSP00000257430:S2005L;ENSP00000427089:S2005L	.	S	+	2	0	APC	112205204	1.000000	0.71417	0.994000	0.49952	0.922000	0.55478	3.601000	0.54059	2.781000	0.95711	0.650000	0.86243	TCA	APC	-	NULL	ENSG00000134982		0.408	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2		0.00	48	0	C	NM_000038		112177305	+1			no_errors	ENST00000257430	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.832	T
APOB	338	genome.wustl.edu	37	2	21226114	21226114	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:21226114T>G	ENST00000233242.1	-	29	12307	c.12180A>C	c.(12178-12180)gaA>gaC	p.E4060D	RP11-116D2.1_ENST00000567376.2_lincRNA	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	4060					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGCTGCCTCTTCTTCCCAAT	0.453																																																	0													202.0	220.0	214.0					2																	21226114		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.12180A>C	2.37:g.21226114T>G	ENSP00000233242:p.Glu4060Asp		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E4060D	ENST00000233242.1	37	c.12180	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	T	12.67	2.006857	0.35415	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.35421	1.31	5.89	-0.718	0.11205	.	0.322526	0.26069	N	0.026529	T	0.33294	0.0858	M	0.76574	2.34	0.80722	D	1	B	0.25390	0.125	B	0.22753	0.041	T	0.08973	-1.0696	10	0.54805	T	0.06	.	7.9226	0.29854	0.0:0.3466:0.117:0.5364	.	4060	P04114	APOB_HUMAN	D	4060	ENSP00000233242:E4060D	ENSP00000233242:E4060D	E	-	3	2	APOB	21079619	0.820000	0.29190	0.473000	0.27253	0.716000	0.41182	-0.381000	0.07417	-0.337000	0.08426	-2.671000	0.00144	GAA	APOB	-	NULL	ENSG00000084674		0.453	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	80	0	T			21226114	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	54.55	30	36	SNP	0.964	G
ARHGAP28	79822	genome.wustl.edu	37	18	6882174	6882174	+	Silent	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr18:6882174T>C	ENST00000383472.4	+	11	1433	c.1329T>C	c.(1327-1329)gaT>gaC	p.D443D	ARHGAP28_ENST00000532996.1_Silent_p.D266D|ARHGAP28_ENST00000314319.3_Silent_p.D284D|ARHGAP28_ENST00000531294.1_Silent_p.D279D|ARHGAP28_ENST00000262227.3_Silent_p.D391D|ARHGAP28_ENST00000400091.2_Silent_p.D443D|ARHGAP28_ENST00000418986.1_Silent_p.D284D|ARHGAP28_ENST00000419673.2_Silent_p.D284D			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	443	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				TTAATGCTGATAAATTTAAAT	0.398																																																	0													159.0	154.0	156.0					18																	6882174		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1329T>C	18.37:g.6882174T>C			A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.D443	ENST00000383472.4	37	c.1329		18																																																																																			ARHGAP28	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000088756		0.398	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	-	0.00	53	0	T	XM_371108		6882174	+1	tier1	-	no_errors	ENST00000400091	ensembl	human	known	74_37	silent	51.85	13	14	SNP	0.652	C
ARHGAP32	9743	genome.wustl.edu	37	11	128843098	128843098	+	Silent	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:128843098A>C	ENST00000310343.9	-	21	3260	c.3261T>G	c.(3259-3261)tcT>tcG	p.S1087S	ARHGAP32_ENST00000527272.1_Silent_p.S738S|ARHGAP32_ENST00000392657.3_Silent_p.S738S|ARHGAP32_ENST00000524655.1_3'UTR	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1087					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CTGCAGAGTAAGAACTGGACA	0.478																																																	0													169.0	167.0	168.0					11																	128843098		2201	4297	6498	SO:0001819	synonymous_variant	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.3261T>G	11.37:g.128843098A>C			I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.S1087	ENST00000310343.9	37	c.3261	CCDS44769.1	11																																																																																			ARHGAP32	-	NULL	ENSG00000134909		0.478	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	-	0.00	63	0	A	NM_014715		128843098	-1	tier1	-	no_errors	ENST00000310343	ensembl	human	known	74_37	silent	27.50	58	22	SNP	0.000	C
ARHGAP32	9743	genome.wustl.edu	37	11	128844307	128844307	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:128844307G>A	ENST00000310343.9	-	20	2742	c.2743C>T	c.(2743-2745)Cta>Tta	p.L915L	ARHGAP32_ENST00000527272.1_Silent_p.L566L|ARHGAP32_ENST00000392657.3_Silent_p.L566L|ARHGAP32_ENST00000524655.1_Silent_p.L841L	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	915					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CGTGGTGGTAGGGTCACTGAA	0.448																																																	0													174.0	159.0	164.0					11																	128844307		2201	4297	6498	SO:0001819	synonymous_variant	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2743C>T	11.37:g.128844307G>A			I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Silent	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L915	ENST00000310343.9	37	c.2743	CCDS44769.1	11																																																																																			ARHGAP32	-	NULL	ENSG00000134909		0.448	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	-	0.00	68	0	G	NM_014715		128844307	-1	tier1	-	no_errors	ENST00000310343	ensembl	human	known	74_37	silent	21.82	43	12	SNP	0.013	A
ARHGEF10L	55160	genome.wustl.edu	37	1	17944985	17944987	+	Intron	DEL	CCT	CCT	-	rs544006964	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:17944985_17944987delCCT	ENST00000361221.3	+	10	994				ARHGEF10L_ENST00000375408.3_In_Frame_Del_p.S52del|ARHGEF10L_ENST00000452522.1_Intron|ARHGEF10L_ENST00000375420.3_Intron|ARHGEF10L_ENST00000469726.1_Intron|ARHGEF10L_ENST00000434513.1_Intron|ARHGEF10L_ENST00000375415.1_Intron|ARHGEF10L_ENST00000167825.4_In_Frame_Del_p.S52del	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like							cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		ATCCGCTGTCcctcctcctcctc	0.68																																																	0																																										SO:0001627	intron_variant	0			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.836-847CCT>-	1.37:g.17944994_17944996delCCT			B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	In_Frame_Del	DEL	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.S50in_frame_del	ENST00000361221.3	37	c.137_139	CCDS182.1	1																																																																																			ARHGEF10L	-	NULL	ENSG00000074964		0.680	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	HGNC	protein_coding	OTTHUMT00000007147.1		0.00	57	0	CCT	NM_018125		17944987	+1	tier1		no_errors	ENST00000375408	ensembl	human	known	74_37	in_frame_del	10.20	44	5	DEL	0.989:0.989:0.996	-
ARNT2	9915	genome.wustl.edu	37	15	80843542	80843542	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:80843542A>G	ENST00000303329.4	+	9	1045	c.880A>G	c.(880-882)Atg>Gtg	p.M294V	ARNT2_ENST00000533983.1_Missense_Mutation_p.M283V|ARNT2_ENST00000527771.1_Missense_Mutation_p.M283V	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	294					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			CATTTCAGGAATGACCATACC	0.403																																																	0													137.0	126.0	130.0					15																	80843542		2203	4300	6503	SO:0001583	missense	0			AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.880A>G	15.37:g.80843542A>G	ENSP00000307479:p.Met294Val		B4DIS7|O15024|Q8IYC2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom,prints_Nuc_translocat,tigrfam_PAS	p.M294V	ENST00000303329.4	37	c.880	CCDS32307.1	15	.	.	.	.	.	.	.	.	.	.	A	1.478	-0.558088	0.03967	.	.	ENSG00000172379	ENST00000360062;ENST00000303329;ENST00000540859	T	0.05258	3.47	4.9	4.9	0.64082	.	0.274240	0.40064	N	0.001199	T	0.02610	0.0079	N	0.02674	-0.535	0.80722	D	1	B	0.09022	0.002	B	0.01281	0.0	T	0.32161	-0.9917	10	0.02654	T	1	.	14.5465	0.68035	1.0:0.0:0.0:0.0	.	294	Q9HBZ2	ARNT2_HUMAN	V	283;294;294	ENSP00000307479:M294V	ENSP00000307479:M294V	M	+	1	0	ARNT2	78630597	1.000000	0.71417	0.998000	0.56505	0.454000	0.32378	6.358000	0.73055	1.837000	0.53436	0.533000	0.62120	ATG	ARNT2	-	prints_Nuc_translocat	ENSG00000172379		0.403	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARNT2	HGNC	protein_coding	OTTHUMT00000384389.2	-	0.00	112	0	A			80843542	+1	tier1	-	no_errors	ENST00000303329	ensembl	human	known	74_37	missense	25.97	57	20	SNP	1.000	G
ASCC3	10973	genome.wustl.edu	37	6	101095202	101095202	+	Silent	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:101095202A>T	ENST00000369162.2	-	21	3722	c.3378T>A	c.(3376-3378)ccT>ccA	p.P1126P		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1126	SEC63 1.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		ATTGTCTCAAAGGGCTAGCCC	0.408																																																	0													125.0	121.0	122.0					6																	101095202		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.3378T>A	6.37:g.101095202A>T			E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Silent	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P1126	ENST00000369162.2	37	c.3378	CCDS5046.1	6																																																																																			ASCC3	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000112249		0.408	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	-	0.00	80	0	A	NM_006828		101095202	-1	tier1	-	no_errors	ENST00000369162	ensembl	human	known	74_37	silent	8.33	55	5	SNP	1.000	T
ASMT	438	genome.wustl.edu	37	X	1755354	1755354	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:1755354C>T	ENST00000381229.4	+	7	763	c.727C>T	c.(727-729)Ccg>Tcg	p.P243S	ASMT_ENST00000381241.3_Missense_Mutation_p.P271S|ASMT_ENST00000509780.1_3'UTR|ASMT_ENST00000381233.3_Missense_Mutation_p.P196S			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	243			P -> L (functional polymorphism with reduced enzyme activity; dbSNP:rs121918826). {ECO:0000269|PubMed:21251267, ECO:0000269|PubMed:22694957, ECO:0000269|PubMed:23349736}.		cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	AGACCCTCTTCCGGAAGCTGA	0.542																																																	0													302.0	273.0	283.0					X																	1755354		2203	4296	6499	SO:0001583	missense	0			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.727C>T	X.37:g.1755354C>T	ENSP00000370627:p.Pro243Ser		B2RC33|Q16598|Q5JQ72|Q5JQ73	Missense_Mutation	SNP	pfam_O_MeTrfase_2,pirsf_COMT	p.P271S	ENST00000381229.4	37	c.811		X	.	.	.	.	.	.	.	.	.	.	c	12.85	2.062455	0.36373	.	.	ENSG00000196433	ENST00000381241;ENST00000381229;ENST00000381233;ENST00000432523	T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49	2.33	2.33	0.28932	.	0.119825	0.56097	U	0.000021	D	0.91395	0.7285	H	0.94582	3.555	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84283	0.0495	10	0.72032	D	0.01	.	12.6028	0.56506	0.0:1.0:0.0:0.0	.	196;271	P46597-2;P46597-3	.;.	S	271;243;196;22	ENSP00000370639:P271S;ENSP00000370627:P243S;ENSP00000370631:P196S;ENSP00000392053:P22S	ENSP00000370627:P243S	P	+	1	0	ASMT	1715354	0.998000	0.40836	0.017000	0.16124	0.068000	0.16541	5.597000	0.67577	0.958000	0.37956	0.453000	0.30009	CCG	ASMT	-	pfam_O_MeTrfase_2,pirsf_COMT	ENSG00000196433		0.542	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	-	0.00	166	0	C	NM_004043		1755354	+1	tier1	-	no_errors	ENST00000381241	ensembl	human	known	74_37	missense	52.31	31	34	SNP	0.994	T
ASTE1	28990	genome.wustl.edu	37	3	130733046	130733047	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:130733046_130733047insT	ENST00000264992.3	-	6	2335_2336	c.1894_1895insA	c.(1894-1896)aggfs	p.R632fs	ASTE1_ENST00000514044.1_Frame_Shift_Ins_p.R657fs|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000504381.1_Intron|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000328560.8_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTCTTCTGCCTTTTTTTTTTT	0.406																																																	2	Deletion - Frameshift(2)	ovary(2)																																								SO:0001589	frameshift_variant	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1895dupA	3.37:g.130733057_130733057dupT	ENSP00000264992:p.Arg632fs		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Ins	INS	pfam_XPG_DNA_repair_N	p.R632fs	ENST00000264992.3	37	c.1895_1894	CCDS3068.1	3																																																																																			ASTE1	-	NULL	ENSG00000034533		0.406	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1		0.00	26	0	-	NM_014065		130733047	-1	tier1		no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_ins	11.90	37	5	INS	0.003:0.014	T
ATF7IP2	80063	genome.wustl.edu	37	16	10534309	10534309	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:10534309G>A	ENST00000396560.2	+	6	1411	c.1184G>A	c.(1183-1185)gGa>gAa	p.G395E	ATF7IP2_ENST00000543967.1_Intron|ATF7IP2_ENST00000324570.5_Missense_Mutation_p.G395E|ATF7IP2_ENST00000356427.2_Missense_Mutation_p.G395E|ATF7IP2_ENST00000396559.1_Missense_Mutation_p.G395E	NM_024997.3	NP_079273.2	Q5U623	MCAF2_HUMAN	activating transcription factor 7 interacting protein 2	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				large_intestine(3)	3						TCCAGTAATGGAGCCTCTAAG	0.303																																																	0													43.0	47.0	45.0					16																	10534309		2194	4298	6492	SO:0001583	missense	0			AK022730	CCDS10540.1, CCDS58422.1	16p13.2	2008-02-05			ENSG00000166669	ENSG00000166669			20397	protein-coding gene	gene with protein product		613645					Standard	NM_001256160		Approved	FLJ12668	uc002czu.3	Q5U623	OTTHUMG00000129749	ENST00000396560.2:c.1184G>A	16.37:g.10534309G>A	ENSP00000379808:p.Gly395Glu		B2RNR2|Q53EZ7|Q658U2|Q6IS97|Q8N9X8|Q9H9L6	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.G395E	ENST00000396560.2	37	c.1184	CCDS10540.1	16	.	.	.	.	.	.	.	.	.	.	G	0	-2.705102	0.00096	.	.	ENSG00000166669	ENST00000396559;ENST00000396560;ENST00000535850;ENST00000356427;ENST00000324570	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	4.62	-4.85	0.03142	.	1.541730	0.03814	N	0.266511	T	0.27933	0.0688	N	0.22421	0.69	0.09310	N	1	B;B	0.25169	0.119;0.103	B;B	0.26416	0.069;0.037	T	0.33523	-0.9865	10	0.54805	T	0.06	4.3421	6.9069	0.24313	0.0:0.3026:0.1324:0.565	.	395;395	Q5U623-2;Q5U623	.;MCAF2_HUMAN	E	395	ENSP00000379807:G395E;ENSP00000379808:G395E;ENSP00000348799:G395E;ENSP00000322811:G395E	ENSP00000322811:G395E	G	+	2	0	ATF7IP2	10441810	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.714000	0.05002	-0.872000	0.04037	-0.340000	0.08031	GGA	ATF7IP2	-	NULL	ENSG00000166669		0.303	ATF7IP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF7IP2	HGNC	protein_coding	OTTHUMT00000251961.1		0.00	96	0	G	NM_024997		10534309	+1			no_errors	ENST00000356427	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.000	A
ATP13A3	79572	genome.wustl.edu	37	3	194126666	194126666	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:194126666T>A	ENST00000439040.1	-	33	4454	c.3663A>T	c.(3661-3663)caA>caT	p.Q1221H	ATP13A3_ENST00000256031.4_Missense_Mutation_p.Q1221H			Q9H7F0	AT133_HUMAN	ATPase type 13A3	1221						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TGGTGATGATTTGACATGATC	0.423																																																	0													264.0	242.0	249.0					3																	194126666		1991	4172	6163	SO:0001583	missense	0			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.3663A>T	3.37:g.194126666T>A	ENSP00000416508:p.Gln1221His		Q8NC11|Q96KS1	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.Q1221H	ENST00000439040.1	37	c.3663	CCDS43187.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.45|15.45	2.837738|2.837738	0.50951|0.50951	.|.	.|.	ENSG00000133657|ENSG00000133657	ENST00000429136|ENST00000439040;ENST00000256031	.|D;D	.|0.86497	.|-2.13;-2.13	5.78|5.78	-6.26|-6.26	0.02033|0.02033	.|.	.|0.240692	.|0.42821	.|D	.|0.000648	D|D	0.85592|0.85592	0.5732|0.5732	L|L	0.27053|0.27053	0.805|0.805	0.40683|0.40683	D|D	0.982322|0.982322	.|D	.|0.71674	.|0.998	.|D	.|0.79784	.|0.993	D|D	0.84704|0.84704	0.0730|0.0730	5|10	.|0.72032	.|D	.|0.01	-10.2813|-10.2813	13.0405|13.0405	0.58897|0.58897	0.0:0.1518:0.0891:0.7591|0.0:0.1518:0.0891:0.7591	.|.	.|1221	.|Q9H7F0	.|AT133_HUMAN	Y|H	157|1221	.|ENSP00000416508:Q1221H;ENSP00000256031:Q1221H	.|ENSP00000256031:Q1221H	N|Q	-|-	1|3	0|2	ATP13A3|ATP13A3	195607955|195607955	0.997000|0.997000	0.39634|0.39634	0.809000|0.809000	0.32408|0.32408	0.393000|0.393000	0.30537|0.30537	0.316000|0.316000	0.19469|0.19469	-1.079000|-1.079000	0.03113|0.03113	-0.993000|-0.993000	0.02533|0.02533	AAT|CAA	ATP13A3	-	NULL	ENSG00000133657		0.423	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP13A3	HGNC	protein_coding	OTTHUMT00000342799.2	-	0.00	81	0	T	NM_024524		194126666	-1	tier1	-	no_errors	ENST00000256031	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.408	A
ATP6V1H	51606	genome.wustl.edu	37	8	54727259	54727259	+	Missense_Mutation	SNP	T	T	A	rs370437064		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:54727259T>A	ENST00000359530.2	-	6	751	c.488A>T	c.(487-489)tAc>tTc	p.Y163F	ATP6V1H_ENST00000396774.2_Missense_Mutation_p.Y163F|ATP6V1H_ENST00000355221.3_Missense_Mutation_p.Y163F|ATP6V1H_ENST00000520188.1_Missense_Mutation_p.Y123F	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H	163					ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			ATTGAAATAGTAATTTAAGTC	0.333																																																	0													73.0	76.0	75.0					8																	54727259		2203	4297	6500	SO:0001583	missense	0			AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.488A>T	8.37:g.54727259T>A	ENSP00000352522:p.Tyr163Phe		B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Missense_Mutation	SNP	pfam_ATPase_V1-cplx_hsu,pfam_ATPase_V1-cplx_hsu_C,superfamily_ARM-type_fold,pirsf_ATPase_V1-cplx_hsu	p.Y163F	ENST00000359530.2	37	c.488	CCDS6153.1	8	.	.	.	.	.	.	.	.	.	.	T	13.76	2.332311	0.41297	.	.	ENSG00000047249	ENST00000355221;ENST00000520188;ENST00000359530;ENST00000396774	.	.	.	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51295	0.1666	N	0.21324	0.655	0.80722	D	1	B;B	0.21225	0.01;0.053	B;B	0.33960	0.045;0.173	T	0.45205	-0.9277	9	0.10111	T	0.7	-11.1312	15.727	0.77770	0.0:0.0:0.0:1.0	.	163;163	Q9UI12-2;Q9UI12	.;VATH_HUMAN	F	163;123;163;163	.	ENSP00000347359:Y163F	Y	-	2	0	ATP6V1H	54889812	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.013000	0.88655	2.118000	0.64928	0.533000	0.62120	TAC	ATP6V1H	-	pfam_ATPase_V1-cplx_hsu,superfamily_ARM-type_fold,pirsf_ATPase_V1-cplx_hsu	ENSG00000047249		0.333	ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1H	HGNC	protein_coding	OTTHUMT00000377865.1		0.00	46	0	T	NM_015941		54727259	-1			no_errors	ENST00000359530	ensembl	human	known	74_37	missense	6.06	60	4	SNP	1.000	A
ATP9A	10079	genome.wustl.edu	37	20	50245527	50245527	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:50245527C>A	ENST00000338821.5	-	16	2017	c.1753G>T	c.(1753-1755)Gag>Tag	p.E585*	ATP9A_ENST00000402822.1_Nonsense_Mutation_p.E464*|ATP9A_ENST00000311637.5_Nonsense_Mutation_p.E449*	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	585					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.E585K(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ACCTCTTCCTCCAACCAGTCA	0.488																																																	1	Substitution - Missense(1)	lung(1)											231.0	188.0	202.0					20																	50245527		2203	4300	6503	SO:0001587	stop_gained	0			AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1753G>T	20.37:g.50245527C>A	ENSP00000342481:p.Glu585*		E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E585*	ENST00000338821.5	37	c.1753	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	C	42	9.682786	0.99237	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	.	.	.	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-30.182	18.7535	0.91823	0.0:1.0:0.0:0.0	.	.	.	.	X	449;585;464	.	ENSP00000309086:E449X	E	-	1	0	ATP9A	49678934	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.619000	0.83057	2.405000	0.81733	0.655000	0.94253	GAG	ATP9A	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000054793		0.488	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	HGNC	protein_coding	OTTHUMT00000106494.1	-	0.00	80	0	C	NM_006045		50245527	-1	tier1	-	no_errors	ENST00000338821	ensembl	human	known	74_37	nonsense	31.58	39	18	SNP	1.000	A
AUTS2	26053	genome.wustl.edu	37	7	69064801	69064801	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:69064801C>T	ENST00000342771.4	+	1	483	c.162C>T	c.(160-162)tcC>tcT	p.S54S	AUTS2_ENST00000403018.2_Silent_p.S54S|AUTS2_ENST00000406775.2_Silent_p.S54S|RP5-942I16.1_ENST00000436600.2_lincRNA	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	54										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGTCGGGCTCCGACAAGGAAG	0.761																																																	0													11.0	12.0	12.0					7																	69064801		2137	4157	6294	SO:0001819	synonymous_variant	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.162C>T	7.37:g.69064801C>T			A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	prints_AUTS2	p.S54	ENST00000342771.4	37	c.162	CCDS5539.1	7																																																																																			AUTS2	-	NULL	ENSG00000158321		0.761	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	-	0.00	44	0	C			69064801	+1	tier1	-	no_errors	ENST00000342771	ensembl	human	known	74_37	silent	25.00	21	7	SNP	0.999	T
B4GALNT4	338707	genome.wustl.edu	37	11	372929	372929	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:372929C>T	ENST00000329962.6	+	4	426	c.426C>T	c.(424-426)caC>caT	p.H142H		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	142					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAACCTGCACTTCCCGCTGT	0.677																																																	0													33.0	36.0	35.0					11																	372929		2193	4292	6485	SO:0001819	synonymous_variant	0			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.426C>T	11.37:g.372929C>T			Q96LV2	Silent	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.H142	ENST00000329962.6	37	c.426	CCDS7694.1	11																																																																																			B4GALNT4	-	smart_PA14	ENSG00000182272		0.677	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	-	0.00	40	0	C	NM_178537		372929	+1	tier1	-	no_errors	ENST00000329962	ensembl	human	known	74_37	silent	30.00	21	9	SNP	1.000	T
BAZ2B	29994	genome.wustl.edu	37	2	160181430	160181430	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:160181430G>T	ENST00000392783.2	-	36	6740	c.6245C>A	c.(6244-6246)gCa>gAa	p.A2082E	BAZ2B_ENST00000355831.2_Missense_Mutation_p.A2048E|BAZ2B_ENST00000343439.5_Missense_Mutation_p.A1982E|BAZ2B_ENST00000392782.1_Missense_Mutation_p.A2046E	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	2082	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						AAAAGGCCATGCATCCTCATG	0.299																																																	0													63.0	59.0	60.0					2																	160181430		1809	4078	5887	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.6245C>A	2.37:g.160181430G>T	ENSP00000376534:p.Ala2082Glu		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.A2082E	ENST00000392783.2	37	c.6245	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101450	0.56183	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.48	5.48	0.80851	Bromodomain (6);Bromodomain, conserved site (1);	0.212479	0.22871	U	0.054631	T	0.69593	0.3128	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.97;0.999	T	0.75508	-0.3293	10	0.87932	D	0	-5.2601	19.7236	0.96153	0.0:0.0:1.0:0.0	.	2046;2082	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	E	2046;2082;2048;1982	ENSP00000376533:A2046E;ENSP00000376534:A2082E;ENSP00000348087:A2048E;ENSP00000339670:A1982E	ENSP00000339670:A1982E	A	-	2	0	BAZ2B	159889676	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.358000	0.97109	2.730000	0.93505	0.655000	0.94253	GCA	BAZ2B	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000123636		0.299	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	-	0.00	82	0	G			160181430	-1	tier1	-	no_errors	ENST00000392783	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
BCAS3	54828	genome.wustl.edu	37	17	59465981	59465981	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:59465981delA	ENST00000589222.1	+	25	2730	c.2662delA	c.(2662-2664)aaafs	p.K890fs	BCAS3_ENST00000585744.1_Intron|BCAS3_ENST00000588462.1_Intron|BCAS3_ENST00000390652.5_Intron|RP11-332H18.5_ENST00000585765.1_RNA|BCAS3_ENST00000585812.1_Intron|BCAS3_ENST00000407086.3_Intron|BCAS3_ENST00000588874.1_Intron|BCAS3_ENST00000408905.3_Intron					breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TTCAAAAGGGAAAAAAAAAGG	0.443																																																	0													6.0	5.0	5.0					17																	59465981		836	1922	2758	SO:0001589	frameshift_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000589222.1:c.2662delA	17.37:g.59465981delA	ENSP00000466078:p.Lys890fs			Frame_Shift_Del	DEL	pfam_BCAS3,pfam_WD40_repeat	p.G891fs	ENST00000589222.1	37	c.2662		17																																																																																			BCAS3	-	NULL	ENSG00000141376		0.443	BCAS3-004	KNOWN	basic	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449571.1		0.00	52	0	A	NM_017679		59465981	+1	tier1		no_errors	ENST00000589222	ensembl	human	known	74_37	frame_shift_del	37.14	22	13	DEL	1.000	-
BMS1P17	101101776	genome.wustl.edu	37	14	19904576	19904576	+	lincRNA	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:19904576T>G	ENST00000552602.1	-	0	202				BMS1P18_ENST00000549877.1_lincRNA																							AATTGTATATTCATGGAATAT	0.289																																																	0																																												0																															14.37:g.19904576T>G				RNA	SNP	-	NULL	ENST00000552602.1	37	NULL		14																																																																																			BMS1P18	-	-	ENSG00000215394		0.289	CTD-2314B22.3-003	KNOWN	basic	lincRNA	BMS1P18	HGNC	lincRNA	OTTHUMT00000409412.1	-	0.00	11	0	T			19904576	+1	tier1	-	no_errors	ENST00000549877	ensembl	human	known	74_37	rna	36.36	6	4	SNP	0.132	G
BOD1L1	259282	genome.wustl.edu	37	4	13604828	13604828	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:13604828A>G	ENST00000040738.5	-	10	3831	c.3696T>C	c.(3694-3696)aaT>aaC	p.N1232N		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	1232						nucleus (GO:0005634)	DNA binding (GO:0003677)										CAGAATCTATATTCACTTCAG	0.388																																																	0													113.0	115.0	114.0					4																	13604828		2203	4300	6503	SO:0001819	synonymous_variant	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.3696T>C	4.37:g.13604828A>G			Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	NULL	p.N1232	ENST00000040738.5	37	c.3696	CCDS3411.2	4																																																																																			BOD1L1	-	NULL	ENSG00000038219		0.388	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	61	0	A	NM_148894		13604828	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	silent	44.00	28	22	SNP	0.114	G
BTBD8	284697	genome.wustl.edu	37	1	92573557	92573557	+	Splice_Site	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:92573557A>T	ENST00000342818.3	+	4	897	c.661A>T	c.(661-663)Agg>Tgg	p.R221W	BTBD8_ENST00000540648.1_Splice_Site_p.R221W|BTBD8_ENST00000370382.3_Splice_Site_p.R221W	NM_183242.3	NP_899065.2	Q5XKL5	BTBD8_HUMAN	BTB (POZ) domain containing 8	221	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.					nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)	16		all_lung(203;0.0484)|Lung NSC(277;0.126)|Glioma(108;0.222)		all cancers(265;0.0153)|Epithelial(280;0.0982)		TAAAGCTCACAGGTAAATAGA	0.413																																																	0													164.0	162.0	163.0					1																	92573557		2203	4300	6503	SO:0001630	splice_region_variant	0			AY346333	CCDS737.1	1p22.1	2013-01-08			ENSG00000189195	ENSG00000189195		"""BTB/POZ domain containing"""	21019	protein-coding gene	gene with protein product						14654994	Standard	NM_183242		Approved		uc001doo.3	Q5XKL5	OTTHUMG00000010289	ENST00000342818.3:c.662+1A>T	1.37:g.92573557A>T			Q6V9S5	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R221W	ENST00000342818.3	37	c.661	CCDS737.1	1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964227	0.74131	.	.	ENSG00000189195	ENST00000370382;ENST00000342818;ENST00000540648	T;T;T	0.75477	-0.94;-0.94;-0.94	5.32	4.12	0.48240	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000008	D	0.88577	0.6474	H	0.97829	4.085	0.42605	D	0.993297	D	0.89917	1.0	D	0.97110	1.0	D	0.90875	0.4749	10	0.87932	D	0	-10.763	9.7609	0.40532	0.8266:0.1734:0.0:0.0	.	221	Q5XKL5	BTBD8_HUMAN	W	221	ENSP00000359408:R221W;ENSP00000343686:R221W;ENSP00000443397:R221W	ENSP00000343686:R221W	R	+	1	2	BTBD8	92346145	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.551000	0.53698	2.006000	0.58801	0.482000	0.46254	AGG	BTBD8	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000189195		0.413	BTBD8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD8	HGNC	protein_coding	OTTHUMT00000028372.1	-	0.00	53	0	A	NM_183242	Missense_Mutation	92573557	+1	tier1	-	no_errors	ENST00000342818	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
BRINP2	57795	genome.wustl.edu	37	1	177250517	177250517	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:177250517A>G	ENST00000361539.4	+	8	2517	c.2205A>G	c.(2203-2205)aaA>aaG	p.K735K	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	735					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											CACCTGGCAAAGTCCGACTTG	0.542																																																	0													95.0	86.0	89.0					1																	177250517		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.2205A>G	1.37:g.177250517A>G			O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	pfam_MACPF,smart_MACPF	p.K735	ENST00000361539.4	37	c.2205	CCDS1320.1	1																																																																																			BRINP2	-	NULL	ENSG00000198797		0.542	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	HGNC	protein_coding	OTTHUMT00000084599.1	-	0.00	50	0	A	NM_021165		177250517	+1	tier1	-	no_errors	ENST00000361539	ensembl	human	known	74_37	silent	48.15	28	26	SNP	1.000	G
CCDC184	387856	genome.wustl.edu	37	12	48578103	48578103	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:48578103C>T	ENST00000316554.3	+	1	738	c.198C>T	c.(196-198)gaC>gaT	p.D66D		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		66						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						GGGCCCTGGACGAGCAGGCCT	0.642																																																	0													50.0	52.0	51.0					12																	48578103		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000316554.3:c.198C>T	12.37:g.48578103C>T			Q96MK5|Q96N39	Silent	SNP	NULL	p.D66	ENST00000316554.3	37	c.198	CCDS31785.1	12																																																																																			C12orf68	-	NULL	ENSG00000177875		0.642	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf68	HGNC	protein_coding	OTTHUMT00000406514.1	-	0.00	94	0	C			48578103	+1	tier1	-	no_errors	ENST00000316554	ensembl	human	known	74_37	silent	22.58	48	14	SNP	1.000	T
C22orf15	150248	genome.wustl.edu	37	22	24107912	24107912	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr22:24107912C>T	ENST00000402217.3	+	6	693	c.440C>T	c.(439-441)cCt>cTt	p.P147L	C22orf15_ENST00000382821.3_Silent_p.P142P|C22orf15_ENST00000305199.5_Silent_p.L149L	NM_182520.2	NP_872326.2	Q8WYQ4	CV015_HUMAN	chromosome 22 open reading frame 15	147										breast(1)|pancreas(1)	2		Medulloblastoma(6;6.27e-05)|all_neural(6;0.00518)				ACCCAGGGCCCTGATTAAGGG	0.577																																																	0													48.0	49.0	48.0					22																	24107912		692	1591	2283	SO:0001583	missense	0			AB050773	CCDS13814.2	22q11.23	2012-11-13			ENSG00000169314	ENSG00000169314			15558	protein-coding gene	gene with protein product							Standard	NM_182520		Approved	FLJ36561, N27C7-3	uc011aja.2	Q8WYQ4	OTTHUMG00000150740	ENST00000402217.3:c.440C>T	22.37:g.24107912C>T	ENSP00000384965:p.Pro147Leu		Q6ICJ7	Missense_Mutation	SNP	superfamily_Ferritin-like_SF	p.P147L	ENST00000402217.3	37	c.440	CCDS13814.2	22	.	.	.	.	.	.	.	.	.	.	C	6.300	0.423516	0.11928	.	.	ENSG00000169314	ENST00000402217	.	.	.	3.52	-1.45	0.08828	.	572.337000	0.00792	U	0.001354	T	0.17534	0.0421	N	0.08118	0	0.09310	N	0.999999	B	0.17667	0.023	B	0.11329	0.006	T	0.09122	-1.0689	8	.	.	.	-1.2143	3.2198	0.06711	0.1841:0.4889:0.0:0.327	.	147	Q8WYQ4	CV015_HUMAN	L	147	.	.	P	+	2	0	C22orf15	22437912	0.000000	0.05858	0.000000	0.03702	0.242000	0.25591	-0.259000	0.08721	-0.122000	0.11766	0.485000	0.47835	CCT	C22orf15	-	NULL	ENSG00000169314		0.577	C22orf15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf15	HGNC	protein_coding	OTTHUMT00000319887.2	-	0.00	52	0	C	NM_182520		24107912	+1	tier1	-	no_errors	ENST00000402217	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.000	T
C3orf67	200844	genome.wustl.edu	37	3	58849417	58849417	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:58849417G>A	ENST00000482387.1	-	8	1181	c.1085C>T	c.(1084-1086)gCa>gTa	p.A362V	RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000463703.1_RNA|C3orf67_ENST00000472469.1_Missense_Mutation_p.A269V|RP11-147N17.1_ENST00000492031.1_RNA|RP11-147N17.1_ENST00000482372.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.A362V			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	362										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		TCCATGAGGTGCTGATCGTGG	0.468																																																	0													144.0	137.0	139.0					3																	58849417		2203	4300	6503	SO:0001583	missense	0			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.1085C>T	3.37:g.58849417G>A	ENSP00000417122:p.Ala362Val		B9EKV6|Q6ZV69	Missense_Mutation	SNP	NULL	p.A362V	ENST00000482387.1	37	c.1085		3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152241	0.78001	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000394474;ENST00000472469	T;T;T	0.26067	1.9;2.07;1.76	5.39	4.5	0.54988	.	0.140759	0.46442	D	0.000299	T	0.31482	0.0798	L	0.58810	1.83	0.80722	D	1	D;P;B	0.55605	0.972;0.736;0.319	P;B;B	0.47075	0.536;0.397;0.111	T	0.02837	-1.1104	10	0.42905	T	0.14	-13.0341	13.3245	0.60452	0.0774:0.0:0.9226:0.0	.	269;362;362	C9J3M8;Q6ZVT6-2;Q6ZVT6	.;.;CC067_HUMAN	V	362;362;67;269	ENSP00000295966:A362V;ENSP00000417122:A362V;ENSP00000417271:A269V	ENSP00000295966:A362V	A	-	2	0	C3orf67	58824457	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.951000	0.63610	2.678000	0.91216	0.655000	0.94253	GCA	C3orf67	-	NULL	ENSG00000163689		0.468	C3orf67-003	KNOWN	basic	protein_coding	C3orf67	HGNC	protein_coding	OTTHUMT00000353803.1	-	0.00	71	0	G	NM_198463		58849417	-1	tier1	-	no_errors	ENST00000482387	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
C6orf132	647024	genome.wustl.edu	37	6	42072477	42072477	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:42072477delC	ENST00000341865.4	-	4	3172	c.3173delG	c.(3172-3174)ggcfs	p.G1058fs		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	1058										breast(1)	1						GAGCGAGCGGCCCCCTCCCGA	0.751																																																	0													2.0	2.0	2.0					6																	42072477		511	1272	1783	SO:0001589	frameshift_variant	0				CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.3173delG	6.37:g.42072477delC	ENSP00000341368:p.Gly1058fs		A6NI05	Frame_Shift_Del	DEL	NULL	p.G1058fs	ENST00000341865.4	37	c.3173	CCDS47428.1	6																																																																																			C6orf132	-	NULL	ENSG00000188112		0.751	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	HGNC	protein_coding	OTTHUMT00000040548.2		0.00	27	0	C	NM_001164446		42072477	-1			no_errors	ENST00000341865	ensembl	human	putative	74_37	frame_shift_del	33.33	4	2	DEL	0.999	0
C8orf34	116328	genome.wustl.edu	37	8	69243294	69243294	+	5'UTR	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:69243294G>T	ENST00000539993.1	+	0	338				RP11-664D7.4_ENST00000512294.3_Intron|C8orf34_ENST00000348340.2_5'Flank|C8orf34_ENST00000523686.1_5'Flank|C8orf34_ENST00000518698.1_Missense_Mutation_p.R16L			Q49A92	CH034_HUMAN	chromosome 8 open reading frame 34											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(12)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	36			Epithelial(68;0.0117)|OV - Ovarian serous cystadenocarcinoma(28;0.0227)|all cancers(69;0.0502)			GCGGCGCTGCGCCCAGGCTTC	0.766																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB056652	CCDS6203.1, CCDS6203.2	8q13	2009-10-01			ENSG00000165084	ENSG00000165084			30905	protein-coding gene	gene with protein product	"""vestibule 1"""						Standard	NM_052958		Approved	vest-1, VEST1	uc010lyz.3	Q49A92	OTTHUMG00000164438	ENST00000539993.1:c.-212G>T	8.37:g.69243294G>T			A8K5X1|G3XAM6|Q8N1X0|Q8N9M7|Q8ND19|Q96Q28	Missense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.R16L	ENST00000539993.1	37	c.47		8	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841553	0.71488	.	.	ENSG00000165084	ENST00000518698	T	0.50813	0.73	3.82	1.8	0.24995	.	0.696105	0.11296	N	0.578745	T	0.20981	0.0505	N	0.08118	0	0.21220	N	0.999755	.	.	.	.	.	.	T	0.16630	-1.0396	7	.	.	.	.	2.0778	0.03628	0.1224:0.3368:0.3722:0.1686	.	.	.	.	L	16	ENSP00000427820:R16L	.	R	+	2	0	C8orf34	69405848	0.007000	0.16637	0.010000	0.14722	0.933000	0.57130	0.998000	0.29744	0.355000	0.24131	0.462000	0.41574	CGC	C8orf34	-	NULL	ENSG00000165084		0.766	C8orf34-201	KNOWN	basic|appris_candidate	protein_coding	C8orf34	HGNC	protein_coding		-	0.00	25	0	G	NM_052958		69243294	+1	tier1	-	no_errors	ENST00000518698	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.002	T
C9orf131	138724	genome.wustl.edu	37	9	35045584	35045584	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:35045584C>T	ENST00000312292.5	+	2	3005	c.2958C>T	c.(2956-2958)agC>agT	p.S986S	C9orf131_ENST00000421362.2_Silent_p.S938S|FLJ00273_ENST00000595331.1_5'Flank|C9orf131_ENST00000354479.5_Silent_p.S913S	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	986										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			CCCCTGTAAGCACATTTCCCC	0.577																																																	0													83.0	87.0	86.0					9																	35045584		2203	4300	6503	SO:0001819	synonymous_variant	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.2958C>T	9.37:g.35045584C>T			A6NLE6|E9PB26|Q86XC6|Q9UF74	Silent	SNP	NULL	p.S986	ENST00000312292.5	37	c.2958	CCDS6572.2	9																																																																																			C9orf131	-	NULL	ENSG00000174038		0.577	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5	-	0.00	46	0	C	NM_203299		35045584	+1	tier1	-	no_errors	ENST00000312292	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.001	T
CALCOCO2	10241	genome.wustl.edu	37	17	46919220	46919220	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:46919220C>T	ENST00000258947.3	+	2	252	c.151C>T	c.(151-153)Cgt>Tgt	p.R51C	CALCOCO2_ENST00000508679.1_Intron|CALCOCO2_ENST00000448105.2_Missense_Mutation_p.R51C|CALCOCO2_ENST00000509507.1_Missense_Mutation_p.R51C|CALCOCO2_ENST00000416445.2_Missense_Mutation_p.R51C	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	51					response to interferon-gamma (GO:0034341)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	15						TTTCATCCCTCGTCGAAAGGA	0.433																																																	0													158.0	141.0	147.0					17																	46919220		2203	4300	6503	SO:0001583	missense	0			BC004130	CCDS11538.1, CCDS58558.1, CCDS58559.1, CCDS58560.1, CCDS58561.1	17q21.32	2006-02-09				ENSG00000136436			29912	protein-coding gene	gene with protein product		604587				7540613	Standard	NM_001261390		Approved	MGC17318, NDP52	uc010wlr.3	Q13137		ENST00000258947.3:c.151C>T	17.37:g.46919220C>T	ENSP00000258947:p.Arg51Cys		B2RBT0|B4DDC4|B4DDT4|B4DP36|B4E0C0|E7ENK0|E7ETP5|E9PBE5|Q53FQ5|Q53HB5|Q6IBN9|Q9BTF7	Missense_Mutation	SNP	pfam_CoCoA	p.R51C	ENST00000258947.3	37	c.151	CCDS11538.1	17	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851099	0.71719	.	.	ENSG00000136436	ENST00000258947;ENST00000509507;ENST00000448105;ENST00000509415;ENST00000416445;ENST00000505071;ENST00000502761	T;T;T;T;T;T;T	0.12879	2.98;2.64;2.64;2.98;2.98;2.98;2.98	6.07	5.1	0.69264	.	0.317776	0.27971	N	0.017114	T	0.20941	0.0504	M	0.64997	1.995	0.80722	D	1	P;B;B;B	0.46512	0.879;0.277;0.277;0.29	B;B;B;B	0.43123	0.409;0.099;0.099;0.189	T	0.01810	-1.1269	10	0.66056	D	0.02	-4.5483	16.4837	0.84171	0.1322:0.8678:0.0:0.0	.	51;51;51;51	E7ETP5;B4DP36;E9PBE5;Q13137	.;.;.;CACO2_HUMAN	C	51	ENSP00000258947:R51C;ENSP00000424352:R51C;ENSP00000398523:R51C;ENSP00000425692:R51C;ENSP00000406974:R51C;ENSP00000422697:R51C;ENSP00000424889:R51C	ENSP00000258947:R51C	R	+	1	0	CALCOCO2	44274219	0.947000	0.32204	0.135000	0.22099	0.894000	0.52154	2.294000	0.43567	1.561000	0.49584	0.655000	0.94253	CGT	CALCOCO2	-	pfam_CoCoA	ENSG00000136436		0.433	CALCOCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALCOCO2	HGNC	protein_coding	OTTHUMT00000360866.1		0.00	49	0	C	NM_005831		46919220	+1			no_errors	ENST00000258947	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.791	T
CCDC15	80071	genome.wustl.edu	37	11	124856678	124856678	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:124856678C>T	ENST00000344762.5	+	7	1053	c.794C>T	c.(793-795)tCt>tTt	p.S265F	CCDC15_ENST00000529051.1_Missense_Mutation_p.S265F	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	265						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		GAATCTTCATCTCTTGTAACT	0.453																																																	0													41.0	42.0	42.0					11																	124856678		1833	4036	5869	SO:0001583	missense	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.794C>T	11.37:g.124856678C>T	ENSP00000341684:p.Ser265Phe		Q9H8U7	Missense_Mutation	SNP	NULL	p.S265F	ENST00000344762.5	37	c.794	CCDS44756.1	11	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369019	0.42003	.	.	ENSG00000149548	ENST00000529051;ENST00000344762	T;T	0.36520	1.25;1.25	3.97	2.06	0.26882	.	2.445670	0.02239	N	0.065555	T	0.39306	0.1073	L	0.56769	1.78	0.09310	N	1	B	0.23735	0.09	B	0.26310	0.068	T	0.32188	-0.9916	10	0.62326	D	0.03	-1.1	6.7909	0.23699	0.0:0.7831:0.0:0.2169	.	265	Q0P6D6	CCD15_HUMAN	F	265	ENSP00000435403:S265F;ENSP00000341684:S265F	ENSP00000341684:S265F	S	+	2	0	CCDC15	124361888	0.036000	0.19791	0.012000	0.15200	0.079000	0.17450	0.408000	0.21065	0.630000	0.30394	0.467000	0.42956	TCT	CCDC15	-	NULL	ENSG00000149548		0.453	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1	-	0.00	51	0	C	NM_025004		124856678	+1	tier1	-	no_errors	ENST00000344762	ensembl	human	known	74_37	missense	26.53	36	13	SNP	0.016	T
CCDC30	728621	genome.wustl.edu	37	1	42948563	42948563	+	Intron	DEL	A	A	-	rs202122677	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:42948563delA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						GGAACATGAGAAAAAAAAAAA	0.363													|||unknown(HR)	839	0.167532	0.1573	0.1556	5008	,	,		20659	0.1746		0.1998	False		,,,				2504	0.1493																0																																										SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+76A>-	1.37:g.42948563delA			Q14F06|Q5VVM5	RNA	DEL	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.363	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding			0.00	31	0	A	NM_025030		42948563	+1	tier1		no_errors	ENST00000475614	ensembl	human	known	74_37	rna	14.29	24	4	DEL	0.003	-
CCDC57	284001	genome.wustl.edu	37	17	80146217	80146217	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:80146217C>T	ENST00000389641.4	-	7	966	c.930G>A	c.(928-930)ctG>ctA	p.L310L	CCDC57_ENST00000392343.3_Silent_p.L310L|CCDC57_ENST00000392347.1_Silent_p.L310L			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	310										endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GCAGCTCCTGCAGCTGCTCCA	0.652																																																	0													30.0	35.0	34.0					17																	80146217		2175	4272	6447	SO:0001819	synonymous_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.930G>A	17.37:g.80146217C>T			A6NP51|A8MQC7|Q8IWG2|Q8TER3	Silent	SNP	NULL	p.L310	ENST00000389641.4	37	c.930		17																																																																																			CCDC57	-	NULL	ENSG00000176155		0.652	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	-	0.00	38	0	C	NM_198082		80146217	-1	tier1	-	no_errors	ENST00000389641	ensembl	human	known	74_37	silent	15.79	16	3	SNP	0.995	T
CCDC88B	283234	genome.wustl.edu	37	11	64118892	64118892	+	Intron	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:64118892A>G	ENST00000356786.5	+	18	3002				CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Intron|CCDC88B_ENST00000301897.4_Intron	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B							membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGCCTGTGGTAGGCACTAGGG	0.657																																																	0																																										SO:0001627	intron_variant	0			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.2959-56A>G	11.37:g.64118892A>G			A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	RNA	SNP	-	NULL	ENST00000356786.5	37	NULL	CCDS8072.2	11																																																																																			CCDC88B	-	-	ENSG00000168071		0.657	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	HGNC	protein_coding	OTTHUMT00000104845.1	-	0.00	90	0	A	NM_032251		64118892	+1	tier1	-	no_errors	ENST00000463837	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.030	G
CCM2L	140706	genome.wustl.edu	37	20	30605787	30605787	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:30605787G>A	ENST00000300415.8	+	4	301	c.288G>A	c.(286-288)ctG>ctA	p.L96L	CCM2L_ENST00000262659.8_Silent_p.L96L			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like	96																	TGCAGCAGCTGAAGGAGCTGC	0.637																																																	0													30.0	32.0	31.0					20																	30605787		2202	4300	6502	SO:0001819	synonymous_variant	0			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.288G>A	20.37:g.30605787G>A			Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	Silent	SNP	NULL	p.L96	ENST00000300415.8	37	c.288		20																																																																																			CCM2L	-	NULL	ENSG00000101331		0.637	CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCM2L	HGNC	protein_coding		-	0.00	34	0	G	NM_080625		30605787	+1	tier1	-	no_errors	ENST00000300415	ensembl	human	known	74_37	silent	22.81	44	13	SNP	1.000	A
CD109	135228	genome.wustl.edu	37	6	74530287	74530287	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:74530287A>C	ENST00000287097.5	+	32	4274	c.4162A>C	c.(4162-4164)Agg>Cgg	p.R1388R	CD109_ENST00000422508.2_Splice_Site_p.R1311R|CD109_ENST00000437994.2_Splice_Site_p.R1371R			Q6YHK3	CD109_HUMAN	CD109 molecule	1388					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTATGAGCCAAGTAAGTATGC	0.383																																																	0													75.0	75.0	75.0					6																	74530287		2203	4300	6503	SO:0001630	splice_region_variant	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.4162+1A>C	6.37:g.74530287A>C			A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Silent	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.R1388	ENST00000287097.5	37	c.4162	CCDS4982.1	6																																																																																			CD109	-	pfam_A-macroglobulin_rcpt-bd,superfamily_A-macroglobulin_rcpt-bd	ENSG00000156535		0.383	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	-	0.00	63	0	A	NM_133493	Silent	74530287	+1	tier1	-	no_errors	ENST00000287097	ensembl	human	known	74_37	silent	41.86	25	18	SNP	1.000	C
CD180	4064	genome.wustl.edu	37	5	66492452	66492452	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:66492452G>T	ENST00000256447.4	-	1	175	c.18C>A	c.(16-18)agC>agA	p.S6R		NM_005582.2	NP_005573.2	Q99467	CD180_HUMAN	CD180 molecule	6					B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|kidney(7)|large_intestine(12)|liver(1)|lung(8)|ovary(1)|stomach(2)	34		Lung NSC(167;4.94e-05)|Prostate(74;0.00601)|Ovarian(174;0.0654)|Breast(144;0.198)|Colorectal(97;0.234)		Lung(70;0.0046)		AAAAGAAGCAGCTGACGTCAA	0.483																																																	0													161.0	163.0	162.0					5																	66492452		2203	4300	6503	SO:0001583	missense	0			D83597	CCDS3992.1	5q12	2008-02-05	2006-03-28	2005-06-07	ENSG00000134061	ENSG00000134061		"""CD molecules"""	6726	protein-coding gene	gene with protein product		602226	"""lymphocyte antigen 64 (mouse) homolog, radioprotective, 105kD"", ""CD180 antigen"""	LY64		9763566, 8975706	Standard	NM_005582		Approved	RP105, Ly78	uc003juy.2	Q99467	OTTHUMG00000131229	ENST00000256447.4:c.18C>A	5.37:g.66492452G>T	ENSP00000256447:p.Ser6Arg		B2R7Z7|Q32MM5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S6R	ENST00000256447.4	37	c.18	CCDS3992.1	5	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328860	0.60743	.	.	ENSG00000134061	ENST00000256447	T	0.36157	1.27	4.99	3.22	0.36961	.	0.828452	0.11071	N	0.602873	T	0.32376	0.0827	M	0.65975	2.015	0.21473	N	0.999678	P	0.40476	0.718	B	0.33042	0.157	T	0.12268	-1.0554	10	0.34782	T	0.22	.	8.7655	0.34700	0.1759:0.0:0.8241:0.0	.	6	Q99467	CD180_HUMAN	R	6	ENSP00000256447:S6R	ENSP00000256447:S6R	S	-	3	2	CD180	66528208	0.216000	0.23585	0.334000	0.25495	0.064000	0.16182	1.127000	0.31357	0.823000	0.34589	0.591000	0.81541	AGC	CD180	-	NULL	ENSG00000134061		0.483	CD180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD180	HGNC	protein_coding	OTTHUMT00000253973.2	-	0.00	62	0	G	NM_005582		66492452	-1	tier1	-	no_errors	ENST00000256447	ensembl	human	known	74_37	missense	10.20	44	5	SNP	0.652	T
CDC6	990	genome.wustl.edu	37	17	38457815	38457815	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:38457815G>T	ENST00000209728.4	+	11	2019	c.1548G>T	c.(1546-1548)agG>agT	p.R516S	CTD-2267D19.6_ENST00000602403.1_lincRNA	NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	516					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						TGGAAGCCAGGGGCATTTTAG	0.433																																																	0													137.0	148.0	144.0					17																	38457815		2203	4300	6503	SO:0001583	missense	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.1548G>T	17.37:g.38457815G>T	ENSP00000209728:p.Arg516Ser		Q8TB30	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6/18	p.R516S	ENST00000209728.4	37	c.1548	CCDS11365.1	17	.	.	.	.	.	.	.	.	.	.	G	19.29	3.800006	0.70567	.	.	ENSG00000094804	ENST00000209728	T	0.42900	0.96	5.71	2.57	0.30868	Winged helix-turn-helix transcription repressor DNA-binding (1);CDC6, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60856	0.2301	M	0.84433	2.695	0.52501	D	0.99995	D	0.89917	1.0	D	0.75484	0.986	T	0.60910	-0.7169	10	0.15499	T	0.54	-6.308	9.5737	0.39445	0.2414:0.0:0.7586:0.0	.	516	Q99741	CDC6_HUMAN	S	516	ENSP00000209728:R516S	ENSP00000209728:R516S	R	+	3	2	CDC6	35711341	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.417000	0.34770	0.388000	0.25054	0.655000	0.94253	AGG	CDC6	-	pfam_Cdc6_C_dom,pirsf_Cell_div_Cdc6/18	ENSG00000094804		0.433	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	-	0.00	64	0	G			38457815	+1	tier1	-	no_errors	ENST00000209728	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
CDH11	1009	genome.wustl.edu	37	16	65005844	65005844	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:65005844A>G	ENST00000268603.4	-	10	2129	c.1514T>C	c.(1513-1515)cTt>cCt	p.L505P	CDH11_ENST00000394156.3_Missense_Mutation_p.L505P|CDH11_ENST00000566827.1_Missense_Mutation_p.L379P	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	505	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CTGGTTGGAAAGTGGCTTGGT	0.453			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													87.0	71.0	77.0					16																	65005844		2203	4300	6503	SO:0001583	missense	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1514T>C	16.37:g.65005844A>G	ENSP00000268603:p.Leu505Pro		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L505P	ENST00000268603.4	37	c.1514	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	A	13.98	2.398390	0.42512	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.59083	2.27;0.29	5.91	4.81	0.61882	Cadherin (1);Cadherin-like (1);	0.140067	0.31246	N	0.007989	T	0.40247	0.1109	N	0.08118	0	0.80722	D	1	B;P	0.51791	0.384;0.948	B;P	0.46049	0.26;0.502	T	0.30563	-0.9974	10	0.35671	T	0.21	.	10.7018	0.45931	0.857:0.0:0.0:0.143	.	505;505	P55287-2;P55287	.;CAD11_HUMAN	P	505;505;488	ENSP00000268603:L505P;ENSP00000377711:L505P	ENSP00000268603:L505P	L	-	2	0	CDH11	63563345	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.389000	0.52516	1.048000	0.40298	0.533000	0.62120	CTT	CDH11	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000140937		0.453	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	65	0	A	NM_033664		65005844	-1	tier1	-	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	65.12	15	28	SNP	0.999	G
CDH4	1002	genome.wustl.edu	37	20	60348099	60348099	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:60348099C>T	ENST00000360469.5	+	4	525	c.437C>T	c.(436-438)cCg>cTg	p.P146L	CDH4_ENST00000543233.1_Missense_Mutation_p.P72L	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	146					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GACCCCTCTCCGCCTCCGAAG	0.607																																																	0													40.0	38.0	39.0					20																	60348099		2203	4300	6503	SO:0001583	missense	0			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.437C>T	20.37:g.60348099C>T	ENSP00000353656:p.Pro146Leu		B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.P146L	ENST00000360469.5	37	c.437	CCDS13488.1	20	.	.	.	.	.	.	.	.	.	.	C	9.989	1.230318	0.22542	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.54675	0.56;0.57	4.84	-2.6	0.06190	Cadherin-like (1);	0.612407	0.16364	N	0.217658	T	0.24198	0.0586	N	0.08118	0	0.20975	N	0.999812	B	0.26318	0.146	B	0.13407	0.009	T	0.19031	-1.0318	9	.	.	.	.	9.9941	0.41889	0.3581:0.5335:0.0:0.1084	.	146	P55283	CADH4_HUMAN	L	146;54;72	ENSP00000353656:P146L;ENSP00000443301:P72L	.	P	+	2	0	CDH4	59781494	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.273000	0.18662	-0.381000	0.07882	0.655000	0.94253	CCG	CDH4	-	superfamily_Cadherin-like	ENSG00000179242		0.607	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	-	0.00	55	0	C	NM_001794		60348099	+1	tier1	-	no_errors	ENST00000360469	ensembl	human	known	74_37	missense	38.18	33	21	SNP	0.321	T
CEL	1056	genome.wustl.edu	37	9	135947058	135947058	+	Silent	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:135947058C>A	ENST00000372080.4	+	11	2194	c.2178C>A	c.(2176-2178)ccC>ccA	p.P726P	CEL_ENST00000351304.7_Silent_p.P657P	NM_001807.3	NP_001798.2	P19835	CEL_HUMAN	carboxyl ester lipase	723	17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process (GO:0006707)|fatty acid catabolic process (GO:0009062)|intestinal cholesterol absorption (GO:0030299)|intestinal lipid catabolic process (GO:0044258)|lipid digestion (GO:0044241)|lipid metabolic process (GO:0006629)|pancreatic juice secretion (GO:0030157)|protein esterification (GO:0018350)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	acylglycerol lipase activity (GO:0047372)|catalytic activity (GO:0003824)|heparin binding (GO:0008201)|hydrolase activity (GO:0016787)|sterol esterase activity (GO:0004771)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|pancreas(2)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)		CCGGGGCCCCCCCTGTGCCCC	0.716																																																	0													11.0	13.0	13.0					9																	135947058		1745	3970	5715	SO:0001819	synonymous_variant	0			M54994	CCDS43896.1	9q34.3	2013-03-13	2013-03-13		ENSG00000170835	ENSG00000170835	3.1.1.3, 3.1.1.13		1848	protein-coding gene	gene with protein product	"""bile salt-stimulated lipase"""	114840				1676983	Standard	NM_001807		Approved	BSSL, MODY8	uc010naa.2	P19835	OTTHUMG00000020855	ENST00000372080.4:c.2178C>A	9.37:g.135947058C>A			Q16398|Q5T7U7|Q9UCH1|Q9UP41	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.P726	ENST00000372080.4	37	c.2178	CCDS43896.1	9																																																																																			CEL	-	NULL	ENSG00000170835		0.716	CEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEL	HGNC	protein_coding	OTTHUMT00000054823.1	-	0.00	29	0	C			135947058	+1	tier1	-	no_errors	ENST00000372080	ensembl	human	known	74_37	silent	42.86	16	12	SNP	0.011	A
CELF2	10659	genome.wustl.edu	37	10	11363231	11363231	+	Silent	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:11363231C>A	ENST00000379261.4	+	11	1229	c.1137C>A	c.(1135-1137)acC>acA	p.T379T	CELF2_ENST00000609692.1_Silent_p.T359T|CELF2_ENST00000450189.1_Silent_p.T392T|CELF2_ENST00000537122.1_Silent_p.T274T|CELF2_ENST00000416382.2_Silent_p.T379T|CELF2_ENST00000608830.1_Silent_p.T359T|CELF2_ENST00000427450.1_Silent_p.T361T|CELF2_ENST00000315874.4_Silent_p.T361T|CELF2_ENST00000417956.2_Silent_p.T359T|CELF2_ENST00000354897.3_Silent_p.T373T|CELF2_ENST00000542579.1_Silent_p.T392T|CELF2-AS1_ENST00000379256.3_RNA|CELF2_ENST00000399850.3_Silent_p.T361T|CELF2_ENST00000354440.2_Silent_p.T361T	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	379	Ala-rich.|Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CGGCTGGCACCATGGACGCCC	0.582																																																	0													112.0	107.0	109.0					10																	11363231		2074	4218	6292	SO:0001819	synonymous_variant	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.1137C>A	10.37:g.11363231C>A			B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.T392	ENST00000379261.4	37	c.1176	CCDS44354.1	10																																																																																			CELF2	-	NULL	ENSG00000048740		0.582	CELF2-201	KNOWN	basic|CCDS	protein_coding	CELF2	HGNC	protein_coding		-	0.00	57	0	C			11363231	+1	tier1	-	no_errors	ENST00000450189	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.994	A
CHD1	1105	genome.wustl.edu	37	5	98233975	98233975	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:98233975A>G	ENST00000284049.3	-	9	1499	c.1350T>C	c.(1348-1350)ccT>ccC	p.P450P		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	450	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	AATCTTTAAAAGGAGTGGTTT	0.313																																																	0													73.0	74.0	73.0					5																	98233975		2202	4299	6501	SO:0001819	synonymous_variant	0			AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.1350T>C	5.37:g.98233975A>G			Q17RZ3	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P450	ENST00000284049.3	37	c.1350	CCDS34204.1	5																																																																																			CHD1	-	superfamily_P-loop_NTPase,pfscan_Chromo_domain/shadow	ENSG00000153922		0.313	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	HGNC	protein_coding	OTTHUMT00000370295.1	-	0.00	136	0	A	NM_001270		98233975	-1	tier1	-	no_errors	ENST00000284049	ensembl	human	known	74_37	silent	20.25	63	16	SNP	0.997	G
CHD4	1108	genome.wustl.edu	37	12	6711207	6711209	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:6711207_6711209delCTT	ENST00000357008.2	-	4	518_520	c.355_357delAAG	c.(355-357)aagdel	p.K119del	CHD4_ENST00000544040.1_In_Frame_Del_p.K112del|CHD4_ENST00000544484.1_In_Frame_Del_p.K116del|CHD4_ENST00000309577.6_In_Frame_Del_p.K119del	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	119	Poly-Lys.				ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)	p.K119delK(3)		central_nervous_system(2)	2						TAGGTCCAAGCTTCTTCTTCTTC	0.537																																					Colon(32;586 792 4568 16848 45314)												3	Deletion - In frame(3)	central_nervous_system(3)								115,4123		4,107,2008						4.7	1.0			29	227,7995		2,223,3886	no	coding	CHD4	NM_001273.2		6,330,5894	A1A1,A1R,RR		2.7609,2.7135,2.7448				342,12118				SO:0001651	inframe_deletion	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.355_357delAAG	12.37:g.6711216_6711218delCTT	ENSP00000349508:p.Lys119del		Q8IXZ5	In_Frame_Del	DEL	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K119in_frame_del	ENST00000357008.2	37	c.357_355	CCDS8552.1	12																																																																																			CHD4	-	NULL	ENSG00000111642		0.537	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding			0.00	27	0	CTT	NM_001273		6711209	-1	tier1		no_errors	ENST00000309577	ensembl	human	known	74_37	in_frame_del	14.29	12	2	DEL	0.999:1.000:1.000	-
CLEC4F	165530	genome.wustl.edu	37	2	71043374	71043374	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:71043374T>C	ENST00000272367.2	-	4	1215	c.1139A>G	c.(1138-1140)aAt>aGt	p.N380S	CLEC4F_ENST00000426626.1_Missense_Mutation_p.N380S	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	380					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						CATATGACCATTTAAGACCTG	0.413																																					Colon(107;10 2157 6841 26035)												0													119.0	119.0	119.0					2																	71043374		2203	4300	6503	SO:0001583	missense	0			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.1139A>G	2.37:g.71043374T>C	ENSP00000272367:p.Asn380Ser		A4QPA5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Prefoldin,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.N380S	ENST00000272367.2	37	c.1139	CCDS1910.1	2	.	.	.	.	.	.	.	.	.	.	T	0.747	-0.774141	0.02951	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.76060	-0.99;-0.99	3.88	-2.78	0.05859	.	0.687592	0.12639	N	0.451500	T	0.50240	0.1604	N	0.19112	0.55	0.09310	N	1	B;B	0.25719	0.01;0.132	B;B	0.20767	0.013;0.031	T	0.28332	-1.0047	10	0.27082	T	0.32	.	4.7386	0.13001	0.1861:0.4899:0.0:0.324	.	380;380	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	S	380	ENSP00000272367:N380S;ENSP00000390581:N380S	ENSP00000272367:N380S	N	-	2	0	CLEC4F	70896882	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.695000	0.05109	-0.533000	0.06323	0.383000	0.25322	AAT	CLEC4F	-	NULL	ENSG00000152672		0.413	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	HGNC	protein_coding	OTTHUMT00000251922.1	-	0.00	84	0	T	NM_173535		71043374	-1	tier1	-	no_errors	ENST00000272367	ensembl	human	known	74_37	missense	20.88	72	19	SNP	0.000	C
CLASP1	23332	genome.wustl.edu	37	2	122145385	122145385	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:122145385G>T	ENST00000263710.4	-	31	3610	c.3221C>A	c.(3220-3222)aCc>aAc	p.T1074N	CLASP1_ENST00000545861.1_Missense_Mutation_p.T820N|CLASP1_ENST00000397587.3_Missense_Mutation_p.T1053N|CLASP1_ENST00000541377.1_Missense_Mutation_p.T1052N|CLASP1_ENST00000541859.1_Missense_Mutation_p.T830N|CLASP1_ENST00000409078.3_Missense_Mutation_p.T1046N|CLASP1_ENST00000455322.2_Missense_Mutation_p.T1069N	NM_015282.2	NP_056097.1	Q7Z460	CLAP1_HUMAN	cytoplasmic linker associated protein 1	1074					axon guidance (GO:0007411)|cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|establishment or maintenance of cell polarity (GO:0007163)|exit from mitosis (GO:0010458)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)	cell cortex (GO:0005938)|centrosomal corona (GO:0031592)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|spindle microtubule (GO:0005876)	kinetochore binding (GO:0043515)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)	47	Renal(3;0.0496)					CAGGAGTTTGGTGGCACCATC	0.463																																																	0													191.0	195.0	194.0					2																	122145385		2027	4185	6212	SO:0001583	missense	0			AB014522		2q14.2-q14.3	2013-01-18			ENSG00000074054	ENSG00000074054			17088	protein-coding gene	gene with protein product	"""multiple asters 1"""	605852				9734811, 10899121, 16914514	Standard	NM_015282		Approved	KIAA0622, MAST1	uc002tnc.3	Q7Z460	OTTHUMG00000153331	ENST00000263710.4:c.3221C>A	2.37:g.122145385G>T	ENSP00000263710:p.Thr1074Asn		B7ZLX3|O75118|Q2KHQ9|Q5H9P0|Q8N5B8|Q9BQT5	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.T1074N	ENST00000263710.4	37	c.3221		2	.	.	.	.	.	.	.	.	.	.	G	34	5.302320	0.95601	.	.	ENSG00000074054	ENST00000263710;ENST00000455322;ENST00000397587;ENST00000541377;ENST00000541859;ENST00000409078;ENST00000545861	T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	6.17	6.17	0.99709	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78220	0.4249	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	0.999;0.997;0.995;1.0	D;D;P;D	0.83275	0.991;0.945;0.883;0.996	T	0.74287	-0.3714	10	0.44086	T	0.13	-13.7918	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1046;1053;1054;1074	E7EUA5;F5GWS0;A2RU21;Q7Z460	.;.;.;CLAP1_HUMAN	N	1074;1069;1053;1052;830;1046;820	ENSP00000263710:T1074N;ENSP00000389372:T1069N;ENSP00000380717:T1053N;ENSP00000441625:T1052N;ENSP00000441770:T830N;ENSP00000386442:T1046N;ENSP00000438620:T820N	ENSP00000263710:T1074N	T	-	2	0	CLASP1	121861855	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.434000	0.97515	2.941000	0.99782	0.655000	0.94253	ACC	CLASP1	-	superfamily_ARM-type_fold	ENSG00000074054		0.463	CLASP1-201	KNOWN	basic	protein_coding	CLASP1	HGNC	protein_coding			0.00	71	0	G	NM_015282		122145385	-1			no_errors	ENST00000263710	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
CNBD1	168975	genome.wustl.edu	37	8	88365874	88365874	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:88365874delA	ENST00000518476.1	+	10	1214	c.1163delA	c.(1162-1164)caafs	p.Q388fs		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	388										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						AAAAGATCTCAAAAACTTGTT	0.318																																																	0													58.0	58.0	58.0					8																	88365874		1799	4062	5861	SO:0001589	frameshift_variant	0			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.1163delA	8.37:g.88365874delA	ENSP00000430073:p.Gln388fs			Frame_Shift_Del	DEL	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.K389fs	ENST00000518476.1	37	c.1163	CCDS55259.1	8																																																																																			CNBD1	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	ENSG00000176571		0.318	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	HGNC	protein_coding	OTTHUMT00000375113.2		0.00	83	0	A	NM_173538		88365874	+1	tier1		no_errors	ENST00000518476	ensembl	human	known	74_37	frame_shift_del	26.96	84	31	DEL	0.000	-
CNTNAP5	129684	genome.wustl.edu	37	2	125405341	125405341	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:125405341A>G	ENST00000431078.1	+	13	2244	c.1880A>G	c.(1879-1881)aAg>aGg	p.K627R		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	627	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCAGAGGACAAGATCTGGACA	0.542																																																	0													38.0	38.0	38.0					2																	125405341		2104	4237	6341	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1880A>G	2.37:g.125405341A>G	ENSP00000399013:p.Lys627Arg		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.K627R	ENST00000431078.1	37	c.1880	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	A	18.06	3.538442	0.65085	.	.	ENSG00000155052	ENST00000431078	T	0.20463	2.07	5.5	2.95	0.34219	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (2);	0.000000	0.53938	D	0.000058	T	0.33323	0.0859	L	0.50847	1.595	0.48696	D	0.999692	D	0.71674	0.998	D	0.77004	0.989	T	0.09684	-1.0663	10	0.10636	T	0.68	.	11.46	0.50204	0.7146:0.2854:0.0:0.0	.	627	Q8WYK1	CNTP5_HUMAN	R	627	ENSP00000399013:K627R	ENSP00000399013:K627R	K	+	2	0	CNTNAP5	125121811	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	6.020000	0.70826	0.905000	0.36596	0.459000	0.35465	AAG	CNTNAP5	-	superfamily_Fibrinogen_a/b/g_C_dom	ENSG00000155052		0.542	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	85	0	A			125405341	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	47.27	29	26	SNP	1.000	G
COL11A1	1301	genome.wustl.edu	37	1	103345334	103345334	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:103345334T>G	ENST00000370096.3	-	66	5491	c.5179A>C	c.(5179-5181)Agt>Cgt	p.S1727R	COL11A1_ENST00000358392.2_Missense_Mutation_p.S1739R|COL11A1_ENST00000353414.4_Missense_Mutation_p.S1688R|COL11A1_ENST00000512756.1_Missense_Mutation_p.S1611R	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1727	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTGTCATAACTTCCTGATGAC	0.443																																																	0													160.0	142.0	148.0					1																	103345334		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.5179A>C	1.37:g.103345334T>G	ENSP00000359114:p.Ser1727Arg		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.S1739R	ENST00000370096.3	37	c.5215	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.058513	0.76074	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.52	3.22	0.36961	Fibrillar collagen, C-terminal (4);	0.190142	0.56097	D	0.000025	T	0.63698	0.2533	M	0.85542	2.76	0.52099	D	0.999942	B;B;P;P;B	0.38335	0.049;0.126;0.573;0.627;0.039	B;B;B;B;B	0.36989	0.077;0.109;0.232;0.238;0.056	T	0.64719	-0.6341	10	0.48119	T	0.1	.	9.7059	0.40216	0.0:0.1405:0.0:0.8595	.	1611;1688;1739;1727;947	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	R	1727;1739;1688;947;1611	ENSP00000359114:S1727R;ENSP00000351163:S1739R;ENSP00000302551:S1688R;ENSP00000426533:S1611R	ENSP00000302551:S1688R	S	-	1	0	COL11A1	103117922	1.000000	0.71417	0.954000	0.39281	0.955000	0.61496	3.373000	0.52394	0.483000	0.27608	0.482000	0.46254	AGT	COL11A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000060718		0.443	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	62	0	T	NM_080630		103345334	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	39.13	28	18	SNP	1.000	G
COL17A1	1308	genome.wustl.edu	37	10	105801273	105801273	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:105801273G>A	ENST00000353479.5	-	37	2865	c.2575C>T	c.(2575-2577)Cca>Tca	p.P859S	COL17A1_ENST00000369733.3_Missense_Mutation_p.P859S	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	859	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GGTGGGCCTGGGGGACCTTGT	0.522																																																	0													23.0	27.0	25.0					10																	105801273		2202	4299	6501	SO:0001583	missense	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2575C>T	10.37:g.105801273G>A	ENSP00000340937:p.Pro859Ser		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.P859S	ENST00000353479.5	37	c.2575	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109707	0.37242	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.92858	-3.12;-3.12	5.19	4.28	0.50868	.	0.299238	0.23736	N	0.045066	D	0.88385	0.6422	L	0.57536	1.79	0.80722	D	1	B	0.14805	0.011	B	0.10450	0.005	T	0.82577	-0.0388	10	0.18710	T	0.47	-4.187	10.1328	0.42689	0.093:0.0:0.907:0.0	.	859	Q9UMD9	COHA1_HUMAN	S	859	ENSP00000340937:P859S;ENSP00000358748:P859S	ENSP00000340937:P859S	P	-	1	0	COL17A1	105791263	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	3.379000	0.52440	1.375000	0.46248	0.491000	0.48974	CCA	COL17A1	-	NULL	ENSG00000065618		0.522	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	-	0.00	94	0	G	NM_130778, NM_000494		105801273	-1	tier1	-	no_errors	ENST00000353479	ensembl	human	known	74_37	missense	23.60	68	21	SNP	1.000	A
COL4A5	1287	genome.wustl.edu	37	X	107840674	107840674	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:107840674C>A	ENST00000361603.2	+	24	1899	c.1655C>A	c.(1654-1656)aCt>aAt	p.T552N	COL4A5_ENST00000328300.6_Missense_Mutation_p.T552N	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	552	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GATATCCTCACTTTTCCAGGA	0.507									Alport syndrome with Diffuse Leiomyomatosis																																								0													81.0	80.0	80.0					X																	107840674		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1655C>A	X.37:g.107840674C>A	ENSP00000354505:p.Thr552Asn		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.T552N	ENST00000361603.2	37	c.1655	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	c	13.41	2.228801	0.39399	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.92752	-3.1;-3.1	5.58	5.58	0.84498	.	0.141387	0.47852	D	0.000220	D	0.82852	0.5127	N	0.08118	0	0.30017	N	0.814697	B;B;B	0.15473	0.006;0.013;0.006	B;B;B	0.12156	0.007;0.005;0.007	T	0.75022	-0.3464	10	0.25751	T	0.34	.	13.5833	0.61915	0.155:0.845:0.0:0.0	.	552;160;552	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	N	552	ENSP00000331902:T552N;ENSP00000354505:T552N	ENSP00000331902:T552N	T	+	2	0	COL4A5	107727330	0.666000	0.27475	1.000000	0.80357	0.996000	0.88848	1.559000	0.36320	2.344000	0.79699	0.597000	0.82753	ACT	COL4A5	-	NULL	ENSG00000188153		0.507	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	-	0.00	112	0	C			107840674	+1	tier1	-	no_errors	ENST00000328300	ensembl	human	known	74_37	missense	23.29	56	17	SNP	1.000	A
CRAMP1L	57585	genome.wustl.edu	37	16	1723954	1723954	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:1723954G>T	ENST00000397412.3	+	21	3817	c.3718G>T	c.(3718-3720)Gcc>Tcc	p.A1240S	LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000262317.4_Missense_Mutation_p.A615S|CRAMP1L_ENST00000436138.3_Missense_Mutation_p.A1237S|CRAMP1L_ENST00000293925.5_Missense_Mutation_p.A1240S			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1240	Ser-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CAATGACCTGGCCCAAGAGCT	0.552																																																	0													96.0	98.0	98.0					16																	1723954		2078	4229	6307	SO:0001583	missense	0			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3718G>T	16.37:g.1723954G>T	ENSP00000380559:p.Ala1240Ser		A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.A1240S	ENST00000397412.3	37	c.3718	CCDS10440.2	16	.	.	.	.	.	.	.	.	.	.	G	36	5.856060	0.97030	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138;ENST00000262317	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.74238	0.3690	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.74131	-0.3764	9	0.66056	D	0.02	-37.2759	20.6439	0.99570	0.0:0.0:1.0:0.0	.	1240	Q96RY5	CRML_HUMAN	S	1240;1240;1237;615	.	ENSP00000262317:A615S	A	+	1	0	CRAMP1L	1663955	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.140000	0.94607	2.884000	0.98904	0.655000	0.94253	GCC	CRAMP1L	-	NULL	ENSG00000007545		0.552	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAMP1L	HGNC	protein_coding	OTTHUMT00000157297.4	-	0.00	61	0	G			1723954	+1	tier1	-	no_errors	ENST00000293925	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	T
