#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA2	20	genome.wustl.edu	37	9	139903009	139903009	+	Silent	SNP	G	G	A	rs376059407		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:139903009G>A	ENST00000371605.3	-	47	7278	c.7131C>T	c.(7129-7131)tcC>tcT	p.S2377S	ABCA2_ENST00000265662.5_Silent_p.S2378S|ABCA2_ENST00000341511.6_Silent_p.S2378S			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	2377					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACTGCAGTGCGGATGGCGGCT	0.682																																																	0													19.0	23.0	22.0					9																	139903009		2073	4192	6265	SO:0001819	synonymous_variant	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.7131C>T	9.37:g.139903009G>A			A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S2378	ENST00000371605.3	37	c.7134		9																																																																																			ABCA2	-	NULL	ENSG00000107331		0.682	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	80	0	G	NM_001606		139903009	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	silent	8.51	86	8	SNP	0.000	A
ABLIM2	84448	genome.wustl.edu	37	4	8108335	8108335	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:8108335G>A	ENST00000341937.5	-	2	104	c.40C>T	c.(40-42)Ctg>Ttg	p.L14L	ABLIM2_ENST00000296372.8_Silent_p.L14L|ABLIM2_ENST00000546334.1_Silent_p.L14L|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000428004.2_Silent_p.L14L|ABLIM2_ENST00000361581.5_Silent_p.L14L|ABLIM2_ENST00000505872.1_Silent_p.L14L|ABLIM2_ENST00000361737.5_Silent_p.L14L|ABLIM2_ENST00000545242.1_Silent_p.L14L|ABLIM2_ENST00000447017.2_Silent_p.L14L|ABLIM2_ENST00000407564.3_Silent_p.L14L	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	14					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						GACTTCTCCAGCGGGCTGGGA	0.597																																																	0													31.0	36.0	34.0					4																	8108335		2124	4234	6358	SO:0001819	synonymous_variant	0			AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.40C>T	4.37:g.8108335G>A			E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Silent	SNP	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.L14	ENST00000341937.5	37	c.40	CCDS47013.1	4																																																																																			ABLIM2	-	NULL	ENSG00000163995		0.597	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABLIM2	HGNC	protein_coding	OTTHUMT00000358862.2		0.00	52	0	G	NM_001130083		8108335	-1			no_errors	ENST00000447017	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.842	A
ADAMTS16	170690	genome.wustl.edu	37	5	5242188	5242188	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:5242188C>A	ENST00000274181.7	+	17	2684	c.2546C>A	c.(2545-2547)cCg>cAg	p.P849Q		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	849	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P849Q(2)		breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						GGAAGGAACCCGGGTGTTGCC	0.512																																																	2	Substitution - Missense(2)	lung(2)											57.0	61.0	60.0					5																	5242188		1904	4120	6024	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2546C>A	5.37:g.5242188C>A	ENSP00000274181:p.Pro849Gln		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P849Q	ENST00000274181.7	37	c.2546	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743240	0.49151	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.54479	0.57	5.77	4.9	0.64082	ADAM-TS Spacer 1 (1);	0.062950	0.64402	D	0.000005	T	0.71013	0.3290	M	0.79805	2.47	0.58432	D	0.999998	D;D	0.89917	1.0;0.966	D;P	0.78314	0.991;0.733	T	0.73173	-0.4066	10	0.51188	T	0.08	.	10.616	0.45451	0.0:0.8445:0.0:0.1555	.	849;849	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	Q	849	ENSP00000274181:P849Q	ENSP00000274181:P849Q	P	+	2	0	ADAMTS16	5295188	0.998000	0.40836	0.885000	0.34714	0.255000	0.26057	3.866000	0.56040	1.437000	0.47472	0.650000	0.86243	CCG	ADAMTS16	-	pfam_ADAM_spacer1	ENSG00000145536		0.512	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	-	0.00	82	0	C	NM_139056		5242188	+1	tier1	-	no_errors	ENST00000274181	ensembl	human	known	74_37	missense	71.57	29	73	SNP	0.993	A
ACTBL2	345651	genome.wustl.edu	37	5	56778214	56778214	+	Silent	SNP	G	G	T	rs371146209		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:56778214G>T	ENST00000423391.1	-	1	422	c.321C>A	c.(319-321)acC>acA	p.T107T	CTD-2023N9.1_ENST00000506106.1_RNA|AC025470.1_ENST00000584598.1_RNA	NM_001017992.3	NP_001017992.1	Q562R1	ACTBL_HUMAN	actin, beta-like 2	107						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(3)|pancreas(1)|prostate(2)	28		Lung NSC(810;0.000135)|Prostate(74;0.055)|Breast(144;0.0707)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;4.24e-37)		GGGGTGCCTCGGTGAGGAGGA	0.527																																																	0													104.0	89.0	94.0					5																	56778214		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34163.1	5q11.2	2014-08-08			ENSG00000169067	ENSG00000169067			17780	protein-coding gene	gene with protein product		614835					Standard	NM_001017992		Approved	DKFZp686D0972	uc003jrm.3	Q562R1	OTTHUMG00000162330	ENST00000423391.1:c.321C>A	5.37:g.56778214G>T			B2RPJ1|Q562R2|Q562S9|Q562X8	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.T107	ENST00000423391.1	37	c.321	CCDS34163.1	5																																																																																			ACTBL2	-	pfam_Actin-related,smart_Actin-related	ENSG00000169067		0.527	ACTBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTBL2	HGNC	protein_coding	OTTHUMT00000368579.1		0.00	39	0	G	NM_001017992		56778214	-1			no_errors	ENST00000423391	ensembl	human	known	74_37	silent	5.36	53	3	SNP	0.097	T
ADCY8	114	genome.wustl.edu	37	8	132051794	132051794	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:132051794G>A	ENST00000286355.5	-	1	2878	c.786C>T	c.(784-786)ctC>ctT	p.L262L	ADCY8_ENST00000377928.3_Silent_p.L262L	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	262					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			GCCCGTAGCCGAGGCCTGCTG	0.657										HNSCC(32;0.087)																																							0													44.0	39.0	41.0					8																	132051794		2203	4300	6503	SO:0001819	synonymous_variant	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.786C>T	8.37:g.132051794G>A				Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.L262	ENST00000286355.5	37	c.786	CCDS6363.1	8																																																																																			ADCY8	-	NULL	ENSG00000155897		0.657	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	57	0	G			132051794	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	silent	23.46	62	19	SNP	0.304	A
AFG3L2	10939	genome.wustl.edu	37	18	12371665	12371665	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr18:12371665G>T	ENST00000269143.3	-	2	371	c.140C>A	c.(139-141)gCa>gAa	p.A47E		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	47					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	GCTGGCCCTTGCTTGAGTTGT	0.363																																																	0													60.0	59.0	59.0					18																	12371665		2203	4300	6503	SO:0001583	missense	0			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.140C>A	18.37:g.12371665G>T	ENSP00000269143:p.Ala47Glu		Q6P1L0	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.A47E	ENST00000269143.3	37	c.140	CCDS11859.1	18	.	.	.	.	.	.	.	.	.	.	G	1.624	-0.520699	0.04171	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	D	0.92752	-3.1	5.56	1.02	0.19986	Peptidase M41, FtsH (1);	0.824347	0.11187	N	0.590288	T	0.81635	0.4864	L	0.34521	1.04	0.09310	N	1	B	0.15141	0.012	B	0.11329	0.006	T	0.65022	-0.6269	10	0.02654	T	1	0.1428	2.1805	0.03873	0.2055:0.1521:0.4875:0.155	.	47	Q9Y4W6	AFG32_HUMAN	E	47;62	ENSP00000269143:A47E	ENSP00000269143:A47E	A	-	2	0	AFG3L2	12361665	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.431000	0.21444	0.267000	0.21916	0.655000	0.94253	GCA	AFG3L2	-	NULL	ENSG00000141385		0.363	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFG3L2	HGNC	protein_coding	OTTHUMT00000254603.2	-	0.00	51	0	G	NM_006796		12371665	-1	tier1	-	no_errors	ENST00000269143	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	T
AHCYL2	23382	genome.wustl.edu	37	7	129040214	129040214	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:129040214C>T	ENST00000325006.3	+	6	961	c.907C>T	c.(907-909)Cag>Tag	p.Q303*	AHCYL2_ENST00000474594.1_Nonsense_Mutation_p.Q200*|AHCYL2_ENST00000490911.1_Nonsense_Mutation_p.Q200*|AHCYL2_ENST00000446544.2_Nonsense_Mutation_p.Q302*|AHCYL2_ENST00000531335.2_Nonsense_Mutation_p.Q222*|AHCYL2_ENST00000446212.1_Nonsense_Mutation_p.Q201*	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	303					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						GGAGGGCTGGCAGCCAAACAT	0.488																																					Pancreas(160;1736 1964 29875 40941 45605)												0													158.0	151.0	154.0					7																	129040214		2203	4300	6503	SO:0001587	stop_gained	0			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.907C>T	7.37:g.129040214C>T	ENSP00000315931:p.Gln303*		B4DIZ5|D9N155|O94917	Nonsense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,tigrfam_Adenosylhomocysteinase	p.Q303*	ENST00000325006.3	37	c.907	CCDS5812.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.253162	0.95336	.	.	ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-3.9956	17.128	0.86719	0.0:1.0:0.0:0.0	.	.	.	.	X	303;302;222;200;201;200	.	ENSP00000315931:Q303X	Q	+	1	0	AHCYL2	128827450	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.572000	0.67411	2.446000	0.82766	0.563000	0.77884	CAG	AHCYL2	-	pfam_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000158467		0.488	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHCYL2	HGNC	protein_coding	OTTHUMT00000354065.1	-	0.00	97	0	C			129040214	+1	tier1	-	no_errors	ENST00000325006	ensembl	human	known	74_37	nonsense	5.21	91	5	SNP	1.000	T
AKAP13	11214	genome.wustl.edu	37	15	86064675	86064675	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr15:86064675C>T	ENST00000394518.2	+	3	145	c.50C>T	c.(49-51)aCa>aTa	p.T17I	AKAP13_ENST00000560302.1_Missense_Mutation_p.T17I|AKAP13_ENST00000361243.2_Missense_Mutation_p.T17I	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	17					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TGTGTTGTTACAGTGCTGCTT	0.408																																					Melanoma(94;603 1453 3280 32295 32951)												0													411.0	360.0	377.0					15																	86064675		2203	4299	6502	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.50C>T	15.37:g.86064675C>T	ENSP00000378026:p.Thr17Ile		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.T17I	ENST00000394518.2	37	c.50	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955409	0.53293	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.61040	0.14;0.14	5.57	4.64	0.57946	.	.	.	.	.	T	0.67924	0.2945	L	0.40543	1.245	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	T	0.70219	-0.4932	9	0.56958	D	0.05	.	14.5619	0.68144	0.0:0.8526:0.1474:0.0	.	17;17;17	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	I	17;17;16;16	ENSP00000354718:T17I;ENSP00000378026:T17I	ENSP00000354718:T17I	T	+	2	0	AKAP13	83865679	0.998000	0.40836	0.714000	0.30535	0.907000	0.53573	4.869000	0.63028	1.481000	0.48307	0.650000	0.86243	ACA	AKAP13	-	NULL	ENSG00000170776		0.408	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	86	0	C	NM_007200		86064675	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.910	T
AKR1CL1	340811	genome.wustl.edu	37	10	5200895	5200895	+	IGR	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:5200895G>T	ENST00000334314.3	-	0	492				AKR1CL1_ENST00000465430.1_Intron			Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						TTGAGGTAAGGGTGACATTCC	0.428																																					Ovarian(129;1623 1737 25446 28757 47467)												0																																										SO:0001628	intergenic_variant	0					10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213		10.37:g.5200895G>T			A6NF66|Q6ZN81	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.P23T	ENST00000334314.3	37	c.67		10	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362705	0.41902	.	.	ENSG00000196326	ENST00000473890	T	0.25414	1.8	3.73	1.66	0.24008	.	0.678609	0.13226	U	0.403982	T	0.36138	0.0956	.	.	.	0.32070	N	0.594573	.	.	.	.	.	.	T	0.49523	-0.8931	7	0.87932	D	0	.	11.6772	0.51436	0.0:0.5287:0.4713:0.0	.	.	.	.	T	23	ENSP00000417959:P23T	ENSP00000417959:P23T	P	-	1	0	AKR1CL1	5190895	0.999000	0.42202	0.019000	0.16419	0.777000	0.43975	2.841000	0.48223	0.260000	0.21731	0.484000	0.47621	CCT	AKR1CL1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	ENSG00000196326		0.428	AKR1CL1-201	KNOWN	basic|appris_candidate_longest	protein_coding	AKR1CL1	HGNC	protein_coding			0.00	79	0	G	NR_027916		5200895	-1			no_errors	ENST00000473890	ensembl	human	novel	74_37	missense	5.06	75	4	SNP	0.572	T
AMY2B	280	genome.wustl.edu	37	1	104118398	104118399	+	Intron	INS	-	-	A	rs371844100		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:104118398_104118399insA	ENST00000361355.4	+	9	1717				AMY2B_ENST00000491397.1_Intron	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TAGCCCACAGGAAAAAAAAAAA	0.327																																																	0																																										SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1101+236->A	1.37:g.104118409_104118409dupA			B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	INS	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.327	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1		0.00	14	0	-	NM_020978		104118399	+1	tier1		no_errors	ENST00000462971	ensembl	human	known	74_37	rna	8.70	21	2	INS	0.002:0.005	A
AKT3	10000	genome.wustl.edu	37	1	243801021	243801021	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:243801021C>T	ENST00000366539.1	-	6	653	c.453G>A	c.(451-453)ttG>ttA	p.L151L	AKT3_ENST00000336199.5_Silent_p.L151L|AKT3_ENST00000263826.5_Silent_p.L151L|AKT3_ENST00000366540.1_Silent_p.L151L			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	151	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			CTAGTAGTTTCAAATAGTCAA	0.279																																																	0													74.0	72.0	73.0					1																	243801021		2201	4296	6497	SO:0001819	synonymous_variant	0			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.453G>A	1.37:g.243801021C>T			Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom	p.L151	ENST00000366539.1	37	c.453	CCDS31077.1	1																																																																																			AKT3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000117020		0.279	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT3	HGNC	protein_coding	OTTHUMT00000096479.1	-	0.00	111	0	C	NM_181690		243801021	-1	tier1	-	no_errors	ENST00000263826	ensembl	human	known	74_37	silent	20.29	55	14	SNP	1.000	T
ANO1	55107	genome.wustl.edu	37	11	70028614	70028614	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:70028614G>T	ENST00000355303.5	+	24	2715	c.2410G>T	c.(2410-2412)Gtg>Ttg	p.V804L	ANO1_ENST00000538023.1_Missense_Mutation_p.V804L|ANO1_ENST00000531349.1_Missense_Mutation_p.V513L|ANO1_ENST00000530676.1_Missense_Mutation_p.V658L|ANO1_ENST00000398543.2_Missense_Mutation_p.V658L|ANO1_ENST00000525494.1_3'UTR	NM_018043.5	NP_060513.5	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	804					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of membrane potential (GO:0042391)|trachea development (GO:0060438)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(12)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)	29					Crofelemer(DB04941)	ACAGGCCTTCGTGATCTCCTT	0.617																																																	0													60.0	65.0	63.0					11																	70028614		2068	4176	6244	SO:0001583	missense	0			BC033036	CCDS44663.1	11q13.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000131620	ENSG00000131620		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	21625	protein-coding gene	gene with protein product		610108	"""oral cancer overexpressed 2"", ""transmembrane protein 16A"""	ORAOV2, TMEM16A		15067359, 18724360, 24692353	Standard	NM_018043		Approved	TAOS2, FLJ10261, DOG1	uc001opj.3	Q5XXA6	OTTHUMG00000167204	ENST00000355303.5:c.2410G>T	11.37:g.70028614G>T	ENSP00000347454:p.Val804Leu		A8KAM3|Q8IYY8|Q8N7V3	Missense_Mutation	SNP	pfam_Anoctamin	p.V804L	ENST00000355303.5	37	c.2410	CCDS44663.1	11	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914327	0.92178	.	.	ENSG00000131620	ENST00000355303;ENST00000538023;ENST00000398543;ENST00000546327;ENST00000530676;ENST00000531349;ENST00000539321	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	4.41	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.66005	0.2746	L	0.48260	1.515	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.77004	0.982;0.989	T	0.65220	-0.6221	9	.	.	.	.	17.3532	0.87329	0.0:0.0:1.0:0.0	.	513;804	E9PNA7;Q5XXA6	.;ANO1_HUMAN	L	804;804;658;562;658;513;131	ENSP00000347454:V804L;ENSP00000444689:V804L;ENSP00000381551:V658L;ENSP00000435797:V658L;ENSP00000432843:V513L	.	V	+	1	0	ANO1	69706262	1.000000	0.71417	0.995000	0.50966	0.913000	0.54294	9.104000	0.94239	2.176000	0.68965	0.555000	0.69702	GTG	ANO1	-	pfam_Anoctamin	ENSG00000131620		0.617	ANO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO1	HGNC	protein_coding	OTTHUMT00000393685.1	-	0.00	49	0	G	NM_018043		70028614	+1	tier1	-	no_errors	ENST00000355303	ensembl	human	known	74_37	missense	63.89	13	23	SNP	1.000	T
AOC3	8639	genome.wustl.edu	37	17	41004727	41004727	+	Missense_Mutation	SNP	C	C	T	rs367848102		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:41004727C>T	ENST00000308423.2	+	1	1527	c.1367C>T	c.(1366-1368)gCg>gTg	p.A456V	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	456					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	GGGGGTCTTGCGGAAACGGTG	0.522																																					NSCLC(3;192 220 10664 11501 16477)												0								C	VAL/ALA	0,4406		0,0,2203	135.0	118.0	124.0		1367	-3.9	0.0	17		124	1,8599	1.2+/-3.3	0,1,4299	no	missense	AOC3	NM_003734.2	64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	456/764	41004727	1,13005	2203	4300	6503	SO:0001583	missense	0			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1367C>T	17.37:g.41004727C>T	ENSP00000312326:p.Ala456Val		B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.A456V	ENST00000308423.2	37	c.1367	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	C	0.041	-1.284128	0.01398	0.0	1.16E-4	ENSG00000131471	ENST00000308423	T	0.03951	3.75	5.17	-3.86	0.04230	Copper amine oxidase, C-terminal (3);	1.107710	0.06813	N	0.790733	T	0.02380	0.0073	N	0.11201	0.11	0.09310	N	1	B	0.18166	0.026	B	0.11329	0.006	T	0.46721	-0.9171	10	0.37606	T	0.19	.	3.8656	0.09015	0.101:0.3159:0.0994:0.4837	.	456	Q16853	AOC3_HUMAN	V	456	ENSP00000312326:A456V	ENSP00000312326:A456V	A	+	2	0	AOC3	38258253	0.000000	0.05858	0.000000	0.03702	0.123000	0.20343	-2.454000	0.01004	-0.502000	0.06596	0.591000	0.81541	GCG	AOC3	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000131471		0.522	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1	-	0.00	79	0	C	NM_003734		41004727	+1	tier1	-	no_errors	ENST00000308423	ensembl	human	known	74_37	missense	42.11	44	32	SNP	0.000	T
AP1M1	8907	genome.wustl.edu	37	19	16318830	16318830	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:16318830G>A	ENST00000291439.3	+	4	717	c.268G>A	c.(268-270)Gtg>Atg	p.V90M	AP1M1_ENST00000429941.2_Splice_Site_p.V90M|AP1M1_ENST00000444449.2_Splice_Site_p.V90M|AP1M1_ENST00000541844.1_Splice_Site_p.V18M|AP1M1_ENST00000590756.1_Splice_Site_p.V18M	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	90					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						ACCGCCACAGGTGTTTTCCGA	0.542																																																	0													127.0	123.0	125.0					19																	16318830		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.268-1G>A	19.37:g.16318830G>A			Q4TTY5	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.V90M	ENST00000291439.3	37	c.268	CCDS12342.1	19	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285503	0.59867	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844;ENST00000429941	T;T;T;T	0.68624	0.21;0.22;0.19;-0.34	3.92	3.92	0.45320	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	D	0.85146	0.5630	M	0.93420	3.415	0.80722	D	1	P;D;D	0.59767	0.671;0.986;0.986	P;D;D	0.70016	0.72;0.967;0.967	D	0.89518	0.3776	9	.	.	.	-24.3065	14.6746	0.68969	0.0:0.0:1.0:0.0	.	90;90;90	E7ENJ6;Q4TTY5;Q9BXS5	.;.;AP1M1_HUMAN	M	90;90;18;90	ENSP00000388996:V90M;ENSP00000291439:V90M;ENSP00000445682:V18M;ENSP00000411498:V90M	.	V	+	1	0	AP1M1	16179830	1.000000	0.71417	0.974000	0.42286	0.328000	0.28507	9.218000	0.95166	2.040000	0.60383	0.467000	0.42956	GTG	AP1M1	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu	ENSG00000072958		0.542	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1M1	HGNC	protein_coding	OTTHUMT00000460492.1	-	0.00	48	0	G	NM_032493	Missense_Mutation	16318830	+1	tier1	-	no_errors	ENST00000444449	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	A
APOBEC4	403314	genome.wustl.edu	37	1	183617423	183617423	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:183617423G>T	ENST00000308641.4	-	2	765	c.494C>A	c.(493-495)cCt>cAt	p.P165H	RGL1_ENST00000304685.4_Intron|RGL1_ENST00000536277.1_Intron|APOBEC4_ENST00000481562.1_Intron	NM_203454.2	NP_982279.1	Q8WW27	ABEC4_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 4 (putative)	165					mRNA processing (GO:0006397)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines (GO:0016814)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(6)|skin(1)	21						TGCTGAGGCAGGAAAGTCCAT	0.473																																																	0													65.0	70.0	68.0					1																	183617423		2203	4300	6503	SO:0001583	missense	0			BC021711	CCDS1358.1	1q25.3	2008-02-05	2005-10-27	2005-10-27	ENSG00000173627	ENSG00000173627		"""Apolipoprotein B mRNA editing enzymes"""	32152	protein-coding gene	gene with protein product		609908	"""chromosome 1 open reading frame 169"""	C1orf169		16082223	Standard	NM_203454		Approved	MGC26594, FLJ25691, RP1-127C7.4	uc001gqn.3	Q8WW27	OTTHUMG00000035459	ENST00000308641.4:c.494C>A	1.37:g.183617423G>T	ENSP00000310622:p.Pro165His		Q8N7F6	Missense_Mutation	SNP	pfam_APOBEC_N	p.P165H	ENST00000308641.4	37	c.494	CCDS1358.1	1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.515379	0.44763	.	.	ENSG00000173627	ENST00000308641	T	0.64438	-0.1	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000020	T	0.72236	0.3435	L	0.34521	1.04	0.43603	D	0.995961	D	0.89917	1.0	D	0.85130	0.997	T	0.75482	-0.3302	10	0.87932	D	0	-3.3548	18.5218	0.90956	0.0:0.0:1.0:0.0	.	165	Q8WW27	ABEC4_HUMAN	H	165	ENSP00000310622:P165H	ENSP00000310622:P165H	P	-	2	0	APOBEC4	181884046	1.000000	0.71417	0.953000	0.39169	0.084000	0.17831	4.678000	0.61641	2.472000	0.83506	0.655000	0.94253	CCT	APOBEC4	-	NULL	ENSG00000173627		0.473	APOBEC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC4	HGNC	protein_coding	OTTHUMT00000086126.1	-	0.00	42	0	G	NM_203454		183617423	-1	tier1	-	no_errors	ENST00000308641	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.996	T
ARAF	369	genome.wustl.edu	37	X	47426444	47426444	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:47426444G>A	ENST00000377045.4	+	9	981	c.787G>A	c.(787-789)Gtg>Atg	p.V263M	ARAF_ENST00000290277.6_3'UTR	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	263					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	CCCAGCCAGCGTGTCCTCGGG	0.617																																																	0													29.0	29.0	29.0					X																	47426444		2203	4300	6503	SO:0001583	missense	0			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.787G>A	X.37:g.47426444G>A	ENSP00000366244:p.Val263Met		P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.V263M	ENST00000377045.4	37	c.787	CCDS35232.1	X	.	.	.	.	.	.	.	.	.	.	g	13.38	2.218636	0.39201	.	.	ENSG00000078061	ENST00000377045	T	0.74842	-0.88	5.32	-0.911	0.10507	.	1.441670	0.03991	N	0.294875	T	0.58481	0.2125	L	0.34521	1.04	0.45097	D	0.998119	B;B	0.33238	0.403;0.003	B;B	0.22880	0.042;0.004	T	0.26710	-1.0095	10	0.35671	T	0.21	.	4.6853	0.12755	0.4367:0.0:0.4194:0.1439	.	263;129	P10398;B4DV85	ARAF_HUMAN;.	M	263	ENSP00000366244:V263M	ENSP00000366244:V263M	V	+	1	0	ARAF	47311388	0.014000	0.17966	0.008000	0.14137	0.983000	0.72400	0.257000	0.18369	-0.649000	0.05430	0.417000	0.27973	GTG	ARAF	-	NULL	ENSG00000078061		0.617	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ARAF	HGNC	protein_coding	OTTHUMT00000056418.1	-	0.00	44	0	G			47426444	+1	tier1	-	no_errors	ENST00000377045	ensembl	human	known	74_37	missense	7.69	47	4	SNP	0.002	A
ARHGAP21	57584	genome.wustl.edu	37	10	24886431	24886431	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:24886431C>A	ENST00000396432.2	-	16	3765	c.3279G>T	c.(3277-3279)aaG>aaT	p.K1093N	ARHGAP21_ENST00000493154.1_5'UTR|ARHGAP21_ENST00000320481.6_Missense_Mutation_p.K880N	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1092	Interaction with ARF1 and ARF6.				establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GGCTTTGAGTCTTTGGCTCTG	0.398																																																	0													172.0	152.0	159.0					10																	24886431		2203	4300	6503	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.3279G>T	10.37:g.24886431C>A	ENSP00000379709:p.Lys1093Asn		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.K1093N	ENST00000396432.2	37	c.3279	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	C	16.21	3.057828	0.55325	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003	T;T;T;T	0.52057	2.65;2.78;0.69;0.68	6.17	5.1	0.69264	.	0.198634	0.52532	D	0.000063	T	0.51075	0.1653	L	0.38838	1.175	0.39561	D	0.969128	D;P	0.56287	0.975;0.927	P;P	0.56216	0.794;0.628	T	0.39078	-0.9631	10	0.31617	T	0.26	.	14.1271	0.65228	0.0:0.8798:0.0:0.1202	.	1083;1092	F8W9U9;Q5T5U3	.;RHG21_HUMAN	N	1093;880;1083;1093	ENSP00000379709:K1093N;ENSP00000365604:K880N;ENSP00000365592:K1083N;ENSP00000405018:K1093N	ENSP00000365604:K880N	K	-	3	2	ARHGAP21	24926437	0.996000	0.38824	0.999000	0.59377	0.998000	0.95712	0.995000	0.29706	2.941000	0.99782	0.655000	0.94253	AAG	ARHGAP21	-	NULL	ENSG00000107863		0.398	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	-	0.00	95	0	C	NM_020824		24886431	-1	tier1	-	no_errors	ENST00000396432	ensembl	human	known	74_37	missense	20.48	66	17	SNP	0.593	A
ARHGAP40	343578	genome.wustl.edu	37	20	37267426	37267426	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr20:37267426G>C	ENST00000373345.4	+	8	1073	c.905G>C	c.(904-906)aGa>aCa	p.R302T		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	302	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						TTGGAAAAGAGAGGACTGGAC	0.517																																																	0													120.0	112.0	115.0					20																	37267426		692	1591	2283	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.905G>C	20.37:g.37267426G>C	ENSP00000362442:p.Arg302Thr			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R302T	ENST00000373345.4	37	c.905		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.489|9.489	1.100192|1.100192	0.20552|0.20552	.|.	.|.	ENSG00000124143|ENSG00000124143	ENST00000243967|ENST00000373345	.|T	.|0.20463	.|2.07	4.82|4.82	2.87|2.87	0.33458|0.33458	.|.	.|0.243308	.|0.43919	.|D	.|0.000514	T|T	0.15652|0.15652	0.0377|0.0377	L|L	0.33245|0.33245	0.995|0.995	0.34692|0.34692	D|D	0.725792|0.725792	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.24083|0.24083	-1.0170|-1.0170	5|8	.|0.15066	.|T	.|0.55	.|.	6.8082|6.8082	0.23788|0.23788	0.2919:0.0:0.7081:0.0|0.2919:0.0:0.7081:0.0	.|.	.|.	.|.	.|.	D|T	242|302	.|ENSP00000362442:R302T	.|ENSP00000362442:R302T	E|R	+|+	3|2	2|0	ARHGAP40|ARHGAP40	36700840|36700840	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.972000|0.972000	0.66771|0.66771	1.284000|1.284000	0.33249|0.33249	0.460000|0.460000	0.27045|0.27045	0.563000|0.563000	0.77884|0.77884	GAG|AGA	ARHGAP40	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000124143		0.517	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP40	HGNC	protein_coding		-	0.00	118	0	G	XM_293123		37267426	+1	tier1	-	no_errors	ENST00000373345	ensembl	human	known	74_37	missense	26.56	94	34	SNP	1.000	C
ARHGAP5	394	genome.wustl.edu	37	14	32623994	32623994	+	Missense_Mutation	SNP	A	A	G	rs573152967		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:32623994A>G	ENST00000345122.3	+	7	4664	c.4349A>G	c.(4348-4350)tAc>tGc	p.Y1450C	ARHGAP5_ENST00000556611.1_Missense_Mutation_p.Y1449C|ARHGAP5_ENST00000433497.1_Missense_Mutation_p.Y189C|ARHGAP5_ENST00000539826.2_Missense_Mutation_p.Y1450C|ARHGAP5_ENST00000396582.2_Missense_Mutation_p.Y185C|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.Y1449C	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1450					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TTTTTCTTTTACAATGGAGAA	0.413													A|||	1	0.000199681	0.0008	0.0	5008	,	,		18957	0.0		0.0	False		,,,				2504	0.0				NSCLC(9;77 350 3443 29227 41353)												0													67.0	62.0	63.0					14																	32623994		2203	4300	6503	SO:0001583	missense	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.4349A>G	14.37:g.32623994A>G	ENSP00000371897:p.Tyr1450Cys		A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.Y1450C	ENST00000345122.3	37	c.4349	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	A	12.83	2.054251	0.36277	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497	T;T;T;T;T;T	0.21932	3.0;2.99;1.98;2.99;3.0;1.98	4.87	4.87	0.63330	Rho GTPase-activating protein domain (1);	0.282258	0.36167	N	0.002743	T	0.23370	0.0565	L	0.55990	1.75	0.58432	D	0.999998	B;B;B	0.29115	0.233;0.043;0.025	B;B;B	0.30782	0.1;0.12;0.061	T	0.03068	-1.1076	10	0.33141	T	0.24	.	14.8156	0.70031	1.0:0.0:0.0:0.0	.	185;1449;1450	Q13017-3;Q13017-2;Q13017	.;.;RHG05_HUMAN	C	1449;1450;185;1450;1449;189	ENSP00000452222:Y1449C;ENSP00000441692:Y1450C;ENSP00000379827:Y185C;ENSP00000371897:Y1450C;ENSP00000393307:Y1449C;ENSP00000407395:Y189C	ENSP00000371897:Y1450C	Y	+	2	0	ARHGAP5	31693745	1.000000	0.71417	1.000000	0.80357	0.125000	0.20455	9.093000	0.94163	1.973000	0.57446	0.524000	0.50904	TAC	ARHGAP5	-	NULL	ENSG00000100852		0.413	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1		0.00	88	0	A	NM_001030055		32623994	+1			no_errors	ENST00000345122	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	G
ARSJ	79642	genome.wustl.edu	37	4	114899598	114899598	+	Silent	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:114899598A>G	ENST00000315366.7	-	1	1259	c.393T>C	c.(391-393)acT>acC	p.T131T	ARSJ_ENST00000541197.1_Silent_p.T131T|ARSJ_ENST00000503013.2_5'UTR	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	131					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CTTACTTTCCAGTAATAAACT	0.383																																																	0													81.0	77.0	78.0					4																	114899598		1870	4110	5980	SO:0001819	synonymous_variant	0				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.393T>C	4.37:g.114899598A>G			A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.T131	ENST00000315366.7	37	c.393	CCDS43264.1	4																																																																																			ARSJ	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000180801		0.383	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSJ	HGNC	protein_coding	OTTHUMT00000363650.1	-	0.00	93	0	A	NM_024590		114899598	-1	tier1	-	no_errors	ENST00000315366	ensembl	human	known	74_37	silent	7.94	58	5	SNP	1.000	G
ASRGL1	80150	genome.wustl.edu	37	11	62159024	62159024	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:62159024G>A	ENST00000415229.2	+	6	856	c.641G>A	c.(640-642)gGa>gAa	p.G214E	ASRGL1_ENST00000301776.5_Missense_Mutation_p.G214E|CTD-2531D15.5_ENST00000526045.1_RNA	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	214					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	AATGACATCGGAGCCGTCTCA	0.488											OREG0021023	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													90.0	69.0	76.0					11																	62159024		2202	4299	6501	SO:0001583	missense	0				CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.641G>A	11.37:g.62159024G>A	ENSP00000400057:p.Gly214Glu	1059	B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	pfam_Peptidase_T2	p.G214E	ENST00000415229.2	37	c.641	CCDS8019.1	11	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368003	0.82463	.	.	ENSG00000162174	ENST00000415229;ENST00000301776	D;D	0.90676	-2.71;-2.71	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	D	0.97228	0.9094	H	0.98559	4.265	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.98137	1.0434	10	0.49607	T	0.09	-18.8424	15.6076	0.76685	0.0:0.0:1.0:0.0	.	214	Q7L266	ASGL1_HUMAN	E	214	ENSP00000400057:G214E;ENSP00000301776:G214E	ENSP00000301776:G214E	G	+	2	0	ASRGL1	61915600	1.000000	0.71417	0.601000	0.28877	0.732000	0.41865	8.701000	0.91331	2.253000	0.74438	0.650000	0.86243	GGA	ASRGL1	-	pfam_Peptidase_T2	ENSG00000162174		0.488	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASRGL1	HGNC	protein_coding	OTTHUMT00000394865.1	-	0.00	30	0	G	NM_001083926		62159024	+1	tier1	-	no_errors	ENST00000301776	ensembl	human	known	74_37	missense	62.50	9	15	SNP	1.000	A
ATAD2	29028	genome.wustl.edu	37	8	124392780	124392780	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:124392780C>T	ENST00000287394.5	-	2	416	c.309G>A	c.(307-309)agG>agA	p.R103R	ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	103					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TTGTAAAATGCCTGCCATTAG	0.333																																																	0													99.0	93.0	95.0					8																	124392780		2203	4300	6503	SO:0001819	synonymous_variant	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.309G>A	8.37:g.124392780C>T			Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Silent	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.R103	ENST00000287394.5	37	c.309	CCDS6343.1	8																																																																																			ATAD2	-	NULL	ENSG00000156802		0.333	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	-	0.00	62	0	C	NM_014109		124392780	-1	tier1	-	no_errors	ENST00000287394	ensembl	human	known	74_37	silent	5.81	81	5	SNP	0.997	T
ATP10B	23120	genome.wustl.edu	37	5	160018126	160018126	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:160018126G>T	ENST00000327245.5	-	23	4431	c.3585C>A	c.(3583-3585)ttC>ttA	p.F1195L		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1195					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAGAAATCCAGAAAGTCGACA	0.423																																																	0													131.0	137.0	135.0					5																	160018126		1909	4124	6033	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3585C>A	5.37:g.160018126G>T	ENSP00000313600:p.Phe1195Leu		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.F1195L	ENST00000327245.5	37	c.3585	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	G	23.4	4.416178	0.83449	.	.	ENSG00000118322	ENST00000327245	T	0.77489	-1.1	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.88429	0.6434	M	0.89287	3.02	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	D	0.89638	0.3860	9	.	.	.	.	10.8925	0.47004	0.0969:0.0:0.9031:0.0	.	1195	O94823	AT10B_HUMAN	L	1195	ENSP00000313600:F1195L	.	F	-	3	2	ATP10B	159950704	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.107000	0.50329	2.408000	0.81797	0.655000	0.94253	TTC	ATP10B	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000118322		0.423	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	-	0.00	49	0	G	NM_025153		160018126	-1	tier1	-	no_errors	ENST00000327245	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
ATP13A5	344905	genome.wustl.edu	37	3	193082019	193082019	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:193082019G>A	ENST00000342358.4	-	2	231	c.114C>T	c.(112-114)gtC>gtT	p.V38V		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	38						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		GCACGGATGCGACAAGGCAGA	0.502																																																	0													167.0	169.0	168.0					3																	193082019		2203	4300	6503	SO:0001819	synonymous_variant	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.114C>T	3.37:g.193082019G>A			Q6UWS4|Q6ZWL0	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.V38	ENST00000342358.4	37	c.114	CCDS33914.1	3																																																																																			ATP13A5	-	pfam_ATPase_P-typ_Cation_typ_V,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.502	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	-	0.00	60	0	G	NM_198505		193082019	-1	tier1	-	no_errors	ENST00000342358	ensembl	human	known	74_37	silent	31.25	54	25	SNP	0.000	A
ATP1A4	480	genome.wustl.edu	37	1	160143923	160143923	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:160143923C>T	ENST00000368081.4	+	14	2485	c.2014C>T	c.(2014-2016)Cat>Tat	p.H672Y	ATP1A4_ENST00000418334.1_3'UTR	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	672					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			cattgtggtgcatggtgcaga	0.488																																																	0													105.0	98.0	100.0					1																	160143923		2203	4300	6503	SO:0001583	missense	0			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.2014C>T	1.37:g.160143923C>T	ENSP00000357060:p.His672Tyr		Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.H672Y	ENST00000368081.4	37	c.2014	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966350	0.53507	.	.	ENSG00000132681	ENST00000368081	D	0.97041	-4.22	4.27	4.27	0.50696	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96355	0.8811	M	0.74467	2.265	0.80722	D	1	D	0.54397	0.966	P	0.52159	0.691	D	0.96338	0.9249	10	0.87932	D	0	.	9.7604	0.40528	0.2059:0.7941:0.0:0.0	.	672	Q13733	AT1A4_HUMAN	Y	672	ENSP00000357060:H672Y	ENSP00000357060:H672Y	H	+	1	0	ATP1A4	158410547	0.167000	0.22975	0.984000	0.44739	0.351000	0.29236	0.787000	0.26858	2.371000	0.80710	0.655000	0.94253	CAT	ATP1A4	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000132681		0.488	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	-	0.00	53	0	C	NM_144699		160143923	+1	tier1	-	no_errors	ENST00000368081	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
ATP8B3	148229	genome.wustl.edu	37	19	1799764	1799764	+	Intron	DEL	A	A	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:1799764delA	ENST00000310127.6	-	14	1791				ATP8B3_ENST00000539485.1_Intron|ATP8B3_ENST00000525591.1_Intron|ATP8B3_ENST00000526092.2_Frame_Shift_Del_p.F525fs	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		actctgcctcaaaaaaaaaaa	0.547																																																	0																																										SO:0001627	intron_variant	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.1552+181T>-	19.37:g.1799764delA			Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Frame_Shift_Del	DEL	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom	p.F525fs	ENST00000310127.6	37	c.1575	CCDS45901.1	19																																																																																			ATP8B3	-	NULL	ENSG00000130270		0.547	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1		0.00	34	0	A	NM_138813		1799764	-1	tier1		no_errors	ENST00000526092	ensembl	human	putative	74_37	frame_shift_del	16.00	21	4	DEL	0.016	-
BAZ2B	29994	genome.wustl.edu	37	2	160205695	160205695	+	Missense_Mutation	SNP	G	G	T	rs372805282		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:160205695G>T	ENST00000392783.2	-	29	5455	c.4960C>A	c.(4960-4962)Cta>Ata	p.L1654I	BAZ2B_ENST00000392782.1_Missense_Mutation_p.L1618I|BAZ2B_ENST00000355831.2_Missense_Mutation_p.L1620I|BAZ2B_ENST00000343439.5_Missense_Mutation_p.L1554I	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1654					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						CCCGATCCTAGACTAGGTACA	0.408																																																	0													124.0	114.0	117.0					2																	160205695		1861	4108	5969	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4960C>A	2.37:g.160205695G>T	ENSP00000376534:p.Leu1654Ile		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.L1654I	ENST00000392783.2	37	c.4960	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	6.858	0.527666	0.13127	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.61274	0.17;0.16;0.17;0.12	5.47	2.59	0.31030	.	0.000000	0.29876	U	0.010973	T	0.46092	0.1375	L	0.57536	1.79	0.32739	N	0.507957	B;B	0.22276	0.002;0.067	B;B	0.18263	0.003;0.021	T	0.52079	-0.8623	10	0.54805	T	0.06	-4.5253	2.5006	0.04632	0.1443:0.1274:0.4709:0.2574	.	1618;1654	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	I	1618;1654;1620;1554	ENSP00000376533:L1618I;ENSP00000376534:L1654I;ENSP00000348087:L1620I;ENSP00000339670:L1554I	ENSP00000339670:L1554I	L	-	1	2	BAZ2B	159913941	0.983000	0.35010	0.998000	0.56505	0.589000	0.36550	0.287000	0.18920	0.753000	0.32945	0.591000	0.81541	CTA	BAZ2B	-	NULL	ENSG00000123636		0.408	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2		0.00	33	0	G			160205695	-1			no_errors	ENST00000392783	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.987	T
BMP15	9210	genome.wustl.edu	37	X	50659106	50659106	+	Silent	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:50659106C>A	ENST00000252677.3	+	2	678	c.678C>A	c.(676-678)tcC>tcA	p.S226S		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	226					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					GCACTTCATCCTTGGACATTG	0.453																																																	0													146.0	115.0	126.0					X																	50659106		2203	4299	6502	SO:0001819	synonymous_variant	0			AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.678C>A	X.37:g.50659106C>A			Q17RM6|Q5JST1|Q9UMS1	Silent	SNP	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.S226	ENST00000252677.3	37	c.678	CCDS14334.1	X																																																																																			BMP15	-	NULL	ENSG00000130385		0.453	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP15	HGNC	protein_coding	OTTHUMT00000056572.1	-	0.00	49	0	C	NM_005448		50659106	+1	tier1	-	no_errors	ENST00000252677	ensembl	human	known	74_37	silent	60.87	18	28	SNP	0.000	A