TLN1	7094	genome.wustl.edu	37	9	35732839	35732839	+	5'Flank	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:35732839G>T	ENST00000314888.9	-	0	0				CREB3_ENST00000353704.2_Missense_Mutation_p.G24W|CREB3_ENST00000486056.1_3'UTR|TLN1_ENST00000540444.1_5'Flank	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGGAGATTTGGGGACGGCACC	0.602																																																	0													82.0	83.0	82.0					9																	35732839		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874		9.37:g.35732839G>T	Exception_encountered		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.G24W	ENST00000314888.9	37	c.70	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	G	0.639	-0.814263	0.02798	.	.	ENSG00000107175	ENST00000353704	T	0.63744	-0.06	4.83	1.77	0.24775	.	1.385440	0.04789	N	0.431374	T	0.50034	0.1592	N	0.20685	0.6	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.41998	-0.9477	10	0.52906	T	0.07	.	9.846	0.41028	0.0741:0.0:0.6748:0.2511	.	24	O43889-2	.	W	24	ENSP00000342136:G24W	ENSP00000342136:G24W	G	+	1	0	CREB3	35722839	0.026000	0.19158	0.010000	0.14722	0.003000	0.03518	0.225000	0.17757	-0.081000	0.12662	-2.615000	0.00158	GGG	CREB3	-	NULL	ENSG00000107175		0.602	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3	HGNC	protein_coding	OTTHUMT00000052353.2	-	0.00	89	0	G	NM_006289		35732839	+1	tier1	-	no_errors	ENST00000353704	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.051	T
CST8	10047	genome.wustl.edu	37	20	23473636	23473636	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:23473636C>T	ENST00000246012.1	+	3	630	c.273C>T	c.(271-273)gcC>gcT	p.A91A		NM_005492.2	NP_005483.1	O60676	CST8_HUMAN	cystatin 8 (cystatin-related epididymal specific)	91					negative regulation of endopeptidase activity (GO:0010951)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(9)|skin(2)	16	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TAGAAATTGCCCGCAGCGATT	0.378																																																	0													146.0	156.0	152.0					20																	23473636		2203	4300	6503	SO:0001819	synonymous_variant	0			AF059244	CCDS13156.1	20p11.21	2012-08-14			ENSG00000125815	ENSG00000125815			2480	protein-coding gene	gene with protein product		608683				7619504, 20565543	Standard	NM_005492		Approved	CRES, CTES5	uc002wth.1	O60676	OTTHUMG00000032071	ENST00000246012.1:c.273C>T	20.37:g.23473636C>T			Q2M2X6	Silent	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.A91	ENST00000246012.1	37	c.273	CCDS13156.1	20																																																																																			CST8	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	ENSG00000125815		0.378	CST8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST8	HGNC	protein_coding	OTTHUMT00000078336.1	-	0.00	46	0	C			23473636	+1	tier1	-	no_errors	ENST00000246012	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.927	T
CTC1	80169	genome.wustl.edu	37	17	8133261	8133261	+	Silent	SNP	G	G	T	rs202138550	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:8133261G>T	ENST00000315684.8	-	18	2966	c.2959C>A	c.(2959-2961)Cgg>Agg	p.R987R		NM_025099.5	NP_079375.3	Q2NKJ3	CTC1_HUMAN	CTS telomere maintenance complex component 1	987			R -> W (in CRMCC). {ECO:0000269|PubMed:22267198}.		bone marrow development (GO:0048539)|cellular response to DNA damage stimulus (GO:0006974)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organism growth (GO:0035264)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|replicative senescence (GO:0090399)|spleen development (GO:0048536)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)|thymus development (GO:0048538)	nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)			NS(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|skin(4)	29						GTGGATGACCGGAAACAACAA	0.498																																																	0													121.0	124.0	123.0					17																	8133261		2003	4184	6187	SO:0001819	synonymous_variant	0			AL831955	CCDS42259.1	17p13.1	2011-02-21	2011-02-21	2011-02-21	ENSG00000178971	ENSG00000178971			26169	protein-coding gene	gene with protein product	"""conserved telomere maintenance component 1"", ""alpha accessory factor 132"", ""conserved telomere capping protein 1"""	613129	"""tmp494178"", ""chromosome 17 open reading frame 68"""	C17orf68		19854130, 19854131	Standard	NM_025099		Approved	FLJ22170, AAF132	uc002gkq.4	Q2NKJ3		ENST00000315684.8:c.2959C>A	17.37:g.8133261G>T			B3KR66|C9JEX5|Q1PCD1|Q2TBE3|Q8N3S6|Q9H6L0	Silent	SNP	NULL	p.R987	ENST00000315684.8	37	c.2959	CCDS42259.1	17																																																																																			CTC1	-	NULL	ENSG00000178971		0.498	CTC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CTC1	HGNC	protein_coding	OTTHUMT00000442012.1		0.00	46	0	G	NM_025099		8133261	-1			no_errors	ENST00000315684	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
CTNNA3	29119	genome.wustl.edu	37	10	68040264	68040264	+	Silent	SNP	T	T	C	rs182490263		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:68040264T>C	ENST00000433211.2	-	13	2022	c.1848A>G	c.(1846-1848)acA>acG	p.T616T	CTNNA3_ENST00000373744.4_Silent_p.T616T	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3									p.T616T(2)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TATCATGAATTGTATCATAGA	0.368																																																	2	Substitution - coding silent(2)	lung(2)											172.0	166.0	168.0					10																	68040264		2203	4300	6503	SO:0001819	synonymous_variant	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1848A>G	10.37:g.68040264T>C				Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.T616	ENST00000433211.2	37	c.1848	CCDS7269.1	10																																																																																			CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000183230		0.368	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2		0.00	34	0	T	NM_013266		68040264	-1			no_errors	ENST00000373744	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.999	C
CTNNB1	1499	genome.wustl.edu	37	3	41266205	41266205	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:41266205C>T	ENST00000349496.5	+	3	482	c.202C>T	c.(202-204)Cag>Tag	p.Q68*	CTNNB1_ENST00000396185.3_Nonsense_Mutation_p.Q68*|CTNNB1_ENST00000453024.1_Nonsense_Mutation_p.Q61*|CTNNB1_ENST00000396183.3_Nonsense_Mutation_p.Q68*|CTNNB1_ENST00000405570.1_Nonsense_Mutation_p.Q68*	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	68					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M1_A87del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.P16_K133del(1)|p.Q68*(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.M8_A80del(1)|p.A21_A80del(1)|p.V22_S71>A(1)|p.A20_S111del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGAGTGGGAACAGGGATTTTC	0.428		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	106	Deletion - In frame(83)|Complex - deletion inframe(15)|Unknown(7)|Substitution - Nonsense(1)	liver(76)|large_intestine(16)|stomach(8)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)											52.0	51.0	51.0					3																	41266205		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.202C>T	3.37:g.41266205C>T	ENSP00000344456:p.Gln68*		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Nonsense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.Q68*	ENST00000349496.5	37	c.202	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.871387	0.97049	.	.	ENSG00000168036	ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	.	.	.	5.91	5.91	0.95273	.	0.056069	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-2.5003	20.2983	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	68;68;68;68;61;68;68;68	.	ENSP00000344456:Q68X	Q	+	1	0	CTNNB1	41241209	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	4.842000	0.62831	2.802000	0.96397	0.655000	0.94253	CAG	CTNNB1	-	NULL	ENSG00000168036		0.428	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2		0.00	37	0	C	NM_001098210		41266205	+1			no_errors	ENST00000349496	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	1.000	T
CTSL	1514	genome.wustl.edu	37	9	90343605	90343605	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:90343605G>C	ENST00000343150.5	+	5	1392	c.502G>C	c.(502-504)Gac>Cac	p.D168H	CTSL_ENST00000342020.5_Missense_Mutation_p.D168H|CTSL_ENST00000340342.6_Missense_Mutation_p.D168H|CTSL_ENST00000495822.1_Intron			P07711	CATL1_HUMAN	cathepsin L	168					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										GAATCTGGTAGACTGCTCTGG	0.493																																																	0													136.0	133.0	134.0					9																	90343605		2203	4300	6503	SO:0001583	missense	0			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.502G>C	9.37:g.90343605G>C	ENSP00000345344:p.Asp168His		Q6IAV1|Q96QJ0	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.D168H	ENST00000343150.5	37	c.502	CCDS6675.1	9	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105810	0.77096	.	.	ENSG00000135047	ENST00000343150;ENST00000340342;ENST00000342020	T;T;T	0.32753	1.44;1.44;1.44	4.51	3.59	0.41128	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.73690	0.3619	H	0.99619	4.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85935	0.1454	10	0.87932	D	0	.	14.457	0.67423	0.0:0.1481:0.8518:0.0	.	168	P07711	CATL1_HUMAN	H	168	ENSP00000345344:D168H;ENSP00000365061:D168H;ENSP00000340470:D168H	ENSP00000365061:D168H	D	+	1	0	CTSL1	89533425	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	6.834000	0.75339	1.066000	0.40716	0.655000	0.94253	GAC	CTSL	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000135047		0.493	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL	HGNC	protein_coding	OTTHUMT00000052936.1	-	0.00	67	0	G	NM_001912		90343605	+1	tier1	-	no_errors	ENST00000340342	ensembl	human	known	74_37	missense	14.71	57	10	SNP	1.000	C
RTP5	285093	genome.wustl.edu	37	2	242811962	242811962	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:242811962C>T	ENST00000343216.3	+	1	82	c.54C>T	c.(52-54)gcC>gcT	p.A18A		NM_173821.2	NP_776182.2																					TGGCCATGGCCGAGAGGAAGC	0.701																																																	0													20.0	27.0	24.0					2																	242811962		2005	4161	6166	SO:0001819	synonymous_variant	0																														ENST00000343216.3:c.54C>T	2.37:g.242811962C>T				Silent	SNP	NULL	p.A18	ENST00000343216.3	37	c.54	CCDS42843.1	2																																																																																			CXXC11	-	NULL	ENSG00000188011		0.701	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1	-	0.00	165	0	C			242811962	+1	tier1	-	no_errors	ENST00000343216	ensembl	human	known	74_37	silent	28.04	77	30	SNP	0.020	T
CYB561D1	284613	genome.wustl.edu	37	1	110038827	110038827	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:110038827G>A	ENST00000420578.2	+	3	676	c.636G>A	c.(634-636)gtG>gtA	p.V212V	CYB561D1_ENST00000310611.4_3'UTR|CYB561D1_ENST00000527072.1_3'UTR|CYB561D1_ENST00000496961.1_3'UTR|CYB561D1_ENST00000393709.3_Silent_p.V155V|CYB561D1_ENST00000430195.2_3'UTR|CYB561D1_ENST00000369868.3_Silent_p.V234V|CYB561D1_ENST00000528785.1_Silent_p.V212V|CYB561D1_ENST00000533024.1_3'UTR			Q8N8Q1	C56D1_HUMAN	cytochrome b561 family, member D1	212	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|prostate(1)	5		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0422)|Epithelial(280;0.0655)|all cancers(265;0.0685)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		CAGCCCTGGTGATCATGCACC	0.537																																																	0													102.0	101.0	102.0					1																	110038827		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096354	CCDS800.1, CCDS44188.1, CCDS44189.1, CCDS44190.1, CCDS44191.1	1p13.2	2013-03-14	2013-03-14		ENSG00000174151	ENSG00000174151		"""Cytochrome b genes"""	26804	protein-coding gene	gene with protein product			"""cytochrome b-561 domain containing 1"""			23249217	Standard	NM_182580		Approved	FLJ39035, FLJ44753	uc010ovo.2	Q8N8Q1	OTTHUMG00000011051	ENST00000420578.2:c.636G>A	1.37:g.110038827G>A			B4DH97|E9PCM8|Q52M36|Q5T6C2|Q5T6C3	Silent	SNP	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	p.V234	ENST00000420578.2	37	c.702	CCDS800.1	1																																																																																			CYB561D1	-	pfscan_Cyt_b561/ferric_Rdtase_TM	ENSG00000174151		0.537	CYB561D1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYB561D1	HGNC	protein_coding	OTTHUMT00000030384.1	-	0.00	40	0	G	NM_182580		110038827	+1	tier1	-	no_errors	ENST00000369868	ensembl	human	known	74_37	silent	27.27	24	9	SNP	1.000	A
CYP27A1	1593	genome.wustl.edu	37	2	219679730	219679730	+	Missense_Mutation	SNP	C	C	G	rs374507635		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:219679730C>G	ENST00000258415.4	+	9	2000	c.1573C>G	c.(1573-1575)Cag>Gag	p.Q525E		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	525					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	AGTGGGCCTGCAGTTCCTGCA	0.597																																																	0													102.0	93.0	96.0					2																	219679730		2203	4300	6503	SO:0001583	missense	0			BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.1573C>G	2.37:g.219679730C>G	ENSP00000258415:p.Gln525Glu		A8K303|Q6LDB4|Q86YQ6	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.Q525E	ENST00000258415.4	37	c.1573	CCDS2423.1	2	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444307	0.25987	.	.	ENSG00000135929	ENST00000258415	T	0.68181	-0.31	4.39	2.4	0.29515	.	0.693854	0.15174	N	0.276497	T	0.45337	0.1337	N	0.20986	0.625	0.09310	N	0.999997	B	0.19583	0.037	B	0.18871	0.023	T	0.17868	-1.0355	10	0.22109	T	0.4	-0.5045	4.672	0.12694	0.1425:0.6075:0.1579:0.0921	.	525	Q02318	CP27A_HUMAN	E	525	ENSP00000258415:Q525E	ENSP00000258415:Q525E	Q	+	1	0	CYP27A1	219387974	0.909000	0.30893	0.915000	0.36163	0.832000	0.47134	1.818000	0.39012	1.145000	0.42336	-0.140000	0.14226	CAG	CYP27A1	-	superfamily_Cyt_P450	ENSG00000135929		0.597	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP27A1	HGNC	protein_coding	OTTHUMT00000109734.4	-	0.00	37	0	C			219679730	+1	tier1	-	no_errors	ENST00000258415	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.466	G
CYR61	3491	genome.wustl.edu	37	1	86048536	86048536	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:86048536C>T	ENST00000451137.2	+	5	1181	c.957C>T	c.(955-957)gaC>gaT	p.D319D		NM_001554.4	NP_001545.2	O00622	CYR61_HUMAN	cysteine-rich, angiogenic inducer, 61	319	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				anatomical structure morphogenesis (GO:0009653)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|cell proliferation (GO:0008283)|chemotaxis (GO:0006935)|chondroblast differentiation (GO:0060591)|chorio-allantoic fusion (GO:0060710)|extracellular matrix organization (GO:0030198)|intussusceptive angiogenesis (GO:0002041)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of apoptotic process (GO:0043066)|osteoblast differentiation (GO:0001649)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reactive oxygen species metabolic process (GO:0072593)|regulation of cell growth (GO:0001558)|regulation of ERK1 and ERK2 cascade (GO:0070372)|ventricular septum development (GO:0003281)|wound healing, spreading of cells (GO:0044319)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|prostate(1)	5				all cancers(265;0.0216)|Epithelial(280;0.0441)		CCTGCGTGGACGGCCGATGCT	0.547											OREG0013583	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													60.0	53.0	56.0					1																	86048536		2203	4300	6503	SO:0001819	synonymous_variant	0			AF031385	CCDS706.1	1p22.3	2008-02-05			ENSG00000142871	ENSG00000142871			2654	protein-coding gene	gene with protein product		602369		IGFBP10		9135077	Standard	NM_001554		Approved	GIG1, CCN1	uc001dle.3	O00622	OTTHUMG00000010577	ENST00000451137.2:c.957C>T	1.37:g.86048536C>T		1241	O14934|O43775|Q9BZL7	Silent	SNP	pfam_Cys_knot,pfam_IGFBP-like,pfam_VWF_C,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D319	ENST00000451137.2	37	c.957	CCDS706.1	1																																																																																			CYR61	-	pfam_Cys_knot,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C	ENSG00000142871		0.547	CYR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYR61	HGNC	protein_coding	OTTHUMT00000029187.1	-	0.00	64	0	C	NM_001554		86048536	+1	tier1	-	no_errors	ENST00000451137	ensembl	human	known	74_37	silent	26.09	34	12	SNP	0.946	T
DAPK1	1612	genome.wustl.edu	37	9	90321700	90321700	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:90321700delC	ENST00000408954.3	+	26	4049	c.3714delC	c.(3712-3714)agcfs	p.S1238fs	DAPK1_ENST00000358077.5_Frame_Shift_Del_p.S1238fs|DAPK1_ENST00000491893.1_Frame_Shift_Del_p.S1172fs|DAPK1_ENST00000472284.1_Frame_Shift_Del_p.S1238fs|DAPK1_ENST00000469640.2_Frame_Shift_Del_p.S1263fs	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1238					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ATTACCTGAGCCCCCAGCAGC	0.597									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													29.0	33.0	32.0					9																	90321700		2130	4248	6378	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3714delC	9.37:g.90321700delC	ENSP00000386135:p.Ser1238fs		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.Q1265fs	ENST00000408954.3	37	c.3789	CCDS43842.1	9																																																																																			DAPK1	-	NULL	ENSG00000196730		0.597	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1		0.00	25	0	C	NM_004938		90321700	+1	tier1		no_errors	ENST00000469640	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
DAPK1	1612	genome.wustl.edu	37	9	90254585	90254585	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:90254585G>A	ENST00000408954.3	+	6	909	c.574G>A	c.(574-576)Gaa>Aaa	p.E192K	DAPK1_ENST00000358077.5_Missense_Mutation_p.E192K|DAPK1_ENST00000491893.1_Missense_Mutation_p.E192K|DAPK1_ENST00000472284.1_Missense_Mutation_p.E192K|DAPK1_ENST00000469640.2_Missense_Mutation_p.E192K	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	192	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AGTCAACTATGAACCTCTTGG	0.388									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													361.0	320.0	333.0					9																	90254585		1924	4129	6053	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.574G>A	9.37:g.90254585G>A	ENSP00000386135:p.Glu192Lys		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.E192K	ENST00000408954.3	37	c.574	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.516372	0.96402	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000057	T	0.73938	0.3651	L	0.41079	1.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.996	D;D;D	0.81914	0.992;0.995;0.991	T	0.75077	-0.3445	10	0.87932	D	0	.	19.6142	0.95626	0.0:0.0:1.0:0.0	.	192;192;192	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	K	192	ENSP00000350785:E192K;ENSP00000417076:E192K;ENSP00000418885:E192K;ENSP00000386135:E192K;ENSP00000419026:E192K	ENSP00000350785:E192K	E	+	1	0	DAPK1	89444405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.601000	0.98297	2.941000	0.99782	0.655000	0.94253	GAA	DAPK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000196730		0.388	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1		0.00	116	0	G	NM_004938		90254585	+1			no_errors	ENST00000469640	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	A
DCC	1630	genome.wustl.edu	37	18	50985741	50985741	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr18:50985741T>G	ENST00000442544.2	+	24	4148	c.3532T>G	c.(3532-3534)Tct>Gct	p.S1178A	DCC_ENST00000581580.1_Missense_Mutation_p.S813A	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1178					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AGGAAGGGACTCTCCCATCCA	0.483																																																	0													140.0	137.0	138.0					18																	50985741		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3532T>G	18.37:g.50985741T>G	ENSP00000389140:p.Ser1178Ala			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1178A	ENST00000442544.2	37	c.3532	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	T	12.61	1.990389	0.35131	.	.	ENSG00000187323	ENST00000442544	T	0.48201	0.82	5.93	4.76	0.60689	Neogenin, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.56529	0.1991	L	0.51422	1.61	0.41784	D	0.989831	D	0.55172	0.97	P	0.60068	0.868	T	0.53215	-0.8470	10	0.32370	T	0.25	-5.4404	11.6178	0.51099	0.1335:0.0:0.0:0.8665	.	1178	P43146	DCC_HUMAN	A	1178	ENSP00000389140:S1178A	ENSP00000389140:S1178A	S	+	1	0	DCC	49239739	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	3.048000	0.49862	1.046000	0.40249	0.533000	0.62120	TCT	DCC	-	pfam_Neogenin_C	ENSG00000187323		0.483	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	36	0	T	NM_005215		50985741	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	70.83	7	17	SNP	1.000	G
DFNA5	1687	genome.wustl.edu	37	7	24758817	24758817	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:24758817G>A	ENST00000342947.3	-	4	850	c.425C>T	c.(424-426)cCt>cTt	p.P142L	DFNA5_ENST00000409970.1_5'UTR|DFNA5_ENST00000409775.3_Missense_Mutation_p.P142L|DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000545231.1_5'UTR|DFNA5_ENST00000419307.1_5'UTR	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	142			P -> T (in dbSNP:rs754554). {ECO:0000269|PubMed:12690205}.		apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						CTGGAGCACAGGGTTTCTCAG	0.483																																					GBM(78;184 1250 20134 20900 23600)												0													111.0	107.0	108.0					7																	24758817		2203	4300	6503	SO:0001583	missense	0			AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.425C>T	7.37:g.24758817G>A	ENSP00000339587:p.Pro142Leu		A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	pfam_Gasdermin	p.P142L	ENST00000342947.3	37	c.425	CCDS5389.1	7	.	.	.	.	.	.	.	.	.	.	G	9.145	1.014747	0.19355	.	.	ENSG00000105928	ENST00000342947;ENST00000409775	T;T	0.22134	1.97;1.97	5.17	3.33	0.38152	.	0.885835	0.10104	N	0.715585	T	0.16428	0.0395	L	0.31207	0.915	0.25894	N	0.983434	B;B	0.18461	0.028;0.028	B;B	0.24541	0.054;0.054	T	0.31280	-0.9949	10	0.33141	T	0.24	-2.0218	8.1278	0.31010	0.0909:0.1603:0.7488:0.0	.	142;142	A4FTY0;O60443	.;DFNA5_HUMAN	L	142	ENSP00000339587:P142L;ENSP00000386670:P142L	ENSP00000339587:P142L	P	-	2	0	DFNA5	24725342	0.052000	0.20516	0.000000	0.03702	0.002000	0.02628	2.077000	0.41557	0.548000	0.28955	-0.165000	0.13383	CCT	DFNA5	-	pfam_Gasdermin	ENSG00000105928		0.483	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNA5	HGNC	protein_coding	OTTHUMT00000214060.2		0.00	25	0	G	NM_004403		24758817	-1			no_errors	ENST00000342947	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.002	A
DIO2	1734	genome.wustl.edu	37	14	80669483	80669483	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:80669483A>G	ENST00000557010.1	-	4	756	c.371T>C	c.(370-372)cTa>cCa	p.L124P	DIO2_ENST00000438257.4_Missense_Mutation_p.L124P|DIO2_ENST00000422005.3_Missense_Mutation_p.L124P|DIO2_ENST00000557125.1_Intron|DIO2_ENST00000555750.1_Missense_Mutation_p.L160P	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	124					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		GTTGACCACTAGTGGGCGCTC	0.557											OREG0022848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													50.0	53.0	52.0					14																	80669483		2067	4209	6276	SO:0001583	missense	0			AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.371T>C	14.37:g.80669483A>G	ENSP00000451419:p.Leu124Pro	1200	B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	pfam_Iodothyronine_deiodinase	p.L124P	ENST00000557010.1	37	c.371	CCDS45146.1	14	.	.	.	.	.	.	.	.	.	.	A	23.4	4.417742	0.83449	.	.	ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000422005;ENST00000555750	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.63	5.63	0.86233	Thioredoxin-like fold (1);	0.000000	0.50627	D	0.000101	T	0.75517	0.3860	M	0.90977	3.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.81918	-0.0713	10	0.87932	D	0	.	15.8957	0.79333	1.0:0.0:0.0:0.0	.	160;124;160	Q92813-2;Q92813;G3V315	.;IOD2_HUMAN;.	P	124;124;124;160	ENSP00000405854:L124P;ENSP00000451419:L124P;ENSP00000411438:L124P;ENSP00000450980:L160P	ENSP00000411438:L124P	L	-	2	0	DIO2	79739236	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	9.062000	0.93920	2.159000	0.67721	0.473000	0.43528	CTA	DIO2	-	pfam_Iodothyronine_deiodinase	ENSG00000211448		0.557	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	DIO2	HGNC	protein_coding	OTTHUMT00000413428.2	-	0.00	60	0	A			80669483	-1	tier1	-	no_errors	ENST00000422005	ensembl	human	known	74_37	missense	57.14	21	28	SNP	1.000	G
DIP2B	57609	genome.wustl.edu	37	12	51102285	51102285	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:51102285G>A	ENST00000301180.5	+	22	2623	c.2589G>A	c.(2587-2589)gcG>gcA	p.A863A		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	863						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TGGTGGTTGCGGAACAAAGAC	0.493																																																	0													269.0	196.0	220.0					12																	51102285		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2589G>A	12.37:g.51102285G>A			Q6B011|Q8N1L5|Q8NB38	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A863	ENST00000301180.5	37	c.2589	CCDS31799.1	12																																																																																			DIP2B	-	NULL	ENSG00000066084		0.493	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	-	0.00	86	0	G	NM_173602		51102285	+1	tier1	-	no_errors	ENST00000301180	ensembl	human	known	74_37	silent	23.26	66	20	SNP	0.994	A
DNAH10	196385	genome.wustl.edu	37	12	124401081	124401081	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:124401081C>T	ENST00000409039.3	+	62	10471	c.10446C>T	c.(10444-10446)cgC>cgT	p.R3482R		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3482	AAA 5. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TCCTGTTCCGCGATGTTGATG	0.458																																																	0													123.0	122.0	122.0					12																	124401081		1983	4157	6140	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.10446C>T	12.37:g.124401081C>T			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.R3482	ENST00000409039.3	37	c.10446	CCDS9255.2	12																																																																																			DNAH10	-	NULL	ENSG00000197653		0.458	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	69	0	C			124401081	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	silent	27.08	35	13	SNP	0.796	T
DNAH11	8701	genome.wustl.edu	37	7	21582997	21582997	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:21582997C>T	ENST00000409508.3	+	1	165	c.134C>T	c.(133-135)gCg>gTg	p.A45V	DNAH11_ENST00000328843.6_Missense_Mutation_p.A45V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	45	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						gaggaggaggCGGCGGCCAGG	0.692									Kartagener syndrome																																								0													12.0	16.0	15.0					7																	21582997		1894	3928	5822	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.134C>T	7.37:g.21582997C>T	ENSP00000475939:p.Ala45Val		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A45V	ENST00000409508.3	37	c.134		7	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237989	0.39598	.	.	ENSG00000105877	ENST00000328843	T	0.27890	1.64	3.66	1.78	0.24846	.	1.348720	0.05053	N	0.478478	T	0.19725	0.0474	N	0.24115	0.695	0.28354	N	0.920778	B	0.21688	0.059	B	0.09377	0.004	T	0.24368	-1.0162	10	0.29301	T	0.29	.	4.6081	0.12387	0.2139:0.6671:0.0:0.119	.	45	Q96DT5	DYH11_HUMAN	V	45	ENSP00000330671:A45V	ENSP00000330671:A45V	A	+	2	0	DNAH11	21549522	0.035000	0.19736	0.978000	0.43139	0.888000	0.51559	0.455000	0.21843	0.339000	0.23719	0.563000	0.77884	GCG	DNAH11	-	NULL	ENSG00000105877		0.692	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	-	0.00	41	0	C	NM_003777		21582997	+1	tier1	-	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	26.19	31	11	SNP	0.996	T
DNAH9	1770	genome.wustl.edu	37	17	11837260	11837260	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:11837260G>A	ENST00000262442.4	+	65	12429	c.12361G>A	c.(12361-12363)Gac>Aac	p.D4121N	DNAH9_ENST00000454412.2_Missense_Mutation_p.D4045N|DNAH9_ENST00000608377.1_Missense_Mutation_p.D433N|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4121					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TATCACAGATGACTGGGACAG	0.498																																																	0													99.0	95.0	97.0					17																	11837260		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.12361G>A	17.37:g.11837260G>A	ENSP00000262442:p.Asp4121Asn		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D4121N	ENST00000262442.4	37	c.12361	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871661	0.51695	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001	T;T;T	0.09817	2.94;2.94;2.94	5.0	3.03	0.35002	Dynein heavy chain (1);	0.138632	0.64402	D	0.000005	T	0.22126	0.0533	M	0.82323	2.585	0.58432	D	0.999995	B	0.31989	0.35	B	0.41202	0.35	T	0.07443	-1.0772	10	0.56958	D	0.05	.	12.2829	0.54774	0.1458:0.0:0.8542:0.0	.	4121	Q9NYC9	DYH9_HUMAN	N	4121;4045;2627;433	ENSP00000262442:D4121N;ENSP00000414874:D4045N;ENSP00000379323:D433N	ENSP00000262442:D4121N	D	+	1	0	DNAH9	11777985	1.000000	0.71417	0.906000	0.35671	0.867000	0.49689	6.480000	0.73604	1.478000	0.48253	-0.143000	0.13931	GAC	DNAH9	-	pfam_Dynein_heavy_dom	ENSG00000007174		0.498	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	59	0	G	NM_001372		11837260	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	27.66	34	13	SNP	0.998	A
DNMT3A	1788	genome.wustl.edu	37	2	25505571	25505571	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:25505571C>T	ENST00000264709.3	-	4	524	c.187G>A	c.(187-189)Ggt>Agt	p.G63S	DNMT3A_ENST00000406659.3_Missense_Mutation_p.G63S|DNMT3A_ENST00000321117.5_Missense_Mutation_p.G63S	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	63					C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGCGTGTCACCGCTTTCCACC	0.517			"""Mis, F, N, S"""		AML																																			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0													48.0	57.0	54.0					2																	25505571		2201	4298	6499	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.187G>A	2.37:g.25505571C>T	ENSP00000264709:p.Gly63Ser		E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.G63S	ENST00000264709.3	37	c.187	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	C	0.887	-0.726897	0.03158	.	.	ENSG00000119772	ENST00000321117;ENST00000264709;ENST00000406659	D;D	0.91792	-2.91;-2.91	4.91	3.75	0.43078	.	0.123897	0.36591	N	0.002515	T	0.74427	0.3715	N	0.02539	-0.55	0.21416	N	0.999692	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.61884	-0.6971	10	0.02654	T	1	-1.1177	7.6066	0.28105	0.0:0.0983:0.0:0.9017	.	63;63	Q9Y6K1-3;Q9Y6K1	.;DNM3A_HUMAN	S	63	ENSP00000324375:G63S;ENSP00000264709:G63S	ENSP00000264709:G63S	G	-	1	0	DNMT3A	25359075	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	2.312000	0.43726	0.720000	0.32209	-0.414000	0.06135	GGT	DNMT3A	-	NULL	ENSG00000119772		0.517	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	-	0.00	82	0	C	NM_022552		25505571	-1	tier1	-	no_errors	ENST00000264709	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
DOCK11	139818	genome.wustl.edu	37	X	117712576	117712576	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:117712576C>T	ENST00000276202.7	+	13	1541	c.1478C>T	c.(1477-1479)gCa>gTa	p.A493V	DOCK11_ENST00000276204.6_Missense_Mutation_p.A493V	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	493					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						ACACACTGTGCAGAACCCTAT	0.343																																																	0													61.0	56.0	58.0					X																	117712576		2203	4300	6503	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.1478C>T	X.37:g.117712576C>T	ENSP00000276202:p.Ala493Val		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A493V	ENST00000276202.7	37	c.1478	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603146	0.66445	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.50548	0.74;0.74	5.95	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.41096	0.1144	L	0.45285	1.41	0.50813	D	0.999895	B;B	0.17852	0.024;0.024	B;B	0.20577	0.021;0.03	T	0.21827	-1.0234	10	0.36615	T	0.2	-15.9486	13.2586	0.60093	0.0:0.92:0.0:0.08	.	493;493	A6NIW2;Q5JSL3	.;DOC11_HUMAN	V	493	ENSP00000276204:A493V;ENSP00000276202:A493V	ENSP00000276202:A493V	A	+	2	0	DOCK11	117596604	0.991000	0.36638	0.986000	0.45419	0.985000	0.73830	2.954000	0.49113	2.519000	0.84933	0.594000	0.82650	GCA	DOCK11	-	NULL	ENSG00000147251		0.343	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	-	0.00	85	0	C	NM_144658		117712576	+1	tier1	-	no_errors	ENST00000276202	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
DROSHA	29102	genome.wustl.edu	37	5	31410883	31410883	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:31410883G>A	ENST00000511367.2	-	30	3881	c.3637C>T	c.(3637-3639)Cgc>Tgc	p.R1213C	DROSHA_ENST00000344624.3_Missense_Mutation_p.R1213C|DROSHA_ENST00000513349.1_Missense_Mutation_p.R1176C|DROSHA_ENST00000442743.1_Missense_Mutation_p.R1176C	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1213	Necessary for interaction with DGCR8 and pri-miRNA processing activity.|RNase III 2.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GTCTTGGTGCGAAGCGCCACA	0.512																																																	0													136.0	144.0	141.0					5																	31410883		1994	4170	6164	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3637C>T	5.37:g.31410883G>A	ENSP00000425979:p.Arg1213Cys		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.R1213C	ENST00000511367.2	37	c.3637	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.026101	0.75390	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	5.34	1.91	0.25777	Ribonuclease III (5);	0.000000	0.85682	D	0.000000	D	0.87014	0.6072	M	0.77406	2.37	0.80722	D	1	D;P	0.89917	1.0;0.915	D;P	0.79784	0.993;0.65	D	0.88229	0.2902	10	0.87932	D	0	-14.711	15.2259	0.73352	0.0:0.0:0.7596:0.2404	.	1176;1213	E7EMP9;Q9NRR4	.;RNC_HUMAN	C	1213;1213;1176;1176;1138	ENSP00000425979:R1213C;ENSP00000339845:R1213C;ENSP00000409335:R1176C;ENSP00000424161:R1176C	ENSP00000265075:R1138C	R	-	1	0	DROSHA	31446640	0.998000	0.40836	0.495000	0.27527	0.980000	0.70556	2.585000	0.46111	0.384000	0.24942	0.484000	0.47621	CGC	DROSHA	-	pfam_RNase_III_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,pfscan_RNase_III_dom	ENSG00000113360		0.512	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	-	0.00	64	0	G	NM_013235		31410883	-1	tier1	-	no_errors	ENST00000344624	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.941	A
DPYSL3	1809	genome.wustl.edu	37	5	146795411	146795411	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:146795411C>T	ENST00000398514.3	-	4	710	c.339G>A	c.(337-339)gaG>gaA	p.E113E	DPYSL3_ENST00000534907.1_Intron|DPYSL3_ENST00000343218.5_Silent_p.E227E	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	113					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAGGCTGGACTCAGGCTCAG	0.557																																																	0													167.0	165.0	165.0					5																	146795411		2099	4218	6317	SO:0001819	synonymous_variant	0			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.339G>A	5.37:g.146795411C>T			B3SXQ8|Q93012	Silent	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.E113	ENST00000398514.3	37	c.339	CCDS43381.1	5																																																																																			DPYSL3	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000113657		0.557	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL3	HGNC	protein_coding	OTTHUMT00000373421.2		0.00	43	0	C	NM_001387		146795411	-1			no_errors	ENST00000398514	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.999	T
DSCAML1	57453	genome.wustl.edu	37	11	117389188	117389188	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:117389188G>A	ENST00000321322.6	-	7	1684	c.1683C>T	c.(1681-1683)aaC>aaT	p.N561N	DSCAML1_ENST00000527706.1_Silent_p.N291N	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	501	Ig-like C2-type 6.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CACCTCTTACGTTTATTCGCG	0.488																																																	0													96.0	100.0	99.0					11																	117389188		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1683C>T	11.37:g.117389188G>A			Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N561	ENST00000321322.6	37	c.1683	CCDS8384.1	11																																																																																			DSCAML1	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000177103		0.488	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	60	0	G	NM_020693		117389188	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	silent	60.78	20	31	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56485366	56485366	+	Nonsense_Mutation	SNP	G	G	A	rs577972555		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:56485366G>A	ENST00000370765.6	-	23	3573	c.3466C>T	c.(3466-3468)Cga>Tga	p.R1156*	DST_ENST00000370769.4_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	0					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCCTCTACTCGGGACTTTTGT	0.433																																																	0													180.0	175.0	177.0					6																	56485366		2203	4300	6503	SO:0001587	stop_gained	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.3466C>T	6.37:g.56485366G>A	ENSP00000359801:p.Arg1156*		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R1156*	ENST00000370765.6	37	c.3466	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.515711	0.98332	.	.	ENSG00000151914	ENST00000370765	.	.	.	4.48	3.59	0.41128	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	7.7425	0.28849	0.0824:0.0:0.7546:0.163	.	.	.	.	X	1156	.	ENSP00000359801:R1156X	R	-	1	2	DST	56593325	0.849000	0.29639	0.577000	0.28562	0.672000	0.39443	3.785000	0.55424	1.077000	0.40990	0.460000	0.39030	CGA	DST	-	NULL	ENSG00000151914		0.433	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2		0.00	42	0	G	NM_001723		56485366	-1			no_errors	ENST00000370765	ensembl	human	known	74_37	nonsense	5.56	51	3	SNP	0.013	A
DTX3L	151636	genome.wustl.edu	37	3	122288127	122288127	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:122288127A>G	ENST00000296161.4	+	3	1380	c.1191A>G	c.(1189-1191)tcA>tcG	p.S397S	DTX3L_ENST00000383661.3_Intron	NM_138287.3	NP_612144.1	Q8TDB6	DTX3L_HUMAN	deltex 3 like, E3 ubiquitin ligase	397					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone monoubiquitination (GO:0010390)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0459)		AGGAGATATCAGAGATCGAAA	0.378																																																	0													60.0	62.0	62.0					3																	122288127		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3015.1	3q21.1	2014-01-28	2014-01-28		ENSG00000163840	ENSG00000163840		"""RING-type (C3HC4) zinc fingers"""	30323	protein-coding gene	gene with protein product	"""rhysin 2"""	613143	"""deltex 3-like (Drosophila)"""			12670957, 22411408	Standard	NM_138287		Approved	BBAP	uc003efk.3	Q8TDB6	OTTHUMG00000159524	ENST00000296161.4:c.1191A>G	3.37:g.122288127A>G			B3KWH6|Q53ZZ3|Q5MJP7	Silent	SNP	smart_Znf_RING,pfscan_Znf_RING	p.S397	ENST00000296161.4	37	c.1191	CCDS3015.1	3																																																																																			DTX3L	-	NULL	ENSG00000163840		0.378	DTX3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX3L	HGNC	protein_coding	OTTHUMT00000355966.1	-	0.00	37	0	A	NM_138287		122288127	+1	tier1	-	no_errors	ENST00000296161	ensembl	human	known	74_37	silent	31.48	37	17	SNP	0.172	G
DYNC1H1	1778	genome.wustl.edu	37	14	102493004	102493004	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:102493004C>T	ENST00000360184.4	+	44	8895	c.8731C>T	c.(8731-8733)Ctg>Ttg	p.L2911L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2911	AAA 4. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TCCGCTGGTGCTGTTTAATGA	0.443																																																	0													116.0	108.0	111.0					14																	102493004		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.8731C>T	14.37:g.102493004C>T			B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L2911	ENST00000360184.4	37	c.8731	CCDS9966.1	14																																																																																			DYNC1H1	-	superfamily_P-loop_NTPase	ENSG00000197102		0.443	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	-	0.00	77	0	C	NM_001376		102493004	+1	tier1	-	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103124155	103124155	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:103124155C>A	ENST00000375735.2	+	66	10328	c.10184C>A	c.(10183-10185)aCa>aAa	p.T3395K	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.T3402K	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3395	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTTACTACAACAAGAAGTGGA	0.363																																																	0													103.0	98.0	100.0					11																	103124155		1815	4086	5901	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10184C>A	11.37:g.103124155C>A	ENSP00000364887:p.Thr3395Lys		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T3402K	ENST00000375735.2	37	c.10205	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.132029	0.94473	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.29142	1.58;1.58	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.84219	2.685	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.986;0.99	T	0.61893	-0.6969	10	0.51188	T	0.08	.	20.3334	0.98727	0.0:1.0:0.0:0.0	.	3395;3402	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	K	3395;3402	ENSP00000364887:T3395K;ENSP00000381167:T3402K	ENSP00000364887:T3395K	T	+	2	0	DYNC2H1	102629365	1.000000	0.71417	0.990000	0.47175	0.992000	0.81027	6.057000	0.71119	2.818000	0.97014	0.591000	0.81541	ACA	DYNC2H1	-	NULL	ENSG00000187240		0.363	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	72	0	C	XM_370652		103124155	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	30.68	61	27	SNP	1.000	A
EHMT2	10919	genome.wustl.edu	37	6	31856023	31856023	+	Missense_Mutation	SNP	G	G	A	rs139432784		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:31856023G>A	ENST00000375537.4	-	13	1546	c.1540C>T	c.(1540-1542)Cgt>Tgt	p.R514C	EHMT2_ENST00000375530.4_Missense_Mutation_p.R480C|EHMT2_ENST00000375528.4_Missense_Mutation_p.R537C|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000395728.3_Missense_Mutation_p.R571C	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	514					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						TGGGCCACACGGAAGTCAGGG	0.607																																																	0								G	CYS/ARG,CYS/ARG	0,3018		0,0,1509	63.0	60.0	61.0		1540,1438	4.6	1.0	6	dbSNP_134	61	1,5417		0,1,2708	no	missense,missense	EHMT2	NM_006709.3,NM_025256.5	180,180	0,1,4217	AA,AG,GG		0.0185,0.0,0.0119	probably-damaging,probably-damaging	514/1211,480/1177	31856023	1,8435	1509	2709	4218	SO:0001583	missense	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1540C>T	6.37:g.31856023G>A	ENSP00000364687:p.Arg514Cys		B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.R571C	ENST00000375537.4	37	c.1711	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452683	0.63290	0.0	1.85E-4	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.70631	-0.5;-0.44;-0.38;-0.49	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000001	T	0.60612	0.2282	N	0.14661	0.345	0.51482	D	0.999928	D;D;D;D	0.76494	0.998;0.999;0.998;0.998	P;D;P;P	0.64042	0.872;0.921;0.835;0.835	T	0.68420	-0.5413	10	0.59425	D	0.04	.	11.4729	0.50280	0.0:0.0:0.8198:0.1802	.	537;480;514;328	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	C	571;537;480;514;328	ENSP00000379078:R571C;ENSP00000364678:R537C;ENSP00000364680:R480C;ENSP00000364687:R514C	ENSP00000364678:R537C	R	-	1	0	EHMT2	31964002	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.216000	0.32443	2.358000	0.79984	0.555000	0.69702	CGT	EHMT2	-	NULL	ENSG00000204371		0.607	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5		0.00	31	0	G	NM_006709		31856023	-1			no_errors	ENST00000395728	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	A
CTDSPL2	51496	genome.wustl.edu	37	15	44819512	44819512	+	3'UTR	SNP	T	T	A	rs534939470	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:44819512T>A	ENST00000260327.4	+	0	5104					NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2								phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		ATGTTTTTTTTAAAAAATTAT	0.303													T|||	2	0.000399361	0.0	0.0	5008	,	,		17536	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001624	3_prime_UTR_variant	0			AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.*3140T>A	15.37:g.44819512T>A			Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	RNA	SNP	-	NULL	ENST00000260327.4	37	NULL	CCDS10110.1	15																																																																																			EIF3J-AS1	-	-	ENSG00000179523		0.303	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3J-AS1	HGNC	protein_coding	OTTHUMT00000253851.1	-	0.00	31	0	T	NM_016396		44819512	-1	tier1	-	no_errors	ENST00000560750	ensembl	human	known	74_37	rna	58.06	13	18	SNP	0.000	A
ENOX2	10495	genome.wustl.edu	37	X	129822857	129822857	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:129822857G>A	ENST00000370927.1	-	3	341	c.320C>T	c.(319-321)aCg>aTg	p.T107M	ENOX2_ENST00000370935.1_Missense_Mutation_p.T78M|ENOX2_ENST00000338144.3_Missense_Mutation_p.T107M|ENOX2_ENST00000394363.1_Missense_Mutation_p.T78M|ENOX2_ENST00000492263.1_5'UTR			Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2	107	Pro-rich.				cell growth (GO:0016049)|oxidation-reduction process (GO:0055114)|regulation of growth (GO:0040008)|ultradian rhythm (GO:0007624)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|protein disulfide oxidoreductase activity (GO:0015035)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(3)	33						AGGGAAGAGCGTGCAGCTTTT	0.393																																					Ovarian(101;828 1506 2951 9500 35258)												0													266.0	218.0	234.0					X																	129822857		2203	4300	6503	SO:0001583	missense	0			AF207881	CCDS14626.1, CCDS14627.1	Xq25	2013-02-12	2007-03-23	2007-03-23	ENSG00000165675	ENSG00000165675		"""RNA binding motif (RRM) containing"""	2259	protein-coding gene	gene with protein product		300282	"""cytosolic ovarian carcinoma antigen 1"""	COVA1		8150545, 11888291	Standard	NM_006375		Approved	APK1, tNOX	uc004evw.3	Q16206	OTTHUMG00000022401	ENST00000370927.1:c.320C>T	X.37:g.129822857G>A	ENSP00000359965:p.Thr107Met		A8K197|A8K1C2|Q5VTJ1|Q5VTJ2|Q8WUX0|Q9NTP6|Q9UH82	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T107M	ENST00000370927.1	37	c.320	CCDS14626.1	X	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681963	0.68042	.	.	ENSG00000165675	ENST00000538435;ENST00000370935;ENST00000338144;ENST00000394363;ENST00000350369;ENST00000370927;ENST00000432489	T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84	5.12	4.26	0.50523	.	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	M	0.71036	2.16	0.46927	D	0.999251	D	0.89917	1.0	D	0.91635	0.999	T	0.82845	-0.0256	9	.	.	.	-5.666	10.4	0.44225	0.0963:0.0:0.9037:0.0	.	107	Q16206	ENOX2_HUMAN	M	78;78;107;78;135;107;78	ENSP00000359973:T78M;ENSP00000337146:T107M;ENSP00000377890:T78M;ENSP00000359965:T107M;ENSP00000400304:T78M	.	T	-	2	0	ENOX2	129650538	1.000000	0.71417	0.971000	0.41717	0.953000	0.61014	7.448000	0.80631	1.151000	0.42436	0.513000	0.50165	ACG	ENOX2	-	NULL	ENSG00000165675		0.393	ENOX2-004	KNOWN	basic|CCDS	protein_coding	ENOX2	HGNC	protein_coding	OTTHUMT00000058277.1	-	0.00	72	0	G	NM_182314		129822857	-1	tier1	-	no_errors	ENST00000338144	ensembl	human	known	74_37	missense	35.62	47	26	SNP	0.995	A
ZNF793	390927	genome.wustl.edu	37	19	38039041	38039041	+	RNA	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:38039041T>G	ENST00000316807.2	-	0	597				ZNF571-AS1_ENST00000592575.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA																							GAGCCAGTAGTTGATTACCAA	0.443																																																	0																																												0																															19.37:g.38039041T>G				RNA	SNP	-	NULL	ENST00000316807.2	37	NULL		19																																																																																			CTD-3064H18.4	-	-	ENSG00000180458		0.443	CTD-3064H18.4-001	KNOWN	basic	antisense	ENSG00000180458	Clone_based_vega_gene	antisense	OTTHUMT00000458665.1	-	0.00	18	0	T			38039041	-1	tier1	-	no_errors	ENST00000316807	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.012	G
NPR3	4883	genome.wustl.edu	37	5	32789565	32789565	+	3'UTR	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:32789565T>G	ENST00000265074.8	+	0	5083				AC026703.1_ENST00000326958.1_Missense_Mutation_p.L20V	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	TTGTCTTTTCTTGAACCACAG	0.413																																																	0													90.0	92.0	91.0					5																	32789565		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.*3114T>G	5.37:g.32789565T>G			A2RRD1|B4DT84|E7EPG9	Missense_Mutation	SNP	NULL	p.L20V	ENST00000265074.8	37	c.58	CCDS56357.1	5	.	.	.	.	.	.	.	.	.	.	T	6.489	0.458440	0.12342	.	.	ENSG00000181495	ENST00000326958	.	.	.	4.58	-3.05	0.05396	.	.	.	.	.	T	0.36663	0.0975	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.45716	-0.9242	5	0.87932	D	0	.	5.3208	0.15879	0.1494:0.3023:0.0:0.5483	.	.	.	.	V	20	.	ENSP00000318340:L20V	L	+	1	2	AC026703.1	32825322	0.011000	0.17503	0.000000	0.03702	0.000000	0.00434	0.031000	0.13710	-0.498000	0.06632	-1.531000	0.00922	TTG	AC026703.1	-	NULL	ENSG00000181495		0.413	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000181495	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000317550.3	-	0.00	51	0	T	NM_000908		32789565	+1	tier1	-	no_errors	ENST00000326958	ensembl	human	novel	74_37	missense	28.12	23	9	SNP	0.000	G
XXyac-YM21GA2.7	0	genome.wustl.edu	37	9	90473946	90473946	+	RNA	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:90473946G>A	ENST00000399186.2	-	0	368																											TGGGGTGCCCGTGTTCTGAGG	0.582																																																	0																																												0																															9.37:g.90473946G>A				RNA	SNP	-	NULL	ENST00000399186.2	37	NULL		9																																																																																			XXyac-YM21GA2.7	-	-	ENSG00000214888		0.582	XXyac-YM21GA2.7-001	KNOWN	basic	antisense	ENSG00000214888	Clone_based_vega_gene	antisense	OTTHUMT00000397578.1	-	0.00	105	0	G			90473946	-1	tier1	-	no_errors	ENST00000399186	ensembl	human	known	74_37	rna	33.05	79	39	SNP	0.000	A
AP001623.1	0	genome.wustl.edu	37	21	43720386	43720387	+	RNA	DEL	GT	GT	-	rs142198765		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:43720386_43720387delGT	ENST00000401378.1	-	0	68_69																											ACAGGGGCTGgtgtgtgtgtgt	0.55																																																	0										117,2837		8,101,1368						-0.2	0.0		dbSNP_134	70	210,4996		37,136,2430	no	intergenic				45,237,3798	A1A1,A1R,RR		4.0338,3.9607,4.0074				327,7833						0																															21.37:g.43720396_43720397delGT				RNA	DEL	-	NULL	ENST00000401378.1	37	NULL		21																																																																																			AP001623.1	-	-	ENSG00000216197		0.550	AP001623.1-201	NOVEL	basic	miRNA	ENSG00000216197	Clone_based_ensembl_gene	miRNA			0.00	44	0	GT			43720387	-1	tier1		no_errors	ENST00000401378	ensembl	human	novel	74_37	rna	8.82	31	3	DEL	0.001:0.000	-
RP13-60M5.2	0	genome.wustl.edu	37	9	91262482	91262482	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:91262482A>G	ENST00000418343.2	-	0	269																											GTAGCTGATGAACACATTTCC	0.408																																																	0													169.0	161.0	163.0					9																	91262482		1939	4138	6077			0																															9.37:g.91262482A>G				RNA	SNP	-	NULL	ENST00000418343.2	37	NULL		9																																																																																			RP13-60M5.2	-	-	ENSG00000228189		0.408	RP13-60M5.2-001	KNOWN	basic	lincRNA	ENSG00000228189	Clone_based_vega_gene	lincRNA	OTTHUMT00000052976.2	-	0.00	76	0	A			91262482	-1	tier1	-	no_errors	ENST00000418343	ensembl	human	known	74_37	rna	24.49	37	12	SNP	0.002	G
Unknown	0	genome.wustl.edu	37	13	47040111	47040111	+	IGR	SNP	G	G	A	rs7320447	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr13:47040111G>A								RP11-189B4.6 (6791 upstream) : LRCH1 (87191 downstream)																							gtcatttgcagtctaccggag	0.507													.|||	1357	0.270966	0.2542	0.2752	5008	,	,		13370	0.4593		0.1978	False		,,,				2504	0.1718																0																																										SO:0001628	intergenic_variant	0																															13.37:g.47040111G>A				RNA	SNP	-	NULL		37	NULL		13																																																																																			RP11-189B4.6	-	-	ENSG00000231817	0	0.507					ENSG00000231817	Clone_based_vega_gene			-	0.00	22	0	G			47040111	-1	tier1	rs7320447	no_errors	ENST00000594153	ensembl	human	known	74_37	rna	27.78	13	5	SNP	0.046	A
TSSK1B	83942	genome.wustl.edu	37	5	112769190	112769190	+	3'UTR	SNP	G	G	A	rs529161742	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:112769190G>A	ENST00000390666.3	-	0	1538				CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B						multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		CACCTGCTCCGGGTCACGCTC	0.617													G|||	3	0.000599042	0.0	0.0	5008	,	,		14788	0.0		0.0	False		,,,				2504	0.0031																0																																										SO:0001624	3_prime_UTR_variant	0			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.*243C>T	5.37:g.112769190G>A			B2R8D9	RNA	SNP	-	NULL	ENST00000390666.3	37	NULL	CCDS4112.1	5																																																																																			CTD-2201G3.1	-	-	ENSG00000232633		0.617	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232633	Clone_based_vega_gene	protein_coding	OTTHUMT00000250774.2	-	0.00	31	0	G	NM_032028		112769190	+1	tier1	-	no_errors	ENST00000416046	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.273	A
RP11-423O2.5	0	genome.wustl.edu	37	1	142803429	142803429	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:142803429A>C	ENST00000423385.1	-	0	1536																											catcctctcaagtagtttgga	0.343																																																	0																																												0																															1.37:g.142803429A>C				RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-	ENSG00000234978		0.343	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	-	0.00	256	0	A			142803429	-1	tier1	-	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	8.06	194	17	SNP	0.007	C
RP11-403I13.8	0	genome.wustl.edu	37	1	149291295	149291295	+	lincRNA	SNP	G	G	A	rs61789501		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:149291295G>A	ENST00000433084.1	+	0	1538																											tacacaagccgtaactactgc	0.458																																																	0																																												0																															1.37:g.149291295G>A				RNA	SNP	-	NULL	ENST00000433084.1	37	NULL		1																																																																																			RP11-403I13.8	-	-	ENSG00000235999		0.458	RP11-403I13.8-001	KNOWN	basic	lincRNA	ENSG00000235999	Clone_based_vega_gene	lincRNA	OTTHUMT00000099633.1		0.00	39	0	G			149291295	+1			no_errors	ENST00000433084	ensembl	human	known	74_37	rna	14.29	18	3	SNP	0.029	A
RP11-758I14.3	0	genome.wustl.edu	37	3	146109174	146109174	+	RNA	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:146109174A>G	ENST00000490344.1	-	0	680																											TTTTTGATGTAGTTTATTAGG	0.299																																																	0																																												0																															3.37:g.146109174A>G				RNA	SNP	-	NULL	ENST00000490344.1	37	NULL		3																																																																																			RP11-758I14.3	-	-	ENSG00000241358		0.299	RP11-758I14.3-002	KNOWN	basic	processed_transcript	ENSG00000241358	Clone_based_vega_gene	pseudogene	OTTHUMT00000355269.1	-	0.00	21	0	A			146109174	-1	tier1	-	no_errors	ENST00000490344	ensembl	human	known	74_37	rna	56.25	7	9	SNP	0.000	G
PXDNL	137902	genome.wustl.edu	37	8	52233303	52233303	+	Intron	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:52233303A>T	ENST00000356297.4	-	22	4361				RP11-401H2.1_ENST00000521294.1_RNA|PXDNL_ENST00000543296.1_Intron	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like						hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCTGGCTAGAAGTGAAATGGG	0.413																																																	0													44.0	63.0	57.0					8																	52233303		1844	4087	5931	SO:0001627	intron_variant	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4260+40T>A	8.37:g.52233303A>T			B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	RNA	SNP	-	NULL	ENST00000356297.4	37	NULL	CCDS47855.1	8																																																																																			RP11-401H2.1	-	-	ENSG00000253664		0.413	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253664	Clone_based_vega_gene	protein_coding	OTTHUMT00000377905.1	-	0.00	52	0	A	NM_144651		52233303	+1	tier1	-	no_errors	ENST00000521294	ensembl	human	known	74_37	rna	59.18	20	29	SNP	0.000	T
CLVS1	157807	genome.wustl.edu	37	8	62212880	62212880	+	Intron	SNP	T	T	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:62212880T>A	ENST00000519846.1	+	3	927				RP11-787D18.1_ENST00000518064.1_RNA|CLVS1_ENST00000325897.4_Intron|RP11-787D18.1_ENST00000521801.1_RNA|CLVS1_ENST00000518592.1_Intron			Q8IUQ0	CLVS1_HUMAN	clavesin 1						lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TTTTCTTTGCTATAAGCATTA	0.378																																																	0													12.0	12.0	12.0					8																	62212880		2169	4242	6411	SO:0001627	intron_variant	0			AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.455+39T>A	8.37:g.62212880T>A			B2R7M5|C8UZT3|Q8NB32	RNA	SNP	-	NULL	ENST00000519846.1	37	NULL	CCDS6176.1	8																																																																																			RP11-787D18.1	-	-	ENSG00000253711		0.378	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000253711	Clone_based_vega_gene	protein_coding	OTTHUMT00000378323.1	-	0.00	46	0	T	NM_173519		62212880	-1	tier1	-	no_errors	ENST00000518064	ensembl	human	known	74_37	rna	5.88	64	4	SNP	0.000	A
NOTCH2NL	388677	genome.wustl.edu	37	1	145273434	145273434	+	Silent	SNP	C	C	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:145273434C>G	ENST00000369340.3	+	4	732	c.288C>G	c.(286-288)gtC>gtG	p.V96V	NOTCH2NL_ENST00000344859.3_Silent_p.V96V|NOTCH2NL_ENST00000362074.6_Silent_p.V96V|RP11-458D21.5_ENST00000468030.1_Silent_p.V96V			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	96	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.V96V(2)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						CCTGTCAAGTCGGGTTTACAG	0.463																																																	2	Substitution - coding silent(2)	large_intestine(2)											296.0	304.0	301.0					1																	145273434		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.288C>G	1.37:g.145273434C>G			Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Silent	SNP	pfam_EG-like_dom,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.V96	ENST00000369340.3	37	c.288	CCDS909.1	1																																																																																			RP11-458D21.5	-	pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000255168		0.463	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000255168	Clone_based_vega_gene	protein_coding	OTTHUMT00000038546.1	-	0.00	247	0	C	NM_203458		145273434	+1	tier1	-	no_errors	ENST00000468030	ensembl	human	known	74_37	silent	7.98	196	17	SNP	0.314	G
FEZ1	9638	genome.wustl.edu	37	11	125366549	125366549	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:125366549C>T	ENST00000278919.3	-	0	0				AP000708.1_ENST00000527818.1_Missense_Mutation_p.H145Y|FEZ1_ENST00000366139.3_5'Flank|FEZ1_ENST00000524435.1_5'Flank	NM_005103.4	NP_005094.1	Q99689	FEZ1_HUMAN	fasciculation and elongation protein zeta 1 (zygin I)						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|establishment of mitochondrion localization (GO:0051654)|nervous system development (GO:0007399)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|transport (GO:0006810)	axon (GO:0030424)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	24	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0934)		CCGAGTTTCCCATTCTCCTCT	0.577																																					Melanoma(180;509 2033 10762 15939 24711)												0																																										SO:0001631	upstream_gene_variant	0			U60060	CCDS31716.1, CCDS44758.1	11q24.2	2005-09-29			ENSG00000149557	ENSG00000149557			3659	protein-coding gene	gene with protein product		604825				9096408, 15843383	Standard	NM_005103		Approved		uc001qbx.3	Q99689	OTTHUMG00000165886		11.37:g.125366549C>T	Exception_encountered		O00679|O00728|Q6IBI7	Missense_Mutation	SNP	NULL	p.H145Y	ENST00000278919.3	37	c.433	CCDS31716.1	11	.	.	.	.	.	.	.	.	.	.	C	9.904	1.207727	0.22205	.	.	ENSG00000255537	ENST00000527818	.	.	.	3.4	3.4	0.38934	.	.	.	.	.	T	0.41880	0.1178	.	.	.	.	.	.	P	0.48294	0.908	B	0.42112	0.376	T	0.60177	-0.7314	6	0.87932	D	0	.	10.6109	0.45421	0.0:1.0:0.0:0.0	.	145	Q8IYB0	YK038_HUMAN	Y	145	.	ENSP00000434154:H145Y	H	+	1	0	AP000708.1	124871759	0.004000	0.15560	0.006000	0.13384	0.004000	0.04260	1.158000	0.31737	2.181000	0.69327	0.650000	0.86243	CAT	AP000708.1	-	NULL	ENSG00000255537		0.577	FEZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255537	Clone_based_vega_gene	protein_coding	OTTHUMT00000386875.1	-	0.00	64	0	C	NM_005103		125366549	+1	tier1	-	no_errors	ENST00000527818	ensembl	human	putative	74_37	missense	31.33	57	26	SNP	0.006	T
EPS15L1	58513	genome.wustl.edu	37	19	16528891	16528891	+	Silent	SNP	C	C	T	rs375758505		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:16528891C>T	ENST00000248070.6	-	11	1114	c.975G>A	c.(973-975)acG>acA	p.T325T	EPS15L1_ENST00000602009.1_Silent_p.T171T|EPS15L1_ENST00000535753.2_Silent_p.T325T|EPS15L1_ENST00000455140.2_Silent_p.T325T|EPS15L1_ENST00000594975.1_Silent_p.T325T|EPS15L1_ENST00000597937.1_Silent_p.T325T	NM_021235.2	NP_067058.1	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway substrate 15-like 1	325	EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	clathrin coat of coated pit (GO:0030132)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(4)|skin(2)	30						TTAACTTCCCCGTTTGCCTCG	0.542											OREG0025334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								C		0,4406		0,0,2203	196.0	142.0	160.0		975	1.1	1.0	19		160	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EPS15L1	NM_021235.1		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		325/865	16528891	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF110265	CCDS32944.1, CCDS58653.1, CCDS58654.1, CCDS59363.1	19p13.12	2013-01-10				ENSG00000127527		"""EF-hand domain containing"""	24634	protein-coding gene	gene with protein product							Standard	NM_001258374		Approved	eps15R	uc002ndx.4	Q9UBC2		ENST00000248070.6:c.975G>A	19.37:g.16528891C>T		711	A2RRF3|A5PL29|B4DKA3	Silent	SNP	superfamily_Prefoldin,smart_EPS15_homology,smart_EF_hand_dom,smart_Ubiquitin-int_motif,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.T325	ENST00000248070.6	37	c.975	CCDS32944.1	19																																																																																			EPS15L1	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000127527		0.542	EPS15L1-006	KNOWN	basic|CCDS	protein_coding	EPS15L1	HGNC	protein_coding	OTTHUMT00000461040.1	-	0.00	40	0	C	NM_021235		16528891	-1	tier1	-	no_errors	ENST00000455140	ensembl	human	known	74_37	silent	25.00	21	7	SNP	1.000	T
LOC100420587	100420587	genome.wustl.edu	37	19	29213619	29213619	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:29213619A>C	ENST00000592347.1	-	0	499																											TACTCGCTCAAGATTCACAGA	0.478																																																	0																																												0																															19.37:g.29213619A>C				RNA	SNP	-	NULL	ENST00000592347.1	37	NULL		19																																																																																			AC005307.3	-	-	ENSG00000267243		0.478	AC005307.3-001	KNOWN	basic	lincRNA	ENSG00000267243	Clone_based_vega_gene	lincRNA	OTTHUMT00000453069.1	-	0.00	35	0	A			29213619	-1	tier1	-	no_errors	ENST00000590072	ensembl	human	known	74_37	rna	35.29	22	12	SNP	0.095	C
EYS	346007	genome.wustl.edu	37	6	64431646	64431646	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:64431646A>G	ENST00000370621.3	-	44	8870	c.8344T>C	c.(8344-8346)Tac>Cac	p.Y2782H	EYS_ENST00000503581.1_Missense_Mutation_p.Y2761H|EYS_ENST00000370616.2_Missense_Mutation_p.Y2782H			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2782	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCAAGGTTGTAGCGAAGTTGA	0.358																																																	0													140.0	105.0	115.0					6																	64431646		692	1591	2283	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.8344T>C	6.37:g.64431646A>G	ENSP00000359655:p.Tyr2782His		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.Y2782H	ENST00000370621.3	37	c.8344		6	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138447	0.77775	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	T;T;T	0.77750	-1.12;-1.12;-1.12	4.71	4.71	0.59529	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.096277	0.43579	U	0.000544	D	0.82407	0.5030	M	0.79123	2.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.81134	-0.1071	10	0.22706	T	0.39	.	12.7661	0.57393	1.0:0.0:0.0:0.0	.	2761;2782	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	H	2761;2782;2782	ENSP00000424243:Y2761H;ENSP00000359655:Y2782H;ENSP00000359650:Y2782H	ENSP00000359650:Y2782H	Y	-	1	0	EYS	64489605	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.110000	0.89562	1.752000	0.51891	0.528000	0.53228	TAC	EYS	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188107		0.358	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3		0.00	78	0	A	XM_294050		64431646	-1			no_errors	ENST00000370616	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	G
EYS	346007	genome.wustl.edu	37	6	65300859	65300859	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:65300859T>C	ENST00000370621.3	-	26	5427	c.4901A>G	c.(4900-4902)aAg>aGg	p.K1634R	EYS_ENST00000503581.1_Missense_Mutation_p.K1634R|EYS_ENST00000370616.2_Missense_Mutation_p.K1634R			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1634					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TTTTGCACTCTTTTTAGAAGG	0.353																																																	0													79.0	73.0	75.0					6																	65300859		692	1590	2282	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4901A>G	6.37:g.65300859T>C	ENSP00000359655:p.Lys1634Arg		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.K1634R	ENST00000370621.3	37	c.4901		6	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470122	0.26423	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.83992	-1.79;-1.77;-1.77	5.64	0.00433	0.14057	.	.	.	.	.	T	0.40619	0.1124	N	0.08118	0	0.36924	D	0.89152	B;B	0.26195	0.144;0.033	B;B	0.24155	0.051;0.013	T	0.04333	-1.0959	9	0.15499	T	0.54	.	6.1156	0.20124	0.5306:0.0724:0.0:0.397	.	1634;1634	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	R	1634	ENSP00000424243:K1634R;ENSP00000359655:K1634R;ENSP00000359650:K1634R	ENSP00000359650:K1634R	K	-	2	0	EYS	65357580	0.854000	0.29725	0.855000	0.33649	0.958000	0.62258	0.064000	0.14437	0.061000	0.16311	-0.403000	0.06358	AAG	EYS	-	NULL	ENSG00000188107		0.353	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	41	0	T	XM_294050		65300859	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.656	C
FAM111A	63901	genome.wustl.edu	37	11	58920829	58920829	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:58920829C>T	ENST00000528737.1	+	5	4506	c.1688C>T	c.(1687-1689)aCt>aTt	p.T563I	FAM111A_ENST00000361723.3_Missense_Mutation_p.T563I|FAM111A_ENST00000531147.1_Missense_Mutation_p.T563I|FAM111A_ENST00000533703.1_Missense_Mutation_p.T563I|FAM111A_ENST00000420244.1_Missense_Mutation_p.T563I			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	563	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				TTTGCTTATACTTACCAAAAT	0.413																																																	0													138.0	136.0	136.0					11																	58920829		2201	4295	6496	SO:0001583	missense	0			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1688C>T	11.37:g.58920829C>T	ENSP00000434435:p.Thr563Ile		A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.T563I	ENST00000528737.1	37	c.1688	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385358	0.25031	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.87	-7.06	0.01568	Peptidase cysteine/serine, trypsin-like (1);	2.542540	0.00950	N	0.002940	T	0.22704	0.0548	N	0.24115	0.695	0.09310	N	1	B	0.20671	0.047	B	0.19148	0.024	T	0.07366	-1.0776	10	0.38643	T	0.18	-17.1367	0.9377	0.01348	0.1747:0.3316:0.1978:0.2959	.	563	Q96PZ2	F111A_HUMAN	I	563	ENSP00000434435:T563I;ENSP00000406683:T563I;ENSP00000355264:T563I;ENSP00000433154:T563I;ENSP00000431631:T563I	ENSP00000355264:T563I	T	+	2	0	FAM111A	58677405	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.248000	0.02890	-1.152000	0.02832	-2.066000	0.00396	ACT	FAM111A	-	superfamily_Trypsin-like_Pept_dom	ENSG00000166801		0.413	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	-	0.00	74	0	C	NM_022074		58920829	+1	tier1	-	no_errors	ENST00000361723	ensembl	human	known	74_37	missense	10.91	49	6	SNP	0.000	T
FAM157C	100996541	genome.wustl.edu	37	16	90229256	90229257	+	RNA	INS	-	-	CG	rs564425784|rs373938345		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:90229256_90229257insCG	ENST00000570230.1	+	0	1231_1232				RP11-356C4.5_ENST00000565965.1_lincRNA			P0CG43	F157C_HUMAN	family with sequence similarity 157, member C																		CCCATACCCTATCACGGCAGCC	0.574																																																	0																																												0					16q24.3	2013-01-24	2013-01-18	2013-01-18	ENSG00000260528	ENSG00000260528			34081	other	unknown							Standard	XR_429804		Approved			P0CG43	OTTHUMG00000172848		16.37:g.90229256_90229257insCG				RNA	INS	-	NULL	ENST00000570230.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.574	FAM157C-004	KNOWN	basic	processed_transcript	FAM157C	HGNC	processed_transcript	OTTHUMT00000420872.1		0.00	15	0	-			90229257	+1	tier1		no_errors	ENST00000570230	ensembl	human	known	74_37	rna	30.00	7	3	INS	0.000:0.000	CG
FAM63A	55793	genome.wustl.edu	37	1	150978592	150978592	+	Intron	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:150978592G>T	ENST00000361936.5	-	2	604				FAM63A_ENST00000361738.6_Missense_Mutation_p.P14T|FAM63A_ENST00000312210.5_Intron|FAM63A_ENST00000470877.1_Intron|PRUNE_ENST00000368935.1_5'Flank|PRUNE_ENST00000368936.1_5'Flank|FAM63A_ENST00000493834.2_Intron|PRUNE_ENST00000271620.3_5'Flank|PRUNE_ENST00000368937.1_5'Flank|PRUNE_ENST00000271619.8_5'Flank	NM_018379.4	NP_060849	Q8N5J2	FA63A_HUMAN	family with sequence similarity 63, member A							extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(3)|large_intestine(4)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GAGGGGGAAGGTTTCGTGCTT	0.453																																																	0													167.0	154.0	158.0					1																	150978592		692	1591	2283	SO:0001627	intron_variant	0			BC032321	CCDS976.1, CCDS30854.1, CCDS53361.1, CCDS55635.1	1q21.2	2008-02-05			ENSG00000143409	ENSG00000143409			25648	protein-coding gene	gene with protein product						10718198	Standard	NM_001040217		Approved	FLJ11280	uc010pcn.2	Q8N5J2	OTTHUMG00000035061	ENST00000361936.5:c.350+195C>A	1.37:g.150978592G>T			B3KWP4|B3KWV8|B4DXF2|B4E1S4|D3DV09|J3KP53|Q5SZF0|Q9NUL9|Q9P2F7	Missense_Mutation	SNP	pfam_DUF544	p.P14T	ENST00000361936.5	37	c.40	CCDS976.1	1	.	.	.	.	.	.	.	.	.	.	G	14.24	2.477862	0.44044	.	.	ENSG00000143409	ENST00000361738	T	0.47869	0.83	3.82	-1.86	0.07760	.	.	.	.	.	T	0.11965	0.0291	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.28396	-1.0045	8	0.72032	D	0.01	-0.8545	0.5906	0.00727	0.2047:0.1536:0.2975:0.3442	.	14	Q8N5J2-3	.	T	14	ENSP00000354669:P14T	ENSP00000354669:P14T	P	-	1	0	FAM63A	149245216	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.074000	0.11450	-0.527000	0.06374	-0.182000	0.12963	CCT	FAM63A	-	NULL	ENSG00000143409		0.453	FAM63A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM63A	HGNC	protein_coding	OTTHUMT00000411753.1	-	0.00	47	0	G	NM_018379		150978592	-1	tier1	-	no_errors	ENST00000361738	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.000	T
FAT2	2196	genome.wustl.edu	37	5	150923997	150923997	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:150923997A>T	ENST00000261800.5	-	9	6703	c.6691T>A	c.(6691-6693)Ttg>Atg	p.L2231M		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2231	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCATAGTCCAAAGGCCCTGTT	0.502																																																	0													121.0	118.0	119.0					5																	150923997		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.6691T>A	5.37:g.150923997A>T	ENSP00000261800:p.Leu2231Met		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L2231M	ENST00000261800.5	37	c.6691	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	A	14.98	2.697193	0.48202	.	.	ENSG00000086570	ENST00000261800	T	0.74842	-0.88	5.48	0.537	0.17144	Cadherin (4);Cadherin-like (1);	0.000000	0.50627	D	0.000119	D	0.83764	0.5325	M	0.87328	2.875	0.37706	D	0.924392	D	0.89917	1.0	D	0.79784	0.993	T	0.82129	-0.0610	10	0.62326	D	0.03	.	6.1674	0.20398	0.46:0.1424:0.3976:0.0	.	2231	Q9NYQ8	FAT2_HUMAN	M	2231	ENSP00000261800:L2231M	ENSP00000261800:L2231M	L	-	1	2	FAT2	150904190	0.788000	0.28762	0.937000	0.37676	0.988000	0.76386	1.212000	0.32394	0.078000	0.16900	0.459000	0.35465	TTG	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.502	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	51	0	A	NM_001447		150923997	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	8.89	40	4	SNP	0.259	T
FAT4	79633	genome.wustl.edu	37	4	126238058	126238058	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:126238058C>T	ENST00000394329.3	+	1	505	c.492C>T	c.(490-492)atC>atT	p.I164I		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	164	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ACTCGGACATCGGCTCAAACG	0.627											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	39.0	38.0					4																	126238058		2078	4204	6282	SO:0001819	synonymous_variant	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.492C>T	4.37:g.126238058C>T		1548	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.I164	ENST00000394329.3	37	c.492	CCDS3732.3	4																																																																																			FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.627	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	38	0	C	NM_024582		126238058	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	35.00	13	7	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126412644	126412644	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:126412644G>T	ENST00000394329.3	+	17	14680	c.14667G>T	c.(14665-14667)aaG>aaT	p.K4889N	FAT4_ENST00000335110.5_Missense_Mutation_p.K3130N	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4889					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCAGACTGAAGCCTCGAAGGT	0.527																																																	0													59.0	59.0	59.0					4																	126412644		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14667G>T	4.37:g.126412644G>T	ENSP00000377862:p.Lys4889Asn		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.K4889N	ENST00000394329.3	37	c.14667	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	9.601	1.128798	0.21041	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.76578	-0.84;-1.03	5.19	2.42	0.29668	.	0.000000	0.35805	U	0.002980	T	0.79112	0.4391	L	0.51422	1.61	0.44677	D	0.99766	D;D;P	0.61697	0.99;0.983;0.944	P;P;P	0.57152	0.814;0.521;0.714	T	0.76597	-0.2901	10	0.66056	D	0.02	.	8.5626	0.33520	0.2628:0.0:0.7372:0.0	.	3130;4889;4888	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	N	4889;3130	ENSP00000377862:K4889N;ENSP00000335169:K3130N	ENSP00000335169:K3130N	K	+	3	2	FAT4	126632094	1.000000	0.71417	0.991000	0.47740	0.151000	0.21798	4.347000	0.59373	0.170000	0.19704	0.491000	0.48974	AAG	FAT4	-	NULL	ENSG00000196159		0.527	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	44	0	G	NM_024582		126412644	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	T
FBN3	84467	genome.wustl.edu	37	19	8191462	8191462	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:8191462T>C	ENST00000600128.1	-	20	2858	c.2444A>G	c.(2443-2445)aAg>aGg	p.K815R	FBN3_ENST00000601739.1_Missense_Mutation_p.K815R|FBN3_ENST00000270509.2_Missense_Mutation_p.K815R			Q75N90	FBN3_HUMAN	fibrillin 3	815	TB 4.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CTCCTGGATCTTCAGCCAGCA	0.677																																																	0													37.0	34.0	35.0					19																	8191462		2203	4300	6503	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2444A>G	19.37:g.8191462T>C	ENSP00000470498:p.Lys815Arg		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.K815R	ENST00000600128.1	37	c.2444	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	t	8.836	0.941059	0.18281	.	.	ENSG00000142449	ENST00000270509	D	0.90732	-2.72	3.79	1.64	0.23874	Matrix fibril-associated (2);TGF-beta binding (1);	0.334930	0.29046	U	0.013309	D	0.83445	0.5256	L	0.44542	1.39	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.66740	-0.5847	10	0.22706	T	0.39	.	7.5725	0.27915	0.0:0.1843:0.0:0.8157	.	815	Q75N90	FBN3_HUMAN	R	815	ENSP00000270509:K815R	ENSP00000270509:K815R	K	-	2	0	FBN3	8097462	0.974000	0.33945	0.109000	0.21407	0.892000	0.51952	1.383000	0.34385	-0.004000	0.14419	0.402000	0.26972	AAG	FBN3	-	superfamily_TB_dom,pirsf_FBN	ENSG00000142449		0.677	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	167	0	T	NM_032447		8191462	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.405	C
FBXO3	26273	genome.wustl.edu	37	11	33792357	33792357	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:33792357T>A	ENST00000265651.3	-	2	142	c.124A>T	c.(124-126)Aga>Tga	p.R42*	FBXO3_ENST00000526785.1_De_novo_Start_OutOfFrame|FBXO3_ENST00000530401.1_Nonsense_Mutation_p.R37*|FBXO3_ENST00000534136.1_Nonsense_Mutation_p.R42*|FBXO3_ENST00000533103.1_5'UTR|FBXO3_ENST00000448981.2_Nonsense_Mutation_p.R42*	NM_012175.3	NP_036307.2	Q9UK99	FBX3_HUMAN	F-box protein 3	42	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|pancreas(1)|stomach(1)	13		Lung NSC(402;0.0804)		BRCA - Breast invasive adenocarcinoma(625;0.00315)|Lung(977;0.00488)|LUSC - Lung squamous cell carcinoma(625;0.008)		TGGCTAAGTCTTCGACTGACA	0.338																																																	0													221.0	206.0	211.0					11																	33792357		2202	4298	6500	SO:0001587	stop_gained	0			AK001943	CCDS7887.1, CCDS44566.1	11p13	2006-07-07	2004-06-15		ENSG00000110429	ENSG00000110429		"""F-boxes /  ""other"""""	13582	protein-coding gene	gene with protein product		609089	"""F-box only protein 3"""			10531037	Standard	NM_033406		Approved	FBX3, FBA	uc001muz.3	Q9UK99	OTTHUMG00000166244	ENST00000265651.3:c.124A>T	11.37:g.33792357T>A	ENSP00000265651:p.Arg42*		B3KY16|D3DR05|Q86X90|Q9H0V2|Q9NUX2	Nonsense_Mutation	SNP	pfam_ApaG_domain,pfam_F-box_dom,superfamily_ApaG_domain,superfamily_F-box_dom,smart_F-box_dom,smart_SMI1/KNR4_like_dom,pfscan_ApaG_domain,pfscan_F-box_dom	p.R42*	ENST00000265651.3	37	c.124	CCDS7887.1	11	.	.	.	.	.	.	.	.	.	.	T	36	5.757504	0.96898	.	.	ENSG00000110429	ENST00000265651;ENST00000321458;ENST00000530401;ENST00000534136;ENST00000448981	.	.	.	5.5	3.01	0.34805	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9694	6.9774	0.24683	0.1473:0.0:0.1539:0.6989	.	.	.	.	X	42;39;37;42;42	.	ENSP00000265651:R42X	R	-	1	2	FBXO3	33748933	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.308000	0.43690	0.885000	0.36088	0.397000	0.26171	AGA	FBXO3	-	pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	ENSG00000110429		0.338	FBXO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO3	HGNC	protein_coding	OTTHUMT00000388665.1	-	0.00	67	0	T	NM_012175		33792357	-1	tier1	-	no_errors	ENST00000265651	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	1.000	A
FBXO43	286151	genome.wustl.edu	37	8	101154374	101154374	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:101154374C>T	ENST00000428847.2	-	2	424	c.108G>A	c.(106-108)tcG>tcA	p.S36S		NM_001029860.3	NP_001025031.2	Q4G163	FBX43_HUMAN	F-box protein 43	36					meiotic nuclear division (GO:0007126)|negative regulation of meiosis (GO:0045835)|negative regulation of protein catabolic process (GO:0042177)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.S2S(2)		endometrium(1)|kidney(4)|large_intestine(5)|lung(14)|prostate(1)|skin(5)|urinary_tract(1)	31	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			AGTGCCTTTGCGACATCTTCA	0.418																																																	2	Substitution - coding silent(2)	large_intestine(2)											78.0	82.0	81.0					8																	101154374		2001	4179	6180	SO:0001819	synonymous_variant	0			BC028709	CCDS47904.1	8q22.3	2004-08-24			ENSG00000156509	ENSG00000156509		"""F-boxes /  ""other"""""	28521	protein-coding gene	gene with protein product		609110					Standard	NR_036491		Approved	Fbx43	uc003yjd.3	Q4G163	OTTHUMG00000164803	ENST00000428847.2:c.108G>A	8.37:g.101154374C>T				Silent	SNP	pfam_Znf_C6HC,superfamily_F-box_dom,smart_Znf_C6HC	p.S36	ENST00000428847.2	37	c.108	CCDS47904.1	8																																																																																			FBXO43	-	NULL	ENSG00000156509		0.418	FBXO43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO43	HGNC	protein_coding	OTTHUMT00000380380.1	-	0.00	64	0	C	XM_209918		101154374	-1	tier1	-	no_errors	ENST00000428847	ensembl	human	known	74_37	silent	70.91	15	39	SNP	0.561	T
FCGBP	8857	genome.wustl.edu	37	19	40368423	40368423	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:40368423G>C	ENST00000221347.6	-	28	12932	c.12925C>G	c.(12925-12927)Ctg>Gtg	p.L4309V		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4309						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CAGACGTCCAGAACACAGCCC	0.622																																																	0													131.0	132.0	131.0					19																	40368423		2203	4297	6500	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.12925C>G	19.37:g.40368423G>C	ENSP00000221347:p.Leu4309Val		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.L4309V	ENST00000221347.6	37	c.12925	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276584	0.23307	.	.	ENSG00000090920	ENST00000221347	T	0.78003	-1.14	4.08	2.99	0.34606	Uncharacterised domain, cysteine-rich (2);	0.526247	0.16872	U	0.196082	T	0.76407	0.3983	M	0.76002	2.32	0.22666	N	0.998874	P	0.47841	0.901	P	0.49361	0.608	T	0.63651	-0.6589	10	0.19590	T	0.45	.	3.4829	0.07609	0.1958:0.0:0.5894:0.2148	.	4309	Q9Y6R7	FCGBP_HUMAN	V	4309	ENSP00000221347:L4309V	ENSP00000221347:L4309V	L	-	1	2	FCGBP	45060263	0.017000	0.18338	0.644000	0.29465	0.797000	0.45037	2.337000	0.43947	1.003000	0.39130	0.305000	0.20034	CTG	FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000090920		0.622	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	207	0	G	NM_003890		40368423	-1	tier1	-	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	33.85	86	44	SNP	0.995	C
FCGBP	8857	genome.wustl.edu	37	19	40408685	40408685	+	Missense_Mutation	SNP	T	T	A	rs61735900	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:40408685T>A	ENST00000221347.6	-	8	4161	c.4154A>T	c.(4153-4155)cAg>cTg	p.Q1385L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1385	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCACACATCTGCTGGTAGTA	0.567																																																	0								T	LEU/GLN	1,4405		0,1,2202	145.0	124.0	131.0		4154	3.7	1.0	19	dbSNP_129	131	19,8581	7.1+/-27.0	0,19,4281	no	missense	FCGBP	NM_003890.2	113	0,20,6483	AA,AT,TT		0.2209,0.0227,0.1538	probably-damaging	1385/5406	40408685	20,12986	2203	4300	6503	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4154A>T	19.37:g.40408685T>A	ENSP00000221347:p.Gln1385Leu		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.Q1385L	ENST00000221347.6	37	c.4154	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	T	8.402	0.842279	0.16963	2.27E-4	0.002209	ENSG00000090920	ENST00000221347	T	0.60920	0.15	4.71	3.68	0.42216	von Willebrand factor, type D domain (3);	0.262657	0.30949	N	0.008545	T	0.48857	0.1523	L	0.51853	1.615	0.09310	N	0.999993	B	0.25850	0.136	B	0.24541	0.054	T	0.40572	-0.9556	10	0.41790	T	0.15	.	9.762	0.40537	0.1551:0.0:0.0:0.8449	rs61735900	1385	Q9Y6R7	FCGBP_HUMAN	L	1385	ENSP00000221347:Q1385L	ENSP00000221347:Q1385L	Q	-	2	0	FCGBP	45100525	0.000000	0.05858	0.985000	0.45067	0.120000	0.20174	-0.023000	0.12456	0.649000	0.30751	-0.349000	0.07799	CAG	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.567	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	226	0	T	NM_003890		40408685	-1	tier1	rs61735900	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	16.30	113	22	SNP	0.327	A
FCGBP	8857	genome.wustl.edu	37	19	40408702	40408702	+	Silent	SNP	G	G	A	rs111260775	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:40408702G>A	ENST00000221347.6	-	8	4144	c.4137C>T	c.(4135-4137)ccC>ccT	p.P1379P		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1379	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGTAGTTTCCGGGGACGGTGA	0.577													G|||	3	0.000599042	0.0	0.0	5008	,	,		20862	0.001		0.001	False		,,,				2504	0.001																0																																										SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4137C>T	19.37:g.40408702G>A			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.P1379	ENST00000221347.6	37	c.4137	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000090920		0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	219	0	G	NM_003890		40408702	-1	tier1	rs111260775	no_errors	ENST00000221347	ensembl	human	known	74_37	silent	15.97	100	19	SNP	0.085	A
FCRL4	83417	genome.wustl.edu	37	1	157559110	157559110	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:157559110C>A	ENST00000271532.1	-	3	326	c.191G>T	c.(190-192)gGa>gTa	p.G64V	FCRL4_ENST00000448509.2_5'Flank	NM_031282.2	NP_112572.1	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4	64	Ig-like C2-type 1.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(20)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	40	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)				CAACTTTTCTCCCCAGTAGTG	0.522																																																	0													108.0	93.0	98.0					1																	157559110		2203	4300	6503	SO:0001583	missense	0			AF343661	CCDS1166.1	1q21	2013-01-14			ENSG00000163518	ENSG00000163518		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18507	protein-coding gene	gene with protein product		605876				11290337, 11493702	Standard	NM_031282		Approved	FCRH4, IRTA1, IGFP2, CD307d	uc001fqw.3	Q96PJ5	OTTHUMG00000035488	ENST00000271532.1:c.191G>T	1.37:g.157559110C>A	ENSP00000271532:p.Gly64Val		Q96PJ3|Q96RE0	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G64V	ENST00000271532.1	37	c.191	CCDS1166.1	1	.	.	.	.	.	.	.	.	.	.	C	9.054	0.992701	0.18966	.	.	ENSG00000163518	ENST00000271532	T	0.62788	0.0	4.2	-7.08	0.01558	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.292790	0.05964	N	0.641146	T	0.40909	0.1136	M	0.85041	2.73	0.09310	N	1	B	0.29671	0.254	B	0.36186	0.219	T	0.48670	-0.9015	10	0.28530	T	0.3	.	3.9893	0.09530	0.2538:0.2273:0.0:0.5189	.	64	Q96PJ5	FCRL4_HUMAN	V	64	ENSP00000271532:G64V	ENSP00000271532:G64V	G	-	2	0	FCRL4	155825734	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.051000	0.00628	-0.852000	0.04141	-0.455000	0.05494	GGA	FCRL4	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000163518		0.522	FCRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL4	HGNC	protein_coding	OTTHUMT00000086180.1	-	0.00	135	0	C	NM_031282		157559110	-1	tier1	-	no_errors	ENST00000271532	ensembl	human	known	74_37	missense	21.10	86	23	SNP	0.000	A
FER	2241	genome.wustl.edu	37	5	108260458	108260458	+	Intron	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:108260458G>T	ENST00000281092.4	+	11	1620				FER_ENST00000438717.2_Intron|FER_ENST00000536402.1_Intron	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase						actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		GTTCAGCTCTGAGCCTTCCAC	0.478																																					Colon(146;1051 1799 9836 27344 47401)												0																																										SO:0001627	intron_variant	0			J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.1237-21373G>T	5.37:g.108260458G>T			B2RCR4|B4DSQ2|H2FLB8	RNA	SNP	-	NULL	ENST00000281092.4	37	NULL	CCDS4098.1	5																																																																																			FER	-	-	ENSG00000151422		0.478	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER	HGNC	protein_coding	OTTHUMT00000250664.1	-	0.00	39	0	G	NM_005246		108260458	+1	tier1	-	no_errors	ENST00000505323	ensembl	human	known	74_37	rna	7.84	47	4	SNP	0.019	T
FGF6	2251	genome.wustl.edu	37	12	4554486	4554486	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:4554486C>T	ENST00000228837.2	-	1	294	c.251G>A	c.(250-252)cGg>cAg	p.R84Q		NM_020996.1	NP_066276.2	P10767	FGF6_HUMAN	fibroblast growth factor 6	84					angiogenesis (GO:0001525)|cartilage condensation (GO:0001502)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|myoblast differentiation (GO:0045445)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|sarcolemma (GO:0042383)	growth factor activity (GO:0008083)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)			CCTCCGCTGCCGCTTGATCCC	0.652																																																	0													84.0	74.0	78.0					12																	4554486		2203	4300	6503	SO:0001583	missense	0			X63454	CCDS8527.1	12p13	2014-01-30				ENSG00000111241		"""Endogenous ligands"""	3684	protein-coding gene	gene with protein product		134921				16597617	Standard	NM_020996		Approved		uc001qmr.1	P10767		ENST00000228837.2:c.251G>A	12.37:g.4554486C>T	ENSP00000228837:p.Arg84Gln		Q0VAE1	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.R84Q	ENST00000228837.2	37	c.251	CCDS8527.1	12	.	.	.	.	.	.	.	.	.	.	C	29.0	4.966252	0.92855	.	.	ENSG00000111241	ENST00000228837	D	0.84589	-1.87	5.3	4.41	0.53225	.	0.000000	0.85682	D	0.000000	D	0.93910	0.8051	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.95231	0.8342	10	0.87932	D	0	.	14.2222	0.65836	0.0:0.9279:0.0:0.0721	.	84	P10767	FGF6_HUMAN	Q	84	ENSP00000228837:R84Q	ENSP00000228837:R84Q	R	-	2	0	FGF6	4424747	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	1.373000	0.46208	0.655000	0.94253	CGG	FGF6	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam	ENSG00000111241		0.652	FGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF6	HGNC	protein_coding	OTTHUMT00000398939.1	-	0.00	70	0	C	NM_020996		4554486	-1	tier1	-	no_errors	ENST00000228837	ensembl	human	known	74_37	missense	29.69	45	19	SNP	1.000	T
FGF8	2253	genome.wustl.edu	37	10	103530199	103530199	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:103530199G>A	ENST00000344255.3	-	6	588	c.589C>T	c.(589-591)Ccc>Tcc	p.P197S	FGF8_ENST00000346714.3_Missense_Mutation_p.P168S|FGF8_ENST00000320185.2_Missense_Mutation_p.P208S|FGF8_ENST00000347978.2_Missense_Mutation_p.P179S|FGF8_ENST00000485728.1_5'UTR			P55075	FGF8_HUMAN	fibroblast growth factor 8 (androgen-induced)	197					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in mesendoderm migration (GO:0090134)|cell proliferation in forebrain (GO:0021846)|corticotropin hormone secreting cell differentiation (GO:0060128)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral axon guidance (GO:0033563)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|forebrain neuron development (GO:0021884)|gastrulation (GO:0007369)|gonad development (GO:0008406)|heart looping (GO:0001947)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lung morphogenesis (GO:0060425)|male genitalia development (GO:0030539)|MAPK cascade (GO:0000165)|mesodermal cell migration (GO:0008078)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|midbrain-hindbrain boundary development (GO:0030917)|motor neuron axon guidance (GO:0008045)|negative regulation of cardiac muscle tissue development (GO:0055026)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate morphogenesis (GO:0001839)|neuroepithelial cell differentiation (GO:0060563)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|pallium development (GO:0021543)|patterning of blood vessels (GO:0001569)|pharyngeal system development (GO:0060037)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitosis (GO:0045840)|positive regulation of organ growth (GO:0046622)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)|signal transduction involved in regulation of gene expression (GO:0023019)|subpallium development (GO:0021544)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(2)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		TGGCCCCGGGGCAGCCGCTTC	0.692																																																	0													26.0	32.0	29.0					10																	103530199		2203	4298	6501	SO:0001583	missense	0			D38752	CCDS7515.1, CCDS7516.1, CCDS7517.1, CCDS7518.1, CCDS73185.1	10q25-q26	2014-01-30			ENSG00000107831	ENSG00000107831		"""Endogenous ligands"""	3686	protein-coding gene	gene with protein product		600483				8595889	Standard	NM_033164		Approved	AIGF	uc001ktq.2	P55075	OTTHUMG00000018940	ENST00000344255.3:c.589C>T	10.37:g.103530199G>A	ENSP00000340039:p.Pro197Ser		A1A514|Q14915|Q15766	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.P208S	ENST00000344255.3	37	c.622	CCDS7517.1	10	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559252	0.65538	.	.	ENSG00000107831	ENST00000344255;ENST00000320185;ENST00000346714;ENST00000347978	D;T;D;T	0.82167	-1.58;-1.43;-1.55;-1.38	3.79	3.79	0.43588	.	0.063314	0.64402	D	0.000004	D	0.84857	0.5565	L	0.46157	1.445	0.80722	D	1	D;P;P;D	0.60575	0.988;0.945;0.906;0.965	P;B;P;P	0.54706	0.759;0.396;0.572;0.632	D	0.86723	0.1943	10	0.59425	D	0.04	.	15.6748	0.77307	0.0:0.0:1.0:0.0	.	168;179;208;197	P55075-2;P55075-3;P55075-4;P55075	.;.;.;FGF8_HUMAN	S	197;208;168;179	ENSP00000340039:P197S;ENSP00000321797:P208S;ENSP00000344306:P168S;ENSP00000321945:P179S	ENSP00000321797:P208S	P	-	1	0	FGF8	103520189	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.359000	0.97115	1.679000	0.50963	0.455000	0.32223	CCC	FGF8	-	superfamily_Cytokine_IL1-like	ENSG00000107831		0.692	FGF8-004	KNOWN	basic|CCDS	protein_coding	FGF8	HGNC	protein_coding	OTTHUMT00000049999.1	-	0.00	58	0	G	NM_006119, NM_033165		103530199	-1	tier1	-	no_errors	ENST00000320185	ensembl	human	known	74_37	missense	30.77	27	12	SNP	1.000	A
FIGLA	344018	genome.wustl.edu	37	2	71017637	71017637	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:71017637C>T	ENST00000332372.6	-	1	138	c.134G>A	c.(133-135)cGg>cAg	p.R45Q		NM_001004311.3	NP_001004311.2	Q6QHK4	FIGLA_HUMAN	folliculogenesis specific basic helix-loop-helix	45					multicellular organismal development (GO:0007275)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			endometrium(2)|lung(3)	5						CCGCTTGAGCCGGCAGACAGC	0.726																																																	0													3.0	4.0	3.0					2																	71017637		1483	3164	4647	SO:0001583	missense	0			BC039536	CCDS46320.1	2p13.3	2013-05-21			ENSG00000183733	ENSG00000183733		"""Basic helix-loop-helix proteins"""	24669	protein-coding gene	gene with protein product	"""factor in the germline alpha"""	608697				12468641	Standard	NM_001004311		Approved	bHLHc8	uc002she.1	Q6QHK4	OTTHUMG00000153440	ENST00000332372.6:c.134G>A	2.37:g.71017637C>T	ENSP00000333097:p.Arg45Gln			Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R45Q	ENST00000332372.6	37	c.134	CCDS46320.1	2	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400566	0.62177	.	.	ENSG00000183733	ENST00000332372	D	0.95980	-3.87	3.83	3.83	0.44106	.	0.150870	0.28971	N	0.013546	D	0.95921	0.8672	L	0.58101	1.795	0.29255	N	0.871719	D	0.89917	1.0	D	0.66716	0.946	D	0.91422	0.5159	10	0.66056	D	0.02	.	7.1783	0.25757	0.0:0.879:0.0:0.121	.	45	Q6QHK4	FIGLA_HUMAN	Q	45	ENSP00000333097:R45Q	ENSP00000333097:R45Q	R	-	2	0	FIGLA	70871145	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	2.425000	0.44723	1.965000	0.57142	0.313000	0.20887	CGG	FIGLA	-	NULL	ENSG00000183733		0.726	FIGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGLA	HGNC	protein_coding	OTTHUMT00000331214.1	-	0.00	15	0	C	NM_001004311		71017637	-1	tier1	-	no_errors	ENST00000332372	ensembl	human	known	74_37	missense	60.00	4	6	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152280658	152280658	+	Missense_Mutation	SNP	G	G	A	rs200713352		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:152280658G>A	ENST00000368799.1	-	3	6739	c.6704C>T	c.(6703-6705)aCa>aTa	p.T2235I	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2235	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGCCTGCTTGTCCTGGGCCC	0.582									Ichthyosis																																								0													214.0	215.0	214.0					1																	152280658		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6704C>T	1.37:g.152280658G>A	ENSP00000357789:p.Thr2235Ile		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.T2235I	ENST00000368799.1	37	c.6704	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	g	4.267	0.048550	0.08243	.	.	ENSG00000143631	ENST00000368799	T	0.04654	3.58	3.41	0.301	0.15781	.	.	.	.	.	T	0.01765	0.0056	M	0.75447	2.3	0.09310	N	1	B	0.33413	0.411	B	0.28991	0.097	T	0.43097	-0.9412	9	0.38643	T	0.18	.	2.4051	0.04411	0.1129:0.1855:0.511:0.1906	.	2235	P20930	FILA_HUMAN	I	2235	ENSP00000357789:T2235I	ENSP00000357789:T2235I	T	-	2	0	FLG	150547282	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.854000	0.01664	-0.036000	0.13669	-1.307000	0.01316	ACA	FLG	-	pfam_Filaggrin	ENSG00000143631		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	144	0	G	NM_002016		152280658	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	49.62	66	65	SNP	0.000	A
PIEZO1	9780	genome.wustl.edu	37	16	88809962	88809962	+	Intron	SNP	C	C	T	rs532834969	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:88809962C>T	ENST00000301015.9	-	3	407				RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.8_ENST00000333666.1_RNA|RP5-1142A6.7_ENST00000566114.1_RNA|RP5-1142A6.8_ENST00000567588.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CTCTCGGCCTCGGGGCGCAAA	0.572											OREG0024049	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2	0.000399361	0.0	0.0	5008	,	,		20494	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001627	intron_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.161-1132G>A	16.37:g.88809962C>T		1262	A6NHT9|A7E2B7|Q0KKZ9	RNA	SNP	-	NULL	ENST00000301015.9	37	NULL	CCDS54058.1	16																																																																																			RP5-1142A6.8	-	-	ENSG00000182376		0.572	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	FLJ40448	Clone_based_vega_gene	protein_coding	OTTHUMT00000345699.4	-	0.00	90	0	C	NM_014745		88809962	+1	tier1	-	no_errors	ENST00000567588	ensembl	human	known	74_37	rna	57.75	30	41	SNP	0.001	T
LINC01446	401337	genome.wustl.edu	37	7	53879455	53879455	+	lincRNA	SNP	T	T	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:53879455T>A	ENST00000380970.2	-	0	169					NR_038371.1																						aggcccaccgtgtgctcctag	0.662																																																	0																																												0																															7.37:g.53879455T>A				RNA	SNP	-	NULL	ENST00000380970.2	37	NULL		7																																																																																			GS1-179L18.1	-	-	ENSG00000205628		0.662	GS1-179L18.1-001	KNOWN	basic	lincRNA	FLJ45974	Clone_based_vega_gene	lincRNA	OTTHUMT00000342819.1	-	0.00	31	0	T			53879455	-1	tier1	-	no_errors	ENST00000380970	ensembl	human	known	74_37	rna	40.00	14	10	SNP	0.020	A
FLRT2	23768	genome.wustl.edu	37	14	86090122	86090122	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:86090122A>C	ENST00000330753.4	+	0	3031				FLRT2_ENST00000554746.1_3'UTR	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TACAATGAGAACCCAATGCCA	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.*281A>C	14.37:g.86090122A>C			A0AV84|B7ZLP3	RNA	SNP	-	NULL	ENST00000330753.4	37	NULL	CCDS9877.1	14																																																																																			FLRT2	-	-	ENSG00000185070		0.343	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	-	0.00	55	0	A			86090122	+1	tier1	-	no_errors	ENST00000553650	ensembl	human	putative	74_37	rna	52.50	19	21	SNP	1.000	C
FN1	2335	genome.wustl.edu	37	2	216240064	216240064	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:216240064C>A	ENST00000359671.1	-	37	6022	c.5757G>T	c.(5755-5757)ttG>ttT	p.L1919F	FN1_ENST00000446046.1_Missense_Mutation_p.L1919F|FN1_ENST00000443816.1_Missense_Mutation_p.L1829F|FN1_ENST00000357867.4_Missense_Mutation_p.L1829F|FN1_ENST00000357009.2_Missense_Mutation_p.L1919F|FN1_ENST00000345488.5_Missense_Mutation_p.L1919F|FN1_ENST00000336916.4_Missense_Mutation_p.L1919F|FN1_ENST00000323926.6_Missense_Mutation_p.L2010F|FN1_ENST00000346544.3_Missense_Mutation_p.L1919F|FN1_ENST00000354785.4_Missense_Mutation_p.L2010F|FN1_ENST00000421182.1_Missense_Mutation_p.L1829F|FN1_ENST00000432072.2_Missense_Mutation_p.L1920F|FN1_ENST00000356005.4_Missense_Mutation_p.L1829F			P02751	FINC_HUMAN	fibronectin 1	1919	Binds to FBLN1.|Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ATGATACCAGCAAGGAATTGG	0.517																																																	0													58.0	59.0	59.0					2																	216240064		2203	4300	6503	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5757G>T	2.37:g.216240064C>A	ENSP00000352696:p.Leu1919Phe		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.L2010F	ENST00000359671.1	37	c.6030		2	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659306	0.67586	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923;ENST00000438981	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.61510	0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1	5.64	3.83	0.44106	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.139803	0.31721	N	0.007166	T	0.66406	0.2786	L	0.43598	1.365	0.23381	N	0.997796	D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.982;1.0;1.0;0.999;0.992;1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;P;D;D;D;D;D;D;D;D	0.91635	0.933;0.998;0.998;0.96;0.883;0.998;0.999;0.96;0.999;0.998;0.998;0.999;0.999	T	0.57837	-0.7742	10	0.51188	T	0.08	.	10.9623	0.47393	0.0:0.69:0.2433:0.0667	.	1710;1919;1920;2010;1829;1829;1919;1919;1920;1829;1829;2010;1919	Q68CX6;F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	F	1829;2010;1919;1829;2010;1920;1919;1919;1919;1919;1919;1829;1920;1829;636;38	ENSP00000394423:L1829F;ENSP00000323534:L2010F;ENSP00000338200:L1919F;ENSP00000350534:L1829F;ENSP00000346839:L2010F;ENSP00000352696:L1919F;ENSP00000265312:L1919F;ENSP00000273049:L1919F;ENSP00000349509:L1919F;ENSP00000410422:L1919F;ENSP00000415018:L1829F;ENSP00000399538:L1920F;ENSP00000348285:L1829F;ENSP00000416139:L636F;ENSP00000392565:L38F	ENSP00000265313:L1920F	L	-	3	2	FN1	215948309	1.000000	0.71417	0.930000	0.37139	0.986000	0.74619	1.721000	0.38032	0.720000	0.32209	0.563000	0.77884	TTG	FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.517	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		-	0.00	75	0	C	NM_212476		216240064	-1	tier1	-	no_errors	ENST00000354785	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
FREM3	166752	genome.wustl.edu	37	4	144619387	144619387	+	Silent	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:144619387C>A	ENST00000329798.5	-	1	2441	c.2442G>T	c.(2440-2442)gtG>gtT	p.V814V	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	814					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						ATGTGCCTGGCACGCTATTGC	0.502																																																	0													173.0	139.0	149.0					4																	144619387		692	1591	2283	SO:0001819	synonymous_variant	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.2442G>T	4.37:g.144619387C>A				Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.V814	ENST00000329798.5	37	c.2442	CCDS54808.1	4																																																																																			FREM3	-	NULL	ENSG00000183090		0.502	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	93	0	C	XM_094074		144619387	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	silent	73.14	47	128	SNP	0.000	A
FTCD	10841	genome.wustl.edu	37	21	47557244	47557244	+	Missense_Mutation	SNP	G	G	A	rs145609043		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:47557244G>A	ENST00000291670.5	-	13	1491	c.1448C>T	c.(1447-1449)gCg>gTg	p.A483V	FTCD_ENST00000397746.3_Missense_Mutation_p.A483V|FTCD_ENST00000359679.2_Missense_Mutation_p.A483V|FTCD_ENST00000397748.1_Missense_Mutation_p.A483V|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000355384.2_Silent_p.G468G|FTCD_ENST00000397743.1_Silent_p.G468G	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	483	Cyclodeaminase/cyclohydrolase. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	GGCTTTGGCCGCCACCTGCAA	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		18300	0.0		0.001	False		,,,				2504	0.0																0								G	VAL/ALA,VAL/ALA	0,4406		0,0,2203	90.0	87.0	88.0		1448,1448	4.1	1.0	21	dbSNP_134	88	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	FTCD	NM_006657.2,NM_206965.1	64,64	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging,probably-damaging	483/542,483/542	47557244	3,13003	2203	4300	6503	SO:0001583	missense	0			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1448C>T	21.37:g.47557244G>A	ENSP00000291670:p.Ala483Val		B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	pfam_Formiminotransferase_N,pfam_Formiminotransferase_C,pfam_Cyclodeamin/CycHdrlase,superfamily_FormiminoTrfase_N/C_subdom,superfamily_Cyclodeamin/CycHdrlase,tigrfam_Formiminotransferase_cat	p.A483V	ENST00000291670.5	37	c.1448	CCDS13731.1	21	1|1	4.578754578754579E-4|4.578754578754579E-4	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	1|1	0.0013192612137203166|0.0013192612137203166	G|G	19.52|19.52	3.843774|3.843774	0.71488|0.71488	0.0|0.0	3.49E-4|3.49E-4	ENSG00000160282|ENSG00000160282	ENST00000291670;ENST00000397748;ENST00000359679;ENST00000397746|ENST00000446405	T;T;T;T|.	0.58506|.	0.33;0.33;0.33;0.33|.	4.12|4.12	4.12|4.12	0.48240|0.48240	Cyclodeaminase/cyclohydrolase (2);|.	0.126274|.	0.52532|.	U|.	0.000077|.	T|T	0.80654|0.80654	0.4664|0.4664	M|M	0.91406|0.91406	3.205|3.205	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	P;D|.	0.64776|.	0.834;0.929|.	D|D	0.85232|0.85232	0.1033|0.1033	10|5	0.87932|.	D|.	0|.	-7.8491|-7.8491	13.3068|13.3068	0.60357|0.60357	0.0:0.1728:0.8272:0.0|0.0:0.1728:0.8272:0.0	.|.	483;483|.	O95954-2;O95954|.	.;FTCD_HUMAN|.	V|W	483|24	ENSP00000291670:A483V;ENSP00000380856:A483V;ENSP00000352707:A483V;ENSP00000380854:A483V|.	ENSP00000291670:A483V|.	A|R	-|-	2|1	0|2	FTCD|FTCD	46381672|46381672	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.897000|0.897000	0.52465|0.52465	3.380000|3.380000	0.52448|0.52448	1.842000|1.842000	0.53543|0.53543	0.455000|0.455000	0.32223|0.32223	GCG|CGG	FTCD	-	pfam_Cyclodeamin/CycHdrlase,superfamily_Cyclodeamin/CycHdrlase	ENSG00000160282		0.597	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206962.1		0.00	48	0	G	NM_006657		47557244	-1			no_errors	ENST00000359679	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.996	A
GAL	51083	genome.wustl.edu	37	11	68452434	68452434	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:68452434G>A	ENST00000265643.3	+	2	301	c.43G>A	c.(43-45)Gcc>Acc	p.A15T		NM_015973.3	NP_057057.2	P22466	GALA_HUMAN	galanin/GMAP prepropeptide	15					cAMP-mediated signaling (GO:0019933)|feeding behavior (GO:0007631)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of root hair elongation (GO:1902891)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catagen (GO:0051795)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein kinase A signaling (GO:0010737)|regulation of glucocorticoid metabolic process (GO:0031943)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|secretory granule (GO:0030141)	neuropeptide hormone activity (GO:0005184)|type 1 galanin receptor binding (GO:0031764)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			lung(4)	4	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		CCTCCTCCTCGCCGCGGCCCT	0.746																																																	0													12.0	12.0	12.0					11																	68452434		2193	4282	6475	SO:0001583	missense	0			L11144	CCDS8183.1	11q13.2	2013-02-26	2012-10-23		ENSG00000069482	ENSG00000069482		"""Endogenous ligands"""	4114	protein-coding gene	gene with protein product	"""galanin-message-associated peptide"", ""galanin/GMAP prepropeptide"""	137035	"""galanin"", ""galanin prepropeptide"""	GALN		7508413	Standard	XM_006718580		Approved	GMAP, GAL-GMAP, GLNN	uc001oob.3	P22466	OTTHUMG00000167890	ENST00000265643.3:c.43G>A	11.37:g.68452434G>A	ENSP00000265643:p.Ala15Thr		Q14413	Missense_Mutation	SNP	pfam_GMAP,pfam_Galanin,smart_Galanin_pre,prints_Galanin	p.A15T	ENST00000265643.3	37	c.43	CCDS8183.1	11	.	.	.	.	.	.	.	.	.	.	G	12.58	1.979339	0.34942	.	.	ENSG00000069482	ENST00000265643	T	0.45668	0.89	3.03	-0.714	0.11219	.	0.662303	0.12684	N	0.447764	T	0.25531	0.0621	L	0.36672	1.1	0.09310	N	1	B	0.16603	0.018	B	0.08055	0.003	T	0.15607	-1.0431	10	0.30854	T	0.27	-15.2966	3.3847	0.07268	0.1455:0.0:0.3787:0.4758	.	15	P22466	GALA_HUMAN	T	15	ENSP00000265643:A15T	ENSP00000265643:A15T	A	+	1	0	GAL	68209010	0.000000	0.05858	0.142000	0.22268	0.620000	0.37586	0.033000	0.13754	0.053000	0.16036	-0.350000	0.07774	GCC	GAL	-	NULL	ENSG00000069482		0.746	GAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAL	HGNC	protein_coding	OTTHUMT00000396843.2		0.00	56	0	G	NM_001479		68452434	+1			no_errors	ENST00000265643	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.010	A
GANC	2595	genome.wustl.edu	37	15	42622792	42622792	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:42622792G>T	ENST00000318010.8	+	15	1903	c.1663G>T	c.(1663-1665)Gga>Tga	p.G555*		NM_198141.2	NP_937784.2	Q8TET4	GANC_HUMAN	glucosidase, alpha; neutral C	555					carbohydrate metabolic process (GO:0005975)		alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|maltose alpha-glucosidase activity (GO:0032450)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_cancers(109;3.08e-16)|all_epithelial(112;7.48e-15)|Lung NSC(122;3.08e-09)|all_lung(180;1.48e-08)|Melanoma(134;0.0574)|Colorectal(260;0.153)		GBM - Glioblastoma multiforme(94;1.06e-06)	Miglitol(DB00491)	TACTGCAGAAGGACTGATAAA	0.368																																																	0													168.0	143.0	152.0					15																	42622792		2203	4299	6502	SO:0001587	stop_gained	0			AF545045	CCDS10084.1	15q15.2	2012-10-02			ENSG00000214013	ENSG00000214013	3.2.1.20		4139	protein-coding gene	gene with protein product		104180				6995030, 12370436	Standard	NM_198141		Approved		uc001zpi.3	Q8TET4	OTTHUMG00000130487	ENST00000318010.8:c.1663G>T	15.37:g.42622792G>T	ENSP00000326227:p.Gly555*		Q52LQ4|Q8IWZ0|Q8IZM4|Q8IZM5	Nonsense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom	p.G555*	ENST00000318010.8	37	c.1663	CCDS10084.1	15	.	.	.	.	.	.	.	.	.	.	G	41	8.806727	0.98960	.	.	ENSG00000214013	ENST00000318010	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.246	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	555	.	ENSP00000326227:G555X	G	+	1	0	GANC	40410084	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.507000	0.97996	2.941000	0.99782	0.655000	0.94253	GGA	GANC	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000214013		0.368	GANC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GANC	HGNC	protein_coding	OTTHUMT00000252887.2	-	0.00	40	0	G	NM_198141		42622792	+1	tier1	-	no_errors	ENST00000318010	ensembl	human	known	74_37	nonsense	11.43	31	4	SNP	1.000	T
GCDH	2639	genome.wustl.edu	37	19	13004319	13004319	+	Silent	SNP	G	G	T	rs150674535		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:13004319G>T	ENST00000222214.5	+	6	568	c.357G>T	c.(355-357)tcG>tcT	p.S119S	GCDH_ENST00000591470.1_Silent_p.S119S|GCDH_ENST00000457854.1_Silent_p.S119S|GCDH_ENST00000422947.2_Silent_p.S75S			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	119					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	CTGGGGTTTCGTCTGTGGCCT	0.597																																					GBM(123;875 1636 7726 16444 26754)												0													116.0	87.0	97.0					19																	13004319		2203	4300	6503	SO:0001819	synonymous_variant	0			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.357G>T	19.37:g.13004319G>T			A8K2Z2|O14719	Missense_Mutation	SNP	superfamily_AcylCoA_DH/oxidase_NM_dom	p.V138F	ENST00000222214.5	37	c.412	CCDS12286.1	19																																																																																			GCDH	-	NULL	ENSG00000105607		0.597	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCDH	HGNC	protein_coding	OTTHUMT00000451897.1	-	0.00	79	0	G			13004319	+1	tier1	-	no_errors	ENST00000590530	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.038	T
GCNT1	2650	genome.wustl.edu	37	9	79117381	79117383	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	CTT	CTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:79117381_79117383delCTT	ENST00000376730.4	+	4	567_569	c.84_86delCTT	c.(82-87)accttc>acc	p.F29del	GCNT1_ENST00000444201.2_In_Frame_Del_p.F29del|GCNT1_ENST00000442371.1_In_Frame_Del_p.F29del|GCNT1_ENST00000536223.1_In_Frame_Del_p.F29del	NM_001097636.1|NM_001490.4	NP_001091105.1|NP_001481.2	Q02742	GCNT1_HUMAN	glucosaminyl (N-acetyl) transferase 1, core 2	29					cell adhesion molecule production (GO:0060352)|cellular protein metabolic process (GO:0044267)|glycoprotein biosynthetic process (GO:0009101)|kidney morphogenesis (GO:0060993)|leukocyte tethering or rolling (GO:0050901)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to insulin (GO:0032868)|tissue morphogenesis (GO:0048729)	extracellular space (GO:0005615)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(11)|prostate(2)|urinary_tract(1)	30						CCCTAATCACCTTCTCCGTTTTA	0.389																																																	0																																										SO:0001651	inframe_deletion	0			L41415	CCDS6653.1	9q13	2013-02-25	2010-03-16		ENSG00000187210	ENSG00000187210	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4203	protein-coding gene	gene with protein product	"""core 2 beta1,6 N-acetylglucosaminyltransferase-I"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N--acetylglucosaminyltransferase"""	600391	"""glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""	NACGT2		8449405, 9915862	Standard	NM_001490		Approved	C2GNT, NAGCT2	uc004akf.4	Q02742	OTTHUMG00000020044	ENST00000376730.4:c.84_86delCTT	9.37:g.79117381_79117383delCTT	ENSP00000365920:p.Phe29del		Q6DJZ4	In_Frame_Del	DEL	pfam_Glyco_trans_14	p.F29in_frame_del	ENST00000376730.4	37	c.84_86	CCDS6653.1	9																																																																																			GCNT1	-	NULL	ENSG00000187210		0.389	GCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT1	HGNC	protein_coding	OTTHUMT00000052725.1		0.00	72	0	CTT	NM_001097634		79117383	+1	tier1		no_errors	ENST00000376730	ensembl	human	known	74_37	in_frame_del	20.59	54	14	DEL	0.943:0.997:1.000	-
GLI3	2737	genome.wustl.edu	37	7	42004019	42004019	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:42004019G>C	ENST00000395925.3	-	15	4736	c.4652C>G	c.(4651-4653)tCc>tGc	p.S1551C	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	1551					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGTGCTCATGGACAGCGCTGG	0.557									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																																								0													85.0	84.0	84.0					7																	42004019		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.4652C>G	7.37:g.42004019G>C	ENSP00000379258:p.Ser1551Cys		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1551C	ENST00000395925.3	37	c.4652	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309084	0.60414	.	.	ENSG00000106571	ENST00000395925	T	0.14516	2.5	6.03	6.03	0.97812	.	0.406933	0.29087	N	0.013200	T	0.15349	0.0370	N	0.19112	0.55	0.80722	D	1	D	0.53885	0.963	P	0.45712	0.491	T	0.00872	-1.1532	10	0.72032	D	0.01	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	1551	P10071	GLI3_HUMAN	C	1551	ENSP00000379258:S1551C	ENSP00000379258:S1551C	S	-	2	0	GLI3	41970544	1.000000	0.71417	0.734000	0.30879	0.871000	0.50021	6.593000	0.74100	2.861000	0.98227	0.655000	0.94253	TCC	GLI3	-	NULL	ENSG00000106571		0.557	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	-	0.00	62	0	G	NM_000168		42004019	-1	tier1	-	no_errors	ENST00000395925	ensembl	human	known	74_37	missense	25.37	50	17	SNP	0.999	C
GMPS	8833	genome.wustl.edu	37	3	155637040	155637040	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:155637040C>G	ENST00000496455.2	+	10	1566	c.1231C>G	c.(1231-1233)Ctg>Gtg	p.L411V	GMPS_ENST00000295920.7_Missense_Mutation_p.L312V	NM_003875.2	NP_003866.1	P49915	GUAA_HUMAN	guanine monphosphate synthase	411	GMPS ATP-PPase. {ECO:0000255|PROSITE- ProRule:PRU00886}.				glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|GMP synthase (glutamine-hydrolyzing) activity (GO:0003922)|GMP synthase activity (GO:0003921)|pyrophosphatase activity (GO:0016462)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)		L-Glutamine(DB00130)	AATAGAACCTCTGAAAGATTT	0.358			T	MLL	AML																																Ovarian(153;896 1876 4149 15499 28134)			Dom	yes		3	3q24	8833	guanine monphosphate synthetase		L	0													45.0	44.0	44.0					3																	155637040		1799	4066	5865	SO:0001583	missense	0			U10860	CCDS46941.1	3q25.31	2013-06-18	2013-06-18		ENSG00000163655	ENSG00000163655	6.3.5.2		4378	protein-coding gene	gene with protein product	"""GMP synthase"""	600358	"""guanine monphosphate synthetase"""			8089153, 9195163	Standard	NM_003875		Approved		uc003faq.3	P49915	OTTHUMG00000158551	ENST00000496455.2:c.1231C>G	3.37:g.155637040C>G	ENSP00000419851:p.Leu411Val		A8K639|B4DXV7|F8W720	Missense_Mutation	SNP	pfam_GATASE,pfam_GMP_synth_C,pfam_Peptidase_C26,pfam_NAD/GMP_synthase,pfam_QueC,pfam_Asn_synthase,pfam_tRNA-specific_2-thiouridylase,tigrfam_GMP_synth_N	p.L411V	ENST00000496455.2	37	c.1231	CCDS46941.1	3	.	.	.	.	.	.	.	.	.	.	C	17.39	3.378732	0.61735	.	.	ENSG00000163655	ENST00000496455;ENST00000295920;ENST00000537975;ENST00000541628	.	.	.	5.41	-0.144	0.13440	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.64402	D	0.000003	T	0.75925	0.3916	M	0.84948	2.725	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.69307	0.963;0.918	T	0.74306	-0.3708	9	0.72032	D	0.01	-8.5909	9.3646	0.38217	0.0:0.4949:0.0:0.5051	.	312;411	F8W720;P49915	.;GUAA_HUMAN	V	411;312;360;411	.	ENSP00000295920:L312V	L	+	1	2	GMPS	157119734	0.995000	0.38212	0.957000	0.39632	0.982000	0.71751	2.576000	0.46033	-0.373000	0.07979	-0.373000	0.07131	CTG	GMPS	-	NULL	ENSG00000163655		0.358	GMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPS	HGNC	protein_coding	OTTHUMT00000351260.2	-	0.00	64	0	C			155637040	+1	tier1	-	no_errors	ENST00000496455	ensembl	human	known	74_37	missense	17.50	66	14	SNP	0.981	G
GNAS	2778	genome.wustl.edu	37	20	57480483	57480483	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:57480483C>T	ENST00000371085.3	+	6	902	c.478C>T	c.(478-480)Cgt>Tgt	p.R160C	GNAS_ENST00000371102.4_Missense_Mutation_p.R789C|GNAS_ENST00000371095.3_Missense_Mutation_p.R146C|GNAS_ENST00000371100.4_Missense_Mutation_p.R803C|GNAS_ENST00000265620.7_Missense_Mutation_p.R145C|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.R161C|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000306090.10_Missense_Mutation_p.R146C	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	160					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			TGAAGGAGTGCGTGCCTGCTA	0.468			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0			GRCh37	CM002273	GNAS	M							130.0	116.0	121.0					20																	57480483		2203	4300	6503	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.478C>T	20.37:g.57480483C>T	ENSP00000360126:p.Arg160Cys		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.R161C	ENST00000371085.3	37	c.481	CCDS13472.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.84|18.84	3.708344|3.708344	0.68615|0.68615	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000450130|ENST00000371100;ENST00000371102;ENST00000349036;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	.|D;D;D;D;D;D;D;D	.|0.89681	.|-2.55;-2.55;-2.55;-2.55;-2.55;-2.55;-2.55;-2.55	5.93|5.93	4.93|4.93	0.64822|0.64822	.|G protein alpha subunit, helical insertion (4);	.|0.247996	.|0.39687	.|N	.|0.001291	D|D	0.82504|0.82504	0.5051|0.5051	L|L	0.51422|0.51422	1.61|1.61	0.51012|0.51012	D|D	0.999907|0.999907	.|B;B;B;P	.|0.46656	.|0.013;0.003;0.001;0.882	.|B;B;B;B	.|0.32762	.|0.004;0.004;0.002;0.152	D|D	0.84965|0.84965	0.0879|0.0879	5|10	.|0.87932	.|D	.|0	.|.	11.2577|11.2577	0.49063|0.49063	0.341:0.659:0.0:0.0|0.341:0.659:0.0:0.0	.|.	.|160;161;145;803	.|P63092;A6NI00;P63092-3;Q5JWF2	.|GNAS2_HUMAN;.;.;GNAS1_HUMAN	V|C	174|803;789;177;146;160;161;145;146	.|ENSP00000360141:R803C;ENSP00000360143:R789C;ENSP00000265621:R177C;ENSP00000360136:R146C;ENSP00000360126:R160C;ENSP00000346328:R161C;ENSP00000265620:R145C;ENSP00000304472:R146C	.|ENSP00000265620:R145C	A|R	+|+	2|1	0|0	GNAS|GNAS	56913878|56913878	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.450000|0.450000	0.32258|0.32258	3.690000|3.690000	0.54713|0.54713	2.814000|2.814000	0.96858|0.96858	0.655000|0.655000	0.94253|0.94253	GCG|CGT	GNAS	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su	ENSG00000087460		0.468	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	-	0.00	71	0	C	NM_000516		57480483	+1	tier1	-	no_errors	ENST00000354359	ensembl	human	known	74_37	missense	35.29	55	30	SNP	0.998	T
GOLGA8EP	390535	genome.wustl.edu	37	15	23441160	23441160	+	RNA	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:23441160C>T	ENST00000526079.1	+	0	1239				RN7SL106P_ENST00000488468.2_RNA	NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		CAAACTCAAACACCAGATGGG	0.562																																																	0													75.0	82.0	79.0					15																	23441160		1449	2675	4124			0					15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23441160C>T				RNA	SNP	-	NULL	ENST00000526079.1	37	NULL		15																																																																																			GOLGA8EP	-	-	ENSG00000175676		0.562	GOLGA8EP-002	KNOWN	basic	processed_transcript	GOLGA8EP	HGNC	pseudogene	OTTHUMT00000393312.1	-	0.00	230	0	C	NR_033350.1		23441160	+1	tier1	-	no_errors	ENST00000526079	ensembl	human	known	74_37	rna	15.13	230	41	SNP	0.251	T
GOLGA8S	653061	genome.wustl.edu	37	15	23602691	23602691	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:23602691G>A	ENST00000562295.1	+	4	234	c.234G>A	c.(232-234)ccG>ccA	p.P78P						golgin A8 family, member S																		CTCAGAGCCCGTGCCAAGAAC	0.547																																																	0																																										SO:0001819	synonymous_variant	0					15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.234G>A	15.37:g.23602691G>A				Silent	SNP	NULL	p.P78	ENST00000562295.1	37	c.234		15																																																																																			GOLGA8S	-	NULL	ENSG00000261739		0.547	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8S	HGNC	protein_coding	OTTHUMT00000431934.1	-	0.00	176	0	G	NR_038843		23602691	+1	tier1	-	no_errors	ENST00000562295	ensembl	human	novel	74_37	silent	18.43	177	40	SNP	1.000	A
GOLGB1	2804	genome.wustl.edu	37	3	121417605	121417605	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:121417605T>C	ENST00000340645.5	-	13	1875	c.1750A>G	c.(1750-1752)Agg>Ggg	p.R584G	GOLGB1_ENST00000393667.3_Missense_Mutation_p.R589G	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	584					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.R584G(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TCCTCAGCCCTTTTTCCCTGG	0.363																																																	1	Substitution - Missense(1)	prostate(1)											82.0	85.0	84.0					3																	121417605		2203	4300	6503	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.1750A>G	3.37:g.121417605T>C	ENSP00000341848:p.Arg584Gly		B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.R584G	ENST00000340645.5	37	c.1750	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	T	5.981	0.364872	0.11296	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	T;T;T	0.23348	2.49;2.49;1.91	5.43	4.25	0.50352	.	0.457306	0.22595	N	0.058022	T	0.25901	0.0631	L	0.57536	1.79	0.09310	N	1	P;P;P;P;B	0.39480	0.493;0.675;0.675;0.675;0.287	B;B;B;B;B	0.39379	0.079;0.298;0.154;0.154;0.053	T	0.09530	-1.0670	10	0.35671	T	0.21	.	9.7072	0.40222	0.0:0.0:0.339:0.661	.	509;548;589;589;584	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	G	584;589;548;396	ENSP00000341848:R584G;ENSP00000377275:R589G;ENSP00000418231:R548G	ENSP00000341848:R584G	R	-	1	2	GOLGB1	122900295	0.528000	0.26314	0.695000	0.30226	0.589000	0.36550	1.134000	0.31442	1.033000	0.39918	0.533000	0.62120	AGG	GOLGB1	-	NULL	ENSG00000173230		0.363	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1		0.00	77	0	T	NM_004487		121417605	-1			no_errors	ENST00000340645	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.177	C
GPR112	139378	genome.wustl.edu	37	X	135432567	135432567	+	Silent	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:135432567T>G	ENST00000394143.1	+	6	6993	c.6702T>G	c.(6700-6702)acT>acG	p.T2234T	GPR112_ENST00000394141.1_Silent_p.T2029T|GPR112_ENST00000287534.4_Silent_p.T2171T|GPR112_ENST00000370652.1_Silent_p.T2234T|GPR112_ENST00000412101.1_Silent_p.T2029T	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2234					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AAGCATCGACTTCGCCTACTG	0.468																																																	0													118.0	99.0	105.0					X																	135432567		2203	4300	6503	SO:0001819	synonymous_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6702T>G	X.37:g.135432567T>G			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T2234	ENST00000394143.1	37	c.6702	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.468	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	67	0	T			135432567	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	silent	71.79	11	28	SNP	0.075	G
GPR112	139378	genome.wustl.edu	37	X	135439883	135439883	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:135439883A>G	ENST00000394143.1	+	10	7239	c.6948A>G	c.(6946-6948)caA>caG	p.Q2316Q	GPR112_ENST00000394141.1_Silent_p.Q2111Q|GPR112_ENST00000287534.4_Intron|GPR112_ENST00000370652.1_Silent_p.Q2316Q|GPR112_ENST00000412101.1_Silent_p.Q2111Q	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2316					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					GAGAAGGACAAGAAATGGCTA	0.343																																																	0													231.0	212.0	219.0					X																	135439883		2203	4300	6503	SO:0001819	synonymous_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6948A>G	X.37:g.135439883A>G			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.Q2316	ENST00000394143.1	37	c.6948	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.343	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	-	0.00	68	0	A			135439883	+1	tier1	-	no_errors	ENST00000370652	ensembl	human	known	74_37	silent	61.22	19	30	SNP	0.931	G
GPR148	344561	genome.wustl.edu	37	2	131487111	131487111	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:131487111C>A	ENST00000309926.4	+	1	469	c.387C>A	c.(385-387)ttC>ttA	p.F129L		NM_207364.2	NP_997247.2	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(15)|skin(3)|upper_aerodigestive_tract(1)	27	Colorectal(110;0.1)					ATGCTGTCTTCGCCGCCTGCA	0.602																																																	0													60.0	60.0	60.0					2																	131487111		2203	4300	6503	SO:0001583	missense	0			AY255532	CCDS2163.1	2q21.2	2012-08-21			ENSG00000173302	ENSG00000173302		"""GPCR / Class A : Orphans"""	23623	protein-coding gene	gene with protein product						12679517	Standard	NM_207364		Approved	PGR6	uc002trv.2	Q8TDV2	OTTHUMG00000131655	ENST00000309926.4:c.387C>A	2.37:g.131487111C>A	ENSP00000308908:p.Phe129Leu		Q2M369|Q86SP7|Q86U87	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.F129L	ENST00000309926.4	37	c.387	CCDS2163.1	2	.	.	.	.	.	.	.	.	.	.	.	5.753	0.323376	0.10900	.	.	ENSG00000173302	ENST00000309926	T	0.70516	-0.49	3.15	-0.0212	0.13952	GPCR, rhodopsin-like superfamily (1);	0.112943	0.35151	U	0.003412	T	0.56426	0.1984	N	0.19112	0.55	0.09310	N	1	P	0.39535	0.677	P	0.46076	0.503	T	0.51482	-0.8700	10	0.54805	T	0.06	-11.8138	6.3668	0.21459	0.0:0.5731:0.0:0.4269	.	129	Q8TDV2	GP148_HUMAN	L	129	ENSP00000308908:F129L	ENSP00000308908:F129L	F	+	3	2	GPR148	131203581	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.634000	0.05477	0.099000	0.17552	0.462000	0.41574	TTC	GPR148	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000173302		0.602	GPR148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR148	HGNC	protein_coding	OTTHUMT00000254552.3	-	0.00	22	0	C	XM_293092		131487111	+1	tier1	-	no_errors	ENST00000309926	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.007	A
GRIN2B	2904	genome.wustl.edu	37	12	13717503	13717503	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:13717503G>A	ENST00000609686.1	-	13	2878	c.2669C>T	c.(2668-2670)aCc>aTc	p.T890I		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	890					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.T890I(1)		NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTGTTCATGGTTGCGGTGGG	0.572																																																	1	Substitution - Missense(1)	lung(1)											133.0	119.0	124.0					12																	13717503		2203	4300	6503	SO:0001583	missense	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.2669C>T	12.37:g.13717503G>A	ENSP00000477455:p.Thr890Ile		Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T890I	ENST00000609686.1	37	c.2669	CCDS8662.1	12	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451279	0.63290	.	.	ENSG00000150086	ENST00000279593	T	0.12465	2.68	5.43	5.43	0.79202	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.050900	0.85682	D	0.000000	T	0.33206	0.0855	L	0.55481	1.735	0.80722	D	1	D	0.59767	0.986	D	0.63703	0.917	T	0.00942	-1.1506	10	0.52906	T	0.07	.	19.2359	0.93858	0.0:0.0:1.0:0.0	.	890	Q13224	NMDE2_HUMAN	I	890	ENSP00000279593:T890I	ENSP00000279593:T890I	T	-	2	0	GRIN2B	13608770	1.000000	0.71417	0.951000	0.38953	0.776000	0.43924	9.835000	0.99442	2.561000	0.86390	0.655000	0.94253	ACC	GRIN2B	-	pfam_NMDAR2_C	ENSG00000273079		0.572	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2		0.00	22	0	G			13717503	-1			no_errors	ENST00000609686	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	A
GRM3	2913	genome.wustl.edu	37	7	86394587	86394587	+	Silent	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:86394587G>C	ENST00000361669.2	+	2	1225	c.126G>C	c.(124-126)ggG>ggC	p.G42G	GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Silent_p.G42G|GRM3_ENST00000394720.2_Silent_p.G40G|GRM3_ENST00000536043.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	42					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TTGTTTTAGGGGGCCTGTTTC	0.413																																					GBM(52;969 1098 3139 52280)												0													105.0	108.0	107.0					7																	86394587		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.126G>C	7.37:g.86394587G>C			Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.G42	ENST00000361669.2	37	c.126	CCDS5600.1	7																																																																																			GRM3	-	superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000198822		0.413	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2		0.00	54	0	G			86394587	+1			no_errors	ENST00000361669	ensembl	human	known	74_37	silent	8.57	32	3	SNP	0.978	C
GTF3C4	9329	genome.wustl.edu	37	9	135555136	135555136	+	Silent	SNP	C	C	T	rs139080117	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:135555136C>T	ENST00000372146.4	+	2	2694	c.2130C>T	c.(2128-2130)cgC>cgT	p.R710R		NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	710					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		TCCCCACCCGCGGACTCTGTA	0.443													C|||	2	0.000399361	0.0	0.0	5008	,	,		19191	0.0		0.002	False		,,,				2504	0.0				Pancreas(142;417 1875 11086 31973 47667)												0								C		0,4406		0,0,2203	86.0	82.0	83.0		2130	0.0	0.9	9	dbSNP_134	83	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous	GTF3C4	NM_012204.2		0,4,6499	TT,TC,CC		0.0465,0.0,0.0308		710/823	135555136	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	0			AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.2130C>T	9.37:g.135555136C>T			Q5VZJ7	Silent	SNP	superfamily_WD40_repeat_dom	p.R710	ENST00000372146.4	37	c.2130	CCDS6953.1	9																																																																																			GTF3C4	-	NULL	ENSG00000125484		0.443	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C4	HGNC	protein_coding	OTTHUMT00000054792.1		0.00	44	0	C			135555136	+1			no_errors	ENST00000372146	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.986	T
HAPLN3	145864	genome.wustl.edu	37	15	89422387	89422387	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:89422387G>A	ENST00000359595.3	-	4	821	c.607C>T	c.(607-609)Cgg>Tgg	p.R203W	HAPLN3_ENST00000562889.1_Missense_Mutation_p.R265W	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	203	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	TCCCAGGCCCGGAAGAGCTGC	0.672											OREG0023445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													34.0	38.0	37.0					15																	89422387		2200	4299	6499	SO:0001583	missense	0			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.607C>T	15.37:g.89422387G>A	ENSP00000352606:p.Arg203Trp	1267	A8K7P0	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.R203W	ENST00000359595.3	37	c.607	CCDS10346.1	15	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715298	0.68844	.	.	ENSG00000140511	ENST00000359595	T	0.09817	2.94	4.36	2.06	0.26882	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.597953	0.16984	N	0.191571	T	0.24928	0.0605	M	0.67953	2.075	0.32895	D	0.512446	D;D	0.76494	0.999;0.999	D;D	0.70716	0.97;0.97	T	0.26052	-1.0114	10	0.72032	D	0.01	-23.1519	6.5602	0.22481	0.1021:0.0:0.6131:0.2847	.	203;203	A8K7T8;Q96S86	.;HPLN3_HUMAN	W	203	ENSP00000352606:R203W	ENSP00000352606:R203W	R	-	1	2	HAPLN3	87223391	0.994000	0.37717	1.000000	0.80357	0.999000	0.98932	0.301000	0.19174	0.940000	0.37473	0.655000	0.94253	CGG	HAPLN3	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000140511		0.672	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN3	HGNC	protein_coding	OTTHUMT00000309070.1	-	0.00	125	0	G	NM_178232		89422387	-1	tier1	-	no_errors	ENST00000359595	ensembl	human	known	74_37	missense	29.79	66	28	SNP	0.987	A
HAPLN4	404037	genome.wustl.edu	37	19	19369505	19369505	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:19369505C>T	ENST00000291481.7	-	4	707	c.644G>A	c.(643-645)cGc>cAc	p.R215H	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	215	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	TGAGCCGTCGCGCAACCAGCC	0.746																																																	0													15.0	17.0	16.0					19																	19369505		2185	4240	6425	SO:0001583	missense	0			AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.644G>A	19.37:g.19369505C>T	ENSP00000291481:p.Arg215His		A5PKW5|Q96PW2	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.R215H	ENST00000291481.7	37	c.644	CCDS12398.1	19	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410587	0.42715	.	.	ENSG00000187664	ENST00000291481	T	0.08008	3.14	3.97	2.86	0.33363	C-type lectin fold (1);Link (4);C-type lectin-like (1);	0.269396	0.29814	N	0.011126	T	0.05914	0.0154	L	0.29908	0.895	0.30169	N	0.801474	B	0.27823	0.19	B	0.30105	0.111	T	0.07309	-1.0779	10	0.56958	D	0.05	-24.348	3.9548	0.09385	0.0:0.6718:0.0:0.3282	.	215	Q86UW8	HPLN4_HUMAN	H	215	ENSP00000291481:R215H	ENSP00000291481:R215H	R	-	2	0	HAPLN4	19230505	0.543000	0.26434	1.000000	0.80357	0.437000	0.31866	1.548000	0.36201	2.055000	0.61198	0.313000	0.20887	CGC	HAPLN4	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000187664		0.746	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN4	HGNC	protein_coding	OTTHUMT00000460117.2	-	0.00	96	0	C	NM_023002		19369505	-1	tier1	-	no_errors	ENST00000291481	ensembl	human	known	74_37	missense	30.16	44	19	SNP	0.990	T
HECW2	57520	genome.wustl.edu	37	2	197199178	197199178	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:197199178delG	ENST00000260983.3	-	4	647	c.465delC	c.(463-465)cccfs	p.P155fs	HECW2_ENST00000409111.1_5'UTR	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	155					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						CGGTGATGCAGGGGGTCGTGG	0.478																																																	0													44.0	37.0	39.0					2																	197199178		2202	4300	6502	SO:0001589	frameshift_variant	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.465delC	2.37:g.197199178delG	ENSP00000260983:p.Pro155fs		B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Frame_Shift_Del	DEL	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.C156fs	ENST00000260983.3	37	c.465	CCDS33354.1	2																																																																																			HECW2	-	NULL	ENSG00000138411		0.478	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3		0.00	80	0	G	NM_020760		197199178	-1	tier1		no_errors	ENST00000260983	ensembl	human	known	74_37	frame_shift_del	17.31	43	9	DEL	0.990	-
HIAT1	64645	genome.wustl.edu	37	1	100533698	100533698	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:100533698C>T	ENST00000370152.3	+	6	788	c.652C>T	c.(652-654)Cgg>Tgg	p.R218W	RP4-714D9.2_ENST00000432294.1_RNA	NM_033055.2	NP_149044.2	Q96MC6	HIAT1_HUMAN	hippocampus abundant transcript 1	218					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|skin(1)	16		all_epithelial(167;2.96e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0832)|all cancers(265;0.136)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.195)		TGAGAAAATGCGGCCAGCATC	0.453																																																	0													157.0	150.0	152.0					1																	100533698		2203	4300	6503	SO:0001583	missense	0			AK096669	CCDS763.1	1p21.3	2008-02-05			ENSG00000156875	ENSG00000156875			23363	protein-coding gene	gene with protein product						9299464	Standard	NM_033055		Approved	DKFZP564L0864	uc001dst.3	Q96MC6	OTTHUMG00000010755	ENST00000370152.3:c.652C>T	1.37:g.100533698C>T	ENSP00000359171:p.Arg218Trp		Q6P2N7|Q8N8K2|Q8NBV3|Q96NY0|Q9NT25	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Tet-R_TetA/multi-R_MdtG	p.R218W	ENST00000370152.3	37	c.652	CCDS763.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.024407	0.75390	.	.	ENSG00000156875	ENST00000370152	T	0.80653	-1.4	5.72	2.46	0.29980	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.88687	0.6504	M	0.90814	3.15	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.90995	0.4838	10	0.87932	D	0	-42.2858	14.1091	0.65111	0.4932:0.5068:0.0:0.0	.	218	Q96MC6	HIAT1_HUMAN	W	218	ENSP00000359171:R218W	ENSP00000359171:R218W	R	+	1	2	HIAT1	100306286	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.446000	0.35090	0.713000	0.32060	0.655000	0.94253	CGG	HIAT1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000156875		0.453	HIAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIAT1	HGNC	protein_coding	OTTHUMT00000029657.1	-	0.00	74	0	C	NM_033055		100533698	+1	tier1	-	no_errors	ENST00000370152	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
HIRA	7290	genome.wustl.edu	37	22	19384325	19384325	+	Silent	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr22:19384325G>T	ENST00000263208.5	-	7	895	c.639C>A	c.(637-639)acC>acA	p.T213T	HIRA_ENST00000340170.4_Silent_p.T213T|HIRA_ENST00000546308.1_Silent_p.T169T|HIRA_ENST00000464189.1_5'Flank|HIRA_ENST00000541063.1_Silent_p.T169T	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	213					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.T213T(1)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					CAAAAGGCTTGGTGATGCTGG	0.567																																																	1	Substitution - coding silent(1)	lung(1)											86.0	78.0	81.0					22																	19384325		2203	4300	6503	SO:0001819	synonymous_variant	0			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.639C>A	22.37:g.19384325G>T			Q05BU9|Q8IXN2	Silent	SNP	pfam_Hira,pfam_WD40_repeat,pfam_HIRA_B_motif,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T213	ENST00000263208.5	37	c.639	CCDS13759.1	22																																																																																			HIRA	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000100084		0.567	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	HGNC	protein_coding	OTTHUMT00000316488.2	-	0.00	70	0	G	NM_003325		19384325	-1	tier1	-	no_errors	ENST00000263208	ensembl	human	known	74_37	silent	7.55	49	4	SNP	0.998	T
HK3	3101	genome.wustl.edu	37	5	176308317	176308317	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:176308317G>T	ENST00000292432.5	-	18	2704	c.2613C>A	c.(2611-2613)taC>taA	p.Y871*		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	871	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGCAGCTTGTAGAGCGTTC	0.672																																																	0													90.0	99.0	96.0					5																	176308317		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2613C>A	5.37:g.176308317G>T	ENSP00000292432:p.Tyr871*		Q8N1E7	Nonsense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.Y871*	ENST00000292432.5	37	c.2613	CCDS4407.1	5	.	.	.	.	.	.	.	.	.	.	G	29.4	5.006326	0.93287	.	.	ENSG00000160883	ENST00000292432	.	.	.	5.09	2.13	0.27403	.	0.000000	0.44902	D	0.000407	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.2087	0.15304	0.3251:0.1392:0.5357:0.0	.	.	.	.	X	871	.	ENSP00000292432:Y871X	Y	-	3	2	HK3	176240923	1.000000	0.71417	0.999000	0.59377	0.311000	0.27955	3.494000	0.53273	0.191000	0.20236	-0.367000	0.07326	TAC	HK3	-	pfam_Hexokinase_C	ENSG00000160883		0.672	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK3	HGNC	protein_coding	OTTHUMT00000253428.1	-	0.00	68	0	G			176308317	-1	tier1	-	no_errors	ENST00000292432	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
HLA-G	3135	genome.wustl.edu	37	6	29795963	29795963	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:29795963G>A	ENST00000360323.6	+	2	237	c.213G>A	c.(211-213)ccG>ccA	p.P71P	HLA-G_ENST00000428701.1_Silent_p.P71P|HLA-G_ENST00000376815.3_Silent_p.P71P|HLA-G_ENST00000376818.3_Silent_p.P71P|HLA-G_ENST00000376828.2_Silent_p.P76P			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	71	Alpha-1.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						GGATGGAGCCGCGGGCGCCGT	0.677																																																	0													41.0	28.0	32.0					6																	29795963		1511	2709	4220	SO:0001819	synonymous_variant	0				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.213G>A	6.37:g.29795963G>A				Silent	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.P76	ENST00000360323.6	37	c.228	CCDS4668.1	6																																																																																			HLA-G	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000204632		0.677	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-G	HGNC	protein_coding	OTTHUMT00000076286.2	-	0.00	100	0	G	NM_002127		29795963	+1	tier1	-	no_errors	ENST00000376828	ensembl	human	known	74_37	silent	25.93	80	28	SNP	0.994	A
HLA-E	3133	genome.wustl.edu	37	6	30458193	30458193	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:30458193G>T	ENST00000376630.4	+	3	576	c.511G>T	c.(511-513)Gcc>Tcc	p.A171S		NM_005516.5	NP_005507.3	P13747	HLAE_HUMAN	major histocompatibility complex, class I, E	171	Alpha-2.				antigen processing and presentation of endogenous peptide antigen via MHC class Ib (GO:0002476)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protection from natural killer cell mediated cytotoxicity (GO:0042270)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)|ovary(3)|skin(1)|urinary_tract(1)	18						GTCAAATGATGCCTCTGAGGC	0.592																																																	0													65.0	62.0	63.0					6																	30458193		1510	2709	4219	SO:0001583	missense	0			M20022	CCDS34379.1	6p21.3	2013-01-11			ENSG00000204592	ENSG00000204592		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4962	protein-coding gene	gene with protein product		143010				3131426	Standard	NM_005516		Approved		uc003nqg.3	P13747	OTTHUMG00000031155	ENST00000376630.4:c.511G>T	6.37:g.30458193G>T	ENSP00000365817:p.Ala171Ser		Q30169|Q9BT83|Q9GIY7|Q9GIY8	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.A171S	ENST00000376630.4	37	c.511	CCDS34379.1	6	.	.	.	.	.	.	.	.	.	.	.	12.01	1.810824	0.32053	.	.	ENSG00000204592	ENST00000376630	T	0.00792	5.69	1.67	1.67	0.24075	.	2.788690	0.03732	U	0.253637	T	0.00468	0.0015	L	0.37466	1.105	0.09310	N	1	B;B	0.31193	0.312;0.06	B;B	0.38327	0.271;0.078	T	0.46345	-0.9198	10	0.72032	D	0.01	.	6.7735	0.23607	0.0:0.0:1.0:0.0	.	212;171	E7ENN9;Q6DU44	.;.	S	171	ENSP00000365817:A171S	ENSP00000365817:A171S	A	+	1	0	HLA-E	30566172	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.238000	0.08977	1.235000	0.43724	0.462000	0.41574	GCC	HLA-E	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000204592		0.592	HLA-E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-E	HGNC	protein_coding	OTTHUMT00000076282.2	-	0.00	61	0	G	NM_005516		30458193	+1	tier1	-	no_errors	ENST00000376630	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.001	T
HMGA1P4	100506080	genome.wustl.edu	37	9	131425446	131425447	+	RNA	INS	-	-	T	rs200407120	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:131425446_131425447insT	ENST00000428643.1	-	0	299_300									high mobility group AT-hook 1 pseudogene 4																		TATCTATCATGTTTTTTTTTCA	0.46													?|TTTTTTTTT|TTTTTTTTTT|unsure	11	0.00219649	0.0015	0.0	5008	,	,		17629	0.006		0.001	False		,,,				2504	0.002																0																																												0					9q34.11	2012-03-12			ENSG00000234705	ENSG00000234705		"""High mobility group / AT-hook pseudogenes"""	39093	pseudogene	pseudogene						12727900	Standard	NG_031851		Approved				OTTHUMG00000020753		9.37:g.131425455_131425455dupT				RNA	INS	-	NULL	ENST00000428643.1	37	NULL		9																																																																																			HMGA1P4	-	-	ENSG00000234705		0.460	HMGA1P4-001	KNOWN	basic	antisense	HMGA1P4	HGNC	antisense	OTTHUMT00000054468.1		0.00	8	0	0	NG_031851		131425447	-1			no_errors	ENST00000428643	ensembl	human	known	74_37	rna	33.33	4	2	INS	0.076:0.784	T
HMX3	340784	genome.wustl.edu	37	10	124896929	124896929	+	Silent	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:124896929G>T	ENST00000357878.5	+	2	845	c.756G>T	c.(754-756)ctG>ctT	p.L252L		NM_001105574.1	NP_001099044.1	A6NHT5	HMX3_HUMAN	H6 family homeobox 3	252					brain development (GO:0007420)|cell differentiation (GO:0030154)|embryo implantation (GO:0007566)|inner ear morphogenesis (GO:0042472)|maternal process involved in female pregnancy (GO:0060135)|neuromuscular process controlling balance (GO:0050885)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(4)	4		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.122)|COAD - Colon adenocarcinoma(40;0.141)		AGCGCTATCTGAGCAGCTCGG	0.632																																																	0													24.0	29.0	28.0					10																	124896929		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS41575.1	10q26.13	2011-06-20	2007-07-09		ENSG00000188620	ENSG00000188620		"""Homeoboxes / ANTP class : NKL subclass"""	5019	protein-coding gene	gene with protein product		613380	"""homeo box (H6 family) 3"""				Standard	NM_001105574		Approved	NKX5-1	uc010quc.2	A6NHT5	OTTHUMG00000019199	ENST00000357878.5:c.756G>T	10.37:g.124896929G>T			A8MU06	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.L252	ENST00000357878.5	37	c.756	CCDS41575.1	10																																																																																			HMX3	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	ENSG00000188620		0.632	HMX3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HMX3	HGNC	protein_coding	OTTHUMT00000050842.4		0.00	83	0	G	XM_291716		124896929	+1			no_errors	ENST00000357878	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