BNC1	646	genome.wustl.edu	37	15	83933212	83933212	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr15:83933212T>G	ENST00000345382.2	-	4	876	c.791A>C	c.(790-792)tAt>tCt	p.Y264S	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.Y257S	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	264					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CTCCAACATATATTGTTCGGG	0.498																																																	0													84.0	82.0	83.0					15																	83933212		2203	4300	6503	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.791A>C	15.37:g.83933212T>G	ENSP00000307041:p.Tyr264Ser		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y264S	ENST00000345382.2	37	c.791	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	T	5.184	0.219501	0.09863	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.03181	4.02	5.23	4.07	0.47477	.	0.630970	0.16849	N	0.197006	T	0.03915	0.0110	L	0.46157	1.445	0.09310	N	1	B;B	0.16396	0.017;0.01	B;B	0.11329	0.005;0.006	T	0.42565	-0.9444	10	0.22706	T	0.39	-9.3412	6.2488	0.20833	0.3102:0.0:0.137:0.5528	.	257;264	F5GY04;Q01954	.;BNC1_HUMAN	S	264;257	ENSP00000307041:Y264S	ENSP00000307041:Y264S	Y	-	2	0	BNC1	81724216	0.477000	0.25909	0.031000	0.17742	0.972000	0.66771	1.426000	0.34870	0.945000	0.37605	0.533000	0.62120	TAT	BNC1	-	NULL	ENSG00000169594		0.498	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	-	0.00	109	0	T	NM_001717		83933212	-1	tier1	-	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	45.31	35	29	SNP	0.001	G
BSN	8927	genome.wustl.edu	37	3	49690024	49690024	+	Missense_Mutation	SNP	G	G	T	rs368815355		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:49690024G>T	ENST00000296452.4	+	5	3149	c.3035G>T	c.(3034-3036)cGc>cTc	p.R1012L		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	1012					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		AGCCCCAGCCGCAGGCAGCGT	0.647																																																	0													29.0	30.0	30.0					3																	49690024		2202	4299	6501	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.3035G>T	3.37:g.49690024G>T	ENSP00000296452:p.Arg1012Leu		O43161|Q7LGH3	Missense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.R1012L	ENST00000296452.4	37	c.3035	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	G	17.56	3.419607	0.62622	.	.	ENSG00000164061	ENST00000296452	T	0.23348	1.91	5.17	5.17	0.71159	.	0.058475	0.64402	D	0.000002	T	0.50650	0.1628	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.50939	-0.8768	10	0.59425	D	0.04	.	18.673	0.91518	0.0:0.0:1.0:0.0	.	1012	Q9UPA5	BSN_HUMAN	L	1012	ENSP00000296452:R1012L	ENSP00000296452:R1012L	R	+	2	0	BSN	49665028	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	9.843000	0.99491	2.413000	0.81919	0.561000	0.74099	CGC	BSN	-	NULL	ENSG00000164061		0.647	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	-	0.00	43	0	G	NM_003458		49690024	+1	tier1	-	no_errors	ENST00000296452	ensembl	human	known	74_37	missense	34.00	33	17	SNP	1.000	T
BTN3A1	11119	genome.wustl.edu	37	6	26412944	26412944	+	Intron	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:26412944C>T	ENST00000289361.6	+	10	1386				BTN3A1_ENST00000414912.2_Intron|BTN3A1_ENST00000425234.2_3'UTR|BTN3A1_ENST00000476549.2_Missense_Mutation_p.L344F	NM_001145008.1|NM_001145009.1|NM_007048.5	NP_001138480.1|NP_001138481.1|NP_008979.3	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1						activated T cell proliferation (GO:0050798)|cytokine secretion (GO:0050663)|interferon-gamma secretion (GO:0072643)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28						tgaggaaatgcttcagatgag	0.413																																																	0													172.0	137.0	148.0					6																	26412944		692	1591	2283	SO:0001627	intron_variant	0			U90552	CCDS4608.1, CCDS4609.1, CCDS47388.1, CCDS47389.1	6p22.1	2014-01-14			ENSG00000026950	ENSG00000026950		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1138	protein-coding gene	gene with protein product		613593				9149941	Standard	NM_007048		Approved	BT3.1, BTF5, CD277, BTN3.1	uc003nhv.3	O00481	OTTHUMG00000014449	ENST00000289361.6:c.1019-453C>T	6.37:g.26412944C>T			A2A278|A8K2C8|B4DIQ1|B4DRM2|E9PGB4|E9PHG8|Q0P515|Q147X5|Q53F15|Q99420|Q9HCY1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.L344F	ENST00000289361.6	37	c.1030	CCDS4608.1	6	.	.	.	.	.	.	.	.	.	.	.	11.28	1.591052	0.28357	.	.	ENSG00000026950	ENST00000476549	T	0.04083	3.71	0.737	0.737	0.18314	.	.	.	.	.	T	0.04182	0.0116	L	0.42245	1.32	0.09310	N	0.999999	D	0.54964	0.969	P	0.57620	0.824	T	0.38308	-0.9667	8	0.72032	D	0.01	.	.	.	.	.	344	O00481-2	.	F	344	ENSP00000420010:L344F	ENSP00000420010:L344F	L	+	1	0	BTN3A1	26520923	0.202000	0.23423	0.045000	0.18777	0.048000	0.14542	0.441000	0.21611	0.658000	0.30925	0.514000	0.50259	CTT	BTN3A1	-	NULL	ENSG00000026950		0.413	BTN3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN3A1	HGNC	protein_coding	OTTHUMT00000040112.3	-	0.00	71	0	C			26412944	+1	tier1	-	no_errors	ENST00000476549	ensembl	human	known	74_37	missense	47.46	31	28	SNP	0.060	T
C11orf45	219833	genome.wustl.edu	37	11	128772514	128772514	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:128772514T>A	ENST00000524878.1	-	4	546	c.376A>T	c.(376-378)Aga>Tga	p.R126*	C11orf45_ENST00000530168.1_5'UTR|C11orf45_ENST00000310799.3_Nonsense_Mutation_p.R126*|KCNJ5_ENST00000338350.4_Intron|KCNJ5_ENST00000529694.1_Intron			Q8TAV5	CK045_HUMAN	chromosome 11 open reading frame 45	126						extracellular region (GO:0005576)				endometrium(1)|kidney(1)|lung(2)|pancreas(1)|prostate(2)	7	all_hematologic(175;0.0641)	Lung NSC(97;0.00521)|Breast(109;0.00715)|all_lung(97;0.0111)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.00531)|LUSC - Lung squamous cell carcinoma(976;0.0193)|Lung(977;0.0195)		CGGCCCTCTCTACTATCATGG	0.597																																																	0													74.0	66.0	69.0					11																	128772514		2201	4297	6498	SO:0001587	stop_gained	0			AK125634	CCDS8478.1	11q24.3	2012-05-30			ENSG00000174370	ENSG00000174370			28584	protein-coding gene	gene with protein product							Standard	NM_001256088		Approved	MGC35558, FLJ43646	uc001qeu.3	Q8TAV5	OTTHUMG00000165796	ENST00000524878.1:c.376A>T	11.37:g.128772514T>A	ENSP00000431922:p.Arg126*		B2RAD0	Nonsense_Mutation	SNP	NULL	p.R126*	ENST00000524878.1	37	c.376	CCDS8478.1	11	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015594	0.54468	.	.	ENSG00000174370	ENST00000310799;ENST00000524878	.	.	.	2.83	1.71	0.24356	.	.	.	.	.	.	.	.	.	.	.	0.28625	N	0.907977	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.4122	0.11438	0.0:0.1576:0.0:0.8424	.	.	.	.	X	126	.	ENSP00000307879:R126X	R	-	1	2	C11orf45	128277724	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.604000	0.24164	0.508000	0.28173	0.460000	0.39030	AGA	C11orf45	-	NULL	ENSG00000174370		0.597	C11orf45-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	C11orf45	HGNC	protein_coding	OTTHUMT00000386243.1	-	0.00	36	0	T	NM_145013		128772514	-1	tier1	-	no_errors	ENST00000310799	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	0.001	A
CFAP54	144535	genome.wustl.edu	37	12	96927722	96927723	+	In_Frame_Ins	INS	-	-	CTG			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:96927722_96927723insCTG	ENST00000524981.4	+	10	1533_1534	c.1510_1511insCTG	c.(1510-1512)tct>tCTGct	p.505_506insA	C12orf55_ENST00000298953.3_In_Frame_Ins_p.505_506insA			Q96N23	CL055_HUMAN		505																	ATTTGAATCTTCTGCTGTACAT	0.307																																																	0																																										SO:0001652	inframe_insertion	0																														ENST00000524981.4:c.1514_1516dupCTG	12.37:g.96927726_96927728dupCTG	ENSP00000431759:p.Ala505_Ala505dup			In_Frame_Ins	INS	superfamily_Fibronectin_type3	p.506in_frame_insA	ENST00000524981.4	37	c.1510_1511		12																																																																																			C12orf55	-	NULL	ENSG00000188596		0.307	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4		0.00	58	0	-			96927723	+1	tier1		no_errors	ENST00000524981	ensembl	human	putative	74_37	in_frame_ins	20.00	52	13	INS	0.000:0.015	CTG
C1QTNF1	114897	genome.wustl.edu	37	17	77042652	77042652	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:77042652T>A	ENST00000339142.2	+	4	726	c.171T>A	c.(169-171)caT>caA	p.H57Q	C1QTNF1_ENST00000580474.1_Missense_Mutation_p.H57Q|C1QTNF1_ENST00000583904.1_Missense_Mutation_p.H57Q|C1QTNF1_ENST00000580454.1_Missense_Mutation_p.H57Q|C1QTNF1_ENST00000354124.3_Missense_Mutation_p.H67Q|C1QTNF1_ENST00000392445.2_Missense_Mutation_p.H57Q|C1QTNF1_ENST00000581774.1_Missense_Mutation_p.H57Q|C1QTNF1_ENST00000579760.1_Missense_Mutation_p.H57Q|C1QTNF1_ENST00000311661.4_5'UTR|C1QTNF1_ENST00000578229.1_5'UTR	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	57					negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			AAGAACAACATGAAAAATACA	0.592											OREG0024791	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													72.0	71.0	71.0					17																	77042652		2203	4300	6503	SO:0001583	missense	0			AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.171T>A	17.37:g.77042652T>A	ENSP00000340864:p.His57Gln	1172	Q6ZMH6|Q96NF2|Q9GZR4	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.H67Q	ENST00000339142.2	37	c.201	CCDS11761.1	17	.	.	.	.	.	.	.	.	.	.	t	10.37	1.332708	0.24167	.	.	ENSG00000173918	ENST00000339142;ENST00000354124;ENST00000392444;ENST00000392445	T;T	0.75821	-0.97;-0.96	4.12	-0.837	0.10766	.	1.043170	0.07607	N	0.924609	T	0.52805	0.1757	L	0.29908	0.895	0.09310	N	1	P;B;B	0.39480	0.675;0.001;0.001	B;B;B	0.33392	0.163;0.001;0.001	T	0.40021	-0.9585	10	0.27082	T	0.32	.	1.8173	0.03103	0.1401:0.3626:0.164:0.3333	.	67;67;57	A8K7L9;Q6ZMH6;Q9BXJ1	.;.;C1QT1_HUMAN	Q	57;67;57;67	ENSP00000340864:H57Q;ENSP00000343230:H67Q	ENSP00000340864:H57Q	H	+	3	2	C1QTNF1	74554247	0.000000	0.05858	0.001000	0.08648	0.821000	0.46438	-1.226000	0.02953	-0.307000	0.08804	0.398000	0.26397	CAT	C1QTNF1	-	NULL	ENSG00000173918		0.592	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF1	HGNC	protein_coding	OTTHUMT00000437388.2		0.00	59	0	T	NM_030968		77042652	+1			no_errors	ENST00000354124	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.001	A
C1QTNF1	114897	genome.wustl.edu	37	17	77043850	77043850	+	Missense_Mutation	SNP	G	G	A	rs373450378		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:77043850G>A	ENST00000339142.2	+	5	1081	c.526G>A	c.(526-528)Gac>Aac	p.D176N	C1QTNF1_ENST00000580474.1_Missense_Mutation_p.D176N|C1QTNF1_ENST00000583904.1_Missense_Mutation_p.D176N|C1QTNF1_ENST00000580454.1_Missense_Mutation_p.D176N|C1QTNF1_ENST00000354124.3_Missense_Mutation_p.D186N|C1QTNF1_ENST00000392445.2_Missense_Mutation_p.D176N|C1QTNF1_ENST00000581774.1_Missense_Mutation_p.D176N|C1QTNF1_ENST00000582625.1_3'UTR|C1QTNF1_ENST00000579760.1_Missense_Mutation_p.D176N|C1QTNF1_ENST00000311661.4_Missense_Mutation_p.D94N|C1QTNF1_ENST00000578229.1_Missense_Mutation_p.D94N	NM_198593.3	NP_940995.1	Q9BXJ1	C1QT1_HUMAN	C1q and tumor necrosis factor related protein 1	176	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				negative regulation of platelet activation (GO:0010544)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase B signaling (GO:0051897)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)|regulation of glucose metabolic process (GO:0010906)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	collagen binding (GO:0005518)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(2)	14			BRCA - Breast invasive adenocarcinoma(99;0.0294)|OV - Ovarian serous cystadenocarcinoma(97;0.201)			GAACCTCTACGACCACTTCAA	0.562																																																	0								G	ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	163.0	149.0	154.0		526,526,280	-4.9	0.9	17		154	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	C1QTNF1	NM_030968.2,NM_198593.2,NM_198594.1	23,23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign	176/282,176/282,94/200	77043850	1,13005	2203	4300	6503	SO:0001583	missense	0			AF329840	CCDS11761.1, CCDS11762.1	17q25	2012-07-02			ENSG00000173918	ENSG00000173918			14324	protein-coding gene	gene with protein product	"""G protein coupled receptor interacting protein"""	610365				12409230	Standard	NM_198593		Approved	CTRP1, ZSIG37, GIP, FLJ90694	uc002jwp.4	Q9BXJ1	OTTHUMG00000177533	ENST00000339142.2:c.526G>A	17.37:g.77043850G>A	ENSP00000340864:p.Asp176Asn		Q6ZMH6|Q96NF2|Q9GZR4	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.D186N	ENST00000339142.2	37	c.556	CCDS11761.1	17	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165617	0.38217	0.0	1.16E-4	ENSG00000173918	ENST00000339142;ENST00000311661;ENST00000354124;ENST00000392444;ENST00000392445	T;T;T	0.20332	2.08;2.08;2.08	4.72	-4.91	0.03085	Tumour necrosis factor-like (2);Complement C1q protein (4);	1.337000	0.04802	N	0.433541	T	0.06188	0.0160	N	0.01493	-0.835	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.002;0.003;0.003	T	0.41360	-0.9513	10	0.05959	T	0.93	.	9.5063	0.39048	0.4158:0.0933:0.4909:0.0	.	186;186;176	A8K7L9;Q6ZMH6;Q9BXJ1	.;.;C1QT1_HUMAN	N	176;94;186;176;186	ENSP00000340864:D176N;ENSP00000311265:D94N;ENSP00000343230:D186N	ENSP00000311265:D94N	D	+	1	0	C1QTNF1	74555445	0.998000	0.40836	0.908000	0.35775	0.933000	0.57130	1.054000	0.30455	-0.826000	0.04284	-1.134000	0.01955	GAC	C1QTNF1	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000173918		0.562	C1QTNF1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF1	HGNC	protein_coding	OTTHUMT00000437388.2		0.00	60	0	G	NM_030968		77043850	+1			no_errors	ENST00000354124	ensembl	human	known	74_37	missense	5.81	81	5	SNP	0.364	A
C1orf127	148345	genome.wustl.edu	37	1	11015170	11015171	+	Frame_Shift_Ins	INS	-	-	GAAC			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:11015170_11015171insGAAC	ENST00000377008.4	-	8	796_797	c.350_351insGTTC	c.(349-351)tccfs	p.-117fs	C1orf127_ENST00000377004.4_Frame_Shift_Ins_p.-284fs			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127											NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CCTCAATGTAGGAACCTCTTTT	0.51																																																	0																																										SO:0001589	frameshift_variant	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.347_350dupGTTC	1.37:g.11015171_11015174dupGAAC	ENSP00000366207:p.Ser117fs		A0AVG8|A6NKM7|Q5VXJ2	Frame_Shift_Ins	INS	superfamily_DNA-bd_dom_put	p.Y285fs	ENST00000377008.4	37	c.852_851		1																																																																																			C1orf127	-	NULL	ENSG00000175262		0.510	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding			0.00	42	0	-	NM_173507		11015171	-1	tier1		no_errors	ENST00000377004	ensembl	human	known	74_37	frame_shift_ins	14.29	42	7	INS	0.000:0.000	GAAC
C1orf167	284498	genome.wustl.edu	37	1	11838983	11838983	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:11838983G>T	ENST00000433342.1	+	12	2569	c.2569G>T	c.(2569-2571)Gtt>Ttt	p.V857F	RP11-56N19.5_ENST00000376620.3_RNA			Q5SNV9	CA167_HUMAN	chromosome 1 open reading frame 167	857										central_nervous_system(1)	1						CCTTCCCCAGGTTCCCAGGGC	0.682																																																	0																																										SO:0001630	splice_region_variant	0			AL834308		1p36.22	2012-04-20			ENSG00000215910	ENSG00000215910			25262	protein-coding gene	gene with protein product						12370778	Standard	XM_006710065		Approved	DKFZp434E1410, RP11-56N19.2	uc001asy.1	Q5SNV9	OTTHUMG00000002228	ENST00000433342.1:c.2569-1G>T	1.37:g.11838983G>T			Q8NDA9|Q8NDF3	Missense_Mutation	SNP	NULL	p.V857F	ENST00000433342.1	37	c.2569		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.94|10.94	1.493674|1.493674	0.26774|0.26774	.|.	.|.	ENSG00000215910|ENSG00000215910	ENST00000312793|ENST00000433342	.|T	.|0.06687	.|3.27	4.73|4.73	1.45|1.45	0.22620|0.22620	.|.	.|.	.|.	.|.	.|.	T|T	0.04048|0.04048	0.0113|0.0113	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|P	.|0.45827	.|0.867	.|B	.|0.40134	.|0.32	T|T	0.42916|0.42916	-0.9423|-0.9423	5|8	.|.	.|.	.|.	-0.0439|-0.0439	7.5186|7.5186	0.27614|0.27614	0.0979:0.4126:0.4895:0.0|0.0979:0.4126:0.4895:0.0	.|.	.|857	.|Q5SNV9	.|CA167_HUMAN	V|F	216|857	.|ENSP00000414909:V857F	.|.	G|V	+|+	2|1	0|0	C1orf167|C1orf167	11761570|11761570	0.424000|0.424000	0.25490|0.25490	0.042000|0.042000	0.18584|0.18584	0.047000|0.047000	0.14425|0.14425	0.413000|0.413000	0.21148|0.21148	0.308000|0.308000	0.22923|0.22923	0.194000|0.194000	0.17425|0.17425	GGT|GTT	C1orf167	-	NULL	ENSG00000215910		0.682	C1orf167-201	KNOWN	basic|appris_principal	protein_coding	C1orf167	HGNC	protein_coding		-	0.00	176	0	G		Missense_Mutation	11838983	+1	tier1	-	no_errors	ENST00000433342	ensembl	human	known	74_37	missense	13.92	135	22	SNP	0.105	T
C2orf71	388939	genome.wustl.edu	37	2	29295183	29295183	+	Missense_Mutation	SNP	C	C	T	rs376195796		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:29295183C>T	ENST00000331664.5	-	1	1944	c.1945G>A	c.(1945-1947)Gtg>Atg	p.V649M		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	649					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TTGGGCCACACGGCGGCTGCT	0.582																																																	0								C	MET/VAL	2,4150		0,2,2074	89.0	90.0	90.0		1945	-5.3	0.0	2		90	0,8400		0,0,4200	no	missense	C2orf71	NM_001029883.1	21	0,2,6274	TT,TC,CC		0.0,0.0482,0.0159	possibly-damaging	649/1289	29295183	2,12550	2076	4200	6276	SO:0001583	missense	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1945G>A	2.37:g.29295183C>T	ENSP00000332809:p.Val649Met			Missense_Mutation	SNP	NULL	p.V649M	ENST00000331664.5	37	c.1945	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	C	5.001	0.185845	0.09495	4.82E-4	0.0	ENSG00000179270	ENST00000331664	T	0.19250	2.16	5.77	-5.35	0.02697	.	1.415110	0.04392	N	0.362564	T	0.06962	0.0177	N	0.14661	0.345	0.09310	N	1	P	0.44344	0.833	B	0.29942	0.109	T	0.25882	-1.0119	10	0.37606	T	0.19	-0.271	0.53	0.00626	0.2319:0.2654:0.157:0.3457	.	649	A6NGG8	CB071_HUMAN	M	649	ENSP00000332809:V649M	ENSP00000332809:V649M	V	-	1	0	C2orf71	29148687	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.594000	0.05733	-0.752000	0.04728	-1.195000	0.01675	GTG	C2orf71	-	NULL	ENSG00000179270		0.582	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3		0.00	44	0	C	NM_001029883		29295183	-1			no_errors	ENST00000331664	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.000	T
C8B	732	genome.wustl.edu	37	1	57415411	57415411	+	Nonsense_Mutation	SNP	G	G	T	rs138606922	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:57415411G>T	ENST00000371237.4	-	6	747	c.681C>A	c.(679-681)taC>taA	p.Y227*	C8B_ENST00000535057.1_Nonsense_Mutation_p.Y165*|C8B_ENST00000543257.1_Nonsense_Mutation_p.Y175*	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	227	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.Y227Y(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						ATATGAATTCGTATTTGCCTT	0.348																																																	1	Substitution - coding silent(1)	lung(1)											57.0	56.0	56.0					1																	57415411		2203	4299	6502	SO:0001587	stop_gained	0			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.681C>A	1.37:g.57415411G>T	ENSP00000360281:p.Tyr227*		A1L4K7	Nonsense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.Y227*	ENST00000371237.4	37	c.681	CCDS30730.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.261939	0.95368	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	.	.	.	5.0	-4.86	0.03132	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.2908	12.0924	0.53736	0.6367:0.0:0.3633:0.0	.	.	.	.	X	227;175;165	.	ENSP00000360281:Y227X	Y	-	3	2	C8B	57187999	0.999000	0.42202	0.969000	0.41365	0.186000	0.23388	0.722000	0.25925	-0.706000	0.05028	-1.366000	0.01203	TAC	C8B	-	NULL	ENSG00000021852		0.348	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8B	HGNC	protein_coding	OTTHUMT00000022886.2	-	0.00	60	0	G			57415411	-1	tier1	-	no_errors	ENST00000371237	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.996	T
CACNA1E	777	genome.wustl.edu	37	1	181750615	181750615	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:181750615C>A	ENST00000367573.2	+	39	5320	c.5320C>A	c.(5320-5322)Ccg>Acg	p.P1774T	CACNA1E_ENST00000357570.5_Missense_Mutation_p.P1725T|CACNA1E_ENST00000367567.4_Missense_Mutation_p.P1381T|CACNA1E_ENST00000358338.5_Intron|CACNA1E_ENST00000367570.1_Missense_Mutation_p.P1774T|CACNA1E_ENST00000360108.3_Missense_Mutation_p.P1755T|CACNA1E_ENST00000526775.1_Missense_Mutation_p.P1755T	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1774	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CATGTCACCTCCGCTAGGCCT	0.542																																																	0													34.0	34.0	34.0					1																	181750615		2049	4208	6257	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5320C>A	1.37:g.181750615C>A	ENSP00000356545:p.Pro1774Thr		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.P1774T	ENST00000367573.2	37	c.5320	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776926	0.90195	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000367567;ENST00000360108;ENST00000367573	T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.85336	0.5673	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.994;0.998	D	0.88592	0.3144	10	0.87932	D	0	.	19.4226	0.94727	0.0:1.0:0.0:0.0	.	1755;1774	Q15878-2;Q15878-3	.;.	T	1774;1755;1725;1381;1755;1774	ENSP00000356542:P1774T;ENSP00000434814:P1755T;ENSP00000350183:P1725T;ENSP00000356539:P1381T;ENSP00000353222:P1755T;ENSP00000356545:P1774T	ENSP00000350183:P1725T	P	+	1	0	CACNA1E	180017238	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.711000	0.84669	2.684000	0.91462	0.650000	0.86243	CCG	CACNA1E	-	pfscan_EF_hand_dom	ENSG00000198216		0.542	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	66	0	C	NM_000721		181750615	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	missense	28.00	36	14	SNP	1.000	A
CACNA1I	8911	genome.wustl.edu	37	22	40037141	40037141	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:40037141C>T	ENST00000402142.3	+	6	1010	c.1010C>T	c.(1009-1011)gCc>gTc	p.A337V	CACNA1I_ENST00000407673.1_Missense_Mutation_p.A337V|CACNA1I_ENST00000401624.1_Missense_Mutation_p.A337V|CACNA1I_ENST00000400164.3_Missense_Mutation_p.A337V|CACNA1I_ENST00000336649.4_Missense_Mutation_p.A337V|CACNA1I_ENST00000404898.1_Missense_Mutation_p.A337V	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	337					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CACAAGGGTGCCATCAACTTT	0.607																																																	0													68.0	71.0	70.0					22																	40037141		2071	4194	6265	SO:0001583	missense	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.1010C>T	22.37:g.40037141C>T	ENSP00000385019:p.Ala337Val		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.A337V	ENST00000402142.3	37	c.1010	CCDS46710.1	22	.	.	.	.	.	.	.	.	.	.	C	32	5.150937	0.94645	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41;-4.41;-4.41	5.21	5.21	0.72293	Ion transport (1);	0.056187	0.64402	D	0.000001	D	0.97974	0.9333	M	0.66439	2.03	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	D	0.97274	0.9913	10	0.20519	T	0.43	.	18.7618	0.91855	0.0:1.0:0.0:0.0	.	337;337;337;337	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	V	337	ENSP00000385019:A337V;ENSP00000384093:A337V;ENSP00000383887:A337V;ENSP00000385680:A337V;ENSP00000337829:A337V;ENSP00000383028:A337V	ENSP00000337829:A337V	A	+	2	0	CACNA1I	38367087	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.388000	0.79795	2.445000	0.82738	0.563000	0.77884	GCC	CACNA1I	-	pfam_Ion_trans_dom	ENSG00000100346		0.607	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	-	0.00	40	0	C	NM_001003406		40037141	+1	tier1	-	no_errors	ENST00000336649	ensembl	human	known	74_37	missense	8.89	40	4	SNP	1.000	T
CACNA2D4	93589	genome.wustl.edu	37	12	1993438	1993438	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:1993438C>T	ENST00000382722.5	-	12	1684	c.1322G>A	c.(1321-1323)cGc>cAc	p.R441H	CACNA2D4_ENST00000587995.1_Missense_Mutation_p.R441H|CACNA2D4_ENST00000585708.1_Missense_Mutation_p.R377H|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.R377H|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.R441H	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	441	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCACTTCATGCGGTCAGCAAA	0.537																																					Colon(2;101 179 21030 23310 28141)												0													67.0	74.0	72.0					12																	1993438		2066	4212	6278	SO:0001583	missense	0			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1322G>A	12.37:g.1993438C>T	ENSP00000372169:p.Arg441His		Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R441H	ENST00000382722.5	37	c.1322	CCDS44785.1	12	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626698	0.46840	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.07908	3.15	5.37	2.53	0.30540	von Willebrand factor, type A (3);	0.179561	0.56097	D	0.000028	T	0.03053	0.0090	N	0.02539	-0.55	0.80722	D	1	B	0.12630	0.006	B	0.14578	0.011	T	0.39683	-0.9602	10	0.52906	T	0.07	.	6.0262	0.19656	0.0:0.5669:0.0:0.4331	.	441	Q7Z3S7	CA2D4_HUMAN	H	377;441;441	ENSP00000372169:R441H	ENSP00000280663:R441H	R	-	2	0	CACNA2D4	1863699	0.999000	0.42202	0.964000	0.40570	0.925000	0.55904	2.705000	0.47127	1.277000	0.44412	0.603000	0.83216	CGC	CACNA2D4	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000151062		0.537	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA2D4	HGNC	protein_coding	OTTHUMT00000398230.2	-	0.00	80	0	C			1993438	-1	tier1	-	no_errors	ENST00000382722	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.789	T
CCAR1	55749	genome.wustl.edu	37	10	70482290	70482290	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:70482290C>A	ENST00000265872.6	+	2	148	c.29C>A	c.(28-30)cCg>cAg	p.P10Q	CCAR1_ENST00000535016.1_Missense_Mutation_p.P10Q|CCAR1_ENST00000543719.1_Missense_Mutation_p.P10Q	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	10					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						CAGAAGAATCCGCCATGGGCT	0.418																																																	0													121.0	130.0	127.0					10																	70482290		2203	4300	6503	SO:0001583	missense	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.29C>A	10.37:g.70482290C>A	ENSP00000265872:p.Pro10Gln		A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_dom,superfamily_NA-bd_OB-fold,smart_SAP_dom,pfscan_SAP_dom	p.P10Q	ENST00000265872.6	37	c.29	CCDS7282.1	10	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035445	0.75617	.	.	ENSG00000060339	ENST00000536391;ENST00000265872;ENST00000535016;ENST00000538031;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000494903	T;T;T;T;T	0.67698	0.36;-0.04;-0.04;0.11;-0.28	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75503	0.3858	L	0.29908	0.895	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.995	T	0.77376	-0.2611	10	0.87932	D	0	-8.4426	19.6915	0.96002	0.0:1.0:0.0:0.0	.	10;10	Q8IX12-2;Q8IX12	.;CCAR1_HUMAN	Q	10;10;10;10;10;10;10;69	ENSP00000265872:P10Q;ENSP00000441820:P10Q;ENSP00000445254:P10Q;ENSP00000439252:P10Q;ENSP00000438610:P10Q	ENSP00000265872:P10Q	P	+	2	0	CCAR1	70152296	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	6.205000	0.72148	2.824000	0.97209	0.655000	0.94253	CCG	CCAR1	-	NULL	ENSG00000060339		0.418	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	-	0.00	73	0	C	NM_018237		70482290	+1	tier1	-	no_errors	ENST00000265872	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	A
CCDC102A	92922	genome.wustl.edu	37	16	57559951	57559951	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:57559951G>A	ENST00000258214.2	-	3	920	c.674C>T	c.(673-675)cCg>cTg	p.P225L		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	225										endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						GCTGCCCCGCGGGCCCCCAGC	0.711																																																	0													13.0	14.0	14.0					16																	57559951		2194	4281	6475	SO:0001583	missense	0			BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.674C>T	16.37:g.57559951G>A	ENSP00000258214:p.Pro225Leu		Q9BT74	Missense_Mutation	SNP	NULL	p.P225L	ENST00000258214.2	37	c.674	CCDS10784.1	16	.	.	.	.	.	.	.	.	.	.	g	1.684	-0.505650	0.04261	.	.	ENSG00000135736	ENST00000258214	T	0.44083	0.93	5.47	0.694	0.18062	.	1.222320	0.05668	N	0.588158	T	0.20088	0.0483	N	0.03115	-0.41	0.09310	N	0.999997	B	0.06786	0.001	B	0.06405	0.002	T	0.20240	-1.0281	10	0.25751	T	0.34	0.1619	6.7694	0.23585	0.2776:0.1334:0.589:0.0	.	225	Q96A19	C102A_HUMAN	L	225	ENSP00000258214:P225L	ENSP00000258214:P225L	P	-	2	0	CCDC102A	56117452	0.000000	0.05858	0.000000	0.03702	0.182000	0.23217	0.558000	0.23469	0.263000	0.21812	-0.349000	0.07799	CCG	CCDC102A	-	NULL	ENSG00000135736		0.711	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC102A	HGNC	protein_coding	OTTHUMT00000257348.1	-	0.00	56	0	G	NM_033212		57559951	-1	tier1	-	no_errors	ENST00000258214	ensembl	human	known	74_37	missense	25.00	45	15	SNP	0.000	A
CCDC170	80129	genome.wustl.edu	37	6	151894421	151894421	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:151894421G>T	ENST00000239374.7	+	6	986	c.887G>T	c.(886-888)aGc>aTc	p.S296I	CCDC170_ENST00000367290.5_Missense_Mutation_p.S296I	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	296																	CAGGAAGTGAGCCTCCTGAAG	0.478																																																	0													70.0	73.0	72.0					6																	151894421		1962	4157	6119	SO:0001583	missense	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.887G>T	6.37:g.151894421G>T	ENSP00000239374:p.Ser296Ile		Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.S296I	ENST00000239374.7	37	c.887	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	G	9.173	1.021692	0.19433	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.12774	2.65;2.65	5.46	-0.633	0.11519	.	0.567823	0.20989	N	0.082071	T	0.04003	0.0112	L	0.53249	1.67	0.09310	N	1	P	0.46706	0.883	B	0.42771	0.397	T	0.29518	-1.0009	10	0.40728	T	0.16	-1.2202	2.2615	0.04068	0.349:0.114:0.4201:0.117	.	296	Q8IYT3	CF097_HUMAN	I	296	ENSP00000239374:S296I;ENSP00000356259:S296I	ENSP00000239374:S296I	S	+	2	0	C6orf97	151936114	0.153000	0.22777	0.038000	0.18304	0.131000	0.20780	0.325000	0.19628	-0.360000	0.08138	-0.874000	0.02982	AGC	CCDC170	-	NULL	ENSG00000120262		0.478	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	-	0.00	76	0	G	NM_025059		151894421	+1	tier1	-	no_errors	ENST00000367290	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.020	T
CCDC180	100499483	genome.wustl.edu	37	9	100077199	100077199	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:100077199G>T	ENST00000357054.1	+	22	2250	c.1315G>T	c.(1315-1317)Gtg>Ttg	p.V439L	CCDC180_ENST00000395220.1_Missense_Mutation_p.V439L|CCDC180_ENST00000375202.2_Missense_Mutation_p.V300L|CCDC180_ENST00000411667.2_Missense_Mutation_p.V297L|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.V300L|CCDC180_ENST00000460482.2_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	439						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GCGGCCCGAAGTGTACAGGCT	0.502																																																	0													83.0	79.0	80.0					9																	100077199		2203	4300	6503	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1315G>T	9.37:g.100077199G>T	ENSP00000349562:p.Val439Leu		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.V300L	ENST00000357054.1	37	c.898		9	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073556	0.36566	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	5.85	4.94	0.65067	.	0.255709	0.31566	N	0.007440	T	0.51227	0.1662	M	0.77103	2.36	0.26655	N	0.972017	D;D;D;D	0.89917	1.0;0.99;0.999;0.99	D;P;D;D	0.80764	0.994;0.87;0.938;0.909	T	0.43988	-0.9357	10	0.18276	T	0.48	-26.5272	11.5058	0.50466	0.086:0.0:0.914:0.0	.	297;439;300;439	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	L	439;439;300;297;323;300	ENSP00000349562:V439L;ENSP00000378646:V439L;ENSP00000364348:V300L;ENSP00000414000:V297L;ENSP00000434727:V300L	ENSP00000349562:V439L	V	+	1	0	C9orf174	99117020	0.993000	0.37304	0.925000	0.36789	0.021000	0.10359	1.996000	0.40776	2.941000	0.99782	0.655000	0.94253	GTG	CCDC180	-	NULL	ENSG00000197816		0.502	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	HGNC	protein_coding		-	0.00	46	0	G	NM_020893		100077199	+1	tier1	-	no_errors	ENST00000375202	ensembl	human	known	74_37	missense	7.69	47	4	SNP	0.726	T
CCDC3	83643	genome.wustl.edu	37	10	12940592	12940592	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:12940592G>T	ENST00000378825.3	-	3	763	c.637C>A	c.(637-639)Cgc>Agc	p.R213S	CCDC3_ENST00000378839.1_Missense_Mutation_p.R88S	NM_031455.3	NP_113643.1	Q9BQI4	CCDC3_HUMAN	coiled-coil domain containing 3	213						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	11		Ovarian(717;0.0822)	BRCA - Breast invasive adenocarcinoma(52;0.163)			TGCCGGTTGCGCTTCTCCAGG	0.607																																																	0													78.0	72.0	74.0					10																	12940592		2203	4300	6503	SO:0001583	missense	0			BC051334	CCDS7093.1, CCDS60484.1	10p14	2004-02-13			ENSG00000151468	ENSG00000151468			23813	protein-coding gene	gene with protein product							Standard	NM_031455		Approved	DKFZp761F241	uc001ilq.1	Q9BQI4	OTTHUMG00000017689	ENST00000378825.3:c.637C>A	10.37:g.12940592G>T	ENSP00000368102:p.Arg213Ser		Q5VYV8|Q5VYV9	Missense_Mutation	SNP	NULL	p.R213S	ENST00000378825.3	37	c.637	CCDS7093.1	10	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889344	0.72524	.	.	ENSG00000151468	ENST00000378839;ENST00000378825	T	0.18016	2.24	5.42	4.51	0.55191	.	0.060742	0.64402	D	0.000010	T	0.24736	0.0600	L	0.57536	1.79	0.33812	D	0.627959	P	0.49253	0.921	P	0.46275	0.51	T	0.43196	-0.9406	10	0.59425	D	0.04	-22.2928	14.6982	0.69136	0.0:0.0:0.8541:0.1458	.	213	Q9BQI4	CCDC3_HUMAN	S	88;213	ENSP00000368116:R88S	ENSP00000368102:R213S	R	-	1	0	CCDC3	12980598	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	2.560000	0.45896	1.282000	0.44496	0.561000	0.74099	CGC	CCDC3	-	NULL	ENSG00000151468		0.607	CCDC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC3	HGNC	protein_coding	OTTHUMT00000046829.1	-	0.00	44	0	G	NM_031455		12940592	-1	tier1	-	no_errors	ENST00000378825	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.997	T
CCDC64B	146439	genome.wustl.edu	37	16	3078433	3078433	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:3078433C>T	ENST00000572449.1	-	9	1337	c.1275G>A	c.(1273-1275)tcG>tcA	p.S425S	CCDC64B_ENST00000573514.1_Silent_p.S218S|CCDC64B_ENST00000389347.4_Silent_p.S425S			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	425										breast(1)|endometrium(2)|large_intestine(1)	4						CTCGCTCCAGCGAGACGCGGT	0.721																																																	0													4.0	5.0	5.0					16																	3078433		1692	3748	5440	SO:0001819	synonymous_variant	0			BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.1275G>A	16.37:g.3078433C>T			Q658L9	Silent	SNP	superfamily_Sig_transdc_His_kinase_dimeric	p.S425	ENST00000572449.1	37	c.1275	CCDS45393.1	16																																																																																			CCDC64B	-	NULL	ENSG00000162069		0.721	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC64B	HGNC	protein_coding	OTTHUMT00000436991.1	-	0.00	13	0	C			3078433	-1	tier1	-	no_errors	ENST00000389347	ensembl	human	known	74_37	silent	83.33	1	5	SNP	0.954	T
CENPV	201161	genome.wustl.edu	37	17	16256469	16256471	+	In_Frame_Del	DEL	CGG	CGG	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	CGG	CGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:16256469_16256471delCGG	ENST00000299736.4	-	1	342_344	c.280_282delCCG	c.(280-282)ccgdel	p.P94del	CENPV_ENST00000476243.1_5'UTR	NM_181716.2	NP_859067.2	Q7Z7K6	CENPV_HUMAN	centromere protein V	97	Pro-rich.				ameboidal cell migration (GO:0001667)|centromere complex assembly (GO:0034508)|mitotic nuclear division (GO:0007067)|pericentric heterochromatin assembly (GO:0031508)|positive regulation of cytokinesis (GO:0032467)|regulation of chromosome organization (GO:0033044)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle midzone (GO:0051233)	carbon-sulfur lyase activity (GO:0016846)			endometrium(1)|large_intestine(2)	3						TCGCGGGAGTcggcggcggcggc	0.773																																																	0																																										SO:0001651	inframe_deletion	0			AF514992	CCDS32575.1	17p11.2	2013-11-05	2008-10-29	2008-10-29	ENSG00000166582	ENSG00000166582			29920	protein-coding gene	gene with protein product		608139	"""proline rich 6"""	PRR6		12196509, 18772885	Standard	NM_181716		Approved	p30, CENP-V	uc002gpw.3	Q7Z7K6	OTTHUMG00000059345	ENST00000299736.4:c.280_282delCCG	17.37:g.16256478_16256480delCGG	ENSP00000299736:p.Pro94del		B2RPK2|Q3L8N5|Q8NFH6	In_Frame_Del	DEL	pfam_GFA/CENP-V,superfamily_Mss4-like	p.P94in_frame_del	ENST00000299736.4	37	c.282_280	CCDS32575.1	17																																																																																			CENPV	-	NULL	ENSG00000166582		0.773	CENPV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPV	HGNC	protein_coding	OTTHUMT00000131877.1		0.00	23	0	CGG	NM_181716		16256471	-1	tier1		no_errors	ENST00000299736	ensembl	human	known	74_37	in_frame_del	12.50	14	2	DEL	0.235:0.239:0.231	-
CDK5RAP3	80279	genome.wustl.edu	37	17	46051389	46051389	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:46051389C>T	ENST00000338399.4	+	4	383	c.277C>T	c.(277-279)Cgg>Tgg	p.R93W	CDK5RAP3_ENST00000536708.2_Missense_Mutation_p.R118W|RP11-6N17.9_ENST00000582262.1_RNA	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	93					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTCTTCACAGCGGATGAAGGC	0.522																																																	0													74.0	74.0	74.0					17																	46051389		1926	4120	6046	SO:0001583	missense	0			AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.277C>T	17.37:g.46051389C>T	ENSP00000344683:p.Arg93Trp		B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Missense_Mutation	SNP	pfam_DUF773	p.R93W	ENST00000338399.4	37	c.277	CCDS42356.1	17	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198088	0.79015	.	.	ENSG00000108465	ENST00000536708;ENST00000338399	T;T	0.64991	-0.13;-0.13	5.52	3.28	0.37604	.	0.000000	0.85682	D	0.000000	T	0.81992	0.4940	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86000	0.1494	10	0.59425	D	0.04	-15.9348	13.9256	0.63961	0.3609:0.6391:0.0:0.0	.	93	Q96JB5	CK5P3_HUMAN	W	118;93	ENSP00000438886:R118W;ENSP00000344683:R93W	ENSP00000344683:R93W	R	+	1	2	CDK5RAP3	43406388	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.428000	0.34892	1.301000	0.44836	0.655000	0.94253	CGG	CDK5RAP3	-	pfam_DUF773	ENSG00000108465		0.522	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	HGNC	protein_coding	OTTHUMT00000442913.1	-	0.00	31	0	C	NM_176096		46051389	+1	tier1	-	no_errors	ENST00000338399	ensembl	human	known	74_37	missense	8.47	54	5	SNP	1.000	T
CGN	57530	genome.wustl.edu	37	1	151506465	151506465	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:151506465G>A	ENST00000271636.7	+	15	2890	c.2757G>A	c.(2755-2757)cgG>cgA	p.R919R		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	913					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGAGGCTGCGGCAGGCCCTGC	0.632																																																	0													31.0	34.0	33.0					1																	151506465		2145	4204	6349	SO:0001819	synonymous_variant	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.2757G>A	1.37:g.151506465G>A			A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	pfam_Myosin_tail	p.R919	ENST00000271636.7	37	c.2757	CCDS999.1	1																																																																																			CGN	-	pfam_Myosin_tail	ENSG00000143375		0.632	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	-	0.00	54	0	G	NM_020770		151506465	+1	tier1	-	no_errors	ENST00000271636	ensembl	human	known	74_37	silent	8.33	55	5	SNP	1.000	A
CHFR	55743	genome.wustl.edu	37	12	133438075	133438075	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:133438075G>A	ENST00000432561.2	-	7	838	c.765C>T	c.(763-765)ccC>ccT	p.P255P	CHFR_ENST00000450056.2_Silent_p.P243P|CHFR_ENST00000443047.2_Silent_p.P163P|CHFR_ENST00000266880.7_Silent_p.P255P|CHFR_ENST00000315585.7_Silent_p.P214P|CHFR_ENST00000541837.2_5'UTR			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	255					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.P255P(1)|p.P214P(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TCTTCTTCACGGGCTCCAAAT	0.567																																																	2	Substitution - coding silent(2)	endometrium(2)											217.0	182.0	194.0					12																	133438075		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.765C>T	12.37:g.133438075G>A			A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Silent	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Znf_RING,pfscan_FHA_dom,pfscan_Znf_RING	p.P255	ENST00000432561.2	37	c.765	CCDS53849.1	12																																																																																			CHFR	-	NULL	ENSG00000072609		0.567	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CHFR	HGNC	protein_coding	OTTHUMT00000397130.2	-	0.00	100	0	G			133438075	-1	tier1	-	no_errors	ENST00000266880	ensembl	human	known	74_37	silent	40.68	70	48	SNP	0.007	A
CHML	1122	genome.wustl.edu	37	1	241798619	241798619	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:241798619G>T	ENST00000366553.1	-	1	613	c.450C>A	c.(448-450)agC>agA	p.S150R	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	150					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			GCATTTCGTCGCTATTAAAAT	0.403																																																	0													155.0	156.0	156.0					1																	241798619		2203	4299	6502	SO:0001583	missense	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.450C>A	1.37:g.241798619G>T	ENSP00000355511:p.Ser150Arg		B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.S150R	ENST00000366553.1	37	c.450	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.409263	0.01155	.	.	ENSG00000203668	ENST00000366553	T	0.54479	0.57	4.43	1.53	0.23141	.	0.944991	0.08878	N	0.880512	T	0.35885	0.0947	.	.	.	0.09310	N	1	B	0.19445	0.036	B	0.20384	0.029	T	0.26916	-1.0089	9	0.37606	T	0.19	.	4.2521	0.10700	0.2068:0.1914:0.6017:0.0	.	150	P26374	RAE2_HUMAN	R	150	ENSP00000355511:S150R	ENSP00000355511:S150R	S	-	3	2	CHML	239865242	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.123000	0.10611	0.614000	0.30107	-0.143000	0.13931	AGC	CHML	-	pirsf_Rab_geranylTrfase_A_euk	ENSG00000203668		0.403	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1		0.00	51	0	G	NM_001821		241798619	-1			no_errors	ENST00000366553	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.000	T