HOXA1	3198	genome.wustl.edu	37	7	27134095	27134095	+	Silent	SNP	C	C	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:27134095C>G	ENST00000343060.4	-	2	1033	c.972G>C	c.(970-972)ggG>ggC	p.G324G	HOTAIRM1_ENST00000425358.2_RNA|HOXA1_ENST00000355633.5_3'UTR|HOTAIRM1_ENST00000495032.1_RNA|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000429611.3_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	324					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGGTAGAAGACCCCGGGGAAG	0.612																																																	0													57.0	58.0	58.0					7																	27134095		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.972G>C	7.37:g.27134095C>G			A4D184|B2R8U7|O43363	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.G324	ENST00000343060.4	37	c.972	CCDS5401.1	7																																																																																			HOXA1	-	NULL	ENSG00000105991		0.612	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	HGNC	protein_coding	OTTHUMT00000358454.1		0.00	41	0	C			27134095	-1			no_errors	ENST00000343060	ensembl	human	known	74_37	silent	15.15	28	5	SNP	0.926	G
HSPB6	126393	genome.wustl.edu	37	19	36246507	36246507	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:36246507C>T	ENST00000592984.1	-	4	595	c.399G>A	c.(397-399)acG>acA	p.T133T	HSPB6_ENST00000004982.3_Silent_p.T133T|C19orf55_ENST00000536950.1_5'Flank|C19orf55_ENST00000396908.4_5'Flank|C19orf55_ENST00000537459.1_5'Flank|C19orf55_ENST00000421853.2_5'Flank|AC002398.12_ENST00000587767.1_RNA|HSPB6_ENST00000587965.1_3'UTR|AC002398.11_ENST00000591091.1_RNA|C19orf55_ENST00000544099.1_5'Flank			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6	133					regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACAGCGCGGACGTCACGGCAG	0.736																																																	0													5.0	9.0	7.0					19																	36246507		1570	2817	4387	SO:0001819	synonymous_variant	0			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122	ENST00000592984.1:c.399G>A	19.37:g.36246507C>T			O14551|Q6NVI3|Q96MG9	Silent	SNP	pfam_a-crystallin/Hsp20_dom,pfam_Alpha-crystallin_N,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.T133	ENST00000592984.1	37	c.399	CCDS12475.1	19																																																																																			HSPB6	-	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	ENSG00000004776		0.736	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB6	HGNC	protein_coding	OTTHUMT00000109498.3	-	0.00	16	0	C	NM_144617		36246507	-1	tier1	-	no_errors	ENST00000004982	ensembl	human	known	74_37	silent	71.05	11	27	SNP	0.998	T
IL17B	27190	genome.wustl.edu	37	5	148754128	148754128	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:148754128A>G	ENST00000261796.3	-	3	397	c.347T>C	c.(346-348)cTg>cCg	p.L116P	IL17B_ENST00000505432.1_5'UTR|RP11-394O4.3_ENST00000521756.1_RNA	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	116					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCTCCGGCAGGTCCACGGG	0.622																																																	0													31.0	31.0	31.0					5																	148754128		2201	4289	6490	SO:0001583	missense	0			AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.347T>C	5.37:g.148754128A>G	ENSP00000261796:p.Leu116Pro		Q14CE5	Missense_Mutation	SNP	pfam_IL-17_fam,prints_IL-17_chr	p.L116P	ENST00000261796.3	37	c.347	CCDS4297.1	5	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578331	0.65878	.	.	ENSG00000127743	ENST00000261796	T	0.61980	0.06	4.68	4.68	0.58851	.	0.111229	0.37483	N	0.002076	T	0.77765	0.4179	M	0.73430	2.235	0.58432	D	0.999999	D	0.76494	0.999	D	0.72338	0.977	T	0.81219	-0.1032	10	0.87932	D	0	-29.4782	14.3203	0.66482	1.0:0.0:0.0:0.0	.	116	Q9UHF5	IL17B_HUMAN	P	116	ENSP00000261796:L116P	ENSP00000261796:L116P	L	-	2	0	IL17B	148734321	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	6.899000	0.75682	1.963000	0.57068	0.459000	0.35465	CTG	IL17B	-	pfam_IL-17_fam	ENSG00000127743		0.622	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17B	HGNC	protein_coding	OTTHUMT00000252330.1	-	0.00	52	0	A	NM_014443		148754128	-1	tier1	-	no_errors	ENST00000261796	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	G
IL19	29949	genome.wustl.edu	37	1	206972299	206972299	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:206972299G>A	ENST00000340758.2	+	1	85	c.60G>A	c.(58-60)gtG>gtA	p.V20V		NM_153758.2	NP_715639.1	Q9UHD0	IL19_HUMAN	interleukin 19	0					apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			TCACACATGTGCACACACATA	0.527																																																	0													181.0	147.0	159.0					1																	206972299		2203	4300	6503	SO:0001819	synonymous_variant	0			AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000340758.2:c.60G>A	1.37:g.206972299G>A			B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Silent	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,prints_IL-19,prints_IL-24	p.V20	ENST00000340758.2	37	c.60	CCDS1468.1	1																																																																																			IL19	-	NULL	ENSG00000142224		0.527	IL19-001	KNOWN	basic|CCDS	protein_coding	IL19	HGNC	protein_coding	OTTHUMT00000088566.3	-	0.00	64	0	G	NM_153758		206972299	+1	tier1	-	no_errors	ENST00000340758	ensembl	human	known	74_37	silent	50.98	25	26	SNP	0.000	A
IL31RA	133396	genome.wustl.edu	37	5	55164734	55164734	+	Silent	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:55164734T>G	ENST00000447346.2	+	3	335	c.270T>G	c.(268-270)acT>acG	p.T90T	IL31RA_ENST00000354961.4_Silent_p.T71T|IL31RA_ENST00000396834.1_Silent_p.T71T|IL31RA_ENST00000490985.1_5'UTR|IL31RA_ENST00000359040.5_Silent_p.T90T|IL31RA_ENST00000396836.2_Silent_p.T90T|IL31RA_ENST00000297015.3_Intron	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	58	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TTAAGAGAACTTAGTAAGTAC	0.413																																																	0													95.0	99.0	97.0					5																	55164734		2203	4300	6503	SO:0001819	synonymous_variant	0			AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.270T>G	5.37:g.55164734T>G			A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Silent	SNP	pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T90	ENST00000447346.2	37	c.270	CCDS3970.2	5																																																																																			IL31RA	-	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000164509		0.413	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL31RA	HGNC	protein_coding	OTTHUMT00000214148.1	-	0.00	62	0	T	NM_139017		55164734	+1	tier1	-	no_errors	ENST00000447346	ensembl	human	known	74_37	silent	40.00	14	10	SNP	0.867	G
IL3RA	3563	genome.wustl.edu	37	X	1497627	1497627	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:1497627C>T	ENST00000331035.4	+	10	1299	c.950C>T	c.(949-951)gCc>gTc	p.A317V	IL3RA_ENST00000381469.2_Missense_Mutation_p.A239V	NM_001267713.1|NM_002183.3	NP_001254642.1|NP_002174.1	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha (low affinity)	317					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-3 receptor activity (GO:0004912)			lung(1)|skin(2)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ACGCTGCTGGCCCTGGTCTGT	0.612																																																	0													132.0	108.0	116.0					X																	1497627		2201	4295	6496	SO:0001583	missense	0			M74782	CCDS14113.1, CCDS59158.1	Xp22.3 and Yp13.3	2008-07-21			ENSG00000185291	ENSG00000185291		"""Pseudoautosomal regions / PAR1"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6012	protein-coding gene	gene with protein product		308385, 430000				1833064	Standard	NM_002183		Approved	CD123	uc004cps.3	P26951	OTTHUMG00000021059	ENST00000331035.4:c.950C>T	X.37:g.1497627C>T	ENSP00000327890:p.Ala317Val		A8K3F3|B9VI81|Q5HYQ7|Q5HYQ8|Q9UEH7	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.A317V	ENST00000331035.4	37	c.950	CCDS14113.1	X	.	.	.	.	.	.	.	.	.	.	.	5.635	0.301782	0.10678	.	.	ENSG00000185291	ENST00000331035;ENST00000381469	T;T	0.33654	1.67;1.4	0.798	-0.16	0.13375	.	94.233600	0.00931	U	0.002703	T	0.18718	0.0449	N	0.14661	0.345	0.09310	N	1	B;B	0.17852	0.018;0.024	B;B	0.15484	0.013;0.012	T	0.17167	-1.0378	9	0.02654	T	1	.	.	.	.	.	238;317	P26951-2;P26951	.;IL3RA_HUMAN	V	317;239	ENSP00000327890:A317V;ENSP00000370878:A239V	ENSP00000327890:A317V	A	+	2	0	IL3RA	1457627	0.001000	0.12720	0.031000	0.17742	0.086000	0.17979	-0.373000	0.07494	-0.099000	0.12263	0.402000	0.26972	GCC	IL3RA	-	NULL	ENSG00000185291		0.612	IL3RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL3RA	HGNC	protein_coding	OTTHUMT00000055600.3	-	0.00	208	0	C			1497627	+1	tier1	-	no_errors	ENST00000331035	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.028	T
ZC2HC1A	51101	genome.wustl.edu	37	8	79588162	79588162	+	Intron	SNP	C	C	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:79588162C>G	ENST00000263849.4	+	2	195				ZC2HC1A_ENST00000521176.1_Intron	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A								metal ion binding (GO:0046872)										TAATTCTGGTCAATTCTCATG	0.348																																																	0													145.0	122.0	129.0					8																	79588162		692	1591	2283	SO:0001627	intron_variant	0				CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.93+64C>G	8.37:g.79588162C>G			Q9Y372	RNA	SNP	-	NULL	ENST00000263849.4	37	NULL	CCDS6223.1	8																																																																																			IL7	-	-	ENSG00000104432		0.348	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7	HGNC	protein_coding	OTTHUMT00000379423.2	-	0.00	30	0	C	NM_016010		79588162	-1	tier1	-	no_errors	ENST00000523959	ensembl	human	known	74_37	rna	20.00	44	11	SNP	0.000	G
IMMP2L	83943	genome.wustl.edu	37	7	110303543	110303543	+	3'UTR	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:110303543T>C	ENST00000405709.2	-	0	1085				IMMP2L_ENST00000452895.1_3'UTR|IMMP2L_ENST00000331762.3_3'UTR|IMMP2L_ENST00000489381.1_5'UTR|IMMP2L_ENST00000450877.1_3'UTR	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)						ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		GTGCTGTAAATATTTCTCGCA	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.*115A>G	7.37:g.110303543T>C			Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	RNA	SNP	-	NULL	ENST00000405709.2	37	NULL	CCDS5753.1	7																																																																																			IMMP2L	-	-	ENSG00000184903		0.338	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMMP2L	HGNC	protein_coding	OTTHUMT00000338109.4	-	0.00	47	0	T	NM_032549		110303543	-1	tier1	-	no_errors	ENST00000489381	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.026	C
IREB2	3658	genome.wustl.edu	37	15	78758680	78758680	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:78758680A>G	ENST00000258886.8	+	5	627	c.478A>G	c.(478-480)Aaa>Gaa	p.K160E	IREB2_ENST00000559427.1_3'UTR|IREB2_ENST00000560440.1_Missense_Mutation_p.K160E	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	160					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		CTCTCCAGTTAAAGTGCAGCC	0.468																																					NSCLC(200;764 2208 35157 49871 50830)												0													73.0	71.0	72.0					15																	78758680		2196	4293	6489	SO:0001583	missense	0			M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.478A>G	15.37:g.78758680A>G	ENSP00000258886:p.Lys160Glu		A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.K160E	ENST00000258886.8	37	c.478	CCDS10302.1	15	.	.	.	.	.	.	.	.	.	.	A	13.10	2.135452	0.37728	.	.	ENSG00000136381	ENST00000258886	T	0.19669	2.13	6.08	0.671	0.17929	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.519358	0.21986	N	0.066222	T	0.15522	0.0374	L	0.27053	0.805	0.09310	N	1	B;B	0.20368	0.044;0.012	B;B	0.15870	0.014;0.014	T	0.19484	-1.0304	10	0.62326	D	0.03	.	14.7174	0.69280	0.5241:0.4759:0.0:0.0	.	160;160	P48200;Q8WVK6	IREB2_HUMAN;.	E	160	ENSP00000258886:K160E	ENSP00000258886:K160E	K	+	1	0	IREB2	76545735	0.053000	0.20554	0.000000	0.03702	0.904000	0.53231	0.649000	0.24843	-0.123000	0.11745	0.482000	0.46254	AAA	IREB2	-	superfamily_Acoase/IPM_deHydtase_lsu_aba	ENSG00000136381		0.468	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IREB2	HGNC	protein_coding	OTTHUMT00000290109.3	-	0.00	84	0	A	NM_004136		78758680	+1	tier1	-	no_errors	ENST00000258886	ensembl	human	known	74_37	missense	19.51	33	8	SNP	0.004	G
IRS2	8660	genome.wustl.edu	37	13	110434578	110434580	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr13:110434578_110434580delGCG	ENST00000375856.3	-	1	4335_4337	c.3821_3823delCGC	c.(3820-3825)ccgctt>ctt	p.P1274del		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1274	Poly-Pro.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			ggctgaggaagcggcggcggcgg	0.719																																					Melanoma(100;613 2409 40847)												0										24,2146		6,12,1067						-0.2	0.0			7	129,5017		21,87,2465	no	coding	IRS2	NM_003749.2		27,99,3532	A1A1,A1R,RR		2.5068,1.106,2.0913				153,7163				SO:0001651	inframe_deletion	0			AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3821_3823delCGC	13.37:g.110434587_110434589delGCG	ENSP00000365016:p.Pro1274del		Q96RR2|Q9BZG0|Q9Y6I5	In_Frame_Del	DEL	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.P1274in_frame_del	ENST00000375856.3	37	c.3823_3821	CCDS9510.1	13																																																																																			IRS2	-	NULL	ENSG00000185950		0.719	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS2	HGNC	protein_coding	OTTHUMT00000045755.1		0.00	44	0	GCG	NM_003749		110434580	-1	tier1		no_errors	ENST00000375856	ensembl	human	known	74_37	in_frame_del	6.90	27	2	DEL	0.047:0.045:0.006	-
ISOC2	79763	genome.wustl.edu	37	19	55966410	55966410	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:55966410G>A	ENST00000425675.2	-	5	543	c.483C>T	c.(481-483)agC>agT	p.S161S	ISOC2_ENST00000438389.2_Silent_p.S91S|ISOC2_ENST00000085068.3_Silent_p.S177S			Q96AB3	ISOC2_HUMAN	isochorismatase domain containing 2	161					protein destabilization (GO:0031648)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			endometrium(1)|lung(4)|ovary(1)|stomach(1)	7	Breast(117;0.155)		BRCA - Breast invasive adenocarcinoma(297;0.18)|LUSC - Lung squamous cell carcinoma(43;0.193)	GBM - Glioblastoma multiforme(193;0.0535)		TGAGCCCTTCGCTGGTGGAGA	0.647											OREG0025682	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													45.0	43.0	44.0					19																	55966410		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027122	CCDS12925.1, CCDS46194.1, CCDS46195.1	19q13.42	2011-07-14			ENSG00000063241	ENSG00000063241			26278	protein-coding gene	gene with protein product		612928				17658461	Standard	NM_024710		Approved	FLJ23469	uc002qla.3	Q96AB3		ENST00000425675.2:c.483C>T	19.37:g.55966410G>A		1011	Q6ZN91|Q9H5G0	Silent	SNP	pfam_Isochorismatase-like,superfamily_Isochorismatase-like	p.S177	ENST00000425675.2	37	c.531	CCDS46195.1	19																																																																																			ISOC2	-	pfam_Isochorismatase-like,superfamily_Isochorismatase-like	ENSG00000063241		0.647	ISOC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ISOC2	HGNC	protein_coding	OTTHUMT00000453179.1	-	0.00	140	0	G	NM_024710		55966410	-1	tier1	-	no_errors	ENST00000085068	ensembl	human	known	74_37	silent	39.09	67	43	SNP	0.782	A
ITGA4	3676	genome.wustl.edu	37	2	182322980	182322980	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:182322980C>T	ENST00000397033.2	+	2	685	c.255C>T	c.(253-255)ccC>ccT	p.P85P	ITGA4_ENST00000478440.1_3'UTR|ITGA4_ENST00000339307.4_Silent_p.P85P	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	85					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	TGATCAATCCCGGGGCGATTT	0.597																																																	0													31.0	35.0	34.0					2																	182322980		2026	4185	6211	SO:0001819	synonymous_variant	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.255C>T	2.37:g.182322980C>T			D3DPG4|Q7Z4L6	Silent	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.P85	ENST00000397033.2	37	c.255	CCDS42788.1	2																																																																																			ITGA4	-	smart_Int_alpha_beta-p	ENSG00000115232		0.597	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1	-	0.00	33	0	C			182322980	+1	tier1	-	no_errors	ENST00000397033	ensembl	human	known	74_37	silent	26.09	17	6	SNP	0.992	T
ITGA8	8516	genome.wustl.edu	37	10	15649741	15649741	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:15649741C>T	ENST00000378076.3	-	17	2052	c.1699G>A	c.(1699-1701)Gtc>Atc	p.V567I		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	567			V -> L. {ECO:0000269|PubMed:15579315}.		brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AGAGGGAAGACGCGATGAGCC	0.458																																																	0													177.0	175.0	176.0					10																	15649741		2203	4300	6503	SO:0001583	missense	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1699G>A	10.37:g.15649741C>T	ENSP00000367316:p.Val567Ile		B0YJ31|Q5VX94	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V567I	ENST00000378076.3	37	c.1699	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	C	5.424	0.263421	0.10294	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.42131	0.98	5.83	-7.7	0.01259	Integrin alpha-2 (1);	1.506000	0.03343	N	0.195106	T	0.15132	0.0365	N	0.02539	-0.55	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.04013	0.001;0.001	T	0.21895	-1.0232	10	0.11182	T	0.66	.	8.6536	0.34049	0.2281:0.205:0.0:0.5669	.	552;567	F5H818;P53708	.;ITA8_HUMAN	I	567;552	ENSP00000367316:V567I	ENSP00000367316:V567I	V	-	1	0	ITGA8	15689747	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.680000	0.00837	-1.874000	0.01133	-0.203000	0.12734	GTC	ITGA8	-	pfam_Integrin_alpha-2	ENSG00000077943		0.458	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	-	0.00	54	0	C	NM_003638		15649741	-1	tier1	-	no_errors	ENST00000378076	ensembl	human	known	74_37	missense	30.00	28	12	SNP	0.000	T
ITGB1BP1	9270	genome.wustl.edu	37	2	9546844	9546844	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:9546844C>T	ENST00000360635.3	-	0	1618				ITGB1BP1_ENST00000488451.1_3'UTR|ITGB1BP1_ENST00000355346.4_3'UTR|ITGB1BP1_ENST00000238091.4_3'UTR|ITGB1BP1_ENST00000490426.1_5'UTR|ITGB1BP1_ENST00000359712.3_3'UTR			O14713	ITBP1_HUMAN	integrin beta 1 binding protein 1						activation of protein kinase B activity (GO:0032148)|biomineral tissue development (GO:0031214)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|myoblast migration (GO:0051451)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|Notch signaling pathway (GO:0007219)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)|receptor clustering (GO:0043113)|regulation of blood vessel size (GO:0050880)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of integrin-mediated signaling pathway (GO:2001044)|transcription, DNA-templated (GO:0006351)|tube formation (GO:0035148)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GDP-dissociation inhibitor activity (GO:0005092)|integrin binding (GO:0005178)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)			kidney(2)|large_intestine(2)|lung(2)|prostate(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		TTACACAATCCATTTTCTTCA	0.323																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF012023	CCDS1662.1, CCDS1663.1	2p25.2	2008-02-05			ENSG00000119185	ENSG00000119185			23927	protein-coding gene	gene with protein product	"""integrin cytoplasmic domain-associated protein 1"", ""integrin cytoplasmic domain-associated protein 1-beta"", ""integrin cytoplasmic domain-associated protein 1-alpha"", ""bodenin"""	607153				11854171, 9281591	Standard	NM_004763		Approved	ICAP-1A, ICAP-1B, ICAP1, ICAP1A, ICAP1B, ICAP-1alpha	uc002qzj.3	O14713	OTTHUMG00000090414	ENST00000360635.3:c.*119G>A	2.37:g.9546844C>T			D6W4Y9|O14714|Q53RS0	RNA	SNP	-	NULL	ENST00000360635.3	37	NULL	CCDS1662.1	2																																																																																			ITGB1BP1	-	-	ENSG00000119185		0.323	ITGB1BP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ITGB1BP1	HGNC	protein_coding	OTTHUMT00000314623.2	-	0.00	33	0	C	NM_004763, NM_022334		9546844	-1	tier1	-	no_errors	ENST00000490426	ensembl	human	known	74_37	rna	35.00	13	7	SNP	0.000	T
KCNK13	56659	genome.wustl.edu	37	14	90651285	90651285	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:90651285G>T	ENST00000282146.4	+	2	1606	c.1165G>T	c.(1165-1167)Ggg>Tgg	p.G389W		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	389			G -> A (in dbSNP:rs35909577).		synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.G389W(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				TGAATTCTCAGGGGGGGTGGG	0.587																																																	1	Substitution - Missense(1)	lung(1)											17.0	19.0	18.0					14																	90651285		2202	4293	6495	SO:0001583	missense	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.1165G>T	14.37:g.90651285G>T	ENSP00000282146:p.Gly389Trp		B5TJL8|Q96E79	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.G389W	ENST00000282146.4	37	c.1165	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907343	0.52333	.	.	ENSG00000152315	ENST00000282146	T	0.53640	0.61	5.12	5.12	0.69794	.	0.000000	0.42172	D	0.000751	T	0.72534	0.3472	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.77216	-0.2669	10	0.87932	D	0	.	18.9098	0.92479	0.0:0.0:1.0:0.0	.	389	Q9HB14	KCNKD_HUMAN	W	389	ENSP00000282146:G389W	ENSP00000282146:G389W	G	+	1	0	KCNK13	89721038	1.000000	0.71417	0.999000	0.59377	0.009000	0.06853	7.911000	0.87458	2.536000	0.85505	0.655000	0.94253	GGG	KCNK13	-	NULL	ENSG00000152315		0.587	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1		0.00	29	0	G	NM_022054		90651285	+1			no_errors	ENST00000282146	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	66986883	66986883	+	Intron	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:66986883T>C	ENST00000529006.2	+	10	1403				KDM2A_ENST00000526258.1_Intron|snoU13_ENST00000459034.1_RNA|KDM2A_ENST00000398645.2_Intron	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GGGTAAGTAATCTTATGTAAC	0.353																																																	0													46.0	45.0	46.0					11																	66986883		1848	4093	5941	SO:0001627	intron_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.957+9T>C	11.37:g.66986883T>C			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	SNP	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.353	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	-	0.00	56	0	T	NM_012308		66986883	+1	tier1	-	no_errors	ENST00000525379	ensembl	human	putative	74_37	rna	32.50	27	13	SNP	0.036	C
KDM2B	84678	genome.wustl.edu	37	12	121947744	121947744	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:121947744T>C	ENST00000377071.4	-	11	1345	c.1273A>G	c.(1273-1275)Aag>Gag	p.K425E	KDM2B_ENST00000538046.2_Missense_Mutation_p.K335E|KDM2B_ENST00000377069.4_Missense_Mutation_p.K394E|KDM2B_ENST00000536437.1_Missense_Mutation_p.K308E|KDM2B_ENST00000542973.1_5'Flank	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	425	Glu-rich.				embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						tcctcgtccttctcctcctcc	0.652																																																	0													40.0	47.0	45.0					12																	121947744		2060	4179	6239	SO:0001583	missense	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.1273A>G	12.37:g.121947744T>C	ENSP00000366271:p.Lys425Glu		A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.K425E	ENST00000377071.4	37	c.1273	CCDS41850.1	12	.	.	.	.	.	.	.	.	.	.	T	3.554	-0.091097	0.07053	.	.	ENSG00000089094	ENST00000397480;ENST00000377069;ENST00000377071;ENST00000536437;ENST00000397478;ENST00000261824;ENST00000446152	T;T;T;T	0.41065	2.59;1.99;1.02;1.01	4.96	1.65	0.23941	.	0.461423	0.20010	N	0.101143	T	0.24851	0.0603	L	0.34521	1.04	0.32970	D	0.522269	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.36261	-0.9755	10	0.06625	T	0.88	-1.8817	8.476	0.33014	0.0:0.7129:0.0:0.2871	.	425;308;425;394	E7EML5;Q1RLM7;Q8NHM5;A8MRS1	.;.;KDM2B_HUMAN;.	E	425;394;425;308;425;425;388	ENSP00000366269:K394E;ENSP00000366271:K425E;ENSP00000445196:K308E;ENSP00000398279:K388E	ENSP00000261824:K425E	K	-	1	0	KDM2B	120432127	0.001000	0.12720	0.782000	0.31804	0.758000	0.43043	-1.118000	0.03280	0.087000	0.17167	-0.408000	0.06270	AAG	KDM2B	-	NULL	ENSG00000089094		0.652	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	-	0.00	50	0	T	NM_032590		121947744	-1	tier1	-	no_errors	ENST00000377071	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.996	C
KIAA0556	23247	genome.wustl.edu	37	16	27752022	27752022	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:27752022G>A	ENST00000261588.4	+	15	2423	c.2404G>A	c.(2404-2406)Gag>Aag	p.E802K		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	802						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						TGGAGAGACCGAGGCCAGGGA	0.622																																																	0													51.0	55.0	54.0					16																	27752022		2197	4300	6497	SO:0001583	missense	0			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.2404G>A	16.37:g.27752022G>A	ENSP00000261588:p.Glu802Lys		A7E2C2	Missense_Mutation	SNP	superfamily_Thaumatin	p.E802K	ENST00000261588.4	37	c.2404	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	G	8.474	0.858128	0.17178	.	.	ENSG00000047578	ENST00000261588	T	0.10005	2.92	4.94	1.9	0.25705	.	0.562283	0.18681	N	0.134180	T	0.06325	0.0163	L	0.27053	0.805	0.21604	N	0.999626	B	0.18013	0.025	B	0.09377	0.004	T	0.44236	-0.9341	10	0.10902	T	0.67	-22.8321	8.3912	0.32528	0.2494:0.0:0.7506:0.0	.	802	O60303	K0556_HUMAN	K	802	ENSP00000261588:E802K	ENSP00000261588:E802K	E	+	1	0	KIAA0556	27659523	0.001000	0.12720	0.006000	0.13384	0.019000	0.09904	0.852000	0.27764	0.149000	0.19098	0.561000	0.74099	GAG	KIAA0556	-	NULL	ENSG00000047578		0.622	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	HGNC	protein_coding	OTTHUMT00000433724.1	-	0.00	46	0	G	NM_015202		27752022	+1	tier1	-	no_errors	ENST00000261588	ensembl	human	known	74_37	missense	28.26	33	13	SNP	0.286	A
CCDC183	84960	genome.wustl.edu	37	9	139699339	139699339	+	Intron	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:139699339G>T	ENST00000338005.6	+	8	882				RP11-216L13.19_ENST00000415992.1_RNA|RP11-216L13.18_ENST00000471502.1_RNA|KIAA1984_ENST00000371682.3_Intron|KIAA1984-AS1_ENST00000414656.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN												biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		TCAGGCCAACGGATCAAGTCA	0.617																																																	0													46.0	49.0	48.0					9																	139699339		692	1591	2283	SO:0001627	intron_variant	0																														ENST00000338005.6:c.847+71G>T	9.37:g.139699339G>T			B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	RNA	SNP	-	NULL	ENST00000338005.6	37	NULL	CCDS43906.1	9																																																																																			KIAA1984-AS1	-	-	ENSG00000228544		0.617	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1984-AS1	HGNC	protein_coding	OTTHUMT00000354899.1	-	0.00	15	0	G			139699339	-1	tier1	-	no_errors	ENST00000414656	ensembl	human	known	74_37	rna	30.77	9	4	SNP	0.002	T
CCDC183	84960	genome.wustl.edu	37	9	139701045	139701045	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:139701045A>G	ENST00000338005.6	+	11	1234	c.1199A>G	c.(1198-1200)cAg>cGg	p.Q400R	RABL6_ENST00000371671.4_5'Flank|RP11-216L13.19_ENST00000415992.1_RNA|RABL6_ENST00000357466.2_5'Flank|RP11-216L13.18_ENST00000471502.1_RNA|RABL6_ENST00000371663.4_5'Flank|RABL6_ENST00000311502.7_5'Flank|KIAA1984-AS1_ENST00000414656.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN		400										biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		ACCAAGGGCCAGGAGCTGCTG	0.557																																																	0													40.0	48.0	45.0					9																	139701045		2113	4223	6336	SO:0001583	missense	0																														ENST00000338005.6:c.1199A>G	9.37:g.139701045A>G	ENSP00000338013:p.Gln400Arg		B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	Missense_Mutation	SNP	NULL	p.Q400R	ENST00000338005.6	37	c.1199	CCDS43906.1	9	.	.	.	.	.	.	.	.	.	.	A	14.39	2.521651	0.44866	.	.	ENSG00000213213	ENST00000423962;ENST00000338005	T	0.13901	2.55	4.77	4.77	0.60923	.	.	.	.	.	T	0.24122	0.0584	L	0.56769	1.78	0.80722	D	1	D	0.58268	0.982	P	0.58077	0.832	T	0.03706	-1.1011	9	0.16420	T	0.52	-27.8933	10.9778	0.47475	1.0:0.0:0.0:0.0	.	400	Q5T5S1	K1984_HUMAN	R	400	ENSP00000338013:Q400R	ENSP00000338013:Q400R	Q	+	2	0	KIAA1984	138820866	1.000000	0.71417	1.000000	0.80357	0.271000	0.26615	3.885000	0.56182	1.897000	0.54924	0.459000	0.35465	CAG	KIAA1984	-	NULL	ENSG00000213213		0.557	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1984	HGNC	protein_coding	OTTHUMT00000354899.1	-	0.00	44	0	A			139701045	+1	tier1	-	no_errors	ENST00000338005	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	G
KIF3A	11127	genome.wustl.edu	37	5	132051477	132051477	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:132051477T>C	ENST00000378746.4	-	8	1319	c.1101A>G	c.(1099-1101)atA>atG	p.I367M	KIF3A_ENST00000378735.1_Missense_Mutation_p.I367M|AC004237.1_ENST00000431165.1_RNA|KIF3A_ENST00000403231.1_Missense_Mutation_p.I367M	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	367					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAGTTCTTCTATTTCTTTCT	0.328																																																	0													68.0	66.0	67.0					5																	132051477		2203	4298	6501	SO:0001583	missense	0			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1101A>G	5.37:g.132051477T>C	ENSP00000368020:p.Ile367Met		A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.I367M	ENST00000378746.4	37	c.1101	CCDS34235.1	5	.	.	.	.	.	.	.	.	.	.	T	17.23	3.335924	0.60853	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000403231;ENST00000450914	T;T;T	0.75154	-0.91;-0.91;-0.91	5.7	4.51	0.55191	.	0.092490	0.64402	D	0.000001	D	0.85013	0.5600	M	0.88241	2.94	0.80722	D	1	D;D;D;D	0.57571	0.98;0.98;0.98;0.98	D;D;D;D	0.64321	0.924;0.924;0.924;0.924	D	0.85057	0.0932	10	0.72032	D	0.01	.	7.2157	0.25959	0.2387:0.0:0.1203:0.6409	.	367;367;367;367	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	M	367;367;367;367;337	ENSP00000368020:I367M;ENSP00000368009:I367M;ENSP00000385808:I367M	ENSP00000368009:I367M	I	-	3	3	KIF3A	132079376	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.590000	0.23954	0.955000	0.37878	0.383000	0.25322	ATA	KIF3A	-	superfamily_P-loop_NTPase	ENSG00000131437		0.328	KIF3A-001	KNOWN	basic|CCDS	protein_coding	KIF3A	HGNC	protein_coding	OTTHUMT00000132788.3	-	0.00	60	0	T	NM_007054		132051477	-1	tier1	-	no_errors	ENST00000378735	ensembl	human	known	74_37	missense	39.53	26	17	SNP	1.000	C
KLF11	8462	genome.wustl.edu	37	2	10187921	10187921	+	Missense_Mutation	SNP	G	G	A	rs541774526		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:10187921G>A	ENST00000305883.1	+	3	619	c.457G>A	c.(457-459)Gcg>Acg	p.A153T	KLF11_ENST00000535335.1_Missense_Mutation_p.A136T|KLF11_ENST00000540845.1_Missense_Mutation_p.A136T	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11	153					apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A153T(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		GAGCGGGGGCGCGGAGAGGGG	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15906	0.0		0.0	False		,,,				2504	0.0				Melanoma(56;431 1507 23687 50789)												1	Substitution - Missense(1)	endometrium(1)											51.0	52.0	51.0					2																	10187921		2203	4300	6503	SO:0001583	missense	0			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.457G>A	2.37:g.10187921G>A	ENSP00000307023:p.Ala153Thr		B4DZE7|Q9EPF4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A153T	ENST00000305883.1	37	c.457	CCDS1668.1	2	.	.	.	.	.	.	.	.	.	.	G	6.311	0.425509	0.11987	.	.	ENSG00000172059	ENST00000305883;ENST00000448523;ENST00000540845;ENST00000535335	T;T;T;T	0.63913	2.54;-0.07;2.53;2.53	4.45	-1.92	0.07618	.	2.005690	0.02435	N	0.083995	T	0.46171	0.1379	L	0.28274	0.84	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.15492	-1.0435	9	.	.	.	.	5.9661	0.19326	0.4322:0.2345:0.3333:0.0	.	153	O14901	KLF11_HUMAN	T	153;136;136;136	ENSP00000307023:A153T;ENSP00000387866:A136T;ENSP00000444690:A136T;ENSP00000442722:A136T	.	A	+	1	0	KLF11	10105372	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.590000	0.05760	-0.208000	0.10171	-1.905000	0.00526	GCG	KLF11	-	NULL	ENSG00000172059		0.617	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLF11	HGNC	protein_coding	OTTHUMT00000239202.3		0.00	74	0	G	NM_003597		10187921	+1			no_errors	ENST00000305883	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.000	A
KMT2D	8085	genome.wustl.edu	37	12	49431061	49431061	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:49431061G>T	ENST00000301067.7	-	34	10077	c.10078C>A	c.(10078-10080)Cag>Aag	p.Q3360K	KMT2D_ENST00000549743.1_5'UTR	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3360	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3090*(1)|p.Q3360*(1)									CCTCCATGCTGCCCACTTAGC	0.602																																																	2	Substitution - Nonsense(2)	lung(2)											38.0	40.0	39.0					12																	49431061		2123	4251	6374	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.10078C>A	12.37:g.49431061G>T	ENSP00000301067:p.Gln3360Lys		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3360K	ENST00000301067.7	37	c.10078	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	9.780	1.174961	0.21704	.	.	ENSG00000167548	ENST00000301067	D	0.87334	-2.24	5.61	4.67	0.58626	.	0.000000	0.36409	N	0.002604	D	0.84106	0.5399	L	0.29908	0.895	0.35151	D	0.769738	D	0.54207	0.965	P	0.47251	0.542	D	0.89408	0.3701	10	0.87932	D	0	.	16.2333	0.82358	0.0:0.1327:0.8673:0.0	.	3360	O14686	MLL2_HUMAN	K	3360	ENSP00000301067:Q3360K	ENSP00000301067:Q3360K	Q	-	1	0	MLL2	47717328	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.425000	0.73370	2.826000	0.97356	0.655000	0.94253	CAG	KMT2D	-	NULL	ENSG00000167548		0.602	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2		0.00	52	0	G			49431061	-1			no_errors	ENST00000301067	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.997	T
KNOP1	400506	genome.wustl.edu	37	16	19721832	19721832	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:19721832G>A	ENST00000219837.7	-	4	1142	c.1064C>T	c.(1063-1065)aCg>aTg	p.T355M	KNOP1_ENST00000568230.1_Splice_Site_p.T34M|AC002550.5_ENST00000565916.1_RNA	NM_001012991.2	NP_001013009.2	Q1ED39	KNOP1_HUMAN	lysine-rich nucleolar protein 1	355	Interaction with ZNF106. {ECO:0000250}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.T355M(1)									CAAACTTACCGTCCACTTCCT	0.577																																																	1	Substitution - Missense(1)	large_intestine(1)											113.0	132.0	126.0					16																	19721832		2131	4233	6364	SO:0001630	splice_region_variant	0			BC047010	CCDS42127.1	16p12.3	2013-03-12	2013-03-12	2013-03-12	ENSG00000103550	ENSG00000103550			34404	protein-coding gene	gene with protein product	"""family with sequence similarity 191, member A"", ""testis-specific gene 118"""		"""chromosome 16 open reading frame 88"""	C16orf88			Standard	NM_001012991		Approved	101F10.1, FAM191A, TSG118	uc002dgq.3	Q1ED39		ENST00000219837.7:c.1065+1C>T	16.37:g.19721832G>A			O43328|Q5FWF3	Missense_Mutation	SNP	NULL	p.T355M	ENST00000219837.7	37	c.1064	CCDS42127.1	16	.	.	.	.	.	.	.	.	.	.	G	9.009	0.982122	0.18889	.	.	ENSG00000103550	ENST00000219837	T	0.26223	1.75	4.36	-1.68	0.08212	.	.	.	.	.	T	0.12774	0.0310	L	0.28740	0.885	0.09310	N	1	B	0.18461	0.028	B	0.14023	0.01	T	0.32188	-0.9916	8	.	.	.	-5.9576	0.4677	0.00526	0.3197:0.1266:0.2954:0.2583	.	355	Q1ED39	CP088_HUMAN	M	355	ENSP00000219837:T355M	.	T	-	2	0	C16orf88	19629333	0.001000	0.12720	0.031000	0.17742	0.072000	0.16883	-0.503000	0.06383	-0.127000	0.11661	-0.670000	0.03821	ACG	KNOP1	-	NULL	ENSG00000103550		0.577	KNOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNOP1	HGNC	protein_coding	OTTHUMT00000435993.2	-	0.00	76	0	G	NM_001012991	Missense_Mutation	19721832	-1	tier1	-	no_errors	ENST00000219837	ensembl	human	known	74_37	missense	45.45	23	20	SNP	0.000	A
KRT32	3882	genome.wustl.edu	37	17	39622043	39622043	+	Silent	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:39622043G>C	ENST00000225899.3	-	3	793	c.690C>G	c.(688-690)ctC>ctG	p.L230L	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	230	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				GGTTCTTTTTGAGGCACATCA	0.597																																																	0													77.0	65.0	69.0					17																	39622043		2203	4300	6503	SO:0001819	synonymous_variant	0			X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.690C>G	17.37:g.39622043G>C				Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.L230	ENST00000225899.3	37	c.690	CCDS11393.1	17																																																																																			KRT32	-	pfam_IF	ENSG00000108759		0.597	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT32	HGNC	protein_coding	OTTHUMT00000257293.1	-	0.00	70	0	G	NM_002278		39622043	-1	tier1	-	no_errors	ENST00000225899	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.997	C
LINGO1	84894	genome.wustl.edu	37	15	77906450	77906450	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:77906450C>T	ENST00000355300.6	-	2	1973	c.1799G>A	c.(1798-1800)cGa>cAa	p.R600Q	LINGO1_ENST00000561030.1_Missense_Mutation_p.R594Q	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	600					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GTCCGACTTTCGGGGCACATA	0.642																																																	0													63.0	66.0	65.0					15																	77906450		2066	4171	6237	SO:0001583	missense	0			AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1799G>A	15.37:g.77906450C>T	ENSP00000347451:p.Arg600Gln		D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R600Q	ENST00000355300.6	37	c.1799	CCDS45313.1	15	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392627	0.83011	.	.	ENSG00000169783	ENST00000355300	T	0.62105	0.05	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.80439	0.4623	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.82776	-0.0290	10	0.87932	D	0	.	19.0895	0.93221	0.0:1.0:0.0:0.0	.	600	Q96FE5	LIGO1_HUMAN	Q	600	ENSP00000347451:R600Q	ENSP00000347451:R600Q	R	-	2	0	LINGO1	75693505	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.818000	0.86416	2.509000	0.84616	0.561000	0.74099	CGA	LINGO1	-	NULL	ENSG00000169783		0.642	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1		0.00	37	0	C	NM_032808		77906450	-1			no_errors	ENST00000355300	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	T
RP11-435B5.5	0	genome.wustl.edu	37	1	143378691	143378691	+	lincRNA	SNP	G	G	A	rs200050767		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:143378691G>A	ENST00000428624.1	+	0	1411				RP11-435B5.3_ENST00000430699.1_lincRNA|RP11-435B5.4_ENST00000423249.1_lincRNA																							TAGAAGAGAGGATATGTCAAC	0.373																																																	0																																												0																															1.37:g.143378691G>A				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.373	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	49	0	G			143378691	+1	tier1	rs200050767	no_errors	ENST00000428624	ensembl	human	known	74_37	rna	17.14	29	6	SNP	0.002	A
SIGLEC7	27036	genome.wustl.edu	37	19	51656566	51656566	+	3'UTR	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:51656566T>C	ENST00000317643.6	+	0	1537				CTD-3187F8.14_ENST00000600074.1_RNA|SIGLEC7_ENST00000305628.7_3'UTR	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7						cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		AGTCTGAGGCTGATTCCAGTA	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.*64T>C	19.37:g.51656566T>C			Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	RNA	SNP	-	NULL	ENST00000317643.6	37	NULL	CCDS12826.1	19																																																																																			CTD-3187F8.14	-	-	ENSG00000269072		0.468	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928517	Clone_based_vega_gene	protein_coding	OTTHUMT00000464226.2	-	0.00	19	0	T	NM_016543		51656566	-1	tier1	-	no_errors	ENST00000600074	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.000	C
DDIT4L	115265	genome.wustl.edu	37	4	101111193	101111193	+	Intron	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:101111193G>C	ENST00000273990.2	-	2	166				RP11-588P8.1_ENST00000515782.1_RNA|RP11-15B17.1_ENST00000515026.1_RNA	NM_145244.3	NP_660287.1	Q96D03	DDT4L_HUMAN	DNA-damage-inducible transcript 4-like						negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)				breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(2)	12				OV - Ovarian serous cystadenocarcinoma(123;5.75e-09)		CTGAGCGCTGGAAAAAATGAG	0.572																																																	0													49.0	43.0	45.0					4																	101111193		692	1591	2283	SO:0001627	intron_variant	0			BC013592	CCDS34036.1	4q23	2008-02-05				ENSG00000145358			30555	protein-coding gene	gene with protein product	"""regulated in development and DNA damage response 2"", "" similar to Smhs1 protein"""	607730				12477932	Standard	NM_145244		Approved	REDD2, Rtp801L	uc003hvq.3	Q96D03		ENST00000273990.2:c.49-4C>G	4.37:g.101111193G>C			B2R7C3	RNA	SNP	-	NULL	ENST00000273990.2	37	NULL	CCDS34036.1	4																																																																																			RP11-588P8.1	-	-	ENSG00000249710		0.572	DDIT4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929353	Clone_based_vega_gene	protein_coding	OTTHUMT00000363423.1	-	0.00	37	0	G	NM_145244		101111193	+1	tier1	-	no_errors	ENST00000515782	ensembl	human	known	74_37	rna	28.57	10	4	SNP	0.804	C
SPANXA2-OT1	619455	genome.wustl.edu	37	X	140714686	140714686	+	RNA	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:140714686G>T	ENST00000421554.1	+	0	572				RP1-171K16.5_ENST00000412163.1_lincRNA	NR_037183.1		Q8N9U9	SPOT1_HUMAN	SPANXA2 overlapping transcript 1																		ATGAAAATCAGCCAAATGAGG	0.388																																																	0																																												0			AK093505		Xq27.2	2014-06-02	2014-06-02	2011-08-31	ENSG00000226574	ENSG00000277215		"""Long non-coding RNAs"", ""-"""	31683	non-coding RNA	RNA, long non-coding			"""chromosome X open reading frame 18"", ""SPANXA2 overlapping transcript 1 (non-protein coding)"""	CXorf18			Standard	NR_037183		Approved	FLJ36186	uc004fbm.1	Q8N9U9	OTTHUMG00000022566		X.37:g.140714686G>T				RNA	SNP	-	NULL	ENST00000421554.1	37	NULL		X																																																																																			RP1-171K16.5	-	-	ENSG00000223438		0.388	SPANXA2-OT1-001	KNOWN	basic	processed_transcript	LOC645188	Clone_based_vega_gene	processed_transcript	OTTHUMT00000058601.2	-	0.00	71	0	G	NR_037183		140714686	+1	tier1	-	no_errors	ENST00000412163	ensembl	human	known	74_37	rna	81.25	9	39	SNP	0.000	T
LPHN2	23266	genome.wustl.edu	37	1	82372903	82372903	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:82372903T>G	ENST00000370728.1	+	6	920	c.275T>G	c.(274-276)aTt>aGt	p.I92S	LPHN2_ENST00000370717.2_Missense_Mutation_p.I92S|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000359929.3_Missense_Mutation_p.I92S|LPHN2_ENST00000271029.4_Missense_Mutation_p.I92S|LPHN2_ENST00000370713.1_Missense_Mutation_p.I92S|LPHN2_ENST00000335786.5_Missense_Mutation_p.I92S|LPHN2_ENST00000394879.1_Missense_Mutation_p.I92S|LPHN2_ENST00000370730.1_Missense_Mutation_p.I92S|LPHN2_ENST00000370723.1_Missense_Mutation_p.I92S|LPHN2_ENST00000370725.1_Missense_Mutation_p.I92S|LPHN2_ENST00000319517.6_Missense_Mutation_p.I92S|LPHN2_ENST00000370727.1_Missense_Mutation_p.I92S|LPHN2_ENST00000370715.1_Missense_Mutation_p.I92S|LPHN2_ENST00000370721.1_Missense_Mutation_p.I92S			O95490	LPHN2_HUMAN	latrophilin 2	92	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GCCTTCAAAATTATGACTCAA	0.378																																																	0													131.0	122.0	125.0					1																	82372903		2203	4300	6503	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.275T>G	1.37:g.82372903T>G	ENSP00000359763:p.Ile92Ser		A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.I92S	ENST00000370728.1	37	c.275		1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.522539	0.85600	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31;2.31	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	M	0.63208	1.945	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.994;0.996;0.999;1.0	T	0.04811	-1.0925	10	0.66056	D	0.02	.	15.8673	0.79074	0.0:0.0:0.0:1.0	.	92;92;92;92	O95490-3;O95490-4;O95490-2;B3KVU1	.;.;.;.	S	92	ENSP00000359756:I92S;ENSP00000359763:I92S;ENSP00000359765:I92S;ENSP00000359762:I92S;ENSP00000359760:I92S;ENSP00000359758:I92S;ENSP00000353006:I92S;ENSP00000359750:I92S;ENSP00000359748:I92S;ENSP00000322270:I92S;ENSP00000359752:I92S;ENSP00000378344:I92S;ENSP00000271029:I92S;ENSP00000337306:I92S	ENSP00000271029:I92S	I	+	2	0	LPHN2	82145491	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.903000	0.87398	2.208000	0.71279	0.455000	0.32223	ATT	LPHN2	-	pfam_Lectin_gal-bd_dom,prints_GPCR_2_latrophilin,pfscan_Lectin_gal-bd_dom	ENSG00000117114		0.378	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	-	0.00	45	0	T	NM_012302		82372903	+1	tier1	-	no_errors	ENST00000370717	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	G
PLPPR4	9890	genome.wustl.edu	37	1	99771527	99771527	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:99771527C>T	ENST00000370185.3	+	7	1750	c.1253C>T	c.(1252-1254)cCg>cTg	p.P418L	LPPR4_ENST00000457765.1_Missense_Mutation_p.P360L|LPPR4_ENST00000370184.1_Missense_Mutation_p.P260L	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		418					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		AATACCTTGCCGCGAGCCAAT	0.498																																																	0													55.0	56.0	56.0					1																	99771527		2203	4300	6503	SO:0001583	missense	0																														ENST00000370185.3:c.1253C>T	1.37:g.99771527C>T	ENSP00000359204:p.Pro418Leu		E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.P418L	ENST00000370185.3	37	c.1253	CCDS757.1	1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.996051	0.54147	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.70869	0.15;-0.52;-0.34	5.71	5.71	0.89125	.	0.272209	0.42682	D	0.000671	T	0.80954	0.4723	M	0.67397	2.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.987	T	0.78570	-0.2153	9	.	.	.	-20.7641	19.8478	0.96722	0.0:1.0:0.0:0.0	.	360;418	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	L	418;360;418;260	ENSP00000359204:P418L;ENSP00000394913:P360L;ENSP00000359203:P260L	.	P	+	2	0	RP4-788L13.1	99544115	1.000000	0.71417	0.950000	0.38849	0.185000	0.23345	7.212000	0.77941	2.685000	0.91497	0.650000	0.86243	CCG	LPPR4	-	NULL	ENSG00000117600		0.498	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	Uniprot_gn	protein_coding	OTTHUMT00000029670.2	-	0.00	32	0	C			99771527	+1	tier1	-	no_errors	ENST00000370185	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	T
LOC730102	730102	genome.wustl.edu	37	1	178001582	178001582	+	RNA	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:178001582A>T	ENST00000476232.2	-	0	366					NR_037167.1																						TCAGTGACGCATTCTTCAGCC	0.373											OREG0014009	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												0																															1.37:g.178001582A>T		1943		RNA	SNP	-	NULL	ENST00000476232.2	37	NULL		1																																																																																			RP11-568K15.1	-	-	ENSG00000242193		0.373	RP11-568K15.1-002	KNOWN	basic	processed_transcript	LOC730102	Clone_based_vega_gene	pseudogene	OTTHUMT00000337461.2	-	0.00	66	0	A			178001582	-1	tier1	-	no_errors	ENST00000476232	ensembl	human	known	74_37	rna	10.81	33	4	SNP	0.689	T
LRFN2	57497	genome.wustl.edu	37	6	40399635	40399635	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:40399635G>T	ENST00000338305.6	-	2	1760	c.1218C>A	c.(1216-1218)agC>agA	p.S406R		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	406						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)		p.S406S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CACCTCCCCGGCTGGTCTTGC	0.652																																																	1	Substitution - coding silent(1)	large_intestine(1)											41.0	44.0	43.0					6																	40399635		2203	4300	6503	SO:0001583	missense	0			AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1218C>A	6.37:g.40399635G>T	ENSP00000345985:p.Ser406Arg		A5PKU3|Q5SYP9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S406R	ENST00000338305.6	37	c.1218	CCDS34443.1	6	.	.	.	.	.	.	.	.	.	.	G	8.732	0.916951	0.17907	.	.	ENSG00000156564	ENST00000338305	T	0.56444	0.46	5.38	2.41	0.29592	.	0.362821	0.36444	N	0.002595	T	0.21347	0.0514	L	0.43152	1.355	0.29742	N	0.837056	B	0.10296	0.003	B	0.12156	0.007	T	0.14062	-1.0486	10	0.62326	D	0.03	.	5.2911	0.15727	0.2415:0.0:0.6132:0.1452	.	406	Q9ULH4	LRFN2_HUMAN	R	406	ENSP00000345985:S406R	ENSP00000345985:S406R	S	-	3	2	LRFN2	40507613	0.191000	0.23288	0.921000	0.36526	0.631000	0.37964	0.544000	0.23253	0.622000	0.30249	0.561000	0.74099	AGC	LRFN2	-	NULL	ENSG00000156564		0.652	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN2	HGNC	protein_coding	OTTHUMT00000040488.1		0.00	81	0	G	XM_166372		40399635	-1			no_errors	ENST00000338305	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.832	T
LRP2	4036	genome.wustl.edu	37	2	170027070	170027070	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:170027070G>A	ENST00000263816.3	-	59	11656	c.11371C>T	c.(11371-11373)Cgg>Tgg	p.R3791W		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3791	LDL-receptor class A 32. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R3791W(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CCACAGTCCCGTTCATCTGAG	0.448																																																	1	Substitution - Missense(1)	breast(1)											178.0	152.0	161.0					2																	170027070		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11371C>T	2.37:g.170027070G>A	ENSP00000263816:p.Arg3791Trp		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R3791W	ENST00000263816.3	37	c.11371	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.126997	0.77549	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.95588	-3.75	5.56	4.68	0.58851	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.172256	0.48767	D	0.000170	D	0.96821	0.8962	M	0.62154	1.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96278	0.9204	10	0.40728	T	0.16	.	13.7586	0.62952	0.0:0.0:0.7203:0.2797	.	3791	P98164	LRP2_HUMAN	W	3791;486	ENSP00000263816:R3791W	ENSP00000263816:R3791W	R	-	1	2	LRP2	169735316	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	3.941000	0.56607	1.460000	0.47911	0.655000	0.94253	CGG	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.448	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	68	0	G	NM_004525		170027070	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	A
LRRC36	55282	genome.wustl.edu	37	16	67404883	67404883	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:67404883C>T	ENST00000329956.6	+	9	1251	c.1232C>T	c.(1231-1233)gCt>gTt	p.A411V	LRRC36_ENST00000290940.7_Missense_Mutation_p.A143V|LRRC36_ENST00000435835.3_Missense_Mutation_p.A290V|LRRC36_ENST00000563189.1_Missense_Mutation_p.A290V|LRRC36_ENST00000541146.1_5'UTR	NM_018296.5	NP_060766.5	Q1X8D7	LRC36_HUMAN	leucine rich repeat containing 36	411										endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	24		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0669)|Epithelial(162;0.161)		AGTGACCCTGCTGTACTTGTC	0.478																																																	0													193.0	165.0	175.0					16																	67404883		2198	4300	6498	SO:0001583	missense	0			BC026156	CCDS32467.1, CCDS58474.1	16q22.1	2008-02-05				ENSG00000159708			25615	protein-coding gene	gene with protein product						12477932	Standard	NM_001161575		Approved	FLJ11004	uc002esv.3	Q1X8D7		ENST00000329956.6:c.1232C>T	16.37:g.67404883C>T	ENSP00000329943:p.Ala411Val		A4FTV6|A6NDE9|A8K8E6|Q7Z5K5	Missense_Mutation	SNP	NULL	p.A411V	ENST00000329956.6	37	c.1232	CCDS32467.1	16	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582728	0.46006	.	.	ENSG00000159708	ENST00000329956;ENST00000290940;ENST00000435835	T;T;T	0.58797	2.62;0.31;0.93	5.7	3.75	0.43078	.	0.425278	0.27362	N	0.019708	T	0.65186	0.2667	L	0.59436	1.845	0.80722	D	1	B;B;D;P	0.65815	0.043;0.043;0.995;0.93	B;B;P;P	0.59825	0.047;0.083;0.864;0.71	T	0.65529	-0.6146	10	0.87932	D	0	-2.7511	7.9684	0.30113	0.0:0.7542:0.1607:0.0851	.	290;143;290;411	B7Z7B3;Q9NV11;Q1X8D7-2;Q1X8D7	.;.;.;LRC36_HUMAN	V	411;143;290	ENSP00000329943:A411V;ENSP00000290940:A143V;ENSP00000411122:A290V	ENSP00000290940:A143V	A	+	2	0	LRRC36	65962384	0.994000	0.37717	0.969000	0.41365	0.174000	0.22865	0.783000	0.26802	0.777000	0.33496	-0.304000	0.09214	GCT	LRRC36	-	NULL	ENSG00000159708		0.478	LRRC36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC36	HGNC	protein_coding	OTTHUMT00000421770.1	-	0.00	46	0	C	NM_018296		67404883	+1	tier1	-	no_errors	ENST00000329956	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.999	T
LRRK2	120892	genome.wustl.edu	37	12	40645037	40645037	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:40645037A>C	ENST00000298910.7	+	9	1020	c.962A>C	c.(961-963)gAg>gCg	p.E321A	LRRK2_ENST00000343742.2_Missense_Mutation_p.E321A	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	321					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				tttCAAGCTGAGACTATTTTC	0.289											OREG0003829	type=REGULATORY REGION|Gene=LRRK2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													22.0	24.0	23.0					12																	40645037		2188	4298	6486	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.962A>C	12.37:g.40645037A>C	ENSP00000298910:p.Glu321Ala	895	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.E321A	ENST00000298910.7	37	c.962	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	A	15.30	2.793970	0.50102	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.72615	2.16;-0.67	5.66	4.52	0.55395	Armadillo-like helical (1);Armadillo-type fold (1);	0.121584	0.53938	D	0.000055	T	0.63920	0.2552	L	0.50333	1.59	0.35427	D	0.7937	B	0.29805	0.257	B	0.31016	0.123	T	0.69924	-0.5013	10	0.72032	D	0.01	.	9.3449	0.38102	0.9174:0.0:0.0826:0.0	.	321	Q5S007	LRRK2_HUMAN	A	321	ENSP00000341930:E321A;ENSP00000298910:E321A	ENSP00000298910:E321A	E	+	2	0	LRRK2	38931304	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.260000	0.72502	0.982000	0.38575	0.533000	0.62120	GAG	LRRK2	-	superfamily_ARM-type_fold	ENSG00000188906		0.289	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1		0.00	25	0	A	XM_058513		40645037	+1			no_errors	ENST00000298910	ensembl	human	known	74_37	missense	37.50	14	9	SNP	1.000	C
LUZP2	338645	genome.wustl.edu	37	11	25071622	25071622	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:25071622A>G	ENST00000336930.6	+	10	870	c.804A>G	c.(802-804)caA>caG	p.Q268Q	LUZP2_ENST00000533227.1_Silent_p.Q182Q			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	268						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						AGAGCTCTCAAGTTGAGTCAA	0.358																																																	0													93.0	94.0	94.0					11																	25071622		2203	4300	6503	SO:0001819	synonymous_variant	0			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.804A>G	11.37:g.25071622A>G			A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Silent	SNP	NULL	p.Q268	ENST00000336930.6	37	c.804	CCDS31446.1	11																																																																																			LUZP2	-	NULL	ENSG00000187398		0.358	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	HGNC	protein_coding	OTTHUMT00000387861.1	-	0.00	36	0	A	NM_001009909		25071622	+1	tier1	-	no_errors	ENST00000336930	ensembl	human	known	74_37	silent	56.25	14	18	SNP	0.018	G
MAGEB3	4114	genome.wustl.edu	37	X	30254478	30254478	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:30254478A>G	ENST00000361644.2	+	5	1174	c.437A>G	c.(436-438)aAg>aGg	p.K146R		NM_002365.4	NP_002356.2	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	146	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	25						AAAAGCCATAAGAATTGCTTC	0.358																																																	0													94.0	88.0	90.0					X																	30254478		2202	4299	6501	SO:0001583	missense	0			AK057441	CCDS14220.1	Xp21.3	2009-03-17			ENSG00000198798	ENSG00000198798			6810	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 5"""	300152				9441743	Standard	NM_002365		Approved	CT3.5	uc004dca.2	O15480	OTTHUMG00000021320	ENST00000361644.2:c.437A>G	X.37:g.30254478A>G	ENSP00000355198:p.Lys146Arg		A0AVE4|B3KQ52|O75861	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.K146R	ENST00000361644.2	37	c.437	CCDS14220.1	X	.	.	.	.	.	.	.	.	.	.	A	6.991	0.553052	0.13374	.	.	ENSG00000198798	ENST00000378986;ENST00000361644	T;T	0.05319	3.46;3.46	4.1	1.57	0.23409	.	0.438122	0.22367	N	0.060986	T	0.04724	0.0128	L	0.35723	1.085	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.39722	-0.9600	10	0.28530	T	0.3	.	5.4161	0.16374	0.7592:0.0:0.2408:0.0	.	146	O15480	MAGB3_HUMAN	R	146	ENSP00000368271:K146R;ENSP00000355198:K146R	ENSP00000355198:K146R	K	+	2	0	MAGEB3	30164399	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.273000	0.18662	0.196000	0.20367	-0.360000	0.07572	AAG	MAGEB3	-	pfam_MAGE,pfscan_MAGE	ENSG00000198798		0.358	MAGEB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB3	HGNC	protein_coding	OTTHUMT00000056158.2	-	0.00	62	0	A	NM_002365		30254478	+1	tier1	-	no_errors	ENST00000361644	ensembl	human	known	74_37	missense	16.67	40	8	SNP	0.000	G
MALSU1	115416	genome.wustl.edu	37	7	23349147	23349147	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:23349147G>A	ENST00000466681.1	+	4	843	c.690G>A	c.(688-690)gaG>gaA	p.E230E		NM_138446.1	NP_612455.1	Q96EH3	MASU1_HUMAN	mitochondrial assembly of ribosomal large subunit 1	230					negative regulation of mitochondrial translation (GO:0070130)|ribosomal large subunit biogenesis (GO:0042273)	mitochondrion (GO:0005739)											CTCCAGTGGAGTTAAAATGTG	0.383																																																	0													63.0	60.0	61.0					7																	23349147		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012331	CCDS5381.1	7p15.3	2013-05-24	2012-02-20	2012-02-20	ENSG00000156928	ENSG00000156928			21721	protein-coding gene	gene with protein product		614624	"""chromosome 7 open reading frame 30"""	C7orf30		22238376, 22238375	Standard	NM_138446		Approved	mtRsfA	uc003swd.1	Q96EH3	OTTHUMG00000128443	ENST00000466681.1:c.690G>A	7.37:g.23349147G>A			A4D154	Silent	SNP	pfam_Oligomer_dom,tigrfam_Iojap/RsfS	p.E230	ENST00000466681.1	37	c.690	CCDS5381.1	7																																																																																			MALSU1	-	NULL	ENSG00000156928		0.383	MALSU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MALSU1	HGNC	protein_coding	OTTHUMT00000250241.2	-	0.00	34	0	G	NM_138446		23349147	+1	tier1	-	no_errors	ENST00000466681	ensembl	human	known	74_37	silent	17.02	39	8	SNP	0.295	A
MAST4	375449	genome.wustl.edu	37	5	66385997	66385997	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:66385997C>T	ENST00000403625.2	+	6	1066	c.771C>T	c.(769-771)agC>agT	p.S257S	MAST4_ENST00000261569.7_Silent_p.S63S|MAST4_ENST00000405643.1_Silent_p.S75S|MAST4_ENST00000404260.3_Silent_p.S257S|MAST4_ENST00000403666.1_Silent_p.S68S|MAST4_ENST00000490016.2_Silent_p.S68S	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	257						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TAGGAAATAGCCCTCAAGATA	0.363																																																	0													72.0	66.0	68.0					5																	66385997		1824	4081	5905	SO:0001819	synonymous_variant	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.771C>T	5.37:g.66385997C>T			A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Silent	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.S257	ENST00000403625.2	37	c.771	CCDS54861.1	5																																																																																			MAST4	-	NULL	ENSG00000069020		0.363	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	-	0.00	105	0	C			66385997	+1	tier1	-	no_errors	ENST00000404260	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	T
MDN1	23195	genome.wustl.edu	37	6	90440524	90440524	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:90440524C>A	ENST00000369393.3	-	35	5176	c.5061G>T	c.(5059-5061)aaG>aaT	p.K1687N	MDN1_ENST00000428876.1_Missense_Mutation_p.K1687N			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1687					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGTCATAAATCTTCAACTCAT	0.343																																																	0													110.0	101.0	104.0					6																	90440524		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.5061G>T	6.37:g.90440524C>A	ENSP00000358400:p.Lys1687Asn		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.K1687N	ENST00000369393.3	37	c.5061	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	10.65	1.408524	0.25378	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03330	3.97;3.97	5.62	4.76	0.60689	.	0.106321	0.64402	D	0.000008	T	0.01222	0.0040	L	0.31065	0.9	0.37707	D	0.92442	B	0.22800	0.075	B	0.20384	0.029	T	0.50294	-0.8845	10	0.19147	T	0.46	.	11.5098	0.50486	0.0:0.8568:0.0:0.1432	.	1687	Q9NU22	MDN1_HUMAN	N	1687	ENSP00000358400:K1687N;ENSP00000413970:K1687N	ENSP00000358400:K1687N	K	-	3	2	MDN1	90497245	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	1.635000	0.37134	1.377000	0.46286	-0.225000	0.12378	AAG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.343	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	97	0	C			90440524	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	21.33	59	16	SNP	1.000	A
MED1	5469	genome.wustl.edu	37	17	37564479	37564479	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:37564479C>T	ENST00000300651.6	-	17	4218	c.3995G>A	c.(3994-3996)aGc>aAc	p.S1332N	CTB-131K11.1_ENST00000582842.1_RNA|MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		AGAATTTGTGCTCACCCCCAT	0.498										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													94.0	102.0	99.0					17																	37564479		2203	4298	6501	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3995G>A	17.37:g.37564479C>T	ENSP00000300651:p.Ser1332Asn		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.S1332N	ENST00000300651.6	37	c.3995	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	C	15.70	2.912109	0.52439	.	.	ENSG00000125686	ENST00000300651	T	0.35605	1.3	5.2	5.2	0.72013	.	.	.	.	.	T	0.24661	0.0598	N	0.14661	0.345	0.42849	D	0.99407	B	0.29432	0.244	B	0.19666	0.026	T	0.05053	-1.0909	9	0.32370	T	0.25	-9.1213	19.2916	0.94102	0.0:1.0:0.0:0.0	.	1332	Q15648	MED1_HUMAN	N	1332	ENSP00000300651:S1332N	ENSP00000300651:S1332N	S	-	2	0	MED1	34818005	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.055000	0.30467	2.861000	0.98227	0.655000	0.94253	AGC	MED1	-	NULL	ENSG00000125686		0.498	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	-	0.00	23	0	C	NM_004774		37564479	-1	tier1	-	no_errors	ENST00000300651	ensembl	human	known	74_37	missense	15.38	44	8	SNP	1.000	T
MEPCE	56257	genome.wustl.edu	37	7	100028975	100028975	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:100028975G>T	ENST00000310512.2	+	1	1722	c.1334G>T	c.(1333-1335)cGg>cTg	p.R445L	ZCWPW1_ENST00000398027.2_5'Flank|MEPCE_ENST00000414441.1_5'UTR|ZCWPW1_ENST00000324725.6_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	445	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTTCGGGGCCGGGACGTCCTA	0.577																																																	0													90.0	77.0	81.0					7																	100028975		2203	4300	6503	SO:0001583	missense	0			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1334G>T	7.37:g.100028975G>T	ENSP00000308546:p.Arg445Leu		B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	pfam_Bin3	p.R445L	ENST00000310512.2	37	c.1334	CCDS5693.1	7	.	.	.	.	.	.	.	.	.	.	G	21.8	4.203245	0.79127	.	.	ENSG00000146834	ENST00000310512	T	0.22134	1.97	4.68	3.81	0.43845	Bin3-type S-adenosyl-L-methionine binding domain (1);	0.072360	0.53938	D	0.000044	T	0.13798	0.0334	N	0.16066	0.365	0.44515	D	0.997462	P	0.52842	0.956	P	0.46026	0.501	T	0.03413	-1.1039	10	0.56958	D	0.05	-15.6864	7.116	0.25416	0.1984:0.0:0.8016:0.0	.	445	Q7L2J0	MEPCE_HUMAN	L	445	ENSP00000308546:R445L	ENSP00000308546:R445L	R	+	2	0	MEPCE	99866911	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.526000	0.67116	1.193000	0.43086	0.462000	0.41574	CGG	MEPCE	-	NULL	ENSG00000146834		0.577	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	HGNC	protein_coding	OTTHUMT00000339135.1	-	0.00	121	0	G			100028975	+1	tier1	-	no_errors	ENST00000310512	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
MGAT4B	11282	genome.wustl.edu	37	5	179225977	179225977	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:179225977C>T	ENST00000292591.7	-	11	1644	c.1294G>A	c.(1294-1296)Gcg>Acg	p.A432T	MGAT4B_ENST00000521305.1_5'Flank|MIR1229_ENST00000408467.1_RNA|MGAT4B_ENST00000337755.5_Missense_Mutation_p.A447T	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	432					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGTCCCCCGCGGCAGGGGTG	0.647																																					GBM(13;414 434 4098 22176 23230)												0													91.0	90.0	90.0					5																	179225977		2203	4300	6503	SO:0001583	missense	0			AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1294G>A	5.37:g.179225977C>T	ENSP00000292591:p.Ala432Thr		A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	pfam_Glyco_transf_54	p.A447T	ENST00000292591.7	37	c.1339	CCDS4448.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.5|29.5	5.014581|5.014581	0.93404|0.93404	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000337755;ENST00000292591;ENST00000519836|ENST00000518778;ENST00000520875	T;T|.	0.33654|.	1.4;1.41|.	4.17|4.17	4.17|4.17	0.49024|0.49024	.|.	0.060230|.	0.64402|.	N|.	0.000003|.	T|T	0.74951|0.74951	0.3784|0.3784	M|M	0.75615|0.75615	2.305|2.305	0.80722|0.80722	D|D	1|1	P;D;D|.	0.76494|.	0.94;0.991;0.999|.	B;B;D|.	0.77557|.	0.206;0.37;0.99|.	T|T	0.76798|0.76798	-0.2826|-0.2826	10|5	0.59425|.	D|.	0.04|.	-8.7569|-8.7569	16.6962|16.6962	0.85336|0.85336	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	432;447;431|.	Q9UQ53;A8MPR0;Q9UQ53-2|.	MGT4B_HUMAN;.;.|.	T|H	447;432;300|256;212	ENSP00000338487:A447T;ENSP00000292591:A432T|.	ENSP00000292591:A432T|.	A|R	-|-	1|2	0|0	MGAT4B|MGAT4B	179158583|179158583	1.000000|1.000000	0.71417|0.71417	0.016000|0.016000	0.15963|0.15963	0.945000|0.945000	0.59286|0.59286	5.788000|5.788000	0.69020|0.69020	2.161000|2.161000	0.67846|0.67846	0.561000|0.561000	0.74099|0.74099	GCG|CGC	MGAT4B	-	NULL	ENSG00000161013		0.647	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4B	HGNC	protein_coding	OTTHUMT00000253503.3	-	0.00	35	0	C	NM_014275		179225977	-1	tier1	-	no_errors	ENST00000337755	ensembl	human	known	74_37	missense	43.24	21	16	SNP	0.993	T
MMRN2	79812	genome.wustl.edu	37	10	88696628	88696628	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:88696628C>G	ENST00000372027.5	-	7	3043	c.2722G>C	c.(2722-2724)Gca>Cca	p.A908P		NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	908	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						AAGACCGTTGCTGTGCTTCCA	0.567																																																	0													174.0	176.0	175.0					10																	88696628		2203	4300	6503	SO:0001583	missense	0			AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.2722G>C	10.37:g.88696628C>G	ENSP00000361097:p.Ala908Pro		Q504V7|Q6P2N2	Missense_Mutation	SNP	pfam_C1q,pfam_EMI_domain,superfamily_Tumour_necrosis_fac-like_dom,superfamily_tRNA-bd_arm,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EMI_domain	p.A908P	ENST00000372027.5	37	c.2722	CCDS7379.1	10	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671410	0.29693	.	.	ENSG00000173269	ENST00000372027;ENST00000443699	T	0.78481	-1.18	4.34	4.34	0.51931	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.282977	0.24698	N	0.036328	D	0.85687	0.5754	M	0.78916	2.43	0.09310	N	1	D;D	0.89917	1.0;0.998	D;D	0.80764	0.994;0.986	T	0.76561	-0.2914	10	0.59425	D	0.04	-10.4983	8.6386	0.33964	0.0:0.8418:0.0:0.1582	.	686;908	E7EN39;Q9H8L6	.;MMRN2_HUMAN	P	908;686	ENSP00000361097:A908P	ENSP00000361097:A908P	A	-	1	0	MMRN2	88686608	0.001000	0.12720	0.016000	0.15963	0.094000	0.18550	0.439000	0.21575	2.258000	0.74832	0.558000	0.71614	GCA	MMRN2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,prints_C1q,pfscan_C1q	ENSG00000173269		0.567	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN2	HGNC	protein_coding	OTTHUMT00000049179.2		0.00	77	0	C	NM_024756		88696628	-1			no_errors	ENST00000372027	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.006	G
MKI67	4288	genome.wustl.edu	37	10	129907608	129907608	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:129907608C>T	ENST00000368654.3	-	13	2871	c.2496G>A	c.(2494-2496)cgG>cgA	p.R832R	MKI67_ENST00000368653.3_Silent_p.R472R|MKI67_ENST00000484853.1_5'Flank	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	832			R -> W (in dbSNP:rs34916904).		cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TAATACACTGCCGTCTTAAGG	0.418																																																	0													160.0	159.0	159.0					10																	129907608		2203	4300	6503	SO:0001819	synonymous_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.2496G>A	10.37:g.129907608C>T			Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R832	ENST00000368654.3	37	c.2496	CCDS7659.1	10																																																																																			MKI67	-	NULL	ENSG00000148773		0.418	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	-	0.00	26	0	C	NM_002417		129907608	-1	tier1	-	no_errors	ENST00000368654	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.000	T
MOB3C	148932	genome.wustl.edu	37	1	47078811	47078811	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:47078811G>A	ENST00000319928.3	-	2	413	c.183C>T	c.(181-183)gcC>gcT	p.A61A	MOB3C_ENST00000477318.1_5'UTR|MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000271139.8_Silent_p.A113A|MOB3C_ENST00000371940.1_Silent_p.A84A	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C	61							metal ion binding (GO:0046872)										CCACGTGCACGGCGATCCAGT	0.632																																																	0													110.0	77.0	88.0					1																	47078811		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.183C>T	1.37:g.47078811G>A			D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Silent	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.A113	ENST00000319928.3	37	c.339	CCDS540.1	1																																																																																			MOB3C	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000142961		0.632	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB3C	HGNC	protein_coding		-	0.00	72	0	G	NM_145279		47078811	-1	tier1	-	no_errors	ENST00000271139	ensembl	human	known	74_37	silent	26.23	45	16	SNP	0.005	A
MSS51	118490	genome.wustl.edu	37	10	75187850	75187850	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:75187850G>T	ENST00000372912.1	-	1	195	c.193C>A	c.(193-195)Ctg>Atg	p.L65M	MSS51_ENST00000299432.2_Missense_Mutation_p.L65M|AL353731.1_ENST00000584907.1_RNA			Q4VC12	MSS51_HUMAN	MSS51 mitochondrial translational activator	65					social behavior (GO:0035176)		metal ion binding (GO:0046872)										TTCATGTTCAGCTTTTGAAGG	0.448																																																	0													98.0	98.0	98.0					10																	75187850		2203	4300	6503	SO:0001583	missense	0			AK096884	CCDS31221.1	10q22.3	2013-01-10	2013-01-10	2012-02-24	ENSG00000166343	ENSG00000166343		"""Zinc fingers, MYND-type"""	21000	protein-coding gene	gene with protein product		614773	"""zinc finger, MYND-type containing 17"", ""MSS51 mitochondrial translational activator homolog (S. cerevisiae)"""	ZMYND17		19710419	Standard	NM_001024593		Approved	FLJ39565	uc001jud.3	Q4VC12	OTTHUMG00000018464	ENST00000372912.1:c.193C>A	10.37:g.75187850G>T	ENSP00000362003:p.Leu65Met		A6NGH6|Q2VP95|Q5F2H5|Q7Z3M9|Q8N8G0	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.L65M	ENST00000372912.1	37	c.193	CCDS31221.1	10	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610507	0.66558	.	.	ENSG00000166343	ENST00000299432;ENST00000372912	T;T	0.57595	0.39;0.39	5.54	1.29	0.21616	.	0.074874	0.53938	N	0.000047	T	0.56702	0.2003	L	0.59436	1.845	0.33630	D	0.60586	D;D	0.56521	0.959;0.976	P;P	0.56398	0.631;0.797	T	0.65717	-0.6100	10	0.87932	D	0	-3.4213	6.6169	0.22782	0.189:0.0:0.6724:0.1386	.	65;65	Q4VC12;F6VAV3	ZMY17_HUMAN;.	M	65	ENSP00000299432:L65M;ENSP00000362003:L65M	ENSP00000299432:L65M	L	-	1	2	ZMYND17	74857856	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.192000	0.42649	0.315000	0.23110	0.591000	0.81541	CTG	MSS51	-	NULL	ENSG00000166343		0.448	MSS51-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MSS51	HGNC	protein_coding	OTTHUMT00000048652.3		0.00	62	0	G	NM_178451		75187850	-1			no_errors	ENST00000299432	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
MT-CO1	4512	genome.wustl.edu	37	M	2964	2964	+	5'Flank	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrM:2964T>C	ENST00000361624.2	+	0	0				MT-ND2_ENST00000361453.3_5'Flank|MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTCTAGAGTCCATATCAACAA	0.433																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.2964T>C	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	159	0	T	YP_003024028		2964	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	32.04	210	99	SNP	NULL	C
MTRR	4552	genome.wustl.edu	37	5	7900207	7900207	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:7900207G>A	ENST00000264668.2	+	0	2244				MTRR_ENST00000440940.2_3'UTR	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase						cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	AAGCTTTTTTGACTGAAAGTA	0.328																																																	0													35.0	38.0	37.0					5																	7900207		2197	4299	6496	SO:0001624	3_prime_UTR_variant	0			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.*36G>A	5.37:g.7900207G>A			O60471|Q32MA9|Q7Z4M8	RNA	SNP	-	NULL	ENST00000264668.2	37	NULL	CCDS3874.1	5																																																																																			MTRR	-	-	ENSG00000124275		0.328	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	HGNC	protein_coding	OTTHUMT00000206931.1	-	0.00	49	0	G			7900207	+1	tier1	-	no_errors	ENST00000506115	ensembl	human	putative	74_37	rna	27.27	16	6	SNP	0.069	A
MUC16	94025	genome.wustl.edu	37	19	9073258	9073258	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:9073258C>T	ENST00000397910.4	-	3	14391	c.14188G>A	c.(14188-14190)Gac>Aac	p.D4730N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4732	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTGACACGTCCTTGACATCA	0.488																																																	0													155.0	150.0	151.0					19																	9073258		2066	4196	6262	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14188G>A	19.37:g.9073258C>T	ENSP00000381008:p.Asp4730Asn		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.D4730N	ENST00000397910.4	37	c.14188	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	1.669	-0.509508	0.04231	.	.	ENSG00000181143	ENST00000397910	T	0.22336	1.96	1.61	-3.23	0.05109	.	.	.	.	.	T	0.07098	0.0180	N	0.14661	0.345	.	.	.	P	0.39809	0.689	B	0.25987	0.065	T	0.10776	-1.0615	8	0.87932	D	0	.	0.7806	0.01040	0.169:0.2115:0.3342:0.2853	.	4730	B5ME49	.	N	4730	ENSP00000381008:D4730N	ENSP00000381008:D4730N	D	-	1	0	MUC16	8934258	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.229000	0.02945	-2.323000	0.00639	-0.389000	0.06534	GAC	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	83	0	C	NM_024690		9073258	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	29.31	41	17	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9077073	9077073	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:9077073G>A	ENST00000397910.4	-	3	10576	c.10373C>T	c.(10372-10374)aCc>aTc	p.T3458I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3459	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TAGTGAGGTGGTTTGTGCTGT	0.488																																																	0													134.0	131.0	132.0					19																	9077073		2120	4231	6351	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10373C>T	19.37:g.9077073G>A	ENSP00000381008:p.Thr3458Ile		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T3458I	ENST00000397910.4	37	c.10373	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	7.748	0.702649	0.15172	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	1.98	-0.343	0.12632	.	.	.	.	.	T	0.01523	0.0049	N	0.08118	0	.	.	.	B	0.23540	0.087	B	0.19148	0.024	T	0.45071	-0.9286	8	0.87932	D	0	.	2.4897	0.04607	0.18:0.0:0.5313:0.2887	.	3458	B5ME49	.	I	3458	ENSP00000381008:T3458I	ENSP00000381008:T3458I	T	-	2	0	MUC16	8938073	0.001000	0.12720	0.000000	0.03702	0.629000	0.37895	0.408000	0.21065	-0.017000	0.14103	0.313000	0.20887	ACC	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	43	0	G	NM_024690		9077073	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	68.97	9	20	SNP	0.000	A
MUC16	94025	genome.wustl.edu	37	19	9083902	9083902	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:9083902G>T	ENST00000397910.4	-	1	8116	c.7913C>A	c.(7912-7914)gCt>gAt	p.A2638D		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2638	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGGGAAGGAAGCTCCAGACAG	0.483																																																	0													52.0	52.0	52.0					19																	9083902		1952	4147	6099	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7913C>A	19.37:g.9083902G>T	ENSP00000381008:p.Ala2638Asp		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.A2638D	ENST00000397910.4	37	c.7913	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.529	-0.544748	0.04024	.	.	ENSG00000181143	ENST00000397910	T	0.02812	4.15	0.235	0.235	0.15431	.	.	.	.	.	T	0.01523	0.0049	N	0.08118	0	.	.	.	P	0.35208	0.49	B	0.28991	0.097	T	0.43065	-0.9414	7	0.87932	D	0	.	.	.	.	.	2638	B5ME49	.	D	2638	ENSP00000381008:A2638D	ENSP00000381008:A2638D	A	-	2	0	MUC16	8944902	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.195000	0.09546	0.308000	0.22923	0.313000	0.20887	GCT	MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	30	0	G	NM_024690		9083902	-1			no_errors	ENST00000397910	ensembl	human	known	74_37	missense	12.50	21	3	SNP	0.002	T
MYH13	8735	genome.wustl.edu	37	17	10212569	10212569	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:10212569C>T	ENST00000418404.3	-	34	5314	c.5151G>A	c.(5149-5151)gtG>gtA	p.V1717V	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Silent_p.V1717V			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1717					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						GCAGGAGCTGCACGCGGTCGC	0.667																																																	0													21.0	22.0	22.0					17																	10212569		2070	4188	6258	SO:0001819	synonymous_variant	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5151G>A	17.37:g.10212569C>T			O95252|Q9P0U8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1717	ENST00000418404.3	37	c.5151	CCDS45613.1	17																																																																																			MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.667	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1		0.00	25	0	C	NM_003802		10212569	-1			no_errors	ENST00000252172	ensembl	human	known	74_37	silent	16.67	15	3	SNP	1.000	T
MYH7	4625	genome.wustl.edu	37	14	23902923	23902923	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:23902923C>A	ENST00000355349.3	-	3	181	c.19G>T	c.(19-21)Gca>Tca	p.A7S		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	7					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CCAAAGACTGCCATCTCCGAA	0.607																																																	0													49.0	50.0	50.0					14																	23902923		2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.19G>T	14.37:g.23902923C>A	ENSP00000347507:p.Ala7Ser		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A7S	ENST00000355349.3	37	c.19	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	8.567	0.879213	0.17395	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.85258	-1.96	4.11	3.2	0.36748	.	.	.	.	.	T	0.70116	0.3187	N	0.11131	0.1	0.53005	D	0.999963	B	0.02656	0.0	B	0.15484	0.013	T	0.59658	-0.7413	9	0.15066	T	0.55	.	12.8838	0.58032	0.1646:0.8354:0.0:0.0	.	7	P12883	MYH7_HUMAN	S	7	ENSP00000347507:A7S	ENSP00000347507:A7S	A	-	1	0	MYH7	22972763	1.000000	0.71417	0.958000	0.39756	0.276000	0.26787	1.056000	0.30480	0.801000	0.34066	0.555000	0.69702	GCA	MYH7	-	NULL	ENSG00000092054		0.607	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3		0.00	38	0	C	NM_000257		23902923	-1			no_errors	ENST00000355349	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	A
MYLK2	85366	genome.wustl.edu	37	20	30414661	30414661	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:30414661G>C	ENST00000375994.2	+	7	1417	c.1144G>C	c.(1144-1146)Gac>Cac	p.D382H	MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_Missense_Mutation_p.D382H			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2	382	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GACCGAGGTGGACACCATGGT	0.577																																																	0													157.0	124.0	135.0					20																	30414661		2203	4300	6503	SO:0001583	missense	0			AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.1144G>C	20.37:g.30414661G>C	ENSP00000365162:p.Asp382His		Q569L1|Q96I84	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D382H	ENST00000375994.2	37	c.1144	CCDS13191.1	20	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007489	0.75046	.	.	ENSG00000101306	ENST00000375994;ENST00000375985	T;T	0.66099	-0.19;-0.19	3.66	3.66	0.41972	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.70535	0.3235	L	0.39514	1.22	0.80722	D	1	D	0.65815	0.995	D	0.71184	0.972	T	0.74785	-0.3547	9	0.87932	D	0	.	14.5797	0.68278	0.0:0.0:1.0:0.0	.	382	Q9H1R3	MYLK2_HUMAN	H	382	ENSP00000365162:D382H;ENSP00000365152:D382H	ENSP00000365152:D382H	D	+	1	0	MYLK2	29878322	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.494000	0.97962	1.882000	0.54519	0.435000	0.28638	GAC	MYLK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000101306		0.577	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	HGNC	protein_coding	OTTHUMT00000078583.2	-	0.00	58	0	G	NM_033118		30414661	+1	tier1	-	no_errors	ENST00000375985	ensembl	human	known	74_37	missense	27.14	51	19	SNP	1.000	C
MYO6	4646	genome.wustl.edu	37	6	76602247	76602247	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:76602247G>T	ENST00000369977.3	+	28	3086	c.2947G>T	c.(2947-2949)Gct>Tct	p.A983S	MYO6_ENST00000369985.4_Splice_Site_p.A983S|MYO6_ENST00000369981.3_Splice_Site_p.A983S|MYO6_ENST00000369975.1_Splice_Site_p.A983S	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	983	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		CCCTTGTCAGGCTGAAGTGGA	0.517																																																	0													100.0	111.0	107.0					6																	76602247		2203	4300	6503	SO:0001630	splice_region_variant	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2947-1G>T	6.37:g.76602247G>T			A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.A983S	ENST00000369977.3	37	c.2947	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417414	0.42918	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975;ENST00000430435	T;T;T;T;T	0.20738	2.23;2.05;2.05;2.23;2.05	5.75	5.75	0.90469	.	0.367115	0.30060	N	0.010502	T	0.22437	0.0541	M	0.63843	1.955	0.58432	D	0.999999	B;P	0.36768	0.058;0.569	B;B	0.43623	0.037;0.425	T	0.01065	-1.1463	9	.	.	.	.	19.9312	0.97120	0.0:0.0:1.0:0.0	.	983;983	Q9UM54-2;Q9UM54-1	.;.	S	983;983;983;983;983;46	ENSP00000358998:A983S;ENSP00000359002:A983S;ENSP00000358994:A983S;ENSP00000358992:A983S;ENSP00000399406:A46S	.	A	+	1	0	MYO6	76658967	1.000000	0.71417	0.998000	0.56505	0.869000	0.49853	5.358000	0.66064	2.720000	0.93068	0.491000	0.48974	GCT	MYO6	-	NULL	ENSG00000196586		0.517	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	-	0.00	61	0	G	NM_004999	Missense_Mutation	76602247	+1	tier1	-	no_errors	ENST00000369981	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
MYRF	745	genome.wustl.edu	37	11	61541497	61541497	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:61541497G>A	ENST00000278836.5	+	8	1270	c.1174G>A	c.(1174-1176)Gac>Aac	p.D392N	MYRF_ENST00000265460.5_Missense_Mutation_p.D383N|TMEM258_ENST00000535042.1_5'UTR|MYRF_ENST00000327797.1_Missense_Mutation_p.D19N	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	392					central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D383N(1)									GGTGGGCGACGACGCCTTTGT	0.642																																																	1	Substitution - Missense(1)	large_intestine(1)											80.0	67.0	72.0					11																	61541497		2202	4299	6501	SO:0001583	missense	0				CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1174G>A	11.37:g.61541497G>A	ENSP00000278836:p.Asp392Asn		O43582|Q9P1Q6	Missense_Mutation	SNP	pfam_NDT80_DNA-bd_dom,superfamily_p53-like_TF_DNA-bd	p.D392N	ENST00000278836.5	37	c.1174	CCDS44622.1	11	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066422	0.76187	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000327797	T;T;T	0.42131	1.55;1.55;0.98	4.43	4.43	0.53597	NDT80 DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);	0.124581	0.56097	D	0.000023	T	0.43389	0.1245	L	0.59436	1.845	0.80722	D	1	P;B	0.42357	0.777;0.414	B;B	0.40444	0.329;0.126	T	0.45071	-0.9286	10	0.39692	T	0.17	-27.6325	17.6067	0.88040	0.0:0.0:1.0:0.0	.	383;392	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	N	392;383;19	ENSP00000278836:D392N;ENSP00000265460:D383N;ENSP00000333261:D19N	ENSP00000265460:D383N	D	+	1	0	C11orf9	61298073	1.000000	0.71417	0.971000	0.41717	0.525000	0.34531	9.204000	0.95041	2.484000	0.83849	0.462000	0.41574	GAC	MYRF	-	superfamily_p53-like_TF_DNA-bd	ENSG00000124920		0.642	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYRF	HGNC	protein_coding	OTTHUMT00000398519.2		0.00	43	0	G	NM_013279		61541497	+1			no_errors	ENST00000278836	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
MYO7A	4647	genome.wustl.edu	37	11	76924905	76924905	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:76924905G>T	ENST00000409709.3	+	48	6711	c.6439G>T	c.(6439-6441)Gat>Tat	p.D2147Y	MYO7A_ENST00000605744.1_3'UTR|MYO7A_ENST00000409619.2_Splice_Site_p.D2098Y|MYO7A_ENST00000458637.2_Splice_Site_p.D2107Y	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	2147	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GCTCCCCCAGGATATCCTCAC	0.597																																																	0													117.0	123.0	121.0					11																	76924905		2100	4204	6304	SO:0001630	splice_region_variant	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.6439-1G>T	11.37:g.76924905G>T			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.D2147Y	ENST00000409709.3	37	c.6439	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458947	0.84317	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169	T;T;T;T	0.74737	-0.87;-0.87;-0.87;-0.87	5.87	5.87	0.94306	FERM domain (1);Pleckstrin homology-type (1);	0.137974	0.64402	D	0.000005	D	0.85796	0.5780	M	0.79475	2.455	0.80722	D	1	D;P	0.55385	0.971;0.913	P;P	0.61003	0.882;0.832	D	0.84824	0.0798	9	.	.	.	.	20.2227	0.98327	0.0:0.0:1.0:0.0	.	2107;2147	F8VUN5;Q13402	.;MYO7A_HUMAN	Y	2147;2107;2098;1320;2146;2116;2023;1289	ENSP00000386331:D2147Y;ENSP00000392185:D2107Y;ENSP00000386635:D2098Y;ENSP00000417017:D1289Y	.	D	+	1	0	MYO7A	76602553	1.000000	0.71417	1.000000	0.80357	0.736000	0.42039	9.476000	0.97823	2.778000	0.95560	0.650000	0.86243	GAT	MYO7A	-	pfscan_FERM_domain	ENSG00000137474		0.597	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1		0.00	72	0	G	NM_000260	Missense_Mutation	76924905	+1			no_errors	ENST00000409709	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
N4BP2	55728	genome.wustl.edu	37	4	40124821	40124821	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:40124821G>T	ENST00000261435.6	+	10	4689	c.4273G>T	c.(4273-4275)Gaa>Taa	p.E1425*		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	1425					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						GAAATGGAAAGAATCTGTAAT	0.383																																																	0													130.0	134.0	133.0					4																	40124821		2203	4300	6503	SO:0001587	stop_gained	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.4273G>T	4.37:g.40124821G>T	ENSP00000261435:p.Glu1425*		A0AVR3|Q9NVK2|Q9P2D4	Nonsense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.E1425*	ENST00000261435.6	37	c.4273	CCDS3457.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.150654|7.150654	0.98096|0.98096	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000261435;ENST00000381804|ENST00000513269	.|.	.|.	.|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.195639|.	0.44097|.	D|.	0.000498|.	.|T	.|0.75939	.|0.3918	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74881	.|-0.3513	.|3	0.72032|.	D|.	0.01|.	-12.6705|-12.6705	19.0678|19.0678	0.93119|0.93119	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|I	1425;1345|1071	.|.	ENSP00000261435:E1425X|.	E|R	+|+	1|2	0|0	N4BP2|N4BP2	39801216|39801216	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.253000|0.253000	0.25986|0.25986	8.444000|8.444000	0.90323|0.90323	2.494000|2.494000	0.84150|0.84150	0.591000|0.591000	0.81541|0.81541	GAA|AGA	N4BP2	-	NULL	ENSG00000078177		0.383	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2		0.00	78	0	G	NM_018177		40124821	+1			no_errors	ENST00000261435	ensembl	human	known	74_37	nonsense	5.08	56	3	SNP	1.000	T
NAV1	89796	genome.wustl.edu	37	1	201618308	201618308	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:201618308C>T	ENST00000367296.4	+	1	932	c.512C>T	c.(511-513)cCg>cTg	p.P171L	NAV1_ENST00000367300.3_Missense_Mutation_p.P171L|NAV1_ENST00000367302.1_Missense_Mutation_p.P184L|NAV1_ENST00000295624.6_Missense_Mutation_p.P171L|NAV1_ENST00000367297.4_Missense_Mutation_p.P171L	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	171					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CTGGGAAAGCCGAGCCGGATC	0.687																																																	0													16.0	21.0	20.0					1																	201618308		2192	4297	6489	SO:0001583	missense	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.512C>T	1.37:g.201618308C>T	ENSP00000356265:p.Pro171Leu		A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P171L	ENST00000367296.4	37	c.512	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.219444	0.79464	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	4.74	4.74	0.60224	.	0.071450	0.56097	D	0.000024	T	0.53610	0.1807	L	0.47716	1.5	0.58432	D	0.999995	D	0.67145	0.996	P	0.57548	0.823	T	0.58115	-0.7693	10	0.66056	D	0.02	-23.1116	17.3345	0.87276	0.0:1.0:0.0:0.0	.	171	Q8NEY1-3	.	L	184;171;171;171;171	ENSP00000356271:P184L;ENSP00000356265:P171L;ENSP00000295624:P171L;ENSP00000356266:P171L;ENSP00000356269:P171L	ENSP00000295624:P171L	P	+	2	0	NAV1	199884931	0.748000	0.28294	0.998000	0.56505	0.875000	0.50365	1.348000	0.33987	2.180000	0.69256	0.313000	0.20887	CCG	NAV1	-	NULL	ENSG00000134369		0.687	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	-	0.00	55	0	C	NM_020443		201618308	+1	tier1	-	no_errors	ENST00000367296	ensembl	human	known	74_37	missense	55.56	12	15	SNP	1.000	T
NCAM1	4684	genome.wustl.edu	37	11	113078610	113078610	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:113078610G>A	ENST00000533760.1	+	7	1047	c.448G>A	c.(448-450)Gat>Aat	p.D150N	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000401611.2_Missense_Mutation_p.D267N|NCAM1_ENST00000316851.7_Missense_Mutation_p.D258N	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	268	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CTTCAGCGACGATAGTTCCCA	0.483																																																	0													74.0	73.0	74.0					11																	113078610		2026	4188	6214	SO:0001583	missense	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.448G>A	11.37:g.113078610G>A	ENSP00000473281:p.Asp150Asn		A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.D258N	ENST00000533760.1	37	c.772		11	.	.	.	.	.	.	.	.	.	.	G	18.88	3.717222	0.68844	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.66815	-0.23;-0.23	5.71	5.71	0.89125	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.83027	0.5165	.	.	.	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.997;0.997;1.0;0.998;0.979	T	0.82500	-0.0426	9	0.48119	T	0.1	-27.8279	19.8599	0.96779	0.0:0.0:1.0:0.0	.	268;268;268;268;268	P13591-5;P13591-1;P13591;P13591-3;P13591-6	.;.;NCAM1_HUMAN;.;.	N	150;267;258	ENSP00000384055:D267N;ENSP00000318472:D258N	ENSP00000318472:D258N	D	+	1	0	NCAM1	112583820	1.000000	0.71417	0.942000	0.38095	0.195000	0.23768	9.362000	0.97126	2.710000	0.92621	0.655000	0.94253	GAT	NCAM1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149294		0.483	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	NCAM1	HGNC	protein_coding	OTTHUMT00000394068.2	-	0.00	30	0	G	NM_000615		113078610	+1	tier1	-	no_errors	ENST00000316851	ensembl	human	known	74_37	missense	28.57	20	8	SNP	1.000	A
NCKAP5	344148	genome.wustl.edu	37	2	133489333	133489333	+	Missense_Mutation	SNP	C	C	T	rs373366099	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:133489333C>T	ENST00000409261.1	-	17	5793	c.5420G>A	c.(5419-5421)cGc>cAc	p.R1807H	NCKAP5_ENST00000409213.1_Missense_Mutation_p.R488H|NCKAP5_ENST00000317721.6_Missense_Mutation_p.R1807H|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Missense_Mutation_p.R488H	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1807								p.R327H(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TTTGGGGAGGCGGCTCTGAAG	0.517													C|||	2	0.000399361	0.0	0.0	5008	,	,		19407	0.0		0.0	False		,,,				2504	0.002																1	Substitution - Missense(1)	liver(1)											57.0	60.0	59.0					2																	133489333		1935	4140	6075	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5420G>A	2.37:g.133489333C>T	ENSP00000387128:p.Arg1807His		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.R1807H	ENST00000409261.1	37	c.5420	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	C	9.915	1.210718	0.22289	.	.	ENSG00000176771	ENST00000409261;ENST00000409213;ENST00000317721;ENST00000405974;ENST00000537661	T;T;T;T	0.51325	2.72;0.71;2.72;0.71	5.43	-0.481	0.12082	.	0.245826	0.20275	N	0.095597	T	0.20941	0.0504	N	0.11560	0.145	0.22811	N	0.9987	B;B	0.18741	0.017;0.03	B;B	0.16722	0.003;0.016	T	0.14172	-1.0482	10	0.20046	T	0.44	.	4.7406	0.13010	0.3618:0.4484:0.0:0.1898	.	488;1807	O14513-2;O14513	.;NCKP5_HUMAN	H	1807;488;1807;488;488	ENSP00000387128:R1807H;ENSP00000386952:R488H;ENSP00000380603:R1807H;ENSP00000385692:R488H	ENSP00000380603:R1807H	R	-	2	0	NCKAP5	133205803	0.579000	0.26725	0.689000	0.30133	0.747000	0.42532	-0.287000	0.08388	-0.270000	0.09285	-0.142000	0.14014	CGC	NCKAP5	-	NULL	ENSG00000176771		0.517	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	74	0	C	NM_207481		133489333	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	21.69	64	18	SNP	0.996	T
NCKAP5	344148	genome.wustl.edu	37	2	133540076	133540076	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:133540076A>G	ENST00000409261.1	-	14	4681	c.4308T>C	c.(4306-4308)acT>acC	p.T1436T	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Silent_p.T1436T|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1436										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						TTGTTTCAAAAGTGCTTGGAT	0.572																																																	0													48.0	49.0	49.0					2																	133540076		1944	4135	6079	SO:0001819	synonymous_variant	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4308T>C	2.37:g.133540076A>G			B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	NULL	p.T1436	ENST00000409261.1	37	c.4308	CCDS46418.1	2																																																																																			NCKAP5	-	NULL	ENSG00000176771		0.572	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	35	0	A	NM_207481		133540076	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	silent	29.73	26	11	SNP	0.033	G
NDNF	79625	genome.wustl.edu	37	4	121958330	121958330	+	Missense_Mutation	SNP	G	G	A	rs201775943		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:121958330G>A	ENST00000379692.4	-	4	1322	c.796C>T	c.(796-798)Cgc>Tgc	p.R266C	NDNF_ENST00000506900.1_5'UTR	NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	266	Fibronectin type-III 1.				cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						TGGAAACTGCGTTCTTTACCT	0.453																																																	0								G	CYS/ARG	0,4406		0,0,2203	86.0	86.0	86.0		796	4.9	0.3	4		86	2,8598	2.2+/-6.3	0,2,4298	no	missense	NDNF	NM_024574.3	180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	266/569	121958330	2,13004	2203	4300	6503	SO:0001583	missense	0			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.796C>T	4.37:g.121958330G>A	ENSP00000369014:p.Arg266Cys		A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.R266C	ENST00000379692.4	37	c.796	CCDS3717.2	4	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840538	0.32513	0.0	2.33E-4	ENSG00000173376	ENST00000379692	.	.	.	5.77	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.68483	0.958	T	0.78473	-0.2190	9	0.66056	D	0.02	-11.6756	16.2534	0.82498	0.0:0.0:0.8669:0.1331	.	266	Q8TB73	NDNF_HUMAN	C	266	.	ENSP00000369014:R266C	R	-	1	0	NDNF	122177780	1.000000	0.71417	0.318000	0.25279	0.032000	0.12392	6.107000	0.71517	2.715000	0.92844	0.655000	0.94253	CGC	NDNF	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000173376		0.453	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNF	HGNC	protein_coding	OTTHUMT00000256532.2	-	0.00	31	0	G	NM_024574		121958330	-1	tier1	-	no_errors	ENST00000379692	ensembl	human	known	74_37	missense	30.00	14	6	SNP	0.971	A
NIN	51199	genome.wustl.edu	37	14	51194411	51194411	+	Intron	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:51194411A>G	ENST00000382041.3	-	30	6269				NIN_ENST00000245441.5_Intron|NIN_ENST00000530997.2_Intron|NIN_ENST00000382043.4_Intron|NIN_ENST00000453196.1_Missense_Mutation_p.L2046P|NIN_ENST00000389868.3_Intron|NIN_ENST00000324330.9_Intron	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)						centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CAGTTTTCACAGGTGCCCAAT	0.507			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													122.0	127.0	125.0					14																	51194411		2169	4277	6446	SO:0001627	intron_variant	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.6079-1627T>C	14.37:g.51194411A>G			A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.L2046P	ENST00000382041.3	37	c.6137	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	A	17.17	3.322184	0.60634	.	.	ENSG00000100503	ENST00000453196	T	0.11821	2.74	4.45	3.32	0.38043	.	.	.	.	.	T	0.08133	0.0203	N	0.08118	0	0.80722	D	1	B	0.28552	0.215	B	0.32022	0.139	T	0.24048	-1.0171	9	0.87932	D	0	.	9.7476	0.40457	0.9172:0.0:0.0828:0.0	.	2046	C9J066	.	P	2046	ENSP00000412391:L2046P	ENSP00000412391:L2046P	L	-	2	0	NIN	50264161	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.441000	0.66569	1.040000	0.40099	0.533000	0.62120	CTG	NIN	-	NULL	ENSG00000100503		0.507	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	-	0.00	47	0	A	NM_182946		51194411	-1	tier1	-	no_errors	ENST00000453196	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	G
NKX2-5	1482	genome.wustl.edu	37	5	172659978	172659978	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:172659978C>T	ENST00000329198.4	-	2	842	c.569G>A	c.(568-570)cGc>cAc	p.R190H	NKX2-5_ENST00000424406.2_3'UTR|NKX2-5_ENST00000521848.1_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	190			R -> C (in ASD7). {ECO:0000269|PubMed:15810002}.		adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GCACTTGTAGCGCCGGTTCTG	0.687																																					Esophageal Squamous(72;810 1219 2387 13420 44943)												0			GRCh37	CM044906	NKX2-5	M							17.0	16.0	16.0					5																	172659978		2202	4298	6500	SO:0001583	missense	0			AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.569G>A	5.37:g.172659978C>T	ENSP00000327758:p.Arg190His		A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.R190H	ENST00000329198.4	37	c.569	CCDS4387.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.197203	0.94960	.	.	ENSG00000183072	ENST00000329198	D	0.99158	-5.5	4.23	4.23	0.50019	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.53938	D	0.000051	D	0.99674	0.9878	H	0.99697	4.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96894	0.9655	10	0.87932	D	0	.	16.8019	0.85616	0.0:1.0:0.0:0.0	.	190	P52952	NKX25_HUMAN	H	190	ENSP00000327758:R190H	ENSP00000327758:R190H	R	-	2	0	NKX2-5	172592584	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.624000	0.83124	2.203000	0.70933	0.462000	0.41574	CGC	NKX2-5	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	ENSG00000183072		0.687	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-5	HGNC	protein_coding	OTTHUMT00000252942.2	-	0.00	57	0	C			172659978	-1	tier1	-	no_errors	ENST00000329198	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	T
NOX4	50507	genome.wustl.edu	37	11	89088130	89088130	+	Splice_Site	SNP	T	T	C	rs575738113		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:89088130T>C	ENST00000263317.4	-	13	1455	c.1217A>G	c.(1216-1218)aAg>aGg	p.K406R	NOX4_ENST00000375979.3_Splice_Site_p.K99R|NOX4_ENST00000424319.1_Splice_Site_p.K382R|NOX4_ENST00000531342.1_Splice_Site_p.K99R|NOX4_ENST00000542487.1_Splice_Site_p.K382R|NOX4_ENST00000535633.1_Splice_Site_p.K382R|NOX4_ENST00000527626.1_Splice_Site_p.K240R|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000528341.1_Splice_Site_p.K381R|NOX4_ENST00000534731.1_Splice_Site_p.K406R|NOX4_ENST00000527956.1_Splice_Site_p.K382R|NOX4_ENST00000343727.5_Splice_Site_p.K382R|NOX4_ENST00000532825.1_Splice_Site_p.K382R|NOX4_ENST00000413594.2_Splice_Site_p.K427R			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	406	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TTTTGCTTACTTGGGATAATT	0.383																																																	0													47.0	49.0	49.0					11																	89088130		2201	4299	6500	SO:0001630	splice_region_variant	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1217+1A>G	11.37:g.89088130T>C			A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.K427R	ENST00000263317.4	37	c.1280	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	T	14.87	2.663082	0.47572	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D	0.95342	-3.01;-3.01;-3.01;-3.59;-3.01;-3.68;-3.01;-3.01;-3.01;-3.01;-3.01;-3.09;-3.46	5.31	5.31	0.75309	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.050645	0.85682	D	0.000000	D	0.94525	0.8237	L	0.33753	1.03	0.46167	D	0.998906	B;B;B;P;B;B;B	0.49696	0.382;0.048;0.178;0.927;0.148;0.287;0.339	B;B;B;D;B;B;B	0.67725	0.306;0.066;0.115;0.953;0.048;0.1;0.161	D	0.93435	0.6789	9	.	.	.	-9.5277	11.6681	0.51385	0.0:0.0:0.0:1.0	.	382;240;381;99;99;406;406	E9PMY6;E9PR43;E9PPP2;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;NOX4_HUMAN	R	382;382;382;406;406;382;382;382;240;381;427;99;99	ENSP00000412446:K382R;ENSP00000440172:K382R;ENSP00000344747:K382R;ENSP00000436892:K406R;ENSP00000263317:K406R;ENSP00000434924:K382R;ENSP00000433797:K382R;ENSP00000439373:K382R;ENSP00000436093:K240R;ENSP00000436970:K381R;ENSP00000405705:K427R;ENSP00000435039:K99R;ENSP00000365146:K99R	.	K	-	2	0	NOX4	88727778	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	4.228000	0.58619	2.007000	0.58848	0.460000	0.39030	AAG	NOX4	-	pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	ENSG00000086991		0.383	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	-	0.00	114	0	T	NM_016931	Missense_Mutation	89088130	-1	tier1	-	no_errors	ENST00000413594	ensembl	human	known	74_37	missense	49.32	37	36	SNP	1.000	C
NOX5	79400	genome.wustl.edu	37	15	69341356	69341356	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:69341356C>T	ENST00000388866.3	+	14	1998	c.1957C>T	c.(1957-1959)Ctg>Ttg	p.L653L	NOX5_ENST00000448182.3_Silent_p.L607L|NOX5_ENST00000455873.3_Silent_p.L618L|NOX5_ENST00000530406.2_Silent_p.L625L|NOX5_ENST00000525163.1_3'UTR|NOX5_ENST00000260364.5_Silent_p.L635L	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	653					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						TGTGAGCCTGCTGACTAAACT	0.572																																																	0													62.0	56.0	58.0					15																	69341356		2200	4298	6498	SO:0001819	synonymous_variant	0			AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1957C>T	15.37:g.69341356C>T			B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_dom,pfscan_EF_hand_dom	p.L653	ENST00000388866.3	37	c.1957	CCDS32276.2	15																																																																																			NOX5	-	pfam_Fe_red_NAD-bd_6	ENSG00000255346		0.572	NOX5-003	KNOWN	basic|CCDS	protein_coding	NOX5	HGNC	protein_coding	OTTHUMT00000257124.2	-	0.00	40	0	C	NM_024505		69341356	+1	tier1	-	no_errors	ENST00000388866	ensembl	human	known	74_37	silent	8.33	44	4	SNP	1.000	T
NPTN	27020	genome.wustl.edu	37	15	73889549	73889549	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:73889549G>A	ENST00000345330.4	-	2	450	c.253C>T	c.(253-255)Cgc>Tgc	p.R85C	NPTN_ENST00000563691.1_Missense_Mutation_p.R85C|NPTN_ENST00000351217.6_Intron|NPTN_ENST00000545878.1_Missense_Mutation_p.R85C|NPTN_ENST00000542234.1_Intron|NPTN_ENST00000564551.1_Intron|NPTN_ENST00000287226.8_Missense_Mutation_p.R85C|NPTN_ENST00000562924.1_Intron	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	85	Ig-like 1.				homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						GTGACACGGCGCTTCCGAGCA	0.612																																					Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)												0													120.0	97.0	105.0					15																	73889549		2198	4297	6495	SO:0001583	missense	0			AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.253C>T	15.37:g.73889549G>A	ENSP00000290401:p.Arg85Cys		B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_MFS_dom_general_subst_transpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R85C	ENST00000345330.4	37	c.253	CCDS10249.1	15	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497411	0.85069	.	.	ENSG00000156642	ENST00000345330;ENST00000545878;ENST00000287226	T;T;T	0.66638	-0.22;-0.22;-0.22	5.61	5.61	0.85477	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.84056	0.5388	M	0.86268	2.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.69824	0.942;0.966	D	0.84312	0.0511	10	0.49607	T	0.09	.	20.0018	0.97417	0.0:0.0:1.0:0.0	.	85;85	Q9Y639-5;Q9Y639	.;NPTN_HUMAN	C	85	ENSP00000290401:R85C;ENSP00000444548:R85C;ENSP00000287226:R85C	ENSP00000287226:R85C	R	-	1	0	NPTN	71676602	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.695000	0.98691	2.793000	0.96121	0.655000	0.94253	CGC	NPTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000156642		0.612	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPTN	HGNC	protein_coding	OTTHUMT00000268980.1	-	0.00	48	0	G	NM_012428		73889549	-1	tier1	-	no_errors	ENST00000345330	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	A
NRSN1	140767	genome.wustl.edu	37	6	24146173	24146173	+	Nonstop_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:24146173G>T	ENST00000378491.4	+	4	888	c.587G>T	c.(586-588)tGa>tTa	p.*196L		NM_080723.4	NP_542454.3			neurensin 1											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						CTGGCAACCTGAAACCTTTCC	0.498																																																	0													56.0	63.0	61.0					6																	24146173		2203	4300	6503	SO:0001578	stop_lost	0			AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.587G>T	6.37:g.24146173G>T	ENSP00000367752:p.*196Leuext*16			Nonstop_Mutation	SNP	NULL	p.*196L	ENST00000378491.4	37	c.587	CCDS4549.1	6	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195101	0.38806	.	.	ENSG00000152954	ENST00000378491	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0813	0.93182	0.0:0.0:1.0:0.0	.	.	.	.	L	196	.	.	X	+	2	2	NRSN1	24254152	1.000000	0.71417	0.997000	0.53966	0.390000	0.30446	6.525000	0.73795	2.505000	0.84491	0.650000	0.86243	TGA	NRSN1	-	NULL	ENSG00000152954		0.498	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRSN1	HGNC	protein_coding	OTTHUMT00000043866.1	-	0.00	21	0	G	NM_080723		24146173	+1	tier1	-	no_errors	ENST00000378491	ensembl	human	known	74_37	nonstop	18.75	13	3	SNP	1.000	T
NUP88	4927	genome.wustl.edu	37	17	5302881	5302881	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:5302881G>T	ENST00000573584.1	-	8	1791	c.1282C>A	c.(1282-1284)Ctt>Att	p.L428I		NM_002532.4	NP_002523.2	Q99567	NUP88_HUMAN	nucleoporin 88kDa	428					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	transporter activity (GO:0005215)	p.L428I(1)		endometrium(4)|kidney(4)|large_intestine(4)|lung(3)	15						CCTGATCCAAGAAATTTGTGA	0.343																																																	1	Substitution - Missense(1)	large_intestine(1)											74.0	70.0	71.0					17																	5302881		2203	4300	6503	SO:0001583	missense	0			Y08612	CCDS11070.1	17p13	2004-02-18	2002-08-29		ENSG00000108559	ENSG00000108559			8067	protein-coding gene	gene with protein product		602552	"""nucleoporin 88kD"""			9049309	Standard	NM_002532		Approved	MGC8530	uc002gbo.2	Q99567	OTTHUMG00000099453	ENST00000573584.1:c.1282C>A	17.37:g.5302881G>T	ENSP00000458954:p.Leu428Ile		D3DTM2|Q9BWE5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup88	p.L428I	ENST00000573584.1	37	c.1282	CCDS11070.1	17	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022303	0.54683	.	.	ENSG00000108559	ENST00000225696;ENST00000543132	.	.	.	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.75591	0.3870	L	0.59436	1.845	0.58432	D	0.999993	P;B;D	0.69078	0.476;0.288;0.997	B;B;D	0.85130	0.159;0.069;0.997	T	0.74420	-0.3671	9	0.39692	T	0.17	-0.711	16.987	0.86342	0.0:0.0:1.0:0.0	.	428;297;428	B7Z5I6;B4DP20;Q99567	.;.;NUP88_HUMAN	I	428;297	.	ENSP00000225696:L428I	L	-	1	0	NUP88	5243605	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.784000	0.75084	2.580000	0.87095	0.460000	0.39030	CTT	NUP88	-	pfam_Nucleoporin_Nup88	ENSG00000108559		0.343	NUP88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP88	HGNC	protein_coding	OTTHUMT00000216918.3		0.00	50	0	G	NM_002532		5302881	-1			no_errors	ENST00000573584	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
OBP2A	29991	genome.wustl.edu	37	9	138439069	138439069	+	Silent	SNP	G	G	A	rs372804933		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:138439069G>A	ENST00000539850.1	+	3	278	c.252G>A	c.(250-252)acG>acA	p.T84T	OBP2A_ENST00000371776.1_Silent_p.T84T|OBP2A_ENST00000342114.4_Missense_Mutation_p.G40R|OBP2A_ENST00000340780.3_Silent_p.T84T			Q9NY56	OBP2A_HUMAN	odorant binding protein 2A	84					response to stimulus (GO:0050896)|sensory perception of chemical stimulus (GO:0007606)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		TGCGGAAGACGGAGGAGCCTG	0.642																																																	0								G		0,4406		0,0,2203	92.0	85.0	87.0		252	-5.1	0.0	9		87	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	OBP2A	NM_014582.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		84/171	138439069	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ251029	CCDS6992.1	9q34	2014-01-22			ENSG00000122136	ENSG00000122136		"""Lipocalins"""	23380	protein-coding gene	gene with protein product		164320					Standard	NM_014582		Approved	hOBPIIa, OBP, LCN13	uc004cgb.3	Q9NY56	OTTHUMG00000020909	ENST00000539850.1:c.252G>A	9.37:g.138439069G>A			Q5T8A3|Q9NY50|Q9NY53|Q9NY54|Q9NY55	Missense_Mutation	SNP	superfamily_Calycin-like	p.G40R	ENST00000539850.1	37	c.118	CCDS6992.1	9	.	.	.	.	.	.	.	.	.	.	g	11.45	1.642606	0.29246	0.0	1.16E-4	ENSG00000122136	ENST00000342114	T	0.09445	2.98	2.55	-5.1	0.02911	.	.	.	.	.	T	0.07052	0.0179	.	.	.	0.09310	N	1	B	0.22604	0.072	B	0.14578	0.011	T	0.34650	-0.9820	8	0.72032	D	0.01	-24.9717	6.2004	0.20573	0.2341:0.5311:0.2348:0.0	.	40	Q5T8A4	.	R	40	ENSP00000340950:G40R	ENSP00000340950:G40R	G	+	1	0	OBP2A	137578890	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.063000	0.00302	-1.273000	0.02424	-0.532000	0.04303	GGA	OBP2A	-	NULL	ENSG00000122136		0.642	OBP2A-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	OBP2A	HGNC	protein_coding	OTTHUMT00000397904.1	-	0.00	207	0	G	NM_014582		138439069	+1	tier1	-	no_errors	ENST00000342114	ensembl	human	known	74_37	missense	27.27	120	45	SNP	0.000	A
OBSCN	84033	genome.wustl.edu	37	1	228468108	228468108	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:228468108C>T	ENST00000422127.1	+	29	7936	c.7892C>T	c.(7891-7893)tCc>tTc	p.S2631F	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.S2631F|OBSCN_ENST00000570156.2_Missense_Mutation_p.S3060F|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000359599.6_Missense_Mutation_p.S1478F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2631	Ig-like 25.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGCGCCTCCTCCCTGAAGGTG	0.627																																																	0													33.0	37.0	36.0					1																	228468108		2110	4207	6317	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.7892C>T	1.37:g.228468108C>T	ENSP00000409493:p.Ser2631Phe		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.S2631F	ENST00000422127.1	37	c.7892	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	c	9.052	0.992325	0.18966	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T	0.39229	1.09;1.09;1.09	5.3	5.3	0.74995	Immunoglobulin-like fold (1);	0.167336	0.42294	D	0.000730	T	0.58623	0.2135	L	0.60455	1.87	0.37480	D	0.915943	D;D;D	0.76494	0.999;0.993;0.999	D;P;D	0.71184	0.972;0.906;0.966	T	0.63220	-0.6686	10	0.49607	T	0.09	.	13.3023	0.60332	0.0:0.9238:0.0:0.0762	.	2631;2631;2631	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	F	2631;2631;1478;330;37	ENSP00000284548:S2631F;ENSP00000409493:S2631F;ENSP00000352613:S1478F	ENSP00000284548:S2631F	S	+	2	0	OBSCN	226534731	0.988000	0.35896	0.049000	0.19019	0.004000	0.04260	3.262000	0.51538	2.484000	0.83849	0.550000	0.68814	TCC	OBSCN	-	smart_Ig_sub	ENSG00000154358		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	63	0	C	NM_052843		228468108	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	20.00	32	8	SNP	0.032	T
OBSCN	84033	genome.wustl.edu	37	1	228509131	228509131	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:228509131C>A	ENST00000422127.1	+	55	14633	c.14589C>A	c.(14587-14589)agC>agA	p.S4863R	OBSCN_ENST00000366707.4_Missense_Mutation_p.S2497R|OBSCN_ENST00000284548.11_Missense_Mutation_p.S4863R|OBSCN_ENST00000570156.2_Missense_Mutation_p.S5820R|OBSCN_ENST00000366709.4_Missense_Mutation_p.S1982R	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4863					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGACCTGAGCACCAAAGACC	0.612																																																	0													25.0	28.0	27.0					1																	228509131		2010	4168	6178	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.14589C>A	1.37:g.228509131C>A	ENSP00000409493:p.Ser4863Arg		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.S4863R	ENST00000422127.1	37	c.14589	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500694	0.44455	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.62105	0.46;0.05;0.09;0.61	5.1	-7.27	0.01461	.	1.638850	0.03167	N	0.170105	T	0.35913	0.0948	N	0.04508	-0.205	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.10450	0.002;0.005	T	0.32052	-0.9921	10	0.14252	T	0.57	.	12.2473	0.54578	0.0:0.6654:0.1288:0.2058	.	4863;4863	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	R	4863;4863;2497;1982	ENSP00000284548:S4863R;ENSP00000409493:S4863R;ENSP00000355668:S2497R;ENSP00000355670:S1982R	ENSP00000284548:S4863R	S	+	3	2	OBSCN	226575754	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-2.734000	0.00803	-1.274000	0.02421	-0.471000	0.05019	AGC	OBSCN	-	NULL	ENSG00000154358		0.612	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	46	0	C	NM_052843		228509131	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.001	A
OR10H1	26539	genome.wustl.edu	37	19	15918274	15918274	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:15918274C>A	ENST00000334920.2	-	1	662	c.574G>T	c.(574-576)Gat>Tat	p.D192Y		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						ACCAGCACATCGTCTCCACAG	0.577																																																	0													219.0	168.0	185.0					19																	15918274		2203	4300	6503	SO:0001583	missense	0			AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.574G>T	19.37:g.15918274C>A	ENSP00000335596:p.Asp192Tyr		Q6IFQ2|Q96R59	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D192Y	ENST00000334920.2	37	c.574	CCDS12335.1	19	.	.	.	.	.	.	.	.	.	.	.	8.737	0.917938	0.17982	.	.	ENSG00000186723	ENST00000334920	T	0.00099	8.73	4.61	-6.53	0.01866	GPCR, rhodopsin-like superfamily (1);	0.879604	0.09613	N	0.778662	T	0.00210	0.0006	N	0.19112	0.55	0.09310	N	1	P	0.44578	0.838	P	0.59948	0.866	T	0.30504	-0.9976	10	0.72032	D	0.01	.	12.8599	0.57908	0.0:0.4137:0.0:0.5863	.	192	Q9Y4A9	O10H1_HUMAN	Y	192	ENSP00000335596:D192Y	ENSP00000335596:D192Y	D	-	1	0	OR10H1	15779274	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.934000	0.03955	-1.325000	0.02269	-2.259000	0.00280	GAT	OR10H1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000186723		0.577	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H1	HGNC	protein_coding	OTTHUMT00000460364.1	-	0.00	96	0	C			15918274	-1	tier1	-	no_errors	ENST00000334920	ensembl	human	known	74_37	missense	75.34	18	55	SNP	0.000	A
OR13C8	138802	genome.wustl.edu	37	9	107332000	107332000	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:107332000C>T	ENST00000335040.1	+	1	552	c.552C>T	c.(550-552)atC>atT	p.I184I		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	184						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TTCTGGCTATCTTGAAACTGG	0.383																																																	0													173.0	168.0	170.0					9																	107332000		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.552C>T	9.37:g.107332000C>T			Q5VVG0|Q96R44	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I184	ENST00000335040.1	37	c.552	CCDS35090.1	9																																																																																			OR13C8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000186943		0.383	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C8	HGNC	protein_coding	OTTHUMT00000053480.1		0.00	47	0	C			107332000	+1			no_errors	ENST00000335040	ensembl	human	known	74_37	silent	6.45	26	2	SNP	0.000	T
OR13C5	138799	genome.wustl.edu	37	9	107360878	107360878	+	Missense_Mutation	SNP	A	A	C	rs141268591		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:107360878A>C	ENST00000374779.2	-	1	910	c.817T>G	c.(817-819)Ttg>Gtg	p.L273V		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	273						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L273M(1)		endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GTGGCATCCAAGTCATCTGAA	0.428																																																	1	Substitution - Missense(1)	large_intestine(1)											136.0	126.0	129.0					9																	107360878		2203	4300	6503	SO:0001583	missense	0				CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.817T>G	9.37:g.107360878A>C	ENSP00000363911:p.Leu273Val		B2RNE5|B9EGW5|Q6IF53	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L273V	ENST00000374779.2	37	c.817	CCDS35091.1	9	.	.	.	.	.	.	.	.	.	.	A	0.054	-1.241859	0.01493	.	.	ENSG00000255800	ENST00000374779	T	0.37235	1.21	3.14	-6.29	0.02013	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.12603	0.0306	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.12502	-1.0545	9	0.20519	T	0.43	.	1.7013	0.02873	0.1241:0.3406:0.1955:0.3397	.	273	Q8NGS8	O13C5_HUMAN	V	273	ENSP00000363911:L273V	ENSP00000363911:L273V	L	-	1	2	OR13C5	106400699	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.328000	0.07945	-3.187000	0.00220	0.347000	0.21830	TTG	OR13C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000255800		0.428	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C5	HGNC	protein_coding	OTTHUMT00000053479.2	-	0.00	58	0	A	NM_001004482		107360878	-1	tier1	-	no_errors	ENST00000374779	ensembl	human	known	74_37	missense	52.11	34	37	SNP	0.000	C
OR2L5	81466	genome.wustl.edu	37	1	248185569	248185569	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:248185569C>A	ENST00000355281.1	+	1	320	c.320C>A	c.(319-321)gCa>gAa	p.A107E	OR2L13_ENST00000366478.2_Intron	NM_001258284.1	NP_001245213.1	Q8NG80	OR2L5_HUMAN	olfactory receptor, family 2, subfamily L, member 5	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										ATGACTTTTGCAGGTGCAGAA	0.433																																																	0																																										SO:0001583	missense	0				CCDS58068.1	1q44	2012-08-09		2004-03-10	ENSG00000197454	ENSG00000197454		"""GPCR / Class A : Olfactory receptors"""	15011	protein-coding gene	gene with protein product				OR2L11, OR2L5P			Standard	NM_001258284		Approved		uc031psy.1	Q8NG80	OTTHUMG00000040194	ENST00000355281.1:c.320C>A	1.37:g.248185569C>A	ENSP00000347428:p.Ala107Glu		Q6IF04	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A107E	ENST00000355281.1	37	c.320	CCDS58068.1	1	.	.	.	.	.	.	.	.	.	.	.	7.057	0.565661	0.13560	.	.	ENSG00000197454	ENST00000355281	D	0.88509	-2.39	2.37	-4.75	0.03239	.	0.602712	0.12422	U	0.470316	T	0.81336	0.4801	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.71948	-0.4438	7	0.52906	T	0.07	.	1.501	0.02477	0.1624:0.3251:0.324:0.1885	.	.	.	.	E	107	ENSP00000347428:A107E	ENSP00000347428:A107E	A	+	2	0	OR2L5	246252192	0.000000	0.05858	0.031000	0.17742	0.165000	0.22458	-4.181000	0.00279	-0.312000	0.08741	-0.687000	0.03738	GCA	OR2L5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197454		0.433	OR2L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L5	HGNC	protein_coding	OTTHUMT00000096851.1	-	0.00	133	0	C			248185569	+1	tier1	-	no_errors	ENST00000355281	ensembl	human	known	74_37	missense	44.55	61	49	SNP	0.000	A
OR4N2	390429	genome.wustl.edu	37	14	20296368	20296369	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:20296368_20296369GC>CT	ENST00000315947.1	+	1	761_762	c.761_762GC>CT	c.(760-762)gGC>gCT	p.G254A	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTTGGACCTGGCATCTTCATCT	0.446																																																	0																																										SO:0001583	missense	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		Exception_encountered	14.37:g.20296368_20296369delinsCT	ENSP00000319601:p.Gly254Ala		Q6IEY9|Q6IFA2	Missense_Mutation|Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G254A|p.G254	ENST00000315947.1	37	c.761|c.762	CCDS32022.1	14																																																																																			OR4N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176294		0.446	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	-	0.00	157	0	G|C			20296368|20296369	+1	tier1	-	no_errors	ENST00000315947	ensembl	human	known	74_37	missense|silent	6.36|6.31	103|104	7	SNP	0.013|0.014	C|T
OR5D13	390142	genome.wustl.edu	37	11	55541539	55541539	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:55541539A>C	ENST00000361760.1	+	1	626	c.626A>C	c.(625-627)gAg>gCg	p.E209A		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				ATATTCAATGAGGTGAGCAGC	0.393																																																	0													139.0	133.0	135.0					11																	55541539		2200	4296	6496	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.626A>C	11.37:g.55541539A>C	ENSP00000354800:p.Glu209Ala		Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E209A	ENST00000361760.1	37	c.626	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	A	6.084	0.383876	0.11524	.	.	ENSG00000198877	ENST00000361760	T	0.36699	1.24	3.82	-0.312	0.12758	GPCR, rhodopsin-like superfamily (1);	0.504966	0.14652	U	0.306524	T	0.32102	0.0818	N	0.25647	0.755	0.09310	N	1	P	0.45902	0.868	P	0.55087	0.768	T	0.10894	-1.0610	10	0.44086	T	0.13	-10.7247	4.1938	0.10433	0.3425:0.17:0.0:0.4876	.	209	Q8NGL4	OR5DD_HUMAN	A	209	ENSP00000354800:E209A	ENSP00000354800:E209A	E	+	2	0	OR5D13	55298115	0.000000	0.05858	0.055000	0.19348	0.002000	0.02628	-0.079000	0.11357	0.461000	0.27071	-0.766000	0.03442	GAG	OR5D13	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198877		0.393	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	-	0.00	67	0	A	NM_001001967		55541539	+1	tier1	-	no_errors	ENST00000361760	ensembl	human	known	74_37	missense	58.00	21	29	SNP	0.007	C
OR5M8	219484	genome.wustl.edu	37	11	56258648	56258648	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:56258648A>G	ENST00000327216.2	-	1	223	c.199T>C	c.(199-201)Ttc>Ctc	p.F67L		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					AGATCCACGAAGGATAAGTGG	0.493																																																	0													77.0	76.0	76.0					11																	56258648		2201	4296	6497	SO:0001583	missense	0			AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.199T>C	11.37:g.56258648A>G	ENSP00000323354:p.Phe67Leu		B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F67L	ENST00000327216.2	37	c.199	CCDS31533.1	11	.	.	.	.	.	.	.	.	.	.	A	7.612	0.675019	0.14841	.	.	ENSG00000181371	ENST00000327216	T	0.00966	5.49	4.13	0.343	0.16001	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33515	U	0.004833	T	0.00967	0.0032	L	0.49571	1.57	0.27349	N	0.95628	B	0.16802	0.019	B	0.21151	0.033	T	0.44636	-0.9315	10	0.33940	T	0.23	-15.3841	3.4074	0.07345	0.6249:0.0:0.2031:0.172	.	67	Q8NGP6	OR5M8_HUMAN	L	67	ENSP00000323354:F67L	ENSP00000323354:F67L	F	-	1	0	OR5M8	56015224	0.000000	0.05858	0.110000	0.21437	0.056000	0.15407	-0.012000	0.12699	0.116000	0.18110	0.440000	0.28878	TTC	OR5M8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181371		0.493	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M8	HGNC	protein_coding	OTTHUMT00000391641.1	-	0.00	61	0	A	NM_001005282		56258648	-1	tier1	-	no_errors	ENST00000327216	ensembl	human	known	74_37	missense	25.97	57	20	SNP	0.690	G
OTUD7B	56957	genome.wustl.edu	37	1	149915980	149915980	+	Nonsense_Mutation	SNP	G	G	A	rs587752377		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:149915980G>A	ENST00000369135.4	-	12	2602	c.2308C>T	c.(2308-2310)Cga>Tga	p.R770*		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	770					mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TCAGCCACTCGGTAGGGGGGT	0.602													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16407	0.0		0.0	False		,,,				2504	0.0																0													39.0	42.0	41.0					1																	149915980		1918	4125	6043	SO:0001587	stop_gained	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.2308C>T	1.37:g.149915980G>A	ENSP00000358131:p.Arg770*		B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Nonsense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.R770*	ENST00000369135.4	37	c.2308	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.709221	0.96821	.	.	ENSG00000163113	ENST00000369135;ENST00000543330	.	.	.	4.75	3.83	0.44106	.	0.468479	0.23450	N	0.048048	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	4.2344	7.5659	0.27879	0.1911:0.0:0.8089:0.0	.	.	.	.	X	770	.	.	R	-	1	2	OTUD7B	148182604	0.113000	0.22115	0.469000	0.27204	0.469000	0.32828	0.820000	0.27323	1.353000	0.45828	0.557000	0.71058	CGA	OTUD7B	-	NULL	ENSG00000163113		0.602	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3	-	0.00	116	0	G	NM_020205		149915980	-1	tier1	-	no_errors	ENST00000369135	ensembl	human	known	74_37	nonsense	37.88	41	25	SNP	0.383	A
OXGR1	27199	genome.wustl.edu	37	13	97639316	97639316	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr13:97639316C>T	ENST00000298440.1	-	4	941	c.698G>A	c.(697-699)aGc>aAc	p.S233N	OXGR1_ENST00000543457.1_Missense_Mutation_p.S233N	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	233					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			CTTAAGGCAGCTGTCAGTTTG	0.448																																																	0													162.0	156.0	158.0					13																	97639316		2203	4300	6503	SO:0001583	missense	0			AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.698G>A	13.37:g.97639316C>T	ENSP00000298440:p.Ser233Asn		Q5T5A7|Q86TL1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S233N	ENST00000298440.1	37	c.698	CCDS9482.1	13	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249699	0.39797	.	.	ENSG00000165621	ENST00000298440;ENST00000543457	T;T	0.38077	1.16;1.16	5.83	4.99	0.66335	GPCR, rhodopsin-like superfamily (1);	0.427811	0.27159	N	0.020658	T	0.25827	0.0629	L	0.39147	1.195	0.32800	D	0.500043	B	0.12013	0.005	B	0.13407	0.009	T	0.29243	-1.0018	10	0.12430	T	0.62	.	8.6162	0.33833	0.0:0.7232:0.1362:0.1406	.	233	Q96P68	OXGR1_HUMAN	N	233	ENSP00000298440:S233N;ENSP00000438800:S233N	ENSP00000298440:S233N	S	-	2	0	OXGR1	96437317	0.892000	0.30473	0.986000	0.45419	0.899000	0.52679	2.348000	0.44045	1.634000	0.50500	0.650000	0.86243	AGC	OXGR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000165621		0.448	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXGR1	HGNC	protein_coding	OTTHUMT00000045521.3	-	0.00	46	0	C	NM_080818		97639316	-1	tier1	-	no_errors	ENST00000298440	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
PABPC5	140886	genome.wustl.edu	37	X	90690713	90690713	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:90690713T>G	ENST00000312600.3	+	2	351	c.137T>G	c.(136-138)tTc>tGc	p.F46C	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Intron	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	46	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						CCTCTGCGATTCACCCGAATC	0.572																																																	0													46.0	37.0	40.0					X																	90690713		2203	4300	6503	SO:0001583	missense	0			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.137T>G	X.37:g.90690713T>G	ENSP00000308012:p.Phe46Cys		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.F46C	ENST00000312600.3	37	c.137	CCDS14460.1	X	.	.	.	.	.	.	.	.	.	.	T	15.72	2.917374	0.52546	.	.	ENSG00000174740	ENST00000312600;ENST00000402906	T	0.15834	2.39	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.049362	0.85682	D	0.000000	T	0.19565	0.0470	N	0.21373	0.66	0.43902	D	0.996539	D	0.62365	0.991	P	0.59115	0.852	T	0.02167	-1.1202	10	0.87932	D	0	.	5.7577	0.18182	0.0:0.1157:0.0:0.8843	.	46	Q96DU9	PABP5_HUMAN	C	46;14	ENSP00000308012:F46C	ENSP00000308012:F46C	F	+	2	0	PABPC5	90577369	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	5.653000	0.67967	1.957000	0.56846	0.486000	0.48141	TTC	PABPC5	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000174740		0.572	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC5	HGNC	protein_coding	OTTHUMT00000057429.1	-	0.00	64	0	T	NM_080832		90690713	+1	tier1	-	no_errors	ENST00000312600	ensembl	human	known	74_37	missense	76.74	10	33	SNP	1.000	G
PAXBP1	94104	genome.wustl.edu	37	21	34132172	34132173	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:34132172_34132173insT	ENST00000331923.4	-	6	1297_1298	c.1108_1109insA	c.(1108-1110)acafs	p.T370fs	PAXBP1_ENST00000472588.1_5'UTR|PAXBP1_ENST00000290178.4_Frame_Shift_Ins_p.T370fs	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	370					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGTATTATCTGTTTTTTGAGAT	0.406																																																	0																																										SO:0001589	frameshift_variant	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.1109dupA	21.37:g.34132178_34132178dupT	ENSP00000328992:p.Thr370fs		D3DSE7|Q96DU8|Q9NYQ0	Frame_Shift_Ins	INS	pfam_GCFC_dom	p.T370fs	ENST00000331923.4	37	c.1109_1108	CCDS13619.1	21																																																																																			PAXBP1	-	NULL	ENSG00000159086		0.406	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAXBP1	HGNC	protein_coding	OTTHUMT00000139563.1		0.00	72	0	-	NM_013329		34132173	-1	tier1		no_errors	ENST00000331923	ensembl	human	known	74_37	frame_shift_ins	30.00	35	15	INS	1.000:0.930	T
PAXIP1	22976	genome.wustl.edu	37	7	154782727	154782727	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:154782727A>G	ENST00000404141.1	-	4	467	c.313T>C	c.(313-315)Tgc>Cgc	p.C105R	PAXIP1_ENST00000397192.1_Missense_Mutation_p.C105R|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	105	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with PAGR1. {ECO:0000250}.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TGAGAAAGGCAGGCAGTGATT	0.328																																																	0													50.0	47.0	48.0					7																	154782727		1825	4078	5903	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.313T>C	7.37:g.154782727A>G	ENSP00000384048:p.Cys105Arg		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.C105R	ENST00000404141.1	37	c.313	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101337	0.76983	.	.	ENSG00000157212	ENST00000404141;ENST00000397192	D;D	0.84944	-1.92;-1.92	5.26	5.26	0.73747	BRCT (3);	0.137376	0.33217	U	0.005160	D	0.94032	0.8088	M	0.93854	3.465	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	D	0.95353	0.8448	10	0.87932	D	0	-0.7776	14.0495	0.64727	1.0:0.0:0.0:0.0	.	105	Q6ZW49	PAXI1_HUMAN	R	105	ENSP00000384048:C105R;ENSP00000380376:C105R	ENSP00000380376:C105R	C	-	1	0	PAXIP1	154413660	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.193000	0.89719	2.113000	0.64589	0.454000	0.30748	TGC	PAXIP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000157212		0.328	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	-	0.00	46	0	A	NM_007349		154782727	-1	tier1	-	no_errors	ENST00000397192	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	G
PCDH8	5100	genome.wustl.edu	37	13	53422026	53422026	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr13:53422026G>A	ENST00000377942.3	-	1	749	c.546C>T	c.(544-546)cgC>cgT	p.R182R	PCDH8_ENST00000338862.4_Silent_p.R182R	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	182	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GCAGCTCCACGCGAAAGGGGC	0.721																																					GBM(36;25 841 9273 49207)												0													5.0	6.0	6.0					13																	53422026		1968	3896	5864	SO:0001819	synonymous_variant	0			AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.546C>T	13.37:g.53422026G>A			B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R182	ENST00000377942.3	37	c.546	CCDS9438.1	13																																																																																			PCDH8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000136099		0.721	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH8	HGNC	protein_coding	OTTHUMT00000045108.2	-	0.00	11	0	G	NM_002590		53422026	-1	tier1	-	no_errors	ENST00000377942	ensembl	human	known	74_37	silent	60.00	4	6	SNP	0.784	A
PCDHB12	56124	genome.wustl.edu	37	5	140590328	140590328	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:140590328G>A	ENST00000239450.2	+	1	2038	c.1849G>A	c.(1849-1851)Gtg>Atg	p.V617M	PCDHB12_ENST00000541609.1_Missense_Mutation_p.V280M	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	617	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTATTCGGCGTGTGGGCGCA	0.682																																																	0													10.0	13.0	12.0					5																	140590328		1690	3504	5194	SO:0001583	missense	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1849G>A	5.37:g.140590328G>A	ENSP00000239450:p.Val617Met		B4DDU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V617M	ENST00000239450.2	37	c.1849	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966773	0.53507	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.59502	0.26;0.26	3.53	3.53	0.40419	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72145	0.3424	M	0.77313	2.365	0.28923	N	0.892038	D	0.76494	0.999	D	0.72982	0.979	T	0.64609	-0.6367	9	0.72032	D	0.01	.	7.1407	0.25554	0.2143:0.0:0.7857:0.0	.	617	Q9Y5F1	PCDBC_HUMAN	M	280;617;237	ENSP00000440199:V280M;ENSP00000239450:V617M	ENSP00000239450:V617M	V	+	1	0	PCDHB12	140570512	0.015000	0.18098	0.970000	0.41538	0.976000	0.68499	1.775000	0.38584	1.678000	0.50952	0.479000	0.44913	GTG	PCDHB12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120328		0.682	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	-	0.00	256	0	G	NM_018932		140590328	+1	tier1	-	no_errors	ENST00000239450	ensembl	human	known	74_37	missense	27.57	134	51	SNP	0.740	A
PCDHB12	56124	genome.wustl.edu	37	5	140590694	140590694	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:140590694G>A	ENST00000239450.2	+	1	2404	c.2215G>A	c.(2215-2217)Gtg>Atg	p.V739M	PCDHB12_ENST00000541609.1_Missense_Mutation_p.V402M|PCDHB13_ENST00000341948.4_5'Flank	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	739					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTGGTGGACGTGAGTGGCAC	0.607																																																	0													70.0	75.0	74.0					5																	140590694		2203	4300	6503	SO:0001583	missense	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2215G>A	5.37:g.140590694G>A	ENSP00000239450:p.Val739Met		B4DDU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V739M	ENST00000239450.2	37	c.2215	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069174	0.36470	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.55234	0.53;0.68	3.4	2.48	0.30137	.	.	.	.	.	T	0.62865	0.2463	H	0.98155	4.16	0.19300	N	0.999974	B	0.34015	0.435	B	0.29598	0.104	T	0.65323	-0.6196	9	0.62326	D	0.03	.	5.4079	0.16332	0.1284:0.212:0.6596:0.0	.	739	Q9Y5F1	PCDBC_HUMAN	M	402;739;359	ENSP00000440199:V402M;ENSP00000239450:V739M	ENSP00000239450:V739M	V	+	1	0	PCDHB12	140570878	0.000000	0.05858	0.208000	0.23602	0.123000	0.20343	0.711000	0.25764	1.626000	0.50381	0.479000	0.44913	GTG	PCDHB12	-	NULL	ENSG00000120328		0.607	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	-	0.00	123	0	G	NM_018932		140590694	+1	tier1	-	no_errors	ENST00000239450	ensembl	human	known	74_37	missense	28.74	62	25	SNP	0.600	A
PCGF1	84759	genome.wustl.edu	37	2	74733105	74733105	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:74733105C>T	ENST00000233630.6	-	5	1415	c.504G>A	c.(502-504)caG>caA	p.Q168Q	PCGF1_ENST00000480844.2_5'UTR|LBX2_ENST00000550249.1_5'Flank|LBX2-AS1_ENST00000548978.2_RNA|LBX2_ENST00000341396.2_5'Flank|LBX2_ENST00000460508.3_5'Flank|LBX2-AS1_ENST00000603175.1_RNA	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	168	Required for repressor activity.|Sufficient for interaction with BCOR and BCORL1.				histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						ACAGGTTCAACTGCTCATCAT	0.572																																																	0													195.0	199.0	198.0					2																	74733105		2203	4300	6503	SO:0001819	synonymous_variant	0			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.504G>A	2.37:g.74733105C>T			Q7Z506	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q168	ENST00000233630.6	37	c.504	CCDS1946.2	2																																																																																			PCGF1	-	NULL	ENSG00000115289		0.572	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF1	HGNC	protein_coding	OTTHUMT00000252216.1	-	0.00	85	0	C	NM_032673		74733105	-1	tier1	-	no_errors	ENST00000233630	ensembl	human	known	74_37	silent	29.79	33	14	SNP	1.000	T
PCNT	5116	genome.wustl.edu	37	21	47746346	47746346	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:47746346A>G	ENST00000359568.5	+	2	217	c.110A>G	c.(109-111)aAg>aGg	p.K37R	C21orf58_ENST00000291691.7_5'Flank|C21orf58_ENST00000397680.1_5'Flank|C21orf58_ENST00000397682.3_5'Flank|PCNT_ENST00000480896.1_3'UTR|C21orf58_ENST00000397685.4_5'Flank	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	37					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)		p.K37R(1)		NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TCGGAGAAAAAGACGGCGAAG	0.512																																																	1	Substitution - Missense(1)	lung(1)											89.0	77.0	81.0					21																	47746346		2203	4300	6503	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.110A>G	21.37:g.47746346A>G	ENSP00000352572:p.Lys37Arg		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.K37R	ENST00000359568.5	37	c.110	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	A	24.6	4.553396	0.86127	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.03386	3.95	5.18	4.02	0.46733	.	0.000000	0.33813	N	0.004525	T	0.12603	0.0306	L	0.59436	1.845	0.29830	N	0.830103	D	0.89917	1.0	D	0.69654	0.965	T	0.01228	-1.1412	10	0.46703	T	0.11	.	11.5502	0.50716	0.8402:0.1598:0.0:0.0	.	37	O95613	PCNT_HUMAN	R	37	ENSP00000352572:K37R	ENSP00000338675:K37R	K	+	2	0	PCNT	46570774	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.082000	0.64450	0.793000	0.33875	0.379000	0.24179	AAG	PCNT	-	NULL	ENSG00000160299		0.512	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1		0.00	52	0	A	NM_006031		47746346	+1			no_errors	ENST00000359568	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	G
PDGFC	56034	genome.wustl.edu	37	4	157688963	157688963	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:157688963G>T	ENST00000502773.1	-	5	1373	c.883C>A	c.(883-885)Caa>Aaa	p.Q295K	PDGFC_ENST00000422544.2_Intron|PDGFC_ENST00000541126.1_Missense_Mutation_p.Q132K|PDGFC_ENST00000542208.1_Missense_Mutation_p.Q140K|PDGFC_ENST00000504672.1_5'UTR	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	295					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)	p.Q295*(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		GGGACACATTGACATTCATTG	0.403																																																	1	Substitution - Nonsense(1)	cervix(1)											135.0	125.0	128.0					4																	157688963		2203	4300	6503	SO:0001583	missense	0			AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.883C>A	4.37:g.157688963G>T	ENSP00000422464:p.Gln295Lys		B4DU34|B9EGR8|Q4W5M9|Q9UL22	Missense_Mutation	SNP	pfam_CUB_dom,pfam_PDGF/VEGF_dom,superfamily_CUB_dom,smart_CUB_dom,smart_PDGF/VEGF_dom,pfscan_CUB_dom,pfscan_PDGF/VEGF_dom	p.Q295K	ENST00000502773.1	37	c.883	CCDS3795.1	4	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382813	0.61845	.	.	ENSG00000145431	ENST00000502773;ENST00000541126;ENST00000542208	T;T;T	0.44881	2.48;0.92;0.91	5.56	5.56	0.83823	Platelet-derived growth factor (PDGF) (3);	0.115412	0.64402	D	0.000012	T	0.47893	0.1470	L	0.57536	1.79	0.80722	D	1	B;B	0.26975	0.165;0.165	B;B	0.33846	0.171;0.109	T	0.42032	-0.9475	10	0.46703	T	0.11	-4.7334	19.5347	0.95244	0.0:0.0:1.0:0.0	.	140;295	B4E3A5;Q9NRA1	.;PDGFC_HUMAN	K	295;132;140	ENSP00000422464:Q295K;ENSP00000442943:Q132K;ENSP00000439728:Q140K	ENSP00000422464:Q295K	Q	-	1	0	PDGFC	157908413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.854000	0.86942	2.617000	0.88574	0.650000	0.86243	CAA	PDGFC	-	pfam_PDGF/VEGF_dom,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	ENSG00000145431		0.403	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFC	HGNC	protein_coding	OTTHUMT00000366123.1	-	0.00	68	0	G			157688963	-1	tier1	-	no_errors	ENST00000502773	ensembl	human	known	74_37	missense	65.48	29	55	SNP	1.000	T
PDK4	5166	genome.wustl.edu	37	7	95217103	95217103	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:95217103delT	ENST00000005178.5	-	8	1003	c.806delA	c.(805-807)aatfs	p.N269fs		NM_002612.3	NP_002603.1	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase, isozyme 4	269	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|negative regulation of anoikis (GO:2000811)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|reactive oxygen species metabolic process (GO:0072593)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of bone resorption (GO:0045124)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			GGAAGGCTGATTTTCCTGGTG	0.388																																																	0													82.0	80.0	81.0					7																	95217103		2203	4300	6503	SO:0001589	frameshift_variant	0			U54617	CCDS5643.1	7q21.3-q22.1	2008-07-18	2005-11-16		ENSG00000004799	ENSG00000004799			8812	protein-coding gene	gene with protein product		602527	"""pyruvate dehydrogenase kinase, isoenzyme 4"""			7499431	Standard	NM_002612		Approved		uc003uoa.3	Q16654	OTTHUMG00000153977	ENST00000005178.5:c.806delA	7.37:g.95217103delT	ENSP00000005178:p.Asn269fs			Frame_Shift_Del	DEL	pfam_BCDHK/PDK_N,pfam_HATPase_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.N269fs	ENST00000005178.5	37	c.806	CCDS5643.1	7																																																																																			PDK4	-	pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pfscan_Sig_transdc_His_kinase_core	ENSG00000004799		0.388	PDK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK4	HGNC	protein_coding	OTTHUMT00000333298.1		0.00	66	0	T	NM_002612		95217103	-1	tier1		no_errors	ENST00000005178	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	0.125	-
PDZD4	57595	genome.wustl.edu	37	X	153069861	153069861	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:153069861C>T	ENST00000164640.4	-	8	1448	c.1257G>A	c.(1255-1257)gcG>gcA	p.A419A	PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000393758.2_Silent_p.A344A|PDZD4_ENST00000544474.1_Silent_p.A310A	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	419						cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCATCTTCTGCGCCCGCAGTA	0.637																																																	0													42.0	34.0	36.0					X																	153069861		2203	4297	6500	SO:0001819	synonymous_variant	0			AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.1257G>A	X.37:g.153069861C>T			B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A419	ENST00000164640.4	37	c.1257	CCDS14732.1	X																																																																																			PDZD4	-	NULL	ENSG00000067840		0.637	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD4	HGNC	protein_coding	OTTHUMT00000061013.3	-	0.00	78	0	C	NM_032512		153069861	-1	tier1	-	no_errors	ENST00000164640	ensembl	human	known	74_37	silent	54.00	23	27	SNP	0.884	T
PEX5	5830	genome.wustl.edu	37	12	7344239	7344239	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:7344239G>T	ENST00000455147.2	+	6	971	c.391G>T	c.(391-393)Gta>Tta	p.V131L	RP11-273B20.3_ENST00000545794.1_RNA|PEX5_ENST00000545220.1_3'UTR|PEX5_ENST00000266563.5_Missense_Mutation_p.V131L|PEX5_ENST00000412720.2_Missense_Mutation_p.V152L|PEX5_ENST00000420616.2_Missense_Mutation_p.V131L|RP11-273B20.3_ENST00000543061.1_RNA|PEX5_ENST00000434354.2_Missense_Mutation_p.V146L|PEX5_ENST00000266564.3_Missense_Mutation_p.V131L	NM_001131026.1	NP_001124498.1	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5	131					cell development (GO:0048468)|cerebral cortex cell migration (GO:0021795)|cerebral cortex neuron differentiation (GO:0021895)|endoplasmic reticulum organization (GO:0007029)|fatty acid beta-oxidation (GO:0006635)|mitochondrial membrane organization (GO:0007006)|negative regulation of protein homotetramerization (GO:1901094)|neuromuscular process (GO:0050905)|neuron migration (GO:0001764)|positive regulation of multicellular organism growth (GO:0040018)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|protein import into peroxisome matrix, translocation (GO:0016561)|protein import into peroxisome membrane (GO:0045046)|protein targeting to peroxisome (GO:0006625)|protein tetramerization (GO:0051262)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|small GTPase binding (GO:0031267)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)	21						TGCTGTGGATGTAACTCAGGA	0.448																																																	0													104.0	100.0	102.0					12																	7344239		2203	4300	6503	SO:0001583	missense	0			U19721	CCDS8576.1, CCDS44822.1, CCDS44823.1, CCDS44824.1, CCDS73433.1	12p	2013-01-10	2004-03-17	2004-03-19		ENSG00000139197		"""Tetratricopeptide (TTC) repeat domain containing"""	9719	protein-coding gene	gene with protein product		600414	"""peroxisome receptor 1"""	PXR1			Standard	NM_000319		Approved	PTS1R	uc010sgc.2	P50542		ENST00000455147.2:c.391G>T	12.37:g.7344239G>T	ENSP00000400647:p.Val131Leu		A8K891|B4DZ45|B7ZAD5|D3DUT8|Q15115|Q15266|Q96FN7	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V146L	ENST00000455147.2	37	c.436	CCDS44823.1	12	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365960	0.24684	.	.	ENSG00000139197	ENST00000536883;ENST00000542539;ENST00000455147;ENST00000266563;ENST00000543974;ENST00000434354;ENST00000545574;ENST00000420616;ENST00000412720;ENST00000396637;ENST00000537873;ENST00000266564;ENST00000545845	D;D;D;D;D;D;D	0.87256	-2.21;-2.21;-2.22;-2.21;-2.23;-2.04;-2.22	4.04	3.12	0.35913	.	0.453502	0.22643	N	0.057428	T	0.78761	0.4334	L	0.34521	1.04	0.34948	D	0.750942	B;B;B;B;B	0.11235	0.004;0.0;0.001;0.001;0.001	B;B;B;B;B	0.15484	0.013;0.002;0.001;0.002;0.004	T	0.77568	-0.2539	10	0.28530	T	0.3	.	10.3604	0.43989	0.0954:0.0:0.9046:0.0	.	152;146;131;131;131	B4E0T2;B4DZ45;P50542;P50542-3;P50542-2	.;.;PEX5_HUMAN;.;.	L	48;131;131;131;48;146;119;131;152;146;131;131;48	ENSP00000400647:V131L;ENSP00000266563:V131L;ENSP00000407401:V146L;ENSP00000410159:V131L;ENSP00000391601:V152L;ENSP00000379877:V146L;ENSP00000266564:V131L	ENSP00000266563:V131L	V	+	1	0	PEX5	7235506	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	2.371000	0.44248	2.075000	0.62263	0.491000	0.48974	GTA	PEX5	-	NULL	ENSG00000139197		0.448	PEX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX5	HGNC	protein_coding	OTTHUMT00000398611.1	-	0.00	62	0	G	NM_000319		7344239	+1	tier1	-	no_errors	ENST00000434354	ensembl	human	known	74_37	missense	5.80	64	4	SNP	0.992	T