CILP	8483	genome.wustl.edu	37	15	65491165	65491165	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr15:65491165C>T	ENST00000261883.4	-	9	1625	c.1459G>A	c.(1459-1461)Gaa>Aaa	p.E487K		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	487					negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						CTCCGAGTTTCCGTACACCGC	0.597																																																	0													67.0	55.0	59.0					15																	65491165		2202	4299	6501	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.1459G>A	15.37:g.65491165C>T	ENSP00000261883:p.Glu487Lys		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.E487K	ENST00000261883.4	37	c.1459	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	C	8.758	0.922916	0.18056	.	.	ENSG00000138615	ENST00000261883	T	0.37235	1.21	5.95	5.04	0.67666	.	0.047834	0.85682	D	0.000000	T	0.28928	0.0718	L	0.34521	1.04	0.43439	D	0.995616	B	0.24483	0.104	B	0.21151	0.033	T	0.04065	-1.0980	10	0.30854	T	0.27	-23.8012	14.4518	0.67389	0.0:0.9297:0.0:0.0703	.	487	O75339	CILP1_HUMAN	K	487	ENSP00000261883:E487K	ENSP00000261883:E487K	E	-	1	0	CILP	63278218	0.999000	0.42202	0.902000	0.35471	0.260000	0.26232	4.070000	0.57548	1.526000	0.49068	0.655000	0.94253	GAA	CILP	-	NULL	ENSG00000138615		0.597	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1		0.00	50	0	C	NM_003613		65491165	-1			no_errors	ENST00000261883	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.998	T
CNTN2	6900	genome.wustl.edu	37	1	205033765	205033765	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:205033765C>T	ENST00000331830.4	+	12	1690	c.1406C>T	c.(1405-1407)cCa>cTa	p.P469L	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	469	Ig-like C2-type 5.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)	p.P469Q(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ACTGTAACTCCAGATGGCACC	0.522																																					Melanoma(183;2548 2817 37099 41192)												1	Substitution - Missense(1)	lung(1)											124.0	105.0	112.0					1																	205033765		2203	4300	6503	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1406C>T	1.37:g.205033765C>T	ENSP00000330633:p.Pro469Leu		P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P469L	ENST00000331830.4	37	c.1406	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356654	0.41801	.	.	ENSG00000184144	ENST00000331830	T	0.66099	-0.19	5.47	3.57	0.40892	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.739987	0.11914	N	0.517359	T	0.61274	0.2334	M	0.73217	2.22	0.44402	D	0.997317	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.58612	-0.7606	10	0.42905	T	0.14	.	11.5612	0.50778	0.0:0.8512:0.0:0.1488	.	469;360	Q02246;Q68DA2	CNTN2_HUMAN;.	L	469	ENSP00000330633:P469L	ENSP00000330633:P469L	P	+	2	0	CNTN2	203300388	0.566000	0.26618	0.841000	0.33234	0.943000	0.58893	3.025000	0.49681	1.285000	0.44548	0.561000	0.74099	CCA	CNTN2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000184144		0.522	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3		0.00	46	0	C	NM_005076		205033765	+1			no_errors	ENST00000331830	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.997	T
CNTNAP3B	728577	genome.wustl.edu	37	9	43915463	43915463	+	Silent	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:43915463G>T	ENST00000377564.3	+	22	3939	c.3546G>T	c.(3544-3546)gcG>gcT	p.A1182A	CNTNAP3B_ENST00000467854.1_3'UTR	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	1182	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						TGAAGGCGGCGCTGCGCCCCA	0.796																																																	0																																										SO:0001819	synonymous_variant	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.3546G>T	9.37:g.43915463G>T			B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.A1182	ENST00000377564.3	37	c.3546	CCDS55312.1	9																																																																																			CNTNAP3B	-	pfscan_Laminin_G	ENSG00000154529		0.796	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	-	0.00	16	0	G			43915463	+1	tier1	-	no_errors	ENST00000377564	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.975	T
CPNE2	221184	genome.wustl.edu	37	16	57153173	57153173	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:57153173C>T	ENST00000535318.2	+	7	935	c.574C>T	c.(574-576)Ctg>Ttg	p.L192L	CPNE2_ENST00000565874.1_Silent_p.L192L|CPNE2_ENST00000290776.8_Silent_p.L192L|CPNE2_ENST00000537605.1_Silent_p.L90L			Q96FN4	CPNE2_HUMAN	copine II	192	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(5)	21		all_neural(199;0.224)				CAAGTGGATGCTGGTCCACAG	0.587																																																	0													100.0	90.0	94.0					16																	57153173		2198	4300	6498	SO:0001819	synonymous_variant	0				CCDS10774.1	16q13	2008-02-05			ENSG00000140848	ENSG00000140848			2315	protein-coding gene	gene with protein product		604206				9430674	Standard	NM_152727		Approved	CPN2	uc002eks.2	Q96FN4	OTTHUMG00000133471	ENST00000535318.2:c.574C>T	16.37:g.57153173C>T			Q68D19|Q719H8|Q86XP9	Silent	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.L192	ENST00000535318.2	37	c.574	CCDS10774.1	16																																																																																			CPNE2	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000140848		0.587	CPNE2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPNE2	HGNC	protein_coding	OTTHUMT00000432986.2	-	0.00	57	0	C	NM_152727		57153173	+1	tier1	-	no_errors	ENST00000290776	ensembl	human	known	74_37	silent	5.43	87	5	SNP	1.000	T
CSGALNACT1	55790	genome.wustl.edu	37	8	19315123	19315124	+	Intron	INS	-	-	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:19315123_19315124insA	ENST00000454498.2	-	5	1865				CSGALNACT1_ENST00000311540.4_Intron|CSGALNACT1_ENST00000518542.1_5'UTR|CSGALNACT1_ENST00000522854.1_Intron|CSGALNACT1_ENST00000544602.1_Intron|CSGALNACT1_ENST00000332246.6_Intron	NM_001130518.1	NP_001123990.1	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 1						anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|endochondral ossification (GO:0001958)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|heparin biosynthetic process (GO:0030210)|nervous system development (GO:0007399)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|UDP-glucuronate metabolic process (GO:0046398)|UDP-N-acetylgalactosamine metabolic process (GO:0019276)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|intracellular (GO:0005622)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|glucuronosyltransferase activity (GO:0015020)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)|peptidoglycan glycosyltransferase activity (GO:0008955)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				Colorectal(111;0.182)		gactccatctcaaaaaaaaaga	0.411																																																	0																																										SO:0001627	intron_variant	0			AK002126	CCDS6010.1	8p21.3	2013-02-19				ENSG00000147408		"""Beta 4-glycosyltransferases"""	24290	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase"""					17145758, 12446672	Standard	NM_018371		Approved	CSGalNAcT-1, FLJ11264, ChGn	uc011kyo.2	Q8TDX6		ENST00000454498.2:c.851+812->T	8.37:g.19315132_19315132dupA			B2RBE4|Q6P9G6|Q8IUF9|Q9NSQ7|Q9NUM9	RNA	INS	-	NULL	ENST00000454498.2	37	NULL	CCDS6010.1	8																																																																																			CSGALNACT1	-	-	ENSG00000147408		0.411	CSGALNACT1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CSGALNACT1	HGNC	protein_coding	OTTHUMT00000375204.1		0.00	11	0	-	NM_018371		19315124	-1	tier1		no_errors	ENST00000518542	ensembl	human	known	74_37	rna	25.00	9	3	INS	0.004:0.009	A
CPQ	10404	genome.wustl.edu	37	8	98155409	98155409	+	Nonstop_Mutation	SNP	T	T	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:98155409T>C	ENST00000220763.5	+	8	1627	c.1417T>C	c.(1417-1419)Tag>Cag	p.*473Q	KB-1958F4.1_ENST00000602771.1_RNA	NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	0					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GCCTAGGTCCTAGAAACAGTA	0.423																																																	0													128.0	120.0	123.0					8																	98155409		2203	4300	6503	SO:0001578	stop_lost	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.1417T>C	8.37:g.98155409T>C	ENSP00000220763:p.*473Glnext*3		B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Nonstop_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.*473Q	ENST00000220763.5	37	c.1417	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	T	13.75	2.331663	0.41297	.	.	ENSG00000104324	ENST00000220763	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.4462	15.2168	0.73274	0.0:0.0:0.0:1.0	.	.	.	.	Q	473	.	.	X	+	1	0	AC010859.1	98224585	0.963000	0.33076	0.075000	0.20258	0.313000	0.28021	2.460000	0.45031	2.187000	0.69744	0.528000	0.53228	TAG	CPQ	-	NULL	ENSG00000104324		0.423	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	-	0.00	126	0	T	NM_016134		98155409	+1	tier1	-	no_errors	ENST00000220763	ensembl	human	known	74_37	nonstop	29.79	99	42	SNP	0.147	C
CTNNA1	1495	genome.wustl.edu	37	5	138261083	138261083	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:138261083T>A	ENST00000302763.7	+	13	1976	c.1886T>A	c.(1885-1887)gTg>gAg	p.V629E	CTNNA1_ENST00000355078.5_Missense_Mutation_p.V526E|CTNNA1_ENST00000518825.1_Missense_Mutation_p.V629E|CTNNA1_ENST00000540387.1_Missense_Mutation_p.V259E	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	629					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGGAAAGCAGTGCTGATGATA	0.483																																																	0													102.0	93.0	96.0					5																	138261083		2203	4300	6503	SO:0001583	missense	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1886T>A	5.37:g.138261083T>A	ENSP00000304669:p.Val629Glu		Q12795|Q8N1C0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.V629E	ENST00000302763.7	37	c.1886	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	T	27.2	4.807913	0.90623	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	6.06	6.06	0.98353	.	0.123947	0.53938	D	0.000044	T	0.60728	0.2291	M	0.78049	2.395	0.80722	D	1	D;P;P	0.61697	0.99;0.894;0.716	D;D;P	0.66979	0.948;0.922;0.887	T	0.64782	-0.6326	10	0.72032	D	0.01	-20.104	14.8391	0.70209	0.0:0.0:0.0:1.0	.	629;506;629	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	E	526;629;629;614;629;259	ENSP00000347190:V526E;ENSP00000304669:V629E;ENSP00000427821:V629E;ENSP00000438476:V259E	ENSP00000304669:V629E	V	+	2	0	CTNNA1	138288982	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.990000	0.88215	2.324000	0.78689	0.533000	0.62120	GTG	CTNNA1	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	ENSG00000044115		0.483	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	-	0.00	68	0	T	NM_001903		138261083	+1	tier1	-	no_errors	ENST00000302763	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
CTTNBP2NL	55917	genome.wustl.edu	37	1	112958899	112958899	+	Intron	DEL	A	A	-	rs370406156		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:112958899delA	ENST00000271277.6	+	3	324					NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like						negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTTAAAAGAAAAAAAAAAA	0.323																																																	0													38.0	42.0	40.0					1																	112958899		2199	4299	6498	SO:0001627	intron_variant	0			AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.99+13A>-	1.37:g.112958899delA			B3KMS5|Q96B40	RNA	DEL	-	NULL	ENST00000271277.6	37	NULL	CCDS845.1	1																																																																																			CTTNBP2NL	-	-	ENSG00000143079		0.323	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	HGNC	protein_coding	OTTHUMT00000030686.1		0.00	34	0	A	NM_018704		112958899	+1	tier1		no_errors	ENST00000502356	ensembl	human	known	74_37	rna	16.67	35	7	DEL	0.000	-
RTP5	285093	genome.wustl.edu	37	2	242815165	242815165	+	Silent	SNP	C	C	T	rs369380323	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:242815165C>T	ENST00000343216.3	+	2	1486	c.1458C>T	c.(1456-1458)ggC>ggT	p.G486G		NM_173821.2	NP_776182.2																					AGCGCAAGGGCGGTGGCCACG	0.622																																																	0													68.0	80.0	76.0					2																	242815165		2084	4198	6282	SO:0001819	synonymous_variant	0																														ENST00000343216.3:c.1458C>T	2.37:g.242815165C>T				Silent	SNP	NULL	p.G486	ENST00000343216.3	37	c.1458	CCDS42843.1	2																																																																																			CXXC11	-	NULL	ENSG00000188011		0.622	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1	-	0.00	99	0	C			242815165	+1	tier1	-	no_errors	ENST00000343216	ensembl	human	known	74_37	silent	20.56	85	22	SNP	0.001	T
CXorf30	645090	genome.wustl.edu	37	X	36324886	36324886	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:36324886G>T	ENST00000378657.4	+	9	1068		c.e9-1			NM_001098843.4	NP_001092313.2	A6PW82	CX030_HUMAN	chromosome X open reading frame 30											breast(1)|lung(2)|stomach(1)	4						CATTTACACAGCTGATCATAT	0.403																																																	0													237.0	152.0	178.0					X																	36324886		692	1591	2283	SO:0001630	splice_region_variant	0				CCDS55396.1	Xp21.1	2014-08-07			ENSG00000205081	ENSG00000205081			27298	protein-coding gene	gene with protein product							Standard	NM_001098843		Approved		uc011mkc.3	A6PW82	OTTHUMG00000021353	ENST00000378657.4:c.421-1G>T	X.37:g.36324886G>T				Splice_Site	SNP	-	e5-1	ENST00000378657.4	37	c.421-1	CCDS55396.1	X	.	.	.	.	.	.	.	.	.	.	G	9.130	1.011188	0.19277	.	.	ENSG00000205081	ENST00000378653;ENST00000378657	.	.	.	4.92	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4809	0.50324	0.091:0.0:0.909:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CXorf30	36234807	1.000000	0.71417	0.066000	0.19879	0.239000	0.25481	5.256000	0.65468	0.977000	0.38444	0.600000	0.82982	.	CXorf30	-	-	ENSG00000205081		0.403	CXorf30-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf30	HGNC	protein_coding			0.00	28	0	G	NP_001092313	Intron	36324886	+1			no_errors	ENST00000378657	ensembl	human	known	74_37	splice_site	5.80	65	4	SNP	0.625	T
DAGLB	221955	genome.wustl.edu	37	7	6464413	6464413	+	Silent	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:6464413C>A	ENST00000297056.6	-	8	1279	c.1110G>T	c.(1108-1110)gtG>gtT	p.V370V	DAGLB_ENST00000428902.2_Silent_p.V243V|DAGLB_ENST00000425398.2_Silent_p.V241V|DAGLB_ENST00000421761.2_Silent_p.V114V|DAGLB_ENST00000436575.1_Silent_p.V329V	NM_139179.3	NP_631918.3	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta	370					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|lipid catabolic process (GO:0016042)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|urinary_tract(2)	26		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)		TCACAGCGACCACAACAGACT	0.577																																																	0													137.0	116.0	123.0					7																	6464413		2203	4300	6503	SO:0001819	synonymous_variant	0			AF450090	CCDS5350.1, CCDS47536.1	7p22.1	2008-03-18			ENSG00000164535	ENSG00000164535	3.1.1.-		28923	protein-coding gene	gene with protein product		614016					Standard	NM_139179		Approved	KCCR13L, DAGLBETA	uc003sqa.3	Q8NCG7	OTTHUMG00000125513	ENST00000297056.6:c.1110G>T	7.37:g.6464413C>A			A4D2P3|B3KV90|B4DQU0|Q6PIX3|Q8N2N2|Q8N9S1|Q8TED3|Q8WXE6	Silent	SNP	pfam_Lipase_3	p.V370	ENST00000297056.6	37	c.1110	CCDS5350.1	7																																																																																			DAGLB	-	pfam_Lipase_3	ENSG00000164535		0.577	DAGLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLB	HGNC	protein_coding	OTTHUMT00000246840.2	-	0.00	31	0	C	NM_139179		6464413	-1	tier1	-	no_errors	ENST00000297056	ensembl	human	known	74_37	silent	11.76	30	4	SNP	1.000	A
DAPP1	27071	genome.wustl.edu	37	4	100774455	100774455	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:100774455G>T	ENST00000512369.1	+	4	507	c.439G>T	c.(439-441)Gca>Tca	p.A147S	DAPP1_ENST00000296414.7_Missense_Mutation_p.A147S	NM_014395.2	NP_055210.2	Q9UN19	DAPP1_HUMAN	dual adaptor of phosphotyrosine and 3-phosphoinositides	147					protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(123;7.04e-09)		GGTTCACACAGCAATGCAGAC	0.443																																																	0													86.0	83.0	84.0					4																	100774455		1940	4138	6078	SO:0001583	missense	0			AF186022	CCDS47112.1	4q25-q27	2013-02-14			ENSG00000070190	ENSG00000070190		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	16500	protein-coding gene	gene with protein product		605768				10432293	Standard	NM_014395		Approved	BAM32	uc003hvf.4	Q9UN19	OTTHUMG00000160974	ENST00000512369.1:c.439G>T	4.37:g.100774455G>T	ENSP00000423602:p.Ala147Ser		Q8TCK5|Q9UHF2	Missense_Mutation	SNP	pfam_SH2,pfam_Pleckstrin_homology,smart_SH2,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH2,prints_SH2	p.A147S	ENST00000512369.1	37	c.439	CCDS47112.1	4	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871368	0.51695	.	.	ENSG00000070190	ENST00000296414;ENST00000512369	T;T	0.71698	-0.59;-0.53	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.48352	0.1495	N	0.11560	0.145	0.58432	D	0.999999	B;B	0.33637	0.42;0.349	B;B	0.25614	0.061;0.062	T	0.52208	-0.8606	10	0.09084	T	0.74	-15.8749	17.7024	0.88299	0.0:0.0:1.0:0.0	.	147;147	Q9UN19-2;Q9UN19	.;DAPP1_HUMAN	S	147	ENSP00000296414:A147S;ENSP00000423602:A147S	ENSP00000296414:A147S	A	+	1	0	DAPP1	100993478	1.000000	0.71417	0.763000	0.31416	0.524000	0.34500	8.613000	0.90913	2.466000	0.83321	0.563000	0.77884	GCA	DAPP1	-	NULL	ENSG00000070190		0.443	DAPP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAPP1	HGNC	protein_coding	OTTHUMT00000363215.1		0.00	69	0	G			100774455	+1			no_errors	ENST00000512369	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.999	T
DCLK3	85443	genome.wustl.edu	37	3	36779753	36779753	+	Missense_Mutation	SNP	G	G	A	rs201773927	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:36779753G>A	ENST00000416516.2	-	2	888	c.398C>T	c.(397-399)tCg>tTg	p.S133L		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	133						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						AATTTCACCCGAGGTCTTTTC	0.567																																																	0								G	LEU/SER	1,3755		0,1,1877	143.0	143.0	143.0		398	3.8	0.9	3		143	10,8220		0,10,4105	yes	missense	DCLK3	NM_033403.1	145	0,11,5982	AA,AG,GG		0.1215,0.0266,0.0918	probably-damaging	133/649	36779753	11,11975	1878	4115	5993	SO:0001583	missense	0			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.398C>T	3.37:g.36779753G>A	ENSP00000394484:p.Ser133Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S133L	ENST00000416516.2	37	c.398	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856277	0.32791	2.66E-4	0.001215	ENSG00000163673	ENST00000416516	T	0.69306	-0.39	4.7	3.83	0.44106	.	0.317189	0.17680	N	0.165651	T	0.51500	0.1678	L	0.34521	1.04	0.09310	N	1	B	0.28470	0.213	B	0.15052	0.012	T	0.46091	-0.9216	10	0.51188	T	0.08	.	9.5159	0.39104	0.164:0.0:0.836:0.0	.	133	Q9C098	DCLK3_HUMAN	L	133	ENSP00000394484:S133L	ENSP00000394484:S133L	S	-	2	0	DCLK3	36754757	0.941000	0.31946	0.912000	0.35992	0.790000	0.44656	2.975000	0.49281	1.134000	0.42165	-0.122000	0.15005	TCG	DCLK3	-	NULL	ENSG00000163673		0.567	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	HGNC	protein_coding	OTTHUMT00000341727.1	-	0.00	58	0	G	XM_047355		36779753	-1	tier1	rs201773927	no_errors	ENST00000416516	ensembl	human	known	74_37	missense	34.69	32	17	SNP	0.068	A
DENND2A	27147	genome.wustl.edu	37	7	140269504	140269504	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:140269504C>T	ENST00000275884.6	-	6	1898	c.1481G>A	c.(1480-1482)cGg>cAg	p.R494Q	DENND2A_ENST00000492720.1_Missense_Mutation_p.R494Q|DENND2A_ENST00000537639.1_Missense_Mutation_p.R494Q|DENND2A_ENST00000496613.1_Missense_Mutation_p.R494Q			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	494					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					CTTTCCTCTCCGGACCTCATA	0.567																																																	0													137.0	138.0	137.0					7																	140269504		1950	4161	6111	SO:0001583	missense	0			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1481G>A	7.37:g.140269504C>T	ENSP00000275884:p.Arg494Gln		C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R494Q	ENST00000275884.6	37	c.1481	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677300	0.88445	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.12672	3.37;3.37;3.37;2.66	4.74	4.74	0.60224	.	0.081588	0.50627	N	0.000106	T	0.32285	0.0824	L	0.46157	1.445	0.54753	D	0.999986	D;P	0.89917	1.0;0.906	D;B	0.79108	0.992;0.259	T	0.05632	-1.0873	10	0.72032	D	0.01	-19.0906	17.7358	0.88392	0.0:1.0:0.0:0.0	.	494;494	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	Q	494	ENSP00000275884:R494Q;ENSP00000442245:R494Q;ENSP00000419654:R494Q;ENSP00000419464:R494Q	ENSP00000275884:R494Q	R	-	2	0	DENND2A	139915973	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.424000	0.66464	2.184000	0.69523	0.462000	0.41574	CGG	DENND2A	-	NULL	ENSG00000146966		0.567	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1	-	0.00	77	0	C	NM_015689		140269504	-1	tier1	-	no_errors	ENST00000275884	ensembl	human	known	74_37	missense	6.10	77	5	SNP	1.000	T
DHX32	55760	genome.wustl.edu	37	10	127555659	127555659	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:127555659G>C	ENST00000284690.3	-	2	866	c.376C>G	c.(376-378)Ctc>Gtc	p.L126V	DHX32_ENST00000284688.6_Missense_Mutation_p.L126V	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	126	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				CGCAGGGCGAGCTGGACCACA	0.527																																																	0													126.0	105.0	112.0					10																	127555659		2203	4300	6503	SO:0001583	missense	0				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.376C>G	10.37:g.127555659G>C	ENSP00000284690:p.Leu126Val		A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.L126V	ENST00000284690.3	37	c.376	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	G	12.01	1.808723	0.31961	.	.	ENSG00000089876	ENST00000284690;ENST00000284688	T;T	0.30714	1.52;1.52	5.53	5.53	0.82687	DEAD-like helicase (1);	0.000000	0.85682	D	0.000000	T	0.44307	0.1287	N	0.21373	0.66	0.36595	D	0.87432	D	0.76494	0.999	D	0.80764	0.994	T	0.51710	-0.8671	10	0.87932	D	0	-26.0064	18.6399	0.91392	0.0:0.0:1.0:0.0	.	126	Q7L7V1	DHX32_HUMAN	V	126	ENSP00000284690:L126V;ENSP00000284688:L126V	ENSP00000284688:L126V	L	-	1	0	DHX32	127545649	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.423000	0.66458	2.871000	0.98454	0.655000	0.94253	CTC	DHX32	-	superfamily_P-loop_NTPase,pfscan_Helicase_ATP-bd	ENSG00000089876		0.527	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	HGNC	protein_coding	OTTHUMT00000050945.2		0.00	72	0	G	NM_018180		127555659	-1			no_errors	ENST00000284690	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	C
DMAP1	55929	genome.wustl.edu	37	1	44680151	44680151	+	Intron	SNP	C	C	T	rs113724198		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:44680151C>T	ENST00000372289.2	+	2	460				DMAP1_ENST00000361745.6_Intron|DMAP1_ENST00000315913.5_Intron	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1						chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					GGTTTTGGCCCCTGATTCACC	0.537																																																	0													54.0	58.0	57.0					1																	44680151		2203	4300	6503	SO:0001627	intron_variant	0			AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.197+38C>T	1.37:g.44680151C>T			A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	RNA	SNP	-	NULL	ENST00000372289.2	37	NULL	CCDS509.1	1																																																																																			DMAP1	-	-	ENSG00000178028		0.537	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DMAP1	HGNC	protein_coding	OTTHUMT00000020027.3	-	0.00	117	0	C	NM_019100		44680151	+1	tier1	-	no_errors	ENST00000463950	ensembl	human	known	74_37	rna	17.31	86	18	SNP	0.056	T
DMD	1756	genome.wustl.edu	37	X	31341748	31341748	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:31341748G>A	ENST00000357033.4	-	62	9397	c.9191C>T	c.(9190-9192)gCc>gTc	p.A3064V	DMD_ENST00000343523.2_Missense_Mutation_p.A604V|DMD_ENST00000541735.1_Missense_Mutation_p.A604V|DMD_ENST00000474231.1_Missense_Mutation_p.A604V|DMD_ENST00000378707.3_Missense_Mutation_p.A604V|DMD_ENST00000359836.1_Missense_Mutation_p.A604V|DMD_ENST00000378677.2_Missense_Mutation_p.A3060V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	3064	Interaction with SYNM. {ECO:0000250}.|WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGGCGAGATGGCTCTCTCCCA	0.408																																																	0													79.0	66.0	71.0					X																	31341748		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.9191C>T	X.37:g.31341748G>A	ENSP00000354923:p.Ala3064Val		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.A3064V	ENST00000357033.4	37	c.9191	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	20.8	4.053438	0.75960	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000358062;ENST00000378677;ENST00000357033;ENST00000359836;ENST00000343523;ENST00000542849;ENST00000535280;ENST00000378707;ENST00000541735;ENST00000474231	D;D;D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	5.49	5.49	0.81192	WW/Rsp5/WWP (6);	0.000000	0.34603	U	0.003833	D	0.89522	0.6739	M	0.75085	2.285	0.51012	D	0.999902	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;0.98;0.98;0.996;0.996;0.996;0.981;0.976;0.999	D;D;D;P;P;D;D;D;P;B;D	0.78314	0.979;0.991;0.991;0.663;0.663;0.911;0.916;0.916;0.514;0.379;0.95	D	0.89228	0.3575	9	.	.	.	.	18.6129	0.91293	0.0:0.0:1.0:0.0	.	3056;3064;3060;1723;1720;604;604;604;604;604;2941	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6;F8VX32;E7ESB2;E7EQS5;E7EQR9;F5GZY3;F5GZT3	.;DMD_HUMAN;.;.;.;.;.;.;.;.;.	V	3056;1723;1720;760;3060;3064;604;604;3064;2941;604;604;604	ENSP00000350765:A760V;ENSP00000367948:A3060V;ENSP00000354923:A3064V;ENSP00000352894:A604V;ENSP00000340057:A604V;ENSP00000367979:A604V;ENSP00000444119:A604V;ENSP00000417123:A604V	.	A	-	2	0	DMD	31251669	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.004000	0.76317	2.426000	0.82243	0.600000	0.82982	GCC	DMD	-	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pirsf_Dystrophin/utrophin,pfscan_WW_dom	ENSG00000198947		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	66	0	G	NM_004006		31341748	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
DNAH10	196385	genome.wustl.edu	37	12	124337760	124337760	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:124337760C>T	ENST00000409039.3	+	35	5970	c.5945C>T	c.(5944-5946)gCg>gTg	p.A1982V		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1982	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGACTCTGGCGAAAAAGATG	0.403																																																	0													34.0	32.0	33.0					12																	124337760		1859	4092	5951	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5945C>T	12.37:g.124337760C>T	ENSP00000386770:p.Ala1982Val		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.A1982V	ENST00000409039.3	37	c.5945	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	18.17	3.563444	0.65651	.	.	ENSG00000197653	ENST00000409039	T	0.14022	2.54	5.7	4.81	0.61882	.	0.224065	0.36854	U	0.002377	T	0.53206	0.1782	H	0.97465	4.01	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	T	0.71951	-0.4437	10	0.87932	D	0	.	14.8368	0.70190	0.0:0.9311:0.0:0.0689	.	1982	Q8IVF4	DYH10_HUMAN	V	1982	ENSP00000386770:A1982V	ENSP00000386770:A1982V	A	+	2	0	DNAH10	122903713	1.000000	0.71417	0.999000	0.59377	0.110000	0.19582	7.805000	0.86005	1.406000	0.46857	0.655000	0.94253	GCG	DNAH10	-	superfamily_P-loop_NTPase	ENSG00000197653		0.403	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	100	0	C			124337760	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	33.93	74	38	SNP	1.000	T
DNAJC24	120526	genome.wustl.edu	37	11	31436406	31436406	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:31436406G>T	ENST00000465995.1	+	3	266	c.160G>T	c.(160-162)Gaa>Taa	p.E54*	DNAJC24_ENST00000536040.1_Nonsense_Mutation_p.E53*	NM_181706.4	NP_859057.4	Q6P3W2	DJC24_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 24	53	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone-mediated protein folding (GO:0061077)|oxidation-reduction process (GO:0055114)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|positive regulation of ATPase activity (GO:0032781)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATPase activator activity (GO:0001671)|ferrous iron binding (GO:0008198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|skin(1)|upper_aerodigestive_tract(2)	11						AACAGTGGAGGAATGTGTACA	0.448																																																	0													102.0	100.0	101.0					11																	31436406		1944	4157	6101	SO:0001587	stop_gained	0			AL833128	CCDS7873.2	11p14.1	2011-09-02	2008-07-03	2008-07-03	ENSG00000170946	ENSG00000170946		"""Heat shock proteins / DNAJ (HSP40)"""	26979	protein-coding gene	gene with protein product		611072	"""zinc finger, CSL-type containing 3"", ""DPH4 homolog (JJJ3, S. cerevisiae)"", ""DPH4, JJJ3 homolog (S. cerevisiae)"""	ZCSL3, DPH4		15485916	Standard	NM_181706		Approved	JJJ3	uc001msx.3	Q6P3W2	OTTHUMG00000133712	ENST00000465995.1:c.160G>T	11.37:g.31436406G>T	ENSP00000417548:p.Glu54*		A8K0V0|B1ALC1|I6L9B4	Nonsense_Mutation	SNP	pfam_DnaJ_domain,pfam_Znf_DHP,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_Znf_DHP,pfscan_DnaJ_domain,prints_DnaJ_domain	p.E54*	ENST00000465995.1	37	c.160	CCDS7873.2	11	.	.	.	.	.	.	.	.	.	.	G	6.080	0.383088	0.11524	.	.	ENSG00000170946	ENST00000465995;ENST00000536040	.	.	.	6.17	4.22	0.49857	.	0.240776	0.43579	D	0.000548	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	11.4471	0.50129	0.0704:0.1239:0.8057:0.0	.	.	.	.	X	54;53	.	ENSP00000417548:E54X	E	+	1	0	DNAJC24	31392982	1.000000	0.71417	0.924000	0.36721	0.000000	0.00434	3.769000	0.55303	0.850000	0.35239	-1.058000	0.02302	GAA	DNAJC24	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain,prints_DnaJ_domain	ENSG00000170946		0.448	DNAJC24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC24	HGNC	protein_coding	OTTHUMT00000258011.3	-	0.00	63	0	G	NM_181706		31436406	+1	tier1	-	no_errors	ENST00000465995	ensembl	human	known	74_37	nonsense	30.77	63	28	SNP	0.997	T
DOCK4	9732	genome.wustl.edu	37	7	111407142	111407142	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:111407142C>A	ENST00000437633.1	-	37	4090	c.3834G>T	c.(3832-3834)aaG>aaT	p.K1278N	DOCK4_ENST00000494651.2_Missense_Mutation_p.K161N|DOCK4_ENST00000428084.1_Missense_Mutation_p.K1287N	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1278	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				GCTCTGCAATCTTCCGGCACA	0.453																																																	0													182.0	177.0	179.0					7																	111407142		1960	4157	6117	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.3834G>T	7.37:g.111407142C>A	ENSP00000404179:p.Lys1278Asn		O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH3_domain,pfscan_SH3_domain	p.K1287N	ENST00000437633.1	37	c.3861	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.0|21.0	4.083600|4.083600	0.76642|0.76642	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288;ENST00000437129;ENST00000450156|ENST00000423057;ENST00000445943	T;T;T;T;T|.	0.45276|.	4.08;3.35;4.09;0.91;0.9|.	5.53|5.53	5.53|5.53	0.82687|0.82687	.|.	0.044644|.	0.85682|.	D|.	0.000000|.	T|T	0.52645|0.52645	0.1747|0.1747	L|L	0.27053|0.27053	0.805|0.805	0.51767|0.51767	D|D	0.999938|0.999938	B;P;B;B;P|.	0.35139|.	0.228;0.486;0.354;0.354;0.486|.	B;B;B;B;B|.	0.38225|.	0.063;0.268;0.179;0.063;0.199|.	T|T	0.43988|0.43988	-0.9357|-0.9357	10|5	0.72032|.	D|.	0.01|.	.|.	13.3014|13.3014	0.60328|0.60328	0.0:0.919:0.0:0.081|0.0:0.919:0.0:0.081	.|.	185;161;1323;1278;1287|.	B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2|.	.;.;.;DOCK4_HUMAN;.|.	N|I	1266;1287;161;1278;1275;152;161|739;1311	ENSP00000410746:K1287N;ENSP00000440944:K161N;ENSP00000404179:K1278N;ENSP00000406298:K152N;ENSP00000406468:K161N|.	ENSP00000345432:K1275N|.	K|R	-|-	3|2	2|0	DOCK4|DOCK4	111194378|111194378	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.641000|3.641000	0.54360|0.54360	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	AAG|AGA	DOCK4	-	NULL	ENSG00000128512		0.453	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	-	0.00	50	0	C	NM_014705		111407142	-1	tier1	-	no_errors	ENST00000428084	ensembl	human	known	74_37	missense	16.67	25	5	SNP	1.000	A
DPY19L2	283417	genome.wustl.edu	37	12	63963039	63963040	+	Frame_Shift_Del	DEL	AT	AT	-	rs145607894		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:63963039_63963040delAT	ENST00000324472.4	-	21	2273_2274	c.2090_2091delAT	c.(2089-2091)tatfs	p.Y697fs	DPY19L2_ENST00000413230.2_Frame_Shift_Del_p.Y144fs	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	697					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		CTTCTAAAACATAATAATTCAC	0.307																																																	0																																										SO:0001589	frameshift_variant	0				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.2090_2091delAT	12.37:g.63963039_63963040delAT	ENSP00000315988:p.Tyr697fs		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Frame_Shift_Del	DEL	pfam_Dpy-19	p.Y697fs	ENST00000324472.4	37	c.2091_2090	CCDS31851.1	12																																																																																			DPY19L2	-	pfam_Dpy-19	ENSG00000177990		0.307	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2		0.00	172	0	AT	NM_173812		63963040	-1	tier1		no_errors	ENST00000324472	ensembl	human	known	74_37	frame_shift_del	25.13	149	50	DEL	0.987:0.997	-
DTNA	1837	genome.wustl.edu	37	18	32431858	32431858	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr18:32431858A>T	ENST00000399113.3	+	14	1417	c.1417A>T	c.(1417-1419)Agg>Tgg	p.R473W	DTNA_ENST00000399121.5_Missense_Mutation_p.R413W|DTNA_ENST00000269190.7_Missense_Mutation_p.R474W|DTNA_ENST00000283365.9_Missense_Mutation_p.R416W|DTNA_ENST00000597599.1_Missense_Mutation_p.R413W|DTNA_ENST00000269192.7_Missense_Mutation_p.R182W|DTNA_ENST00000597674.1_Missense_Mutation_p.R95W|DTNA_ENST00000556414.3_Missense_Mutation_p.R125W|DTNA_ENST00000598142.1_Missense_Mutation_p.R416W|DTNA_ENST00000595022.1_Missense_Mutation_p.R413W|DTNA_ENST00000596745.1_Missense_Mutation_p.R223W|DTNA_ENST00000601125.1_Missense_Mutation_p.R95W|DTNA_ENST00000444659.1_Missense_Mutation_p.R473W|DTNA_ENST00000599844.1_Missense_Mutation_p.R95W|DTNA_ENST00000269191.6_Missense_Mutation_p.R473W|DTNA_ENST00000598334.1_Missense_Mutation_p.R413W|DTNA_ENST00000591182.1_Missense_Mutation_p.R121W|DTNA_ENST00000598774.1_Missense_Mutation_p.R416W|DTNA_ENST00000348997.5_Missense_Mutation_p.R470W|DTNA_ENST00000399097.3_Missense_Mutation_p.R121W			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	473					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						TAAGCAGCAAAGGCAGCTGAT	0.418																																																	0													94.0	76.0	82.0					18																	32431858		2203	4300	6503	SO:0001583	missense	0			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1417A>T	18.37:g.32431858A>T	ENSP00000382064:p.Arg473Trp		A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,smart_Znf_ZZ,pirsf_Distrobrevin,pfscan_Znf_ZZ	p.R474W	ENST00000399113.3	37	c.1420	CCDS59311.1	18	.	.	.	.	.	.	.	.	.	.	A	21.0	4.076182	0.76415	.	.	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000399114;ENST00000269190;ENST00000399097;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113;ENST00000269192;ENST00000450377;ENST00000556414	D;D;D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	5.67	4.51	0.55191	.	0.044163	0.85682	D	0.000000	D	0.90259	0.6954	M	0.77486	2.375	0.58432	D	0.999998	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;0.999;1.0;0.999;1.0;1.0;1.0;1.0;1.0;1.0;0.998	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.999;0.991;1.0;0.999;0.998;0.999;0.995;0.999;0.997;0.999;0.998;0.998;0.998;0.95	D	0.90667	0.4595	10	0.87932	D	0	-18.7478	12.4007	0.55412	0.559:0.441:0.0:0.0	.	125;182;163;223;95;473;473;413;416;121;470;413;424;416;416	B4DIU8;B4DIR0;B7Z3X3;B4DGS6;Q9Y4J8-8;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-6;Q9Y4J8-4;E9PEH8;Q59GK7;Q9Y4J8-2;Q9Y4J8-5	.;.;.;.;.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.	W	416;416;413;474;121;470;473;473;473;473;182;121;125	ENSP00000283365:R416W;ENSP00000269190:R474W;ENSP00000382048:R121W;ENSP00000336682:R470W;ENSP00000405819:R473W;ENSP00000269191:R473W;ENSP00000382064:R473W;ENSP00000269192:R182W;ENSP00000452255:R125W	ENSP00000269190:R474W	R	+	1	2	DTNA	30685856	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	2.062000	0.41413	0.983000	0.38602	0.533000	0.62120	AGG	DTNA	-	pirsf_Distrobrevin	ENSG00000134769		0.418	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	DTNA	HGNC	protein_coding	OTTHUMT00000255422.2	-	0.00	49	0	A	NM_001390		32431858	+1	tier1	-	no_errors	ENST00000269190	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.999	T
DYSF	8291	genome.wustl.edu	37	2	71766292	71766292	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:71766292G>A	ENST00000258104.3	+	16	1680	c.1403G>A	c.(1402-1404)cGc>cAc	p.R468H	DYSF_ENST00000410041.1_Missense_Mutation_p.R500H|DYSF_ENST00000413539.2_Missense_Mutation_p.R499H|DYSF_ENST00000409762.1_Missense_Mutation_p.R499H|DYSF_ENST00000409744.1_Missense_Mutation_p.R469H|DYSF_ENST00000409582.3_Missense_Mutation_p.R499H|DYSF_ENST00000410020.3_Missense_Mutation_p.R500H|DYSF_ENST00000429174.2_Missense_Mutation_p.R468H|DYSF_ENST00000409651.1_Missense_Mutation_p.R500H|DYSF_ENST00000409366.1_Missense_Mutation_p.R469H|DYSF_ENST00000394120.2_Missense_Mutation_p.R469H	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	468	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.R468H(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TCTAGGGACCGCCTGACTCAC	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)											148.0	125.0	133.0					2																	71766292		2203	4300	6503	SO:0001583	missense	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1403G>A	2.37:g.71766292G>A	ENSP00000258104:p.Arg468His		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.R499H	ENST00000258104.3	37	c.1496	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996373	0.74818	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.05	5.05	0.67936	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.054859	0.64402	D	0.000001	D	0.87297	0.6142	M	0.92555	3.32	0.47245	D	0.999362	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.998;0.998;0.996;0.997;0.997;0.997;0.993;0.998;0.997;1.0;0.993;0.996;0.997	D	0.88162	0.2858	10	0.42905	T	0.14	-23.904	16.309	0.82862	0.0:0.0:1.0:0.0	.	500;500;469;469;500;469;499;468;499;499;468;468;469;468	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	H	499;499;499;468;468;500;469;469;469;500;500	ENSP00000407046:R499H;ENSP00000387137:R499H;ENSP00000386547:R499H;ENSP00000398305:R468H;ENSP00000258104:R468H;ENSP00000386683:R500H;ENSP00000377678:R469H;ENSP00000386285:R469H;ENSP00000386512:R469H;ENSP00000386881:R500H;ENSP00000386617:R500H	ENSP00000258104:R468H	R	+	2	0	DYSF	71619800	1.000000	0.71417	1.000000	0.80357	0.537000	0.34900	7.805000	0.86005	2.786000	0.95864	0.563000	0.77884	CGC	DYSF	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000135636		0.552	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3		0.00	65	0	G	NM_003494		71766292	+1			no_errors	ENST00000413539	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	A
EGFLAM	133584	genome.wustl.edu	37	5	38258922	38258922	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:38258922G>A	ENST00000354891.3	+	1	412	c.66G>A	c.(64-66)gcG>gcA	p.A22A	EGFLAM_ENST00000322350.5_Silent_p.A22A	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	22					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GACCCGGCGCGGTGTCGCTCC	0.672																																					Colon(62;485 1295 3347 17454)												0													20.0	20.0	20.0					5																	38258922		2202	4296	6498	SO:0001819	synonymous_variant	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.66G>A	5.37:g.38258922G>A			A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.A22	ENST00000354891.3	37	c.66	CCDS56363.1	5																																																																																			EGFLAM	-	NULL	ENSG00000164318		0.672	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	-	0.00	72	0	G	NM_152403		38258922	+1	tier1	-	no_errors	ENST00000354891	ensembl	human	known	74_37	silent	12.70	55	8	SNP	0.000	A
EHBP1L1	254102	genome.wustl.edu	37	11	65343817	65343817	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:65343817C>T	ENST00000309295.4	+	1	309	c.44C>T	c.(43-45)gCg>gTg	p.A15V		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	15						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGCAAGCGGGCGGCCAAGTTC	0.697																																																	0													29.0	34.0	32.0					11																	65343817		1927	4125	6052	SO:0001583	missense	0			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.44C>T	11.37:g.65343817C>T	ENSP00000312671:p.Ala15Val		Q8TB89|Q9H7M7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A15V	ENST00000309295.4	37	c.44	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.508266	0.96386	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.48201	0.82;0.82	3.71	3.71	0.42584	.	0.000000	0.56097	D	0.000022	T	0.70046	0.3179	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76318	-0.3003	10	0.87932	D	0	.	12.9803	0.58559	0.0:1.0:0.0:0.0	.	15	Q8N3D4	EH1L1_HUMAN	V	15	ENSP00000312671:A15V;ENSP00000431996:A15V	ENSP00000312671:A15V	A	+	2	0	EHBP1L1	65100393	1.000000	0.71417	0.990000	0.47175	0.962000	0.63368	4.467000	0.60155	1.631000	0.50456	0.561000	0.74099	GCG	EHBP1L1	-	NULL	ENSG00000173442		0.697	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	HGNC	protein_coding	OTTHUMT00000390145.1	-	0.00	97	0	C	XM_170658		65343817	+1	tier1	-	no_errors	ENST00000309295	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
ELFN2	114794	genome.wustl.edu	37	22	37769599	37769599	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:37769599C>T	ENST00000402918.2	-	3	2761	c.1976G>A	c.(1975-1977)gGc>gAc	p.G659D	RP1-63G5.5_ENST00000430883.1_RNA|ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	659					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					CTTGGAGTCGCCCTTAGCCAG	0.706																																																	0													8.0	8.0	8.0					22																	37769599		2158	4205	6363	SO:0001583	missense	0			BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.1976G>A	22.37:g.37769599C>T	ENSP00000385277:p.Gly659Asp		Q96PY3	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.G659D	ENST00000402918.2	37	c.1976	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	C	1.254	-0.617627	0.03663	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.49432	0.78;0.78	4.65	3.62	0.41486	.	0.725668	0.12689	N	0.447309	T	0.26702	0.0653	N	0.08118	0	0.20307	N	0.999918	B	0.29716	0.255	B	0.16722	0.016	T	0.06643	-1.0815	10	0.21540	T	0.41	-19.3756	14.28	0.66205	0.0:0.6089:0.391:0.0	.	659	Q5R3F8	PPR29_HUMAN	D	659	ENSP00000300147:G659D;ENSP00000385277:G659D	ENSP00000300147:G659D	G	-	2	0	ELFN2	36099545	0.995000	0.38212	0.997000	0.53966	0.369000	0.29798	1.479000	0.35453	0.918000	0.36919	-0.311000	0.09066	GGC	ELFN2	-	NULL	ENSG00000166897		0.706	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	-	0.00	28	0	C	NM_052906		37769599	-1	tier1	-	no_errors	ENST00000402918	ensembl	human	known	74_37	missense	64.29	5	9	SNP	0.595	T
ELMO3	79767	genome.wustl.edu	37	16	67236656	67236656	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:67236656C>T	ENST00000360833.1	+	14	1690	c.1633C>T	c.(1633-1635)Cgg>Tgg	p.R545W	ELMO3_ENST00000477898.1_Missense_Mutation_p.R396W|ELMO3_ENST00000393997.2_Missense_Mutation_p.R562W|MIR328_ENST00000385213.1_RNA			Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	509	PH.				apoptotic process (GO:0006915)|phagocytosis (GO:0006909)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				cervix(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	18		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		GCAGACTGAACGGCTGCACCA	0.632																																																	0													36.0	43.0	41.0					16																	67236656		2083	4211	6294	SO:0001583	missense	0				CCDS10833.2	16q22.1	2010-03-18	2006-01-20		ENSG00000102890	ENSG00000102890		"""Engulfment and cell motility proteins"""	17289	protein-coding gene	gene with protein product		606422	"""engulfment and cell motility 3 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_024712		Approved	FLJ13824, CED12, ELMO-3, CED-12	uc002esa.3	Q96BJ8	OTTHUMG00000133570	ENST00000360833.1:c.1633C>T	16.37:g.67236656C>T	ENSP00000354077:p.Arg545Trp		B4DV86|Q9H8A5	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.R562W	ENST00000360833.1	37	c.1684		16	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913803	0.33815	.	.	ENSG00000102890	ENST00000360833;ENST00000393997	T;T	0.54675	0.56;0.56	5.69	3.59	0.41128	.	0.000000	0.85682	D	0.000000	T	0.72011	0.3408	M	0.81112	2.525	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.76926	-0.2778	10	0.87932	D	0	-34.9744	12.9811	0.58564	0.4039:0.5961:0.0:0.0	.	509;545;562	Q96BJ8;F8W9E7;Q96BJ8-3	ELMO3_HUMAN;.;.	W	545;562	ENSP00000354077:R545W;ENSP00000377566:R562W	ENSP00000354077:R545W	R	+	1	2	ELMO3	65794157	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	2.034000	0.41145	1.389000	0.46526	-0.314000	0.08810	CGG	ELMO3	-	NULL	ENSG00000102890		0.632	ELMO3-001	NOVEL	basic|exp_conf	protein_coding	ELMO3	HGNC	protein_coding	OTTHUMT00000257667.2	-	0.00	54	0	C	NM_024712		67236656	+1	tier1	-	no_errors	ENST00000393997	ensembl	human	known	74_37	missense	6.02	78	5	SNP	1.000	T
ELP4	26610	genome.wustl.edu	37	11	31616371	31616371	+	Missense_Mutation	SNP	G	G	A	rs144056743		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:31616371G>A	ENST00000350638.5	+	4	471	c.436G>A	c.(436-438)Gta>Ata	p.V146I	ELP4_ENST00000395934.2_Missense_Mutation_p.V146I|ELP4_ENST00000379163.5_Missense_Mutation_p.V146I	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	146					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					TGATGAAGATGTATACAATCA	0.303																																																	0													74.0	70.0	71.0					11																	31616371		1809	4068	5877	SO:0001583	missense	0			AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.436G>A	11.37:g.31616371G>A	ENSP00000298937:p.Val146Ile		B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	pfam_Elongator_complex_protein_4,superfamily_P-loop_NTPase	p.V146I	ENST00000350638.5	37	c.436	CCDS7875.2	11	.	.	.	.	.	.	.	.	.	.	G	4.474	0.087763	0.08583	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	T;T;T	0.42131	0.98;0.98;0.98	4.69	-1.11	0.09840	.	1.270580	0.05188	N	0.502636	T	0.32436	0.0829	L	0.59436	1.845	0.09310	N	1	P;P;B	0.48694	0.572;0.914;0.408	B;B;B	0.35770	0.207;0.21;0.079	T	0.33085	-0.9882	10	0.37606	T	0.19	-27.3746	4.8056	0.13319	0.4356:0.0:0.423:0.1414	.	146;146;146	B4E3W0;G5E9D4;Q96EB1	.;.;ELP4_HUMAN	I	146	ENSP00000298937:V146I;ENSP00000368461:V146I;ENSP00000379267:V146I	ENSP00000298937:V146I	V	+	1	0	ELP4	31572947	0.000000	0.05858	0.000000	0.03702	0.276000	0.26787	-0.723000	0.04952	-0.266000	0.09339	0.460000	0.39030	GTA	ELP4	-	pfam_Elongator_complex_protein_4	ENSG00000109911		0.303	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP4	HGNC	protein_coding	OTTHUMT00000286640.1	-	0.00	62	0	G	NM_019040		31616371	+1	tier1	-	no_errors	ENST00000395934	ensembl	human	known	74_37	missense	30.36	39	17	SNP	0.000	A
RP11-159F24.2	0	genome.wustl.edu	37	5	43348817	43348817	+	RNA	DEL	A	A	-	rs553054916	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:43348817delA	ENST00000511991.1	+	0	431																											CCAAACTCTTAAAAAAAAAAA	0.338														4	0.000798722	0.0023	0.0014	5008	,	,		18773	0.0		0.0	False		,,,				2504	0.0																0																																												0																															5.37:g.43348817delA				RNA	DEL	-	NULL	ENST00000511991.1	37	NULL		5																																																																																			RP11-159F24.2	-	-	ENSG00000188850		0.338	RP11-159F24.2-001	KNOWN	basic	processed_transcript	ENSG00000188850	Clone_based_vega_gene	pseudogene	OTTHUMT00000367972.1		0.00	19	0	A			43348817	+1	tier1		no_errors	ENST00000511991	ensembl	human	known	74_37	rna	15.00	17	3	DEL	0.000	-
AC023469.1	0	genome.wustl.edu	37	2	151900307	151900307	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:151900307G>A	ENST00000409243.1	-	3	190	c.106C>T	c.(106-108)Caa>Taa	p.Q36*																								accatgtcttgacacagtacg	0.438																																																	0																																										SO:0001587	stop_gained	0																														ENST00000409243.1:c.106C>T	2.37:g.151900307G>A	ENSP00000386400:p.Gln36*			Nonsense_Mutation	SNP	NULL	p.Q36*	ENST00000409243.1	37	c.106		2	.	.	.	.	.	.	.	.	.	.	G	11.59	1.684405	0.29872	.	.	ENSG00000222031	ENST00000409243	.	.	.	0.556	0.556	0.17253	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	36	.	ENSP00000386400:Q36X	Q	-	1	0	AC023469.1	151608553	0.017000	0.18338	0.032000	0.17829	0.031000	0.12232	0.364000	0.20325	0.550000	0.28991	0.557000	0.71058	CAA	AC023469.1	-	NULL	ENSG00000222031		0.438	AC023469.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000222031	Clone_based_vega_gene	protein_coding	OTTHUMT00000332405.1	-	0.00	54	0	G			151900307	-1	tier1	-	no_errors	ENST00000409243	ensembl	human	putative	74_37	nonsense	19.05	51	12	SNP	0.040	A
RP11-764K9.1	0	genome.wustl.edu	37	9	68400475	68400475	+	lincRNA	SNP	T	T	G	rs75317582	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:68400475T>G	ENST00000417843.2	-	0	1344																											CAGGCCACAGTGTGGACtgtt	0.488																																																	0																																												0																															9.37:g.68400475T>G				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.488	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	17	0	T			68400475	-1	tier1	rs75317582	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	35.00	13	7	SNP	0.010	G
RP11-764K9.1	0	genome.wustl.edu	37	9	68400495	68400495	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:68400495C>T	ENST00000417843.2	-	0	1324																											tgtaaccaagcgagttataga	0.488																																																	0																																												0																															9.37:g.68400495C>T				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.488	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	16	0	C			68400495	-1	tier1	-	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	27.78	13	5	SNP	0.113	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143189125	143189125	+	lincRNA	SNP	G	G	A	rs201126579		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:143189125G>A	ENST00000412204.2	-	0	2503				RP11-782C8.3_ENST00000425124.1_lincRNA|RP11-782C8.1_ENST00000438000.1_lincRNA																							TGATGACTTGGTTGTTTAAAC	0.333																																																	0																																												0																															1.37:g.143189125G>A				RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.333	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	18	0	G			143189125	-1	tier1	rs201126579	no_errors	ENST00000447389	ensembl	human	known	74_37	rna	27.78	13	5	SNP	0.014	A
LOC102546299	102546299	genome.wustl.edu	37	5	164028110	164028110	+	RNA	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:164028110G>A	ENST00000486913.3	+	0	288				CTC-340A15.2_ENST00000522303.1_RNA|CTC-340A15.2_ENST00000519750.1_RNA|CTC-340A15.2_ENST00000517508.1_RNA|CTC-340A15.2_ENST00000519570.1_RNA|CTC-340A15.2_ENST00000523704.1_RNA|CTC-340A15.2_ENST00000522646.1_RNA																							GGTCGTGGCCGATCATCTCCA	0.602																																																	0																																												0																															5.37:g.164028110G>A				RNA	SNP	-	NULL	ENST00000486913.3	37	NULL		5																																																																																			CTC-340A15.2	-	-	ENSG00000241956		0.602	CTC-340A15.2-001	KNOWN	basic	antisense	ENSG00000241956	Clone_based_vega_gene	antisense	OTTHUMT00000370926.1	-	0.00	119	0	G			164028110	+1	tier1	-	no_errors	ENST00000486913	ensembl	human	known	74_37	rna	50.59	42	43	SNP	0.999	A
SLC35F4	341880	genome.wustl.edu	37	14	58097159	58097159	+	Intron	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:58097159C>T	ENST00000556826.1	-	2	340				CTD-2325K12.1_ENST00000600311.1_RNA|SLC35F4_ENST00000557430.1_Intron	NM_001206920.1	NP_001193849.1	A4IF30	S35F4_HUMAN	solute carrier family 35, member F4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AATTCAAGATCACGGTCCAAG	0.393																																																	0																																										SO:0001627	intron_variant	0					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000556826.1:c.104-36317G>A	14.37:g.58097159C>T			A6NDQ3	RNA	SNP	-	NULL	ENST00000556826.1	37	NULL		14																																																																																			CTD-2325K12.1	-	-	ENSG00000258856		0.393	SLC35F4-004	NOVEL	not_organism_supported|upstream_uORF|basic|appris_principal	protein_coding	ENSG00000258856	Clone_based_vega_gene	protein_coding	OTTHUMT00000412973.1	-	0.00	29	0	C	XM_292260		58097159	+1	tier1	-	no_errors	ENST00000600311	ensembl	human	known	74_37	rna	32.50	27	13	SNP	0.975	T
AL158154.1	0	genome.wustl.edu	37	9	84420936	84420937	+	RNA	INS	-	-	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:84420936_84420937insG	ENST00000581036.1	-	0	59_60																											aaactactcgtggtttttgcca	0.356																																																	0																																												0																															9.37:g.84420938_84420938dupG				RNA	INS	-	NULL	ENST00000581036.1	37	NULL		9																																																																																			AL158154.1	-	-	ENSG00000263404		0.356	AL158154.1-201	NOVEL	basic	miRNA	ENSG00000263404	Clone_based_ensembl_gene	miRNA			0.00	23	0	-			84420937	-1	tier1		no_errors	ENST00000581036	ensembl	human	novel	74_37	rna	17.65	14	3	INS	0.001:0.001	G
VSTM2B	342865	genome.wustl.edu	37	19	30017607	30017607	+	Intron	DEL	G	G	-	rs530212499		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:30017607delG	ENST00000335523.7	+	1	167				CTC-525D6.2_ENST00000579268.1_RNA|CTC-525D6.1_ENST00000582581.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B							integral component of membrane (GO:0016021)				breast(2)	2						CTGTGGACTCGGGGGGGTCTT	0.667																																																	0													10.0	19.0	16.0					19																	30017607		687	1578	2265	SO:0001627	intron_variant	0				CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.82+35G>-	19.37:g.30017607delG				RNA	DEL	-	NULL	ENST00000335523.7	37	NULL	CCDS46034.1	19																																																																																			CTC-525D6.2	-	-	ENSG00000266248		0.667	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266248	Clone_based_vega_gene	protein_coding	OTTHUMT00000458601.1		0.00	55	0	G	NM_001146339		30017607	-1	tier1		no_errors	ENST00000579268	ensembl	human	known	74_37	rna	11.43	31	4	DEL	0.009	-
LOC284379	284379	genome.wustl.edu	37	19	54105311	54105311	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:54105311A>C	ENST00000600193.1	-	2	252	c.145T>G	c.(145-147)Tgt>Ggt	p.C49G																								TGAATCCCACAATGAGCACCA	0.552																																																	0																																										SO:0001583	missense	0																														ENST00000600193.1:c.145T>G	19.37:g.54105311A>C	ENSP00000469517:p.Cys49Gly			Missense_Mutation	SNP	NULL	p.C49G	ENST00000600193.1	37	c.145		19																																																																																			CTB-167G5.5	-	NULL	ENSG00000268864		0.552	CTB-167G5.5-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000268864	Clone_based_vega_gene	protein_coding	OTTHUMT00000464983.1	-	0.00	33	0	A			54105311	-1	tier1	-	no_errors	ENST00000600193	ensembl	human	putative	74_37	missense	36.73	31	18	SNP	0.000	C
ENTHD2	146705	genome.wustl.edu	37	17	79210792	79210792	+	Silent	SNP	G	G	A	rs544653517		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:79210792G>A	ENST00000300714.3	-	3	258	c.201C>T	c.(199-201)caC>caT	p.H67H	C17orf89_ENST00000431388.2_5'Flank|ENTHD2_ENST00000575961.1_5'Flank|ENTHD2_ENST00000374769.2_De_novo_Start_OutOfFrame	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2	67	ENTH.					cytoplasmic vesicle (GO:0031410)											TGAGCTTCCCGTGGCCGGAGC	0.687													g|||	1	0.000199681	0.0	0.0014	5008	,	,		15947	0.0		0.0	False		,,,				2504	0.0																0													11.0	11.0	11.0					17																	79210792		2187	4286	6473	SO:0001819	synonymous_variant	0			AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.201C>T	17.37:g.79210792G>A			Q6ZQU0|Q6ZSQ9	Silent	SNP	pfam_Epsin_dom_N,superfamily_ENTH_VHS	p.H67	ENST00000300714.3	37	c.201	CCDS11779.1	17																																																																																			ENTHD2	-	pfam_Epsin_dom_N,superfamily_ENTH_VHS	ENSG00000167302		0.687	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD2	HGNC	protein_coding	OTTHUMT00000439315.1	-	0.00	105	0	G	NM_144679		79210792	-1	tier1	-	no_errors	ENST00000300714	ensembl	human	known	74_37	silent	35.34	86	47	SNP	0.792	A
ENTPD1	953	genome.wustl.edu	37	10	97515948	97515948	+	5'UTR	SNP	T	T	G	rs149930011|rs573641366	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:97515948T>G	ENST00000371205.4	+	0	235				ENTPD1_ENST00000453258.2_Intron|ENTPD1_ENST00000539125.1_5'UTR|ENTPD1_ENST00000371207.3_Intron|ENTPD1-AS1_ENST00000416301.1_RNA|ENTPD1_ENST00000543964.1_Intron|ENTPD1_ENST00000371203.5_5'UTR			P49961	ENTP1_HUMAN	ectonucleoside triphosphate diphosphohydrolase 1						ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|skin(1)	16		Colorectal(252;0.0821)		Epithelial(162;1.31e-07)|all cancers(201;5.33e-06)		AAGCAGAGGCTGGGGGGGGGA	0.498																																																	0													26.0	29.0	28.0					10																	97515948		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			S73813	CCDS7444.1, CCDS53556.1, CCDS53557.1, CCDS53558.1, CCDS41554.1	10q24.1	2014-03-03			ENSG00000138185	ENSG00000138185		"""CD molecules"""	3363	protein-coding gene	gene with protein product		601752		CD39		9226376, 24482476	Standard	NM_001098175		Approved	NTPDase-1, ATPDase, SPG64	uc010qoj.2	P49961	OTTHUMG00000018818	ENST00000371205.4:c.-49T>G	10.37:g.97515948T>G			A9Z1X8|B4DWB9|B4E1X1|B7Z599|G3XAF6|Q5T561|Q5T562|Q86VV3|Q9UQQ9|Q9Y3Q9	RNA	SNP	-	NULL	ENST00000371205.4	37	NULL	CCDS7444.1	10																																																																																			ENTPD1-AS1	-	-	ENSG00000226688		0.498	ENTPD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD1-AS1	HGNC	protein_coding	OTTHUMT00000049566.1		0.00	72	0	T	NM_001776		97515948	-1			no_errors	ENST00000416301	ensembl	human	known	74_37	rna	6.94	67	5	SNP	0.969	G
EXPH5	23086	genome.wustl.edu	37	11	108382592	108382592	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:108382592G>T	ENST00000265843.4	-	6	3752	c.3642C>A	c.(3640-3642)tgC>tgA	p.C1214*	EXPH5_ENST00000428840.1_Nonsense_Mutation_p.C1138*|EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000525344.1_Nonsense_Mutation_p.C1207*|EXPH5_ENST00000443411.1_Nonsense_Mutation_p.C1026*	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1214					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		ACAAGTCTGAGCAAAAAGGTA	0.378																																																	0													101.0	104.0	103.0					11																	108382592		2201	4298	6499	SO:0001587	stop_gained	0				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.3642C>A	11.37:g.108382592G>T	ENSP00000265843:p.Cys1214*		Q2KHM1|Q9Y4D6	Nonsense_Mutation	SNP	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	p.C1214*	ENST00000265843.4	37	c.3642	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	G	42	9.539050	0.99199	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312;ENST00000533052	.	.	.	5.85	-2.26	0.06867	.	0.609827	0.16589	N	0.207844	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-0.6047	6.6504	0.22959	0.3762:0.1547:0.4691:0.0	.	.	.	.	X	1214;1138;1026;1207;1138;1026	.	ENSP00000265843:C1214X	C	-	3	2	EXPH5	107887802	0.000000	0.05858	0.006000	0.13384	0.721000	0.41392	-0.512000	0.06313	-0.380000	0.07894	-0.238000	0.12139	TGC	EXPH5	-	NULL	ENSG00000110723		0.378	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1		0.00	76	0	G	NM_015065		108382592	-1			no_errors	ENST00000265843	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	0.044	T
EYS	346007	genome.wustl.edu	37	6	65300723	65300723	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:65300723C>T	ENST00000370621.3	-	26	5563	c.5037G>A	c.(5035-5037)atG>atA	p.M1679I	EYS_ENST00000503581.1_Missense_Mutation_p.M1679I|EYS_ENST00000370616.2_Missense_Mutation_p.M1679I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1679					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AATCAGAATTCATCAAGTCTG	0.308																																																	0													78.0	72.0	74.0					6																	65300723		692	1591	2283	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5037G>A	6.37:g.65300723C>T	ENSP00000359655:p.Met1679Ile		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.M1679I	ENST00000370621.3	37	c.5037		6	.	.	.	.	.	.	.	.	.	.	C	9.368	1.069670	0.20147	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.82255	-1.59;-1.57;-1.57	5.56	-1.42	0.08913	.	.	.	.	.	T	0.43055	0.1230	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.001	T	0.37526	-0.9702	9	0.45353	T	0.12	.	6.5747	0.22560	0.0:0.3827:0.1252:0.492	.	1679;1679	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	I	1679	ENSP00000424243:M1679I;ENSP00000359655:M1679I;ENSP00000359650:M1679I	ENSP00000359650:M1679I	M	-	3	0	EYS	65357444	0.000000	0.05858	0.173000	0.22940	0.865000	0.49528	-0.118000	0.10692	-0.047000	0.13423	0.591000	0.81541	ATG	EYS	-	NULL	ENSG00000188107		0.308	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3		0.00	36	0	C	XM_294050		65300723	-1			no_errors	ENST00000370616	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.000	T
FAM110B	90362	genome.wustl.edu	37	8	59059539	59059539	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:59059539C>T	ENST00000361488.3	+	5	1630	c.750C>T	c.(748-750)gtC>gtT	p.V250V	FAM110B_ENST00000520369.1_Intron	NM_147189.2	NP_671722.1	Q8TC76	F110B_HUMAN	family with sequence similarity 110, member B	250						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(9)|skin(2)	26		all_epithelial(80;0.025)|all_lung(136;0.0274)|Lung NSC(129;0.0355)				CTTGTGGAGTCAGCCGAAGAC	0.597																																																	0													89.0	99.0	96.0					8																	59059539		2203	4300	6503	SO:0001819	synonymous_variant	0			U79298	CCDS6170.1	8q12.1	2007-06-21	2007-03-21	2007-03-21		ENSG00000169122			28587	protein-coding gene	gene with protein product		611394	"""chromosome 8 open reading frame 72"""	C8orf72		8619474, 9110174, 17499476	Standard	XM_005251324		Approved	MGC39325	uc003xtj.1	Q8TC76		ENST00000361488.3:c.750C>T	8.37:g.59059539C>T			Q5BM08|Q9Y4K2	Silent	SNP	NULL	p.V250	ENST00000361488.3	37	c.750	CCDS6170.1	8																																																																																			FAM110B	-	NULL	ENSG00000169122		0.597	FAM110B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM110B	HGNC	protein_coding	OTTHUMT00000378095.2	-	0.00	42	0	C	NM_147189		59059539	+1	tier1	-	no_errors	ENST00000361488	ensembl	human	known	74_37	silent	27.27	32	12	SNP	0.999	T
FAM131B	9715	genome.wustl.edu	37	7	143054514	143054514	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:143054514C>T	ENST00000409408.1	-	5	2093	c.385G>A	c.(385-387)Gtc>Atc	p.V129I	FAM131B_ENST00000409346.1_Missense_Mutation_p.V129I|FAM131B_ENST00000443739.2_Missense_Mutation_p.V157I|FAM131B_ENST00000409578.1_Missense_Mutation_p.V145I|FAM131B_ENST00000409222.3_Missense_Mutation_p.V129I			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	129										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					TGCTCCATGACGCCTGGGGGA	0.512																																																	0													112.0	100.0	104.0					7																	143054514		2203	4300	6503	SO:0001583	missense	0			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.385G>A	7.37:g.143054514C>T	ENSP00000387017:p.Val129Ile		A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	NULL	p.V157I	ENST00000409408.1	37	c.469	CCDS5882.1	7	.	.	.	.	.	.	.	.	.	.	C	14.70	2.615166	0.46631	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25	5.68	5.68	0.88126	.	0.057498	0.64402	D	0.000001	T	0.34919	0.0914	L	0.60845	1.875	0.54753	D	0.999981	P;P	0.47545	0.858;0.897	B;B	0.32928	0.155;0.127	T	0.41734	-0.9492	10	0.62326	D	0.03	-13.3059	19.798	0.96494	0.0:1.0:0.0:0.0	.	145;129	Q86XD5-2;Q86XD5	.;F131B_HUMAN	I	157;145;129;133;129;129	ENSP00000410603:V157I;ENSP00000386568:V145I;ENSP00000386984:V129I;ENSP00000387017:V129I;ENSP00000387147:V129I	ENSP00000387147:V129I	V	-	1	0	FAM131B	142764636	0.999000	0.42202	0.973000	0.42090	0.403000	0.30841	4.228000	0.58619	2.677000	0.91161	0.563000	0.77884	GTC	FAM131B	-	NULL	ENSG00000159784		0.512	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	HGNC	protein_coding	OTTHUMT00000328057.1	-	0.00	49	0	C	NM_014690		143054514	-1	tier1	-	no_errors	ENST00000443739	ensembl	human	known	74_37	missense	27.78	39	15	SNP	0.993	T
FAM182A	284800	genome.wustl.edu	37	20	26063533	26063533	+	RNA	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr20:26063533G>A	ENST00000376398.2	+	0	1050					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						TCTACAGATCGCTGCTCAGAG	0.388																																																	0													52.0	39.0	43.0					20																	26063533		690	1508	2198			0			AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26063533G>A			A2RRD0|Q8N947	RNA	SNP	-	NULL	ENST00000376398.2	37	NULL		20	.	.	.	.	.	.	.	.	.	.	N	8.276	0.814544	0.16607	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.329	0.329	0.15924	.	.	.	.	.	T	0.36303	0.0962	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32745	-0.9895	4	0.44086	T	0.13	.	.	.	.	.	.	.	.	T	128	.	ENSP00000246000:A128T	A	+	1	0	FAM182A	26011533	0.342000	0.24809	0.075000	0.20258	0.054000	0.15201	0.930000	0.28858	0.446000	0.26666	0.123000	0.15791	GCT	FAM182A	-	-	ENSG00000125804		0.388	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	-	0.00	21	0	G			26063533	+1	tier1	-	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	19.44	29	7	SNP	0.092	A
FBLN2	2199	genome.wustl.edu	37	3	13671357	13671357	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:13671357C>T	ENST00000295760.7	+	13	2808	c.2739C>T	c.(2737-2739)tgC>tgT	p.C913C	FBLN2_ENST00000535798.1_Silent_p.C939C|FBLN2_ENST00000404922.3_Silent_p.C960C|FBLN2_ENST00000492059.1_Silent_p.C960C	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	913	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			GCCGCCTGTGCCAGCACACGT	0.662																																																	0													20.0	24.0	22.0					3																	13671357		2131	4241	6372	SO:0001819	synonymous_variant	0			X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2739C>T	3.37:g.13671357C>T			B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Anaphylatoxin/fibulin,superfamily_Anaphylatoxin_comp_syst,smart_EG-like_dom,smart_Anaphylatoxin/fibulin,smart_EGF-like_Ca-bd_dom,pfscan_Anaphylatoxin/fibulin,pfscan_EG-like_dom	p.C960	ENST00000295760.7	37	c.2880	CCDS46762.1	3																																																																																			FBLN2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000163520		0.662	FBLN2-002	KNOWN	basic|CCDS	protein_coding	FBLN2	HGNC	protein_coding	OTTHUMT00000340083.3	-	0.00	82	0	C	NM_001004019		13671357	+1	tier1	-	no_errors	ENST00000404922	ensembl	human	known	74_37	silent	6.17	75	5	SNP	1.000	T
FBXO42	54455	genome.wustl.edu	37	1	16632345	16632345	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:16632345C>T	ENST00000375592.3	-	3	536	c.320G>A	c.(319-321)cGt>cAt	p.R107H	FBXO42_ENST00000478089.1_5'UTR	NM_018994.1	NP_061867.1	Q6P3S6	FBX42_HUMAN	F-box protein 42	107										autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	26		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		AGGATAGGTACGGCTCTCCCA	0.478																																																	0													204.0	168.0	180.0					1																	16632345		2203	4300	6503	SO:0001583	missense	0			BC063864	CCDS30613.1	1p36.23-p36.11	2008-02-05			ENSG00000037637	ENSG00000037637		"""F-boxes /  ""other"""""	29249	protein-coding gene	gene with protein product		609109				10718198	Standard	XM_006710698		Approved	KIAA1332, Fbx42	uc001ayg.3	Q6P3S6	OTTHUMG00000002218	ENST00000375592.3:c.320G>A	1.37:g.16632345C>T	ENSP00000364742:p.Arg107His		B3KP30|Q5TEU8|Q86XI0|Q8N3N4|Q8N5F8|Q9BRM0|Q9P2L4	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,pfscan_F-box_dom	p.R107H	ENST00000375592.3	37	c.320	CCDS30613.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.660682	0.96734	.	.	ENSG00000037637	ENST00000375592	T	0.04049	3.72	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.07413	0.0187	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	P	0.56088	0.791	T	0.54146	-0.8337	10	0.36615	T	0.2	-17.7664	18.8634	0.92281	0.0:1.0:0.0:0.0	.	107	Q6P3S6	FBX42_HUMAN	H	107	ENSP00000364742:R107H	ENSP00000364742:R107H	R	-	2	0	FBXO42	16504932	1.000000	0.71417	0.973000	0.42090	0.981000	0.71138	7.376000	0.79658	2.711000	0.92665	0.655000	0.94253	CGT	FBXO42	-	NULL	ENSG00000037637		0.478	FBXO42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO42	HGNC	protein_coding	OTTHUMT00000006285.1	-	0.00	53	0	C			16632345	-1	tier1	-	no_errors	ENST00000375592	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
FDX1L	112812	genome.wustl.edu	37	19	10421305	10421305	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:10421305G>A	ENST00000393708.3	-	5	427	c.409C>T	c.(409-411)Cta>Tta	p.L137L	ZGLP1_ENST00000403352.1_5'Flank|FDX1L_ENST00000492239.1_5'UTR|FDX1L_ENST00000494368.1_Silent_p.L2L|FDX1L_ENST00000541276.1_Intron|ZGLP1_ENST00000403903.3_5'Flank|CTD-2369P2.10_ENST00000452032.2_Intron	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like	137	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			GCCATGTCTAGCATGTCGTCT	0.637																																																	0													62.0	59.0	60.0					19																	10421305		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299	ENST00000393708.3:c.409C>T	19.37:g.10421305G>A			Q8N8B8	Silent	SNP	pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,prints_Adrenodoxin	p.L137	ENST00000393708.3	37	c.409	CCDS32905.1	19																																																																																			FDX1L	-	pfam_2Fe-2S_ferredoxin-type,superfamily_2Fe-2S_ferredoxin-type,pfscan_2Fe-2S_ferredoxin-type,prints_Adrenodoxin	ENSG00000267673		0.637	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDX1L	HGNC	protein_coding	OTTHUMT00000280567.2	-	0.00	54	0	G			10421305	-1	tier1	-	no_errors	ENST00000393708	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	A
FJX1	24147	genome.wustl.edu	37	11	35642248	35642248	+	3'UTR	DEL	A	A	-	rs201586899|rs3834431|rs532787003	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:35642248delA	ENST00000317811.4	+	0	2514				FJX1_ENST00000532914.1_3'UTR	NM_014344.3	NP_055159.2	Q86VR8	FJX1_HUMAN	four jointed box 1 (Drosophila)						retina layer formation (GO:0010842)	extracellular space (GO:0005615)				lung(1)|urinary_tract(1)	2	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				CACCAGAAGGAAAAAAAAAAA	0.294																																					Melanoma(161;10 2587 27165 47356)												0																																										SO:0001624	3_prime_UTR_variant	0			AJ245599	CCDS44570.1	11p13	2012-05-18				ENSG00000179431			17166	protein-coding gene	gene with protein product	"""putative secreted ligand homologous to fjx1"""	612206				7647465, 10072791	Standard	NM_014344		Approved	FLJ22416, FLJ25593	uc001mwh.3	Q86VR8		ENST00000317811.4:c.*750A>-	11.37:g.35642248delA			B2RCA9|Q9UGK6	RNA	DEL	-	NULL	ENST00000317811.4	37	NULL	CCDS44570.1	11																																																																																			FJX1	-	-	ENSG00000179431		0.294	FJX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FJX1	HGNC	protein_coding	OTTHUMT00000389078.1		0.00	54	0	A	NM_014344		35642248	+1	tier1		no_errors	ENST00000532914	ensembl	human	putative	74_37	rna	25.00	60	20	DEL	0.000	-
FLG	2312	genome.wustl.edu	37	1	152279935	152279935	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:152279935G>T	ENST00000368799.1	-	3	7462	c.7427C>A	c.(7426-7428)tCc>tAc	p.S2476Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2476	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCGTAGTGGGATCCCTGCCT	0.577									Ichthyosis																																								0													366.0	338.0	348.0					1																	152279935		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7427C>A	1.37:g.152279935G>T	ENSP00000357789:p.Ser2476Tyr		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S2476Y	ENST00000368799.1	37	c.7427	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	8.609	0.888732	0.17540	.	.	ENSG00000143631	ENST00000368799	T	0.03801	3.8	3.41	-0.0236	0.13942	.	.	.	.	.	T	0.04048	0.0113	L	0.59967	1.855	0.09310	N	1	D	0.56287	0.975	P	0.60886	0.88	T	0.28073	-1.0055	9	0.41790	T	0.15	.	2.3074	0.04177	0.1177:0.1879:0.502:0.1925	.	2476	P20930	FILA_HUMAN	Y	2476	ENSP00000357789:S2476Y	ENSP00000357789:S2476Y	S	-	2	0	FLG	150546559	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.314000	0.19432	-0.247000	0.09597	0.306000	0.20318	TCC	FLG	-	NULL	ENSG00000143631		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	171	0	G	NM_002016		152279935	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	40.70	118	81	SNP	0.000	T
FLG2	388698	genome.wustl.edu	37	1	152327619	152327619	+	Silent	SNP	G	G	A	rs386635465		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:152327619G>A	ENST00000388718.5	-	3	2715	c.2643C>T	c.(2641-2643)taC>taT	p.Y881Y	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	881	Ser-rich.		Y -> S (in dbSNP:rs12411129).		establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAAAGCCAGAGTATTGACCTG	0.493																																																	0													338.0	292.0	307.0					1																	152327619		2197	4260	6457	SO:0001819	synonymous_variant	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2643C>T	1.37:g.152327619G>A			Q9H4U1	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.Y881	ENST00000388718.5	37	c.2643	CCDS30861.1	1																																																																																			FLG2	-	NULL	ENSG00000143520		0.493	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	-	0.00	175	0	G	NM_001014342		152327619	-1	tier1	-	no_errors	ENST00000388718	ensembl	human	known	74_37	silent	37.93	107	66	SNP	0.000	A
FOXG1	2290	genome.wustl.edu	37	14	29237109	29237109	+	Silent	SNP	C	C	T	rs267606826		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:29237109C>T	ENST00000313071.4	+	1	823	c.624C>T	c.(622-624)taC>taT	p.Y208Y	RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000551395.1_RNA|FOXG1_ENST00000382535.3_Silent_p.Y208Y|RP11-966I7.1_ENST00000549487.1_RNA	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	208					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		ACGGCATCTACGAGTTCATCA	0.562																																																	0													56.0	53.0	54.0					14																	29237109		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.624C>T	14.37:g.29237109C>T			A6NFY2|P55315|Q14488|Q86XT7	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Y208	ENST00000313071.4	37	c.624	CCDS9636.1	14																																																																																			FOXG1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000176165		0.562	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	70	0	C			29237109	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	silent	40.54	44	30	SNP	1.000	T
FTCD	10841	genome.wustl.edu	37	21	47574184	47574184	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr21:47574184G>A	ENST00000291670.5	-	2	160	c.117C>T	c.(115-117)gaC>gaT	p.D39D	FTCD_ENST00000359679.2_Silent_p.D39D|FTCD_ENST00000397748.1_Silent_p.D39D|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397743.1_Silent_p.D39D|FTCD_ENST00000355384.2_Silent_p.D39D|FTCD_ENST00000397746.3_Silent_p.D39D|FTCD-AS1_ENST00000446649.1_RNA	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	39	Formiminotransferase N-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	AAGGGCCTGCGTCCACATCCA	0.682																																																	0													43.0	40.0	41.0					21																	47574184		2201	4296	6497	SO:0001819	synonymous_variant	0			U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.117C>T	21.37:g.47574184G>A			B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Silent	SNP	pfam_Formiminotransferase_N,pfam_Formiminotransferase_C,pfam_Cyclodeamin/CycHdrlase,superfamily_FormiminoTrfase_N/C_subdom,superfamily_Cyclodeamin/CycHdrlase,tigrfam_Formiminotransferase_cat	p.D39	ENST00000291670.5	37	c.117	CCDS13731.1	21																																																																																			FTCD	-	pfam_Formiminotransferase_N,superfamily_FormiminoTrfase_N/C_subdom,tigrfam_Formiminotransferase_cat	ENSG00000160282		0.682	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206962.1	-	0.00	161	0	G	NM_006657		47574184	-1	tier1	-	no_errors	ENST00000359679	ensembl	human	known	74_37	silent	19.30	92	22	SNP	0.766	A
GABBR1	2550	genome.wustl.edu	37	6	29573436	29573438	+	In_Frame_Del	DEL	CAG	CAG	-	rs368201041		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:29573436_29573438delCAG	ENST00000377034.4	-	20	2682_2684	c.2347_2349delCTG	c.(2347-2349)ctgdel	p.L783del	GABBR1_ENST00000355973.3_In_Frame_Del_p.L666del|GABBR1_ENST00000376977.3_3'UTR|GABBR1_ENST00000377012.4_In_Frame_Del_p.L666del|GABBR1_ENST00000377016.4_In_Frame_Del_p.L721del	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	783					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)	p.L783M(1)		endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	GGAAGATTCCCAGCAGCAGCAGC	0.512																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001651	inframe_deletion	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.2347_2349delCTG	6.37:g.29573445_29573447delCAG	ENSP00000366233:p.Leu783del		B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	In_Frame_Del	DEL	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Peripla_BP_I,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.L783in_frame_del	ENST00000377034.4	37	c.2349_2347	CCDS4663.1	6																																																																																			GABBR1	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000204681		0.512	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3		0.00	40	0	CAG			29573438	-1	tier1		no_errors	ENST00000377034	ensembl	human	known	74_37	in_frame_del	15.00	17	3	DEL	0.997:1.000:1.000	-
GABBR2	9568	genome.wustl.edu	37	9	101304292	101304292	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:101304292C>T	ENST00000259455.2	-	3	952	c.493G>A	c.(493-495)Gat>Aat	p.D165N	GABBR2_ENST00000477471.1_5'UTR	NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	165					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TTTTTCTTATCGGCTAGAACA	0.468																																																	0													69.0	63.0	65.0					9																	101304292		2203	4300	6503	SO:0001583	missense	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.493G>A	9.37:g.101304292C>T	ENSP00000259455:p.Asp165Asn		O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.D165N	ENST00000259455.2	37	c.493	CCDS6736.1	9	.	.	.	.	.	.	.	.	.	.	C	12.66	2.004770	0.35320	.	.	ENSG00000136928	ENST00000259455	T	0.28069	1.63	5.39	5.39	0.77823	Extracellular ligand-binding receptor (1);	0.052758	0.64402	D	0.000001	T	0.38585	0.1046	N	0.20304	0.555	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.08785	-1.0705	10	0.12766	T	0.61	.	16.6427	0.85130	0.0:1.0:0.0:0.0	.	165	O75899	GABR2_HUMAN	N	165	ENSP00000259455:D165N	ENSP00000259455:D165N	D	-	1	0	GABBR2	100344113	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.703000	0.84585	2.538000	0.85594	0.655000	0.94253	GAT	GABBR2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000136928		0.468	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	-	0.00	60	0	C			101304292	-1	tier1	-	no_errors	ENST00000259455	ensembl	human	known	74_37	missense	28.12	46	18	SNP	1.000	T
GAS7	8522	genome.wustl.edu	37	17	9939846	9939846	+	Intron	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:9939846C>T	ENST00000432992.2	-	2	344				GAS7_ENST00000585266.1_5'UTR|GAS7_ENST00000578655.1_5'UTR|GAS7_ENST00000323816.4_Intron|GAS7_ENST00000540214.1_Intron	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7						actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						AAGACTCCGCCGGCTTCCTCT	0.607			T	MLL	AML*																																			Dom	yes		17	17p	8522	growth arrest-specific 7		L	0													22.0	21.0	21.0					17																	9939846		692	1591	2283	SO:0001627	intron_variant	0			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.184-16632G>A	17.37:g.9939846C>T			A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	RNA	SNP	-	NULL	ENST00000432992.2	37	NULL	CCDS11152.1	17																																																																																			GAS7	-	-	ENSG00000007237		0.607	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS7	HGNC	protein_coding	OTTHUMT00000439883.1	-	0.00	14	0	C	NM_003644, NM_201432, NM_201433		9939846	-1	tier1	-	no_errors	ENST00000578655	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.001	T
GALR2	8811	genome.wustl.edu	37	17	74070978	74070978	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:74070978G>A	ENST00000329003.3	+	1	104	c.14G>A	c.(13-15)gGc>gAc	p.G5D	SRP68_ENST00000539137.1_5'Flank|SRP68_ENST00000307877.2_5'Flank|SRP68_ENST00000355113.5_5'Flank	NM_003857.2	NP_003848.1	O43603	GALR2_HUMAN	galanin receptor 2	5					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell surface receptor signaling pathway (GO:0007166)|digestion (GO:0007586)|feeding behavior (GO:0007631)|learning or memory (GO:0007611)|multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|negative regulation of adenylate cyclase activity (GO:0007194)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|peptide hormone binding (GO:0017046)			cervix(1)|lung(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						AACGTCTCGGGCTGCCCAGGG	0.746																																																	0													5.0	6.0	5.0					17																	74070978		1956	3745	5701	SO:0001583	missense	0			AF040630	CCDS11739.1	17q25.3	2012-08-08			ENSG00000182687	ENSG00000182687		"""GPCR / Class A : Galanin receptors"""	4133	protein-coding gene	gene with protein product		603691				9685625, 9832121	Standard	NM_003857		Approved	GALNR2	uc002jqm.1	O43603	OTTHUMG00000167479	ENST00000329003.3:c.14G>A	17.37:g.74070978G>A	ENSP00000329684:p.Gly5Asp		A5JUU4|Q32MN8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Galanin_rcpt,prints_GAL2_rcpt	p.G5D	ENST00000329003.3	37	c.14	CCDS11739.1	17	.	.	.	.	.	.	.	.	.	.	G	15.88	2.963980	0.53507	.	.	ENSG00000182687	ENST00000329003	T	0.69561	-0.41	3.72	-1.14	0.09741	.	0.752485	0.11184	N	0.590642	T	0.42877	0.1222	N	0.25647	0.755	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.18272	-1.0342	10	0.20519	T	0.43	.	1.1046	0.01691	0.2169:0.2329:0.3912:0.159	.	5	O43603	GALR2_HUMAN	D	5	ENSP00000329684:G5D	ENSP00000329684:G5D	G	+	2	0	GALR2	71582573	0.855000	0.29742	0.001000	0.08648	0.218000	0.24690	2.153000	0.42282	0.052000	0.16007	-0.656000	0.03901	GGC	GALR2	-	prints_GAL2_rcpt	ENSG00000182687		0.746	GALR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALR2	HGNC	protein_coding	OTTHUMT00000394760.1	-	0.00	51	0	G			74070978	+1	tier1	-	no_errors	ENST00000329003	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.018	A
GCC1	79571	genome.wustl.edu	37	7	127222498	127222498	+	Missense_Mutation	SNP	G	G	T	rs553167690		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:127222498G>T	ENST00000321407.2	-	2	2322	c.1898C>A	c.(1897-1899)aCa>aAa	p.T633K	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	633					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						AGAGGATGATGTGTCAGCTGG	0.592													G|||	1	0.000199681	0.0	0.0	5008	,	,		21567	0.0		0.0	False		,,,				2504	0.001																0													104.0	103.0	103.0					7																	127222498		2203	4300	6503	SO:0001583	missense	0			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.1898C>A	7.37:g.127222498G>T	ENSP00000318821:p.Thr633Lys		Q9H6N7	Missense_Mutation	SNP	pfam_GRIP,superfamily_ARM-type_fold,smart_GRIP,pfscan_GRIP	p.T633K	ENST00000321407.2	37	c.1898	CCDS5796.1	7	.	.	.	.	.	.	.	.	.	.	G	0	-2.812377	0.00073	.	.	ENSG00000179562	ENST00000321407	T	0.10960	2.82	4.3	2.5	0.30297	.	0.956388	0.08731	N	0.902106	T	0.05593	0.0147	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.42189	-0.9466	10	0.06891	T	0.86	-0.5698	6.8853	0.24197	0.2067:0.0:0.7933:0.0	.	633	Q96CN9	GCC1_HUMAN	K	633	ENSP00000318821:T633K	ENSP00000318821:T633K	T	-	2	0	GCC1	127009734	0.000000	0.05858	0.006000	0.13384	0.062000	0.15995	-0.030000	0.12308	0.757000	0.33036	0.655000	0.94253	ACA	GCC1	-	NULL	ENSG00000179562		0.592	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	HGNC	protein_coding	OTTHUMT00000059911.3	-	0.00	58	0	G	NM_024523		127222498	-1	tier1	-	no_errors	ENST00000321407	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.035	T