PGLYRP4	57115	genome.wustl.edu	37	1	153317650	153317650	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:153317650G>A	ENST00000359650.5	-	4	412	c.348C>T	c.(346-348)gcC>gcT	p.A116A	PGLYRP4_ENST00000490266.1_5'UTR|PGLYRP4_ENST00000368739.3_Silent_p.A112A	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	116					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTTACTTGTAGGCCACATCAC	0.557																																																	0													91.0	95.0	94.0					1																	153317650		2203	4300	6503	SO:0001819	synonymous_variant	0			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.348C>T	1.37:g.153317650G>A			A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Silent	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.A116	ENST00000359650.5	37	c.348	CCDS30871.1	1																																																																																			PGLYRP4	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000163218		0.557	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	HGNC	protein_coding	OTTHUMT00000089978.1	-	0.00	70	0	G	NM_020393		153317650	-1	tier1	-	no_errors	ENST00000359650	ensembl	human	known	74_37	silent	23.81	48	15	SNP	0.999	A
PHF8	23133	genome.wustl.edu	37	X	54022145	54022145	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:54022145C>T	ENST00000357988.5	-	12	1770	c.1412G>A	c.(1411-1413)aGg>aAg	p.R471K	PHF8_ENST00000338154.6_Missense_Mutation_p.R435K|PHF8_ENST00000338946.6_Missense_Mutation_p.R435K|PHF8_ENST00000322659.8_Missense_Mutation_p.R435K	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	471					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						GCGGATCTCCCTGGCCAGATC	0.537																																																	0													119.0	84.0	96.0					X																	54022145		2203	4300	6503	SO:0001583	missense	0			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1412G>A	X.37:g.54022145C>T	ENSP00000350676:p.Arg471Lys		B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.R471K	ENST00000357988.5	37	c.1412	CCDS55420.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.591|6.591	0.477334|0.477334	0.12521|0.12521	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000396282;ENST00000448003|ENST00000357988;ENST00000338154;ENST00000338946;ENST00000396277;ENST00000322659	.|T;T;T;T	.|0.30714	.|1.52;1.52;1.52;1.52	5.62|5.62	3.82|3.82	0.43975|0.43975	.|.	.|0.086238	.|0.85682	.|D	.|0.000000	T|T	0.12433|0.12433	0.0302|0.0302	N|N	0.11427|0.11427	0.14|0.14	0.32024|0.32024	N|N	0.600454|0.600454	.|B;B;B;B	.|0.18741	.|0.0;0.018;0.03;0.0	.|B;B;B;B	.|0.12156	.|0.001;0.003;0.007;0.001	T|T	0.19811|0.19811	-1.0294|-1.0294	5|10	.|0.02654	.|T	.|1	-13.8442|-13.8442	8.7013|8.7013	0.34327|0.34327	0.0:0.7825:0.0:0.2175|0.0:0.7825:0.0:0.2175	.|.	.|435;435;471;471	.|Q9UPP1-2;B7Z911;Q9UPP1-3;Q9UPP1	.|.;.;.;PHF8_HUMAN	R|K	339;116|471;435;435;465;435	.|ENSP00000350676:R471K;ENSP00000338868:R435K;ENSP00000340051:R435K;ENSP00000319473:R435K	.|ENSP00000319473:R435K	G|R	-|-	1|2	0|0	PHF8|PHF8	54038870|54038870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	3.552000|3.552000	0.53705|0.53705	2.366000|2.366000	0.80165|0.80165	0.468000|0.468000	0.43344|0.43344	GGG|AGG	PHF8	-	NULL	ENSG00000172943		0.537	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	HGNC	protein_coding	OTTHUMT00000056784.2	-	0.00	68	0	C	NM_015107		54022145	-1	tier1	-	no_errors	ENST00000357988	ensembl	human	known	74_37	missense	21.43	55	15	SNP	1.000	T
PIGQ	9091	genome.wustl.edu	37	16	633346	633346	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:633346C>T	ENST00000026218.5	+	10	2083	c.1995C>T	c.(1993-1995)ccC>ccT	p.P665P	PIGQ_ENST00000321878.5_3'UTR	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	665					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				GCCCCATGCCCACCCTGTGTA	0.682																																																	0													50.0	57.0	54.0					16																	633346		2201	4298	6499	SO:0001819	synonymous_variant	0			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1995C>T	16.37:g.633346C>T			A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Silent	SNP	pfam_GlcNAc_Gpi1	p.P665	ENST00000026218.5	37	c.1995	CCDS10411.1	16																																																																																			PIGQ	-	NULL	ENSG00000007541		0.682	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2	-	0.00	109	0	C	NM_004204		633346	+1	tier1	-	no_errors	ENST00000026218	ensembl	human	known	74_37	silent	19.77	69	17	SNP	0.000	T
PIM2	11040	genome.wustl.edu	37	X	48772135	48772135	+	Intron	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:48772135T>C	ENST00000376509.4	-	4	785				SLC35A2_ENST00000376515.3_5'Flank|PIM2_ENST00000485431.1_5'UTR|SLC35A2_ENST00000376521.1_5'Flank	NM_006875.3	NP_006866.2	Q9P1W9	PIM2_HUMAN	Pim-2 proto-oncogene, serine/threonine kinase						apoptotic mitochondrial changes (GO:0008637)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|response to virus (GO:0009615)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			lung(3)|stomach(1)	4						AAAGATGGACTTTATCAGAGG	0.463																																																	0																																										SO:0001627	intron_variant	0			U77735	CCDS14312.1	Xp11.23	2014-06-25	2014-06-25		ENSG00000102096	ENSG00000102096			8987	protein-coding gene	gene with protein product		300295	"""pim-2 oncogene"""			9804974	Standard	NM_006875		Approved		uc004dls.3	Q9P1W9	OTTHUMG00000024132	ENST00000376509.4:c.595+161A>G	X.37:g.48772135T>C			A8K4G6|Q99739	RNA	SNP	-	NULL	ENST00000376509.4	37	NULL	CCDS14312.1	X																																																																																			PIM2	-	-	ENSG00000102096		0.463	PIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIM2	HGNC	protein_coding	OTTHUMT00000060805.1	-	0.00	19	0	T			48772135	-1	tier1	-	no_errors	ENST00000485431	ensembl	human	known	74_37	rna	66.67	2	4	SNP	0.012	C
PKMYT1	9088	genome.wustl.edu	37	16	3025810	3025810	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:3025810G>T	ENST00000262300.8	-	4	890	c.382C>A	c.(382-384)Cgc>Agc	p.R128S	PKMYT1_ENST00000431515.2_Missense_Mutation_p.R128S|PKMYT1_ENST00000574385.1_Missense_Mutation_p.R119S|PKMYT1_ENST00000573944.1_Missense_Mutation_p.R119S|PKMYT1_ENST00000440027.2_Missense_Mutation_p.R128S|PKMYT1_ENST00000574730.1_Missense_Mutation_p.R59S	NM_001258450.1|NM_004203.4|NM_182687.2	NP_001245379.1|NP_004194.3|NP_872629.1	Q99640	PMYT1_HUMAN	protein kinase, membrane associated tyrosine/threonine 1	128	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						TCCTTGGAGCGCACCTGGAAG	0.627																																																	0													30.0	30.0	30.0					16																	3025810		2014	3999	6013	SO:0001583	missense	0			AK097642	CCDS10486.1, CCDS45391.1, CCDS58414.1, CCDS58415.1	16p13.3	2014-06-13			ENSG00000127564	ENSG00000127564			29650	protein-coding gene	gene with protein product	"""membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase"", ""protein phosphatase 1, regulatory subunit 126"""	602474				9001210, 12606722	Standard	NM_004203		Approved	MYT1, PPP1R126	uc002csn.3	Q99640	OTTHUMG00000128975	ENST00000262300.8:c.382C>A	16.37:g.3025810G>T	ENSP00000262300:p.Arg128Ser		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr/Thr_kinase_Cdc2_inhib,pfscan_Prot_kinase_dom	p.R128S	ENST00000262300.8	37	c.382	CCDS10486.1	16	.	.	.	.	.	.	.	.	.	.	G	21.3	4.127751	0.77549	.	.	ENSG00000127564	ENST00000431515;ENST00000262300;ENST00000440027;ENST00000402679;ENST00000382240	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.69	5.69	0.88448	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.218706	0.43110	D	0.000602	T	0.38081	0.1027	L	0.28740	0.885	0.80722	D	1	D;D;D;D	0.69078	0.997;0.997;0.994;0.996	P;D;P;P	0.64877	0.906;0.93;0.905;0.848	T	0.03157	-1.1066	10	0.37606	T	0.19	-30.915	17.2983	0.87175	0.0:0.0:1.0:0.0	.	119;59;128;128	A6NHV6;B4DXD4;Q99640;F8W164	.;.;PMYT1_HUMAN;.	S	128;128;128;128;119	ENSP00000392855:R128S;ENSP00000262300:R128S;ENSP00000397739:R128S;ENSP00000371675:R119S	ENSP00000262300:R128S	R	-	1	0	PKMYT1	2965811	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.384000	0.73177	2.676000	0.91093	0.655000	0.94253	CGC	PKMYT1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr/Thr_kinase_Cdc2_inhib,pfscan_Prot_kinase_dom	ENSG00000127564		0.627	PKMYT1-001	KNOWN	basic|CCDS	protein_coding	PKMYT1	HGNC	protein_coding	OTTHUMT00000250963.2		0.00	93	0	G	NM_004203		3025810	-1			no_errors	ENST00000262300	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
PLEKHG6	55200	genome.wustl.edu	37	12	6428024	6428024	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:6428024C>T	ENST00000396988.3	+	12	1619	c.1389C>T	c.(1387-1389)tgC>tgT	p.C463C	PLEKHG6_ENST00000536531.1_Silent_p.C463C|PLEKHG6_ENST00000011684.7_Silent_p.C463C|PLEKHG6_ENST00000449001.2_Silent_p.C431C|PLEKHG6_ENST00000304581.8_5'Flank	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	463	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						AGCTCGTGTGCCAACCCCTGC	0.567																																																	0													128.0	112.0	118.0					12																	6428024		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.1389C>T	12.37:g.6428024C>T			Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Silent	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.C463	ENST00000396988.3	37	c.1389	CCDS8541.1	12																																																																																			PLEKHG6	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000008323		0.567	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHG6	HGNC	protein_coding	OTTHUMT00000399031.1	-	0.00	49	0	C	NM_018173		6428024	+1	tier1	-	no_errors	ENST00000011684	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.942	T
PNISR	25957	genome.wustl.edu	37	6	99862463	99862463	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:99862463G>T	ENST00000369239.5	-	3	277	c.73C>A	c.(73-75)Cac>Aac	p.H25N	PNISR_ENST00000438806.1_Missense_Mutation_p.H25N|PNISR_ENST00000466057.1_5'UTR	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein	25	Gln-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						TCCTGTTGGTGCTGGAATGAC	0.443																																																	0													142.0	127.0	132.0					6																	99862463		2203	4300	6503	SO:0001583	missense	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.73C>A	6.37:g.99862463G>T	ENSP00000358242:p.His25Asn		A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	Missense_Mutation	SNP	NULL	p.H25N	ENST00000369239.5	37	c.73	CCDS5043.1	6	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176721	0.78564	.	.	ENSG00000132424	ENST00000369239;ENST00000438806	T;T	0.50277	0.75;0.75	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	N	0.24115	0.695	0.80722	D	1	D;D	0.67145	0.989;0.996	D;D	0.76071	0.969;0.987	T	0.13415	-1.0510	10	0.15066	T	0.55	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	25;25	E1P5D4;Q8TF01	.;PNISR_HUMAN	N	25	ENSP00000358242:H25N;ENSP00000387997:H25N	ENSP00000358242:H25N	H	-	1	0	PNISR	99969184	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.358000	0.97109	2.941000	0.99782	0.655000	0.94253	CAC	PNISR	-	NULL	ENSG00000132424		0.443	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1		0.00	71	0	G	NM_032870		99862463	-1			no_errors	ENST00000369239	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
POLR3A	11128	genome.wustl.edu	37	10	79753093	79753093	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:79753093G>T	ENST00000372371.3	-	20	2786	c.2649C>A	c.(2647-2649)tgC>tgA	p.C883*		NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	883					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			CATACTGGGAGCAAAGATCTT	0.443																																																	0													87.0	82.0	83.0					10																	79753093		2203	4300	6503	SO:0001587	stop_gained	0			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.2649C>A	10.37:g.79753093G>T	ENSP00000361446:p.Cys883*		Q8IW34|Q8TCW5	Nonsense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,smart_RNA_pol_N	p.C883*	ENST00000372371.3	37	c.2649	CCDS7354.1	10	.	.	.	.	.	.	.	.	.	.	G	41	8.656550	0.98903	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	.	.	.	5.87	1.98	0.26296	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.3401	10.4973	0.44785	0.3403:0.0:0.6597:0.0	.	.	.	.	X	883	.	.	C	-	3	2	POLR3A	79423099	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	2.118000	0.41949	0.178000	0.19917	0.655000	0.94253	TGC	POLR3A	-	pfam_RNA_pol_Rpb1_5	ENSG00000148606		0.443	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	HGNC	protein_coding	OTTHUMT00000048923.1	-	0.00	45	0	G	NM_007055		79753093	-1	tier1	-	no_errors	ENST00000372371	ensembl	human	known	74_37	nonsense	10.53	34	4	SNP	1.000	T
POU6F1	5463	genome.wustl.edu	37	12	51585419	51585419	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:51585419C>T	ENST00000389243.4	-	10	1459	c.520G>A	c.(520-522)Gca>Aca	p.A174T	POU6F1_ENST00000550824.1_Missense_Mutation_p.A174T|POU6F1_ENST00000333640.10_Missense_Mutation_p.A174T			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	174	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						CCTTCCGTTGCAGTCAGAGCC	0.592																																																	0													57.0	54.0	55.0					12																	51585419		2203	4300	6503	SO:0001583	missense	0			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.520G>A	12.37:g.51585419C>T	ENSP00000373895:p.Ala174Thr		Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.A174T	ENST00000389243.4	37	c.520	CCDS31803.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.146411	0.94603	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.83914	-1.78;-1.78;-1.78	5.28	5.28	0.74379	POU-specific (3);Lambda repressor-like, DNA-binding (2);POU (1);	0.054132	0.64402	D	0.000001	T	0.76652	0.4017	L	0.31664	0.95	0.80722	D	1	P	0.41366	0.747	B	0.43386	0.418	T	0.73116	-0.4084	10	0.08381	T	0.77	.	17.6761	0.88232	0.0:1.0:0.0:0.0	.	174	Q14863	PO6F1_HUMAN	T	174	ENSP00000373895:A174T;ENSP00000330190:A174T;ENSP00000448389:A174T	ENSP00000330190:A174T	A	-	1	0	POU6F1	49871686	1.000000	0.71417	0.460000	0.27093	0.953000	0.61014	7.772000	0.85439	2.476000	0.83614	0.561000	0.74099	GCA	POU6F1	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific,prints_POU	ENSG00000184271		0.592	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU6F1	HGNC	protein_coding	OTTHUMT00000405126.1	-	0.00	117	0	C	NM_002702		51585419	-1	tier1	-	no_errors	ENST00000333640	ensembl	human	known	74_37	missense	5.17	110	6	SNP	1.000	T
PPP1CB	5500	genome.wustl.edu	37	2	29006802	29006802	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:29006802C>T	ENST00000395366.2	+	5	822	c.550C>T	c.(550-552)Cag>Tag	p.Q184*	PPP1CB_ENST00000358506.2_Nonsense_Mutation_p.Q184*|SPDYA_ENST00000462832.1_3'UTR|PPP1CB_ENST00000296122.6_Nonsense_Mutation_p.Q184*	NM_002709.2	NP_002700.1	P62140	PP1B_HUMAN	protein phosphatase 1, catalytic subunit, beta isozyme	184					cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|G2/M transition of mitotic cell cycle (GO:0000086)|glycogen metabolic process (GO:0005977)|mitotic cell cycle (GO:0000278)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|myosin phosphatase activity (GO:0017018)|myosin-light-chain-phosphatase activity (GO:0050115)|phosphatase activity (GO:0016791)|protein kinase binding (GO:0019901)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	9	Acute lymphoblastic leukemia(172;0.155)					ATCTATGGAGCAGATTCGGAG	0.323																																																	0													126.0	133.0	130.0					2																	29006802		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33169.1	2p23	2013-01-18	2010-03-05		ENSG00000213639	ENSG00000213639	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9282	protein-coding gene	gene with protein product		600590	"""protein phosphatase 1, catalytic subunit, beta isoform"""			8312365	Standard	NM_002709		Approved	PP1B, PP-1B, PP1beta	uc002rmg.3	P62140	OTTHUMG00000152011	ENST00000395366.2:c.550C>T	2.37:g.29006802C>T	ENSP00000378769:p.Gln184*		B2R5V4|D6W565|P37140|Q5U087|Q6FG45	Nonsense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.Q184*	ENST00000395366.2	37	c.550	CCDS33169.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.924996	0.97110	.	.	ENSG00000213639	ENST00000455580;ENST00000358506;ENST00000296122;ENST00000395366	.	.	.	5.87	5.0	0.66597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.2843	15.5374	0.76013	0.0:0.9336:0.0:0.0664	.	.	.	.	X	156;184;184;184	.	ENSP00000296122:Q184X	Q	+	1	0	PPP1CB	28860306	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.750000	0.85110	1.626000	0.50381	0.655000	0.94253	CAG	PPP1CB	-	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000213639		0.323	PPP1CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1CB	HGNC	protein_coding	OTTHUMT00000324841.1	-	0.00	80	0	C			29006802	+1	tier1	-	no_errors	ENST00000296122	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	1.000	T
PPP2R5B	5526	genome.wustl.edu	37	11	64697828	64697828	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:64697828G>T	ENST00000164133.2	+	7	1379	c.757G>T	c.(757-759)Gct>Tct	p.A253S		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	253					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)	p.A253T(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CAATGGTGTGGCTGAGCTGCT	0.577																																																	1	Substitution - Missense(1)	endometrium(1)											133.0	117.0	122.0					11																	64697828		2201	4297	6498	SO:0001583	missense	0			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.757G>T	11.37:g.64697828G>T	ENSP00000164133:p.Ala253Ser		Q13853	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.A253S	ENST00000164133.2	37	c.757	CCDS8085.1	11	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150352	0.78001	.	.	ENSG00000068971	ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	3.81	3.81	0.43845	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61148	0.2324	L	0.61218	1.895	0.52501	D	0.999951	B	0.06786	0.001	B	0.25405	0.06	T	0.65175	-0.6232	9	0.72032	D	0.01	-9.8281	14.0102	0.64490	0.0:0.0:1.0:0.0	.	253	Q15173	2A5B_HUMAN	S	253;280;253	.	ENSP00000164133:A253S	A	+	1	0	PPP2R5B	64454404	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.126000	0.94411	2.422000	0.82143	0.655000	0.94253	GCT	PPP2R5B	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000068971		0.577	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1		0.00	49	0	G	NM_006244		64697828	+1			no_errors	ENST00000164133	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
PPRC1	23082	genome.wustl.edu	37	10	103899593	103899594	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:103899593_103899594delAG	ENST00000278070.2	+	5	1367_1368	c.1328_1329delAG	c.(1327-1329)cagfs	p.Q443fs	PPRC1_ENST00000413464.2_Frame_Shift_Del_p.Q443fs|PPRC1_ENST00000370012.1_5'Flank	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	443	Necessary for interaction with CREB1 and NRF1 and for transcriptional coactivation.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		AAGGAGCCTCAGAACCCACCTG	0.579																																																	0																																										SO:0001589	frameshift_variant	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.1328_1329delAG	10.37:g.103899593_103899594delAG	ENSP00000278070:p.Gln443fs		Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.N444fs	ENST00000278070.2	37	c.1328_1329	CCDS7529.1	10																																																																																			PPRC1	-	NULL	ENSG00000148840		0.579	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1		0.00	36	0	AG	NM_015062		103899594	+1	tier1		no_errors	ENST00000278070	ensembl	human	known	74_37	frame_shift_del	33.33	16	8	DEL	0.000:0.001	-
PPRC1	23082	genome.wustl.edu	37	10	103906472	103906472	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:103906472C>T	ENST00000278070.2	+	9	3762	c.3723C>T	c.(3721-3723)ccC>ccT	p.P1241P	PPRC1_ENST00000489648.1_Intron|PPRC1_ENST00000413464.2_Intron|PPRC1_ENST00000370012.1_Silent_p.P208P	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1241					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TATGGAAGCCCCTGGCTGCTG	0.587																																																	0													73.0	73.0	73.0					10																	103906472		2203	4300	6503	SO:0001819	synonymous_variant	0			AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3723C>T	10.37:g.103906472C>T			Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P1241	ENST00000278070.2	37	c.3723	CCDS7529.1	10																																																																																			PPRC1	-	NULL	ENSG00000148840		0.587	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	-	0.00	50	0	C	NM_015062		103906472	+1	tier1	-	no_errors	ENST00000278070	ensembl	human	known	74_37	silent	13.16	33	5	SNP	1.000	T
PRAME	23532	genome.wustl.edu	37	22	22890683	22890683	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr22:22890683C>A	ENST00000398741.1	-	6	1642	c.1336G>T	c.(1336-1338)Gag>Tag	p.E446*	PRAME_ENST00000485532.1_5'Flank|PRAME_ENST00000402697.1_Nonsense_Mutation_p.E446*|PRAME_ENST00000543184.1_Nonsense_Mutation_p.E446*|PRAME_ENST00000539862.1_Nonsense_Mutation_p.E430*|PRAME_ENST00000424204.2_Nonsense_Mutation_p.E430*|PRAME_ENST00000398743.2_Nonsense_Mutation_p.E446*|PRAME_ENST00000405655.3_Nonsense_Mutation_p.E446*	NM_206955.1	NP_996838.1	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	446	Mediates interaction with RARA.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	retinoic acid receptor binding (GO:0042974)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		TCATAACTCTCCAGGGGGACA	0.572																																					Melanoma(73;1707 1838 15168 27201)												0													104.0	88.0	93.0					22																	22890683		2203	4300	6503	SO:0001587	stop_gained	0			U65011	CCDS13801.1	22q11.22	2013-01-17			ENSG00000185686	ENSG00000185686		"""-"""	9336	protein-coding gene	gene with protein product	"""cancer/testis antigen 130"""	606021		MAPE		9047241, 10591208	Standard	XM_006725402		Approved	CT130	uc002zwj.3	P78395	OTTHUMG00000151172	ENST00000398741.1:c.1336G>T	22.37:g.22890683C>A	ENSP00000381726:p.Glu446*		B2R6Y7|O43481|Q8IXN8	Nonsense_Mutation	SNP	NULL	p.E446*	ENST00000398741.1	37	c.1336	CCDS13801.1	22	.	.	.	.	.	.	.	.	.	.	C	33	5.285799	0.95517	.	.	ENSG00000185686	ENST00000398743;ENST00000543184;ENST00000398741;ENST00000405655;ENST00000539862;ENST00000402697;ENST00000424204	.	.	.	3.7	3.7	0.42460	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.7504	0.62904	0.0:1.0:0.0:0.0	.	.	.	.	X	446;446;446;446;430;446;430	.	ENSP00000381726:E446X	E	-	1	0	PRAME	21220683	1.000000	0.71417	0.903000	0.35520	0.009000	0.06853	3.312000	0.51927	2.369000	0.80426	0.643000	0.83706	GAG	PRAME	-	NULL	ENSG00000185686		0.572	PRAME-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAME	HGNC	protein_coding	OTTHUMT00000321644.1	-	0.00	62	0	C	NM_206953		22890683	-1	tier1	-	no_errors	ENST00000398741	ensembl	human	known	74_37	nonsense	15.38	22	4	SNP	0.983	A
PRDM6	93166	genome.wustl.edu	37	5	122506648	122506648	+	Missense_Mutation	SNP	G	G	A	rs372505887		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:122506648G>A	ENST00000407847.4	+	6	1756	c.1342G>A	c.(1342-1344)Gtg>Atg	p.V448M		NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	448					negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						TCAAATCAACGTGAAAAACCA	0.512																																																	0								G	MET/VAL	0,1384		0,0,692	69.0	65.0	66.0		1342	5.8	1.0	5		66	1,3181		0,1,1590	no	missense	PRDM6	NM_001136239.1	21	0,1,2282	AA,AG,GG		0.0314,0.0,0.0219	probably-damaging	448/596	122506648	1,4565	692	1591	2283	SO:0001583	missense	0			AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.1342G>A	5.37:g.122506648G>A	ENSP00000384725:p.Val448Met		B5MCJ4|Q9NQW9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.V448M	ENST00000407847.4	37	c.1342	CCDS47259.1	5	.	.	.	.	.	.	.	.	.	.	G	20.9	4.067811	0.76301	0.0	3.14E-4	ENSG00000061455	ENST00000407847	T	0.09163	3.01	5.83	5.83	0.93111	.	0.131880	0.52532	D	0.000073	T	0.12433	0.0302	N	0.14661	0.345	0.46849	D	0.999222	D	0.67145	0.996	P	0.48270	0.572	T	0.03043	-1.1079	10	0.72032	D	0.01	-25.4685	20.1338	0.98010	0.0:0.0:1.0:0.0	.	448	Q9NQX0	PRDM6_HUMAN	M	448	ENSP00000384725:V448M	ENSP00000384725:V448M	V	+	1	0	PRDM6	122534547	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.138000	0.77305	2.770000	0.95276	0.655000	0.94253	GTG	PRDM6	-	NULL	ENSG00000061455		0.512	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2	-	0.00	58	0	G	XM_049619		122506648	+1	tier1	-	no_errors	ENST00000407847	ensembl	human	known	74_37	missense	55.10	22	27	SNP	1.000	A
PRKG2	5593	genome.wustl.edu	37	4	82010744	82010744	+	3'UTR	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:82010744T>C	ENST00000395578.1	-	0	2523				PRKG2_ENST00000418486.2_3'UTR|PRKG2_ENST00000264399.1_3'UTR|PRKG2_ENST00000545647.1_3'UTR|PRKG2_ENST00000509169.1_5'UTR			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II						blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						CAGGAATTTCTTTTCCCTAAT	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.*118A>G	4.37:g.82010744T>C			B4DMX3|E7EPE6|O00125|O60916	RNA	SNP	-	NULL	ENST00000395578.1	37	NULL	CCDS3589.1	4																																																																																			PRKG2	-	-	ENSG00000138669		0.343	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG2	HGNC	protein_coding	OTTHUMT00000252639.1	-	0.00	34	0	T	NM_006259		82010744	-1	tier1	-	no_errors	ENST00000509169	ensembl	human	known	74_37	rna	23.81	16	5	SNP	0.238	C
PRPF19	27339	genome.wustl.edu	37	11	60669881	60669881	+	Silent	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:60669881A>T	ENST00000227524.4	-	6	724	c.519T>A	c.(517-519)atT>atA	p.I173I		NM_014502.4	NP_055317.1			pre-mRNA processing factor 19											haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	22						TTACCTTCTGAATAATCTCTG	0.517																																																	0													95.0	84.0	88.0					11																	60669881		2203	4299	6502	SO:0001819	synonymous_variant	0			BC018698	CCDS7995.1	11q12.2	2014-05-20	2013-06-10	2005-04-01	ENSG00000110107	ENSG00000110107		"""WD repeat domain containing"", ""U-box domain containing"""	17896	protein-coding gene	gene with protein product	"""nuclear matrix protein NMP200 related to splicing factor PRP19"", ""psoralen 4"""	608330	"""PRP19/PSO4 homolog (S. cerevisiae)"", ""PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)"""	PRP19		12960389	Standard	NM_014502		Approved	UBOX4, NMP200, PSO4, hPSO4	uc001nqf.3	Q9UMS4	OTTHUMG00000167798	ENST00000227524.4:c.519T>A	11.37:g.60669881A>T				Silent	SNP	pfam_WD40_repeat,pfam_Pre-mRNA_splic_Prp19,pfam_Ubox_domain,superfamily_WD40_repeat_dom,smart_Ubox_domain,smart_WD40_repeat,pfscan_Ricin_B_lectin,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I173	ENST00000227524.4	37	c.519	CCDS7995.1	11																																																																																			PRPF19	-	NULL	ENSG00000110107		0.517	PRPF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF19	HGNC	protein_coding	OTTHUMT00000396334.1	-	0.00	61	0	A	NM_014502		60669881	-1	tier1	-	no_errors	ENST00000227524	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.997	T
PRRG3	79057	genome.wustl.edu	37	X	150868621	150868621	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:150868621A>G	ENST00000370353.3	+	3	551	c.161A>G	c.(160-162)gAg>gGg	p.E54G	PRRG3_ENST00000538575.1_Missense_Mutation_p.E54G|PRRG3_ENST00000370354.1_Missense_Mutation_p.E62G			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	54	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GAGAACAAAGAGAAAACGGCA	0.542																																																	0													65.0	62.0	63.0					X																	150868621		2203	4300	6503	SO:0001583	missense	0			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.161A>G	X.37:g.150868621A>G	ENSP00000359378:p.Glu54Gly		A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.E54G	ENST00000370353.3	37	c.161	CCDS14699.1	X	.	.	.	.	.	.	.	.	.	.	A	19.88	3.909268	0.72868	.	.	ENSG00000130032	ENST00000538575;ENST00000370354;ENST00000370353	D;D;D	0.99277	-5.67;-5.67;-5.67	4.5	4.5	0.54988	Gamma-carboxyglutamic acid-rich (GLA) domain (6);Coagulation factor, subgroup, Gla domain (1);	0.137128	0.47455	D	0.000236	D	0.98947	0.9642	M	0.78344	2.41	0.47698	D	0.999499	D	0.57257	0.979	P	0.54759	0.76	D	0.98974	1.0802	10	0.72032	D	0.01	-24.0501	10.7616	0.46268	1.0:0.0:0.0:0.0	.	54	Q9BZD7	TMG3_HUMAN	G	54;62;54	ENSP00000440217:E54G;ENSP00000359379:E62G;ENSP00000359378:E54G	ENSP00000359378:E54G	E	+	2	0	PRRG3	150619277	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.800000	0.62524	1.663000	0.50791	0.430000	0.28490	GAG	PRRG3	-	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	ENSG00000130032		0.542	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	HGNC	protein_coding	OTTHUMT00000060880.1	-	0.00	56	0	A	NM_024082		150868621	+1	tier1	-	no_errors	ENST00000370353	ensembl	human	known	74_37	missense	76.60	11	36	SNP	0.989	G
PTCHD3	374308	genome.wustl.edu	37	10	27702528	27702528	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:27702528C>T	ENST00000438700.3	-	1	769	c.652G>A	c.(652-654)Gac>Aac	p.D218N		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	218					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						AGCAGTGAGTCGCTGTAGGAG	0.602																																																	0													44.0	46.0	45.0					10																	27702528		2203	4300	6503	SO:0001583	missense	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.652G>A	10.37:g.27702528C>T	ENSP00000417658:p.Asp218Asn		I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.D218N	ENST00000438700.3	37	c.652	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	C	8.138	0.784661	0.16189	.	.	ENSG00000182077	ENST00000438700	D	0.85702	-2.02	3.78	-1.94	0.07571	.	1.442900	0.04027	N	0.300732	T	0.69806	0.3152	N	0.12746	0.255	0.09310	N	1	B	0.26935	0.164	B	0.25759	0.063	T	0.56529	-0.7964	10	0.20046	T	0.44	-0.3896	6.03	0.19675	0.0:0.4729:0.1244:0.4027	.	218	Q3KNS1	PTHD3_HUMAN	N	218	ENSP00000417658:D218N	ENSP00000417658:D218N	D	-	1	0	PTCHD3	27742534	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.807000	0.04520	-0.301000	0.08882	0.561000	0.74099	GAC	PTCHD3	-	pfam_Patched	ENSG00000182077		0.602	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3	-	0.00	50	0	C	XM_370541		27702528	-1	tier1	-	no_errors	ENST00000438700	ensembl	human	known	74_37	missense	42.86	20	15	SNP	0.000	T
PTPN13	5783	genome.wustl.edu	37	4	87622936	87622936	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:87622936G>T	ENST00000411767.2	+	7	1240	c.1177G>T	c.(1177-1179)Gaa>Taa	p.E393*	PTPN13_ENST00000427191.2_Nonsense_Mutation_p.E393*|PTPN13_ENST00000316707.6_Nonsense_Mutation_p.E393*|PTPN13_ENST00000436978.1_Nonsense_Mutation_p.E393*|PTPN13_ENST00000511467.1_Nonsense_Mutation_p.E393*			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	393					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GGTTCTGAGGGAAGCCATGAA	0.353																																																	0													40.0	38.0	39.0					4																	87622936		1841	4090	5931	SO:0001587	stop_gained	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1177G>T	4.37:g.87622936G>T	ENSP00000407249:p.Glu393*		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Nonsense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E393*	ENST00000411767.2	37	c.1177	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	43	9.915973	0.99294	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	.	.	.	6.03	5.15	0.70609	.	0.120487	0.36778	N	0.002418	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.2451	0.60018	0.0797:0.0:0.9203:0.0	.	.	.	.	X	393;393;393;393;393;361	.	ENSP00000322675:E393X	E	+	1	0	PTPN13	87841960	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.074000	0.64401	1.469000	0.48083	0.655000	0.94253	GAA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13	ENSG00000163629		0.353	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	60	0	G			87622936	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	nonsense	28.00	36	14	SNP	1.000	T
PTPN13	5783	genome.wustl.edu	37	4	87694054	87694054	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:87694054A>T	ENST00000411767.2	+	32	5355	c.5292A>T	c.(5290-5292)caA>caT	p.Q1764H	PTPN13_ENST00000427191.2_Missense_Mutation_p.Q1745H|PTPN13_ENST00000316707.6_Missense_Mutation_p.Q1573H|PTPN13_ENST00000436978.1_Missense_Mutation_p.Q1769H|PTPN13_ENST00000511467.1_Missense_Mutation_p.Q1769H			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1764					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CAACTAGACAAGAAAACTGGA	0.343																																																	0													86.0	83.0	84.0					4																	87694054		1824	4074	5898	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5292A>T	4.37:g.87694054A>T	ENSP00000407249:p.Gln1764His		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.Q1769H	ENST00000411767.2	37	c.5307	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	A	12.67	2.006833	0.35415	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.53206	0.63;0.63;0.74;0.63;0.63	5.77	-0.954	0.10359	PDZ/DHR/GLGF (1);	0.484785	0.17349	N	0.177442	T	0.39036	0.1063	L	0.40543	1.245	0.09310	N	1	B;P;P;P	0.44309	0.001;0.828;0.832;0.738	B;P;B;B	0.46940	0.001;0.532;0.332;0.413	T	0.27640	-1.0068	10	0.51188	T	0.08	.	5.9547	0.19267	0.4717:0.0:0.4005:0.1278	.	1573;1745;1764;1769	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	H	1745;1769;1573;1764;1769;1713	ENSP00000408368:Q1745H;ENSP00000394794:Q1769H;ENSP00000322675:Q1573H;ENSP00000407249:Q1764H;ENSP00000426626:Q1769H	ENSP00000322675:Q1573H	Q	+	3	2	PTPN13	87913078	0.844000	0.29557	0.049000	0.19019	0.328000	0.28507	1.167000	0.31847	-0.368000	0.08040	0.455000	0.32223	CAA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,superfamily_PDZ	ENSG00000163629		0.343	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	60	0	A			87694054	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	missense	34.00	33	17	SNP	0.054	T
PXDN	7837	genome.wustl.edu	37	2	1652938	1652938	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:1652938C>T	ENST00000252804.4	-	17	2664	c.2614G>A	c.(2614-2616)Ggg>Agg	p.G872R		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	872					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CAGCGGGCCCCGCTCCTGGCC	0.647																																																	0													16.0	19.0	18.0					2																	1652938		2112	4202	6314	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2614G>A	2.37:g.1652938C>T	ENSP00000252804:p.Gly872Arg		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.G872R	ENST00000252804.4	37	c.2614	CCDS46221.1	2	.	.	.	.	.	.	.	.	.	.	C	14.26	2.483222	0.44147	.	.	ENSG00000130508	ENST00000252804	T	0.75050	-0.9	5.36	5.36	0.76844	.	0.249218	0.41712	D	0.000837	T	0.63295	0.2499	L	0.31371	0.925	0.52501	D	0.999958	B	0.06786	0.001	B	0.15484	0.013	T	0.58589	-0.7610	10	0.39692	T	0.17	-40.6257	12.8228	0.57702	0.0:0.9249:0.0:0.0751	.	872	Q92626	PXDN_HUMAN	R	872	ENSP00000252804:G872R	ENSP00000252804:G872R	G	-	1	0	PXDN	1631945	1.000000	0.71417	0.322000	0.25334	0.661000	0.39034	5.971000	0.70440	2.683000	0.91414	0.558000	0.71614	GGG	PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.647	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	-	0.00	36	0	C	XM_056455		1652938	-1	tier1	-	no_errors	ENST00000252804	ensembl	human	known	74_37	missense	32.00	17	8	SNP	0.975	T
PYGB	5834	genome.wustl.edu	37	20	25260915	25260915	+	Missense_Mutation	SNP	C	C	T	rs201517237		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:25260915C>T	ENST00000216962.4	+	10	1216	c.1106C>T	c.(1105-1107)aCg>aTg	p.T369M		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	369					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TGGGAAATCACGAAGAAGACC	0.562																																																	0								C	MET/THR	0,4406		0,0,2203	125.0	113.0	117.0		1106	3.8	1.0	20		117	1,8599	1.2+/-3.3	0,1,4299	no	missense	PYGB	NM_002862.3	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	369/844	25260915	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.1106C>T	20.37:g.25260915C>T	ENSP00000216962:p.Thr369Met		Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.T369M	ENST00000216962.4	37	c.1106	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	C	18.30	3.594739	0.66219	0.0	1.16E-4	ENSG00000100994	ENST00000216962	D	0.94376	-3.41	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	D	0.97657	0.9232	H	0.96111	3.77	0.80722	D	1	D	0.89917	1.0	D	0.72338	0.977	D	0.99094	1.0841	10	0.87932	D	0	-24.3465	15.908	0.79445	0.0:1.0:0.0:0.0	.	369	P11216	PYGB_HUMAN	M	369	ENSP00000216962:T369M	ENSP00000216962:T369M	T	+	2	0	PYGB	25208915	0.992000	0.36948	1.000000	0.80357	0.832000	0.47134	3.026000	0.49689	2.144000	0.66660	0.462000	0.41574	ACG	PYGB	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.562	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	-	0.00	49	0	C	NM_002862		25260915	+1	tier1	rs201517237	no_errors	ENST00000216962	ensembl	human	known	74_37	missense	20.00	16	4	SNP	1.000	T
R3HCC1L	27291	genome.wustl.edu	37	10	99969226	99969226	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:99969226C>A	ENST00000298999.3	+	5	1658	c.1355C>A	c.(1354-1356)tCa>tAa	p.S452*	R3HCC1L_ENST00000370586.2_Intron|R3HCC1L_ENST00000370584.3_Nonsense_Mutation_p.S452*|R3HCC1L_ENST00000314594.5_5'UTR	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	452							nucleotide binding (GO:0000166)										GAGAGTATTTCATCTCATTTT	0.393																																																	0													75.0	72.0	73.0					10																	99969226		2203	4300	6503	SO:0001587	stop_gained	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1355C>A	10.37:g.99969226C>A	ENSP00000298999:p.Ser452*		O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Nonsense_Mutation	SNP	NULL	p.S452*	ENST00000298999.3	37	c.1355	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847813	0.91277	.	.	ENSG00000166024	ENST00000370584;ENST00000298999	.	.	.	5.17	3.29	0.37713	.	0.861732	0.10249	N	0.697410	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.5609	8.2376	0.31636	0.0:0.8097:0.0:0.1903	.	.	.	.	X	452	.	.	S	+	2	0	C10orf28	99959216	0.996000	0.38824	0.985000	0.45067	0.187000	0.23431	1.989000	0.40707	1.177000	0.42855	0.655000	0.94253	TCA	R3HCC1L	-	NULL	ENSG00000166024		0.393	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1	-	0.00	20	0	C	NM_014472		99969226	+1	tier1	-	no_errors	ENST00000370584	ensembl	human	known	74_37	nonsense	19.05	17	4	SNP	0.948	A
RAB25	57111	genome.wustl.edu	37	1	156031064	156031064	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:156031064C>T	ENST00000361084.5	+	0	114				RAB25_ENST00000487325.1_3'UTR	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family						positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					GCAGAAGTCCCCTTACCCCCA	0.582																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.-128C>T	1.37:g.156031064C>T			Q5VYA2|Q8NG24|Q96GB1|Q9BT12	RNA	SNP	-	NULL	ENST00000361084.5	37	NULL	CCDS41413.1	1																																																																																			RAB25	-	-	ENSG00000132698		0.582	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB25	HGNC	protein_coding	OTTHUMT00000046185.1	-	0.00	49	0	C			156031064	+1	tier1	-	no_errors	ENST00000463614	ensembl	human	known	74_37	rna	35.90	25	14	SNP	0.000	T
RAB25	57111	genome.wustl.edu	37	1	156035800	156035800	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:156035800G>T	ENST00000361084.5	+	2	383	c.142G>T	c.(142-144)Gag>Tag	p.E48*	RAB25_ENST00000487325.1_Intron	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	48					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)	p.E52Q(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					CATCGGGGTTGAGTTCTCCAC	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											63.0	68.0	67.0					1																	156035800		2157	4274	6431	SO:0001587	stop_gained	0			AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.142G>T	1.37:g.156035800G>T	ENSP00000354376:p.Glu48*		Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E48*	ENST00000361084.5	37	c.142	CCDS41413.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.352753	0.97498	.	.	ENSG00000132698	ENST00000361084	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.0139	0.89232	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000354376:E48X	E	+	1	0	RAB25	154302424	1.000000	0.71417	0.973000	0.42090	0.981000	0.71138	9.525000	0.98039	2.828000	0.97474	0.655000	0.94253	GAG	RAB25	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000132698		0.607	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB25	HGNC	protein_coding	OTTHUMT00000046185.1		0.00	63	0	G			156035800	+1			no_errors	ENST00000361084	ensembl	human	known	74_37	nonsense	6.52	43	3	SNP	1.000	T
RABEPK	10244	genome.wustl.edu	37	9	127975666	127975666	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:127975666T>G	ENST00000373538.3	+	4	539	c.229T>G	c.(229-231)Tta>Gta	p.L77V	RABEPK_ENST00000394124.4_Missense_Mutation_p.L77V|RABEPK_ENST00000394125.4_Missense_Mutation_p.L77V|RABEPK_ENST00000259460.8_Intron|RABEPK_ENST00000373544.1_Missense_Mutation_p.L77V	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	77					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						CCAGTGGGACTTAGATACCTG	0.493																																																	0													124.0	116.0	119.0					9																	127975666		2203	4300	6503	SO:0001583	missense	0			BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.229T>G	9.37:g.127975666T>G	ENSP00000362639:p.Leu77Val		A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1	p.L77V	ENST00000373538.3	37	c.229	CCDS6862.1	9	.	.	.	.	.	.	.	.	.	.	T	8.636	0.894931	0.17613	.	.	ENSG00000136933	ENST00000394125;ENST00000373544;ENST00000394124;ENST00000373538;ENST00000416065	T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18	5.47	-1.17	0.09648	Galactose oxidase, beta-propeller (1);	1.232540	0.05721	N	0.597690	T	0.13841	0.0335	L	0.34521	1.04	0.09310	N	1	B;B	0.24317	0.101;0.036	B;B	0.28916	0.096;0.05	T	0.36407	-0.9749	10	0.29301	T	0.29	-0.0224	0.3915	0.00411	0.3991:0.206:0.147:0.2479	.	77;77	Q7Z6M1;Q5T1S4	RABEK_HUMAN;.	V	77;77;77;77;160	ENSP00000377683:L77V;ENSP00000362645:L77V;ENSP00000377682:L77V;ENSP00000362639:L77V;ENSP00000402234:L160V	ENSP00000362639:L77V	L	+	1	2	RABEPK	127015487	0.010000	0.17322	0.005000	0.12908	0.663000	0.39108	1.401000	0.34589	0.055000	0.16094	0.482000	0.46254	TTA	RABEPK	-	pfam_Kelch_2	ENSG00000136933		0.493	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEPK	HGNC	protein_coding	OTTHUMT00000054064.1	-	0.00	43	0	T	NM_005833		127975666	+1	tier1	-	no_errors	ENST00000373538	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.000	G
RALY	22913	genome.wustl.edu	37	20	32661373	32661373	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:32661373C>T	ENST00000246194.3	+	4	763	c.261C>T	c.(259-261)atC>atT	p.I87I	RALY_ENST00000493399.1_3'UTR|RALY_ENST00000375114.3_Silent_p.I87I	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	87	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						ACACAGACATCAACATGGCTG	0.522																																																	0													158.0	128.0	138.0					20																	32661373		2203	4300	6503	SO:0001819	synonymous_variant	0			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.261C>T	20.37:g.32661373C>T			Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.I87	ENST00000246194.3	37	c.261	CCDS13230.1	20																																																																																			RALY	-	smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	ENSG00000125970		0.522	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	HGNC	protein_coding	OTTHUMT00000078753.1	-	0.00	41	0	C			32661373	+1	tier1	-	no_errors	ENST00000246194	ensembl	human	known	74_37	silent	36.51	40	23	SNP	1.000	T
RALY	22913	genome.wustl.edu	37	20	32663702	32663702	+	Missense_Mutation	SNP	C	C	G	rs368442158		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:32663702C>G	ENST00000246194.3	+	6	902	c.400C>G	c.(400-402)Ctg>Gtg	p.L134V	RALY_ENST00000493399.1_3'UTR|RALY_ENST00000375114.3_Missense_Mutation_p.L118V	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	134					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						CCGGGGCCGTCTGTCGCCCGT	0.632																																																	0								C	VAL/LEU,VAL/LEU	1,4405	2.1+/-5.4	0,1,2202	26.0	25.0	25.0		400,352	3.1	1.0	20		25	0,8598		0,0,4299	no	missense,missense	RALY	NM_016732.2,NM_007367.3	32,32	0,1,6501	GG,GC,CC		0.0,0.0227,0.0077	benign,benign	134/307,118/291	32663702	1,13003	2203	4299	6502	SO:0001583	missense	0			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.400C>G	20.37:g.32663702C>G	ENSP00000246194:p.Leu134Val		Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.L134V	ENST00000246194.3	37	c.400	CCDS13230.1	20	.	.	.	.	.	.	.	.	.	.	C	4.443	0.081959	0.08533	2.27E-4	0.0	ENSG00000125970	ENST00000375114;ENST00000448364;ENST00000246194;ENST00000333552;ENST00000442805	T;T;T;T;T	0.14266	3.36;3.32;3.46;2.52;3.36	5.06	3.14	0.36123	.	0.072557	0.52532	D	0.000067	T	0.03220	0.0094	N	0.00815	-1.16	0.30756	N	0.744609	B;B	0.21452	0.056;0.056	B;B	0.23716	0.048;0.016	T	0.35674	-0.9779	10	0.07482	T	0.82	-3.2176	6.2875	0.21041	0.0:0.5654:0.2612:0.1734	.	118;134	Q9UKM9-2;Q9UKM9	.;RALY_HUMAN	V	118;134;134;68;118	ENSP00000364255:L118V;ENSP00000413638:L134V;ENSP00000246194:L134V;ENSP00000327522:L68V;ENSP00000415973:L118V	ENSP00000246194:L134V	L	+	1	2	RALY	32127363	1.000000	0.71417	0.984000	0.44739	0.769000	0.43574	2.334000	0.43920	0.734000	0.32515	0.460000	0.39030	CTG	RALY	-	pirsf_hnRNP_C_Raly	ENSG00000125970		0.632	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	HGNC	protein_coding	OTTHUMT00000078753.1	-	0.00	87	0	C			32663702	+1	tier1	-	no_errors	ENST00000246194	ensembl	human	known	74_37	missense	24.44	68	22	SNP	1.000	G
RASGRF1	5923	genome.wustl.edu	37	15	79382679	79382679	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:79382679G>A	ENST00000419573.3	-	1	436	c.162C>T	c.(160-162)ttC>ttT	p.F54F	RASGRF1_ENST00000558480.2_Silent_p.F54F	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	54	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						AGTCGCTCTCGAAGTAGAAGA	0.647																																																	0													102.0	79.0	87.0					15																	79382679		2196	4293	6489	SO:0001819	synonymous_variant	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.162C>T	15.37:g.79382679G>A			F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.F54	ENST00000419573.3	37	c.162	CCDS10309.1	15																																																																																			RASGRF1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000058335		0.647	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	-	0.00	56	0	G	NM_002891		79382679	-1	tier1	-	no_errors	ENST00000419573	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	A
RBFOX1	54715	genome.wustl.edu	37	16	7647385	7647385	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:7647385A>T	ENST00000550418.1	+	9	1562	c.574A>T	c.(574-576)Aca>Tca	p.T192S	RBFOX1_ENST00000535565.2_Missense_Mutation_p.T149S|RBFOX1_ENST00000436368.2_Missense_Mutation_p.T212S|RBFOX1_ENST00000547372.1_Missense_Mutation_p.T235S|RBFOX1_ENST00000552089.1_Missense_Mutation_p.T209S|RBFOX1_ENST00000422070.4_Missense_Mutation_p.T235S|RBFOX1_ENST00000355637.4_Missense_Mutation_p.T212S|RBFOX1_ENST00000340209.4_Missense_Mutation_p.T197S|RBFOX1_ENST00000547338.1_Missense_Mutation_p.T192S|RBFOX1_ENST00000311745.5_Missense_Mutation_p.T212S|RBFOX1_ENST00000553186.1_Missense_Mutation_p.T192S	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	192	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						AAATAATGCCACAGCACGTGT	0.363																																					Ovarian(157;934 2567 15163 39509)												0													104.0	96.0	99.0					16																	7647385		2197	4300	6497	SO:0001583	missense	0			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.574A>T	16.37:g.7647385A>T	ENSP00000450031:p.Thr192Ser		Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.T235S	ENST00000550418.1	37	c.703	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	A	19.35	3.811003	0.70797	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3	5.96	5.96	0.96718	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.46946	0.1419	N	0.19112	0.55	0.80722	D	1	B;D;P;D;P;D;P;P;P	0.76494	0.198;0.999;0.58;0.999;0.863;0.992;0.858;0.765;0.725	B;D;P;D;P;D;P;B;P	0.80764	0.171;0.994;0.566;0.994;0.771;0.984;0.535;0.418;0.542	T	0.51980	-0.8636	10	0.87932	D	0	-7.2485	16.4484	0.83959	1.0:0.0:0.0:0.0	.	212;149;235;212;212;212;192;192;235	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	S	191;192;192;235;235;149;209;192;192;212;212;212;212;197	ENSP00000450402:T191S;ENSP00000450031:T192S;ENSP00000447753:T192S;ENSP00000446842:T235S;ENSP00000391269:T235S;ENSP00000448496:T209S;ENSP00000447281:T192S;ENSP00000447717:T192S;ENSP00000402745:T212S;ENSP00000309117:T212S;ENSP00000347855:T212S;ENSP00000344196:T197S	ENSP00000309117:T212S	T	+	1	0	RBFOX1	7587386	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.108000	0.94275	2.285000	0.76669	0.533000	0.62120	ACA	RBFOX1	-	pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	ENSG00000078328		0.363	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	HGNC	protein_coding	OTTHUMT00000409492.2		0.00	28	0	A	NM_145891		7647385	+1			no_errors	ENST00000547372	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
RFPL4A	342931	genome.wustl.edu	37	19	56273434	56273434	+	Silent	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:56273434A>C	ENST00000434937.2	+	2	439	c.268A>C	c.(268-270)Agg>Cgg	p.R90R		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	90	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						AATGAACCCAAGGATGAGGAA	0.433																																																	0													3.0	4.0	3.0					19																	56273434		584	1373	1957	SO:0001819	synonymous_variant	0				CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.268A>C	19.37:g.56273434A>C				Silent	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.R90	ENST00000434937.2	37	c.268	CCDS46201.1	19																																																																																			RFPL4A	-	pfam_RDM_domain_RFPL,superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000223638		0.433	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	RFPL4A	HGNC	protein_coding	OTTHUMT00000384184.1	-	0.00	66	0	A	XM_292796		56273434	+1	tier1	-	no_errors	ENST00000434937	ensembl	human	novel	74_37	silent	16.00	42	8	SNP	0.190	C
RIMS1	22999	genome.wustl.edu	37	6	73111014	73111014	+	IGR	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:73111014A>C	ENST00000521978.1	+	0	5079				RIMS1_ENST00000348717.5_3'UTR|RIMS1_ENST00000264839.7_3'UTR|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000414192.2_3'UTR	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AAAGGGCTGAAGTAGTCTCTG	0.373																																																	0																																										SO:0001628	intergenic_variant	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009		6.37:g.73111014A>C			A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	RNA	SNP	-	NULL	ENST00000521978.1	37	NULL	CCDS47449.1	6																																																																																			RIMS1	-	-	ENSG00000079841		0.373	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	33	0	A			73111014	+1	tier1	-	no_errors	ENST00000431478	ensembl	human	known	74_37	rna	61.54	10	16	SNP	1.000	C
RFX6	222546	genome.wustl.edu	37	6	117240321	117240321	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:117240321T>G	ENST00000332958.2	+	11	1060	c.1044T>G	c.(1042-1044)aaT>aaG	p.N348K		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	348					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						ACATAAGAAATTTTGCTAAAA	0.313																																																	0													88.0	89.0	89.0					6																	117240321		2203	4300	6503	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1044T>G	6.37:g.117240321T>G	ENSP00000332208:p.Asn348Lys		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.N348K	ENST00000332958.2	37	c.1044	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	T	13.84	2.357404	0.41801	.	.	ENSG00000185002	ENST00000332958	T	0.59083	0.29	6.08	3.74	0.42951	.	0.090781	0.85682	D	0.000000	T	0.19644	0.0472	L	0.32530	0.975	0.49915	D	0.999836	B	0.31318	0.319	B	0.24006	0.05	T	0.06320	-1.0833	10	0.13853	T	0.58	-30.0351	7.7046	0.28642	0.0:0.2417:0.0:0.7583	.	348	Q8HWS3	RFX6_HUMAN	K	348	ENSP00000332208:N348K	ENSP00000332208:N348K	N	+	3	2	RFX6	117347014	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.744000	0.38268	0.554000	0.29061	0.482000	0.46254	AAT	RFX6	-	NULL	ENSG00000185002		0.313	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	-	0.00	79	0	T	NM_173560		117240321	+1	tier1	-	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	50.00	35	35	SNP	1.000	G
RNF10	9921	genome.wustl.edu	37	12	121004647	121004647	+	Silent	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:121004647C>A	ENST00000325954.4	+	13	2366	c.1905C>A	c.(1903-1905)ccC>ccA	p.P635P	RNF10_ENST00000413266.2_Silent_p.P640P	NM_014868.4	NP_055683.3	Q8N5U6	RNF10_HUMAN	ring finger protein 10	635					negative regulation of Schwann cell proliferation (GO:0010626)|positive regulation of myelination (GO:0031643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autoubiquitination (GO:0051865)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	27	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TCCACATTCCCCTCGAGAATC	0.458																																																	0													111.0	110.0	110.0					12																	121004647		2203	4300	6503	SO:0001819	synonymous_variant	0			AB027196	CCDS9201.1	12q23-q24	2013-01-09			ENSG00000022840	ENSG00000022840		"""RING-type (C3HC4) zinc fingers"""	10055	protein-coding gene	gene with protein product							Standard	NM_014868		Approved	KIAA0262, RIE2	uc001typ.4	Q8N5U6	OTTHUMG00000168999	ENST00000325954.4:c.1905C>A	12.37:g.121004647C>A			Q92550|Q9NPP8|Q9ULW4	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P640	ENST00000325954.4	37	c.1920	CCDS9201.1	12																																																																																			RNF10	-	NULL	ENSG00000022840		0.458	RNF10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF10	HGNC	protein_coding	OTTHUMT00000401898.4		0.00	61	0	C			121004647	+1			no_errors	ENST00000413266	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.998	A
RPL10L	140801	genome.wustl.edu	37	14	47120705	47120705	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:47120705T>G	ENST00000298283.3	-	1	323	c.235A>C	c.(235-237)Agt>Cgt	p.S79R		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	79					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						CTGCCACAACTTTTCACCATG	0.537																																																	0													69.0	68.0	69.0					14																	47120705		2203	4300	6503	SO:0001583	missense	0			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.235A>C	14.37:g.47120705T>G	ENSP00000298283:p.Ser79Arg		Q8IUD1	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.S79R	ENST00000298283.3	37	c.235	CCDS32071.1	14	.	.	.	.	.	.	.	.	.	.	T	11.75	1.731962	0.30684	.	.	ENSG00000165496	ENST00000298283	T	0.72282	-0.64	4.17	3.02	0.34903	Ribosomal protein L10e/L16 (2);	0.095984	0.64402	D	0.000001	T	0.61299	0.2336	L	0.42529	1.33	0.42704	D	0.993623	B	0.12013	0.005	B	0.31390	0.129	T	0.53129	-0.8482	10	0.25106	T	0.35	-34.948	8.0843	0.30762	0.0:0.0988:0.0:0.9012	.	79	Q96L21	RL10L_HUMAN	R	79	ENSP00000298283:S79R	ENSP00000298283:S79R	S	-	1	0	RPL10L	46190455	1.000000	0.71417	0.209000	0.23619	0.975000	0.68041	5.523000	0.67099	0.935000	0.37341	0.533000	0.62120	AGT	RPL10L	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000165496		0.537	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	HGNC	protein_coding	OTTHUMT00000349819.1	-	0.00	60	0	T			47120705	-1	tier1	-	no_errors	ENST00000298283	ensembl	human	known	74_37	missense	50.88	27	29	SNP	0.995	G
RRAGB	10325	genome.wustl.edu	37	X	55755727	55755727	+	Splice_Site	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:55755727T>G	ENST00000262850.7	+	5	754	c.311T>G	c.(310-312)tTt>tGt	p.F104C	RRAGB_ENST00000374941.4_Splice_Site_p.I76S	NM_016656.3	NP_057740.2			Ras-related GTP binding B											breast(1)|endometrium(3)|large_intestine(5)|lung(3)|pancreas(1)|prostate(1)	14						TGTCTTCCAGTTGATGTAGAA	0.383																																																	0													191.0	156.0	168.0					X																	55755727		2203	4300	6503	SO:0001630	splice_region_variant	0			X90530	CCDS14371.1, CCDS14372.1	Xp11.21	2008-02-05			ENSG00000083750	ENSG00000083750			19901	protein-coding gene	gene with protein product		300725				7499430, 9394008	Standard	NM_006064		Approved		uc004dup.3	Q5VZM2	OTTHUMG00000021662	ENST00000262850.7:c.311-1T>G	X.37:g.55755727T>G				Missense_Mutation	SNP	pfam_Gtr1_RagA,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase	p.F104C	ENST00000262850.7	37	c.311	CCDS14372.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	16.92|16.92	3.254926|3.254926	0.59321|0.59321	.|.	.|.	ENSG00000083750|ENSG00000083750	ENST00000262850|ENST00000374941;ENST00000414239	.|T;T	.|0.68181	.|-0.31;-0.22	5.03|5.03	3.87|3.87	0.44632|0.44632	.|.	0.104080|.	0.39210|.	N|.	0.001433|.	T|T	0.65176|0.65176	0.2666|0.2666	M|M	0.86028|0.86028	2.79|2.79	0.38452|0.38452	D|D	0.946988|0.946988	P|P	0.39326|0.42409	0.668|0.779	B|B	0.35413|0.36719	0.202|0.231	T|T	0.67507|0.67507	-0.5653|-0.5653	8|8	.|.	.|.	.|.	.|.	8.2018|8.2018	0.31430|0.31430	0.0:0.0978:0.0:0.9022|0.0:0.0978:0.0:0.9022	.|.	104|76	Q5VZM2|Q5VZM2-2	RRAGB_HUMAN|.	C|S	104|76;38	.|ENSP00000364077:I76S;ENSP00000410630:I38S	.|.	F|I	+|+	2|2	0|0	RRAGB|RRAGB	55772452|55772452	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.496000|7.496000	0.81526|0.81526	0.699000|0.699000	0.31761|0.31761	0.483000|0.483000	0.47432|0.47432	TTT|ATT	RRAGB	-	pfam_Gtr1_RagA,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase	ENSG00000083750		0.383	RRAGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRAGB	HGNC	protein_coding	OTTHUMT00000056878.1	-	0.00	122	0	T	NM_016656	Missense_Mutation	55755727	+1	tier1	-	no_errors	ENST00000262850	ensembl	human	known	74_37	missense	27.78	65	25	SNP	1.000	G
SCAF4	57466	genome.wustl.edu	37	21	33043955	33043958	+	Frame_Shift_Del	DEL	CTCT	CTCT	-	rs142270458		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	CTCT	CTCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:33043955_33043958delCTCT	ENST00000286835.7	-	20	3580_3583	c.3198_3201delAGAG	c.(3196-3201)agagagfs	p.RE1066fs	SCAF4_ENST00000434667.3_Frame_Shift_Del_p.RE1051fs|SCAF4_ENST00000399804.1_Frame_Shift_Del_p.RE1044fs	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	1066						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CTCTACGAGACTCTCTATCTCTAG	0.529																																																	0																																										SO:0001589	frameshift_variant	0			AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.3198_3201delAGAG	21.37:g.33043955_33043958delCTCT	ENSP00000286835:p.Arg1066fs		C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Frame_Shift_Del	DEL	pfam_RNA_pol_II-bd,pfam_RRM_dom,superfamily_ENTH_VHS,smart_CID_dom,smart_RRM_dom,pfscan_RRM_dom	p.R1066fs	ENST00000286835.7	37	c.3201_3198	CCDS33537.1	21																																																																																			SCAF4	-	NULL	ENSG00000156304		0.529	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCAF4	HGNC	protein_coding	OTTHUMT00000192659.1		0.00	43	0	CTCT	XM_047889		33043958	-1	tier1		no_errors	ENST00000286835	ensembl	human	known	74_37	frame_shift_del	40.00	12	8	DEL	0.915:1.000:1.000:1.000	-
SCD	6319	genome.wustl.edu	37	10	102107836	102107838	+	In_Frame_Del	DEL	ACC	ACC	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	ACC	ACC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:102107836_102107838delACC	ENST00000370355.2	+	2	424_426	c.43_45delACC	c.(43-45)accdel	p.T19del	RP11-34D15.2_ENST00000429420.1_RNA	NM_005063.4	NP_005054.3	O00767	ACOD_HUMAN	stearoyl-CoA desaturase (delta-9-desaturase)	19					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|large_intestine(3)|lung(5)	9		Colorectal(252;0.0323)		Epithelial(162;1.97e-10)|all cancers(201;1.73e-08)		TAGCTCCTATACCACCACCACCA	0.581																																					Colon(67;260 1459 9574 11663)												0																																										SO:0001651	inframe_deletion	0			AF097514	CCDS7493.1	10q23-q24	2013-01-25			ENSG00000099194	ENSG00000099194	1.14.19.1	"""Fatty acid desaturases"""	10571	protein-coding gene	gene with protein product	"""acyl-CoA desaturase"", ""fatty acid desaturase"", ""delta-9-desaturase"""	604031	"""stearoyl-CoA desaturase opposite strand"""	SCDOS		7909540, 10229681	Standard	NM_005063		Approved	FADS5	uc001kqy.3	O00767	OTTHUMG00000018906	ENST00000370355.2:c.43_45delACC	10.37:g.102107845_102107847delACC	ENSP00000359380:p.Thr19del		B2R5U0|D3DR68|Q16150|Q53GR9|Q5W037|Q5W038|Q6GSS4|Q96KF6|Q9BS07|Q9Y695	In_Frame_Del	DEL	pfam_Fatty_acid_desaturase-1,prints_Fatty_acid_desaturase-1_core	p.T18in_frame_del	ENST00000370355.2	37	c.43_45	CCDS7493.1	10																																																																																			SCD	-	NULL	ENSG00000099194		0.581	SCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCD	HGNC	protein_coding	OTTHUMT00000049857.2		0.00	33	0	ACC	NM_005063		102107838	+1	tier1		no_errors	ENST00000370355	ensembl	human	known	74_37	in_frame_del	5.00	38	2	DEL	0.998:0.990:0.094	-
SCN3A	6328	genome.wustl.edu	37	2	166003485	166003485	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:166003485C>A	ENST00000360093.3	-	12	1926	c.1435G>T	c.(1435-1437)Gga>Tga	p.G479*	RN7SL455P_ENST00000580629.1_RNA|SCN3A_ENST00000283254.7_Nonsense_Mutation_p.G479*|SCN3A_ENST00000409101.3_Nonsense_Mutation_p.G479*	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	479					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACAGCTCTCCTAACCCACCT	0.443																																																	0													114.0	116.0	115.0					2																	166003485		2203	4300	6503	SO:0001587	stop_gained	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.1435G>T	2.37:g.166003485C>A	ENSP00000353206:p.Gly479*		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.G479*	ENST00000360093.3	37	c.1435		2	.	.	.	.	.	.	.	.	.	.	C	43	10.261439	0.99370	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	.	.	.	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.922	0.97089	0.0:1.0:0.0:0.0	.	.	.	.	X	479	.	ENSP00000283254:G479X	G	-	1	0	SCN3A	165711731	0.931000	0.31567	0.976000	0.42696	0.870000	0.49936	1.830000	0.39131	2.780000	0.95670	0.655000	0.94253	GGA	SCN3A	-	NULL	ENSG00000153253		0.443	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding			0.00	42	0	C	NM_006922		166003485	-1			no_errors	ENST00000283254	ensembl	human	known	74_37	nonsense	6.25	45	3	SNP	0.999	A
SCN5A	6331	genome.wustl.edu	37	3	38639278	38639278	+	Missense_Mutation	SNP	G	G	T	rs137854611		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:38639278G>T	ENST00000333535.4	-	14	2353	c.2204C>A	c.(2203-2205)gCg>gAg	p.A735E	SCN5A_ENST00000455624.2_Missense_Mutation_p.A735E|SCN5A_ENST00000423572.2_Missense_Mutation_p.A735E|SCN5A_ENST00000414099.2_Missense_Mutation_p.A735E|SCN5A_ENST00000413689.1_Missense_Mutation_p.A735E|SCN5A_ENST00000450102.2_Missense_Mutation_p.A735E|SCN5A_ENST00000443581.1_Missense_Mutation_p.A735E|SCN5A_ENST00000425664.1_Missense_Mutation_p.A735E|SCN5A_ENST00000451551.2_Missense_Mutation_p.A735E|SCN5A_ENST00000449557.2_Missense_Mutation_p.A735E			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	735			A -> E (in BRGDA1). {ECO:0000269|PubMed:11901046}.|A -> V (in BRGDA1 and SSS1; expresses currents with steady state activation voltage shifted to more positive potentials and exhibit reduced sodium channel current at the end of phase I of the action potential). {ECO:0000269|PubMed:22795782}.		AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.A735V(1)		NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GTGCTCCAGCGCCATGAAGAG	0.532																																																	1	Substitution - Missense(1)	large_intestine(1)	GRCh37	CM020302|CM024639	SCN5A	M	rs137854611						133.0	132.0	132.0					3																	38639278		2105	4231	6336	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2204C>A	3.37:g.38639278G>T	ENSP00000328968:p.Ala735Glu		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.A735E	ENST00000333535.4	37	c.2204	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646921	0.67358	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97642	-4.47;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47;-4.47	4.68	4.68	0.58851	.	0.053822	0.85682	N	0.000000	D	0.98899	0.9627	H	0.94847	3.59	0.80722	D	1	D;B;D;D;B;B;B	0.89917	1.0;0.004;1.0;1.0;0.004;0.096;0.008	D;B;D;D;B;B;B	0.91635	0.997;0.003;0.999;0.997;0.003;0.069;0.008	D	0.99616	1.0982	10	0.87932	D	0	.	17.7531	0.88440	0.0:0.0:1.0:0.0	.	735;735;735;735;735;735;735	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	E	735	ENSP00000398962:A735E;ENSP00000398266:A735E;ENSP00000410257:A735E;ENSP00000388797:A735E;ENSP00000397915:A735E;ENSP00000416634:A735E;ENSP00000328968:A735E;ENSP00000399524:A735E;ENSP00000403355:A735E;ENSP00000413996:A735E	ENSP00000328968:A735E	A	-	2	0	SCN5A	38614282	1.000000	0.71417	0.964000	0.40570	0.983000	0.72400	9.545000	0.98095	2.440000	0.82611	0.491000	0.48974	GCG	SCN5A	-	NULL	ENSG00000183873		0.532	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1		0.00	87	0	G	NM_198056		38639278	-1			no_errors	ENST00000333535	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
SCN8A	6334	genome.wustl.edu	37	12	52078015	52078015	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:52078015T>A	ENST00000354534.6	+	3	512	c.334T>A	c.(334-336)Ttg>Atg	p.L112M	SCN8A_ENST00000545061.1_Missense_Mutation_p.L112M|SCN8A_ENST00000550891.1_Missense_Mutation_p.L112M	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	112					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CACGCCTGCCTTGTACATTTT	0.363																																																	0													98.0	98.0	98.0					12																	52078015		1861	4095	5956	SO:0001583	missense	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.334T>A	12.37:g.52078015T>A	ENSP00000346534:p.Leu112Met		B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L112M	ENST00000354534.6	37	c.334	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	T	20.4	3.984177	0.74474	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D;D	0.97850	-4.5;-4.57;-4.48;-4.36	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000003	D	0.98140	0.9386	M	0.81614	2.55	0.58432	D	0.999997	D	0.67145	0.996	P	0.57548	0.823	D	0.98083	1.0405	10	0.41790	T	0.15	.	14.9233	0.70856	0.0:0.0:0.0:1.0	.	112	Q9UQD0	SCN8A_HUMAN	M	112;112;112;112;25	ENSP00000448415:L112M;ENSP00000346534:L112M;ENSP00000440360:L112M;ENSP00000347255:L112M	ENSP00000346534:L112M	L	+	1	2	SCN8A	50364282	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.777000	0.38604	2.178000	0.69098	0.533000	0.62120	TTG	SCN8A	-	NULL	ENSG00000196876		0.363	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	-	0.00	57	0	T	NM_014191		52078015	+1	tier1	-	no_errors	ENST00000354534	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	A
SEC14L5	9717	genome.wustl.edu	37	16	5057472	5057472	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:5057472C>T	ENST00000251170.7	+	13	1737	c.1557C>T	c.(1555-1557)cgC>cgT	p.R519R		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	519	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						GCGTGCTCCGCGGAGCCCCCC	0.637																																																	0													25.0	28.0	27.0					16																	5057472		1942	4135	6077	SO:0001819	synonymous_variant	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1557C>T	16.37:g.5057472C>T				Silent	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.R519	ENST00000251170.7	37	c.1557	CCDS45403.1	16																																																																																			SEC14L5	-	superfamily_GOLD,pfscan_GOLD	ENSG00000103184		0.637	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	-	0.00	39	0	C			5057472	+1	tier1	-	no_errors	ENST00000251170	ensembl	human	known	74_37	silent	40.74	16	11	SNP	0.406	T
SEC22B	9554	genome.wustl.edu	37	1	145116327	145116327	+	RNA	DEL	G	G	-	rs201829862|rs66718856|rs57905231|rs558269907|rs67374323|rs1822848|rs71248028	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:145116327delG	ENST00000453618.1	+	0	1413							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											ttgtttttttgttttttttGA	0.323																																																	0																																												0			AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145116327delG			A8K1G0	RNA	DEL	-	NULL	ENST00000453618.1	37	NULL		1																																																																																			SEC22B	-	-	ENSG00000223380		0.323	SEC22B-001	KNOWN	basic	processed_transcript	SEC22B	HGNC	processed_transcript	OTTHUMT00000038523.5		0.00	96	0	G	NM_004892		145116327	+1			no_errors	ENST00000453618	ensembl	human	known	74_37	rna	8.60	85	8	DEL	0.005	0
SEMA3D	223117	genome.wustl.edu	37	7	84666287	84666287	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:84666287T>C	ENST00000284136.6	-	10	1152	c.1109A>G	c.(1108-1110)aAt>aGt	p.N370S	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	370	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						ATATGGACCATTAAAAACTGC	0.418																																					Ovarian(63;442 1191 17318 29975 31528)												0													125.0	108.0	114.0					7																	84666287		2203	4300	6503	SO:0001583	missense	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1109A>G	7.37:g.84666287T>C	ENSP00000284136:p.Asn370Ser		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.N370S	ENST00000284136.6	37	c.1109	CCDS34676.1	7	.	.	.	.	.	.	.	.	.	.	T	17.75	3.467157	0.63625	.	.	ENSG00000153993	ENST00000284136	T	0.11930	2.73	5.89	5.89	0.94794	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.21186	0.0510	L	0.31845	0.965	0.80722	D	1	P	0.49447	0.924	P	0.52957	0.714	T	0.00453	-1.1730	10	0.46703	T	0.11	.	16.3071	0.82852	0.0:0.0:0.0:1.0	.	370	O95025	SEM3D_HUMAN	S	370	ENSP00000284136:N370S	ENSP00000284136:N370S	N	-	2	0	SEMA3D	84504223	1.000000	0.71417	0.910000	0.35882	0.494000	0.33585	7.965000	0.87945	2.250000	0.74265	0.477000	0.44152	AAT	SEMA3D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000153993		0.418	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	-	0.00	34	0	T	NM_152754		84666287	-1	tier1	-	no_errors	ENST00000284136	ensembl	human	known	74_37	missense	60.00	8	12	SNP	1.000	C
SEMA3F	6405	genome.wustl.edu	37	3	50225291	50225291	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:50225291G>A	ENST00000002829.3	+	19	2585	c.2101G>A	c.(2101-2103)Gcc>Acc	p.A701T	SEMA3F_ENST00000413852.1_Missense_Mutation_p.A602T|SEMA3F_ENST00000434342.1_Missense_Mutation_p.A670T	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	701					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GGGCCGGGACGCCGTCCATGC	0.637																																																	0													55.0	43.0	47.0					3																	50225291		2203	4300	6503	SO:0001583	missense	0			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.2101G>A	3.37:g.50225291G>A	ENSP00000002829:p.Ala701Thr		C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Missense_Mutation	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.A701T	ENST00000002829.3	37	c.2101	CCDS2811.1	3	.	.	.	.	.	.	.	.	.	.	G	10.45	1.353878	0.24512	.	.	ENSG00000001617	ENST00000413852;ENST00000002829;ENST00000434342	T;T;T	0.52754	0.72;0.65;0.71	5.57	5.57	0.84162	.	0.406937	0.29616	N	0.011645	T	0.33904	0.0879	L	0.37630	1.12	0.45284	D	0.998287	B;B	0.27656	0.184;0.085	B;B	0.15870	0.014;0.011	T	0.12116	-1.0560	10	0.13108	T	0.6	.	12.4286	0.55561	0.0812:0.0:0.9188:0.0	.	670;701	C9JQ85;Q13275	.;SEM3F_HUMAN	T	602;701;670	ENSP00000388931:A602T;ENSP00000002829:A701T;ENSP00000409859:A670T	ENSP00000002829:A701T	A	+	1	0	SEMA3F	50200295	0.987000	0.35691	0.913000	0.36048	0.719000	0.41307	3.339000	0.52135	2.613000	0.88420	0.462000	0.41574	GCC	SEMA3F	-	NULL	ENSG00000001617		0.637	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3F	HGNC	protein_coding	OTTHUMT00000345929.1		0.00	27	0	G	NM_004186		50225291	+1			no_errors	ENST00000002829	ensembl	human	known	74_37	missense	50.00	2	2	SNP	0.953	A