GCC1	79571	genome.wustl.edu	37	7	127225152	127225152	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:127225152G>T	ENST00000321407.2	-	1	509	c.85C>A	c.(85-87)Ctc>Atc	p.L29I	GCC1_ENST00000497650.1_Intron	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	29					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.L29F(1)		breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TGGTACTGGAGAAGCTGCTTC	0.542											OREG0003808	type=REGULATORY REGION|Gene=GCC1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					1	Substitution - Missense(1)	kidney(1)											100.0	103.0	102.0					7																	127225152		2203	4300	6503	SO:0001583	missense	0			AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.85C>A	7.37:g.127225152G>T	ENSP00000318821:p.Leu29Ile	1555	Q9H6N7	Missense_Mutation	SNP	pfam_GRIP,superfamily_ARM-type_fold,smart_GRIP,pfscan_GRIP	p.L29I	ENST00000321407.2	37	c.85	CCDS5796.1	7	.	.	.	.	.	.	.	.	.	.	G	2.743	-0.261799	0.05791	.	.	ENSG00000179562	ENST00000321407	T	0.11821	2.74	5.67	-0.705	0.11252	.	0.535420	0.18228	N	0.147673	T	0.09642	0.0237	L	0.51422	1.61	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.25779	-1.0122	10	0.37606	T	0.19	-0.123	2.2256	0.03983	0.2098:0.2369:0.4315:0.1218	.	29	Q96CN9	GCC1_HUMAN	I	29	ENSP00000318821:L29I	ENSP00000318821:L29I	L	-	1	0	GCC1	127012388	0.005000	0.15991	0.101000	0.21167	0.251000	0.25915	0.110000	0.15437	-0.460000	0.07003	-1.012000	0.02466	CTC	GCC1	-	NULL	ENSG00000179562		0.542	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC1	HGNC	protein_coding	OTTHUMT00000059911.3		0.00	37	0	G	NM_024523		127225152	-1			no_errors	ENST00000321407	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.081	T
GJC2	57165	genome.wustl.edu	37	1	228346575	228346575	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:228346575G>A	ENST00000366714.2	+	2	1291	c.1116G>A	c.(1114-1116)tcG>tcA	p.S372S		NM_020435.3	NP_065168.2	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	372					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|response to toxic substance (GO:0009636)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	gap junction channel activity (GO:0005243)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Prostate(94;0.0405)				GGGACAGTTCGCCGTGCGTCG	0.776																																																	0													1.0	2.0	2.0					1																	228346575		957	2249	3206	SO:0001819	synonymous_variant	0			AF014643	CCDS1569.1	1q41-q42	2009-01-02	2007-12-14	2007-11-06	ENSG00000198835	ENSG00000198835		"""Ion channels / Gap junction proteins (connexins)"""	17494	protein-coding gene	gene with protein product	"""connexin 47"""	608803	"""gap junction protein, alpha 12, 47kDa"""	GJA12		19056803	Standard	NM_020435		Approved	CX47, CX46.6, SPG44	uc001hsk.3	Q5T442	OTTHUMG00000039771	ENST00000366714.2:c.1116G>A	1.37:g.228346575G>A			O43440|Q7Z7J2|Q8IWJ9	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.S372	ENST00000366714.2	37	c.1116	CCDS1569.1	1																																																																																			GJC2	-	NULL	ENSG00000198835		0.776	GJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJC2	HGNC	protein_coding	OTTHUMT00000095985.1	-	0.00	9	0	G	NM_020435		228346575	+1	tier1	-	no_errors	ENST00000366714	ensembl	human	known	74_37	silent	55.56	4	5	SNP	0.328	A
GLB1L3	112937	genome.wustl.edu	37	11	134162099	134162099	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:134162099C>A	ENST00000431683.2	+	8	803	c.803C>A	c.(802-804)aCc>aAc	p.T268N	GLB1L3_ENST00000389887.5_Missense_Mutation_p.T268N	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	268					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		AGTGGCCACACCAAAGGAGGT	0.473																																																	0													68.0	66.0	66.0					11																	134162099		1970	4170	6140	SO:0001583	missense	0				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.803C>A	11.37:g.134162099C>A	ENSP00000396615:p.Thr268Asn		A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.T268N	ENST00000431683.2	37	c.803	CCDS44780.1	11	.	.	.	.	.	.	.	.	.	.	C	14.31	2.496512	0.44352	.	.	ENSG00000166105	ENST00000389887;ENST00000431683	D;D	0.97924	-4.61;-4.61	4.64	0.993	0.19825	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.94945	0.8365	L	0.29908	0.895	0.09310	N	1	P;B	0.42961	0.795;0.068	P;B	0.45712	0.491;0.145	D	0.89519	0.3777	9	0.87932	D	0	.	7.1178	0.25427	0.0:0.2819:0.0:0.7181	.	268;268	Q8NCI6-4;Q8NCI6	.;GLBL3_HUMAN	N	268	ENSP00000374537:T268N;ENSP00000396615:T268N	ENSP00000374537:T268N	T	+	2	0	GLB1L3	133667309	0.012000	0.17670	0.027000	0.17364	0.127000	0.20565	1.910000	0.39927	0.060000	0.16281	-0.806000	0.03193	ACC	GLB1L3	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF	ENSG00000166105		0.473	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L3	HGNC	protein_coding	OTTHUMT00000393625.1	-	0.00	62	0	C	NM_138416		134162099	+1	tier1	-	no_errors	ENST00000431683	ensembl	human	known	74_37	missense	54.29	15	19	SNP	0.041	A
GPAT2	150763	genome.wustl.edu	37	2	96690074	96690074	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:96690074G>A	ENST00000434632.1	-	17	2140	c.1681C>T	c.(1681-1683)Cgg>Tgg	p.R561W	GPAT2_ENST00000377137.3_Missense_Mutation_p.R561W|GPAT2_ENST00000453542.1_Missense_Mutation_p.R490W|FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000359548.4_Missense_Mutation_p.R561W			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	561					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						AGCAGCCCCCGCACTGCACAG	0.637																																																	0													13.0	16.0	15.0					2																	96690074		1899	4044	5943	SO:0001583	missense	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.1681C>T	2.37:g.96690074G>A	ENSP00000389395:p.Arg561Trp		Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	smart_Plipid/glycerol_acylTrfase	p.R561W	ENST00000434632.1	37	c.1681	CCDS42714.1	2	.	.	.	.	.	.	.	.	.	.	g	15.92	2.975919	0.53720	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542;ENST00000377137	T;T;T;T	0.77877	-1.12;-1.12;-0.12;-1.13	5.41	2.59	0.31030	.	0.167585	0.41938	D	0.000794	T	0.80934	0.4719	L	0.54323	1.7	0.30160	N	0.802285	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;P;P;P;D	0.74674	0.984;0.897;0.857;0.891;0.978	T	0.74047	-0.3790	10	0.38643	T	0.18	-33.1395	5.4042	0.16312	0.172:0.0:0.6691:0.1589	.	490;561;567;561;490	E9PE95;Q6NUI2-3;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;.;GPAT2_HUMAN;.	W	561;561;490;561	ENSP00000352547:R561W;ENSP00000389395:R561W;ENSP00000393770:R490W;ENSP00000366341:R561W	ENSP00000352547:R561W	R	-	1	2	GPAT2	96053801	0.009000	0.17119	0.858000	0.33744	0.839000	0.47603	0.876000	0.28092	0.248000	0.21435	0.637000	0.83480	CGG	GPAT2	-	NULL	ENSG00000186281		0.637	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	-	0.00	71	0	G	NM_207328		96690074	-1	tier1	-	no_errors	ENST00000359548	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.832	A
GPC1	2817	genome.wustl.edu	37	2	241405643	241405643	+	Missense_Mutation	SNP	C	C	T	rs372909320		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:241405643C>T	ENST00000264039.2	+	9	1861	c.1613C>T	c.(1612-1614)cCg>cTg	p.P538L	GPC1_ENST00000466624.1_3'UTR	NM_002081.2	NP_002072.2	P35052	GPC1_HUMAN	glypican 1	538					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|myelin assembly (GO:0032288)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|phototransduction, visible light (GO:0007603)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|retinoid metabolic process (GO:0001523)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|fibroblast growth factor binding (GO:0017134)|laminin binding (GO:0043236)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	9		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;4.51e-33)|all cancers(36;1.74e-30)|OV - Ovarian serous cystadenocarcinoma(60;4.73e-15)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;9.1e-06)|Colorectal(34;0.000487)|Lung(119;0.0013)|LUSC - Lung squamous cell carcinoma(224;0.0154)|COAD - Colon adenocarcinoma(134;0.0194)|READ - Rectum adenocarcinoma(96;0.0949)		CCCCAGCCCCCGACCTTCCTC	0.677													c|||	1	0.000199681	0.0	0.0	5008	,	,		13531	0.0		0.0	False		,,,				2504	0.001																0									LEU/PRO	0,4406		0,0,2203	54.0	68.0	63.0		1613	-5.7	0.0	2		63	1,8599	1.2+/-3.3	0,1,4299	no	missense	GPC1	NM_002081.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	538/559	241405643	1,13005	2203	4300	6503	SO:0001583	missense	0			AK095397	CCDS2534.1	2q35-q37	2008-02-05			ENSG00000063660	ENSG00000063660		"""Proteoglycans / Cell Surface : Glypicans"""	4449	protein-coding gene	gene with protein product	"""glypican proteoglycan 1"""	600395				7774946	Standard	NM_002081		Approved	glypican	uc002vyw.4	P35052	OTTHUMG00000133349	ENST00000264039.2:c.1613C>T	2.37:g.241405643C>T	ENSP00000264039:p.Pro538Leu		B3KTD1|Q53QM4	Missense_Mutation	SNP	pfam_Glypican	p.P538L	ENST00000264039.2	37	c.1613	CCDS2534.1	2	.	.	.	.	.	.	.	.	.	.	c	0.068	-1.209089	0.01568	0.0	1.16E-4	ENSG00000063660	ENST00000264039	T	0.44482	0.92	2.84	-5.69	0.02428	.	0.390690	0.08080	U	1.000000	T	0.18257	0.0438	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.29822	-0.9999	10	0.10111	T	0.7	-17.0178	1.3635	0.02197	0.5:0.157:0.1968:0.1462	.	538	P35052	GPC1_HUMAN	L	538	ENSP00000264039:P538L	ENSP00000264039:P538L	P	+	2	0	GPC1	241054316	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.162000	0.16501	-1.384000	0.02103	-1.200000	0.01667	CCG	GPC1	-	pfam_Glypican	ENSG00000063660		0.677	GPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC1	HGNC	protein_coding	OTTHUMT00000257179.3	-	0.00	152	0	C	NM_002081		241405643	+1	tier1	-	no_errors	ENST00000264039	ensembl	human	known	74_37	missense	17.69	107	23	SNP	0.000	T
GPR21	2844	genome.wustl.edu	37	9	125797678	125797678	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:125797678C>T	ENST00000373642.1	+	1	873	c.833C>T	c.(832-834)aCt>aTt	p.T278I	RABGAP1_ENST00000373643.5_Intron|RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373647.4_Intron	NM_005294.1	NP_005285.1	Q99679	GPR21_HUMAN	G protein-coupled receptor 21	278					G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|negative regulation of insulin receptor signaling pathway (GO:0046627)|positive regulation of multicellular organism growth (GO:0040018)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	15						GAAAGCTCCACTGGCCACAGC	0.438																																																	0													136.0	119.0	125.0					9																	125797678		2203	4300	6503	SO:0001583	missense	0			BC066885	CCDS6849.1	9q33	2012-08-21			ENSG00000188394	ENSG00000188394		"""GPCR / Class A : Orphans"""	4476	protein-coding gene	gene with protein product		601909					Standard	NM_005294		Approved		uc011lzk.3	Q99679	OTTHUMG00000020631	ENST00000373642.1:c.833C>T	9.37:g.125797678C>T	ENSP00000362746:p.Thr278Ile		B2R8W9|Q6NXU2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.T278I	ENST00000373642.1	37	c.833	CCDS6849.1	9	.	.	.	.	.	.	.	.	.	.	C	5.571	0.290168	0.10567	.	.	ENSG00000188394	ENST00000373642	T	0.71934	-0.61	5.93	5.93	0.95920	GPCR, rhodopsin-like superfamily (1);	0.845492	0.10331	U	0.687536	T	0.62865	0.2463	L	0.34521	1.04	0.80722	D	1	B	0.26258	0.145	B	0.27380	0.079	T	0.50448	-0.8827	10	0.22109	T	0.4	-8.9307	14.196	0.65672	0.2481:0.7518:0.0:0.0	.	278	Q99679	GPR21_HUMAN	I	278	ENSP00000362746:T278I	ENSP00000362746:T278I	T	+	2	0	GPR21	124837499	0.089000	0.21612	1.000000	0.80357	0.929000	0.56500	1.806000	0.38892	2.814000	0.96858	0.591000	0.81541	ACT	GPR21	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000188394		0.438	GPR21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR21	HGNC	protein_coding	OTTHUMT00000053965.1	-	0.00	69	0	C	NM_005294		125797678	+1	tier1	-	no_errors	ENST00000373642	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.869	T
GPR32	2854	genome.wustl.edu	37	19	51274368	51274368	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:51274368G>A	ENST00000270590.4	+	1	648	c.511G>A	c.(511-513)Gcc>Acc	p.A171T		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	171					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CCTGGCCGCCGCCTTGTGCTC	0.602																																					Esophageal Squamous(113;152 1581 5732 15840 44398)												0													50.0	53.0	52.0					19																	51274368		2203	4300	6503	SO:0001583	missense	0			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.511G>A	19.37:g.51274368G>A	ENSP00000270590:p.Ala171Thr		Q502U7|Q6NWS5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt	p.A171T	ENST00000270590.4	37	c.511	CCDS12801.1	19	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256975	0.39896	.	.	ENSG00000142511	ENST00000270590	T	0.38401	1.14	2.62	0.214	0.15249	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.48241	0.1489	M	0.70903	2.155	0.09310	N	1	D	0.71674	0.998	P	0.62649	0.905	T	0.33189	-0.9878	9	0.62326	D	0.03	.	3.0514	0.06171	0.2726:0.0:0.5205:0.2069	.	171	O75388	GPR32_HUMAN	T	171	ENSP00000270590:A171T	ENSP00000270590:A171T	A	+	1	0	GPR32	55966180	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.164000	0.09983	-0.016000	0.14127	0.313000	0.20887	GCC	GPR32	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000142511		0.602	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	HGNC	protein_coding	OTTHUMT00000465016.1	-	0.00	51	0	G			51274368	+1	tier1	-	no_errors	ENST00000270590	ensembl	human	known	74_37	missense	38.89	22	14	SNP	0.000	A
HEATR5A	25938	genome.wustl.edu	37	14	31771645	31771645	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:31771645G>T	ENST00000389961.3	-	32	5301	c.5302C>A	c.(5302-5304)Cag>Aag	p.Q1768K	HEATR5A_ENST00000439348.1_Intron|HEATR5A_ENST00000543095.2_Missense_Mutation_p.Q1774K|RP11-596D21.1_ENST00000551799.1_RNA|HEATR5A_ENST00000439727.1_Missense_Mutation_p.Q1481K			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	1768										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		GAAGATAACTGGCCCCCAGGT	0.468																																																	0													39.0	41.0	41.0					14																	31771645		1853	4098	5951	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.5302C>A	14.37:g.31771645G>T	ENSP00000374611:p.Gln1768Lys		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q1768K	ENST00000389961.3	37	c.5302		14	.	.	.	.	.	.	.	.	.	.	G	12.82	2.054030	0.36277	.	.	ENSG00000129493	ENST00000389961;ENST00000439727;ENST00000543095	T;T;T	0.63255	-0.03;-0.03;-0.03	4.89	4.89	0.63831	.	0.421237	0.27000	N	0.021423	T	0.49966	0.1588	N	0.13235	0.315	0.80722	D	1	.	.	.	.	.	.	T	0.43114	-0.9411	8	0.07482	T	0.82	.	18.41	0.90548	0.0:0.0:1.0:0.0	.	.	.	.	K	1768;1481;1774	ENSP00000374611:Q1768K;ENSP00000408681:Q1481K;ENSP00000437968:Q1774K	ENSP00000374611:Q1768K	Q	-	1	0	HEATR5A	30841396	1.000000	0.71417	0.767000	0.31495	0.735000	0.41995	6.647000	0.74354	2.441000	0.82636	0.561000	0.74099	CAG	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.468	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		-	0.00	66	0	G	NM_015473		31771645	-1	tier1	-	no_errors	ENST00000389961	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.991	T
HK2	3099	genome.wustl.edu	37	2	75094808	75094808	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:75094808G>A	ENST00000290573.2	+	3	872	c.272G>A	c.(271-273)cGt>cAt	p.R91H	HK2_ENST00000409174.1_Missense_Mutation_p.R63H	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	91	Hexokinase type-1 1.|Regulatory.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						ACCAACTTCCGTGTGCTTTGG	0.512																																																	0													259.0	267.0	264.0					2																	75094808		2203	4300	6503	SO:0001583	missense	0				CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.272G>A	2.37:g.75094808G>A	ENSP00000290573:p.Arg91His		D6W5J2|Q8WU87|Q9UN82	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.R91H	ENST00000290573.2	37	c.272	CCDS1956.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.484518	0.96323	.	.	ENSG00000159399	ENST00000290573;ENST00000535740;ENST00000409174	D;D	0.99479	-5.98;-5.98	5.34	5.34	0.76211	Hexokinase, N-terminal (1);	0.050333	0.85682	D	0.000000	D	0.99281	0.9749	H	0.96080	3.765	0.80722	D	1	B	0.16396	0.017	B	0.14578	0.011	D	0.97925	1.0317	10	0.72032	D	0.01	-13.8452	16.5892	0.84760	0.0:0.0:1.0:0.0	.	91	P52789	HXK2_HUMAN	H	91;91;63	ENSP00000290573:R91H;ENSP00000387140:R63H	ENSP00000290573:R91H	R	+	2	0	HK2	74948316	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.601000	0.98297	2.785000	0.95823	0.655000	0.94253	CGT	HK2	-	pfam_Hexokinase_N	ENSG00000159399		0.512	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK2	HGNC	protein_coding	OTTHUMT00000252238.2	-	0.00	107	0	G	NM_000189		75094808	+1	tier1	-	no_errors	ENST00000290573	ensembl	human	known	74_37	missense	13.54	81	13	SNP	1.000	A
HPSE2	60495	genome.wustl.edu	37	10	100503680	100503680	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:100503680G>A	ENST00000370552.3	-	4	803	c.744C>T	c.(742-744)agC>agT	p.S248S	HPSE2_ENST00000370549.1_Intron|HPSE2_ENST00000370546.1_Silent_p.S248S|HPSE2_ENST00000404542.1_Intron	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	248					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		TTTTGCTGGCGCTGTACTTCA	0.418																																																	0													134.0	128.0	130.0					10																	100503680		2203	4300	6503	SO:0001819	synonymous_variant	0			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.744C>T	10.37:g.100503680G>A			Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Silent	SNP	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.S248	ENST00000370552.3	37	c.744	CCDS7477.1	10																																																																																			HPSE2	-	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	ENSG00000172987		0.418	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	HGNC	protein_coding	OTTHUMT00000049789.1	-	0.00	65	0	G	NM_021828		100503680	-1	tier1	-	no_errors	ENST00000370552	ensembl	human	known	74_37	silent	34.62	51	27	SNP	0.697	A
HUWE1	10075	genome.wustl.edu	37	X	53602169	53602169	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:53602169C>T	ENST00000342160.3	-	45	6500	c.6043G>A	c.(6043-6045)Gct>Act	p.A2015T	HUWE1_ENST00000262854.6_Missense_Mutation_p.A2015T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2015					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CCATCTGCAGCAAAGACCTGA	0.478																																																	0													51.0	45.0	47.0					X																	53602169		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6043G>A	X.37:g.53602169C>T	ENSP00000340648:p.Ala2015Thr		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.A2015T	ENST00000342160.3	37	c.6043	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.44|15.44	2.833353|2.833353	0.50951|0.50951	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.39406|.	1.08;1.08|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	0.532900|.	0.18935|.	N|.	0.127106|.	T|T	0.41534|0.41534	0.1163|0.1163	N|N	0.12182|0.12182	0.205|0.205	0.49687|0.49687	D|D	0.99981|0.99981	B;B|.	0.28713|.	0.141;0.22|.	B;B|.	0.20184|.	0.012;0.028|.	T|T	0.32877|0.32877	-0.9890|-0.9890	10|5	0.09843|.	T|.	0.71|.	.|.	14.819|14.819	0.70055|0.70055	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2015;2015|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	T|Y	2015|1048	ENSP00000340648:A2015T;ENSP00000262854:A2015T|.	ENSP00000262854:A2015T|.	A|C	-|-	1|2	0|0	HUWE1|HUWE1	53618894|53618894	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	4.519000|4.519000	0.60517|0.60517	2.198000|2.198000	0.70561|0.70561	0.600000|0.600000	0.82982|0.82982	GCT|TGC	HUWE1	-	NULL	ENSG00000086758		0.478	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	64	0	C	XM_497119		53602169	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	8.77	52	5	SNP	1.000	T
IGSF21	84966	genome.wustl.edu	37	1	18661448	18661448	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:18661448G>A	ENST00000251296.1	+	4	751	c.368G>A	c.(367-369)cGc>cAc	p.R123H		NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	123	Ig-like 1.					extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		ATCTACGACCGCGCCACCAGG	0.622																																																	0													101.0	74.0	83.0					1																	18661448		2203	4300	6503	SO:0001583	missense	0			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.368G>A	1.37:g.18661448G>A	ENSP00000251296:p.Arg123His		Q8NBR8	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R123H	ENST00000251296.1	37	c.368	CCDS184.1	1	.	.	.	.	.	.	.	.	.	.	g	29.1	4.975183	0.92919	.	.	ENSG00000117154	ENST00000251296	T	0.56611	0.45	5.57	5.57	0.84162	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67373	0.2886	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64266	-0.6448	10	0.39692	T	0.17	-17.7614	18.1211	0.89572	0.0:0.0:1.0:0.0	.	123	Q96ID5	IGS21_HUMAN	H	123	ENSP00000251296:R123H	ENSP00000251296:R123H	R	+	2	0	IGSF21	18534035	1.000000	0.71417	0.953000	0.39169	0.840000	0.47671	8.136000	0.89610	2.614000	0.88457	0.651000	0.88453	CGC	IGSF21	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000117154		0.622	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	HGNC	protein_coding	OTTHUMT00000006924.1	-	0.00	54	0	G	NM_032880		18661448	+1	tier1	-	no_errors	ENST00000251296	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	A
ISG20L2	81875	genome.wustl.edu	37	1	156697415	156697415	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:156697415A>C	ENST00000313146.6	-	1	812	c.30T>G	c.(28-30)ttT>ttG	p.F10L	RRNAD1_ENST00000368218.4_5'Flank|RRNAD1_ENST00000368216.4_5'Flank|RRNAD1_ENST00000524343.1_5'Flank|ISG20L2_ENST00000472824.2_5'Flank|ISG20L2_ENST00000368219.1_Missense_Mutation_p.F10L	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	10					ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAGGTTCCCCAAAATCCAGAT	0.453																																																	0													68.0	76.0	73.0					1																	156697415		2203	4299	6502	SO:0001583	missense	0			AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.30T>G	1.37:g.156697415A>C	ENSP00000323424:p.Phe10Leu		D3DVC6|Q64KA2	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.F10L	ENST00000313146.6	37	c.30	CCDS1153.1	1	.	.	.	.	.	.	.	.	.	.	A	17.92	3.507665	0.64410	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.34275	1.37;1.37	5.41	-1.0	0.10196	.	0.000000	0.47852	D	0.000215	T	0.11750	0.0286	L	0.32530	0.975	0.36722	D	0.881246	B	0.32781	0.384	B	0.38458	0.274	T	0.07712	-1.0758	10	0.46703	T	0.11	.	5.0537	0.14522	0.5068:0.1561:0.3371:0.0	.	10	Q9H9L3	I20L2_HUMAN	L	10	ENSP00000323424:F10L;ENSP00000357202:F10L	ENSP00000323424:F10L	F	-	3	2	ISG20L2	154964039	0.314000	0.24563	0.760000	0.31359	0.990000	0.78478	0.149000	0.16243	-0.333000	0.08476	-0.274000	0.10170	TTT	ISG20L2	-	NULL	ENSG00000143319		0.453	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISG20L2	HGNC	protein_coding	OTTHUMT00000098969.1		0.00	69	0	A	NM_030980		156697415	-1			no_errors	ENST00000313146	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.971	C
ITGA6	3655	genome.wustl.edu	37	2	173368930	173368931	+	Frame_Shift_Ins	INS	-	-	A	rs201055917	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:173368930_173368931insA	ENST00000264106.6	+	26	3546_3547	c.3343_3344insA	c.(3343-3345)gaafs	p.E1115fs	AC093818.1_ENST00000450443.1_RNA|ITGA6_ENST00000409532.1_3'UTR|ITGA6_ENST00000343713.4_3'UTR|ITGA6_ENST00000375221.2_3'UTR|ITGA6_ENST00000409080.1_Frame_Shift_Ins_p.E1076fs|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000264107.7_3'UTR			P23229	ITA6_HUMAN	integrin, alpha 6	1115					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TGATAACCTTGAAAAAAAACAG	0.406													AaAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	6	0.00119808	0.0	0.0	5008	,	,		17705	0.005		0.0	False		,,,				2504	0.001																0																																										SO:0001589	frameshift_variant	0				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.3351dupA	2.37:g.173368938_173368938dupA	ENSP00000264106:p.Glu1115fs		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Frame_Shift_Ins	INS	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.Q1118fs	ENST00000264106.6	37	c.3343_3344		2																																																																																			ITGA6	-	NULL	ENSG00000091409		0.406	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	HGNC	protein_coding			0.00	36	0	-			173368931	+1	tier1		no_errors	ENST00000264106	ensembl	human	known	74_37	frame_shift_ins	46.88	17	15	INS	1.000:1.000	A
KCNB2	9312	genome.wustl.edu	37	8	73480108	73480108	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:73480108G>T	ENST00000523207.1	+	2	727	c.139G>T	c.(139-141)Gaa>Taa	p.E47*		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	47					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	CCTCAACCACGAAGTCCTGTG	0.567																																																	0													78.0	79.0	79.0					8																	73480108		2203	4300	6503	SO:0001587	stop_gained	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.139G>T	8.37:g.73480108G>T	ENSP00000430846:p.Glu47*		Q7Z7D0|Q9BXD3	Nonsense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.E47*	ENST00000523207.1	37	c.139	CCDS6209.1	8	.	.	.	.	.	.	.	.	.	.	G	43	10.227923	0.99364	.	.	ENSG00000182674	ENST00000523207	.	.	.	5.58	4.7	0.59300	.	0.242902	0.21229	U	0.078020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	12.8046	0.57605	0.0:0.1248:0.7454:0.1298	.	.	.	.	X	47	.	ENSP00000430846:E47X	E	+	1	0	KCNB2	73642662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	1.355000	0.45865	0.563000	0.77884	GAA	KCNB2	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9	ENSG00000182674		0.567	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	-	0.00	75	0	G	NM_004770		73480108	+1	tier1	-	no_errors	ENST00000523207	ensembl	human	known	74_37	nonsense	32.63	63	31	SNP	1.000	T
KEAP1	9817	genome.wustl.edu	37	19	10610187	10610187	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:10610187G>C	ENST00000171111.5	-	2	1070	c.523C>G	c.(523-525)Ctg>Gtg	p.L175V	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Missense_Mutation_p.L175V	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	175					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TGCTGCACCAGGAAGTCACTG	0.592																																																	0													144.0	114.0	124.0					19																	10610187		2203	4300	6503	SO:0001583	missense	0			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.523C>G	19.37:g.10610187G>C	ENSP00000171111:p.Leu175Val		B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L175V	ENST00000171111.5	37	c.523	CCDS12239.1	19	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622104	0.66787	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	D;D	0.82803	-1.65;-1.65	4.81	3.54	0.40534	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.89962	0.6867	M	0.80028	2.48	0.51012	D	0.999906	D	0.89917	1.0	D	0.87578	0.998	D	0.90724	0.4637	10	0.87932	D	0	.	11.2331	0.48925	0.1088:0.0:0.8912:0.0	.	175	Q14145	KEAP1_HUMAN	V	175	ENSP00000171111:L175V;ENSP00000377245:L175V	ENSP00000171111:L175V	L	-	1	2	KEAP1	10471187	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.470000	0.73558	2.232000	0.73038	0.561000	0.74099	CTG	KEAP1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000079999		0.592	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEAP1	HGNC	protein_coding	OTTHUMT00000452000.1		0.00	23	0	G	NM_012289		10610187	-1			no_errors	ENST00000171111	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	C
KLHL24	54800	genome.wustl.edu	37	3	183381293	183381293	+	Missense_Mutation	SNP	G	G	A	rs547446710		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:183381293G>A	ENST00000454652.2	+	5	1354	c.968G>A	c.(967-969)cGa>cAa	p.R323Q	KLHL24_ENST00000476808.1_Missense_Mutation_p.R323Q|KLHL24_ENST00000242810.6_Missense_Mutation_p.R323Q	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	323						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			GGATGTGAGCGAGTTGGAGGA	0.353													G|||	1	0.000199681	0.0	0.0	5008	,	,		15968	0.0		0.0	False		,,,				2504	0.001																0													179.0	161.0	167.0					3																	183381293		2203	4300	6503	SO:0001583	missense	0				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.968G>A	3.37:g.183381293G>A	ENSP00000395012:p.Arg323Gln		A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R323Q	ENST00000454652.2	37	c.968	CCDS3246.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.638007	0.96693	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.69175	-0.38;-0.38;-0.32	5.34	5.34	0.76211	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	T	0.75917	0.3915	L	0.43757	1.38	0.80722	D	1	D;P	0.89917	1.0;0.894	D;P	0.79108	0.992;0.487	T	0.69250	-0.5194	10	0.19147	T	0.46	.	19.4149	0.94690	0.0:0.0:1.0:0.0	.	323;323	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	Q	323	ENSP00000242810:R323Q;ENSP00000395012:R323Q;ENSP00000419010:R323Q	ENSP00000242810:R323Q	R	+	2	0	KLHL24	184863987	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.597000	0.82733	2.675000	0.91044	0.462000	0.41574	CGA	KLHL24	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000114796		0.353	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLHL24	HGNC	protein_coding	OTTHUMT00000346586.2	-	0.00	112	0	G	NM_017644		183381293	+1	tier1	-	no_errors	ENST00000242810	ensembl	human	known	74_37	missense	34.97	93	50	SNP	1.000	A
KPNA6	23633	genome.wustl.edu	37	1	32622990	32622990	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:32622990A>G	ENST00000373625.3	+	4	368	c.275A>G	c.(274-276)gAt>gGt	p.D92G	KPNA6_ENST00000545542.1_Missense_Mutation_p.D97G|KPNA6_ENST00000537234.1_Missense_Mutation_p.D89G|KPNA6_ENST00000469790.1_3'UTR	NM_012316.4	NP_036448.1	O60684	IMA7_HUMAN	karyopherin alpha 6 (importin alpha 7)	92					maternal process involved in female pregnancy (GO:0060135)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			large_intestine(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CTCTTTTCTGATGATTCTGAC	0.443																																																	0													138.0	124.0	129.0					1																	32622990		2203	4300	6503	SO:0001583	missense	0			AF060543	CCDS352.1	1p35.1	2013-02-14			ENSG00000025800	ENSG00000025800		"""Importins"", ""Armadillo repeat containing"""	6399	protein-coding gene	gene with protein product		610563				10523667	Standard	NM_012316		Approved	IPOA7, KPNA7, MGC17918, FLJ11249	uc001bug.3	O60684	OTTHUMG00000004333	ENST00000373625.3:c.275A>G	1.37:g.32622990A>G	ENSP00000362728:p.Asp92Gly		B2RDC7|D3DPP5|Q5VVU3	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.D97G	ENST00000373625.3	37	c.290	CCDS352.1	1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166287	0.57476	.	.	ENSG00000025800	ENST00000373625;ENST00000373617;ENST00000537234;ENST00000545542;ENST00000446515	T;T;T;T	0.35421	1.61;1.61;1.61;1.31	4.64	4.64	0.57946	Importin-alpha, importin-beta-binding domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.186487	0.56097	D	0.000027	T	0.30727	0.0774	L	0.39147	1.195	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.002;0.003;0.003	T	0.06391	-1.0829	10	0.30854	T	0.27	-4.9037	14.7747	0.69724	1.0:0.0:0.0:0.0	.	97;97;92	F5GYL8;B4DWX3;O60684	.;.;IMA7_HUMAN	G	92;66;89;97;43	ENSP00000362728:D92G;ENSP00000444930:D89G;ENSP00000440609:D97G;ENSP00000415677:D43G	ENSP00000362719:D66G	D	+	2	0	KPNA6	32395577	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.101000	0.71479	2.042000	0.60477	0.459000	0.35465	GAT	KPNA6	-	pfam_Importin-a_IBB,superfamily_ARM-type_fold	ENSG00000025800		0.443	KPNA6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KPNA6	HGNC	protein_coding	OTTHUMT00000012527.4	-	0.00	101	0	A	NM_012316		32622990	+1	tier1	-	no_errors	ENST00000545542	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	G
KRAS	3845	genome.wustl.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000556131.1_Missense_Mutation_p.G12D|KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)											91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	12.37:g.25398284C>T	ENSP00000256078:p.Gly12Asp		A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G12D	ENST00000256078.4	37	c.35	CCDS8703.1	12	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	KRAS	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000133703		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KRAS	HGNC	protein_coding	OTTHUMT00000412232.1	-	0.00	59	0	C	NM_033360		25398284	-1	tier1	rs121913529	no_errors	ENST00000256078	ensembl	human	known	74_37	missense	27.78	52	20	SNP	1.000	T
LCE3E	353145	genome.wustl.edu	37	1	152538409	152538409	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:152538409G>T	ENST00000368789.1	-	2	331	c.276C>A	c.(274-276)tgC>tgA	p.C92*		NM_178435.2	NP_848522.1	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	92					keratinization (GO:0031424)					lung(6)|ovary(1)	7	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		ATCTGGATCAGCAGCAGCCCC	0.607																																																	0													62.0	74.0	70.0					1																	152538409		2203	4300	6503	SO:0001587	stop_gained	0				CCDS1013.1	1q21.3	2008-02-05			ENSG00000185966	ENSG00000185966		"""Late cornified envelopes"""	29463	protein-coding gene	gene with protein product		612617				11698679	Standard	NM_178435		Approved	LEP17	uc001faa.4	Q5T5B0	OTTHUMG00000012393	ENST00000368789.1:c.276C>A	1.37:g.152538409G>T	ENSP00000357778:p.Cys92*		A2RRM6	Nonsense_Mutation	SNP	NULL	p.C92*	ENST00000368789.1	37	c.276	CCDS1013.1	1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.283352	0.23392	.	.	ENSG00000185966	ENST00000368789	.	.	.	3.54	2.58	0.30949	.	.	.	.	.	.	.	.	.	.	.	0.46396	D	0.999025	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0382	0.30506	0.0:0.0:0.757:0.243	.	.	.	.	X	92	.	ENSP00000357778:C92X	C	-	3	2	LCE3E	150805033	1.000000	0.71417	0.949000	0.38748	0.061000	0.15899	1.060000	0.30530	0.764000	0.33197	0.557000	0.71058	TGC	LCE3E	-	NULL	ENSG00000185966		0.607	LCE3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE3E	HGNC	protein_coding	OTTHUMT00000034513.1	-	0.00	81	0	G	NM_178435		152538409	-1	tier1	-	no_errors	ENST00000368789	ensembl	human	known	74_37	nonsense	23.16	73	22	SNP	0.984	T
LEMD2	221496	genome.wustl.edu	37	6	33746063	33746063	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:33746063C>T	ENST00000293760.5	-	6	1131	c.1112G>A	c.(1111-1113)cGg>cAg	p.R371Q	LEMD2_ENST00000502643.1_5'UTR|LEMD2_ENST00000508327.1_Missense_Mutation_p.R69Q	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	371					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						GAGCAAGGCCCGGCTCAGGCG	0.582																																																	0													89.0	86.0	87.0					6																	33746063		2203	4300	6503	SO:0001583	missense	0				CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.1112G>A	6.37:g.33746063C>T	ENSP00000293760:p.Arg371Gln		B4DVH5|E7EVT2|Q5T972|Q5T974	Missense_Mutation	SNP	pfam_Inner-Nucl-membr_MAN1,pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom	p.R371Q	ENST00000293760.5	37	c.1112	CCDS4785.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.267250|5.267250	0.95399|0.95399	.|.	.|.	ENSG00000161904|ENSG00000161904	ENST00000442696|ENST00000293760;ENST00000508327	.|.	.|.	.|.	5.65|5.65	4.77|4.77	0.60923|0.60923	.|Inner nuclear membrane protein MAN1 (1);	.|0.107028	.|0.39475	.|N	.|0.001350	T|T	0.68851|0.68851	0.3046|0.3046	L|L	0.56769|0.56769	1.78|1.78	0.40756|0.40756	D|D	0.982968|0.982968	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.72625	.|0.978;0.978	T|T	0.72786|0.72786	-0.4188|-0.4188	5|9	.|0.52906	.|T	.|0.07	-5.523|-5.523	15.8448|15.8448	0.78879|0.78879	0.1369:0.8631:0.0:0.0|0.1369:0.8631:0.0:0.0	.|.	.|371;332	.|Q8NC56;A8MS91	.|LEMD2_HUMAN;.	R|Q	237|371;69	.|.	.|ENSP00000293760:R371Q	G|R	-|-	1|2	0|0	LEMD2|LEMD2	33854041|33854041	0.999000|0.999000	0.42202|0.42202	0.929000|0.929000	0.37066|0.37066	0.979000|0.979000	0.70002|0.70002	4.648000|4.648000	0.61425|0.61425	1.346000|1.346000	0.45694|0.45694	0.655000|0.655000	0.94253|0.94253	GGG|CGG	LEMD2	-	pfam_Inner-Nucl-membr_MAN1	ENSG00000161904		0.582	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEMD2	HGNC	protein_coding	OTTHUMT00000040209.3	-	0.00	61	0	C	XM_166338		33746063	-1	tier1	-	no_errors	ENST00000293760	ensembl	human	known	74_37	missense	5.97	62	4	SNP	0.997	T
LGI1	9211	genome.wustl.edu	37	10	95518113	95518113	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:95518113C>T	ENST00000371418.4	+	1	472	c.212C>T	c.(211-213)tCa>tTa	p.S71L	LGI1_ENST00000542308.1_Missense_Mutation_p.S71L|LGI1_ENST00000371413.3_Missense_Mutation_p.S71L|LGI1_ENST00000478763.1_3'UTR	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	71	LRRNT.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				GATGTTATCTCATTGTAAGGC	0.438																																																	0													125.0	122.0	123.0					10																	95518113		2203	4300	6503	SO:0001583	missense	0			AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.212C>T	10.37:g.95518113C>T	ENSP00000360472:p.Ser71Leu		A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.S71L	ENST00000371418.4	37	c.212	CCDS7431.1	10	.	.	.	.	.	.	.	.	.	.	C	21.7	4.190131	0.78789	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	T;D;D	0.89939	0.32;-2.59;-2.59	5.11	5.11	0.69529	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94699	0.8290	M	0.81497	2.545	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.015	D;D;B	0.83275	0.996;0.986;0.114	D	0.94657	0.7844	10	0.56958	D	0.05	-7.8516	18.7464	0.91794	0.0:1.0:0.0:0.0	.	71;71;71	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	L	71	ENSP00000440763:S71L;ENSP00000360472:S71L;ENSP00000360467:S71L	ENSP00000360467:S71L	S	+	2	0	LGI1	95508103	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.896000	0.75665	2.673000	0.90976	0.555000	0.69702	TCA	LGI1	-	NULL	ENSG00000108231		0.438	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI1	HGNC	protein_coding	OTTHUMT00000049445.1		0.00	82	0	C	NM_005097		95518113	+1			no_errors	ENST00000371418	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
LINC00933	100506874	genome.wustl.edu	37	15	85121557	85121557	+	RNA	DEL	A	A	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr15:85121557delA	ENST00000557887.1	+	0	757					NR_038273.1|NR_038274.1				long intergenic non-protein coding RNA 933																		TTCTTGCCTTAAAAAAAAAAA	0.279																																																	0																																												0					15q25.2	2013-05-29			ENSG00000259728	ENSG00000259728		"""Long non-coding RNAs"""	48625	non-coding RNA	RNA, long non-coding							Standard	NR_038273		Approved				OTTHUMG00000172445		15.37:g.85121557delA				RNA	DEL	-	NULL	ENST00000557887.1	37	NULL		15																																																																																			LINC00933	-	-	ENSG00000259728		0.279	LINC00933-001	KNOWN	basic	processed_transcript	LINC00933	HGNC	pseudogene	OTTHUMT00000418591.1		0.00	8	0	A			85121557	+1			no_errors	ENST00000557887	ensembl	human	known	74_37	rna	42.86	4	3	DEL	0.004	0
LRIG1	26018	genome.wustl.edu	37	3	66444597	66444597	+	Silent	SNP	G	G	A	rs199667413		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:66444597G>A	ENST00000273261.3	-	12	1859	c.1335C>T	c.(1333-1335)gaC>gaT	p.D445D	LRIG1_ENST00000496559.2_5'UTR|LRIG1_ENST00000383703.3_Silent_p.D469D	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	445	LRRCT.				innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TCAGCTGGCAGTCACACAGGA	0.562																																																	0													34.0	31.0	32.0					3																	66444597		2203	4300	6503	SO:0001819	synonymous_variant	0			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.1335C>T	3.37:g.66444597G>A			Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Cys-rich_flank_reg_C,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D445	ENST00000273261.3	37	c.1335	CCDS33783.1	3																																																																																			LRIG1	-	smart_Cys-rich_flank_reg_C	ENSG00000144749		0.562	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG1	HGNC	protein_coding	OTTHUMT00000351930.1		0.00	55	0	G	NM_015541		66444597	-1			no_errors	ENST00000273261	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	A
LRRC19	64922	genome.wustl.edu	37	9	26996481	26996481	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:26996481G>A	ENST00000380055.5	-	4	722	c.612C>T	c.(610-612)acC>acT	p.T204T	IFT74_ENST00000380062.5_Intron|LRRC19_ENST00000482770.1_Intron|IFT74_ENST00000429045.2_Intron|IFT74_ENST00000433700.1_Intron|IFT74_ENST00000443698.1_Intron	NM_022901.2	NP_075052.1	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19	204	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|lung(2)	6		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)		AGCTACACATGGTGATGTTCT	0.318																																																	0													86.0	79.0	81.0					9																	26996481		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024955	CCDS6518.1	9p21.1	2008-02-05			ENSG00000184434	ENSG00000184434			23379	protein-coding gene	gene with protein product							Standard	NM_022901		Approved	FLJ21302	uc003zqh.3	Q9H756	OTTHUMG00000019710	ENST00000380055.5:c.612C>T	9.37:g.26996481G>A			A0AV00|B9EG91	Silent	SNP	smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T204	ENST00000380055.5	37	c.612	CCDS6518.1	9																																																																																			LRRC19	-	smart_Cys-rich_flank_reg_C	ENSG00000184434		0.318	LRRC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC19	HGNC	protein_coding	OTTHUMT00000051961.2	-	0.00	75	0	G	NM_022901		26996481	-1	tier1	-	no_errors	ENST00000380055	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.896	A