SETX	23064	genome.wustl.edu	37	9	135204702	135204702	+	Silent	SNP	C	C	A	rs370328795		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:135204702C>A	ENST00000224140.5	-	10	2465	c.2283G>T	c.(2281-2283)tcG>tcT	p.S761S	SETX_ENST00000393220.1_Silent_p.S761S|SETX_ENST00000372169.2_Silent_p.S761S	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	761					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AATCTTCATTCGATGTGGACA	0.368																																																	0													118.0	114.0	116.0					9																	135204702		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.2283G>T	9.37:g.135204702C>A			A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Silent	SNP	superfamily_P-loop_NTPase	p.S761	ENST00000224140.5	37	c.2283	CCDS6947.1	9																																																																																			SETX	-	NULL	ENSG00000107290		0.368	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3		0.00	34	0	C	NM_015046		135204702	-1			no_errors	ENST00000372169	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.031	A
SEZ6	124925	genome.wustl.edu	37	17	27287688	27287688	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:27287688G>T	ENST00000317338.12	-	7	1839	c.1411C>A	c.(1411-1413)Ctc>Atc	p.L471I	SEZ6_ENST00000360295.9_Splice_Site_p.L471I|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000442608.3_Splice_Site_p.L471I|SEZ6_ENST00000335960.6_Splice_Site_p.L471I			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	471	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CGAATGATGAGCCTGAACCAG	0.587																																																	0													41.0	47.0	45.0					17																	27287688		2076	4207	6283	SO:0001630	splice_region_variant	0			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.1410-1C>A	17.37:g.27287688G>T			B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_CUB_dom,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.L471I	ENST00000317338.12	37	c.1411	CCDS45639.1	17	.	.	.	.	.	.	.	.	.	.	G	18.33	3.601197	0.66445	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000335960;ENST00000541381	T;T;T	0.41065	1.01;1.01;1.01	4.22	4.22	0.49857	CUB (5);	0.000000	0.64402	D	0.000002	T	0.63462	0.2513	M	0.76727	2.345	0.45025	D	0.998049	D;D	0.76494	0.999;0.993	D;D	0.79784	0.993;0.965	T	0.68284	-0.5449	10	0.72032	D	0.01	.	14.4785	0.67564	0.0:0.0:1.0:0.0	.	471;471	Q53EL9-3;Q53EL9	.;SEZ6_HUMAN	I	471;471;346;471;471	ENSP00000403784:L471I;ENSP00000353440:L471I;ENSP00000337407:L471I	ENSP00000312942:L346I	L	-	1	0	SEZ6	24311814	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.517000	0.35867	2.365000	0.80145	0.305000	0.20034	CTC	SEZ6	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000063015		0.587	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	-	0.00	62	0	G		Missense_Mutation	27287688	-1	tier1	-	no_errors	ENST00000317338	ensembl	human	known	74_37	missense	35.85	34	19	SNP	1.000	T
SH2D1B	117157	genome.wustl.edu	37	1	162368751	162368751	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:162368751T>C	ENST00000367929.2	-	3	434	c.325A>G	c.(325-327)Aga>Gga	p.R109G	SH2D1B_ENST00000359567.3_Intron	NM_053282.4	NP_444512.2	O14796	SH21B_HUMAN	SH2 domain containing 1B	109					leukocyte activation involved in immune response (GO:0002366)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of innate immune response (GO:0045089)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated immunity (GO:0002717)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of natural killer cell activation (GO:0032814)	intracellular (GO:0005622)	protein binding, bridging (GO:0030674)			kidney(1)|large_intestine(1)|lung(4)|pancreas(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			CCTCTCCATCTCAAGCTGGGG	0.413																																																	0													87.0	82.0	84.0					1																	162368751		2203	4300	6503	SO:0001583	missense	0			AF484964	CCDS30928.1	1q23.3	2013-02-14			ENSG00000198574	ENSG00000198574		"""SH2 domain containing"""	30416	protein-coding gene	gene with protein product		608510				9000139, 11689425	Standard	NM_053282		Approved	EAT2	uc001gbz.1	O14796	OTTHUMG00000031377	ENST00000367929.2:c.325A>G	1.37:g.162368751T>C	ENSP00000356906:p.Arg109Gly		B2RBN6|Q5T0L1|Q8NI18|Q969K9	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.R109G	ENST00000367929.2	37	c.325	CCDS30928.1	1	.	.	.	.	.	.	.	.	.	.	T	9.617	1.132826	0.21041	.	.	ENSG00000198574	ENST00000367929	D	0.81996	-1.56	4.66	-2.55	0.06288	.	2.413830	0.01380	N	0.012905	T	0.54255	0.1847	L	0.44542	1.39	0.23003	N	0.99845	B	0.06786	0.001	B	0.06405	0.002	T	0.36672	-0.9738	9	0.20046	T	0.44	-39.2905	5.5227	0.16941	0.0:0.185:0.4701:0.3449	.	109	O14796	SH21B_HUMAN	G	109	ENSP00000356906:R109G	ENSP00000356906:R109G	R	-	1	2	SH2D1B	160635375	0.000000	0.05858	0.000000	0.03702	0.092000	0.18411	-0.025000	0.12413	-0.686000	0.05170	-0.313000	0.08912	AGA	SH2D1B	-	NULL	ENSG00000198574		0.413	SH2D1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D1B	HGNC	protein_coding	OTTHUMT00000076794.1	-	0.00	81	0	T	NM_053282		162368751	-1	tier1	-	no_errors	ENST00000367929	ensembl	human	known	74_37	missense	5.80	64	4	SNP	0.000	C
SH3D19	152503	genome.wustl.edu	37	4	152048838	152048838	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:152048838G>T	ENST00000409252.2	-	19	2895	c.2188C>A	c.(2188-2190)Ccg>Acg	p.P730T	SH3D19_ENST00000427414.2_Missense_Mutation_p.P671T|SH3D19_ENST00000409598.4_Missense_Mutation_p.P707T|SH3D19_ENST00000424281.1_Missense_Mutation_p.P671T|SH3D19_ENST00000455740.1_Missense_Mutation_p.P707T|SH3D19_ENST00000514152.1_Missense_Mutation_p.P707T|SH3D19_ENST00000304527.4_Missense_Mutation_p.P730T			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	730	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				CTCCCCTTCGGTACTATGGCC	0.358																																																	0													77.0	69.0	71.0					4																	152048838		2203	4300	6503	SO:0001583	missense	0			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.2188C>A	4.37:g.152048838G>T	ENSP00000386848:p.Pro730Thr		B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.P730T	ENST00000409252.2	37	c.2188	CCDS34077.2	4	.	.	.	.	.	.	.	.	.	.	G	4.706	0.131309	0.08981	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49;1.49	5.84	4.1	0.47936	Src homology-3 domain (2);	1.250850	0.05702	N	0.594363	T	0.24812	0.0602	L	0.43923	1.385	0.09310	N	1	B;B;B;B	0.12013	0.0;0.005;0.0;0.004	B;B;B;B	0.15052	0.002;0.012;0.009;0.005	T	0.35871	-0.9771	10	0.13108	T	0.6	15.4916	4.2705	0.10783	0.0761:0.1452:0.513:0.2657	.	730;707;671;485	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	T	707;730;707;671;671;730;707	ENSP00000387030:P707T;ENSP00000302913:P730T;ENSP00000416708:P707T;ENSP00000404542:P671T;ENSP00000415694:P671T;ENSP00000386848:P730T;ENSP00000423449:P707T	ENSP00000302913:P730T	P	-	1	0	SH3D19	152268288	.	.	0.009000	0.14445	0.079000	0.17450	.	.	0.779000	0.33543	0.591000	0.81541	CCG	SH3D19	-	superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000109686		0.358	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	SH3D19	HGNC	protein_coding	OTTHUMT00000335132.3	-	0.00	148	0	G	NM_001009555		152048838	-1	tier1	-	no_errors	ENST00000304527	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.008	T
SHC4	399694	genome.wustl.edu	37	15	49127155	49127155	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:49127155G>T	ENST00000332408.4	-	11	1976	c.1548C>A	c.(1546-1548)caC>caA	p.H516Q	SHC4_ENST00000396535.3_Missense_Mutation_p.H273Q|SHC4_ENST00000537958.1_Missense_Mutation_p.H230Q	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	516	CH1.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GCTGCTTAATGTGTGGCAAAG	0.527																																																	0													64.0	53.0	57.0					15																	49127155		2197	4295	6492	SO:0001583	missense	0			AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1548C>A	15.37:g.49127155G>T	ENSP00000329668:p.His516Gln		Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.H516Q	ENST00000332408.4	37	c.1548	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	G	1.291	-0.607630	0.03717	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	T;T;T	0.62498	0.02;0.02;0.02	4.92	-2.38	0.06622	.	0.396530	0.25236	N	0.032128	T	0.32376	0.0827	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.07328	-1.0778	10	0.15066	T	0.55	-17.3477	1.2168	0.01916	0.302:0.0951:0.3372:0.2658	.	273;516	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	Q	516;273;230	ENSP00000329668:H516Q;ENSP00000379786:H273Q;ENSP00000443300:H230Q	ENSP00000329668:H516Q	H	-	3	2	SHC4	46914447	0.504000	0.26123	0.447000	0.26932	0.377000	0.30045	-0.384000	0.07389	-0.213000	0.10094	-0.282000	0.10007	CAC	SHC4	-	NULL	ENSG00000185634		0.527	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	HGNC	protein_coding	OTTHUMT00000254371.1	-	0.00	39	0	G	NM_203349		49127155	-1	tier1	-	no_errors	ENST00000332408	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.032	T
SHROOM3	57619	genome.wustl.edu	37	4	77662000	77662000	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:77662000T>G	ENST00000296043.6	+	5	3627	c.2674T>G	c.(2674-2676)Ttc>Gtc	p.F892V		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	892					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCAGAGCACCTTCCAGCTCTC	0.731																																																	0													8.0	11.0	10.0					4																	77662000		2145	4212	6357	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2674T>G	4.37:g.77662000T>G	ENSP00000296043:p.Phe892Val		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.F892V	ENST00000296043.6	37	c.2674	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	t	16.24	3.068228	0.55539	.	.	ENSG00000138771	ENST00000296043	T	0.39056	1.1	5.25	2.8	0.32819	Apx/shroom, ASD1 (1);	3.328180	0.00772	N	0.001213	T	0.46190	0.1380	L	0.41236	1.265	0.32028	N	0.599922	P;P;P	0.43578	0.811;0.811;0.811	P;P;P	0.46419	0.516;0.516;0.516	T	0.30966	-0.9960	10	0.72032	D	0.01	-5.6817	8.2491	0.31706	0.0:0.1576:0.0:0.8424	.	716;892;670	B4E244;Q8TF72;B3KY47	.;SHRM3_HUMAN;.	V	892	ENSP00000296043:F892V	ENSP00000296043:F892V	F	+	1	0	SHROOM3	77881024	0.974000	0.33945	0.940000	0.37924	0.932000	0.56968	1.646000	0.37249	0.317000	0.23160	0.456000	0.33151	TTC	SHROOM3	-	pfam_ASD1	ENSG00000138771		0.731	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2		0.00	23	0	T	NM_020859		77662000	+1			no_errors	ENST00000296043	ensembl	human	known	74_37	missense	37.50	5	3	SNP	0.863	G
SIX3	6496	genome.wustl.edu	37	2	45169639	45169640	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	GC	GC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:45169639_45169640delGC	ENST00000260653.3	+	1	738_739	c.396_397delGC	c.(394-399)ctgcgcfs	p.R133fs	SIX3-AS1_ENST00000419364.1_RNA|SIX3-AS1_ENST00000456467.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	133					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGTCGATCCTGCGCGCGCGCGC	0.658																																																	0										80,3760		4,72,1844						1.9	1.0			14	131,7539		4,123,3708	no	frameshift	SIX3	NM_005413.3		8,195,5552	A1A1,A1R,RR		1.708,2.0833,1.8332				211,11299				SO:0001589	frameshift_variant	0			AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.396_397delGC	2.37:g.45169649_45169650delGC	ENSP00000260653:p.Arg133fs		D6W5A5|Q53T42	Frame_Shift_Del	DEL	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.A136fs	ENST00000260653.3	37	c.396_397	CCDS1821.1	2																																																																																			SIX3	-	NULL	ENSG00000138083		0.658	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX3	HGNC	protein_coding	OTTHUMT00000326192.1		0.00	36	0	GC	NM_005413		45169640	+1	tier1		no_errors	ENST00000260653	ensembl	human	known	74_37	frame_shift_del	11.11	24	3	DEL	1.000:1.000	-
SKIL	6498	genome.wustl.edu	37	3	170078555	170078555	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:170078555C>A	ENST00000458537.3	+	1	1145	c.436C>A	c.(436-438)Cag>Aag	p.Q146K	SKIL_ENST00000413427.2_Missense_Mutation_p.Q146K|SKIL_ENST00000259119.4_Missense_Mutation_p.Q146K|SKIL_ENST00000426052.2_Missense_Mutation_p.Q126K	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	146					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AGAACTCACTCAGACTGTGTT	0.453																																																	0													159.0	170.0	166.0					3																	170078555		2203	4300	6503	SO:0001583	missense	0			X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.436C>A	3.37:g.170078555C>A	ENSP00000415243:p.Gln146Lys		A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.Q146K	ENST00000458537.3	37	c.436	CCDS33890.1	3	.	.	.	.	.	.	.	.	.	.	C	15.51	2.856370	0.51376	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	5.64	5.64	0.86602	DNA binding domain, putative (1);Transforming protein Ski (2);	0.051478	0.85682	D	0.000000	D	0.83862	0.5346	N	0.19112	0.55	0.48135	D	0.999597	P;D	0.61080	0.7;0.989	B;P	0.61070	0.261;0.883	T	0.82564	-0.0394	10	0.31617	T	0.26	-12.3262	19.7556	0.96287	0.0:1.0:0.0:0.0	.	146;146	P12757-3;P12757	.;SKIL_HUMAN	K	146;126;146;146	ENSP00000259119:Q146K;ENSP00000406520:Q126K;ENSP00000400193:Q146K;ENSP00000415243:Q146K	ENSP00000259119:Q146K	Q	+	1	0	SKIL	171561249	1.000000	0.71417	0.999000	0.59377	0.675000	0.39556	5.731000	0.68554	2.682000	0.91365	0.579000	0.79373	CAG	SKIL	-	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	ENSG00000136603		0.453	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIL	HGNC	protein_coding	OTTHUMT00000352351.4	-	0.00	36	0	C	NM_005414		170078555	+1	tier1	-	no_errors	ENST00000259119	ensembl	human	known	74_37	missense	18.87	43	10	SNP	1.000	A
SLC24A4	123041	genome.wustl.edu	37	14	92953034	92953034	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:92953034G>T	ENST00000532405.1	+	14	1673	c.1447G>T	c.(1447-1449)Ggg>Tgg	p.G483W	SLC24A4_ENST00000351924.5_Missense_Mutation_p.G447W|SLC24A4_ENST00000531433.1_Missense_Mutation_p.G464W|SLC24A4_ENST00000298877.1_Missense_Mutation_p.G466W|SLC24A4_ENST00000393265.2_Missense_Mutation_p.G419W			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	483					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		ATACACACTTGGGATCCCGGA	0.468																																					NSCLC(10;315 435 10383 28450 38798)												0													165.0	115.0	132.0					14																	92953034		2203	4300	6503	SO:0001583	missense	0			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1447G>T	14.37:g.92953034G>T	ENSP00000431840:p.Gly483Trp		B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	pfam_NaCa_Exmemb,tigrfam_K/Na/Ca-exchanger	p.G483W	ENST00000532405.1	37	c.1447	CCDS9903.2	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	21.2|21.2	4.112944|4.112944	0.77210|0.77210	.|.	.|.	ENSG00000140090|ENSG00000140090	ENST00000393265;ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924|ENST00000525557	T;T;T;T;D|.	0.87256|.	-0.61;-0.38;-0.61;-0.61;-2.23|.	4.84|4.84	4.84|4.84	0.62591|0.62591	Sodium/calcium exchanger membrane region (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88610|0.88610	0.6483|0.6483	H|H	0.97214|0.97214	3.96|3.96	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;0.994|.	D;D;D|.	0.97110|.	1.0;1.0;0.972|.	D|D	0.93043|0.93043	0.6459|0.6459	10|5	0.62326|.	D|.	0.03|.	.|.	17.9761|17.9761	0.89128|0.89128	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	464;419;483|.	Q8NFF2-3;Q8NFF2-2;Q8NFF2|.	.;.;NCKX4_HUMAN|.	W|L	419;464;483;466;447|348	ENSP00000376948:G419W;ENSP00000433302:G464W;ENSP00000431840:G483W;ENSP00000298877:G466W;ENSP00000337789:G447W|.	ENSP00000298877:G466W|.	G|W	+|+	1|2	0|0	SLC24A4|SLC24A4	92022787|92022787	1.000000|1.000000	0.71417|0.71417	0.881000|0.881000	0.34555|0.34555	0.656000|0.656000	0.38851|0.38851	9.572000|9.572000	0.98179|0.98179	2.234000|2.234000	0.73211|0.73211	0.561000|0.561000	0.74099|0.74099	GGG|TGG	SLC24A4	-	pfam_NaCa_Exmemb,tigrfam_K/Na/Ca-exchanger	ENSG00000140090		0.468	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	-	0.00	82	0	G	NM_153646		92953034	+1	tier1	-	no_errors	ENST00000532405	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
SLC25A12	8604	genome.wustl.edu	37	2	172641886	172641886	+	Silent	SNP	C	C	T	rs369901246		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:172641886C>T	ENST00000422440.2	-	18	1972	c.1935G>A	c.(1933-1935)acG>acA	p.T645T	SLC25A12_ENST00000392592.4_Silent_p.T538T	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	645					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	TGCCTGCAAACGTGGCTGTGG	0.517																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	177.0	163.0	168.0		1935	0.7	1.0	2		168	0,8600		0,0,4300	no	coding-synonymous	SLC25A12	NM_003705.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		645/679	172641886	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1935G>A	2.37:g.172641886C>T			B3KR64|Q96AM8	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.T645	ENST00000422440.2	37	c.1935	CCDS33327.1	2																																																																																			SLC25A12	-	NULL	ENSG00000115840		0.517	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A12	HGNC	protein_coding	OTTHUMT00000259010.2	-	0.00	80	0	C	NM_003705		172641886	-1	tier1	-	no_errors	ENST00000422440	ensembl	human	known	74_37	silent	53.33	42	48	SNP	0.934	T
SLC37A1	54020	genome.wustl.edu	37	21	43938512	43938512	+	De_novo_Start_InFrame	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:43938512T>G	ENST00000352133.2	+	0	930				SLC37A1_ENST00000398341.3_De_novo_Start_InFrame			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1						carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						TAATGACTCATTTATGAAGCA	0.552																																																	0													72.0	72.0	72.0					21																	43938512		692	1591	2283			0			AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803		21.37:g.43938512T>G			D3DSJ7|Q9HAQ1	RNA	SNP	-	NULL	ENST00000352133.2	37	NULL	CCDS13689.1	21																																																																																			SLC37A1	-	-	ENSG00000160190		0.552	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC37A1	HGNC	protein_coding	OTTHUMT00000195377.1	-	0.00	103	0	T			43938512	+1	tier1	-	no_errors	ENST00000471277	ensembl	human	known	74_37	rna	30.77	36	16	SNP	0.000	G
SLC45A3	85414	genome.wustl.edu	37	1	205628416	205628416	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:205628416G>T	ENST00000367145.3	-	5	1903	c.1608C>A	c.(1606-1608)taC>taA	p.Y536*	SLC45A3_ENST00000460934.1_5'UTR	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	536					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GTGTAGCAAAGTAAATGGCGA	0.552			T	"""ETV1, ETV5, ELK4, ERG"""	prostate						OREG0014161	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0													76.0	76.0	76.0					1																	205628416		2203	4300	6503	SO:0001587	stop_gained	0			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.1608C>A	1.37:g.205628416G>T	ENSP00000356113:p.Tyr536*	2153	A8K2U9	Nonsense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.Y536*	ENST00000367145.3	37	c.1608	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.390623	0.98791	.	.	ENSG00000158715	ENST00000367145	.	.	.	5.66	3.5	0.40072	.	0.060856	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.9183	10.7786	0.46365	0.2173:0.0:0.7827:0.0	.	.	.	.	X	536	.	ENSP00000356113:Y536X	Y	-	3	2	SLC45A3	203895039	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.418000	0.52721	1.335000	0.45486	0.591000	0.81541	TAC	SLC45A3	-	NULL	ENSG00000158715		0.552	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	HGNC	protein_coding	OTTHUMT00000090619.1	-	0.00	55	0	G	NM_033102		205628416	-1	tier1	-	no_errors	ENST00000367145	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
SLC5A6	8884	genome.wustl.edu	37	2	27423939	27423939	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:27423939G>T	ENST00000310574.3	-	16	2164	c.1691C>A	c.(1690-1692)cCa>cAa	p.P564Q	SLC5A6_ENST00000408041.1_Missense_Mutation_p.P564Q|SLC5A6_ENST00000461319.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	564					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	TGGCAACACTGGGTAAATGGT	0.587																																																	0													115.0	111.0	112.0					2																	27423939		2203	4300	6503	SO:0001583	missense	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.1691C>A	2.37:g.27423939G>T	ENSP00000310208:p.Pro564Gln		B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.P564Q	ENST00000310574.3	37	c.1691	CCDS1740.1	2	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355605	0.61293	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.86694	-2.16;-2.16	5.73	5.73	0.89815	.	0.113675	0.64402	D	0.000009	D	0.92489	0.7615	M	0.74647	2.275	0.58432	D	0.999998	D	0.67145	0.996	D	0.64506	0.926	D	0.92991	0.6415	10	0.87932	D	0	.	15.4002	0.74834	0.0:0.0:1.0:0.0	.	564	Q9Y289	SC5A6_HUMAN	Q	564	ENSP00000310208:P564Q;ENSP00000384853:P564Q	ENSP00000310208:P564Q	P	-	2	0	SLC5A6	27277443	1.000000	0.71417	0.995000	0.50966	0.105000	0.19272	5.730000	0.68546	2.698000	0.92095	0.650000	0.86243	CCA	SLC5A6	-	NULL	ENSG00000138074		0.587	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1	-	0.00	69	0	G	NM_021095		27423939	-1	tier1	-	no_errors	ENST00000310574	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
SMUG1	23583	genome.wustl.edu	37	12	54576323	54576323	+	Nonsense_Mutation	SNP	G	G	A	rs139760820		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:54576323G>A	ENST00000508394.2	-	3	432	c.370C>T	c.(370-372)Cga>Tga	p.R124*	SMUG1_ENST00000513838.1_Nonsense_Mutation_p.R124*|SMUG1_ENST00000514685.1_Nonsense_Mutation_p.R124*|SMUG1_ENST00000506595.1_Nonsense_Mutation_p.R124*|SMUG1_ENST00000243112.5_Nonsense_Mutation_p.R124*|SMUG1_ENST00000505128.1_3'UTR|SMUG1_ENST00000514196.1_Nonsense_Mutation_p.R124*|SMUG1_ENST00000505662.1_5'UTR|SMUG1_ENST00000401977.2_Nonsense_Mutation_p.R124*|SMUG1_ENST00000337581.3_Nonsense_Mutation_p.R124*	NM_001243787.1|NM_001243788.1|NM_014311.2	NP_001230716.1|NP_001230717.1|NP_055126.1	Q53HV7	SMUG1_HUMAN	single-strand-selective monofunctional uracil-DNA glycosylase 1	124				Missing (in Ref. 3; BAC03670). {ECO:0000305}.	base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA N-glycosylase activity (GO:0019104)|oxidized pyrimidine nucleobase lesion DNA N-glycosylase activity (GO:0000703)|single-strand selective uracil DNA N-glycosylase activity (GO:0017065)|uracil DNA N-glycosylase activity (GO:0004844)			kidney(1)|large_intestine(4)|lung(1)	6						AGCACTGGTCGTTTAGGATGC	0.587								Base excision repair (BER), DNA glycosylases																																									0								G	stop/ARG	1,4405	2.1+/-5.4	0,1,2202	96.0	99.0	98.0		370	4.9	1.0	12	dbSNP_134	98	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	SMUG1	NM_014311.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		124/271	54576323	2,13004	2203	4300	6503	SO:0001587	stop_gained	0			AF125182	CCDS8874.1, CCDS58239.1	12q13.13	2013-10-28			ENSG00000123415	ENSG00000123415			17148	protein-coding gene	gene with protein product		607753				10074426, 11526119	Standard	NM_014311		Approved	UNG3, FDG, HMUDG	uc009znf.2	Q53HV7	OTTHUMG00000160068	ENST00000508394.2:c.370C>T	12.37:g.54576323G>A	ENSP00000424191:p.Arg124*		A8K2K9|O95862|Q0D2M0|Q8NB71|Q9BWC8	Nonsense_Mutation	SNP	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like	p.R124*	ENST00000508394.2	37	c.370	CCDS8874.1	12	.	.	.	.	.	.	.	.	.	.	G	29.0	4.970004	0.92855	2.27E-4	1.16E-4	ENSG00000123415	ENST00000506595;ENST00000514685;ENST00000337581;ENST00000508394;ENST00000513838;ENST00000243112;ENST00000401977;ENST00000514196;ENST00000504338	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.0383	0.47816	0.0:0.0:0.7015:0.2985	.	.	.	.	X	124	.	ENSP00000243112:R124X	R	-	1	2	SMUG1	52862590	0.991000	0.36638	1.000000	0.80357	0.946000	0.59487	1.147000	0.31602	2.415000	0.81967	0.563000	0.77884	CGA	SMUG1	-	pfam_Uracil-DNA_glycosylase-like,superfamily_Uracil-DNA_glycosylase-like	ENSG00000123415		0.587	SMUG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMUG1	HGNC	protein_coding	OTTHUMT00000359074.3	-	0.00	45	0	G	NM_014311		54576323	-1	tier1	rs139760820	no_errors	ENST00000337581	ensembl	human	known	74_37	nonsense	32.61	31	15	SNP	1.000	A
SLC5A8	160728	genome.wustl.edu	37	12	101595959	101595959	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:101595959G>T	ENST00000536262.2	-	3	1010	c.452C>A	c.(451-453)gCc>gAc	p.A151D	RNU6-768P_ENST00000384683.1_RNA	NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAAAGCCAGGGCAGGGGCATA	0.383																																					GBM(60;420 1056 13605 22380 47675)												0													57.0	56.0	56.0					12																	101595959		2203	4300	6503	SO:0001583	missense	0			AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.452C>A	12.37:g.101595959G>T	ENSP00000445340:p.Ala151Asp			Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.A151D	ENST00000536262.2	37	c.452	CCDS9080.1	12	.	.	.	.	.	.	.	.	.	.	G	29.3	4.994742	0.93167	.	.	ENSG00000256870	ENST00000536262	D	0.93133	-3.17	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.97860	0.9297	H	0.95780	3.72	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	D	0.98607	1.0661	10	0.87932	D	0	.	19.7398	0.96223	0.0:0.0:1.0:0.0	.	151	Q8N695	SC5A8_HUMAN	D	151	ENSP00000445340:A151D	ENSP00000445340:A151D	A	-	2	0	SLC5A8	100120090	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.744000	0.98853	2.665000	0.90641	0.561000	0.74099	GCC	SLC5A8	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000256870		0.383	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A8	HGNC	protein_coding	OTTHUMT00000409401.1		0.00	84	0	G	NM_145913		101595959	-1			no_errors	ENST00000536262	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
SNAI2	6591	genome.wustl.edu	37	8	49831376	49831376	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:49831376A>G	ENST00000396822.1	-	4	1154	c.797T>C	c.(796-798)gTa>gCa	p.V266A	SNAI2_ENST00000020945.1_Missense_Mutation_p.V266A			O43623	SNAI2_HUMAN	snail family zinc finger 2	266					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				TCAGTGTGCTACACAGCAGCC	0.433																																																	0													160.0	142.0	148.0					8																	49831376		2203	4300	6503	SO:0001583	missense	0			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.797T>C	8.37:g.49831376A>G	ENSP00000380034:p.Val266Ala		B2R6P6|Q53FC1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V266A	ENST00000396822.1	37	c.797	CCDS6146.1	8	.	.	.	.	.	.	.	.	.	.	A	8.737	0.918107	0.17982	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.10960	2.82;2.82	4.92	2.53	0.30540	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.328915	0.31963	N	0.006781	T	0.06600	0.0169	L	0.29908	0.895	0.46096	D	0.998866	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	10	0.07644	T	0.81	-1.343	9.0706	0.36491	0.8492:0.0:0.1508:0.0	.	266	O43623	SNAI2_HUMAN	A	266	ENSP00000020945:V266A;ENSP00000380034:V266A	ENSP00000020945:V266A	V	-	2	0	SNAI2	49993929	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	3.001000	0.49488	0.324000	0.23333	0.528000	0.53228	GTA	SNAI2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000019549		0.433	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	HGNC	protein_coding	OTTHUMT00000313873.2	-	0.00	80	0	A	NM_003068		49831376	-1	tier1	-	no_errors	ENST00000020945	ensembl	human	known	74_37	missense	21.15	82	22	SNP	1.000	G
SNUPN	10073	genome.wustl.edu	37	15	75890870	75890870	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:75890870G>T	ENST00000564644.1	-	10	1490	c.912C>A	c.(910-912)caC>caA	p.H304Q	SNUPN_ENST00000371091.5_Missense_Mutation_p.H346Q|CTD-2323K18.1_ENST00000568707.1_RNA|SNUPN_ENST00000308588.5_Missense_Mutation_p.H304Q|SNUPN_ENST00000567134.1_Missense_Mutation_p.H304Q|SNUPN_ENST00000564675.1_Missense_Mutation_p.H304Q			O95149	SPN1_HUMAN	snurportin 1	304	Necessary for binding to the m3G-cap structure.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						GCTGGAGCTGGTGCCCAGCAT	0.572																																																	0													128.0	131.0	130.0					15																	75890870		2197	4294	6491	SO:0001583	missense	0			AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.912C>A	15.37:g.75890870G>T	ENSP00000454852:p.His304Gln		A6NE34|A8K0B0|D3DW76	Missense_Mutation	SNP	pfam_Snurportin-1_N,pirsf_Snurportin-1,pfscan_Importin-a_IBB	p.H346Q	ENST00000564644.1	37	c.1038	CCDS10281.1	15	.	.	.	.	.	.	.	.	.	.	G	14.64	2.594999	0.46318	.	.	ENSG00000169371	ENST00000308588;ENST00000371091	T;T	0.62639	0.01;0.01	5.9	-1.41	0.08941	.	0.390014	0.33895	N	0.004451	T	0.35422	0.0931	N	0.17723	0.515	0.39028	D	0.959885	B;B	0.20550	0.046;0.011	B;B	0.12837	0.008;0.005	T	0.08534	-1.0717	10	0.12103	T	0.63	-8.8597	6.5098	0.22216	0.1363:0.4815:0.2891:0.093	.	346;304	C9K0X5;O95149	.;SPN1_HUMAN	Q	304;346	ENSP00000309831:H304Q;ENSP00000360132:H346Q	ENSP00000309831:H304Q	H	-	3	2	SNUPN	73677925	0.682000	0.27624	0.989000	0.46669	0.990000	0.78478	-0.109000	0.10840	0.087000	0.17167	0.555000	0.69702	CAC	SNUPN	-	pirsf_Snurportin-1	ENSG00000169371		0.572	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNUPN	HGNC	protein_coding	OTTHUMT00000420332.1	-	0.00	68	0	G	NM_005701		75890870	-1	tier1	-	no_errors	ENST00000371091	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.901	T
SNX27	81609	genome.wustl.edu	37	1	151665465	151665465	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:151665465T>C	ENST00000458013.2	+	10	1588	c.1468T>C	c.(1468-1470)Tat>Cat	p.Y490H	SNX27_ENST00000368838.1_Missense_Mutation_p.Y397H|SNX27_ENST00000368843.3_Missense_Mutation_p.Y490H			Q96L92	SNX27_HUMAN	sorting nexin family member 27	490	FERM-like region F3.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGTTTCGAATATGCACGAGG	0.448																																					Colon(46;291 966 40145 41237 41888)												0													143.0	141.0	142.0					1																	151665465		2203	4300	6503	SO:0001583	missense	0			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1468T>C	1.37:g.151665465T>C	ENSP00000400333:p.Tyr490His		Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.Y490H	ENST00000458013.2	37	c.1468		1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.949165	0.92660	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	D;D;D	0.95482	-3.72;-3.72;-3.72	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.96962	0.9008	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.97771	1.0226	10	0.87932	D	0	.	13.4773	0.61316	0.0:0.0:0.0:1.0	.	490;490	Q96L92;Q96L92-3	SNX27_HUMAN;.	H	490;490;397	ENSP00000400333:Y490H;ENSP00000357836:Y490H;ENSP00000357831:Y397H	ENSP00000357831:Y397H	Y	+	1	0	SNX27	149932089	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.272000	0.78516	2.201000	0.70794	0.460000	0.39030	TAT	SNX27	-	NULL	ENSG00000143376		0.448	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3	-	0.00	81	0	T	NM_030918		151665465	+1	tier1	-	no_errors	ENST00000368843	ensembl	human	known	74_37	missense	18.60	70	16	SNP	1.000	C
SNX31	169166	genome.wustl.edu	37	8	101624292	101624292	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:101624292C>T	ENST00000311812.2	-	7	697	c.547G>A	c.(547-549)Gaa>Aaa	p.E183K	SNX31_ENST00000428383.2_Missense_Mutation_p.E84K	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	183					protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			TAAGGGAGTTCAAAGTCAGCC	0.418																																																	0													85.0	85.0	85.0					8																	101624292		2203	4300	6503	SO:0001583	missense	0				CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.547G>A	8.37:g.101624292C>T	ENSP00000312368:p.Glu183Lys		C9J6L9|Q8N0U9	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.E183K	ENST00000311812.2	37	c.547	CCDS6288.1	8	.	.	.	.	.	.	.	.	.	.	C	28.2	4.899388	0.91962	.	.	ENSG00000174226	ENST00000311812;ENST00000428383;ENST00000520352	T;T;T	0.59772	1.84;1.31;0.24	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000008	T	0.79329	0.4427	M	0.86953	2.85	0.58432	D	0.999994	D;D	0.89917	1.0;0.999	D;D	0.80764	0.992;0.994	T	0.82127	-0.0611	10	0.87932	D	0	-20.1813	15.8344	0.78787	0.0:1.0:0.0:0.0	.	84;183	Q8N9S9-2;Q8N9S9	.;SNX31_HUMAN	K	183;84;117	ENSP00000312368:E183K;ENSP00000405024:E84K;ENSP00000428210:E117K	ENSP00000312368:E183K	E	-	1	0	SNX31	101693468	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	3.922000	0.56462	2.822000	0.97130	0.650000	0.86243	GAA	SNX31	-	NULL	ENSG00000174226		0.418	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX31	HGNC	protein_coding	OTTHUMT00000379910.1	-	0.00	59	0	C	NM_152628		101624292	-1	tier1	-	no_errors	ENST00000311812	ensembl	human	known	74_37	missense	61.11	28	44	SNP	1.000	T
SOGA3	387104	genome.wustl.edu	37	6	127837154	127837154	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:127837154G>A	ENST00000525778.1	-	2	1351	c.606C>T	c.(604-606)cgC>cgT	p.R202R	SOGA3_ENST00000556132.1_Silent_p.R202R|SOGA3_ENST00000465909.2_Silent_p.R202R|SOGA3_ENST00000368268.2_Silent_p.R202R|SOGA3_ENST00000481848.2_Silent_p.R202R			Q5TF21	SOGA3_HUMAN	SOGA family member 3	202	Gly-rich.				regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TCTGCTGAGCGCGTACGCCTT	0.741																																																	0													5.0	6.0	6.0					6																	127837154		1389	3397	4786	SO:0001819	synonymous_variant	0			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.606C>T	6.37:g.127837154G>A				Silent	SNP	pfam_SOGA	p.R202	ENST00000525778.1	37	c.606	CCDS43505.1	6																																																																																			SOGA3	-	NULL	ENSG00000214338		0.741	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SOGA3	HGNC	protein_coding	OTTHUMT00000388246.1	-	0.00	12	0	G	NM_001012279		127837154	-1	tier1	-	no_errors	ENST00000368268	ensembl	human	known	74_37	silent	44.44	5	4	SNP	0.998	A
SPATA31D1	389763	genome.wustl.edu	37	9	84607806	84607806	+	Silent	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:84607806T>C	ENST00000344803.2	+	4	2468	c.2421T>C	c.(2419-2421)acT>acC	p.T807T		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	807					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACCTAGAAACTCATATGATGC	0.458																																																	0													73.0	71.0	71.0					9																	84607806		1871	4091	5962	SO:0001819	synonymous_variant	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2421T>C	9.37:g.84607806T>C				Silent	SNP	NULL	p.T807	ENST00000344803.2	37	c.2421	CCDS47986.1	9																																																																																			SPATA31D1	-	NULL	ENSG00000214929		0.458	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	87	0	T	NM_001001670		84607806	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	silent	23.08	50	15	SNP	0.000	C
SOHLH1	402381	genome.wustl.edu	37	9	138585580	138585580	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:138585580A>C	ENST00000298466.5	-	0	1659				SOHLH1_ENST00000425225.1_Missense_Mutation_p.F343V	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1						oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		TCCCCTAGGAAGCCTGGCTCT	0.647																																																	0													16.0	19.0	18.0					9																	138585580		1947	4139	6086	SO:0001624	3_prime_UTR_variant	0			BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.*612T>G	9.37:g.138585580A>C			C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.F343V	ENST00000298466.5	37	c.1027	CCDS35174.1	9	.	.	.	.	.	.	.	.	.	.	A	15.97	2.990570	0.54041	.	.	ENSG00000165643	ENST00000425225	T	0.49720	0.77	4.78	-0.73	0.11154	.	.	.	.	.	T	0.32793	0.0841	.	.	.	0.09310	N	1	B	0.28713	0.22	B	0.33196	0.159	T	0.39722	-0.9600	8	0.87932	D	0	.	0.5628	0.00682	0.444:0.1752:0.2116:0.1692	.	343	Q5JUK2-2	.	V	343	ENSP00000404438:F343V	ENSP00000404438:F343V	F	-	1	0	SOHLH1	137725401	0.932000	0.31603	0.003000	0.11579	0.002000	0.02628	2.004000	0.40854	-0.282000	0.09128	-1.090000	0.02178	TTC	SOHLH1	-	NULL	ENSG00000165643		0.647	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SOHLH1	HGNC	protein_coding	OTTHUMT00000055018.2	-	0.00	62	0	A	NM_001012415		138585580	-1	tier1	-	no_errors	ENST00000425225	ensembl	human	known	74_37	missense	22.50	31	9	SNP	0.005	C
AKNAD1	254268	genome.wustl.edu	37	1	109400924	109400924	+	5'Flank	DEL	T	T	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:109400924delT	ENST00000370001.3	-	0	0				AKNAD1_ENST00000357393.4_Intron|SPATA42_ENST00000417241.1_RNA|AKNAD1_ENST00000369995.3_5'Flank|SPATA42_ENST00000369989.2_RNA	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AACTTTTGTCTTTTTTTTTTT	0.363																																																	0																																										SO:0001631	upstream_gene_variant	0			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109400924delT	Exception_encountered		B9EK62|Q5T1N0|Q8N990|Q8NCN9	RNA	DEL	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																			SPATA42	-	-	ENSG00000203897		0.363	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA42	HGNC	protein_coding	OTTHUMT00000030923.2		0.00	27	0	T	NM_152763		109400924	+1	tier1		no_errors	ENST00000417241	ensembl	human	known	74_37	rna	11.76	15	2	DEL	0.000	-
SPIRE1	56907	genome.wustl.edu	37	18	12496079	12496079	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr18:12496079C>A	ENST00000409402.4	-	7	1262	c.995G>T	c.(994-996)cGg>cTg	p.R332L	SPIRE1_ENST00000383356.2_Missense_Mutation_p.R173L|SPIRE1_ENST00000453447.2_Missense_Mutation_p.R212L|SPIRE1_ENST00000410092.3_Missense_Mutation_p.R332L|SPIRE1_ENST00000309836.5_Missense_Mutation_p.R135L|SPIRE1_ENST00000464481.1_5'Flank	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1									p.R173L(1)|p.R332L(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						CTTTTTTAACCGAGGGGGAAT	0.373																																																	2	Substitution - Missense(2)	lung(2)											108.0	107.0	107.0					18																	12496079		2203	4300	6503	SO:0001583	missense	0			AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.995G>T	18.37:g.12496079C>A	ENSP00000387266:p.Arg332Leu			Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_KIND	p.R332L	ENST00000409402.4	37	c.995	CCDS45829.1	18	.	.	.	.	.	.	.	.	.	.	C	33	5.200830	0.94997	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	T;T;T;T;T	0.52057	0.73;1.27;1.27;0.69;0.68	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	L	0.45698	1.435	0.80722	D	1	P;D;D	0.89917	0.94;1.0;1.0	P;D;D	0.85130	0.882;0.997;0.989	T	0.65615	-0.6125	10	0.72032	D	0.01	-17.2615	19.9598	0.97242	0.0:1.0:0.0:0.0	.	332;135;332	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	L	212;332;332;135;173	ENSP00000407050:R212L;ENSP00000387266:R332L;ENSP00000387226:R332L;ENSP00000309661:R135L;ENSP00000372847:R173L	ENSP00000309661:R135L	R	-	2	0	SPIRE1	12486079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.471000	0.53107	2.716000	0.92895	0.655000	0.94253	CGG	SPIRE1	-	NULL	ENSG00000134278		0.373	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIRE1	HGNC	protein_coding	OTTHUMT00000333109.2		0.00	60	0	C	XM_290818		12496079	-1			no_errors	ENST00000409402	ensembl	human	known	74_37	missense	6.90	26	2	SNP	1.000	A
SRPX	8406	genome.wustl.edu	37	X	38016194	38016194	+	Silent	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:38016194G>T	ENST00000378533.3	-	8	1150	c.1044C>A	c.(1042-1044)ccC>ccA	p.P348P	SRPX_ENST00000343800.6_Silent_p.P335P|SRPX_ENST00000538295.1_Silent_p.P348P|SRPX_ENST00000479015.1_5'UTR|SRPX_ENST00000544439.1_Silent_p.P328P|SRPX_ENST00000432886.2_Silent_p.P289P|TM4SF2_ENST00000465127.1_Intron	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	348					autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						TTCGGGCTGTGGGTGTGGACA	0.537																																																	0													100.0	76.0	84.0					X																	38016194		2202	4300	6502	SO:0001819	synonymous_variant	0			U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.1044C>A	X.37:g.38016194G>T			A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Silent	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.P348	ENST00000378533.3	37	c.1044	CCDS14245.1	X																																																																																			SRPX	-	NULL	ENSG00000101955		0.537	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX	HGNC	protein_coding	OTTHUMT00000056243.1		0.00	92	0	G	NM_006307		38016194	-1			no_errors	ENST00000378533	ensembl	human	known	74_37	silent	8.57	32	3	SNP	0.997	T
STK35	140901	genome.wustl.edu	37	20	2097969	2097969	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:2097969G>T	ENST00000381482.3	+	3	1821	c.1550G>T	c.(1549-1551)cGg>cTg	p.R517L	STK35_ENST00000246032.3_Missense_Mutation_p.R384L|STK35_ENST00000400064.3_Intron			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	517	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						CCACAGGACCGGCCTGATGCC	0.473																																																	0													82.0	76.0	78.0					20																	2097969		2203	4300	6503	SO:0001583	missense	0			AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.1550G>T	20.37:g.2097969G>T	ENSP00000370891:p.Arg517Leu		B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R517L	ENST00000381482.3	37	c.1550	CCDS13024.2	20	.	.	.	.	.	.	.	.	.	.	G	25.4	4.636455	0.87760	.	.	ENSG00000125834	ENST00000381482;ENST00000246032	D;D	0.99264	-5.65;-5.65	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99453	0.9806	M	0.86805	2.84	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.98703	1.0701	10	0.87932	D	0	-12.6477	16.94	0.86215	0.0:0.0:1.0:0.0	.	517	Q8TDR2	STK35_HUMAN	L	517;384	ENSP00000370891:R517L;ENSP00000246032:R384L	ENSP00000246032:R384L	R	+	2	0	STK35	2045969	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.861000	0.98227	0.655000	0.94253	CGG	STK35	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000125834		0.473	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK35	HGNC	protein_coding	OTTHUMT00000077574.3	-	0.00	47	0	G	NM_080836		2097969	+1	tier1	-	no_errors	ENST00000381482	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
TBCEL	219899	genome.wustl.edu	37	11	120925835	120925835	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:120925835A>C	ENST00000529397.1	+	5	630	c.530A>C	c.(529-531)aAg>aCg	p.K177T	TBCEL_ENST00000422003.2_Missense_Mutation_p.K177T	NM_001130047.1	NP_001123519.1	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	177						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)			TECTA/TBCEL(2)	endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)		CATTCTCTTAAGCTACTACAT	0.398																																																	0													141.0	128.0	132.0					11																	120925835		2203	4299	6502	SO:0001583	missense	0			BC020501	CCDS31692.1	11q23.3	2008-02-05	2006-11-21	2006-11-21		ENSG00000154114			28115	protein-coding gene	gene with protein product		610451	"""leucine rich repeat containing 35"", ""tubulin-specific chaperone e-like"""	LRRC35		15728251	Standard	NM_152715		Approved	MGC10233	uc001pxo.3	Q5QJ74		ENST00000529397.1:c.530A>C	11.37:g.120925835A>C	ENSP00000437184:p.Lys177Thr		Q0VAN6	Missense_Mutation	SNP	pfscan_Ubiquitin_supergroup	p.K177T	ENST00000529397.1	37	c.530	CCDS31692.1	11	.	.	.	.	.	.	.	.	.	.	A	16.27	3.077164	0.55753	.	.	ENSG00000154114	ENST00000529397;ENST00000422003;ENST00000524726	T;T;T	0.18174	2.23;2.23;2.23	5.82	5.82	0.92795	.	0.046567	0.85682	D	0.000000	T	0.16041	0.0386	L	0.29908	0.895	0.54753	D	0.999983	P	0.44816	0.844	B	0.41174	0.349	T	0.01608	-1.1313	10	0.41790	T	0.15	-10.0864	16.1726	0.81828	1.0:0.0:0.0:0.0	.	177	Q5QJ74	TBCEL_HUMAN	T	177	ENSP00000437184:K177T;ENSP00000403925:K177T;ENSP00000432783:K177T	ENSP00000403925:K177T	K	+	2	0	TBCEL	120431045	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.062000	0.64326	2.232000	0.73038	0.482000	0.46254	AAG	TBCEL	-	NULL	ENSG00000154114		0.398	TBCEL-005	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TBCEL	HGNC	protein_coding	OTTHUMT00000387688.1	-	0.00	70	0	A	NM_152715		120925835	+1	tier1	-	no_errors	ENST00000422003	ensembl	human	known	74_37	missense	53.57	39	45	SNP	1.000	C
TBX22	50945	genome.wustl.edu	37	X	79286534	79286534	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:79286534A>T	ENST00000373294.5	+	8	1515	c.1487A>T	c.(1486-1488)gAc>gTc	p.D496V	TBX22_ENST00000442340.1_Missense_Mutation_p.D376V|TBX22_ENST00000373296.3_Missense_Mutation_p.D496V|TBX22_ENST00000373291.1_Missense_Mutation_p.D376V	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	496					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						AAAGTGAATGACGACAGTCAA	0.358																																																	0													71.0	64.0	66.0					X																	79286534		2203	4300	6503	SO:0001583	missense	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.1487A>T	X.37:g.79286534A>T	ENSP00000362390:p.Asp496Val		Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.D496V	ENST00000373294.5	37	c.1487	CCDS14445.1	X	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326062	0.24080	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.87966	-2.32;-2.04;-2.32;-2.04	3.96	2.71	0.32032	.	0.824683	0.10810	N	0.631731	D	0.85212	0.5645	L	0.29908	0.895	0.40354	D	0.979163	D	0.57899	0.981	P	0.55161	0.77	T	0.79825	-0.1640	10	0.72032	D	0.01	.	6.1985	0.20563	0.8471:0.0:0.1529:0.0	.	496	Q9Y458	TBX22_HUMAN	V	496;376;496;376	ENSP00000362393:D496V;ENSP00000396394:D376V;ENSP00000362390:D496V;ENSP00000362388:D376V	ENSP00000362388:D376V	D	+	2	0	TBX22	79173190	1.000000	0.71417	0.128000	0.21923	0.071000	0.16799	4.416000	0.59815	0.390000	0.25115	0.417000	0.27973	GAC	TBX22	-	NULL	ENSG00000122145		0.358	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	-	0.00	63	0	A	NM_016954		79286534	+1	tier1	-	no_errors	ENST00000373294	ensembl	human	known	74_37	missense	72.13	17	44	SNP	0.442	T
TCEA2	6919	genome.wustl.edu	37	20	62703514	62703514	+	Intron	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:62703514C>A	ENST00000343484.5	+	10	1060				RGS19_ENST00000493165.1_5'Flank|TCEA2_ENST00000465111.1_Intron|TCEA2_ENST00000361317.2_Intron|TCEA2_ENST00000395053.3_Intron	NM_003195.4	NP_003186.1	Q15560	TCEA2_HUMAN	transcription elongation factor A (SII), 2						DNA-templated transcription, elongation (GO:0006354)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)	centrosome (GO:0005813)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)	12	all_cancers(38;3.45e-11)|all_epithelial(29;9.12e-13)|Lung NSC(23;2e-09)|all_lung(23;6.77e-09)					GCCTCACCCCCTTTCTCGCAG	0.637																																																	0													98.0	86.0	90.0					20																	62703514		2203	4300	6503	SO:0001627	intron_variant	0			U86749	CCDS13553.1, CCDS13554.1	20q13.33	2011-01-25			ENSG00000171703	ENSG00000171703			11614	protein-coding gene	gene with protein product		604784				9441762, 8566795	Standard	NM_003195		Approved	TFIIS	uc021wgq.1	Q15560	OTTHUMG00000033026	ENST00000343484.5:c.892-11C>A	20.37:g.62703514C>A			B3KNM1|Q8TD37|Q8TD38	RNA	SNP	-	NULL	ENST00000343484.5	37	NULL	CCDS13553.1	20																																																																																			TCEA2	-	-	ENSG00000171703		0.637	TCEA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA2	HGNC	protein_coding	OTTHUMT00000080277.2	-	0.00	54	0	C	NM_198723		62703514	+1	tier1	-	no_errors	ENST00000461072	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.000	A
TCEANC2	127428	genome.wustl.edu	37	1	54520115	54520115	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:54520115G>A	ENST00000234827.1	+	2	220	c.20G>A	c.(19-21)cGa>cAa	p.R7Q	TMEM59_ENST00000371341.1_5'Flank|MIR4781_ENST00000585250.1_RNA|TMEM59_ENST00000371337.3_5'Flank|TCEANC2_ENST00000498272.1_3'UTR|TMEM59_ENST00000234831.5_5'Flank|TCEANC2_ENST00000371331.1_Missense_Mutation_p.R37Q	NM_153035.1	NP_694580.1	Q96MN5	TEAN2_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing 2	7					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|lung(3)|pancreas(1)	5						TTCGTCATTCGAACGCCTAGA	0.478																																																	0													76.0	67.0	70.0					1																	54520115		2203	4300	6503	SO:0001583	missense	0			AK056674	CCDS587.1	1p32.3	2011-01-25	2011-01-25	2011-01-25	ENSG00000116205	ENSG00000116205			26494	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 83"""	C1orf83		12477932	Standard	NM_153035		Approved	FLJ32112	uc001cwt.1	Q96MN5	OTTHUMG00000008434	ENST00000234827.1:c.20G>A	1.37:g.54520115G>A	ENSP00000234827:p.Arg7Gln		Q5T702|Q8N8N2	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N,superfamily_TFIIS_cen_dom,smart_TFIIS/CRSP70_N_sub	p.R37Q	ENST00000234827.1	37	c.110	CCDS587.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.474640	0.96291	.	.	ENSG00000116205	ENST00000234827;ENST00000371331	.	.	.	6.11	5.19	0.71726	.	0.056627	0.64402	D	0.000001	T	0.74450	0.3718	M	0.66939	2.045	0.54753	D	0.999981	D	0.89917	1.0	P	0.62298	0.9	T	0.77531	-0.2553	9	0.72032	D	0.01	-6.6379	13.3038	0.60340	0.0735:0.0:0.9265:0.0	.	7	Q96MN5	TEAN2_HUMAN	Q	7;37	.	ENSP00000234827:R7Q	R	+	2	0	TCEANC2	54292703	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.674000	0.74487	1.586000	0.49944	0.655000	0.94253	CGA	TCEANC2	-	NULL	ENSG00000116205		0.478	TCEANC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEANC2	HGNC	protein_coding	OTTHUMT00000023245.1	-	0.00	37	0	G	NM_153035		54520115	+1	tier1	-	no_errors	ENST00000371331	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	A
TCF3	6929	genome.wustl.edu	37	19	1619821	1619821	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:1619821delG	ENST00000262965.5	-	14	1469	c.1125delC	c.(1123-1125)cccfs	p.P375fs	TCF3_ENST00000395423.3_Frame_Shift_Del_p.P324fs|TCF3_ENST00000588136.1_Frame_Shift_Del_p.P375fs|TCF3_ENST00000453954.2_Frame_Shift_Del_p.P291fs|TCF3_ENST00000344749.5_Frame_Shift_Del_p.P375fs	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	227					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ATAAGGCACCGGGGGCTCCTG	0.682			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																			Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	0													27.0	19.0	22.0					19																	1619821		2186	4290	6476	SO:0001589	frameshift_variant	0			M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1125delC	19.37:g.1619821delG	ENSP00000262965:p.Pro375fs		Q53R97|Q6PD70|Q9NP00	Frame_Shift_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G376fs	ENST00000262965.5	37	c.1125	CCDS12074.1	19																																																																																			TCF3	-	NULL	ENSG00000071564		0.682	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCF3	HGNC	protein_coding	OTTHUMT00000449367.1		0.00	64	0	G	NM_003200		1619821	-1	tier1		no_errors	ENST00000262965	ensembl	human	known	74_37	frame_shift_del	10.34	26	3	DEL	0.983	-
TCHH	7062	genome.wustl.edu	37	1	152084429	152084429	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:152084429C>T	ENST00000368804.1	-	2	1263	c.1264G>A	c.(1264-1266)Gag>Aag	p.E422K		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	422	8 X 6 AA tandem repeats of R-R-E-Q-Q-L.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCTGCTGCTCGCGCCTCAgc	0.711																																																	0													12.0	14.0	14.0					1																	152084429		1912	4098	6010	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.1264G>A	1.37:g.152084429C>T	ENSP00000357794:p.Glu422Lys		Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.E422K	ENST00000368804.1	37	c.1264	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	c	12.20	1.866790	0.32977	.	.	ENSG00000159450	ENST00000368804	T	0.06142	3.34	3.43	3.43	0.39272	.	.	.	.	.	T	0.00845	0.0028	N	0.08118	0	0.28044	N	0.933627	P	0.51147	0.942	B	0.39617	0.305	T	0.17806	-1.0357	9	0.05721	T	0.95	.	8.688	0.34249	0.0:0.7645:0.2355:0.0	.	422	Q07283	TRHY_HUMAN	K	422	ENSP00000357794:E422K	ENSP00000357794:E422K	E	-	1	0	TCHH	150351053	0.011000	0.17503	0.114000	0.21550	0.015000	0.08874	1.437000	0.34991	1.792000	0.52537	0.496000	0.49642	GAG	TCHH	-	NULL	ENSG00000159450		0.711	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	-	0.00	120	0	C	NM_007113		152084429	-1	tier1	-	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	18.81	82	19	SNP	0.857	T
TENM3	55714	genome.wustl.edu	37	4	183268007	183268007	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:183268007T>C	ENST00000511685.1	+	3	559	c.436T>C	c.(436-438)Tgc>Cgc	p.C146R	TENM3_ENST00000406950.2_Missense_Mutation_p.C146R			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	146	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCGCAGCTCCTGCCTGTCAAG	0.517																																																	0													59.0	64.0	62.0					4																	183268007		2014	4195	6209	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.436T>C	4.37:g.183268007T>C	ENSP00000424226:p.Cys146Arg		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.C146R	ENST00000511685.1	37	c.436	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	T	14.70	2.612349	0.46631	.	.	ENSG00000218336	ENST00000512480;ENST00000511685;ENST00000406950	T;T;T	0.36157	1.27;1.27;1.27	4.58	4.58	0.56647	Teneurin intracellular, N-terminal (2);	.	.	.	.	T	0.50377	0.1612	L	0.39397	1.21	0.80722	D	1	D;D	0.76494	0.999;0.995	D;P	0.87578	0.998;0.829	T	0.50268	-0.8848	9	0.51188	T	0.08	.	14.4103	0.67111	0.0:0.0:0.0:1.0	.	146;146	D6RGC5;Q9P273	.;TEN3_HUMAN	R	146	ENSP00000421320:C146R;ENSP00000424226:C146R;ENSP00000385276:C146R	ENSP00000385276:C146R	C	+	1	0	ODZ3	183505001	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.825000	0.86693	2.047000	0.60756	0.460000	0.39030	TGC	TENM3	-	pfam_Ten_N	ENSG00000218336		0.517	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	53	0	T			183268007	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	26.32	28	10	SNP	1.000	C
TFAP2C	7022	genome.wustl.edu	37	20	55204645	55204645	+	Silent	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr20:55204645C>T	ENST00000201031.2	+	1	288	c.45C>T	c.(43-45)tgC>tgT	p.C15C	TFAP2C_ENST00000544508.1_5'Flank	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	15					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			AAGAGGACTGCGAGGTGAGCT	0.652																																																	0													42.0	45.0	44.0					20																	55204645		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.45C>T	20.37:g.55204645C>T			B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Silent	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.C15	ENST00000201031.2	37	c.45	CCDS13454.1	20																																																																																			TFAP2C	-	NULL	ENSG00000087510		0.652	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	HGNC	protein_coding	OTTHUMT00000079823.2	-	0.00	146	0	C	NM_003222		55204645	+1	tier1	-	no_errors	ENST00000201031	ensembl	human	known	74_37	silent	16.89	122	25	SNP	1.000	T
TFIP11	24144	genome.wustl.edu	37	22	26892716	26892716	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr22:26892716G>A	ENST00000407690.1	-	11	1859	c.1576C>T	c.(1576-1578)Caa>Taa	p.Q526*	TFIP11_ENST00000496523.1_5'Flank|TFIP11_ENST00000407148.1_Nonsense_Mutation_p.Q526*|TFIP11_ENST00000405938.1_Nonsense_Mutation_p.Q526*|TFIP11_ENST00000407431.1_Nonsense_Mutation_p.Q526*	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	526					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						AAGATGAGTTGGTCCAGTATG	0.478																																																	0													148.0	117.0	127.0					22																	26892716		2203	4300	6503	SO:0001587	stop_gained	0			AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.1576C>T	22.37:g.26892716G>A	ENSP00000384421:p.Gln526*		O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Nonsense_Mutation	SNP	pfam_GCFC_dom,pfam_TIP_N,pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.Q526*	ENST00000407690.1	37	c.1576	CCDS13838.1	22	.	.	.	.	.	.	.	.	.	.	G	42	9.444594	0.99172	.	.	ENSG00000100109	ENST00000407690;ENST00000407431;ENST00000407148;ENST00000442693;ENST00000405938	.	.	.	5.23	5.23	0.72850	.	0.053967	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-31.8713	17.9478	0.89044	0.0:0.0:1.0:0.0	.	.	.	.	X	526;526;526;211;526	.	ENSP00000384297:Q526X	Q	-	1	0	TFIP11	25222716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.786000	0.75094	2.720000	0.93068	0.561000	0.74099	CAA	TFIP11	-	pfam_GCFC_dom	ENSG00000100109		0.478	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TFIP11	HGNC	protein_coding	OTTHUMT00000320750.1	-	0.00	75	0	G	NM_001008697		26892716	-1	tier1	-	no_errors	ENST00000405938	ensembl	human	known	74_37	nonsense	38.78	30	19	SNP	1.000	A
TGFBR2	7048	genome.wustl.edu	37	3	30713853	30713853	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:30713853G>T	ENST00000295754.5	+	4	1560	c.1178G>T	c.(1177-1179)tGc>tTc	p.C393F	TGFBR2_ENST00000359013.4_Missense_Mutation_p.C418F	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	393	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.C393F(2)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						GACCTAACCTGCTGCCTGTGT	0.547																																																	2	Substitution - Missense(2)	pancreas(2)											314.0	277.0	290.0					3																	30713853		2203	4300	6503	SO:0001583	missense	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1178G>T	3.37:g.30713853G>T	ENSP00000295754:p.Cys393Phe		B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.C418F	ENST00000295754.5	37	c.1253	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057205	0.76074	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.93307	-3.2;-3.2	5.03	5.03	0.67393	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97114	0.9057	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.80764	0.994;0.979	D	0.97917	1.0312	10	0.87932	D	0	.	18.3609	0.90374	0.0:0.0:1.0:0.0	.	393;418	P37173;D2JYI1	TGFR2_HUMAN;.	F	393;418;223	ENSP00000295754:C393F;ENSP00000351905:C418F	ENSP00000295754:C393F	C	+	2	0	TGFBR2	30688857	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.864000	0.99589	2.333000	0.79357	0.650000	0.86243	TGC	TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	ENSG00000163513		0.547	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	-	0.00	32	0	G			30713853	+1	tier1	-	no_errors	ENST00000359013	ensembl	human	known	74_37	missense	59.38	13	19	SNP	1.000	T
THAP3	90326	genome.wustl.edu	37	1	6692910	6692910	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:6692910G>A	ENST00000054650.4	+	6	651	c.493G>A	c.(493-495)Gca>Aca	p.A165T	THAP3_ENST00000377627.3_Intron|THAP3_ENST00000307896.6_Missense_Mutation_p.A164T|DNAJC11_ENST00000465508.1_5'Flank	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3	165							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		GACTGGCCCTGCAGGCCTGAG	0.572																																																	0													87.0	90.0	89.0					1																	6692910		876	1991	2867	SO:0001583	missense	0			BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.493G>A	1.37:g.6692910G>A	ENSP00000054650:p.Ala165Thr		Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.A165T	ENST00000054650.4	37	c.493	CCDS55572.1	1	.	.	.	.	.	.	.	.	.	.	G	0.310	-0.968271	0.02232	.	.	ENSG00000041988	ENST00000054650;ENST00000307896	D;D	0.94417	-3.42;-3.42	3.82	-7.64	0.01286	.	0.259002	0.20311	N	0.094821	T	0.75759	0.3893	N	0.02916	-0.46	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.72769	-0.4193	10	0.19147	T	0.46	-14.711	1.238	0.01957	0.2397:0.3763:0.1462:0.2378	.	164;165	Q8WTV1-3;Q8WTV1	.;THAP3_HUMAN	T	165;164	ENSP00000054650:A165T;ENSP00000311537:A164T	ENSP00000054650:A165T	A	+	1	0	THAP3	6615497	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-4.914000	0.00170	-1.910000	0.01083	-0.379000	0.06801	GCA	THAP3	-	NULL	ENSG00000041988		0.572	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	THAP3	HGNC	protein_coding	OTTHUMT00000004203.1	-	0.00	93	0	G	NM_138350		6692910	+1	tier1	-	no_errors	ENST00000054650	ensembl	human	known	74_37	missense	7.35	62	5	SNP	0.000	A
THSD7B	80731	genome.wustl.edu	37	2	138208594	138208594	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:138208594G>T	ENST00000409968.1	+	15	3316		c.e15+1		THSD7B_ENST00000413152.2_Splice_Site|THSD7B_ENST00000272643.3_Splice_Site|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B							integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAAGAATCAGGTAAAGTGCAT	0.353																																																	0													50.0	45.0	46.0					2																	138208594		1847	4092	5939	SO:0001630	splice_region_variant	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3138+1G>T	2.37:g.138208594G>T				Splice_Site	SNP	-	e14+1	ENST00000409968.1	37	c.3138+1		2	.	.	.	.	.	.	.	.	.	.	G	29.0	4.966069	0.92855	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2191	0.98319	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	THSD7B	137925064	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.869000	0.99810	2.780000	0.95670	0.655000	0.94253	.	THSD7B	-	-	ENSG00000144229		0.353	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	50	0	G	XM_046570.9	Intron	138208594	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	splice_site	29.03	22	9	SNP	1.000	T
THSD7B	80731	genome.wustl.edu	37	2	138400127	138400127	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:138400127T>G	ENST00000409968.1	+	21	4047	c.3869T>G	c.(3868-3870)cTt>cGt	p.L1290R	THSD7B_ENST00000413152.2_Missense_Mutation_p.L1262R|THSD7B_ENST00000272643.3_Missense_Mutation_p.L1293R|THSD7B_ENST00000543459.1_Intron			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1292	TSP type-1 16. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCCACAGAGCTTACCCAGGAG	0.502																																																	0													103.0	106.0	105.0					2																	138400127		1909	4111	6020	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3869T>G	2.37:g.138400127T>G	ENSP00000387145:p.Leu1290Arg			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.L1293R	ENST00000409968.1	37	c.3878		2	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767567	0.69878	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.53857	0.6;0.6;0.6	5.33	5.33	0.75918	.	0.067115	0.64402	D	0.000011	T	0.60650	0.2285	L	0.38838	1.175	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.54576	-0.8273	10	0.18710	T	0.47	.	14.413	0.67128	0.0:0.0:0.0:1.0	.	1262	C9JKN6	.	R	1290;1293;1262	ENSP00000387145:L1290R;ENSP00000272643:L1293R;ENSP00000413841:L1262R	ENSP00000272643:L1293R	L	+	2	0	THSD7B	138116597	1.000000	0.71417	0.994000	0.49952	0.999000	0.98932	4.849000	0.62882	2.234000	0.73211	0.533000	0.62120	CTT	THSD7B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.502	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	29	0	T	XM_046570.9		138400127	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	28.57	25	10	SNP	0.999	G
TMEM144	55314	genome.wustl.edu	37	4	159133894	159133894	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:159133894T>G	ENST00000296529.6	+	3	595	c.75T>G	c.(73-75)aaT>aaG	p.N25K	TMEM144_ENST00000514558.1_Missense_Mutation_p.N25K|TMEM144_ENST00000509278.1_Missense_Mutation_p.N25K	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	25						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		TTGGCTCAAATTTTGTGCCAC	0.328																																																	0													167.0	147.0	154.0					4																	159133894		2203	4300	6503	SO:0001583	missense	0			AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.75T>G	4.37:g.159133894T>G	ENSP00000296529:p.Asn25Lys		D3DP24|Q49A05|Q9NUT3	Missense_Mutation	SNP	pfam_DUF1632_TMEM144,pfam_Sugar_transport	p.N25K	ENST00000296529.6	37	c.75	CCDS3799.1	4	.	.	.	.	.	.	.	.	.	.	T	17.77	3.471936	0.63737	.	.	ENSG00000164124	ENST00000505049;ENST00000505189;ENST00000508243;ENST00000296529;ENST00000512481;ENST00000504569;ENST00000509278;ENST00000514558;ENST00000503200;ENST00000502698;ENST00000514971	T;T;T;T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.57	-0.946	0.10385	.	0.201699	0.50627	D	0.000107	T	0.57388	0.2050	M	0.85373	2.75	0.46749	D	0.99918	D	0.71674	0.998	D	0.69142	0.962	T	0.54370	-0.8304	10	0.29301	T	0.29	-2.0548	6.9524	0.24552	0.0:0.4176:0.1148:0.4676	.	25	Q7Z5S9	TM144_HUMAN	K	25	ENSP00000425266:N25K;ENSP00000421289:N25K;ENSP00000422297:N25K;ENSP00000296529:N25K;ENSP00000424659:N25K;ENSP00000422082:N25K;ENSP00000425815:N25K;ENSP00000426211:N25K;ENSP00000420990:N25K;ENSP00000425907:N25K;ENSP00000422899:N25K	ENSP00000296529:N25K	N	+	3	2	TMEM144	159353344	0.993000	0.37304	0.461000	0.27105	0.970000	0.65996	0.216000	0.17585	-0.279000	0.09167	-0.408000	0.06270	AAT	TMEM144	-	pfam_DUF1632_TMEM144	ENSG00000164124		0.328	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM144	HGNC	protein_coding	OTTHUMT00000365597.1	-	0.00	81	0	T	NM_018342		159133894	+1	tier1	-	no_errors	ENST00000296529	ensembl	human	known	74_37	missense	21.79	61	17	SNP	0.967	G
TMEM200A	114801	genome.wustl.edu	37	6	130762277	130762277	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:130762277A>C	ENST00000296978.3	+	3	1581	c.710A>C	c.(709-711)aAg>aCg	p.K237T	TMEM200A_ENST00000545622.1_Missense_Mutation_p.K237T|TMEM200A_ENST00000392429.1_Missense_Mutation_p.K237T	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	237						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		AATGAAGGTAAGAGTTCTGGG	0.483																																																	0													66.0	64.0	64.0					6																	130762277		2203	4300	6503	SO:0001583	missense	0			AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.710A>C	6.37:g.130762277A>C	ENSP00000296978:p.Lys237Thr		Q96PX5	Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.K237T	ENST00000296978.3	37	c.710	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	A	9.730	1.161910	0.21538	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.93	4.78	0.61160	.	0.354502	0.32301	N	0.006293	T	0.23572	0.0570	L	0.47716	1.5	0.28973	N	0.88914	B	0.27559	0.181	B	0.29440	0.102	T	0.07829	-1.0752	9	0.42905	T	0.14	-17.9716	9.3503	0.38133	0.8687:0.0:0.1313:0.0	.	237	Q86VY9	T200A_HUMAN	T	237	.	ENSP00000296978:K237T	K	+	2	0	TMEM200A	130803970	1.000000	0.71417	0.814000	0.32528	0.186000	0.23388	2.539000	0.45718	2.263000	0.75096	0.533000	0.62120	AAG	TMEM200A	-	NULL	ENSG00000164484		0.483	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	HGNC	protein_coding	OTTHUMT00000042201.1		0.00	31	0	A	NM_052913		130762277	+1			no_errors	ENST00000296978	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.570	C
TMEM254	80195	genome.wustl.edu	37	10	81841421	81841422	+	Intron	INS	-	-	A	rs113172526	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:81841421_81841422insA	ENST00000372281.3	+	2	117				TMEM254_ENST00000467529.1_Intron|TMEM254_ENST00000372277.3_Intron|TMEM254_ENST00000372274.1_Intron|TMEM254_ENST00000372275.1_Intron|TMEM254-AS1_ENST00000412298.1_RNA|TMEM254-AS1_ENST00000448729.2_RNA|TMEM254-AS1_ENST00000432070.2_RNA	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254							integral component of membrane (GO:0016021)											gagaccctgtcaaaaaaaaaag	0.48													|||unknown(NO_COVERAGE)	684	0.136581	0.1785	0.1657	5008	,	,		23050	0.0278		0.0895	False		,,,				2504	0.2198																0																																										SO:0001627	intron_variant	0			BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.88-175->A	10.37:g.81841431_81841431dupA			D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	RNA	INS	-	NULL	ENST00000372281.3	37	NULL	CCDS7363.1	10																																																																																			TMEM254	-	-	ENSG00000133678		0.480	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	HGNC	protein_coding	OTTHUMT00000049030.1		0.00	30	0	-	NM_025125		81841422	+1	tier1		no_errors	ENST00000463029	ensembl	human	known	74_37	rna	16.67	15	3	INS	0.039:0.038	A
TMPRSS15	5651	genome.wustl.edu	37	21	19775826	19775826	+	Silent	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:19775826T>C	ENST00000284885.3	-	1	147	c.114A>G	c.(112-114)gtA>gtG	p.V38V		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	38						brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCAGGCAGGATACTGCAATTA	0.448																																																	0													149.0	135.0	139.0					21																	19775826		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.114A>G	21.37:g.19775826T>C			Q2NKL7	Silent	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.V38	ENST00000284885.3	37	c.114	CCDS13571.1	21																																																																																			TMPRSS15	-	NULL	ENSG00000154646		0.448	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	-	0.00	57	0	T	NM_002772		19775826	-1	tier1	-	no_errors	ENST00000284885	ensembl	human	known	74_37	silent	40.00	24	16	SNP	0.947	C
TOMM20	9804	genome.wustl.edu	37	1	235291954	235291954	+	Missense_Mutation	SNP	C	C	T	rs1130507		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:235291954C>T	ENST00000366607.4	-	1	297	c.77G>A	c.(76-78)cGc>cAc	p.R26H	SNORA14B_ENST00000384452.1_RNA	NM_014765.2	NP_055580.1	Q15388	TOM20_HUMAN	translocase of outer mitochondrial membrane 20 homolog (yeast)	26					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	ER-mitochondrion membrane contact site (GO:0044233)|integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)|unfolded protein binding (GO:0051082)			lung(2)|prostate(1)	3	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;6.33e-05)|Epithelial(3;8.26e-05)			TCGTCTTTTGCGGTCGAAGTA	0.597																																																	0													138.0	127.0	131.0					1																	235291954		2203	4300	6503	SO:0001583	missense	0				CCDS1603.1	1q42	2008-07-18			ENSG00000173726	ENSG00000173726			20947	protein-coding gene	gene with protein product	"""translocase of outer mitochondrial membrane 20 homolog type II"""	601848				7498524, 7589431, 15733919	Standard	NM_014765		Approved	KIAA0016, TOM20, MOM19, MAS20	uc001hwl.3	Q15388	OTTHUMG00000039619	ENST00000366607.4:c.77G>A	1.37:g.235291954C>T	ENSP00000355566:p.Arg26His		A8K195|Q498B3|Q6IBT4	Missense_Mutation	SNP	pfam_MAS20_rcpt-related,superfamily_Tom20_dom,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt_metazoan,prints_MAS20_rcpt-related,tigrfam_MAS20_rcpt-related	p.R26H	ENST00000366607.4	37	c.77	CCDS1603.1	1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.559898	0.27827	.	.	ENSG00000173726	ENST00000366607	T	0.46451	0.87	4.95	2.01	0.26516	.	0.052748	0.64402	D	0.000001	T	0.29749	0.0743	L	0.45285	1.41	0.58432	D	0.999999	B	0.21071	0.051	B	0.19391	0.025	T	0.05699	-1.0869	10	0.24483	T	0.36	-0.4404	6.8598	0.24060	0.1329:0.6698:0.1279:0.0695	rs1130507;rs3189427	26	Q15388	TOM20_HUMAN	H	26	ENSP00000355566:R26H	ENSP00000355566:R26H	R	-	2	0	TOMM20	233358577	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	7.097000	0.76967	0.359000	0.24239	-0.304000	0.09214	CGC	TOMM20	-	pfam_MAS20_rcpt-related,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt-related,tigrfam_MAS20_rcpt-related	ENSG00000173726		0.597	TOMM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM20	HGNC	protein_coding	OTTHUMT00000095551.1	-	0.00	50	0	C	NM_014765		235291954	-1	tier1	rs1130507	no_errors	ENST00000366607	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
TOMM20L	387990	genome.wustl.edu	37	14	58863034	58863034	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr14:58863034delA	ENST00000360945.2	+	2	197	c.155delA	c.(154-156)caafs	p.Q52fs	RP11-517O13.1_ENST00000556734.1_RNA|RP11-517O13.3_ENST00000556390.1_RNA	NM_207377.2	NP_997260.1	Q6UXN7	TO20L_HUMAN	translocase of outer mitochondrial membrane 20 homolog (yeast)-like	52					protein targeting (GO:0006605)	integral component of membrane (GO:0016021)|mitochondrial outer membrane translocase complex (GO:0005742)				large_intestine(2)|lung(2)	4						GCAGAGCCTCAAAAGGCTGAG	0.657																																																	0													63.0	58.0	60.0					14																	58863034		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS9734.1	14q23.1	2009-01-14			ENSG00000196860	ENSG00000196860			33752	protein-coding gene	gene with protein product	"""translocase of outer mitochondrial membrane 20 homolog type I"""					15733919	Standard	NM_207377		Approved	UNQ9438	uc001xdr.1	Q6UXN7	OTTHUMG00000140323	ENST00000360945.2:c.155delA	14.37:g.58863034delA	ENSP00000354204:p.Gln52fs		B2RPR0	Frame_Shift_Del	DEL	pfam_MAS20_rcpt-related,superfamily_Tom20_dom,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt_metazoan,prints_MAS20_rcpt-related	p.K53fs	ENST00000360945.2	37	c.155	CCDS9734.1	14																																																																																			TOMM20L	-	pfam_MAS20_rcpt-related,pirsf_MAS20_rcpt-related,prints_MAS20_rcpt_metazoan	ENSG00000196860		0.657	TOMM20L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM20L	HGNC	protein_coding	OTTHUMT00000276937.1		0.00	31	0	A	NM_207377		58863034	+1	tier1		no_errors	ENST00000360945	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.000	-
TPP2	7174	genome.wustl.edu	37	13	103301601	103301602	+	Intron	INS	-	-	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr13:103301601_103301602insT	ENST00000376065.4	+	22	2909				TPP2_ENST00000376052.3_Intron	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGATGTAGTCATTTTTTTTTTG	0.332																																																	0																																										SO:0001627	intron_variant	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2873+100->T	13.37:g.103301611_103301611dupT			Q5VZU8	RNA	INS	-	NULL	ENST00000376065.4	37	NULL	CCDS9502.1	13																																																																																			TPP2	-	-	ENSG00000134900		0.332	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2		0.00	26	0	-			103301602	+1	tier1		no_errors	ENST00000490420	ensembl	human	known	74_37	rna	8.82	31	3	INS	0.001:0.000	T