LRRC63	220416	genome.wustl.edu	37	13	46844610	46844610	+	Silent	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr13:46844610T>A	ENST00000446175.1	+	11	1944	c.1599T>A	c.(1597-1599)tcT>tcA	p.S533S	LRRC63_ENST00000595396.1_Intron	NM_001282460.1	NP_001269389.1	Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	532										lung(1)|ovary(1)	2						CCATCTATTCTTCAAGAAAAG	0.368																																																	0																																										SO:0001819	synonymous_variant	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000446175.1:c.1599T>A	13.37:g.46844610T>A			Q5TBN0	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S533	ENST00000446175.1	37	c.1599		13																																																																																			LRRC63	-	NULL	ENSG00000173988		0.368	LRRC63-201	KNOWN	basic|appris_candidate	protein_coding	LRRC63	HGNC	protein_coding		-	0.00	30	0	T	XM_001718341		46844610	+1	tier1	-	no_errors	ENST00000446175	ensembl	human	known	74_37	silent	15.22	39	7	SNP	0.977	A
LRRC8A	56262	genome.wustl.edu	37	9	131670056	131670056	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:131670056G>A	ENST00000259324.5	+	3	1136	c.613G>A	c.(613-615)Gtg>Atg	p.V205M	LRRC8A_ENST00000372599.3_Missense_Mutation_p.V205M|LRRC8A_ENST00000372600.4_Missense_Mutation_p.V205M	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	205					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						CAGTGAGGACGTGGAGGCCAC	0.622																																																	0													57.0	50.0	53.0					9																	131670056		2203	4300	6503	SO:0001583	missense	0			AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.613G>A	9.37:g.131670056G>A	ENSP00000259324:p.Val205Met		Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V205M	ENST00000259324.5	37	c.613	CCDS35155.1	9	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874440	0.51695	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.28666	1.6;1.6;1.6	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.33673	0.0871	N	0.22421	0.69	0.80722	D	1	D	0.69078	0.997	P	0.52856	0.711	T	0.03922	-1.0992	10	0.34782	T	0.22	.	17.8448	0.88727	0.0:0.0:1.0:0.0	.	205	Q8IWT6	LRC8A_HUMAN	M	205	ENSP00000361682:V205M;ENSP00000361680:V205M;ENSP00000259324:V205M	ENSP00000259324:V205M	V	+	1	0	LRRC8A	130709877	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.869000	0.99810	2.460000	0.83146	0.563000	0.77884	GTG	LRRC8A	-	NULL	ENSG00000136802		0.622	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8A	HGNC	protein_coding	OTTHUMT00000054516.2	-	0.00	39	0	G	NM_019594		131670056	+1	tier1	-	no_errors	ENST00000259324	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	A
LTBP2	4053	genome.wustl.edu	37	14	75052601	75052601	+	Silent	SNP	C	C	T	rs370399148		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:75052601C>T	ENST00000261978.4	-	3	1172	c.786G>A	c.(784-786)ccG>ccA	p.P262P	LTBP2_ENST00000556690.1_Silent_p.P262P|LTBP2_ENST00000557425.1_Intron	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	262					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GTGGTGCTGGCGGCTGTGCTC	0.672																																																	0								C		1,4403	2.1+/-5.4	0,1,2201	41.0	51.0	47.0		786	-10.8	0.0	14		47	0,8598		0,0,4299	no	coding-synonymous	LTBP2	NM_000428.2		0,1,6500	TT,TC,CC		0.0,0.0227,0.0077		262/1822	75052601	1,13001	2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.786G>A	14.37:g.75052601C>T			Q99907|Q9NS51	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P262	ENST00000261978.4	37	c.786	CCDS9831.1	14																																																																																			LTBP2	-	NULL	ENSG00000119681		0.672	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	-	0.00	116	0	C	NM_000428		75052601	-1	tier1	-	no_errors	ENST00000261978	ensembl	human	known	74_37	silent	5.75	82	5	SNP	0.000	T
LTK	4058	genome.wustl.edu	37	15	41803369	41803371	+	In_Frame_Del	DEL	GCC	GCC	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr15:41803369_41803371delGCC	ENST00000263800.6	-	7	1084_1086	c.988_990delGGC	c.(988-990)ggcdel	p.G330del	LTK_ENST00000561619.1_Intron|LTK_ENST00000355166.5_Intron|LTK_ENST00000453182.2_Intron	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	330					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TACCCCTGTAgccgccgccgcct	0.729										TSP Lung(18;0.14)																																							0																																										SO:0001651	inframe_deletion	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.988_990delGGC	15.37:g.41803378_41803380delGCC	ENSP00000263800:p.Gly330del		A6NNJ8|B4DL89|E9PFX4	In_Frame_Del	DEL	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G330in_frame_del	ENST00000263800.6	37	c.990_988	CCDS10077.1	15																																																																																			LTK	-	NULL	ENSG00000062524		0.729	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2		0.00	73	0	GCC			41803371	-1	tier1		no_errors	ENST00000263800	ensembl	human	known	74_37	in_frame_del	5.71	33	2	DEL	1.000:1.000:1.000	-
LTK	4058	genome.wustl.edu	37	15	41804982	41804982	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr15:41804982G>T	ENST00000263800.6	-	3	378	c.282C>A	c.(280-282)agC>agA	p.S94R	LTK_ENST00000561619.1_Intron|LTK_ENST00000355166.5_Missense_Mutation_p.S94R|LTK_ENST00000453182.2_Missense_Mutation_p.S94R	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	94					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TCACCACCACGCTGGTCCCCG	0.697										TSP Lung(18;0.14)																																							0													13.0	14.0	13.0					15																	41804982		2190	4280	6470	SO:0001583	missense	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.282C>A	15.37:g.41804982G>T	ENSP00000263800:p.Ser94Arg		A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S94R	ENST00000263800.6	37	c.282	CCDS10077.1	15	.	.	.	.	.	.	.	.	.	.	G	18.08	3.543324	0.65198	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.76578	-1.03;-0.79;-0.98	4.08	2.16	0.27623	.	0.185928	0.26099	U	0.026349	T	0.78407	0.4278	L	0.47716	1.5	0.22001	N	0.999424	P;D;P	0.53151	0.93;0.958;0.907	P;P;P	0.57720	0.674;0.826;0.511	T	0.68296	-0.5446	10	0.87932	D	0	.	7.1632	0.25675	0.3646:0.0:0.6354:0.0	.	94;94;94	E9PFX4;P29376-4;P29376	.;.;LTK_HUMAN	R	94	ENSP00000347293:S94R;ENSP00000263800:S94R;ENSP00000392196:S94R	ENSP00000263800:S94R	S	-	3	2	LTK	39592274	0.456000	0.25744	0.987000	0.45799	0.870000	0.49936	0.447000	0.21710	0.362000	0.24319	0.491000	0.48974	AGC	LTK	-	NULL	ENSG00000062524		0.697	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2		0.00	124	0	G			41804982	-1			no_errors	ENST00000263800	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
MAB21L1	4081	genome.wustl.edu	37	13	36049601	36049601	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr13:36049601C>T	ENST00000379919.4	-	1	1231	c.675G>A	c.(673-675)gcG>gcA	p.A225A	NBEA_ENST00000310336.4_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000400445.3_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	225					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CGTCGCTCTCCGCCGAGCTCT	0.622																																																	0													52.0	58.0	56.0					13																	36049601		2203	4300	6503	SO:0001819	synonymous_variant	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.675G>A	13.37:g.36049601C>T			Q6I9T5	Silent	SNP	pfam_Mab-21_dom	p.A225	ENST00000379919.4	37	c.675	CCDS9353.1	13																																																																																			MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.622	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	-	0.00	23	0	C	NM_005584		36049601	-1	tier1	-	no_errors	ENST00000379919	ensembl	human	known	74_37	silent	60.00	12	18	SNP	0.877	T
MAGEC1	9947	genome.wustl.edu	37	X	140995192	140995192	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:140995192G>C	ENST00000285879.4	+	4	2288	c.2002G>C	c.(2002-2004)Gag>Cag	p.E668Q	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	668								p.E668K(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCCTCCTGAGGGGATGCA	0.577										HNSCC(15;0.026)																																							1	Substitution - Missense(1)	lung(1)											92.0	96.0	95.0					X																	140995192		2203	4300	6503	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2002G>C	X.37:g.140995192G>C	ENSP00000285879:p.Glu668Gln		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E668Q	ENST00000285879.4	37	c.2002	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	g	9.584	1.124344	0.20959	.	.	ENSG00000155495	ENST00000285879	T	0.03663	3.85	0.901	-1.8	0.07907	.	.	.	.	.	T	0.01353	0.0044	N	0.08118	0	0.80722	D	1	P	0.42993	0.797	B	0.25759	0.063	T	0.60964	-0.7158	9	0.66056	D	0.02	.	5.5888	0.17289	1.0E-4:0.3442:0.6557:0.0	.	668	O60732	MAGC1_HUMAN	Q	668	ENSP00000285879:E668Q	ENSP00000285879:E668Q	E	+	1	0	MAGEC1	140822858	0.002000	0.14202	0.038000	0.18304	0.038000	0.13279	-2.563000	0.00919	0.158000	0.19367	0.160000	0.16472	GAG	MAGEC1	-	NULL	ENSG00000155495		0.577	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	43	0	G	NM_005462		140995192	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	33.93	37	19	SNP	0.918	C
MCMDC2	157777	genome.wustl.edu	37	8	67803140	67803140	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:67803140C>T	ENST00000422365.2	+	10	1285	c.1114C>T	c.(1114-1116)Cgt>Tgt	p.R372C	MCMDC2_ENST00000396592.3_Missense_Mutation_p.R372C|MCMDC2_ENST00000541540.1_Missense_Mutation_p.R309C|MCMDC2_ENST00000313616.5_Missense_Mutation_p.R372C	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	372					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						CCGTGGTATACGTCATCTAGT	0.368																																																	0													113.0	115.0	114.0					8																	67803140		2203	4300	6503	SO:0001583	missense	0			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.1114C>T	8.37:g.67803140C>T	ENSP00000413632:p.Arg372Cys		B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase	p.R372C	ENST00000422365.2	37	c.1114	CCDS6197.2	8	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056759	0.36277	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000313616;ENST00000541540	T;T;T;T	0.33654	1.4;1.4;1.4;1.4	4.84	3.97	0.46021	.	0.300117	0.36167	N	0.002743	T	0.32102	0.0818	L	0.53249	1.67	0.51012	D	0.999902	B;B;B	0.15930	0.015;0.009;0.009	B;B;B	0.09377	0.004;0.002;0.002	T	0.14090	-1.0485	10	0.54805	T	0.06	-0.8063	9.1053	0.36694	0.1462:0.7765:0.0:0.0773	.	309;372;372	Q4G0Z9-4;Q4G0Z9;B4DXX4	.;CH045_HUMAN;.	C	244;372;372;372;309	ENSP00000379837:R372C;ENSP00000413632:R372C;ENSP00000317234:R372C;ENSP00000445629:R309C	ENSP00000317234:R372C	R	+	1	0	C8orf45	67965694	1.000000	0.71417	0.990000	0.47175	0.081000	0.17604	1.746000	0.38288	1.171000	0.42768	-0.218000	0.12543	CGT	MCMDC2	-	smart_MCM_DNA-dep_ATPase	ENSG00000178460		0.368	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1	-	0.00	119	0	C	NM_173518		67803140	+1	tier1	-	no_errors	ENST00000422365	ensembl	human	known	74_37	missense	40.71	67	46	SNP	0.999	T
MIR3156-3	100423018	genome.wustl.edu	37	21	14778723	14778723	+	RNA	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr21:14778723G>T	ENST00000580304.1	-	0	58					NR_036164.1				microRNA 3156-3																		GAAAGATCAGGAAGTGGGAGC	0.398																																																	0																																												0					21	2011-09-12				ENSG00000266211		"""ncRNAs / Micro RNAs"""	38229	non-coding RNA	RNA, micro							Standard	NR_036164		Approved	hsa-mir-3156-3	uc021whb.1				21.37:g.14778723G>T				RNA	SNP	-	NULL	ENST00000580304.1	37	NULL		21																																																																																			MIR3156-3	-	-	ENSG00000266211		0.398	MIR3156-3-201	KNOWN	basic	miRNA	MIR3156-3	HGNC	miRNA		-	0.00	47	0	G	NR_036164		14778723	-1	tier1	-	no_errors	ENST00000580304	ensembl	human	known	74_37	rna	18.33	49	11	SNP	0.007	T
MRC2	9902	genome.wustl.edu	37	17	60741944	60741944	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:60741944C>T	ENST00000303375.5	+	2	556	c.154C>T	c.(154-156)Cag>Tag	p.Q52*	Y_RNA_ENST00000384652.1_RNA	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	52	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCATGGACTGCAGGGCTGCCT	0.632																																																	0													91.0	94.0	93.0					17																	60741944		2203	4300	6503	SO:0001587	stop_gained	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.154C>T	17.37:g.60741944C>T	ENSP00000307513:p.Gln52*		A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin,prints_AntifreezeII	p.Q52*	ENST00000303375.5	37	c.154	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.804178	0.97849	.	.	ENSG00000011028	ENST00000303375	.	.	.	4.7	3.72	0.42706	.	0.479225	0.23362	N	0.049013	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.845	13.5301	0.61617	0.0:0.7015:0.2985:0.0	.	.	.	.	X	52	.	ENSP00000307513:Q52X	Q	+	1	0	MRC2	58095676	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.801000	0.38843	1.181000	0.42912	0.561000	0.74099	CAG	MRC2	-	superfamily_Ricin_B_lectin,smart_Ricin_B_lectin	ENSG00000011028		0.632	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	-	0.00	60	0	C			60741944	+1	tier1	-	no_errors	ENST00000303375	ensembl	human	known	74_37	nonsense	8.70	42	4	SNP	0.804	T
MRPL54	116541	genome.wustl.edu	37	19	3765204	3765204	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:3765204C>T	ENST00000330133.4	+	2	196	c.159C>T	c.(157-159)agC>agT	p.S53S		NM_172251.2	NP_758455.1	Q6P161	RM54_HUMAN	mitochondrial ribosomal protein L54	53						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)	p.S53S(1)		breast(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGTGACCAGCGAGGCCCTCA	0.567																																																	1	Substitution - coding silent(1)	breast(1)											92.0	77.0	82.0					19																	3765204		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS12111.1	19p13.3	2012-11-14			ENSG00000183617	ENSG00000183617		"""Mitochondrial ribosomal proteins / large subunits"""	16685	protein-coding gene	gene with protein product		611858				11551941	Standard	NM_172251		Approved		uc002lyq.4	Q6P161	OTTHUMG00000180873	ENST00000330133.4:c.159C>T	19.37:g.3765204C>T				Silent	SNP	pfam_Ribosomal_L37_mit	p.S53	ENST00000330133.4	37	c.159	CCDS12111.1	19																																																																																			MRPL54	-	NULL	ENSG00000183617		0.567	MRPL54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL54	HGNC	protein_coding	OTTHUMT00000453443.1	-	0.00	47	0	C	NM_172251		3765204	+1	tier1	-	no_errors	ENST00000330133	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.000	T
MS4A10	341116	genome.wustl.edu	37	11	60557950	60557950	+	Nonsense_Mutation	SNP	G	G	T	rs374960907		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:60557950G>T	ENST00000308287.1	+	2	238	c.142G>T	c.(142-144)Gag>Tag	p.E48*		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	48				E -> D (in Ref. 1; BAC85498). {ECO:0000305}.		integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						ACACCAGCACGAGAAGTCCCA	0.622																																																	0													82.0	78.0	80.0					11																	60557950		2203	4300	6503	SO:0001587	stop_gained	0			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.142G>T	11.37:g.60557950G>T	ENSP00000311862:p.Glu48*		B2RP45|Q96PG3	Nonsense_Mutation	SNP	pfam_CD20-like	p.E48*	ENST00000308287.1	37	c.142	CCDS7992.1	11	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452560	0.43531	.	.	ENSG00000172689	ENST00000308287	.	.	.	3.3	-0.874	0.10631	.	0.663541	0.12499	N	0.463544	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-7.6722	7.1591	0.25654	0.1987:0.1454:0.6559:0.0	.	.	.	.	X	48	.	ENSP00000311862:E48X	E	+	1	0	MS4A10	60314526	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.171000	0.03115	-0.159000	0.11021	-1.149000	0.01842	GAG	MS4A10	-	NULL	ENSG00000172689		0.622	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A10	HGNC	protein_coding	OTTHUMT00000395619.1		0.00	60	0	G	NM_206893		60557950	+1			no_errors	ENST00000308287	ensembl	human	known	74_37	nonsense	6.38	44	3	SNP	0.002	T
MT-ND5	4540	genome.wustl.edu	37	M	12904	12904	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrM:12904A>G	ENST00000361567.2	+	1	568	c.568A>G	c.(568-570)Atc>Gtc	p.I190V	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	190					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TAGCATGATTTATCCTACACT	0.507																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.568A>G	M.37:g.12904A>G	ENSP00000354813:p.Ile190Val		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.I190V	ENST00000361567.2	37	c.568		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.507	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	18	0	A	YP_003024036		12904	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	22.22	7	2	SNP	NULL	G
NAV3	89795	genome.wustl.edu	37	12	78444920	78444920	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:78444920A>G	ENST00000397909.2	+	11	2682	c.2509A>G	c.(2509-2511)Aac>Gac	p.N837D	RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000228327.6_Missense_Mutation_p.N837D|NAV3_ENST00000266692.7_Missense_Mutation_p.N837D|NAV3_ENST00000536525.2_Missense_Mutation_p.N837D			Q8IVL0	NAV3_HUMAN	neuron navigator 3	837						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TGATGACATCAACAGTGGGTA	0.453										HNSCC(70;0.22)																																							0													66.0	65.0	66.0					12																	78444920		2034	4206	6240	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2509A>G	12.37:g.78444920A>G	ENSP00000381007:p.Asn837Asp		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.N837D	ENST00000397909.2	37	c.2509		12	.	.	.	.	.	.	.	.	.	.	A	22.3	4.276619	0.80580	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.27557	1.77;1.78;1.76;1.66	5.79	5.79	0.91817	.	0.000000	0.43110	U	0.000608	T	0.24353	0.0590	N	0.25647	0.755	0.80722	D	1	P;P;P	0.44195	0.65;0.828;0.628	B;B;B	0.40066	0.247;0.157;0.318	T	0.02307	-1.1179	10	0.27785	T	0.31	-27.1311	16.1249	0.81386	1.0:0.0:0.0:0.0	.	837;837;837	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	D	837	ENSP00000446132:N837D;ENSP00000381007:N837D;ENSP00000228327:N837D;ENSP00000266692:N837D	ENSP00000228327:N837D	N	+	1	0	NAV3	76969051	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.871000	0.75531	2.208000	0.71279	0.533000	0.62120	AAC	NAV3	-	NULL	ENSG00000067798		0.453	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	48	0	A	NM_001024383		78444920	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	G
NCAM2	4685	genome.wustl.edu	37	21	22849776	22849776	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr21:22849776G>A	ENST00000400546.1	+	15	2310	c.2061G>A	c.(2059-2061)aaG>aaA	p.K687K	NCAM2_ENST00000284894.7_Silent_p.K545K	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	687	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TGCCACCAAAGCCCAACATTA	0.353																																																	0													81.0	75.0	76.0					21																	22849776		1865	4113	5978	SO:0001819	synonymous_variant	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2061G>A	21.37:g.22849776G>A			A8MQ06|B7Z841|Q7Z7F2	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.K687	ENST00000400546.1	37	c.2061	CCDS42910.1	21																																																																																			NCAM2	-	superfamily_Fibronectin_type3	ENSG00000154654		0.353	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	-	0.00	78	0	G	NM_004540		22849776	+1	tier1	-	no_errors	ENST00000400546	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.942	A
NEK5	341676	genome.wustl.edu	37	13	52661570	52661570	+	Silent	SNP	G	G	A	rs530160119		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr13:52661570G>A	ENST00000355568.4	-	15	1435	c.1296C>T	c.(1294-1296)gcC>gcT	p.A432A		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	432					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		AATTTGGCTCGGCAGAAGATG	0.368													G|||	1	0.000199681	0.0	0.0	5008	,	,		16417	0.0		0.001	False		,,,				2504	0.0																0													125.0	117.0	120.0					13																	52661570		2203	4300	6503	SO:0001819	synonymous_variant	0			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1296C>T	13.37:g.52661570G>A			Q5TAP5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A432	ENST00000355568.4	37	c.1296	CCDS31979.1	13																																																																																			NEK5	-	NULL	ENSG00000197168		0.368	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK5	HGNC	protein_coding	OTTHUMT00000045045.3	-	0.00	92	0	G	NM_199289		52661570	-1	tier1	-	no_errors	ENST00000355568	ensembl	human	known	74_37	silent	49.25	68	66	SNP	0.975	A
NFXL1	152518	genome.wustl.edu	37	4	47900808	47900808	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:47900808C>T	ENST00000507489.1	-	8	1231	c.1055G>A	c.(1054-1056)aGa>aAa	p.R352K	NFXL1_ENST00000381538.3_Missense_Mutation_p.R352K|NFXL1_ENST00000329043.3_Missense_Mutation_p.R352K	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	352						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						TGCACAACTTCTTTCAGCTAC	0.388																																																	0													174.0	166.0	169.0					4																	47900808		2203	4300	6503	SO:0001583	missense	0			AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.1055G>A	4.37:g.47900808C>T	ENSP00000422037:p.Arg352Lys		B1Q2K1|Q86VG1|Q8WVH1	Missense_Mutation	SNP	pfam_Znf_NFX1,smart_Znf_NFX1,pfscan_Znf_RING	p.R352K	ENST00000507489.1	37	c.1055	CCDS3478.2	4	.	.	.	.	.	.	.	.	.	.	C	7.697	0.692235	0.15039	.	.	ENSG00000170448	ENST00000381538;ENST00000507489;ENST00000329043	T;T;T	0.41400	1.0;1.0;1.0	5.19	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.36771	0.0979	L	0.50333	1.59	0.48696	D	0.999698	B	0.06786	0.001	B	0.10450	0.005	T	0.13442	-1.0509	10	0.18710	T	0.47	-9.5991	13.8417	0.63444	0.0:0.9251:0.0:0.0749	.	352	Q6ZNB6	NFXL1_HUMAN	K	352	ENSP00000370949:R352K;ENSP00000422037:R352K;ENSP00000333113:R352K	ENSP00000333113:R352K	R	-	2	0	NFXL1	47595565	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.001000	0.76297	1.168000	0.42723	0.655000	0.94253	AGA	NFXL1	-	NULL	ENSG00000170448		0.388	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NFXL1	HGNC	protein_coding	OTTHUMT00000361636.1	-	0.00	81	0	C	NM_152995		47900808	-1	tier1	-	no_errors	ENST00000381538	ensembl	human	known	74_37	missense	57.63	25	34	SNP	1.000	T
NLE1	54475	genome.wustl.edu	37	17	33464163	33464163	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:33464163G>A	ENST00000442241.4	-	7	724	c.685C>T	c.(685-687)Cgg>Tgg	p.R229W	NLE1_ENST00000586869.1_5'UTR|NLE1_ENST00000593176.1_5'UTR|NLE1_ENST00000360831.5_Missense_Mutation_p.R187W	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	229					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				TCCCAGATCCGCACACTGCCA	0.617																																																	0													62.0	54.0	57.0					17																	33464163		2203	4300	6503	SO:0001583	missense	0				CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.685C>T	17.37:g.33464163G>A	ENSP00000413572:p.Arg229Trp		O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NLE,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep,prints_Gprotein_B	p.R229W	ENST00000442241.4	37	c.685	CCDS11291.1	17	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848474	0.91277	.	.	ENSG00000073536	ENST00000442241;ENST00000537697	T	0.28454	1.61	4.51	4.51	0.55191	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.56891	0.2016	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.63637	-0.6592	10	0.87932	D	0	-25.4301	14.7766	0.69736	0.0:0.0:1.0:0.0	.	229	Q9NVX2	NLE1_HUMAN	W	229;205	ENSP00000413572:R229W	ENSP00000413572:R229W	R	-	1	2	NLE1	30488276	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.047000	0.76599	2.358000	0.79984	0.591000	0.81541	CGG	NLE1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000073536		0.617	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLE1	HGNC	protein_coding	OTTHUMT00000256441.2	-	0.00	71	0	G	NM_018096		33464163	-1	tier1	-	no_errors	ENST00000442241	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.995	A
NLRP3	114548	genome.wustl.edu	37	1	247587419	247587420	+	Frame_Shift_Ins	INS	-	-	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:247587419_247587420insG	ENST00000336119.3	+	3	1420_1421	c.674_675insG	c.(673-678)caggggfs	p.QG225fs	NLRP3_ENST00000366496.2_Frame_Shift_Ins_p.QG225fs|NLRP3_ENST00000348069.2_Frame_Shift_Ins_p.QG225fs|NLRP3_ENST00000366497.2_Frame_Shift_Ins_p.QG225fs|NLRP3_ENST00000391827.2_Frame_Shift_Ins_p.QG225fs|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391828.3_Frame_Shift_Ins_p.QG225fs	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	225	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GTGGTGTTCCAGGGGGCGGCAG	0.535																																																	0																																										SO:0001589	frameshift_variant	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.679dupG	1.37:g.247587424_247587424dupG	ENSP00000337383:p.Gln225fs		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Frame_Shift_Ins	INS	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A227fs	ENST00000336119.3	37	c.674_675	CCDS1632.1	1																																																																																			NLRP3	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000162711		0.535	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1		0.00	50	0	-	NM_004895		247587420	+1	tier1		no_errors	ENST00000336119	ensembl	human	known	74_37	frame_shift_ins	6.25	30	2	INS	1.000:1.000	G
NOD2	64127	genome.wustl.edu	37	16	50745944	50745944	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:50745944C>T	ENST00000300589.2	+	4	2227	c.2122C>T	c.(2122-2124)Cgc>Tgc	p.R708C	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	708					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				GGCCTGTGCCCGCTGGTGTCT	0.682																																																	0													26.0	28.0	27.0					16																	50745944		2197	4297	6494	SO:0001583	missense	0			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2122C>T	16.37:g.50745944C>T	ENSP00000300589:p.Arg708Cys		E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.R708C	ENST00000300589.2	37	c.2122	CCDS10746.1	16	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018863	0.54576	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.70986	-0.53	5.74	4.75	0.60458	.	0.189741	0.37261	N	0.002164	T	0.78916	0.4359	M	0.66939	2.045	0.09310	N	1	D;D;D	0.89917	1.0;0.998;1.0	P;P;P	0.60173	0.87;0.857;0.87	T	0.71391	-0.4607	10	0.62326	D	0.03	.	12.1848	0.54231	0.1695:0.8305:0.0:0.0	.	492;681;708	D6CHF9;Q9HC29-2;Q9HC29	.;.;NOD2_HUMAN	C	681;708	ENSP00000300589:R708C	ENSP00000300589:R708C	R	+	1	0	NOD2	49303445	0.209000	0.23505	0.663000	0.29738	0.972000	0.66771	0.819000	0.27308	2.712000	0.92718	0.561000	0.74099	CGC	NOD2	-	NULL	ENSG00000167207		0.682	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	HGNC	protein_coding	OTTHUMT00000256876.2	-	0.00	51	0	C	NM_022162		50745944	+1	tier1	-	no_errors	ENST00000300589	ensembl	human	known	74_37	missense	46.75	41	36	SNP	0.017	T
NOX3	50508	genome.wustl.edu	37	6	155751997	155751997	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:155751997G>T	ENST00000159060.2	-	8	973	c.871C>A	c.(871-873)Caa>Aaa	p.Q291K		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	291	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		ACAACTTCTTGTTGAAATCGC	0.368																																																	0													99.0	93.0	95.0					6																	155751997		2203	4300	6503	SO:0001583	missense	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.871C>A	6.37:g.155751997G>T	ENSP00000159060:p.Gln291Lys		Q9HBJ9	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.Q291K	ENST00000159060.2	37	c.871	CCDS5250.1	6	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117376	0.77323	.	.	ENSG00000074771	ENST00000159060	T	0.13657	2.57	5.86	5.86	0.93980	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.64402	D	0.000004	T	0.22898	0.0553	L	0.49455	1.56	0.58432	D	0.999998	D	0.76494	0.999	D	0.81914	0.995	T	0.00934	-1.1509	10	0.16896	T	0.51	-18.6392	20.5632	0.99335	0.0:0.0:1.0:0.0	.	291	Q9HBY0	NOX3_HUMAN	K	291	ENSP00000159060:Q291K	ENSP00000159060:Q291K	Q	-	1	0	NOX3	155793689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.773000	0.75006	2.937000	0.99478	0.650000	0.86243	CAA	NOX3	-	superfamily_Riboflavin_synthase-like_b-brl	ENSG00000074771		0.368	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1		0.00	27	0	G			155751997	-1			no_errors	ENST00000159060	ensembl	human	known	74_37	missense	5.88	31	2	SNP	1.000	T
NPNT	255743	genome.wustl.edu	37	4	106816881	106816881	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:106816881G>T	ENST00000379987.2	+	1	287		c.e1+1		NPNT_ENST00000506666.1_Splice_Site|NPNT_ENST00000453617.2_Splice_Site|NPNT_ENST00000427316.2_Splice_Site|NPNT_ENST00000514622.1_Splice_Site|NPNT_ENST00000305572.8_Splice_Site	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin						branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		TCGACGGGAGGTGAGCTGGGC	0.662																																																	0													9.0	11.0	10.0					4																	106816881		2109	4144	6253	SO:0001630	splice_region_variant	0				CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.71+1G>T	4.37:g.106816881G>T			A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Splice_Site	SNP	-	e1+1	ENST00000379987.2	37	c.71+1	CCDS34046.1	4	.	.	.	.	.	.	.	.	.	.	G	13.26	2.182712	0.38511	.	.	ENSG00000168743	ENST00000379987;ENST00000453617;ENST00000427316;ENST00000514622;ENST00000305572;ENST00000506666;ENST00000503451	.	.	.	3.39	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1495	0.42784	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NPNT	107036330	1.000000	0.71417	0.994000	0.49952	0.661000	0.39034	4.625000	0.61262	1.708000	0.51301	0.491000	0.48974	.	NPNT	-	-	ENSG00000168743		0.662	NPNT-001	KNOWN	basic|CCDS	protein_coding	NPNT	HGNC	protein_coding	OTTHUMT00000364083.1	-	0.00	168	0	G	NM_198278	Intron	106816881	+1	tier1	-	no_errors	ENST00000379987	ensembl	human	known	74_37	splice_site	53.19	44	50	SNP	0.998	T
NR1D2	9975	genome.wustl.edu	37	3	24009343	24009343	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:24009343G>C	ENST00000312521.4	+	7	1691	c.1372G>C	c.(1372-1374)Gaa>Caa	p.E458Q	NR1D2_ENST00000492552.1_3'UTR	NM_001145425.1|NM_005126.4	NP_001138897.1|NP_005117	Q14995	NR1D2_HUMAN	nuclear receptor subfamily 1, group D, member 2	458	Interaction with ZNHIT1.|Ligand-binding.				gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lipid homeostasis (GO:0055088)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of inflammatory response (GO:0050727)|regulation of lipid metabolic process (GO:0019216)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	22						TGATGCAAAGGAACGTACTGT	0.333																																																	0													105.0	104.0	104.0					3																	24009343		2203	4300	6503	SO:0001583	missense	0			BC045613	CCDS33718.1	3p24.1	2013-01-16			ENSG00000174738	ENSG00000174738		"""Nuclear hormone receptors"""	7963	protein-coding gene	gene with protein product		602304				7997240, 10198169	Standard	NM_005126		Approved	BD73, RVR, EAR-1r, HZF2, Hs.37288	uc003ccs.2	Q14995	OTTHUMG00000155659	ENST00000312521.4:c.1372G>C	3.37:g.24009343G>C	ENSP00000310006:p.Glu458Gln		B2R8Q3|O00402|Q86XD4	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E458Q	ENST00000312521.4	37	c.1372	CCDS33718.1	3	.	.	.	.	.	.	.	.	.	.	G	21.5	4.154308	0.78114	.	.	ENSG00000174738	ENST00000312521;ENST00000396676	D	0.96619	-4.07	5.88	4.99	0.66335	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.297642	0.40640	N	0.001058	D	0.95720	0.8608	N	0.25485	0.75	0.54753	D	0.999988	P	0.51653	0.947	P	0.57468	0.821	D	0.95753	0.8793	10	0.46703	T	0.11	.	16.9197	0.86161	0.0:0.1282:0.8718:0.0	.	458	Q14995	NR1D2_HUMAN	Q	458	ENSP00000310006:E458Q	ENSP00000310006:E458Q	E	+	1	0	NR1D2	23984347	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.894000	0.87336	1.444000	0.47605	0.655000	0.94253	GAA	NR1D2	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000174738		0.333	NR1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D2	HGNC	protein_coding	OTTHUMT00000341017.3	-	0.00	52	0	G			24009343	+1	tier1	-	no_errors	ENST00000312521	ensembl	human	known	74_37	missense	33.33	40	20	SNP	1.000	C
NTM	50863	genome.wustl.edu	37	11	132206283	132206284	+	3'UTR	DEL	AA	AA	-	rs542763858	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:132206283_132206284delAA	ENST00000374786.1	+	0	2757_2758				NTM_ENST00000374791.3_3'UTR|NTM_ENST00000474900.1_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						GTGAAAGGATAAAAAAAAAAAA	0.421																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*1244AA>-	11.37:g.132206293_132206294delAA			A0MTT2|Q6UXJ3|Q86VJ9	RNA	DEL	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.421	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1		0.00	21	0	AA	NM_016522		132206284	+1	tier1		no_errors	ENST00000474900	ensembl	human	known	74_37	rna	15.00	17	3	DEL	0.023:0.070	-
NUP153	9972	genome.wustl.edu	37	6	17629214	17629214	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:17629214T>G	ENST00000262077.2	-	18	3215	c.3216A>C	c.(3214-3216)aaA>aaC	p.K1072N	NUP153_ENST00000537253.1_Missense_Mutation_p.K1103N	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	1072					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			GCATTTCTTCTTTTTTAGCTT	0.468																																																	0													85.0	78.0	80.0					6																	17629214		2203	4300	6503	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.3216A>C	6.37:g.17629214T>G	ENSP00000262077:p.Lys1072Asn		B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.K1103N	ENST00000262077.2	37	c.3309	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	T	17.89	3.500356	0.64298	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.08634	3.08;3.07	5.5	-1.12	0.09808	.	0.000000	0.50627	D	0.000106	T	0.12689	0.0308	M	0.69823	2.125	0.42923	D	0.994299	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.948;0.993	T	0.02333	-1.1175	10	0.38643	T	0.18	-6.2674	11.1471	0.48436	0.0:0.5972:0.0:0.4028	.	1103;1052;1072	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	N	1072;1052;1103	ENSP00000262077:K1072N;ENSP00000444029:K1103N	ENSP00000262077:K1072N	K	-	3	2	NUP153	17737193	0.987000	0.35691	0.987000	0.45799	0.994000	0.84299	0.083000	0.14871	-0.144000	0.11314	0.496000	0.49642	AAA	NUP153	-	NULL	ENSG00000124789		0.468	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	73	0	T			17629214	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	missense	39.22	31	20	SNP	0.973	G
OCSTAMP	128506	genome.wustl.edu	37	20	45170430	45170430	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr20:45170430C>T	ENST00000279028.2	-	3	1197	c.1184G>A	c.(1183-1185)cGg>cAg	p.R395Q		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	395					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						GCGGGGACGCCGGGCGGGTAG	0.746																																																	0													5.0	6.0	6.0					20																	45170430		681	1573	2254	SO:0001583	missense	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1184G>A	20.37:g.45170430C>T	ENSP00000279028:p.Arg395Gln			Missense_Mutation	SNP	pfam_DC_STAMP-like	p.R395Q	ENST00000279028.2	37	c.1184	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	C	7.577	0.667856	0.14710	.	.	ENSG00000149635	ENST00000279028	T	0.29397	1.57	4.95	1.49	0.22878	Dendritic cell-specific transmembrane protein-like (1);	0.983100	0.08337	N	0.961405	T	0.10035	0.0246	N	0.02916	-0.46	0.09310	N	1	B	0.16802	0.019	B	0.13407	0.009	T	0.34527	-0.9825	10	0.08381	T	0.77	-13.868	1.8851	0.03236	0.1479:0.3749:0.1522:0.325	.	395	Q9BR26	CT123_HUMAN	Q	395	ENSP00000279028:R395Q	ENSP00000279028:R395Q	R	-	2	0	C20orf123	44603837	0.000000	0.05858	0.427000	0.26684	0.373000	0.29922	-0.797000	0.04570	0.082000	0.17018	0.655000	0.94253	CGG	OCSTAMP	-	pfam_DC_STAMP-like	ENSG00000149635		0.746	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2		0.00	27	0	C	XM_496476		45170430	-1			no_errors	ENST00000279028	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.004	T
OR13C4	138804	genome.wustl.edu	37	9	107289070	107289070	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:107289070A>G	ENST00000277216.3	-	1	420	c.421T>C	c.(421-423)Tat>Cat	p.Y141H		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						AGCAGTACATACACCACCTTG	0.448																																																	0													145.0	124.0	131.0					9																	107289070		2203	4300	6503	SO:0001583	missense	0				CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.421T>C	9.37:g.107289070A>G	ENSP00000277216:p.Tyr141His		Q6IF51|Q96R41	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y141H	ENST00000277216.3	37	c.421	CCDS35088.1	9	.	.	.	.	.	.	.	.	.	.	A	8.690	0.907205	0.17833	.	.	ENSG00000148136	ENST00000277216;ENST00000545903	T	0.00107	8.72	4.02	2.77	0.32553	GPCR, rhodopsin-like superfamily (1);	0.172233	0.27710	U	0.018177	T	0.00384	0.0012	M	0.79123	2.44	0.09310	N	1	D	0.76494	0.999	D	0.74348	0.983	T	0.39542	-0.9609	10	0.87932	D	0	.	8.7588	0.34661	0.8104:0.1896:0.0:0.0	.	141	Q8NGS5	O13C4_HUMAN	H	141;170	ENSP00000277216:Y141H	ENSP00000277216:Y141H	Y	-	1	0	OR13C4	106328891	0.027000	0.19231	0.066000	0.19879	0.044000	0.14063	2.614000	0.46359	1.798000	0.52647	0.477000	0.44152	TAT	OR13C4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000148136		0.448	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C4	HGNC	protein_coding	OTTHUMT00000053478.1	-	0.00	40	0	A			107289070	-1	tier1	-	no_errors	ENST00000277216	ensembl	human	known	74_37	missense	35.48	40	22	SNP	0.000	G
OSMR	9180	genome.wustl.edu	37	5	38933248	38933248	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:38933248C>T	ENST00000274276.3	+	18	3044	c.2642C>T	c.(2641-2643)cCa>cTa	p.P881L		NM_003999.2	NP_003990.1	Q99650	OSMR_HUMAN	oncostatin M receptor	881					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	oncostatin-M receptor complex (GO:0005900)	growth factor binding (GO:0019838)|oncostatin-M receptor activity (GO:0004924)	p.P881Q(1)		NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	46	all_lung(31;0.000365)					CCAAAAGCCCCAAGTATGCTG	0.483																																																	1	Substitution - Missense(1)	lung(1)											122.0	132.0	129.0					5																	38933248		2203	4300	6503	SO:0001583	missense	0			U60805	CCDS3928.1, CCDS54847.1	5p13.2	2013-02-11			ENSG00000145623	ENSG00000145623		"""Fibronectin type III domain containing"""	8507	protein-coding gene	gene with protein product		601743				8999038	Standard	NM_001168355		Approved	OSMRB	uc003jln.2	Q99650	OTTHUMG00000090811	ENST00000274276.3:c.2642C>T	5.37:g.38933248C>T	ENSP00000274276:p.Pro881Leu		Q6P4E8|Q96QJ6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.P881L	ENST00000274276.3	37	c.2642	CCDS3928.1	5	.	.	.	.	.	.	.	.	.	.	C	8.294	0.818333	0.16607	.	.	ENSG00000145623	ENST00000274276	T	0.48522	0.81	5.53	2.62	0.31277	.	2.319360	0.01356	N	0.012065	T	0.42562	0.1208	L	0.56769	1.78	0.09310	N	1	P	0.39282	0.666	B	0.33339	0.162	T	0.43940	-0.9360	10	0.62326	D	0.03	.	3.4736	0.07577	0.1776:0.5604:0.1711:0.0909	.	881	Q99650	OSMR_HUMAN	L	881	ENSP00000274276:P881L	ENSP00000274276:P881L	P	+	2	0	OSMR	38969005	0.001000	0.12720	0.002000	0.10522	0.019000	0.09904	0.780000	0.26760	1.456000	0.47831	0.655000	0.94253	CCA	OSMR	-	NULL	ENSG00000145623		0.483	OSMR-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OSMR	HGNC	protein_coding	OTTHUMT00000207609.2	-	0.00	64	0	C	NM_003999		38933248	+1	tier1	-	no_errors	ENST00000274276	ensembl	human	known	74_37	missense	70.83	21	51	SNP	0.000	T
PAX4	5078	genome.wustl.edu	37	7	127253852	127253852	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:127253852G>A	ENST00000341640.2	-	4	701	c.496C>T	c.(496-498)Cgg>Tgg	p.R166W	PAX4_ENST00000463946.1_Missense_Mutation_p.R164W|PAX4_ENST00000338516.3_Missense_Mutation_p.R174W|PAX4_ENST00000378740.2_Missense_Mutation_p.R166W	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	174					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						AAGATAGTCCGATTCCGGTGG	0.587																																					Ovarian(113;737 1605 7858 27720 34092)												0													84.0	82.0	83.0					7																	127253852		2203	4300	6503	SO:0001583	missense	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.496C>T	7.37:g.127253852G>A	ENSP00000339906:p.Arg166Trp		O95161|Q6B0H0	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.R166W	ENST00000341640.2	37	c.496	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310256	0.81358	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740;ENST00000463946	D;D;D	0.99186	-5.53;-5.53;-5.53	5.32	5.32	0.75619	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.070525	0.64402	D	0.000019	D	0.99447	0.9804	H	0.95504	3.68	0.52501	D	0.999957	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.962;1.0;0.999;0.943	D	0.98507	1.0617	10	0.87932	D	0	.	11.9	0.52678	0.0:0.0:0.8259:0.174	.	166;164;174;164	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	W	166;174;174;164	ENSP00000339906:R166W;ENSP00000344297:R174W;ENSP00000451923:R164W	ENSP00000344297:R174W	R	-	1	2	PAX4	127041088	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.812000	0.47994	2.661000	0.90470	0.650000	0.86243	CGG	PAX4	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000106331		0.587	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1	-	0.00	65	0	G			127253852	-1	tier1	-	no_errors	ENST00000341640	ensembl	human	known	74_37	missense	25.25	74	25	SNP	1.000	A
PCGF1	84759	genome.wustl.edu	37	2	74733931	74733931	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:74733931G>T	ENST00000233630.6	-	3	1191	c.280C>A	c.(280-282)Cca>Aca	p.P94T	LBX2-AS1_ENST00000603175.1_RNA|PCGF1_ENST00000480844.2_5'UTR|LBX2-AS1_ENST00000548978.2_RNA	NM_032673.2	NP_116062.2	Q9BSM1	PCGF1_HUMAN	polycomb group ring finger 1	94	Required for repressor activity.				histone H2A monoubiquitination (GO:0035518)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(2)	12						TTGAGCAGTGGCTGTGTCTCG	0.502																																																	0													153.0	133.0	140.0					2																	74733931		2203	4300	6503	SO:0001583	missense	0			AF087884	CCDS1946.2	2p13.1	2013-01-09			ENSG00000115289	ENSG00000115289		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	17615	protein-coding gene	gene with protein product		610231				11287196	Standard	NM_032673		Approved	NSPC1, RNF68, MGC10882	uc002slz.3	Q9BSM1	OTTHUMG00000129954	ENST00000233630.6:c.280C>A	2.37:g.74733931G>T	ENSP00000233630:p.Pro94Thr		Q7Z506	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P94T	ENST00000233630.6	37	c.280	CCDS1946.2	2	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324324	0.81580	.	.	ENSG00000115289	ENST00000233630	T	0.17054	2.3	5.69	4.82	0.62117	Zinc finger, RING/FYVE/PHD-type (1);	0.056713	0.64402	D	0.000001	T	0.45094	0.1325	M	0.87097	2.86	0.50813	D	0.999891	D	0.89917	1.0	D	0.83275	0.996	T	0.50423	-0.8830	10	0.87932	D	0	-9.4608	10.3893	0.44158	0.0894:0.0:0.9106:0.0	.	94	Q9BSM1	PCGF1_HUMAN	T	94	ENSP00000233630:P94T	ENSP00000233630:P94T	P	-	1	0	PCGF1	74587439	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.331000	0.96430	1.413000	0.46997	0.655000	0.94253	CCA	PCGF1	-	NULL	ENSG00000115289		0.502	PCGF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF1	HGNC	protein_coding	OTTHUMT00000252216.1		0.00	90	0	G	NM_032673		74733931	-1			no_errors	ENST00000233630	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
PCSK5	5125	genome.wustl.edu	37	9	78853891	78853891	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:78853891G>T	ENST00000545128.1	+	23	3421	c.2883G>T	c.(2881-2883)gaG>gaT	p.E961D		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	961	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ATGGCCGAGAGCACTTCCTGT	0.473																																																	0													39.0	35.0	36.0					9																	78853891		876	1991	2867	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2883G>T	9.37:g.78853891G>T	ENSP00000446280:p.Glu961Asp		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.E961D	ENST00000545128.1	37	c.2883	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	0.100	-1.153743	0.01700	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.28255	1.62;1.62	5.55	0.907	0.19321	.	0.764503	0.12530	N	0.460860	T	0.15739	0.0379	N	0.17901	0.54	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29731	-1.0002	8	0.12430	T	0.62	-8.9829	5.5504	0.17087	0.2842:0.2441:0.4717:0.0	.	.	.	.	D	961;664;634	ENSP00000446280:E961D;ENSP00000411654:E634D	ENSP00000365945:E664D	E	+	3	2	PCSK5	78043711	0.594000	0.26849	0.038000	0.18304	0.005000	0.04900	0.230000	0.17852	0.730000	0.32425	-0.469000	0.05056	GAG	PCSK5	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000099139		0.473	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	55	0	G			78853891	+1	tier1	-	no_errors	ENST00000545128	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.110	T
PDE3B	5140	genome.wustl.edu	37	11	14880604	14880604	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:14880604G>T	ENST00000282096.4	+	13	2889	c.2536G>T	c.(2536-2538)Gac>Tac	p.D846Y	PDE3B_ENST00000455098.2_Missense_Mutation_p.D795Y	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	846	Catalytic. {ECO:0000250}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	TTTATACAATGACAGATCTGT	0.333																																																	0													119.0	114.0	116.0					11																	14880604		2200	4294	6494	SO:0001583	missense	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.2536G>T	11.37:g.14880604G>T	ENSP00000282096:p.Asp846Tyr		B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.D846Y	ENST00000282096.4	37	c.2536	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465891	0.84425	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	D;D	0.82081	-1.57;-1.57	5.67	5.67	0.87782	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.94076	0.8101	H	0.94847	3.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95135	0.8258	10	0.87932	D	0	.	19.7714	0.96367	0.0:0.0:1.0:0.0	.	795;846	B7ZM37;Q13370	.;PDE3B_HUMAN	Y	846;795	ENSP00000282096:D846Y;ENSP00000388644:D795Y	ENSP00000282096:D846Y	D	+	1	0	PDE3B	14837180	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	9.476000	0.97823	2.666000	0.90696	0.655000	0.94253	GAC	PDE3B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000152270		0.333	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1	-	0.00	76	0	G	NM_000922		14880604	+1	tier1	-	no_errors	ENST00000282096	ensembl	human	known	74_37	missense	35.44	51	28	SNP	1.000	T
PDSS1	23590	genome.wustl.edu	37	10	26986739	26986740	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:26986739_26986740GC>TT	ENST00000376215.5	+	1	152_153	c.99_100GC>TT	c.(97-102)ggGCcg>ggTTcg	p.P34S	PDSS1_ENST00000376203.5_Missense_Mutation_p.P34S	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	34					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						GACCGTTGGGGCCGAGCGCCGC	0.777																																																	0																																										SO:0001583	missense	0			AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	Exception_encountered	10.37:g.26986739_26986740delinsTT	ENSP00000365388:p.Pro34Ser		Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Silent|Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.G33|p.P34S	ENST00000376215.5	37	c.99|c.100	CCDS31168.1	10																																																																																			PDSS1	-	NULL	ENSG00000148459		0.777	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDSS1	HGNC	protein_coding	OTTHUMT00000047276.1		0.00	22	0	G|C			26986739|26986740	+1			no_errors	ENST00000376215	ensembl	human	known	74_37	silent|missense	28.57	10	4	SNP	0.000	T
PER2	8864	genome.wustl.edu	37	2	239157804	239157804	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:239157804G>T	ENST00000254657.3	-	22	3796	c.3517C>A	c.(3517-3519)Cag>Aag	p.Q1173K	PER2_ENST00000254658.3_3'UTR|AC096574.4_ENST00000456601.1_RNA	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	1173	CRY binding domain. {ECO:0000250|UniProtKB:Q9Z301}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TGGAGTTTCTGTAGGAGCTTC	0.527																																																	0													128.0	138.0	135.0					2																	239157804		2203	4300	6503	SO:0001583	missense	0			AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.3517C>A	2.37:g.239157804G>T	ENSP00000254657:p.Gln1173Lys		A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,smart_PAS,pfscan_PAS	p.Q1173K	ENST00000254657.3	37	c.3517	CCDS2528.1	2	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679232	0.47886	.	.	ENSG00000132326	ENST00000254657	T	0.15372	2.43	5.32	5.32	0.75619	Period circadian-like, C-terminal (1);	0.169455	0.53938	D	0.000054	T	0.32346	0.0826	M	0.71581	2.175	0.80722	D	1	P;P	0.49559	0.925;0.925	P;P	0.49922	0.626;0.626	T	0.04811	-1.0925	10	0.72032	D	0.01	-11.9702	16.8724	0.86043	0.0:0.0:1.0:0.0	.	1173;1173	B4DH14;O15055	.;PER2_HUMAN	K	1173	ENSP00000254657:Q1173K	ENSP00000254657:Q1173K	Q	-	1	0	PER2	238822543	1.000000	0.71417	0.614000	0.29051	0.105000	0.19272	7.285000	0.78660	2.664000	0.90586	0.655000	0.94253	CAG	PER2	-	pfam_Period_circadian-like_C	ENSG00000132326		0.527	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER2	HGNC	protein_coding	OTTHUMT00000257167.1		0.00	58	0	G	NM_022817		239157804	-1			no_errors	ENST00000254657	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PES1	23481	genome.wustl.edu	37	22	30975882	30975882	+	Missense_Mutation	SNP	C	C	A	rs147644381		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:30975882C>A	ENST00000405677.1	-	14	1736	c.793G>T	c.(793-795)Gcc>Tcc	p.A265S	PES1_ENST00000354694.7_Missense_Mutation_p.A404S|PES1_ENST00000402284.3_Missense_Mutation_p.A387S|PES1_ENST00000402281.1_Missense_Mutation_p.A265S|PES1_ENST00000335214.6_Missense_Mutation_p.A399S	NM_001282328.1	NP_001269257.1			pescadillo ribosomal biogenesis factor 1											breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	29						AGGAGCCTGGCGTTCACTGAG	0.592																																																	0													89.0	94.0	92.0					22																	30975882		2203	4300	6503	SO:0001583	missense	0			U78310	CCDS13880.1, CCDS58802.1, CCDS74842.1	22q12.1	2012-02-23	2012-02-23		ENSG00000100029	ENSG00000100029			8848	protein-coding gene	gene with protein product		605819	"""pescadillo (zebrafish) homolog 1, containing BRCT domain"", ""pescadillo homolog 1, containing BRCT domain (zebrafish)"""			8985183, 10591208, 17353269	Standard	NM_014303		Approved	PES	uc003aij.2	O00541	OTTHUMG00000151077	ENST00000405677.1:c.793G>T	22.37:g.30975882C>A	ENSP00000385654:p.Ala265Ser			Missense_Mutation	SNP	pfam_Pescadillo,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.A404S	ENST00000405677.1	37	c.1210		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.6|27.6	4.844504|4.844504	0.91197|0.91197	.|.	.|.	ENSG00000100029|ENSG00000100029	ENST00000354694;ENST00000402281;ENST00000405677;ENST00000402284;ENST00000335214|ENST00000441668	T;T;T;T;T|.	0.33865|.	1.39;1.39;1.39;1.39;1.39|.	4.89|4.89	4.89|4.89	0.63831|0.63831	BRCT (3);|.	0.055621|.	0.64402|.	D|.	0.000001|.	T|T	0.71467|0.71467	0.3343|0.3343	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	0.999;0.99;1.0;0.999|.	D;P;D;D|.	0.74674|.	0.948;0.9;0.984;0.948|.	T|T	0.70241|0.70241	-0.4926|-0.4926	10|5	0.56958|.	D|.	0.05|.	-27.0472|-27.0472	17.6636|17.6636	0.88198|0.88198	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	404;387;399;404|.	B2RDF2;B5MCF9;O00541-2;O00541|.	.;.;.;PESC_HUMAN|.	S|L	404;265;265;387;399|10	ENSP00000346725:A404S;ENSP00000384366:A265S;ENSP00000385654:A265S;ENSP00000384252:A387S;ENSP00000334612:A399S|.	ENSP00000334612:A399S|.	A|R	-|-	1|2	0|0	PES1|PES1	29305882|29305882	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.967000|0.967000	0.64934|0.64934	4.648000|4.648000	0.61425|0.61425	2.272000|2.272000	0.75746|0.75746	0.655000|0.655000	0.94253|0.94253	GCC|CGC	PES1	-	superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000100029		0.592	PES1-002	PUTATIVE	basic|exp_conf	protein_coding	PES1	HGNC	protein_coding	OTTHUMT00000321189.2	-	0.00	62	0	C	NM_014303		30975882	-1	tier1	-	no_errors	ENST00000354694	ensembl	human	known	74_37	missense	43.06	41	31	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131831446	131831446	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:131831446C>T	ENST00000359827.3	-	28	5840	c.4878G>A	c.(4876-4878)cgG>cgA	p.R1626R	PLXNA4_ENST00000321063.4_Silent_p.R1626R			Q9HCM2	PLXA4_HUMAN	plexin A4	1626					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGCCCGTGTACCGGATCATGT	0.572																																																	0													110.0	123.0	118.0					7																	131831446		2175	4290	6465	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4878G>A	7.37:g.131831446C>T			A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.R1626	ENST00000359827.3	37	c.4878	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000221866		0.572	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	72	0	C	NM_181775		131831446	-1	tier1	-	no_errors	ENST00000321063	ensembl	human	known	74_37	silent	6.67	70	5	SNP	1.000	T
POLR1B	84172	genome.wustl.edu	37	2	113325658	113325658	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:113325658C>T	ENST00000263331.5	+	11	2441	c.1861C>T	c.(1861-1863)Cgg>Tgg	p.R621W	POLR1B_ENST00000417433.2_Missense_Mutation_p.R565W|POLR1B_ENST00000541869.1_Missense_Mutation_p.R659W|POLR1B_ENST00000409894.3_Missense_Mutation_p.R438W|POLR1B_ENST00000537335.1_Missense_Mutation_p.R410W	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	621					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TAGACTGGTACGGCCTGTGCA	0.433																																					Ovarian(16;256 576 9537 23969 41147)												0													215.0	190.0	198.0					2																	113325658		2203	4300	6503	SO:0001583	missense	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1861C>T	2.37:g.113325658C>T	ENSP00000263331:p.Arg621Trp		B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.R659W	ENST00000263331.5	37	c.1975	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766759	0.69878	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000537335;ENST00000417433;ENST00000458012	D;D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25;-2.25	5.53	2.66	0.31614	RNA polymerase I, Rpa2 specific (1);	0.121231	0.56097	N	0.000025	D	0.93396	0.7894	M	0.91972	3.26	0.80722	D	1	D;B;D;D	0.89917	1.0;0.014;1.0;1.0	D;B;D;D	0.97110	1.0;0.006;1.0;1.0	D	0.91538	0.5247	10	0.87932	D	0	-19.2176	7.5496	0.27788	0.3028:0.6177:0.0:0.0795	.	659;438;565;621	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	W	621;659;438;410;565;85	ENSP00000263331:R621W;ENSP00000444136:R659W;ENSP00000387143:R438W;ENSP00000437914:R410W;ENSP00000405358:R565W;ENSP00000394408:R85W	ENSP00000263331:R621W	R	+	1	2	POLR1B	113042129	0.999000	0.42202	0.449000	0.26957	0.996000	0.88848	3.617000	0.54181	0.251000	0.21505	0.563000	0.77884	CGG	POLR1B	-	pfam_RNA_pol_Rpa2-specific	ENSG00000125630		0.433	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	-	0.00	83	0	C	NM_019014		113325658	+1	tier1	-	no_errors	ENST00000541869	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.860	T
PPEF2	5470	genome.wustl.edu	37	4	76785642	76785642	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:76785642G>A	ENST00000286719.7	-	16	2315	c.1959C>T	c.(1957-1959)aaC>aaT	p.N653N		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	653	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGTTGGATCGGTTTCGATACA	0.338																																					NSCLC(105;1359 1603 15961 44567 47947)												0													201.0	186.0	191.0					4																	76785642		2203	4300	6503	SO:0001819	synonymous_variant	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1959C>T	4.37:g.76785642G>A			O14831	Silent	SNP	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_dom,prints_Ser/Thr-sp_prot-phosphatase,pfscan_EF_hand_dom	p.N653	ENST00000286719.7	37	c.1959	CCDS34013.1	4																																																																																			PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_hand_dom	ENSG00000156194		0.338	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	-	0.00	60	0	G	NM_006239		76785642	-1	tier1	-	no_errors	ENST00000286719	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	A
PPP1R12B	4660	genome.wustl.edu	37	1	202407190	202407190	+	Intron	DEL	T	T	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:202407190delT	ENST00000608999.1	+	10	1611				RP11-175B9.2_ENST00000602961.1_RNA|PPP1R12B_ENST00000356764.2_3'UTR|PPP1R12B_ENST00000336894.4_Intron|PPP1R12B_ENST00000480184.1_Frame_Shift_Del_p.V499fs	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TCCAAGGCAGTTTTTTTTTTC	0.388																																																	0									,,	92,128,3982		2,0,88,2,124,1885	28.0	30.0	30.0		,,	1.9	0.0	1		31	174,230,7838		0,1,173,13,203,3731	no	intron,utr-3,codingComplex	PPP1R12B	NM_002481.3,NM_001167858.1,NM_001167857.1	,,	2,1,261,15,327,5616	A1A1,A1A2,A1R,A2A2,A2R,RR		4.9017,5.2356,5.0145	,,	,,	202407190	266,358,11820	2202	4300	6502	SO:0001627	intron_variant	0			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1458+38T>-	1.37:g.202407190delT			A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F502fs	ENST00000608999.1	37	c.1496	CCDS1426.1	1																																																																																			PPP1R12B	-	NULL	ENSG00000077157		0.388	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3		0.00	50	0	T	NM_032105		202407190	+1	tier1		no_errors	ENST00000480184	ensembl	human	novel	74_37	frame_shift_del	8.11	34	3	DEL	0.041	-
PPP1R16B	26051	genome.wustl.edu	37	20	37531431	37531431	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr20:37531431C>T	ENST00000299824.1	+	6	881	c.692C>T	c.(691-693)aCa>aTa	p.T231I	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.T231I	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	231					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				CAGGGTGCCACACTGGTGAGG	0.612																																																	0													76.0	67.0	70.0					20																	37531431		2203	4300	6503	SO:0001583	missense	0			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.692C>T	20.37:g.37531431C>T	ENSP00000299824:p.Thr231Ile		A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T231I	ENST00000299824.1	37	c.692	CCDS13309.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.8|26.8	4.773861|4.773861	0.90108|0.90108	.|.	.|.	ENSG00000101445|ENSG00000101445	ENST00000438192|ENST00000299824;ENST00000373331	.|T;T	.|0.63744	.|-0.06;-0.06	4.14|4.14	4.14|4.14	0.48551|0.48551	.|Ankyrin repeat-containing domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.81706|0.81706	0.4879|0.4879	M|M	0.87038|0.87038	2.855|2.855	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.994;0.999	D|D	0.86039|0.86039	0.1518|0.1518	5|10	.|0.87932	.|D	.|0	.|.	16.9884|16.9884	0.86347|0.86347	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|231;231	.|E9PFS8;Q96T49	.|.;PP16B_HUMAN	Y|I	174|231	.|ENSP00000299824:T231I;ENSP00000362428:T231I	.|ENSP00000299824:T231I	H|T	+|+	1|2	0|0	PPP1R16B|PPP1R16B	36964845|36964845	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.969000|0.969000	0.65631|0.65631	7.413000|7.413000	0.80104|0.80104	2.298000|2.298000	0.77334|0.77334	0.655000|0.655000	0.94253|0.94253	CAC|ACA	PPP1R16B	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000101445		0.612	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16B	HGNC	protein_coding	OTTHUMT00000079220.2	-	0.00	55	0	C	NM_015568		37531431	+1	tier1	-	no_errors	ENST00000299824	ensembl	human	known	74_37	missense	35.29	33	18	SNP	1.000	T
PPP2R5C	5527	genome.wustl.edu	37	14	102360876	102360876	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:102360876G>T	ENST00000334743.5	+	8	879	c.831G>T	c.(829-831)aaG>aaT	p.K277N	PPP2R5C_ENST00000350249.3_Missense_Mutation_p.K277N|PPP2R5C_ENST00000445439.3_Missense_Mutation_p.K277N|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.K332N|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.K308N|PPP2R5C_ENST00000557095.1_Missense_Mutation_p.K277N	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	277					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TTTTAGAAAAGGACAGCACCC	0.378																																																	0													170.0	134.0	146.0					14																	102360876		2203	4300	6503	SO:0001583	missense	0			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.831G>T	14.37:g.102360876G>T	ENSP00000333905:p.Lys277Asn		B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.K308N	ENST00000334743.5	37	c.924	CCDS9964.1	14	.	.	.	.	.	.	.	.	.	.	G	27.8	4.861591	0.91433	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334756;ENST00000445439;ENST00000334743;ENST00000557095;ENST00000557716	T;T;T;T;T	0.57752	0.39;0.39;0.38;0.44;0.42	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81992	0.4940	H	0.98256	4.185	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;1.0;0.999;1.0;0.998;1.0	D;D;D;D;D;D	0.80764	0.938;0.989;0.936;0.969;0.913;0.994	D	0.87576	0.2481	10	0.87932	D	0	-23.2182	13.2812	0.60214	0.072:0.0:0.928:0.0	.	308;175;277;277;277;332	F5GWP3;E9PHN5;Q13362-3;Q13362;Q13362-2;Q6ZN33	.;.;.;2A5G_HUMAN;.;.	N	308;332;306;277;175;277;277;277;73	ENSP00000412324:K308N;ENSP00000329009:K332N;ENSP00000450931:K306N;ENSP00000262239:K277N;ENSP00000333905:K277N	ENSP00000329009:K332N	K	+	3	2	PPP2R5C	101430629	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.679000	0.68160	2.741000	0.93983	0.650000	0.86243	AAG	PPP2R5C	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000078304		0.378	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2	-	0.00	71	0	G	NM_002719		102360876	+1	tier1	-	no_errors	ENST00000422945	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
PQBP1	10084	genome.wustl.edu	37	X	48755853	48755853	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:48755853G>A	ENST00000376563.1	+	2	261	c.61G>A	c.(61-63)Gag>Aag	p.E21K	PQBP1_ENST00000218224.4_Missense_Mutation_p.E21K|PQBP1_ENST00000376566.4_Missense_Mutation_p.E21K|TIMM17B_ENST00000472645.1_5'Flank|PQBP1_ENST00000247140.4_Missense_Mutation_p.E21K|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000376548.5_Missense_Mutation_p.E21K|TIMM17B_ENST00000396779.3_5'Flank|TIMM17B_ENST00000465150.2_5'Flank|PQBP1_ENST00000396763.1_Missense_Mutation_p.E21K|PQBP1_ENST00000447146.2_Missense_Mutation_p.E21K|TIMM17B_ENST00000495490.2_5'Flank|TIMM17B_ENST00000376582.3_5'Flank	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	21					alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						CAAACATCTGGAGCCTGGTGA	0.542																																																	0													109.0	79.0	89.0					X																	48755853		2203	4300	6503	SO:0001583	missense	0			AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.61G>A	X.37:g.48755853G>A	ENSP00000365747:p.Glu21Lys		Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.E21K	ENST00000376563.1	37	c.61	CCDS14309.1	X	.	.	.	.	.	.	.	.	.	.	G	34	5.353662	0.95830	.	.	ENSG00000102103	ENST00000376563;ENST00000376566;ENST00000447146;ENST00000376548;ENST00000247140;ENST00000218224;ENST00000396763;ENST00000443648	T;T;T;T;T;T;T	0.78364	-1.15;-1.09;-1.15;-1.09;-1.15;-1.15;-1.17	6.08	6.08	0.98989	.	0.117743	0.56097	D	0.000027	D	0.83899	0.5354	L	0.55990	1.75	0.42742	D	0.993742	B;D;B;D;P	0.62365	0.299;0.976;0.005;0.991;0.948	B;P;B;P;P	0.61722	0.107;0.6;0.003;0.893;0.452	T	0.82864	-0.0246	10	0.38643	T	0.18	-31.8653	16.2759	0.82642	0.0:0.0:1.0:0.0	.	21;21;21;21;21	O60828-5;O60828-2;O60828-4;O60828-3;O60828	.;.;.;.;PQBP1_HUMAN	K	21	ENSP00000365747:E21K;ENSP00000365750:E21K;ENSP00000391759:E21K;ENSP00000247140:E21K;ENSP00000218224:E21K;ENSP00000379985:E21K;ENSP00000414861:E21K	ENSP00000218224:E21K	E	+	1	0	PQBP1	48640797	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.032000	0.70918	2.562000	0.86427	0.600000	0.82982	GAG	PQBP1	-	NULL	ENSG00000102103		0.542	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	PQBP1	HGNC	protein_coding	OTTHUMT00000060777.1	-	0.00	29	0	G	NM_001032381.1		48755853	+1	tier1	-	no_errors	ENST00000218224	ensembl	human	known	74_37	missense	53.33	7	8	SNP	1.000	A
PRAMEF1	65121	genome.wustl.edu	37	1	12855915	12855915	+	Missense_Mutation	SNP	C	C	T	rs377131924		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:12855915C>T	ENST00000332296.7	+	4	1298	c.1195C>T	c.(1195-1197)Cgc>Tgc	p.R399C	PRAMEF1_ENST00000400814.3_Missense_Mutation_p.R154C	NM_023013.2	NP_075389.1	O95521	PRAM1_HUMAN	PRAME family member 1	399					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGACCTGCTGCGCCACACCAG	0.557													.|||	1	0.000199681	0.0	0.0	5008	,	,		19646	0.0		0.0	False		,,,				2504	0.001																0								C	CYS/ARG	0,4404		0,0,2202	51.0	48.0	49.0		1195	-0.9	0.0	1		49	2,8586		0,2,4292	no	missense	PRAMEF1	NM_023013.2	180	0,2,6494	TT,TC,CC		0.0233,0.0,0.0154	benign	399/475	12855915	2,12990	2202	4294	6496	SO:0001583	missense	0			AL049686	CCDS148.1	1p36.21	2013-01-17			ENSG00000116721	ENSG00000116721		"""-"""	28840	protein-coding gene	gene with protein product							Standard	NM_023013		Approved		uc001auj.2	O95521	OTTHUMG00000001928	ENST00000332296.7:c.1195C>T	1.37:g.12855915C>T	ENSP00000332134:p.Arg399Cys		Q9UQP2	Missense_Mutation	SNP	NULL	p.R399C	ENST00000332296.7	37	c.1195	CCDS148.1	1	.	.	.	.	.	.	.	.	.	.	.	4.223	0.040221	0.08148	0.0	2.33E-4	ENSG00000116721	ENST00000332296;ENST00000400814	T;T	0.50001	0.76;0.76	1.56	-0.89	0.10577	.	1.571450	0.04233	N	0.335492	T	0.36908	0.0984	L	0.47716	1.5	0.09310	N	1	B	0.21606	0.058	B	0.14023	0.01	T	0.12142	-1.0559	10	0.32370	T	0.25	.	2.9885	0.05975	0.0:0.508:0.2875:0.2045	.	399	O95521	PRAM1_HUMAN	C	399;154	ENSP00000332134:R399C;ENSP00000383616:R154C	ENSP00000332134:R399C	R	+	1	0	PRAMEF1	12778502	0.011000	0.17503	0.009000	0.14445	0.020000	0.10135	0.203000	0.17315	-0.245000	0.09625	0.205000	0.17691	CGC	PRAMEF1	-	NULL	ENSG00000116721		0.557	PRAMEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF1	HGNC	protein_coding	OTTHUMT00000005458.1		0.00	327	0	C	NM_023013		12855915	+1			no_errors	ENST00000332296	ensembl	human	known	74_37	missense	5.02	415	22	SNP	0.012	T
PRDM16	63976	genome.wustl.edu	37	1	3329152	3329152	+	Silent	SNP	C	C	T	rs370931714	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:3329152C>T	ENST00000270722.5	+	9	2440	c.2391C>T	c.(2389-2391)tcC>tcT	p.S797S	PRDM16_ENST00000511072.1_Silent_p.S798S|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378398.3_Silent_p.S798S|PRDM16_ENST00000441472.2_Silent_p.S797S|PRDM16_ENST00000442529.2_Silent_p.S797S|PRDM16_ENST00000514189.1_Silent_p.S798S|PRDM16_ENST00000378391.2_Silent_p.S797S			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	797	Interaction with CTBP1 and CTBP2. {ECO:0000250}.|Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CCCCCGCATCCGGCGAGGAGC	0.701			T	EVI1	"""MDS, AML"""								C|||	4	0.000798722	0.003	0.0	5008	,	,		11216	0.0		0.0	False		,,,				2504	0.0							Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0								C	,	3,3727		0,3,1862	9.0	12.0	11.0		2391,2391	-6.4	0.0	1		11	0,8020		0,0,4010	no	coding-synonymous,coding-synonymous	PRDM16	NM_022114.3,NM_199454.2	,	0,3,5872	TT,TC,CC		0.0,0.0804,0.0255	,	797/1277,797/1258	3329152	3,11747	1865	4010	5875	SO:0001819	synonymous_variant	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.2391C>T	1.37:g.3329152C>T			A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.S797	ENST00000270722.5	37	c.2391	CCDS41236.2	1																																																																																			PRDM16	-	NULL	ENSG00000142611		0.701	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	-	0.00	137	0	C	NM_022114		3329152	+1	tier1	-	no_errors	ENST00000270722	ensembl	human	known	74_37	silent	41.73	74	53	SNP	0.016	T
PRAMEF2	65122	genome.wustl.edu	37	1	12921404	12921404	+	Missense_Mutation	SNP	C	C	T	rs576051310	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:12921404C>T	ENST00000240189.2	+	4	1282	c.1195C>T	c.(1195-1197)Cgc>Tgc	p.R399C		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	399					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGACCTGCTGCGCCACACCAG	0.557													.|||	3	0.000599042	0.0	0.0	5008	,	,		26711	0.001		0.0	False		,,,				2504	0.002																0													72.0	75.0	74.0					1																	12921404		2202	4296	6498	SO:0001583	missense	0				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.1195C>T	1.37:g.12921404C>T	ENSP00000240189:p.Arg399Cys			Missense_Mutation	SNP	NULL	p.R399C	ENST00000240189.2	37	c.1195	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	C	2.140	-0.397001	0.04899	.	.	ENSG00000120952	ENST00000240189	T	0.50001	0.76	0.824	-0.325	0.12702	.	1.555060	0.04295	N	0.346332	T	0.35653	0.0939	L	0.39245	1.2	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.13282	-1.0515	10	0.33141	T	0.24	.	2.8894	0.05671	0.0:0.5607:0.0:0.4393	.	399	O60811	PRAM2_HUMAN	C	399	ENSP00000240189:R399C	ENSP00000240189:R399C	R	+	1	0	PRAMEF2	12843991	0.002000	0.14202	0.003000	0.11579	0.003000	0.03518	0.107000	0.15375	-0.121000	0.11787	0.173000	0.16961	CGC	PRAMEF2	-	NULL	ENSG00000120952		0.557	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	-	0.00	304	0	C	NM_023014		12921404	+1	tier1	-	no_errors	ENST00000240189	ensembl	human	known	74_37	missense	15.28	254	46	SNP	0.003	T
PRKAB1	5564	genome.wustl.edu	37	12	120114351	120114351	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:120114351G>A	ENST00000229328.5	+	5	1034	c.542G>A	c.(541-543)aGt>aAt	p.S181N	PRKAB1_ENST00000541640.1_Missense_Mutation_p.S181N|PRKAB1_ENST00000540121.1_Missense_Mutation_p.S15N	NM_006253.4	NP_006244.2	Q9Y478	AAKB1_HUMAN	protein kinase, AMP-activated, beta 1 non-catalytic subunit	181					cell cycle arrest (GO:0007050)|fatty acid biosynthetic process (GO:0006633)|insulin receptor signaling pathway (GO:0008286)|membrane organization (GO:0061024)|positive regulation of gene expression (GO:0010628)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase activity (GO:0004672)			endometrium(2)|large_intestine(3)|lung(5)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.166)	Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Metformin(DB00331)	GAGCTGTCCAGTTCTCCCCCA	0.517																																																	0													134.0	128.0	130.0					12																	120114351		2203	4300	6503	SO:0001583	missense	0			BC001823	CCDS9191.1	12q24.1-q24.3	2008-05-14			ENSG00000111725	ENSG00000111725			9378	protein-coding gene	gene with protein product	"""AMPK beta 1"""	602740				8557660	Standard	NM_006253		Approved		uc001txg.3	Q9Y478	OTTHUMG00000168954	ENST00000229328.5:c.542G>A	12.37:g.120114351G>A	ENSP00000229328:p.Ser181Asn		Q9UBV0|Q9UE20|Q9UEX2|Q9Y6V8	Missense_Mutation	SNP	pfam_AMP_prot_kin_bsu_interact-dom,superfamily_Ig_E-set	p.S181N	ENST00000229328.5	37	c.542	CCDS9191.1	12	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204750	0.58234	.	.	ENSG00000111725	ENST00000229328;ENST00000541640;ENST00000539596;ENST00000540121;ENST00000545223	.	.	.	5.79	5.79	0.91817	.	0.108515	0.85682	D	0.000000	T	0.66076	0.2753	M	0.73962	2.25	0.80722	D	1	P	0.36837	0.571	B	0.38921	0.285	T	0.62737	-0.6791	9	0.17832	T	0.49	-8.6995	20.0371	0.97565	0.0:0.0:1.0:0.0	.	181	Q9Y478	AAKB1_HUMAN	N	181;181;144;15;15	.	ENSP00000229328:S181N	S	+	2	0	PRKAB1	118598734	1.000000	0.71417	0.996000	0.52242	0.401000	0.30781	9.476000	0.97823	2.734000	0.93682	0.655000	0.94253	AGT	PRKAB1	-	NULL	ENSG00000111725		0.517	PRKAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAB1	HGNC	protein_coding	OTTHUMT00000401731.2	-	0.00	100	0	G	NM_006253		120114351	+1	tier1	-	no_errors	ENST00000229328	ensembl	human	known	74_37	missense	32.67	68	33	SNP	1.000	A
PRMT5	10419	genome.wustl.edu	37	14	23394147	23394147	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr14:23394147G>A	ENST00000324366.8	-	8	1103	c.880C>T	c.(880-882)Cct>Tct	p.P294S	PRMT5-AS1_ENST00000457443.2_RNA|PRMT5_ENST00000216350.8_Missense_Mutation_p.P233S|PRMT5-AS1_ENST00000599580.2_RNA|PRMT5_ENST00000553897.1_Missense_Mutation_p.P250S|PRMT5-AS1_ENST00000590290.1_RNA|PRMT5-AS1_ENST00000609885.1_RNA|PRMT5_ENST00000538452.1_Missense_Mutation_p.P188S|PRMT5_ENST00000553641.1_5'Flank|PRMT5_ENST00000397440.4_Missense_Mutation_p.P123S|PRMT5-AS1_ENST00000595662.1_RNA|PRMT5-AS1_ENST00000424245.2_RNA|PRMT5-AS1_ENST00000587245.2_RNA|PRMT5_ENST00000397441.2_Missense_Mutation_p.P277S	NM_006109.3	NP_006100.2	O14744	ANM5_HUMAN	protein arginine methyltransferase 5	294					cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|endothelial cell activation (GO:0042118)|gene expression (GO:0010467)|histone H4-R3 methylation (GO:0043985)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|peptidyl-arginine N-methylation (GO:0035246)|regulation of mitosis (GO:0007088)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|histone-arginine N-methyltransferase activity (GO:0008469)|methyltransferase activity (GO:0008168)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|transcription corepressor activity (GO:0003714)			endometrium(4)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	25	all_cancers(95;2.76e-05)			GBM - Glioblastoma multiforme(265;0.0126)		TAGGCATTAGGTGGAGGACGG	0.522																																																	0													202.0	195.0	197.0					14																	23394147		2203	4300	6503	SO:0001583	missense	0			AF015913	CCDS9579.1, CCDS41922.1, CCDS61394.1, CCDS61395.1, CCDS61396.1	14q11.2	2014-06-12	2006-02-16	2006-02-16	ENSG00000100462	ENSG00000100462	2.1.1.125	"""Protein arginine methyltransferases"""	10894	protein-coding gene	gene with protein product		604045	"""skb1 (S. pombe) homolog"", ""SKB1 homolog (S. pombe)"""	HRMT1L5, SKB1		9843966	Standard	NM_001282955		Approved	SKB1Hs	uc001whm.1	O14744	OTTHUMG00000028709	ENST00000324366.8:c.880C>T	14.37:g.23394147G>A	ENSP00000319169:p.Pro294Ser		A8MTP3|A8MZ91|B4DX49|B4DY30|B5BU10|D3DS33|E2QRE7|Q6IBR1|Q9UKH1	Missense_Mutation	SNP	pfam_Arg_MeTrfase,pirsf_Arg_MeTrfase_PRMT5	p.P294S	ENST00000324366.8	37	c.880	CCDS9579.1	14	.	.	.	.	.	.	.	.	.	.	G	13.46	2.243285	0.39697	.	.	ENSG00000100462	ENST00000324366;ENST00000397441;ENST00000397440;ENST00000216350;ENST00000538452;ENST00000553897;ENST00000553502;ENST00000555530;ENST00000556043;ENST00000553550	.	.	.	6.04	6.04	0.98038	.	0.095738	0.64402	D	0.000001	T	0.62454	0.2429	L	0.58583	1.82	0.80722	D	1	B;B;B;P;B	0.35944	0.232;0.078;0.078;0.529;0.274	B;B;B;B;B	0.39027	0.07;0.055;0.115;0.288;0.115	T	0.56456	-0.7976	9	0.14252	T	0.57	-14.1838	19.3507	0.94384	0.0:0.0:1.0:0.0	.	250;233;123;294;277	G3V5W5;B4DX49;A8MTP3;O14744;A8MZ91	.;.;.;ANM5_HUMAN;.	S	294;277;123;233;188;250;37;189;46;140	.	ENSP00000216350:P233S	P	-	1	0	PRMT5	22463987	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.032000	0.93736	2.873000	0.98535	0.561000	0.74099	CCT	PRMT5	-	pfam_Arg_MeTrfase,pirsf_Arg_MeTrfase_PRMT5	ENSG00000100462		0.522	PRMT5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT5	HGNC	protein_coding	OTTHUMT00000071674.3	-	0.00	93	0	G			23394147	-1	tier1	-	no_errors	ENST00000324366	ensembl	human	known	74_37	missense	19.44	87	21	SNP	1.000	A
PSMD3	5709	genome.wustl.edu	37	17	38153633	38153634	+	Splice_Site	INS	-	-	GTAA			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:38153633_38153634insGTAA	ENST00000264639.4	+	11	1701	c.1527_1527insGTAA	c.(1528-1530)gaa>gaGTAAa	p.-510fs	PSMD3_ENST00000541736.1_3'UTR	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					AGTCTGCAGAGGTAAGCTCTCT	0.554																																					Ovarian(186;531 2051 6385 19668 48409)												0																																										SO:0001630	splice_region_variant	0			D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.1527+1->GTAA	17.37:g.38153634_38153637dupGTAA			B3KMW9|B4DT72|Q96EI2|Q9BQA4	Frame_Shift_Ins	INS	pfam_26S_Psome_reg_C,pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.E509fs	ENST00000264639.4	37	c.1527_1528	CCDS11356.1	17																																																																																			PSMD3	-	pfam_26S_Psome_reg_C	ENSG00000108344		0.554	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD3	HGNC	protein_coding	OTTHUMT00000257018.1		0.00	67	0	-	NM_002809	Frame_Shift_Ins	38153634	+1	tier1		no_errors	ENST00000264639	ensembl	human	known	74_37	frame_shift_ins	11.36	78	10	INS	1.000:1.000	GTAA
PSTPIP2	9050	genome.wustl.edu	37	18	43585474	43585474	+	Silent	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr18:43585474G>T	ENST00000409746.5	-	6	449	c.378C>A	c.(376-378)atC>atA	p.I126I	PSTPIP2_ENST00000588801.1_5'UTR|PSTPIP2_ENST00000589328.1_Silent_p.I126I	NM_024430.3	NP_077748.3	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting protein 2	126						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	17						TTTGTTTATGGATAGCATCCA	0.308																																																	0													107.0	98.0	101.0					18																	43585474		2201	4298	6499	SO:0001819	synonymous_variant	0				CCDS32820.2	18q12	2008-07-28			ENSG00000152229	ENSG00000152229			9581	protein-coding gene	gene with protein product						9804817	Standard	NM_024430		Approved		uc002lbp.4	Q9H939	OTTHUMG00000152674	ENST00000409746.5:c.378C>A	18.37:g.43585474G>T				Silent	SNP	pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.I126	ENST00000409746.5	37	c.378	CCDS32820.2	18																																																																																			PSTPIP2	-	NULL	ENSG00000152229		0.308	PSTPIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSTPIP2	HGNC	protein_coding	OTTHUMT00000327522.1		0.00	53	0	G			43585474	-1			no_errors	ENST00000409746	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.041	T
PTPN13	5783	genome.wustl.edu	37	4	87691018	87691018	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:87691018G>A	ENST00000411767.2	+	29	4649	c.4586G>A	c.(4585-4587)aGc>aAc	p.S1529N	PTPN13_ENST00000511467.1_Missense_Mutation_p.S1534N|PTPN13_ENST00000316707.6_Missense_Mutation_p.S1338N|PTPN13_ENST00000427191.2_Missense_Mutation_p.S1510N|PTPN13_ENST00000436978.1_Missense_Mutation_p.S1534N			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1529	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		ATTAATGCCAGCATAGTAAGG	0.368																																																	0													97.0	94.0	95.0					4																	87691018		1835	4087	5922	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4586G>A	4.37:g.87691018G>A	ENSP00000407249:p.Ser1529Asn		B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S1534N	ENST00000411767.2	37	c.4601	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	17.46	3.396091	0.62177	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.26810	1.71;1.71;1.71;1.71;1.71	5.74	5.74	0.90152	PDZ/DHR/GLGF (4);	0.104737	0.42420	D	0.000714	T	0.32941	0.0846	N	0.12443	0.215	0.51012	D	0.999907	D;P;D;P	0.67145	0.992;0.653;0.996;0.837	P;P;D;P	0.68353	0.856;0.647;0.957;0.772	T	0.17868	-1.0355	10	0.48119	T	0.1	.	16.4226	0.83772	0.0:0.14:0.86:0.0	.	1338;1510;1529;1534	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	N	1510;1534;1338;1529;1534;1478	ENSP00000408368:S1510N;ENSP00000394794:S1534N;ENSP00000322675:S1338N;ENSP00000407249:S1529N;ENSP00000426626:S1534N	ENSP00000322675:S1338N	S	+	2	0	PTPN13	87910042	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.958000	0.70330	2.715000	0.92844	0.655000	0.94253	AGC	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000163629		0.368	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	119	0	G			87691018	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	A
PTPRC	5788	genome.wustl.edu	37	1	198687284	198687284	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:198687284G>T	ENST00000367376.2	+	14	1677	c.1506G>T	c.(1504-1506)aaG>aaT	p.K502N	PTPRC_ENST00000442510.2_Missense_Mutation_p.K504N|PTPRC_ENST00000352140.3_Missense_Mutation_p.K454N|PTPRC_ENST00000594404.1_Missense_Mutation_p.K341N|PTPRC_ENST00000348564.6_Missense_Mutation_p.K343N	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	502	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						TGCATGTCAAGTGTAGGCCTC	0.408																																																	0													82.0	78.0	79.0					1																	198687284		2203	4300	6503	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.1506G>T	1.37:g.198687284G>T	ENSP00000356346:p.Lys502Asn		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.K504N	ENST00000367376.2	37	c.1512		1	.	.	.	.	.	.	.	.	.	.	G	8.474	0.858258	0.17178	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564	T	0.56776	0.44	4.3	-8.6	0.00889	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.984470	0.02429	N	0.083405	T	0.42040	0.1185	M	0.61703	1.905	0.09310	N	1	B;B;B;B;B	0.26318	0.074;0.146;0.056;0.034;0.06	B;B;B;B;B	0.31495	0.103;0.131;0.048;0.029;0.029	T	0.30446	-0.9978	10	0.26408	T	0.33	.	0.4825	0.00550	0.2408:0.2021:0.3096:0.2476	.	438;438;343;454;502	F5GXZ3;B4DSZ5;B1ALS3;E9PC28;P08575	.;.;.;.;PTPRC_HUMAN	N	504;438;454;454;388;502;436;341	ENSP00000193532:K454N	ENSP00000306782:K341N	K	+	3	2	PTPRC	196953907	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-5.061000	0.00155	-2.505000	0.00508	0.585000	0.79938	AAG	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000081237		0.408	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		-	0.00	75	0	G			198687284	+1	tier1	-	no_errors	ENST00000442510	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.000	T
RAB10	10890	genome.wustl.edu	37	2	26350735	26350735	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:26350735G>A	ENST00000264710.4	+	5	933	c.434G>A	c.(433-435)gGt>gAt	p.G145D	RAB10_ENST00000462003.1_3'UTR	NM_016131.4	NP_057215.3	P61026	RAB10_HUMAN	RAB10, member RAS oncogene family	145					antigen processing and presentation (GO:0019882)|axonogenesis (GO:0007409)|basolateral protein localization (GO:0061467)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum tubular network organization (GO:0071786)|endosomal transport (GO:0016197)|establishment of neuroblast polarity (GO:0045200)|establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|establishment of protein localization to membrane (GO:0090150)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi to plasma membrane transport (GO:0006893)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|polarized epithelial cell differentiation (GO:0030859)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum tubular network (GO:0071782)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|insulin-responsive compartment (GO:0032593)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGGAGCATGGTATTAGGTTT	0.343																																																	0													160.0	153.0	155.0					2																	26350735		2203	4300	6503	SO:0001583	missense	0			AF106681	CCDS1720.1	2p23.3	2008-05-21			ENSG00000084733	ENSG00000084733		"""RAB, member RAS oncogene"""	9759	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein"""	612672				7688123	Standard	NM_016131		Approved		uc002rgv.3	P61026	OTTHUMG00000094796	ENST00000264710.4:c.434G>A	2.37:g.26350735G>A	ENSP00000264710:p.Gly145Asp		D6W538|O88386|Q6IA52|Q9D7X6|Q9H0T3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G145D	ENST00000264710.4	37	c.434	CCDS1720.1	2	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855465	0.71719	.	.	ENSG00000084733	ENST00000264710	D	0.81579	-1.51	5.45	5.45	0.79879	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.80529	0.4640	L	0.56769	1.78	0.80722	D	1	B	0.17038	0.02	B	0.29663	0.105	T	0.77739	-0.2475	10	0.72032	D	0.01	.	16.3594	0.83251	0.0:0.0:1.0:0.0	.	145	P61026	RAB10_HUMAN	D	145	ENSP00000264710:G145D	ENSP00000264710:G145D	G	+	2	0	RAB10	26204239	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.018000	0.93657	2.712000	0.92718	0.650000	0.86243	GGT	RAB10	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000084733		0.343	RAB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB10	HGNC	protein_coding	OTTHUMT00000211610.1	-	0.00	88	0	G	NM_016131		26350735	+1	tier1	-	no_errors	ENST00000264710	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
RAP1GAP	5909	genome.wustl.edu	37	1	21978179	21978179	+	Intron	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:21978179C>T	ENST00000374765.4	-	2	53				RAP1GAP_ENST00000374757.3_5'UTR|RAP1GAP_ENST00000542643.2_Intron|RAP1GAP_ENST00000290101.4_Intron	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein						GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GGCCCACCCGCCCAAACGCGA	0.711																																																	0													9.0	8.0	8.0					1																	21978179		863	1968	2831	SO:0001627	intron_variant	0			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.148-1890G>A	1.37:g.21978179C>T			J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	RNA	SNP	-	NULL	ENST00000374765.4	37	NULL	CCDS218.1	1																																																																																			RAP1GAP	-	-	ENSG00000076864		0.711	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GAP	HGNC	protein_coding	OTTHUMT00000019759.2	-	0.00	75	0	C	NM_002885		21978179	-1	tier1	-	no_errors	ENST00000374757	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.006	T