TPST1	8460	genome.wustl.edu	37	7	65705524	65705524	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:65705524C>T	ENST00000304842.5	+	2	537	c.112C>T	c.(112-114)Cgt>Tgt	p.R38C	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	38					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GATAGAGGAACGTAGCCAGCC	0.483																																																	0													90.0	74.0	79.0					7																	65705524		2203	4300	6503	SO:0001583	missense	0			AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.112C>T	7.37:g.65705524C>T	ENSP00000302413:p.Arg38Cys		A4D2M0|Q6FGM7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.R38C	ENST00000304842.5	37	c.112	CCDS5533.1	7	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421654	0.83559	.	.	ENSG00000169902	ENST00000304842;ENST00000442120;ENST00000544114;ENST00000451388	.	.	.	5.93	5.93	0.95920	.	0.103719	0.64402	D	0.000002	T	0.61073	0.2318	L	0.27053	0.805	0.80722	D	1	D;D	0.61080	0.989;0.981	P;P	0.54924	0.764;0.517	T	0.62286	-0.6886	9	0.56958	D	0.05	-15.8569	19.3279	0.94270	0.0:1.0:0.0:0.0	.	38;38	F5H7U7;O60507	.;TPST1_HUMAN	C	38	.	ENSP00000302413:R38C	R	+	1	0	TPST1	65342959	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	4.164000	0.58190	2.803000	0.96430	0.585000	0.79938	CGT	TPST1	-	NULL	ENSG00000169902		0.483	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST1	HGNC	protein_coding	OTTHUMT00000251705.2	-	0.00	58	0	C	NM_003596		65705524	+1	tier1	-	no_errors	ENST00000304842	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
TPTE	7179	genome.wustl.edu	37	21	10916467	10916468	+	Frame_Shift_Del	DEL	AT	AT	-	rs146018947		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr21:10916467_10916468delAT	ENST00000361285.4	-	20	1507_1508	c.1178_1179delAT	c.(1177-1179)tatfs	p.Y393fs	TPTE_ENST00000298232.7_Frame_Shift_Del_p.Y375fs|TPTE_ENST00000415664.2_Intron|TPTE_ENST00000342420.5_Frame_Shift_Del_p.Y355fs	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	393	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AATATGCAACATATCTCTTCTG	0.342																																																	0																																										SO:0001589	frameshift_variant	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1178_1179delAT	21.37:g.10916469_10916470delAT	ENSP00000355208:p.Tyr393fs		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Y393fs	ENST00000361285.4	37	c.1179_1178	CCDS13560.2	21																																																																																			TPTE	-	pfscan_Phosphatase_tensin-typ	ENSG00000166157		0.342	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1		0.00	315	0	AT			10916468	-1			no_errors	ENST00000361285	ensembl	human	known	74_37	frame_shift_del	9.80	184	20	DEL	0.982:0.984	0
TRDMT1	1787	genome.wustl.edu	37	10	17194051	17194051	+	Intron	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:17194051G>T	ENST00000377799.3	-	10	1123				TRDMT1_ENST00000377766.5_Intron|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000457442.2_Intron|TRDMT1_ENST00000358282.7_Intron|TRDMT1_ENST00000412821.3_Intron|TRDMT1_ENST00000351358.4_Intron	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1						C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	CATTTTAATTGAATAGTTAAT	0.358																																																	0																																										SO:0001627	intron_variant	0			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.1075+1454C>A	10.37:g.17194051G>T			B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	RNA	SNP	-	NULL	ENST00000377799.3	37	NULL	CCDS7114.1	10																																																																																			TRDMT1	-	-	ENSG00000107614		0.358	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRDMT1	HGNC	protein_coding	OTTHUMT00000047024.3	-	0.00	44	0	G	NM_004412		17194051	-1	tier1	-	no_errors	ENST00000452380	ensembl	human	known	74_37	rna	43.66	40	31	SNP	0.000	T
TRIM21	6737	genome.wustl.edu	37	11	4409631	4409631	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:4409631C>T	ENST00000254436.7	-	4	746	c.634G>A	c.(634-636)Ggg>Agg	p.G212R	TRIM21_ENST00000543625.1_Missense_Mutation_p.G212R	NM_003141.3	NP_003132.2	P19474	RO52_HUMAN	tripartite motif containing 21	212					cell cycle (GO:0007049)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein deubiquitination (GO:0090086)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral entry into host cell (GO:0046598)|protein autoubiquitination (GO:0051865)|protein destabilization (GO:0031648)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)	16		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;2.08e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0851)|LUSC - Lung squamous cell carcinoma(625;0.194)		TCTTTCTCCCCCAGGATTCTC	0.557																																																	0													134.0	138.0	137.0					11																	4409631		2004	4181	6185	SO:0001583	missense	0			AF391283	CCDS44525.1	11p15.5-p15.3	2014-02-14	2011-01-25	2004-11-26		ENSG00000132109		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	11312	protein-coding gene	gene with protein product		109092	"""Sjogren syndrome antigen A1 (52kDa, ribonucleoprotein autoantigen SS-A/Ro)"", ""tripartite motif-containing 21"""	SSA1		8094596	Standard	NM_003141		Approved	RNF81, RO52, Ro/SSA	uc001lyy.1	P19474		ENST00000254436.7:c.634G>A	11.37:g.4409631C>T	ENSP00000254436:p.Gly212Arg		Q5XPV5|Q96RF8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Ubox_domain,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.G212R	ENST00000254436.7	37	c.634	CCDS44525.1	11	.	.	.	.	.	.	.	.	.	.	C	12.65	2.002732	0.35320	.	.	ENSG00000132109	ENST00000254436;ENST00000543625	T;T	0.04194	3.68;3.68	4.34	4.34	0.51931	.	0.000000	0.52532	D	0.000063	T	0.08846	0.0219	N	0.17764	0.52	0.09310	N	0.999996	D	0.89917	1.0	D	0.74023	0.982	T	0.39901	-0.9591	10	0.16896	T	0.51	.	12.665	0.56837	0.0:1.0:0.0:0.0	.	212	P19474	RO52_HUMAN	R	212	ENSP00000254436:G212R;ENSP00000444045:G212R	ENSP00000254436:G212R	G	-	1	0	TRIM21	4366207	0.000000	0.05858	0.253000	0.24343	0.043000	0.13939	0.615000	0.24329	2.699000	0.92147	0.655000	0.94253	GGG	TRIM21	-	NULL	ENSG00000132109		0.557	TRIM21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM21	HGNC	protein_coding	OTTHUMT00000385842.1	-	0.00	38	0	C	NM_003141		4409631	-1	tier1	-	no_errors	ENST00000254436	ensembl	human	known	74_37	missense	20.69	23	6	SNP	0.209	T
TRIM6	117854	genome.wustl.edu	37	11	5625768	5625768	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr11:5625768A>C	ENST00000278302.5	+	3	568	c.428A>C	c.(427-429)aAg>aCg	p.K143T	TRIM6_ENST00000445329.1_5'UTR|TRIM6_ENST00000506134.1_5'UTR|TRIM6_ENST00000515022.1_Intron|HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000507320.1_5'UTR|TRIM6_ENST00000380097.3_Missense_Mutation_p.K171T|AC015691.13_ENST00000394793.2_RNA|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.K171T|TRIM6_ENST00000380107.1_Missense_Mutation_p.K117T	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	143					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		TTCAAGGAGAAGTTTCAGGAG	0.443																																																	0													118.0	123.0	121.0					11																	5625768		2201	4297	6498	SO:0001583	missense	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.428A>C	11.37:g.5625768A>C	ENSP00000278302:p.Lys143Thr		A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K171T	ENST00000278302.5	37	c.512	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	A	14.79	2.640280	0.47153	.	.	ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000258659;ENSG00000258588	ENST00000278302;ENST00000380107;ENST00000380097;ENST00000396867;ENST00000337072;ENST00000354852	T;T;T;T	0.58210	0.35;0.35;0.35;1.49	4.92	-0.736	0.11133	.	.	.	.	.	T	0.60090	0.2242	M	0.87682	2.9	0.21105	N	0.999782	P;B;P;P	0.52692	0.955;0.421;0.763;0.501	P;B;B;B	0.52267	0.694;0.107;0.382;0.118	T	0.54221	-0.8326	9	0.87932	D	0	.	1.2757	0.02030	0.2642:0.1213:0.1135:0.5009	.	117;171;171;143	E9PFM0;B2RNG4;Q9C030-2;Q9C030	.;.;.;TRIM6_HUMAN	T	143;117;171;50;171;171	ENSP00000278302:K143T;ENSP00000369450:K117T;ENSP00000369440:K171T;ENSP00000346916:K171T	ENSP00000278302:K143T	K	+	2	0	TRIM34;TRIM6;TRIM6-TRIM34	5582344	1.000000	0.71417	0.918000	0.36340	0.346000	0.29079	0.730000	0.26043	0.055000	0.16094	-0.290000	0.09829	AAG	TRIM6-TRIM34	-	NULL	ENSG00000258588		0.443	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6-TRIM34	HGNC	protein_coding	OTTHUMT00000143376.2	-	0.00	76	0	A	NM_001003818		5625768	+1	tier1	-	no_errors	ENST00000354852	ensembl	human	known	74_37	missense	20.00	56	14	SNP	0.883	C
TRIM67	440730	genome.wustl.edu	37	1	231335944	231335944	+	Silent	SNP	C	C	T	rs370010177		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:231335944C>T	ENST00000366653.5	+	4	1314	c.1314C>T	c.(1312-1314)acC>acT	p.T438T	TRIM67_ENST00000449018.3_Silent_p.T376T|TRIM67_ENST00000366652.2_Silent_p.T438T|TRIM67_ENST00000444294.3_Silent_p.T438T			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	438					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GTCAGTCCACCGGACTGATGG	0.522																																																	0								T		0,4026		0,0,2013	154.0	155.0	155.0		1314	-10.6	0.1	1		155	1,8351		0,1,4175	no	coding-synonymous	TRIM67	NM_001004342.3		0,1,6188	TT,TC,CC		0.012,0.0,0.0081		438/784	231335944	1,12377	2013	4176	6189	SO:0001819	synonymous_variant	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1314C>T	1.37:g.231335944C>T			Q5TER7|Q5TER8|Q7Z4K7	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.T438	ENST00000366653.5	37	c.1314	CCDS44333.1	1																																																																																			TRIM67	-	smart_Bbox_C	ENSG00000119283		0.522	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	-	0.00	43	0	C	NM_001004342		231335944	+1	tier1	-	no_errors	ENST00000366652	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.050	T
TRPS1	7227	genome.wustl.edu	37	8	116616855	116616855	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:116616855G>T	ENST00000220888.5	-	3	1461	c.1302C>A	c.(1300-1302)taC>taA	p.Y434*	TRPS1_ENST00000520276.1_Nonsense_Mutation_p.Y438*|TRPS1_ENST00000395715.3_Nonsense_Mutation_p.Y447*|TRPS1_ENST00000519076.1_Intron|TRPS1_ENST00000519674.1_Nonsense_Mutation_p.Y434*			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	434					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATTTACACCAGTAGTAACTGG	0.473									Langer-Giedion syndrome																																								0													64.0	63.0	63.0					8																	116616855		1904	4130	6034	SO:0001587	stop_gained	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.1302C>A	8.37:g.116616855G>T	ENSP00000220888:p.Tyr434*		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Nonsense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.Y447*	ENST00000220888.5	37	c.1341		8	.	.	.	.	.	.	.	.	.	.	G	38	6.695225	0.97768	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000520276;ENST00000519674	.	.	.	5.69	4.82	0.62117	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.836	0.70183	0.0689:0.0:0.9311:0.0	.	.	.	.	X	447;434;438;434	.	ENSP00000220888:Y434X	Y	-	3	2	TRPS1	116686030	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.217000	0.58547	1.540000	0.49301	0.655000	0.94253	TAC	TRPS1	-	smart_Znf_C2H2-like	ENSG00000104447		0.473	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	-	0.00	28	0	G	NM_014112		116616855	-1	tier1	-	no_errors	ENST00000395715	ensembl	human	known	74_37	nonsense	50.00	27	27	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98579527	98579527	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:98579527C>T	ENST00000359863.4	+	58	8958	c.8749C>T	c.(8749-8751)Cgc>Tgc	p.R2917C	TRRAP_ENST00000355540.3_Missense_Mutation_p.R2899C|TRRAP_ENST00000446306.3_Missense_Mutation_p.R2899C	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	2917	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CCTGGCCATCCGCGAGTGGCG	0.677																																																	0													15.0	16.0	15.0					7																	98579527		2194	4274	6468	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.8749C>T	7.37:g.98579527C>T	ENSP00000352925:p.Arg2917Cys		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R2917C	ENST00000359863.4	37	c.8749	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	C	27.1	4.800433	0.90538	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.70631	-0.5;-0.5	5.46	5.46	0.80206	PIK-related kinase (1);PIK-related kinase, FAT (1);	0.000000	0.85682	D	0.000000	D	0.86339	0.5909	M	0.88906	2.99	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.64237	0.923;0.916;0.916	D	0.88749	0.3249	10	0.87932	D	0	.	19.3216	0.94243	0.0:1.0:0.0:0.0	.	2899;2638;2917	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	C	2917;2899;2898	ENSP00000352925:R2917C;ENSP00000347733:R2899C	ENSP00000347733:R2899C	R	+	1	0	TRRAP	98417463	1.000000	0.71417	0.994000	0.49952	0.950000	0.60333	5.874000	0.69652	2.573000	0.86826	0.655000	0.94253	CGC	TRRAP	-	pfam_PIK-rel_kinase_FAT,pfscan_PIK_FAT	ENSG00000196367		0.677	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	39	0	C	NM_003496		98579527	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	34.48	19	10	SNP	1.000	T
TSPAN7	7102	genome.wustl.edu	37	X	38525451	38525451	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:38525451A>G	ENST00000378482.2	+	2	335	c.158A>G	c.(157-159)gAg>gGg	p.E53G	TSPAN7_ENST00000545599.1_Missense_Mutation_p.E27G|TSPAN7_ENST00000422612.2_Missense_Mutation_p.E79G|TSPAN7_ENST00000286824.6_Missense_Mutation_p.E70G|TSPAN7_ENST00000488893.1_3'UTR|TM4SF2_ENST00000465127.1_Missense_Mutation_p.E83G	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	53			E -> K (in dbSNP:rs17851592). {ECO:0000269|PubMed:15489334}.		viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						CTTATTGCCGAGAACTCCACA	0.517																																																	0													219.0	154.0	176.0					X																	38525451		2202	4300	6502	SO:0001583	missense	0			D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.158A>G	X.37:g.38525451A>G	ENSP00000367743:p.Glu53Gly		B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.E79G	ENST00000378482.2	37	c.236	CCDS14248.1	X	.	.	.	.	.	.	.	.	.	.	A	27.5	4.841158	0.91197	.	.	ENSG00000250349;ENSG00000156298;ENSG00000156298;ENSG00000156298;ENSG00000156298	ENST00000465127;ENST00000378482;ENST00000422612;ENST00000286824;ENST00000545599	T;T;T;T;T	0.79749	-1.3;-1.3;-1.3;-1.3;-1.3	6.02	6.02	0.97574	.	0.934809	0.09097	N	0.849015	D	0.87018	0.6073	M	0.73217	2.22	0.80722	D	1	P;P;D	0.53462	0.866;0.949;0.96	P;P;P	0.53146	0.686;0.719;0.672	T	0.82172	-0.0589	9	.	.	.	.	15.459	0.75339	1.0:0.0:0.0:0.0	.	70;79;53	B4DDG0;B4DEA5;P41732	.;.;TSN7_HUMAN	G	83;53;79;70;27	ENSP00000417050:E83G;ENSP00000367743:E53G;ENSP00000388954:E79G;ENSP00000286824:E70G;ENSP00000441540:E27G	.	E	+	2	0	RP5-972B16.2;TSPAN7	38410395	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	7.174000	0.77620	2.035000	0.60131	0.481000	0.45027	GAG	TSPAN7	-	pfam_Tetraspanin/Peripherin	ENSG00000156298		0.517	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	-	0.00	105	0	A			38525451	+1	tier1	-	no_errors	ENST00000422612	ensembl	human	known	74_37	missense	41.82	32	23	SNP	1.000	G
TSSK3	81629	genome.wustl.edu	37	1	32829275	32829275	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:32829275G>T	ENST00000373534.3	+	2	730	c.225G>T	c.(223-225)gaG>gaT	p.E75D	FAM229A_ENST00000432622.1_5'Flank|FAM229A_ENST00000415596.1_Intron	NM_052841.3	NP_443073.1	Q96PN8	TSSK3_HUMAN	testis-specific serine kinase 3	75	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|large_intestine(6)|lung(5)|skin(2)|stomach(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.17)|Breast(348;0.212)				AGGTGTATGAGATGCTGGAGT	0.557																																																	0													82.0	87.0	85.0					1																	32829275		2203	4300	6503	SO:0001583	missense	0			AF296450	CCDS362.1	1p35-p34	2008-02-05	2005-03-10	2005-03-12	ENSG00000162526	ENSG00000162526			15473	protein-coding gene	gene with protein product		607660	"""serine/threonine kinase 22C (spermiogenesis associated)"""	STK22C		11597141	Standard	NM_052841		Approved	SPOGA3	uc001bvf.3	Q96PN8	OTTHUMG00000007585	ENST00000373534.3:c.225G>T	1.37:g.32829275G>T	ENSP00000362634:p.Glu75Asp		Q5TEE5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E75D	ENST00000373534.3	37	c.225	CCDS362.1	1	.	.	.	.	.	.	.	.	.	.	G	13.95	2.388501	0.42308	.	.	ENSG00000162526	ENST00000373534	T	0.21734	1.99	5.42	4.5	0.54988	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.19725	0.0474	L	0.31294	0.92	0.80722	D	1	P	0.35700	0.516	B	0.42214	0.38	T	0.04333	-1.0959	10	0.87932	D	0	.	9.4842	0.38919	0.1631:0.0:0.8369:0.0	.	75	Q96PN8	TSSK3_HUMAN	D	75	ENSP00000362634:E75D	ENSP00000362634:E75D	E	+	3	2	TSSK3	32601862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.271000	0.43364	1.427000	0.47276	0.655000	0.94253	GAG	TSSK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000162526		0.557	TSSK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK3	HGNC	protein_coding	OTTHUMT00000020049.1	-	0.00	36	0	G			32829275	+1	tier1	-	no_errors	ENST00000373534	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
TSTD3	100130890	genome.wustl.edu	37	6	99968887	99968887	+	RNA	SNP	G	G	C	rs567419880		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr6:99968887G>C	ENST00000452647.2	+	0	319							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		GGCGCCAGGAGGCCGGAGCAG	0.652											OREG0017579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												0					6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99968887G>C		1347		RNA	SNP	-	NULL	ENST00000452647.2	37	NULL		6																																																																																			TSTD3	-	-	ENSG00000228439		0.652	TSTD3-001	KNOWN	basic	antisense	TSTD3	HGNC	antisense	OTTHUMT00000041605.2	-	0.00	229	0	G	NM_001195131		99968887	+1	tier1	-	no_errors	ENST00000452647	ensembl	human	known	74_37	rna	20.34	137	36	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179466867	179466867	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:179466867T>G	ENST00000591111.1	-	234	50432	c.50208A>C	c.(50206-50208)gaA>gaC	p.E16736D	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E9312D|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E9504D|TTN_ENST00000342992.6_Missense_Mutation_p.E15809D|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E18377D|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E9437D|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16736	Ig-like 101.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAATGAAAACTTCTGGTTCCT	0.358																																																	0													84.0	79.0	81.0					2																	179466867		1859	4104	5963	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50208A>C	2.37:g.179466867T>G	ENSP00000465570:p.Glu16736Asp		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E15809D	ENST00000591111.1	37	c.47427		2	.	.	.	.	.	.	.	.	.	.	T	10.66	1.412395	0.25465	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.62788	-0.0;0.25;0.21;0.22	5.78	1.96	0.26148	Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47097	0.1427	L	0.31926	0.97	0.24492	N	0.994293	B;B;B;B	0.12630	0.006;0.006;0.006;0.006	B;B;B;B	0.08055	0.003;0.003;0.003;0.003	T	0.43228	-0.9404	9	0.87932	D	0	.	5.2512	0.15522	0.0:0.3302:0.1488:0.521	.	9312;9437;9504;16736	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	15809;9312;9504;9437;9312	ENSP00000343764:E15809D;ENSP00000434586:E9312D;ENSP00000340554:E9504D;ENSP00000352154:E9437D	ENSP00000340554:E9504D	E	-	3	2	TTN	179175112	0.996000	0.38824	1.000000	0.80357	0.969000	0.65631	0.340000	0.19892	0.528000	0.28580	-0.261000	0.10672	GAA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Ig-like_dom	ENSG00000155657		0.358	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	30	0	T	NM_133378		179466867	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	36.59	25	15	SNP	0.999	G
TTN	7273	genome.wustl.edu	37	2	179639257	179639257	+	Intron	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:179639257T>G	ENST00000591111.1	-	30	7015				TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000359218.5_Intron|RP11-88L24.4_ENST00000582038.2_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCATCTAGACTTAGGATAGAG	0.358																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6791-57A>C	2.37:g.179639257T>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.358	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	32	0	T	NM_133378		179639257	+1	tier1	-	no_errors	ENST00000584485	ensembl	human	known	74_37	rna	45.45	18	15	SNP	0.000	G
UBQLN2	29978	genome.wustl.edu	37	X	56591387	56591387	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:56591387G>T	ENST00000338222.5	+	1	1362	c.1081G>T	c.(1081-1083)Gcc>Tcc	p.A361S		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	361					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TAATTATGTCGCCAGCATCTT	0.522																																					Esophageal Squamous(104;218 1492 6022 10838 28884)												0													48.0	35.0	40.0					X																	56591387		2203	4300	6503	SO:0001583	missense	0			AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.1081G>T	X.37:g.56591387G>T	ENSP00000345195:p.Ala361Ser		O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.A361S	ENST00000338222.5	37	c.1081	CCDS14374.1	X	.	.	.	.	.	.	.	.	.	.	G	0.156	-1.085972	0.01873	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	D	0.86865	-2.18	4.74	4.74	0.60224	.	0.000000	0.64402	D	0.000006	T	0.79417	0.4442	L	0.37466	1.105	0.41841	D	0.990125	B;B	0.22983	0.078;0.05	B;B	0.20384	0.029;0.023	T	0.73222	-0.4051	10	0.13853	T	0.58	-9.5022	12.1167	0.53870	0.0:0.0:1.0:0.0	.	361;361	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	S	361	ENSP00000345195:A361S	ENSP00000345195:A361S	A	+	1	0	UBQLN2	56608112	1.000000	0.71417	0.967000	0.41034	0.926000	0.56050	6.469000	0.73555	2.349000	0.79799	0.600000	0.82982	GCC	UBQLN2	-	NULL	ENSG00000188021		0.522	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN2	HGNC	protein_coding	OTTHUMT00000056891.1	-	0.00	33	0	G	NM_013444		56591387	+1	tier1	-	no_errors	ENST00000338222	ensembl	human	known	74_37	missense	28.00	18	7	SNP	0.898	T
UBQLN4	56893	genome.wustl.edu	37	1	156018405	156018405	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:156018405G>A	ENST00000368309.3	-	5	879	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	UBQLN4_ENST00000472638.1_5'UTR	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	263					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					TCCTGGTTCCGCATCATCTCT	0.577																																																	0													80.0	73.0	75.0					1																	156018405		2203	4300	6503	SO:0001583	missense	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.787C>T	1.37:g.156018405G>A	ENSP00000357292:p.Arg263Trp		A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_UBA/Ts_N,pfam_Rad60/SUMO_like,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.R263W	ENST00000368309.3	37	c.787	CCDS1127.1	1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970903	0.74246	.	.	ENSG00000160803	ENST00000368309	T	0.37058	1.22	4.35	4.35	0.52113	.	0.058765	0.64402	D	0.000002	T	0.48390	0.1497	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.52711	-0.8539	10	0.87932	D	0	-9.4964	10.9615	0.47387	0.0:0.0:0.8131:0.1869	.	243;263	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	W	263	ENSP00000357292:R263W	ENSP00000357292:R263W	R	-	1	2	UBQLN4	154285029	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.536000	0.45693	2.256000	0.74724	0.561000	0.74099	CGG	UBQLN4	-	superfamily_ARM-type_fold	ENSG00000160803		0.577	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	-	0.00	86	0	G	NM_020131		156018405	-1	tier1	-	no_errors	ENST00000368309	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
UCN2	90226	genome.wustl.edu	37	3	48600422	48600422	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:48600422C>A	ENST00000273610.3	-	2	218	c.136G>T	c.(136-138)Gag>Tag	p.E46*	COL7A1_ENST00000470076.1_5'Flank|PFKFB4_ENST00000536104.1_5'Flank	NM_033199.3	NP_149976.1	Q96RP3	UCN2_HUMAN	urocortin 2	46					cAMP biosynthetic process (GO:0006171)|cell proliferation (GO:0008283)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|digestion (GO:0007586)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of gene expression (GO:0010629)|negative regulation of luteinizing hormone secretion (GO:0033685)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone binding (GO:0042562)|receptor binding (GO:0005102)								BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GAGGGGCTCTCTGAGGCCGCA	0.657																																																	0													23.0	26.0	25.0					3																	48600422		2203	4300	6503	SO:0001587	stop_gained	0			AF320560	CCDS2772.1	3p21.3	2013-02-28			ENSG00000145040	ENSG00000145040		"""Endogenous ligands"""	18414	protein-coding gene	gene with protein product	"""prepro-urocortin 2"""	605902				11329063	Standard	NM_033199		Approved	UCNI, SRP, URP, UCN-II	uc003cty.1	Q96RP3	OTTHUMG00000133533	ENST00000273610.3:c.136G>T	3.37:g.48600422C>A	ENSP00000273610:p.Glu46*		Q9BUG0	Nonsense_Mutation	SNP	pfam_Urocortin_II/III	p.E46*	ENST00000273610.3	37	c.136	CCDS2772.1	3	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326040	0.41197	.	.	ENSG00000145040	ENST00000273610	.	.	.	4.87	-0.874	0.10631	.	1.040240	0.07684	N	0.937554	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-6.0489	0.4985	0.00576	0.2093:0.3255:0.1406:0.3246	.	.	.	.	X	46	.	ENSP00000273610:E46X	E	-	1	0	UCN2	48575426	0.000000	0.05858	0.131000	0.22000	0.091000	0.18340	-0.096000	0.11059	-0.004000	0.14419	-0.188000	0.12872	GAG	UCN2	-	NULL	ENSG00000145040		0.657	UCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCN2	HGNC	protein_coding	OTTHUMT00000257510.1		0.00	100	0	C	NM_033199		48600422	-1			no_errors	ENST00000273610	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	0.024	A
UPF2	26019	genome.wustl.edu	37	10	12009383	12009386	+	Frame_Shift_Del	DEL	TTAG	TTAG	-			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	TTAG	TTAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr10:12009383_12009386delTTAG	ENST00000356352.2	-	9	2494_2497	c.2021_2024delCTAA	c.(2020-2025)actaagfs	p.TK674fs	UPF2_ENST00000357604.5_Frame_Shift_Del_p.TK674fs|UPF2_ENST00000397053.2_Frame_Shift_Del_p.TK674fs			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	674	MIF4G 2.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CATCTTAAACTTAGTTAGTTCTCC	0.265																																																	0																																										SO:0001589	frameshift_variant	0			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.2021_2024delCTAA	10.37:g.12009387_12009390delTTAG	ENSP00000348708:p.Thr674fs		A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Frame_Shift_Del	DEL	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.T674fs	ENST00000356352.2	37	c.2024_2021	CCDS7086.1	10																																																																																			UPF2	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000151461		0.265	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1		0.00	63	0	TTAG			12009386	-1	tier1		no_errors	ENST00000356352	ensembl	human	known	74_37	frame_shift_del	27.69	47	18	DEL	1.000:1.000:0.962:1.000	-
UQCRQ	27089	genome.wustl.edu	37	5	132203211	132203211	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:132203211G>T	ENST00000378670.3	+	3	327	c.186G>T	c.(184-186)tgG>tgT	p.W62C	UQCRQ_ENST00000378665.1_Missense_Mutation_p.W62C|GDF9_ENST00000296875.2_5'Flank|UQCRQ_ENST00000496429.1_3'UTR|UQCRQ_ENST00000378667.1_Missense_Mutation_p.W62C|GDF9_ENST00000464378.1_5'Flank|GDF9_ENST00000378673.2_5'Flank	NM_014402.4	NP_055217.2	O14949	QCR8_HUMAN	ubiquinol-cytochrome c reductase, complex III subunit VII, 9.5kDa	62					cellular metabolic process (GO:0044237)|cerebellar Purkinje cell layer development (GO:0021680)|hippocampus development (GO:0021766)|hypothalamus development (GO:0021854)|midbrain development (GO:0030901)|pons development (GO:0021548)|pyramidal neuron development (GO:0021860)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|subthalamus development (GO:0021539)|thalamus development (GO:0021794)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain (GO:0070469)	ubiquinol-cytochrome-c reductase activity (GO:0008121)			lung(3)	3		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTACACATGGGGGACTGAAG	0.393																																																	0													88.0	87.0	88.0					5																	132203211		2203	4300	6503	SO:0001583	missense	0			BC001390	CCDS34237.1	5q31.1	2011-07-04			ENSG00000164405	ENSG00000164405	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	29594	protein-coding gene	gene with protein product	"""ubiquinol-cytochrome c reductase, complex III subunit VII"", ""complex III subunit 8"""	612080				15544925, 12709789, 2164842	Standard	NM_014402		Approved	QP-C, QCR8, UQCR7	uc003kya.1	O14949	OTTHUMG00000059836	ENST00000378670.3:c.186G>T	5.37:g.132203211G>T	ENSP00000367939:p.Trp62Cys		Q5FVE2|Q9BV88|Q9T2V7	Missense_Mutation	SNP	pfam_Cyt_bc1_su8,superfamily_Cyt_bc1_su8	p.W62C	ENST00000378670.3	37	c.186	CCDS34237.1	5	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144359	0.77888	.	.	ENSG00000164405	ENST00000378670;ENST00000378667;ENST00000378665	T;T;T	0.80123	-1.34;-1.34;-1.34	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90515	0.7028	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91147	0.4950	9	0.87932	D	0	-51.0827	18.8846	0.92370	0.0:0.0:1.0:0.0	.	62	O14949	QCR8_HUMAN	C	62	ENSP00000367939:W62C;ENSP00000367936:W62C;ENSP00000367934:W62C	ENSP00000367934:W62C	W	+	3	0	UQCRQ	132231110	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	8.485000	0.90448	2.717000	0.92951	0.655000	0.94253	TGG	UQCRQ	-	pfam_Cyt_bc1_su8,superfamily_Cyt_bc1_su8	ENSG00000164405		0.393	UQCRQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRQ	HGNC	protein_coding	OTTHUMT00000133040.1	-	0.00	54	0	G	NM_014402		132203211	+1	tier1	-	no_errors	ENST00000378665	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
USP24	23358	genome.wustl.edu	37	1	55560968	55560968	+	Silent	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr1:55560968G>T	ENST00000294383.6	-	51	6162	c.6163C>A	c.(6163-6165)Cga>Aga	p.R2055R	USP24_ENST00000407756.1_Silent_p.R1895R	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2055					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						ACGCTGACTCGACTTTTCTTT	0.448																																																	0													84.0	84.0	84.0					1																	55560968		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6163C>A	1.37:g.55560968G>T			Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.R1895	ENST00000294383.6	37	c.5683	CCDS44154.2	1																																																																																			USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.448	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2		0.00	46	0	G			55560968	-1			no_errors	ENST00000407756	ensembl	human	known	74_37	silent	6.67	28	2	SNP	1.000	T
USP27X	389856	genome.wustl.edu	37	X	49643205	49643205	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chrX:49643205C>T	ENST00000508866.2	+	0	0				USP27X-AS1_ENST00000437322.2_lincRNA	NM_001145073.1	NP_001138545.1	A6NNY8	UBP27_HUMAN	ubiquitin specific peptidase 27, X-linked						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(7)	7						AGCAGCAGGCCCAGACCCTGC	0.711																																																	0																																										SO:0001631	upstream_gene_variant	0			AW851065	CCDS65260.1	Xp11.23	2007-10-05	2005-08-08			ENSG00000273820		"""Ubiquitin-specific peptidases"""	13486	protein-coding gene	gene with protein product			"""ubiquitin specific protease 27, X chromosome"", ""ubiquitin specific protease 27, X-linked"""			12838346	Standard	NM_001145073		Approved	USP27	uc004dop.3	A6NNY8			X.37:g.49643205C>T	Exception_encountered			RNA	SNP	-	NULL	ENST00000508866.2	37	NULL		X																																																																																			USP27X-AS1	-	-	ENSG00000234390		0.711	USP27X-001	KNOWN	basic|appris_principal	protein_coding	USP27X-AS1	HGNC	protein_coding	OTTHUMT00000060837.3	-	0.00	50	0	C	XM_372213		49643205	-1	tier1	-	no_errors	ENST00000437322	ensembl	human	known	74_37	rna	57.58	14	19	SNP	0.000	T
VWF	7450	genome.wustl.edu	37	12	6182795	6182795	+	Silent	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:6182795G>A	ENST00000261405.5	-	8	1241	c.987C>T	c.(985-987)tgC>tgT	p.C329C		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	329	TIL 1.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.C329*(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAGGGCAGCTGCAGCCATCCA	0.532																																																	1	Substitution - Nonsense(1)	lung(1)											109.0	92.0	98.0					12																	6182795		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.987C>T	12.37:g.6182795G>A			Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.C329	ENST00000261405.5	37	c.987	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF,pfam_TIL_dom,superfamily_TIL_dom	ENSG00000110799		0.532	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	-	0.00	38	0	G	NM_000552		6182795	-1	tier1	-	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	25.00	15	5	SNP	1.000	A
USP5	8078	genome.wustl.edu	37	12	6965536	6965536	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:6965536G>A	ENST00000229268.8	+	5	558	c.506G>A	c.(505-507)tGg>tAg	p.W169*	USP5_ENST00000389231.5_Nonsense_Mutation_p.W169*	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	169					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						GTGCAGGCATGGGATGGGGAA	0.627																																																	0													86.0	78.0	81.0					12																	6965536		2203	4300	6503	SO:0001587	stop_gained	0			U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.506G>A	12.37:g.6965536G>A	ENSP00000229268:p.Trp169*		D3DUS7|D3DUS8|Q96J22	Nonsense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.W169*	ENST00000229268.8	37	c.506	CCDS41743.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.024504	0.97211	.	.	ENSG00000111667	ENST00000229268;ENST00000389231	.	.	.	4.8	4.8	0.61643	.	0.111287	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0566	0.89365	0.0:0.0:1.0:0.0	.	.	.	.	X	169	.	ENSP00000229268:W169X	W	+	2	0	USP5	6835797	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.254000	0.95512	2.488000	0.83962	0.551000	0.68910	TGG	USP5	-	pirsf_Ubiquitinyl_hydrolase	ENSG00000111667		0.627	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP5	HGNC	protein_coding	OTTHUMT00000402982.1	-	0.00	41	0	G			6965536	+1	tier1	-	no_errors	ENST00000229268	ensembl	human	known	74_37	nonsense	16.67	30	6	SNP	1.000	A
WBSCR17	64409	genome.wustl.edu	37	7	70880968	70880968	+	Missense_Mutation	SNP	G	G	A	rs367865697		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:70880968G>A	ENST00000333538.5	+	4	1317	c.683G>A	c.(682-684)cGc>cAc	p.R228H	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	228	Catalytic subdomain A.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GGCCTGATCCGCGCTCGCATT	0.572																																																	0								G	HIS/ARG	0,4406		0,0,2203	91.0	78.0	82.0		683	5.0	1.0	7		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	WBSCR17	NM_022479.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	228/599	70880968	1,13005	2203	4300	6503	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.683G>A	7.37:g.70880968G>A	ENSP00000329654:p.Arg228His		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R228H	ENST00000333538.5	37	c.683	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	G	35	5.466726	0.96257	0.0	1.16E-4	ENSG00000185274	ENST00000333538	T	0.61980	0.06	5.04	5.04	0.67666	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	M	0.87180	2.865	0.80722	D	1	D	0.58620	0.983	P	0.58820	0.846	D	0.84356	0.0535	10	0.87932	D	0	.	17.3775	0.87396	0.0:0.0:1.0:0.0	.	228	Q6IS24	GLTL3_HUMAN	H	228	ENSP00000329654:R228H	ENSP00000329654:R228H	R	+	2	0	WBSCR17	70518904	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.378000	0.97191	2.351000	0.79841	0.462000	0.41574	CGC	WBSCR17	-	pfam_Glyco_trans_2	ENSG00000185274		0.572	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	-	0.00	38	0	G	NM_022479		70880968	+1	tier1	-	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	A
WDR34	89891	genome.wustl.edu	37	9	131403138	131403138	+	Silent	SNP	C	C	T	rs137886760		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr9:131403138C>T	ENST00000372715.2	-	2	327	c.267G>A	c.(265-267)acG>acA	p.T89T		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	89						axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)		p.T89T(1)		central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						CGGGGGCCTCCGTCTGCACCT	0.632																																																	1	Substitution - coding silent(1)	lung(1)						C		0,4406		0,0,2203	45.0	44.0	44.0		267	-10.7	0.3	9	dbSNP_134	44	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WDR34	NM_052844.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		89/537	131403138	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.267G>A	9.37:g.131403138C>T			Q5VXV4|Q9BV46	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.T89	ENST00000372715.2	37	c.267	CCDS6906.2	9																																																																																			WDR34	-	NULL	ENSG00000119333		0.632	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR34	HGNC	protein_coding	OTTHUMT00000054463.1	-	0.00	44	0	C	NM_052844		131403138	-1	tier1	rs137886760	no_errors	ENST00000372715	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.030	T
WRN	7486	genome.wustl.edu	37	8	30945377	30945379	+	In_Frame_Del	DEL	AAG	AAG	-	rs555283914	byFrequency	TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:30945377_30945379delAAG	ENST00000298139.5	+	12	1766_1768	c.1517_1519delAAG	c.(1516-1521)aaagaa>aaa	p.E510del		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	510	Poly-Glu.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		CTTCCTACTAaagaagaagaaga	0.36			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome					3	0.000599042	0.0	0.0	5008	,	,		22085	0.001		0.001	False		,,,				2504	0.001				Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0																																										SO:0001651	inframe_deletion	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1517_1519delAAG	8.37:g.30945386_30945388delAAG	ENSP00000298139:p.Glu510del		A1KYY9	In_Frame_Del	DEL	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.E510in_frame_del	ENST00000298139.5	37	c.1517_1519	CCDS6082.1	8																																																																																			WRN	-	NULL	ENSG00000165392		0.360	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1		0.00	64	0	AAG			30945379	+1	tier1		no_errors	ENST00000298139	ensembl	human	known	74_37	in_frame_del	8.00	23	2	DEL	0.904:0.908:0.988	-
WRN	7486	genome.wustl.edu	37	8	30982073	30982073	+	Missense_Mutation	SNP	G	G	T	rs374262282		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr8:30982073G>T	ENST00000298139.5	+	22	2915	c.2666G>T	c.(2665-2667)cGa>cTa	p.R889L		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	889	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GAGAAGTTTCGATTATACAAA	0.303			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													71.0	70.0	70.0					8																	30982073		2203	4293	6496	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.2666G>T	8.37:g.30982073G>T	ENSP00000298139:p.Arg889Leu		A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.R889L	ENST00000298139.5	37	c.2666	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047322	0.75846	.	.	ENSG00000165392	ENST00000298139	T	0.51071	0.72	5.58	5.58	0.84498	Helicase, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.56848	0.2013	L	0.61218	1.895	0.47276	D	0.999373	P;P	0.42961	0.477;0.795	B;P	0.46585	0.101;0.521	T	0.59241	-0.7491	10	0.59425	D	0.04	-9.9485	19.1558	0.93510	0.0:0.0:1.0:0.0	.	299;889	Q59F09;Q14191	.;WRN_HUMAN	L	889	ENSP00000298139:R889L	ENSP00000298139:R889L	R	+	2	0	WRN	31101615	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	4.447000	0.60020	2.631000	0.89168	0.555000	0.69702	CGA	WRN	-	pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000165392		0.303	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	-	0.00	59	0	G			30982073	+1	tier1	-	no_errors	ENST00000298139	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
WSCD1	23302	genome.wustl.edu	37	17	6023844	6023844	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr17:6023844C>T	ENST00000574946.1	+	9	1981	c.1591C>T	c.(1591-1593)Cgc>Tgc	p.R531C	WSCD1_ENST00000539421.1_Missense_Mutation_p.R531C|WSCD1_ENST00000317744.5_Missense_Mutation_p.R531C|WSCD1_ENST00000573634.1_Missense_Mutation_p.R415C|WSCD1_ENST00000574232.1_Missense_Mutation_p.R531C			Q658N2	WSCD1_HUMAN	WSC domain containing 1	531						integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(1)	35						CTTCCGGCGGCGCGGCCGGCG	0.637																																																	0													57.0	60.0	59.0					17																	6023844		2202	4300	6502	SO:0001583	missense	0				CCDS32538.1	17p13.2	2008-02-05				ENSG00000179314			29060	protein-coding gene	gene with protein product							Standard	XM_005256572		Approved	KIAA0523	uc002gcn.3	Q658N2		ENST00000574946.1:c.1591C>T	17.37:g.6023844C>T	ENSP00000460825:p.Arg531Cys		A8K0N8|D3DTM3|O60276|Q96G45	Missense_Mutation	SNP	pfam_WSC_carb-bd,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.R531C	ENST00000574946.1	37	c.1591	CCDS32538.1	17	.	.	.	.	.	.	.	.	.	.	C	19.80	3.895614	0.72639	.	.	ENSG00000179314	ENST00000317744;ENST00000539421	T;T	0.33438	1.41;1.41	5.44	5.44	0.79542	.	0.613434	0.18327	N	0.144617	T	0.22282	0.0537	N	0.19112	0.55	0.37518	D	0.917414	D	0.53885	0.963	B	0.43360	0.417	T	0.07424	-1.0773	10	0.59425	D	0.04	-10.1083	10.2338	0.43270	0.0:0.91:0.0:0.09	.	531	Q658N2	WSCD1_HUMAN	C	531	ENSP00000323087:R531C;ENSP00000446032:R531C	ENSP00000323087:R531C	R	+	1	0	WSCD1	5964568	0.759000	0.28416	0.740000	0.30986	0.946000	0.59487	4.664000	0.61540	2.549000	0.85964	0.655000	0.94253	CGC	WSCD1	-	superfamily_P-loop_NTPase	ENSG00000179314		0.637	WSCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WSCD1	HGNC	protein_coding	OTTHUMT00000438965.4	-	0.00	115	0	C	NM_015253		6023844	+1	tier1	-	no_errors	ENST00000317744	ensembl	human	known	74_37	missense	28.33	42	17	SNP	0.695	T
XIRP2	129446	genome.wustl.edu	37	2	168099884	168099884	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr2:168099884G>T	ENST00000409195.1	+	9	2071	c.1982G>T	c.(1981-1983)aGg>aTg	p.R661M	XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.R439M|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.R661M|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	486					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TTTGAAACAAGGCCATTGGAC	0.438																																																	0													74.0	71.0	72.0					2																	168099884		1903	4131	6034	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1982G>T	2.37:g.168099884G>T	ENSP00000386840:p.Arg661Met		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.R661M	ENST00000409195.1	37	c.1982	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	15.60	2.882346	0.51908	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02890	4.12;4.12;4.12	5.93	3.81	0.43845	.	0.267324	0.43416	D	0.000563	T	0.04543	0.0124	L	0.34521	1.04	0.40642	D	0.981958	P;P;P	0.51351	0.906;0.944;0.944	P;P;P	0.51135	0.459;0.563;0.66	T	0.49234	-0.8961	10	0.62326	D	0.03	-4.8712	7.543	0.27751	0.86:0.0:0.14:0.0	.	486;486;439	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	M	661;661;439	ENSP00000386840:R661M;ENSP00000295237:R661M;ENSP00000387255:R439M	ENSP00000295237:R661M	R	+	2	0	XIRP2	167808130	0.988000	0.35896	1.000000	0.80357	0.993000	0.82548	3.004000	0.49513	0.663000	0.31027	-0.140000	0.14226	AGG	XIRP2	-	NULL	ENSG00000163092		0.438	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1		0.00	28	0	G	NM_152381		168099884	+1			no_errors	ENST00000295237	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
XYLT1	64131	genome.wustl.edu	37	16	17451880	17451880	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:17451880G>T	ENST00000261381.6	-	2	475	c.391C>A	c.(391-393)Ctg>Atg	p.L131M	XYLT1_ENST00000568226.1_5'UTR	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	131					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGAGTCTCCAGGGTGATGAGC	0.478																																																	0													130.0	106.0	114.0					16																	17451880		2197	4300	6497	SO:0001583	missense	0			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.391C>A	16.37:g.17451880G>T	ENSP00000261381:p.Leu131Met		Q9H1B6	Missense_Mutation	SNP	pfam_XylT,pfam_Glyco_trans_14	p.L131M	ENST00000261381.6	37	c.391	CCDS10569.1	16	.	.	.	.	.	.	.	.	.	.	G	10.85	1.465596	0.26335	.	.	ENSG00000103489	ENST00000261381	T	0.04654	3.58	5.56	4.61	0.57282	.	0.749808	0.12530	N	0.460870	T	0.07863	0.0197	N	0.08118	0	0.29375	N	0.863714	D	0.71674	0.998	D	0.80764	0.994	T	0.34254	-0.9836	10	0.41790	T	0.15	-18.3416	8.4933	0.33112	0.1751:0.0:0.8249:0.0	.	131	Q86Y38	XYLT1_HUMAN	M	131	ENSP00000261381:L131M	ENSP00000261381:L131M	L	-	1	2	XYLT1	17359381	1.000000	0.71417	0.999000	0.59377	0.584000	0.36387	0.767000	0.26575	1.346000	0.45694	0.655000	0.94253	CTG	XYLT1	-	NULL	ENSG00000103489		0.478	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2	-	0.00	85	0	G	NM_022166		17451880	-1	tier1	-	no_errors	ENST00000261381	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
YKT6	10652	genome.wustl.edu	37	7	44244168	44244168	+	Splice_Site	SNP	G	G	T	rs374571498		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:44244168G>T	ENST00000223369.2	+	2	193	c.106G>T	c.(106-108)Gtt>Ttt	p.V36F	YKT6_ENST00000496112.1_Splice_Site_p.V36F|YKT6_ENST00000447123.1_3'UTR	NM_006555.3	NP_006546.1	O15498	YKT6_HUMAN	YKT6 v-SNARE homolog (S. cerevisiae)	36	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|metabolic process (GO:0008152)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle docking involved in exocytosis (GO:0006904)|vesicle targeting (GO:0006903)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|SNARE complex (GO:0031201)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7						GTTTCTTAGCGTTCAGGAATT	0.428																																																	0													143.0	125.0	131.0					7																	44244168		2203	4300	6503	SO:0001630	splice_region_variant	0			BC007319	CCDS5482.1	7p13	2006-07-07			ENSG00000106636	ENSG00000106636			16959	protein-coding gene	gene with protein product	"""R-SNARE"""	606209				15479160, 15544955	Standard	NM_006555		Approved		uc003tkm.3	O15498	OTTHUMG00000129089	ENST00000223369.2:c.105-1G>T	7.37:g.44244168G>T			B4DR94|Q53F01|Q6FGU9|Q6IB15	Missense_Mutation	SNP	pfam_Synaptobrevin,superfamily_Longin-like_dom,pfscan_Longin_dom,pfscan_Synaptobrevin	p.V36F	ENST00000223369.2	37	c.106	CCDS5482.1	7	.	.	.	.	.	.	.	.	.	.	G	23.6	4.433473	0.83776	.	.	ENSG00000106636	ENST00000496112;ENST00000223369	T	0.21543	2.0	5.55	5.55	0.83447	Longin (2);Longin-like (1);	0.114746	0.64402	D	0.000017	T	0.53012	0.1770	M	0.89163	3.01	0.80722	D	1	D;D	0.71674	0.998;0.996	D;D	0.68943	0.961;0.961	T	0.61232	-0.7104	10	0.87932	D	0	-11.2503	16.4348	0.83872	0.0:0.0:1.0:0.0	.	36;36	B4DR94;O15498	.;YKT6_HUMAN	F	36	ENSP00000223369:V36F	ENSP00000223369:V36F	V	+	1	0	YKT6	44210693	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.817000	0.55668	2.615000	0.88500	0.650000	0.86243	GTT	YKT6	-	superfamily_Longin-like_dom,pfscan_Longin_dom	ENSG00000106636		0.428	YKT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YKT6	HGNC	protein_coding	OTTHUMT00000251125.2	-	0.00	54	0	G	NM_006555	Missense_Mutation	44244168	+1	tier1	-	no_errors	ENST00000223369	ensembl	human	known	74_37	missense	7.14	51	4	SNP	1.000	T
ZCWPW2	152098	genome.wustl.edu	37	3	28566105	28566105	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:28566105T>G	ENST00000383768.2	+	10	1185	c.997T>G	c.(997-999)Tta>Gta	p.L333V	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.L333V			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	333							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						TGGGATAAAATTAAAAGCTGG	0.318																																																	0													76.0	87.0	83.0					3																	28566105		2200	4299	6499	SO:0001583	missense	0			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.997T>G	3.37:g.28566105T>G	ENSP00000373278:p.Leu333Val			Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_CW	p.L333V	ENST00000383768.2	37	c.997	CCDS33723.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.15|14.15	2.450031|2.450031	0.43531|0.43531	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000419130|ENST00000383768;ENST00000421010	.|T;T	.|0.37915	.|1.17;1.17	6.03|6.03	0.978|0.978	0.19740|0.19740	.|.	.|0.331414	.|0.21968	.|N	.|0.066493	T|T	0.30978|0.30978	0.0782|0.0782	L|L	0.32530|0.32530	0.975|0.975	0.21184|0.21184	N|N	0.999769|0.999769	.|D	.|0.58268	.|0.982	.|P	.|0.48815	.|0.591	T|T	0.16453|0.16453	-1.0402|-1.0402	5|10	.|0.72032	.|D	.|0.01	-3.5801|-3.5801	8.3426|8.3426	0.32252|0.32252	0.0:0.3332:0.0:0.6668|0.0:0.3332:0.0:0.6668	.|.	.|333	.|Q504Y3	.|ZCPW2_HUMAN	S|V	217|333	.|ENSP00000373278:L333V;ENSP00000412386:L333V	.|ENSP00000373278:L333V	I|L	+|+	2|1	0|2	ZCWPW2|ZCWPW2	28541109|28541109	0.468000|0.468000	0.25839|0.25839	0.241000|0.241000	0.24154|0.24154	0.991000|0.991000	0.79684|0.79684	0.362000|0.362000	0.20284|0.20284	-0.056000|-0.056000	0.13221|0.13221	-0.290000|-0.290000	0.09829|0.09829	ATT|TTA	ZCWPW2	-	NULL	ENSG00000206559		0.318	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1	-	0.00	93	0	T	XM_087384		28566105	+1	tier1	-	no_errors	ENST00000383768	ensembl	human	known	74_37	missense	79.17	20	76	SNP	0.306	G
ZBTB20	26137	genome.wustl.edu	37	3	114069573	114069573	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr3:114069573C>T	ENST00000474710.1	-	4	1530	c.1352G>A	c.(1351-1353)aGc>aAc	p.S451N	ZBTB20_ENST00000464560.1_Missense_Mutation_p.S378N|ZBTB20_ENST00000357258.3_Missense_Mutation_p.S378N|ZBTB20_ENST00000471418.1_Missense_Mutation_p.S378N|ZBTB20_ENST00000393785.2_Missense_Mutation_p.S378N|ZBTB20_ENST00000462705.1_Missense_Mutation_p.S378N|ZBTB20_ENST00000481632.1_Missense_Mutation_p.S378N|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20-AS1_ENST00000496219.1_RNA|ZBTB20-AS1_ENST00000467304.1_RNA	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	451						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CTTGTCGGAGCTGTTGCTGAC	0.547																																					NSCLC(69;748 1344 9802 11203 30933)												0													110.0	88.0	95.0					3																	114069573		2203	4300	6503	SO:0001583	missense	0			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.1352G>A	3.37:g.114069573C>T	ENSP00000419153:p.Ser451Asn		Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S451N	ENST00000474710.1	37	c.1352	CCDS54626.1	3	.	.	.	.	.	.	.	.	.	.	C	18.95	3.731610	0.69189	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.10192	2.93;2.93;2.93;2.93;2.9;2.93;2.93	5.41	5.41	0.78517	.	0.109013	0.64402	D	0.000001	T	0.12944	0.0314	L	0.27053	0.805	0.80722	D	1	P	0.51791	0.948	P	0.45610	0.487	T	0.01739	-1.1284	10	0.52906	T	0.07	.	19.1985	0.93699	0.0:1.0:0.0:0.0	.	451	Q9HC78	ZBT20_HUMAN	N	378;378;378;378;451;378;378	ENSP00000420324:S378N;ENSP00000377375:S378N;ENSP00000418092:S378N;ENSP00000419902:S378N;ENSP00000419153:S451N;ENSP00000349803:S378N;ENSP00000417307:S378N	ENSP00000349803:S378N	S	-	2	0	ZBTB20	115552263	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.900000	0.48687	2.546000	0.85860	0.557000	0.71058	AGC	ZBTB20	-	NULL	ENSG00000181722		0.547	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1		0.00	32	0	C	NM_015642		114069573	-1			no_errors	ENST00000474710	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
ZDHHC17	23390	genome.wustl.edu	37	12	77202869	77202869	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr12:77202869C>A	ENST00000426126.2	+	4	1016	c.367C>A	c.(367-369)Ctg>Atg	p.L123M	ZDHHC17_ENST00000359019.4_Missense_Mutation_p.L73M|ZDHHC17_ENST00000334822.5_Missense_Mutation_p.L123M	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	123					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						TGGAGGGGACCTGAATTCAAC	0.284																																																	0													73.0	71.0	71.0					12																	77202869		1796	4064	5860	SO:0001583	missense	0			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.367C>A	12.37:g.77202869C>A	ENSP00000403397:p.Leu123Met		B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase,prints_Ankyrin_rpt	p.L123M	ENST00000426126.2	37	c.367	CCDS44946.1	12	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372778	0.61624	.	.	ENSG00000186908	ENST00000426126;ENST00000334822;ENST00000359019;ENST00000549682	T;T;T;T	0.71341	1.3;1.3;0.99;-0.56	5.24	2.47	0.30058	Ankyrin repeat-containing domain (3);	0.065707	0.64402	D	0.000008	T	0.75752	0.3892	L	0.43598	1.365	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73858	-0.3850	10	0.62326	D	0.03	-5.6875	9.3672	0.38232	0.0:0.687:0.0:0.313	.	123	Q8IUH5	ZDH17_HUMAN	M	123;123;73;100	ENSP00000403397:L123M;ENSP00000334868:L123M;ENSP00000351913:L73M;ENSP00000450295:L100M	ENSP00000334868:L123M	L	+	1	2	ZDHHC17	75727000	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	2.514000	0.45503	0.370000	0.24538	-0.142000	0.14014	CTG	ZDHHC17	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000186908		0.284	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC17	HGNC	protein_coding	OTTHUMT00000406555.1		0.00	92	0	C	NM_015336		77202869	+1			no_errors	ENST00000334822	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	A
ZFP28	140612	genome.wustl.edu	37	19	57065438	57065438	+	Silent	SNP	T	T	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:57065438T>C	ENST00000301318.3	+	8	1355	c.1284T>C	c.(1282-1284)acT>acC	p.T428T	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GTAAGAAAACTTTTACCCAGA	0.343																																					Ovarian(124;554 1662 19430 21141 52494)												0													59.0	67.0	65.0					19																	57065438		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1284T>C	19.37:g.57065438T>C			A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T428	ENST00000301318.3	37	c.1284	CCDS12946.1	19																																																																																			ZFP28	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196867		0.343	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP28	HGNC	protein_coding	OTTHUMT00000458409.1	-	0.00	49	0	T	NM_020828		57065438	+1	tier1	-	no_errors	ENST00000301318	ensembl	human	known	74_37	silent	33.93	37	19	SNP	0.558	C
ZNF106	64397	genome.wustl.edu	37	15	42716944	42716944	+	Intron	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr15:42716944C>T	ENST00000263805.4	-	13	5448				RNU6-188P_ENST00000364207.1_RNA|ZNF106_ENST00000565660.1_5'UTR|ZNF106_ENST00000565611.1_Intron|ZNF106_ENST00000565380.1_Intron	NM_001284306.1|NM_001284307.1|NM_022473.1	NP_001271235.1|NP_001271236.1|NP_071918.1	Q9H2Y7	ZN106_HUMAN	zinc finger protein 106						insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										tcccaaagtgctgggactaca	0.502																																																	0																																										SO:0001627	intron_variant	0			AF205632	CCDS32208.1, CCDS61602.1, CCDS61603.1	15q15.1	2012-11-27	2012-11-27		ENSG00000103994	ENSG00000103994		"""Zinc fingers, C2H2-type"""	12886	protein-coding gene	gene with protein product	"""SH3-domain binding protein 3"""		"""zinc finger protein 106 homolog (mouse)"""	ZFP106			Standard	XM_005254591		Approved	ZNF474, SH3BP3	uc001zpw.3	Q9H2Y7	OTTHUMG00000173244	ENST00000263805.4:c.5121+87G>A	15.37:g.42716944C>T			B4DZ40|E9PE29|Q6NSD9|Q6PEK1|Q86T43|Q86T45|Q86T50|Q86T58|Q86TA9|Q96M37|Q9H7B8	RNA	SNP	-	NULL	ENST00000263805.4	37	NULL	CCDS32208.1	15																																																																																			ZNF106	-	-	ENSG00000103994		0.502	ZNF106-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF106	HGNC	protein_coding	OTTHUMT00000422587.1	-	0.00	15	0	C	NM_022473		42716944	-1	tier1	-	no_errors	ENST00000565660	ensembl	human	known	74_37	rna	25.00	12	4	SNP	0.014	T
ZNF329	79673	genome.wustl.edu	37	19	58640829	58640829	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:58640829T>G	ENST00000598312.1	-	4	275	c.42A>C	c.(40-42)gaA>gaC	p.E14D	ZNF329_ENST00000358067.4_Missense_Mutation_p.E14D	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		CACAGGGTACTTCTCTCTCAG	0.418																																																	0													143.0	144.0	144.0					19																	58640829		2203	4300	6503	SO:0001583	missense	0			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.42A>C	19.37:g.58640829T>G	ENSP00000470008:p.Glu14Asp		B3KR32|Q9H9R7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E14D	ENST00000598312.1	37	c.42	CCDS12972.1	19	.	.	.	.	.	.	.	.	.	.	T	7.142	0.581933	0.13749	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.09538	2.97;2.97	4.58	3.56	0.40772	.	0.860680	0.09837	N	0.749426	T	0.06917	0.0176	L	0.27053	0.805	0.21064	N	0.999798	P	0.34522	0.455	B	0.30105	0.111	T	0.35895	-0.9770	10	0.18276	T	0.48	-3.7738	6.8925	0.24236	0.0:0.1017:0.0:0.8983	.	14	Q86UD4	ZN329_HUMAN	D	14	ENSP00000350773:E14D;ENSP00000439527:E14D	ENSP00000350773:E14D	E	-	3	2	ZNF329	63332641	0.001000	0.12720	0.034000	0.17996	0.021000	0.10359	0.502000	0.22594	1.078000	0.41014	0.533000	0.62120	GAA	ZNF329	-	NULL	ENSG00000181894		0.418	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF329	HGNC	protein_coding	OTTHUMT00000466724.1	-	0.00	33	0	T	NM_024620		58640829	-1	tier1	-	no_errors	ENST00000358067	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.684	G
ZNF366	167465	genome.wustl.edu	37	5	71756569	71756569	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr5:71756569C>T	ENST00000318442.5	-	2	1245	c.755G>A	c.(754-756)cGc>cAc	p.R252H		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	252					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		GCACTGCCAGCGCTTCTGCGA	0.627																																																	0													136.0	132.0	133.0					5																	71756569		2203	4300	6503	SO:0001583	missense	0			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.755G>A	5.37:g.71756569C>T	ENSP00000313158:p.Arg252His		Q5HYI9|Q7RTV4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R252H	ENST00000318442.5	37	c.755	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.163421	0.94727	.	.	ENSG00000178175	ENST00000318442	T	0.28454	1.61	5.94	5.94	0.96194	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	T	0.56834	0.2012	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54689	-0.8256	10	0.72032	D	0.01	-58.2749	20.3633	0.98874	0.0:1.0:0.0:0.0	.	252	Q8N895	ZN366_HUMAN	H	252	ENSP00000313158:R252H	ENSP00000313158:R252H	R	-	2	0	ZNF366	71792325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.790000	0.85794	2.826000	0.97356	0.561000	0.74099	CGC	ZNF366	-	NULL	ENSG00000178175		0.627	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	HGNC	protein_coding	OTTHUMT00000218574.3	-	0.00	60	0	C			71756569	-1	tier1	-	no_errors	ENST00000318442	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
ZNF439	90594	genome.wustl.edu	37	19	11979019	11979019	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:11979019G>T	ENST00000304030.2	+	3	1335	c.1135G>T	c.(1135-1137)Gag>Tag	p.E379*	ZNF439_ENST00000592534.1_Intron|ZNF439_ENST00000455282.1_Nonsense_Mutation_p.E243*	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	379					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						TCACAGTGGAGAGAAACCGTA	0.413																																																	0													57.0	57.0	57.0					19																	11979019		2203	4300	6503	SO:0001587	stop_gained	0			AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.1135G>T	19.37:g.11979019G>T	ENSP00000305077:p.Glu379*		Q8IYZ7|Q96SU1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E379*	ENST00000304030.2	37	c.1135	CCDS12268.1	19	.	.	.	.	.	.	.	.	.	.	g	23.9	4.469797	0.84533	.	.	ENSG00000171291	ENST00000455282;ENST00000304030	.	.	.	0.575	0.575	0.17374	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.6675	0.34130	0.0:0.0:1.0:0.0	.	.	.	.	X	243;379	.	ENSP00000305077:E379X	E	+	1	0	ZNF439	11840019	0.752000	0.28338	0.173000	0.22940	0.085000	0.17905	1.557000	0.36299	0.577000	0.29470	0.194000	0.17425	GAG	ZNF439	-	pfscan_Znf_C2H2	ENSG00000171291		0.413	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF439	HGNC	protein_coding	OTTHUMT00000344513.1		0.00	70	0	G			11979019	+1			no_errors	ENST00000304030	ensembl	human	known	74_37	nonsense	6.06	62	4	SNP	1.000	T
ZNF43	7594	genome.wustl.edu	37	19	21990944	21990944	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:21990944T>G	ENST00000354959.4	-	4	2064	c.1895A>C	c.(1894-1896)aAc>aCc	p.N632T	ZNF43_ENST00000594012.1_Missense_Mutation_p.N626T|ZNF43_ENST00000598381.1_Missense_Mutation_p.N626T|ZNF43_ENST00000595461.1_Missense_Mutation_p.N626T	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	632					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TGAGAACTGGTTAAAAGCTTT	0.373																																																	0													44.0	46.0	45.0					19																	21990944		2201	4296	6497	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.1895A>C	19.37:g.21990944T>G	ENSP00000347045:p.Asn632Thr		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N632T	ENST00000354959.4	37	c.1895	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	t	0.007	-1.970483	0.00457	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.38722	1.12	1.21	-2.41	0.06562	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14270	0.0345	N	0.02721	-0.515	0.09310	N	1	B	0.17038	0.02	B	0.24701	0.055	T	0.25187	-1.0139	9	0.06625	T	0.88	.	5.2125	0.15325	0.0:0.1486:0.4733:0.378	.	632	P17038	ZNF43_HUMAN	T	631;632	ENSP00000347045:N632T	ENSP00000347045:N632T	N	-	2	0	ZNF43	21782784	0.000000	0.05858	0.012000	0.15200	0.816000	0.46133	-10.510000	0.00006	-1.416000	0.02019	0.254000	0.18369	AAC	ZNF43	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198521		0.373	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	-	0.00	54	0	T	NM_003423		21990944	-1	tier1	-	no_errors	ENST00000354959	ensembl	human	known	74_37	missense	30.61	34	15	SNP	0.001	G
ZNF461	92283	genome.wustl.edu	37	19	37130420	37130420	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:37130420T>G	ENST00000588268.1	-	6	1054	c.827A>C	c.(826-828)aAc>aCc	p.N276T	ZNF461_ENST00000360357.4_Missense_Mutation_p.N253T|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	276					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CCCACATTCGTTACATTCATA	0.373																																																	0													57.0	61.0	59.0					19																	37130420		2186	4284	6470	SO:0001583	missense	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.827A>C	19.37:g.37130420T>G	ENSP00000467931:p.Asn276Thr		A8K9W9|Q6VSF7|Q9ULZ8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N276T	ENST00000588268.1	37	c.827	CCDS54257.1	19	.	.	.	.	.	.	.	.	.	.	T	14.75	2.627803	0.46944	.	.	ENSG00000197808	ENST00000396893;ENST00000396896;ENST00000360357;ENST00000540605	T	0.17054	2.3	3.71	3.71	0.42584	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08626	0.0214	N	0.10945	0.07	0.21184	N	0.999766	B;B;B	0.20164	0.0;0.042;0.001	B;B;B	0.20955	0.0;0.032;0.005	T	0.17592	-1.0364	9	0.49607	T	0.09	.	3.9993	0.09572	0.0:0.113:0.217:0.67	.	253;198;276	B4DRP8;Q59G30;Q8TAF7	.;.;ZN461_HUMAN	T	276;7;253;149	ENSP00000353515:N253T	ENSP00000353515:N253T	N	-	2	0	ZNF461	41822260	0.000000	0.05858	1.000000	0.80357	0.945000	0.59286	-2.467000	0.00993	1.679000	0.50963	0.477000	0.44152	AAC	ZNF461	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197808		0.373	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	-	0.00	106	0	T	NM_153257		37130420	-1	tier1	-	no_errors	ENST00000588268	ensembl	human	known	74_37	missense	37.84	46	28	SNP	0.947	G
ZNF497	162968	genome.wustl.edu	37	19	58867516	58867516	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:58867516C>T	ENST00000311044.3	-	3	1674	c.1486G>A	c.(1486-1488)Gct>Act	p.A496T	A1BG-AS1_ENST00000593374.1_RNA|ZNF497_ENST00000425453.3_Missense_Mutation_p.A496T|A1BG-AS1_ENST00000593960.1_RNA|A1BG_ENST00000263100.3_5'Flank|A1BG-AS1_ENST00000594950.1_RNA|CTD-2619J13.9_ENST00000599952.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000599728.1_RNA	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		CAGGGCGCAGCGCGGCCCCCG	0.692																																																	0													15.0	16.0	15.0					19																	58867516		2147	4207	6354	SO:0001583	missense	0			AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.1486G>A	19.37:g.58867516C>T	ENSP00000311183:p.Ala496Thr		Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A496T	ENST00000311044.3	37	c.1486	CCDS12977.1	19	.	.	.	.	.	.	.	.	.	.	C	0.046	-1.267338	0.01433	.	.	ENSG00000174586	ENST00000311044;ENST00000425453	T;T	0.06768	3.26;3.26	1.01	-2.02	0.07388	Zinc finger, C2H2 (1);	.	.	.	.	T	0.03651	0.0104	N	0.04686	-0.185	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38286	-0.9668	9	0.72032	D	0.01	.	4.7318	0.12968	0.1963:0.5773:0.0:0.2264	.	496	Q6ZNH5	ZN497_HUMAN	T	496	ENSP00000311183:A496T;ENSP00000402815:A496T	ENSP00000311183:A496T	A	-	1	0	ZNF497	63559328	0.000000	0.05858	0.000000	0.03702	0.515000	0.34225	-1.027000	0.03592	-1.815000	0.01222	-1.076000	0.02234	GCT	ZNF497	-	pfscan_Znf_C2H2	ENSG00000174586		0.692	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF497	HGNC	protein_coding	OTTHUMT00000466942.2	-	0.00	34	0	C	NM_198458		58867516	-1	tier1	-	no_errors	ENST00000311044	ensembl	human	known	74_37	missense	36.36	7	4	SNP	0.001	T
ZNF521	25925	genome.wustl.edu	37	18	22806601	22806601	+	Silent	SNP	A	A	G			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr18:22806601A>G	ENST00000361524.3	-	4	1429	c.1281T>C	c.(1279-1281)acT>acC	p.T427T	ZNF521_ENST00000584787.1_Silent_p.T207T|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000538137.2_Silent_p.T427T	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	427					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTAAGTGCATAGTTTTCAGGT	0.408			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													85.0	87.0	86.0					18																	22806601		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1281T>C	18.37:g.22806601A>G			A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T427	ENST00000361524.3	37	c.1281	CCDS32806.1	18																																																																																			ZNF521	-	smart_Znf_C2H2-like	ENSG00000198795		0.408	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	65	0	A	NM_015461		22806601	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	silent	29.03	22	9	SNP	1.000	G
ZNF595	152687	genome.wustl.edu	37	4	53276	53276	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr4:53276C>T	ENST00000509152.2	+	0	79				ZNF595_ENST00000526473.2_5'UTR|ZNF595_ENST00000339368.6_3'UTR			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TTCTCGGCTCCGGGAGGCCTC	0.602																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.-107C>T	4.37:g.53276C>T				RNA	SNP	-	NULL	ENST00000509152.2	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.602	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	ZNF595	HGNC	protein_coding	OTTHUMT00000357817.2	-	0.00	157	0	C	NM_182524		53276	+1	tier1	-	no_errors	ENST00000339368	ensembl	human	known	74_37	rna	5.26	216	12	SNP	0.003	T
ZNF677	342926	genome.wustl.edu	37	19	53741699	53741699	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:53741699A>C	ENST00000598513.1	-	5	431	c.281T>G	c.(280-282)tTt>tGt	p.F94C	ZNF677_ENST00000333952.4_Missense_Mutation_p.F94C|CTD-2245F17.6_ENST00000596041.1_RNA	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	94					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		CTTGAGGTCAAAATTGTTGAT	0.358																																																	0													83.0	79.0	81.0					19																	53741699		2203	4299	6502	SO:0001583	missense	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.281T>G	19.37:g.53741699A>C	ENSP00000469391:p.Phe94Cys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F94C	ENST00000598513.1	37	c.281	CCDS12861.1	19	.	.	.	.	.	.	.	.	.	.	A	9.547	1.114891	0.20795	.	.	ENSG00000197928	ENST00000416063;ENST00000333952	T	0.08458	3.09	2.2	2.2	0.27929	.	0.236031	0.22194	N	0.063321	T	0.10937	0.0267	L	0.36672	1.1	0.20307	N	0.999916	D	0.76494	0.999	P	0.58454	0.839	T	0.14144	-1.0483	10	0.30854	T	0.27	.	3.9437	0.09339	0.8259:0.0:0.1741:0.0	.	94	Q86XU0	ZN677_HUMAN	C	94	ENSP00000334394:F94C	ENSP00000334394:F94C	F	-	2	0	ZNF677	58433511	0.000000	0.05858	0.435000	0.26784	0.317000	0.28152	0.751000	0.26348	1.264000	0.44198	0.482000	0.46254	TTT	ZNF677	-	NULL	ENSG00000197928		0.358	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	-	0.00	70	0	A	NM_182609		53741699	-1	tier1	-	no_errors	ENST00000333952	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.531	C
ZNF688	146542	genome.wustl.edu	37	16	30581395	30581395	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr16:30581395C>T	ENST00000223459.6	-	3	1777	c.673G>A	c.(673-675)Gca>Aca	p.A225T	ZNF688_ENST00000395219.1_Missense_Mutation_p.A211T|AC002310.7_ENST00000492040.1_RNA|AC002310.7_ENST00000486926.1_RNA	NM_145271.3	NP_660314.1	P0C7X2	ZN688_HUMAN	zinc finger protein 688	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						GCTTCCACTGCGAACTTCCTC	0.701																																																	0													14.0	16.0	15.0					16																	30581395		2191	4283	6474	SO:0001583	missense	0			AK122680	CCDS10684.1	16p11.2	2013-01-08			ENSG00000229809	ENSG00000229809		"""Zinc fingers, C2H2-type"", ""-"""	30489	protein-coding gene	gene with protein product						10493829	Standard	XM_005255139		Approved		uc002dys.2	P0C7X2	OTTHUMG00000132408	ENST00000223459.6:c.673G>A	16.37:g.30581395C>T	ENSP00000223459:p.Ala225Thr		A8MV39|B3KV51|O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A225T	ENST00000223459.6	37	c.673	CCDS10684.1	16	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566195	0.65651	.	.	ENSG00000229809	ENST00000395219;ENST00000223459	T;T	0.28454	1.61;1.61	4.42	3.46	0.39613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38108	0.1028	L	0.34521	1.04	0.31992	N	0.604543	P;D	0.76494	0.58;0.999	B;D	0.75020	0.098;0.985	T	0.32693	-0.9897	9	0.23302	T	0.38	.	8.5301	0.33329	0.0:0.8925:0.0:0.1075	.	225;211	P0C7X2;A8MV39	ZN688_HUMAN;.	T	211;225	ENSP00000378645:A211T;ENSP00000223459:A225T	ENSP00000223459:A225T	A	-	1	0	ZNF688	30488896	0.000000	0.05858	0.965000	0.40720	0.973000	0.67179	0.359000	0.20233	1.203000	0.43233	0.467000	0.42956	GCA	ZNF688	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000229809		0.701	ZNF688-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF688	HGNC	protein_coding	OTTHUMT00000255544.2	-	0.00	87	0	C	NM_145271		30581395	-1	tier1	-	no_errors	ENST00000223459	ensembl	human	known	74_37	missense	47.46	30	28	SNP	0.999	T
ZNF733P	643955	genome.wustl.edu	37	7	62752611	62752611	+	RNA	SNP	G	G	T			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:62752611G>T	ENST00000331425.6	-	0	824					NR_003952.1				zinc finger protein 733, pseudogene																		CTTGTGGTTAGTAAGTGCTGA	0.453																																																	0																																												0					7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752611G>T				RNA	SNP	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			ZNF733P	-	-	ENSG00000185037		0.453	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	HGNC	pseudogene	OTTHUMT00000343679.1	-	0.00	147	0	G			62752611	-1	tier1	-	no_errors	ENST00000331425	ensembl	human	known	74_37	rna	16.20	119	23	SNP	0.005	T
ZNF736	728927	genome.wustl.edu	37	7	63808854	63808854	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr7:63808854G>A	ENST00000423484.2	+	4	735	c.613G>A	c.(613-615)Gaa>Aaa	p.E205K	ZNF736_ENST00000355095.4_Missense_Mutation_p.E205K			B4DX44	ZN736_HUMAN	zinc finger protein 736	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						CAAATGTGAAGAATGTGGCAA	0.353																																																	0													22.0	19.0	20.0					7																	63808854		692	1591	2283	SO:0001583	missense	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.613G>A	7.37:g.63808854G>A	ENSP00000400852:p.Glu205Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E205K	ENST00000423484.2	37	c.613	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829311	0.32329	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.01152	5.26;5.26	1.15	1.15	0.20763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01627	0.0052	L	0.49126	1.545	0.09310	N	1	P	0.50943	0.94	B	0.42851	0.4	T	0.51498	-0.8698	9	0.56958	D	0.05	.	7.7295	0.28779	0.0:0.0:1.0:0.0	.	205	B4DX44	ZN736_HUMAN	K	205	ENSP00000347210:E205K;ENSP00000400852:E205K	ENSP00000347210:E205K	E	+	1	0	ZNF736	63446289	0.000000	0.05858	0.109000	0.21407	0.542000	0.35054	-0.137000	0.10389	0.555000	0.29079	0.305000	0.20034	GAA	ZNF736	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000234444		0.353	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	-	0.00	38	0	G	NM_001170905		63808854	+1	tier1	-	no_errors	ENST00000355095	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.101	A
ZNF90	7643	genome.wustl.edu	37	19	20190747	20190748	+	Intron	INS	-	-	C	rs184257375|rs201406331|rs113327735		TCGA-L5-A8NR-01A-11D-A37C-09	TCGA-L5-A8NR-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b154131f-fe7b-4e83-96b4-81b23fad84e2	5884f0ba-19ec-4f30-bd6d-86742a79b271	g.chr19:20190747_20190748insC	ENST00000418063.2	+	1	115				ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						GTAtttcctctttttttttttt	0.49																																																	0																																										SO:0001627	intron_variant	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.3+1803->C	19.37:g.20190747_20190748insC			B9EH87	RNA	INS	-	NULL	ENST00000418063.2	37	NULL	CCDS46028.1	19																																																																																			ZNF90	-	-	ENSG00000213988		0.490	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1		0.00	30	0	-	NM_007138		20190748	+1	tier1		no_errors	ENST00000492328	ensembl	human	known	74_37	rna	10.53	17	2	INS	1.000:0.997	C