RAB25	57111	genome.wustl.edu	37	1	156038211	156038211	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:156038211C>T	ENST00000361084.5	+	3	631	c.390C>T	c.(388-390)agC>agT	p.S130S	RAB25_ENST00000487325.1_3'UTR	NM_020387.2	NP_065120.2	P57735	RAB25_HUMAN	RAB25, member RAS oncogene family	130					positive regulation of cell proliferation (GO:0008284)|protein transport (GO:0015031)|pseudopodium organization (GO:0031268)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	GTP binding (GO:0005525)|myosin V binding (GO:0031489)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	Hepatocellular(266;0.158)|all_neural(408;0.195)					GTGACCTCAGCCAGGCCCGGG	0.587																																																	0													70.0	79.0	76.0					1																	156038211		2167	4270	6437	SO:0001819	synonymous_variant	0			AF083124	CCDS41413.1	1q22	2008-07-03			ENSG00000132698	ENSG00000132698		"""RAB, member RAS oncogene"""	18238	protein-coding gene	gene with protein product		612942				11697911	Standard	NM_020387		Approved	CATX-8	uc001fnc.3	P57735	OTTHUMG00000017457	ENST00000361084.5:c.390C>T	1.37:g.156038211C>T			Q5VYA2|Q8NG24|Q96GB1|Q9BT12	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S130	ENST00000361084.5	37	c.390	CCDS41413.1	1																																																																																			RAB25	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000132698		0.587	RAB25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB25	HGNC	protein_coding	OTTHUMT00000046185.1		0.00	60	0	C			156038211	+1			no_errors	ENST00000361084	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	T
RBM19	9904	genome.wustl.edu	37	12	114356243	114356243	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:114356243C>T	ENST00000545145.2	-	20	2473	c.2395G>A	c.(2395-2397)Gtg>Atg	p.V799M	RBM19_ENST00000392561.3_Missense_Mutation_p.V799M|RBM19_ENST00000261741.5_Missense_Mutation_p.V799M	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	799	RRM 5. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TGGCCGTCCACGACGTGACCC	0.547																																																	0													128.0	107.0	114.0					12																	114356243		2203	4300	6503	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.2395G>A	12.37:g.114356243C>T	ENSP00000442053:p.Val799Met		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.V799M	ENST00000545145.2	37	c.2395	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221581	0.58560	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.75050	-0.9;-0.9;-0.9	4.48	4.48	0.54585	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.78886	0.4354	L	0.39514	1.22	0.54753	D	0.999988	D	0.56746	0.977	D	0.63283	0.913	T	0.79902	-0.1607	10	0.52906	T	0.07	-28.2928	14.1664	0.65480	0.0:1.0:0.0:0.0	.	799	Q9Y4C8	RBM19_HUMAN	M	799	ENSP00000442053:V799M;ENSP00000376344:V799M;ENSP00000261741:V799M	ENSP00000261741:V799M	V	-	1	0	RBM19	112840626	0.982000	0.34865	0.983000	0.44433	0.484000	0.33280	2.586000	0.46119	2.314000	0.78098	0.655000	0.94253	GTG	RBM19	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.547	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	-	0.00	35	0	C	NM_016196		114356243	-1	tier1	-	no_errors	ENST00000261741	ensembl	human	known	74_37	missense	13.73	44	7	SNP	0.989	T
RBM34	23029	genome.wustl.edu	37	1	235318216	235318216	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:235318216G>A	ENST00000408888.3	-	4	807	c.577C>T	c.(577-579)Cct>Tct	p.P193S	RBM34_ENST00000366606.3_Missense_Mutation_p.P188S			P42696	RBM34_HUMAN	RNA binding motif protein 34	193	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			CATGTAACAGGCAAATTCCCA	0.333																																																	0													139.0	122.0	128.0					1																	235318216		1838	4092	5930	SO:0001583	missense	0				CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.577C>T	1.37:g.235318216G>A	ENSP00000386226:p.Pro193Ser		A8K8J7|Q8N2Z8|Q9H5A1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P193S	ENST00000408888.3	37	c.577	CCDS41477.2	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368042	0.82463	.	.	ENSG00000188739	ENST00000408888;ENST00000366606;ENST00000447801	T;T;T	0.78003	-1.14;-1.14;0.61	5.87	5.87	0.94306	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.048880	0.85682	D	0.000000	D	0.83408	0.5248	L	0.35341	1.055	0.80722	D	1	D;P	0.89917	1.0;0.752	D;P	0.97110	1.0;0.678	D	0.83463	0.0055	10	0.56958	D	0.05	-16.654	18.3552	0.90355	0.0:0.0:1.0:0.0	.	193;193	P42696-2;P42696	.;RBM34_HUMAN	S	193;188;191	ENSP00000386226:P193S;ENSP00000355565:P188S;ENSP00000400000:P191S	ENSP00000355565:P188S	P	-	1	0	RBM34	233384839	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.363000	0.66104	2.941000	0.99782	0.655000	0.94253	CCT	RBM34	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000188739		0.333	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM34	HGNC	protein_coding	OTTHUMT00000100146.1	-	0.00	111	0	G	NM_015014		235318216	-1	tier1	-	no_errors	ENST00000408888	ensembl	human	known	74_37	missense	5.05	94	5	SNP	1.000	A
RGS12	6002	genome.wustl.edu	37	4	3422409	3422409	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:3422409G>A	ENST00000344733.5	+	10	3706	c.2802G>A	c.(2800-2802)tcG>tcA	p.S934S	RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000336727.3_Silent_p.S934S|RGS12_ENST00000306648.7_Silent_p.S332S|RGS12_ENST00000382788.3_Silent_p.S934S|RGS12_ENST00000338806.4_Silent_p.S286S|RGS12_ENST00000538395.1_Silent_p.S276S	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	934					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GCCGAGAGTCGCAGGGCTCTG	0.597																																																	0													79.0	71.0	74.0					4																	3422409		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2802G>A	4.37:g.3422409G>A			B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S934	ENST00000344733.5	37	c.2802	CCDS3366.1	4																																																																																			RGS12	-	NULL	ENSG00000159788		0.597	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1	-	0.00	55	0	G	NM_002926		3422409	+1	tier1	-	no_errors	ENST00000344733	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.185	A
RGSL1	353299	genome.wustl.edu	37	1	182443379	182443379	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:182443379C>T	ENST00000294854.8	+	6	1153	c.1133C>T	c.(1132-1134)gCc>gTc	p.A378V	RGSL1_ENST00000542961.1_Missense_Mutation_p.A413V	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	378					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						TGTGCTGATGCCTGTGCAGGG	0.493																																					Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)												0													152.0	126.0	134.0					1																	182443379		692	1591	2283	SO:0001583	missense	0			AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1133C>T	1.37:g.182443379C>T	ENSP00000457748:p.Ala378Val		A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam	p.A378V	ENST00000294854.8	37	c.1133	CCDS58049.1	1																																																																																			RGSL1	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000121446		0.493	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3		0.00	57	0	C	NM_181572		182443379	+1			no_errors	ENST00000294854	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.000	T
RIMS2	9699	genome.wustl.edu	37	8	104897914	104897914	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:104897914C>T	ENST00000436393.2	+	2	662	c.421C>T	c.(421-423)Cgg>Tgg	p.R141W	RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000406091.3_Missense_Mutation_p.R363W|RIMS2_ENST00000507740.1_Missense_Mutation_p.R171W|RIMS2_ENST00000262231.10_Missense_Mutation_p.R171W			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	394	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTCCCGAGCACGGCATGAGAG	0.478										HNSCC(12;0.0054)																																							0													96.0	95.0	95.0					8																	104897914		1999	4156	6155	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.421C>T	8.37:g.104897914C>T	ENSP00000390665:p.Arg141Trp		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R363W	ENST00000436393.2	37	c.1087		8	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046160	0.55110	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96	5.32	-0.595	0.11660	.	.	.	.	.	T	0.59142	0.2172	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.998;1.0;0.999;1.0	T	0.60105	-0.7328	9	0.87932	D	0	.	9.9694	0.41745	0.4367:0.4974:0.0:0.0659	.	394;141;171;171;363	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	W	363;394;363;394;171;171;171;171;141	ENSP00000427018:R363W;ENSP00000384892:R363W;ENSP00000425205:R171W;ENSP00000262231:R171W;ENSP00000423559:R171W;ENSP00000386228:R171W;ENSP00000390665:R141W	ENSP00000262231:R171W	R	+	1	2	RIMS2	104967090	0.463000	0.25799	0.095000	0.20976	0.931000	0.56810	1.166000	0.31834	-0.118000	0.11851	0.467000	0.42956	CGG	RIMS2	-	NULL	ENSG00000176406		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	69	0	C	NM_001100117		104897914	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.443	T
RPRML	388394	genome.wustl.edu	37	17	45056320	45056320	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:45056320G>A	ENST00000322329.3	-	1	294	c.54C>T	c.(52-54)ggC>ggT	p.G18G	RP11-156P1.2_ENST00000571841.1_Intron|GOSR2_ENST00000439730.2_Intron|LRRC37A17P_ENST00000570478.1_RNA	NM_203400.4	NP_981945.1	Q8N4K4	RPRML_HUMAN	reprimo-like	18						integral component of membrane (GO:0016021)				lung(1)	1						cggcgccgccgcccACGCCGT	0.776																																																	0																																										SO:0001819	synonymous_variant	0			BC033942	CCDS11508.1	17q21.32	2006-09-26				ENSG00000179673			32422	protein-coding gene	gene with protein product							Standard	NM_203400		Approved	MGC43894	uc002ilb.3	Q8N4K4		ENST00000322329.3:c.54C>T	17.37:g.45056320G>A				Silent	SNP	NULL	p.G18	ENST00000322329.3	37	c.54	CCDS11508.1	17																																																																																			RPRML	-	NULL	ENSG00000179673		0.776	RPRML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRML	HGNC	protein_coding	OTTHUMT00000440919.1	-	0.00	20	0	G	NM_203400		45056320	-1	tier1	-	no_errors	ENST00000322329	ensembl	human	known	74_37	silent	44.44	15	12	SNP	0.388	A
SALL3	27164	genome.wustl.edu	37	18	76753955	76753955	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr18:76753955C>T	ENST00000537592.2	+	2	1964	c.1964C>T	c.(1963-1965)tCg>tTg	p.S655L	SALL3_ENST00000536229.3_Missense_Mutation_p.S522L|SALL3_ENST00000575389.2_Missense_Mutation_p.S655L	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	655					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CTGCTAGACTCGATGCAAACG	0.642																																																	0													26.0	26.0	26.0					18																	76753955		2202	4299	6501	SO:0001583	missense	0			AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1964C>T	18.37:g.76753955C>T	ENSP00000441823:p.Ser655Leu		Q9UGH1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S655L	ENST00000537592.2	37	c.1964	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	C	9.362	1.068213	0.20067	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.10960	2.82	5.33	5.33	0.75918	.	0.000000	0.56097	D	0.000027	T	0.35770	0.0943	M	0.82323	2.585	0.80722	D	1	P;D	0.89917	0.879;1.0	P;D	0.64506	0.454;0.926	T	0.05801	-1.0863	10	0.31617	T	0.26	-32.6437	19.4129	0.94683	0.0:1.0:0.0:0.0	.	387;655	F5GXY4;Q9BXA9	.;SALL3_HUMAN	L	655;655;387	ENSP00000441823:S655L	ENSP00000299466:S655L	S	+	2	0	SALL3	74854943	1.000000	0.71417	0.773000	0.31616	0.167000	0.22549	5.821000	0.69257	2.652000	0.90054	0.655000	0.94253	TCG	SALL3	-	NULL	ENSG00000256463		0.642	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	HGNC	protein_coding	OTTHUMT00000256397.1	-	0.00	34	0	C	NM_171999		76753955	+1	tier1	-	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	50.00	6	6	SNP	1.000	T
SCIMP	388325	genome.wustl.edu	37	17	5126688	5126688	+	Missense_Mutation	SNP	C	C	T	rs200696256		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:5126688C>T	ENST00000574081.1	-	2	189	c.85G>A	c.(85-87)Gtt>Att	p.V29I	RP11-333E1.1_ENST00000571689.1_RNA|RP11-333E1.1_ENST00000575601.1_RNA|SCIMP_ENST00000399600.4_Missense_Mutation_p.V29I|SCIMP_ENST00000571800.1_Missense_Mutation_p.V29I|RP11-333E1.1_ENST00000573772.1_RNA|SCIMP_ENST00000574297.1_Missense_Mutation_p.V29I	NM_001271842.1|NM_207103.3	NP_001258771.1|NP_996986.1	Q6UWF3	SCIMP_HUMAN	SLP adaptor and CSK interacting membrane protein	29					positive regulation of ERK1 and ERK2 cascade (GO:0070374)	immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|tetraspanin-enriched microdomain (GO:0097197)|uropod membrane (GO:0031259)											ACAGAGACAACGATGATGGCC	0.493													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21404	0.0		0.0	False		,,,				2504	0.0																0								C	ILE/VAL	2,4144		0,2,2071	288.0	271.0	276.0		85	-11.1	0.0	17	dbSNP_134	276	0,8424		0,0,4212	no	missense	C17orf87	NM_207103.2	29	0,2,6283	TT,TC,CC		0.0,0.0482,0.0159	benign	29/146	5126688	2,12568	2073	4212	6285	SO:0001583	missense	0			AY358809	CCDS42242.1, CCDS62044.1	17p13.2	2011-11-24	2011-11-23	2011-11-23	ENSG00000161929	ENSG00000161929			33504	protein-coding gene	gene with protein product	"""SLP65/SLP76, Csk-interacting membrane protein"""	614406	"""chromosome 17 open reading frame 87"""	C17orf87		21930792	Standard	NM_207103		Approved	DTFT5783, UNQ5783, FLJ32580, MGC163426, MGC163428	uc002gbh.3	Q6UWF3	OTTHUMG00000132914	ENST00000574081.1:c.85G>A	17.37:g.5126688C>T	ENSP00000461269:p.Val29Ile		A6XGL4|B4DLK1|Q96MD0	Missense_Mutation	SNP	NULL	p.V29I	ENST00000574081.1	37	c.85	CCDS42242.1	17	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	1.532	-0.544114	0.04024	4.82E-4	0.0	ENSG00000161929	ENST00000399600;ENST00000399592	.	.	.	5.53	-11.1	0.00147	.	1.998910	0.01941	N	0.041877	T	0.19327	0.0464	N	0.19112	0.55	0.09310	N	1	B;B;B	0.10296	0.0;0.003;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.11842	-1.0571	9	0.09338	T	0.73	0.0642	5.0069	0.14293	0.2238:0.4796:0.073:0.2236	.	29;29;29	A6XGL4;Q6UWF3-2;Q6UWF3	.;.;CQ087_HUMAN	I	29;18	.	ENSP00000382501:V18I	V	-	1	0	C17orf87	5067412	0.000000	0.05858	0.000000	0.03702	0.557000	0.35523	-3.535000	0.00439	-3.597000	0.00135	-1.804000	0.00617	GTT	SCIMP	-	NULL	ENSG00000161929		0.493	SCIMP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCIMP	HGNC	protein_coding	OTTHUMT00000256425.2		0.00	84	0	C	NM_207103		5126688	-1			no_errors	ENST00000574081	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	T
SDK1	221935	genome.wustl.edu	37	7	4056815	4056815	+	Silent	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:4056815T>A	ENST00000404826.2	+	17	2572	c.2433T>A	c.(2431-2433)gcT>gcA	p.A811A	SDK1_ENST00000389531.3_Silent_p.A811A	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	811	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCGCCTGGCTGGCCTTCCCG	0.572																																																	0													57.0	49.0	51.0					7																	4056815		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2433T>A	7.37:g.4056815T>A			Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A811	ENST00000404826.2	37	c.2433	CCDS34590.1	7																																																																																			SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.572	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	90	0	T	NM_152744		4056815	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.079	A
SEMA3E	9723	genome.wustl.edu	37	7	83026033	83026033	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:83026033A>T	ENST00000307792.3	-	12	1846	c.1379T>A	c.(1378-1380)gTg>gAg	p.V460E	SEMA3E_ENST00000427262.1_Missense_Mutation_p.V400E	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	460	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				TACTTTCAGCACAATTCCATT	0.323																																																	0													96.0	85.0	88.0					7																	83026033		2202	4297	6499	SO:0001583	missense	0			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1379T>A	7.37:g.83026033A>T	ENSP00000303212:p.Val460Glu		B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.V460E	ENST00000307792.3	37	c.1379	CCDS34674.1	7	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472348	0.84533	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.30714	1.52;1.52	5.67	5.67	0.87782	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.127876	0.53938	D	0.000058	T	0.65698	0.2716	M	0.93898	3.47	0.80722	D	1	D	0.54397	0.966	D	0.67231	0.95	T	0.75662	-0.3240	10	0.87932	D	0	.	16.2076	0.82138	1.0:0.0:0.0:0.0	.	460	O15041	SEM3E_HUMAN	E	460;400;460	ENSP00000303212:V460E;ENSP00000405052:V400E	ENSP00000303212:V460E	V	-	2	0	SEMA3E	82863969	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	9.236000	0.95360	2.285000	0.76669	0.477000	0.44152	GTG	SEMA3E	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000170381		0.323	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3E	HGNC	protein_coding	OTTHUMT00000336606.1	-	0.00	54	0	A	NM_012431		83026033	-1	tier1	-	no_errors	ENST00000307792	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
SEMA6A	57556	genome.wustl.edu	37	5	115782665	115782665	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:115782665C>T	ENST00000343348.6	-	19	3524	c.2737G>A	c.(2737-2739)Ggg>Agg	p.G913R	SEMA6A_ENST00000503865.1_Missense_Mutation_p.G292R|CTB-118N6.3_ENST00000508424.1_RNA|SEMA6A_ENST00000282394.6_Missense_Mutation_p.G390R|CTB-118N6.3_ENST00000508640.1_RNA|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000512128.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000513137.1_Missense_Mutation_p.G340R|SEMA6A_ENST00000510263.1_Missense_Mutation_p.G913R|SEMA6A_ENST00000257414.8_Missense_Mutation_p.G930R	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	913					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TAGTCAACCCCGTAGGAAGAG	0.572																																																	0													57.0	64.0	61.0					5																	115782665		1974	4165	6139	SO:0001583	missense	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2737G>A	5.37:g.115782665C>T	ENSP00000345512:p.Gly913Arg		Q9P2H9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.G930R	ENST00000343348.6	37	c.2788	CCDS47256.1	5	.	.	.	.	.	.	.	.	.	.	C	13.79	2.343003	0.41498	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000513137;ENST00000282394;ENST00000503865;ENST00000510263	T;T;T;T;T;T	0.49432	2.21;2.2;0.79;2.61;0.78;2.21	5.22	5.22	0.72569	.	0.125811	0.33382	N	0.004973	T	0.32496	0.0831	N	0.22421	0.69	0.41646	D	0.989103	P;P;D;P;D;P	0.59357	0.746;0.848;0.985;0.942;0.963;0.883	B;B;B;B;B;B	0.42916	0.179;0.114;0.372;0.402;0.295;0.244	T	0.19418	-1.0306	10	0.66056	D	0.02	.	7.1755	0.25742	0.0:0.7863:0.0:0.2137	.	292;913;457;930;390;340	E9PDV9;Q9H2E6;Q96SM8;Q9H2E6-2;E7ERF3;B3KU01	.;SEM6A_HUMAN;.;.;.;.	R	913;930;340;390;292;913	ENSP00000345512:G913R;ENSP00000257414:G930R;ENSP00000422997:G340R;ENSP00000282394:G390R;ENSP00000425364:G292R;ENSP00000424388:G913R	ENSP00000257414:G930R	G	-	1	0	SEMA6A	115810564	0.998000	0.40836	0.902000	0.35471	0.992000	0.81027	3.482000	0.53186	2.436000	0.82500	0.563000	0.77884	GGG	SEMA6A	-	NULL	ENSG00000092421		0.572	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	-	0.00	72	0	C	NM_020796		115782665	-1	tier1	-	no_errors	ENST00000257414	ensembl	human	known	74_37	missense	43.64	31	24	SNP	0.993	T
SERPINF1	5176	genome.wustl.edu	37	17	1674367	1674367	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:1674367T>A	ENST00000254722.4	+	4	491	c.328T>A	c.(328-330)Tat>Aat	p.Y110N	SERPINF1_ENST00000571870.1_3'UTR	NM_002615.5	NP_002606.3	P36955	PEDF_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1	110					aging (GO:0007568)|cell proliferation (GO:0008283)|kidney development (GO:0001822)|multicellular organismal development (GO:0007275)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of inflammatory response (GO:0050728)|positive regulation of neurogenesis (GO:0050769)|regulation of proteolysis (GO:0030162)|response to glucocorticoid (GO:0051384)|response to retinoic acid (GO:0032526)|short-term memory (GO:0007614)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	16						GGCTCTCTACTATGACTTGAT	0.547																																																	0													126.0	120.0	122.0					17																	1674367		2203	4300	6503	SO:0001583	missense	0			M76979	CCDS11012.1	17p13.3	2014-02-18	2005-08-18		ENSG00000132386	ENSG00000132386		"""Serine (or cysteine) peptidase inhibitors"""	8824	protein-coding gene	gene with protein product	"""pigment epithelium-derived factor"", ""proliferation-inducing protein 35"""	172860	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 1"""	PEDF		8434014, 24172014	Standard	NM_002615		Approved	EPC-1, PIG35	uc002ftl.3	P36955	OTTHUMG00000090571	ENST00000254722.4:c.328T>A	17.37:g.1674367T>A	ENSP00000254722:p.Tyr110Asn		F1T092|Q13236|Q2TU83|Q96CT1|Q96R01|Q9BWA4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.Y110N	ENST00000254722.4	37	c.328	CCDS11012.1	17	.	.	.	.	.	.	.	.	.	.	T	24.0	4.481793	0.84747	.	.	ENSG00000132386	ENST00000254722	D	0.84730	-1.89	5.21	5.21	0.72293	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.90960	0.7158	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92002	0.5611	10	0.87932	D	0	.	15.1389	0.72595	0.0:0.0:0.0:1.0	.	110	P36955	PEDF_HUMAN	N	110	ENSP00000254722:Y110N	ENSP00000254722:Y110N	Y	+	1	0	SERPINF1	1621117	1.000000	0.71417	0.990000	0.47175	0.970000	0.65996	3.954000	0.56708	1.971000	0.57363	0.529000	0.55759	TAT	SERPINF1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000132386		0.547	SERPINF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF1	HGNC	protein_coding	OTTHUMT00000207109.4	-	0.00	80	0	T	NM_002615		1674367	+1	tier1	-	no_errors	ENST00000254722	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
SENP3	26168	genome.wustl.edu	37	17	7468306	7468306	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:7468306G>T	ENST00000429205.2	+	4	1035	c.986G>T	c.(985-987)gGc>gTc	p.G329V	SENP3_ENST00000578868.1_3'UTR|SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000321337.7_Missense_Mutation_p.G329V			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	329						cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				CAAACGTATGGCAGCCTCATA	0.552																																																	0													59.0	62.0	61.0					17																	7468306		1934	4146	6080	SO:0001583	missense	0			AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.986G>T	17.37:g.7468306G>T	ENSP00000403712:p.Gly329Val		Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.G329V	ENST00000429205.2	37	c.986		17	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451217	0.43531	.	.	ENSG00000161956	ENST00000321337;ENST00000429205	T;T	0.46063	0.88;0.88	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.51725	-0.8669	10	0.23891	T	0.37	-11.6828	16.8198	0.85743	0.0:0.0:1.0:0.0	.	329	Q9H4L4	SENP3_HUMAN	V	329	ENSP00000314029:G329V;ENSP00000403712:G329V	ENSP00000314029:G329V	G	+	2	0	SENP3	7409030	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.543000	0.90651	2.837000	0.97791	0.591000	0.81541	GGC	SENP3	-	NULL	ENSG00000161956		0.552	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding		-	0.00	60	0	G	NM_015670		7468306	+1	tier1	-	no_errors	ENST00000429205	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
SEZ6L	23544	genome.wustl.edu	37	22	26688433	26688433	+	Silent	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:26688433G>T	ENST00000248933.6	+	2	251	c.156G>T	c.(154-156)ccG>ccT	p.P52P	SEZ6L_ENST00000343706.4_Silent_p.P52P|SEZ6L_ENST00000529632.2_Silent_p.P52P|SEZ6L_ENST00000404234.3_Silent_p.P52P|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000360929.3_Silent_p.P52P			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	52			P -> L (in dbSNP:rs6004989).		adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CAGGAGCCCCGGAGAGAGGCA	0.597																																																	0													50.0	44.0	46.0					22																	26688433		2203	4300	6503	SO:0001819	synonymous_variant	0			AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.156G>T	22.37:g.26688433G>T			A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P52	ENST00000248933.6	37	c.156	CCDS13833.1	22																																																																																			SEZ6L	-	NULL	ENSG00000100095		0.597	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	HGNC	protein_coding	OTTHUMT00000320359.3	-	0.00	60	0	G			26688433	+1	tier1	-	no_errors	ENST00000248933	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.002	T
SGCD	6444	genome.wustl.edu	37	5	156186335	156186335	+	Silent	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:156186335G>T	ENST00000435422.3	+	8	1291	c.804G>T	c.(802-804)ggG>ggT	p.G268G	SGCD_ENST00000337851.4_Silent_p.G269G	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	268					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.G269G(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCGCCAATGGGAGATTATTCC	0.502																																																	1	Substitution - coding silent(1)	lung(1)											136.0	131.0	133.0					5																	156186335		1976	4170	6146	SO:0001819	synonymous_variant	0			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.804G>T	5.37:g.156186335G>T			A8K9S9|Q53XA5|Q99644	Silent	SNP	pfam_Sarcoglycan	p.G269	ENST00000435422.3	37	c.807	CCDS47327.1	5																																																																																			SGCD	-	pfam_Sarcoglycan	ENSG00000170624		0.502	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	HGNC	protein_coding	OTTHUMT00000373469.3		0.00	52	0	G			156186335	+1			no_errors	ENST00000337851	ensembl	human	known	74_37	silent	5.71	33	2	SNP	1.000	T
SHROOM3	57619	genome.wustl.edu	37	4	77677900	77677900	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:77677900G>T	ENST00000296043.6	+	8	5961	c.5008G>T	c.(5008-5010)Gct>Tct	p.A1670S	RP11-359D14.2_ENST00000452412.1_RNA|RP11-359D14.3_ENST00000449007.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1670	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CAGAACAGAGGCTTTGGCCAA	0.458																																																	0													67.0	71.0	70.0					4																	77677900		2203	4300	6503	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.5008G>T	4.37:g.77677900G>T	ENSP00000296043:p.Ala1670Ser		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A1670S	ENST00000296043.6	37	c.5008	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457312	0.43634	.	.	ENSG00000138771	ENST00000296043;ENST00000264907	T	0.21361	2.01	5.27	0.509	0.16977	Apx/shroom, ASD2 (1);	1.035690	0.07642	N	0.930512	T	0.20780	0.0500	L	0.40543	1.245	0.32978	D	0.523225	P	0.43578	0.811	B	0.42625	0.393	T	0.38672	-0.9650	10	0.42905	T	0.14	-0.2662	10.6385	0.45579	0.3348:0.0:0.6651:0.0	.	1670	Q8TF72	SHRM3_HUMAN	S	1670;147	ENSP00000296043:A1670S	ENSP00000264907:A147S	A	+	1	0	SHROOM3	77896924	1.000000	0.71417	0.857000	0.33713	0.995000	0.86356	2.648000	0.46647	0.055000	0.16094	0.585000	0.79938	GCT	SHROOM3	-	NULL	ENSG00000138771		0.458	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2		0.00	65	0	G	NM_020859		77677900	+1			no_errors	ENST00000296043	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.993	T
SLC22A10	387775	genome.wustl.edu	37	11	63066469	63066469	+	Missense_Mutation	SNP	C	C	T	rs201468685	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:63066469C>T	ENST00000332793.6	+	5	910	c.908C>T	c.(907-909)gCa>gTa	p.A303V	SLC22A10_ENST00000544661.1_Missense_Mutation_p.A148V|SLC22A10_ENST00000535888.1_Missense_Mutation_p.A93V|SLC22A10_ENST00000525620.1_3'UTR|SLC22A10_ENST00000526800.1_Missense_Mutation_p.A143V	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	303						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	AGAAAAGTTGCACGCACAAAT	0.433													C|||	4	0.000798722	0.0	0.0014	5008	,	,		19786	0.0		0.0	False		,,,				2504	0.0031																0													100.0	96.0	97.0					11																	63066469		2018	4194	6212	SO:0001583	missense	0			AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.908C>T	11.37:g.63066469C>T	ENSP00000327569:p.Ala303Val		Q68CJ0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A303V	ENST00000332793.6	37	c.908	CCDS41661.1	11	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	22.1	4.249529	0.80024	.	.	ENSG00000184999	ENST00000535888;ENST00000544661;ENST00000332793;ENST00000526800	T;T;T;T	0.74947	0.31;0.31;0.31;-0.89	3.46	3.46	0.39613	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.065642	0.64402	U	0.000014	D	0.89371	0.6696	H	0.96269	3.795	0.30264	N	0.792914	D;D	0.89917	0.999;1.0	D;D	0.78314	0.986;0.991	D	0.87720	0.2572	10	0.72032	D	0.01	.	12.6217	0.56607	0.0:1.0:0.0:0.0	.	143;303	E9PJB1;Q63ZE4	.;S22AA_HUMAN	V	93;148;303;143	ENSP00000444602:A93V;ENSP00000445667:A148V;ENSP00000327569:A303V;ENSP00000433908:A143V	ENSP00000327569:A303V	A	+	2	0	SLC22A10	62823045	0.991000	0.36638	0.356000	0.25785	0.440000	0.31957	3.981000	0.56902	1.811000	0.52892	0.454000	0.30748	GCA	SLC22A10	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000184999		0.433	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A10	HGNC	protein_coding	OTTHUMT00000382622.3		0.00	79	0	C	NM_001039752		63066469	+1			no_errors	ENST00000332793	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.992	T
SLC29A1	2030	genome.wustl.edu	37	6	44189380	44189380	+	Intron	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:44189380G>T	ENST00000393844.1	+	1	278				SLC29A1_ENST00000371724.1_5'Flank|SLC29A1_ENST00000371755.3_5'Flank|SLC29A1_ENST00000371740.5_5'Flank|SLC29A1_ENST00000393841.1_5'Flank|SLC29A1_ENST00000427851.2_Intron|SLC29A1_ENST00000371713.1_5'Flank|SLC29A1_ENST00000313248.7_Missense_Mutation_p.E48D|SLC29A1_ENST00000371731.1_5'Flank	NM_001078174.1|NM_004955.2	NP_001071642.1|NP_004946.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1						cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	AGACTGAAGAGAGCTGGCAAG	0.627											OREG0017467	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393844.1:c.-55+1861G>T	6.37:g.44189380G>T		922	B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Missense_Mutation	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt,tigrfam_Eqnu_transpt	p.E48D	ENST00000393844.1	37	c.144	CCDS4908.1	6	.	.	.	.	.	.	.	.	.	.	G	10.29	1.310627	0.23821	.	.	ENSG00000112759	ENST00000313248	T	0.57273	0.41	2.94	2.01	0.26516	.	.	.	.	.	T	0.09905	0.0243	.	.	.	0.18873	N	0.999989	B	0.17852	0.024	B	0.10450	0.005	T	0.35076	-0.9803	8	0.08179	T	0.78	.	6.393	0.21597	0.1651:0.0:0.8349:0.0	.	48	B3KQV7	.	D	48	ENSP00000319152:E48D	ENSP00000319152:E48D	E	+	3	2	SLC29A1	44297358	0.015000	0.18098	0.003000	0.11579	0.011000	0.07611	0.575000	0.23729	1.328000	0.45358	0.561000	0.74099	GAG	SLC29A1	-	NULL	ENSG00000112759		0.627	SLC29A1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A1	HGNC	protein_coding	OTTHUMT00000040722.1	-	0.00	32	0	G			44189380	+1	tier1	-	no_errors	ENST00000313248	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.003	T
SMAD5	4090	genome.wustl.edu	37	5	135514032	135514032	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:135514032C>T	ENST00000514641.2	+	0	2623				SMAD5_ENST00000545279.1_3'UTR|SMAD5_ENST00000545620.1_3'UTR			Q99717	SMAD5_HUMAN	SMAD family member 5						BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle contraction (GO:0060048)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|cellular response to organic cyclic compound (GO:0071407)|embryonic pattern specification (GO:0009880)|erythrocyte differentiation (GO:0030218)|germ cell development (GO:0007281)|intracellular signal transduction (GO:0035556)|Mullerian duct regression (GO:0001880)|osteoblast fate commitment (GO:0002051)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	metal ion binding (GO:0046872)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|large_intestine(4)|lung(3)	8			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTATGGGTGACAGTTTTTAGC	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U59913	CCDS75308.1	5q31	2008-02-05	2006-11-06	2004-05-26		ENSG00000113658		"""SMADs"""	6771	protein-coding gene	gene with protein product		603110	"""MAD, mothers against decapentaplegic homolog 5 (Drosophila)"", ""SMAD, mothers against DPP homolog 5 (Drosophila)"""	MADH5		8673135	Standard	NM_005903		Approved	Dwfc, JV5-1	uc003lbl.1	Q99717		ENST00000514641.2:c.*2620C>T	5.37:g.135514032C>T			O14688|Q15798|Q9UQA1	RNA	SNP	-	NULL	ENST00000514641.2	37	NULL		5																																																																																			SMAD5	-	-	ENSG00000113658		0.348	SMAD5-001	KNOWN	basic	processed_transcript	SMAD5	HGNC	protein_coding	OTTHUMT00000372096.2	-	0.00	75	0	C	NM_005903		135514032	+1	tier1	-	no_errors	ENST00000514641	ensembl	human	known	74_37	rna	5.63	67	4	SNP	0.996	T
SMARCB1	6598	genome.wustl.edu	37	22	24175848	24175848	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:24175848C>T	ENST00000263121.7	+	8	1272	c.1076C>T	c.(1075-1077)gCt>gTt	p.A359V	SMARCB1_ENST00000407422.3_Missense_Mutation_p.A350V|DERL3_ENST00000464023.1_5'Flank|SMARCB1_ENST00000407082.3_Missense_Mutation_p.A313V|SMARCB1_ENST00000344921.6_Missense_Mutation_p.A368V	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	359					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)|p.L266_*386del(1)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				CTGACAGACGCTGAGATGGAG	0.627			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																																	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	3	Unknown(2)|Deletion - In frame(1)	central_nervous_system(3)											142.0	123.0	130.0					22																	24175848		2203	4300	6503	SO:0001583	missense	0			U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.1076C>T	22.37:g.24175848C>T	ENSP00000263121:p.Ala359Val		O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	pfam_SNF5,pirsf_SWI_SNF_chromatin_remodel_cplx	p.A359V	ENST00000263121.7	37	c.1076	CCDS13817.1	22	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869080	0.72065	.	.	ENSG00000099956	ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	4.76	4.76	0.60689	.	0.049577	0.85682	D	0.000000	D	0.89389	0.6701	M	0.89785	3.06	0.80722	D	1	D;D;D	0.61080	0.987;0.988;0.989	D;D;D	0.65140	0.913;0.932;0.932	D	0.90932	0.4791	10	0.51188	T	0.08	-18.3539	17.2148	0.86940	0.0:1.0:0.0:0.0	.	368;350;359	G5E975;Q17S11;Q12824	.;.;SNF5_HUMAN	V	368;359;350;313	ENSP00000340883:A368V;ENSP00000263121:A359V;ENSP00000383984:A350V;ENSP00000385226:A313V	ENSP00000263121:A359V	A	+	2	0	SMARCB1	22505848	1.000000	0.71417	0.139000	0.22197	0.261000	0.26267	7.569000	0.82380	2.387000	0.81309	0.543000	0.68304	GCT	SMARCB1	-	pfam_SNF5,pirsf_SWI_SNF_chromatin_remodel_cplx	ENSG00000099956		0.627	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCB1	HGNC	protein_coding	OTTHUMT00000319872.1	-	0.00	38	0	C	NM_003073		24175848	+1	tier1	-	no_errors	ENST00000263121	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.996	T
SLC25A3	5250	genome.wustl.edu	37	12	98993464	98993464	+	Intron	SNP	C	C	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:98993464C>A	ENST00000228318.3	+	6	764				SLC25A3_ENST00000552981.1_Intron|SLC25A3_ENST00000401722.3_Intron|SNORA53_ENST00000391141.1_RNA|SLC25A3_ENST00000188376.5_Intron|SLC25A3_ENST00000549338.1_Intron|SLC25A3_ENST00000551917.1_Intron|SLC25A3_ENST00000548847.1_Intron	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3						generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		CTGAGTTCCACTTGTAAACTT	0.378																																																	0													187.0	174.0	178.0					12																	98993464		876	1991	2867	SO:0001627	intron_variant	0				CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.645-269C>A	12.37:g.98993464C>A			B3KS34|Q7Z7N7|Q96A03	RNA	SNP	-	NULL	ENST00000228318.3	37	NULL	CCDS9066.1	12																																																																																			SNORA53	-	-	ENSG00000212443		0.378	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNORA53	HGNC	protein_coding	OTTHUMT00000407989.1	-	0.00	120	0	C	NM_005888		98993464	+1	tier1	-	no_errors	ENST00000391141	ensembl	human	known	74_37	rna	5.38	88	5	SNP	0.999	A
SNTG2	54221	genome.wustl.edu	37	2	1241751	1241751	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:1241751G>A	ENST00000308624.5	+	10	940	c.811G>A	c.(811-813)Gcg>Acg	p.A271T	SNTG2_ENST00000407292.1_Missense_Mutation_p.A144T	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	271					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		CTGGCTGCGGGCGGTCTCAGC	0.572																																																	0													30.0	34.0	33.0					2																	1241751		2187	4293	6480	SO:0001583	missense	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.811G>A	2.37:g.1241751G>A	ENSP00000311837:p.Ala271Thr		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A271T	ENST00000308624.5	37	c.811	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	G	5.344	0.248863	0.10130	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.59638	0.25;0.25	4.68	1.84	0.25277	.	0.306995	0.34777	N	0.003689	T	0.59376	0.2189	M	0.77103	2.36	0.09310	N	0.999998	P;P	0.45531	0.86;0.657	P;B	0.47075	0.536;0.255	T	0.53920	-0.8370	10	0.54805	T	0.06	.	6.0152	0.19598	0.1717:0.0:0.6772:0.1511	.	144;271	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	T	271;144	ENSP00000311837:A271T;ENSP00000385020:A144T	ENSP00000311837:A271T	A	+	1	0	SNTG2	1224302	0.946000	0.32159	0.000000	0.03702	0.004000	0.04260	2.683000	0.46943	0.138000	0.18790	-0.140000	0.14226	GCG	SNTG2	-	NULL	ENSG00000172554		0.572	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	-	0.00	57	0	G	NM_018968		1241751	+1	tier1	-	no_errors	ENST00000308624	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.097	A
SNX9	51429	genome.wustl.edu	37	6	158363834	158363834	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:158363834G>T	ENST00000392185.3	+	18	1923	c.1752G>T	c.(1750-1752)aaG>aaT	p.K584N		NM_016224.3	NP_057308.1	Q9Y5X1	SNX9_HUMAN	sorting nexin 9	584	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|lipid tube assembly (GO:0060988)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein oligomerization (GO:0032461)|receptor-mediated endocytosis (GO:0006898)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	1-phosphatidylinositol binding (GO:0005545)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.167)		OV - Ovarian serous cystadenocarcinoma(65;8.06e-18)|BRCA - Breast invasive adenocarcinoma(81;4.48e-05)		TTGCAGAAAAGCTGAGGCAGG	0.458																																																	0													59.0	64.0	62.0					6																	158363834		2203	4300	6503	SO:0001583	missense	0			AF121859	CCDS5253.1	6q25.1-q26	2008-05-22			ENSG00000130340	ENSG00000130340		"""Sorting nexins"""	14973	protein-coding gene	gene with protein product		605952				10531379, 17609109	Standard	NM_016224		Approved	SH3PX1, SDP1, SH3PXD3A	uc003qqv.1	Q9Y5X1	OTTHUMG00000015903	ENST00000392185.3:c.1752G>T	6.37:g.158363834G>T	ENSP00000376024:p.Lys584Asn		Q9BSI7|Q9BVM1|Q9UJH6|Q9UP20	Missense_Mutation	SNP	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,smart_Phox,pirsf_Snx9,pfscan_Phox,pfscan_SH3_domain	p.K584N	ENST00000392185.3	37	c.1752	CCDS5253.1	6	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035580	0.93630	.	.	ENSG00000130340	ENST00000539592;ENST00000392185;ENST00000252631	T	0.44881	0.91	5.68	5.68	0.88126	Sorting nexin protein, WASP-binding domain (1);	0.084793	0.85682	D	0.000000	T	0.63977	0.2557	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.65088	-0.6253	10	0.59425	D	0.04	-33.6181	20.1325	0.98004	0.0:0.0:1.0:0.0	.	584	Q9Y5X1	SNX9_HUMAN	N	584;584;384	ENSP00000376024:K584N	ENSP00000252631:K384N	K	+	3	2	SNX9	158283822	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.002000	0.63952	2.839000	0.97877	0.650000	0.86243	AAG	SNX9	-	pfam_Sorting_nexin_WASP-bd-dom,pirsf_Snx9	ENSG00000130340		0.458	SNX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX9	HGNC	protein_coding	OTTHUMT00000042856.1		0.00	56	0	G			158363834	+1			no_errors	ENST00000392185	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
SORL1	6653	genome.wustl.edu	37	11	121475855	121475855	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:121475855A>G	ENST00000260197.7	+	34	4814	c.4685A>G	c.(4684-4686)cAg>cGg	p.Q1562R	SORL1_ENST00000534286.1_Missense_Mutation_p.Q472R|SORL1_ENST00000527934.1_Missense_Mutation_p.Q177R|SORL1_ENST00000525532.1_Missense_Mutation_p.Q506R|SORL1_ENST00000532694.1_Missense_Mutation_p.Q408R	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1562	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CAGAATCTTCAGTGGACAGCT	0.453																																																	0													157.0	156.0	157.0					11																	121475855		2203	4299	6502	SO:0001583	missense	0			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.4685A>G	11.37:g.121475855A>G	ENSP00000260197:p.Gln1562Arg		B2RNX7|Q92856	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.Q1562R	ENST00000260197.7	37	c.4685	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	A	16.44	3.124747	0.56613	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45	5.19	4.06	0.47325	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.53286	0.1787	N	0.19112	0.55	0.47308	D	0.99938	B;D	0.69078	0.035;0.997	B;D	0.80764	0.038;0.994	T	0.45527	-0.9255	10	0.23302	T	0.38	.	10.5272	0.44957	0.923:0.0:0.077:0.0	.	177;1562	E9PKB0;Q92673	.;SORL_HUMAN	R	1562;506;408;472;177	ENSP00000260197:Q1562R;ENSP00000434634:Q506R;ENSP00000432131:Q408R;ENSP00000436447:Q472R;ENSP00000435405:Q177R	ENSP00000260197:Q1562R	Q	+	2	0	SORL1	120981065	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.142000	0.77339	0.827000	0.34685	0.533000	0.62120	CAG	SORL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000137642		0.453	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	HGNC	protein_coding	OTTHUMT00000387626.2	-	0.00	96	0	A	NM_003105		121475855	+1	tier1	-	no_errors	ENST00000260197	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	G
SOX1	6656	genome.wustl.edu	37	13	112722424	112722424	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr13:112722424C>T	ENST00000330949.1	+	1	512	c.452C>T	c.(451-453)gCg>gTg	p.A151V		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	151					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		ggcggcggcgcggcTGTGGCC	0.776																																																	0													3.0	4.0	3.0					13																	112722424		1648	3378	5026	SO:0001583	missense	0				CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.452C>T	13.37:g.112722424C>T	ENSP00000330218:p.Ala151Val		Q5W0Q1	Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.A151V	ENST00000330949.1	37	c.452	CCDS9523.1	13	.	.	.	.	.	.	.	.	.	.	C	13.98	2.400206	0.42613	.	.	ENSG00000182968	ENST00000330949	T	0.52754	0.65	2.9	2.03	0.26663	.	0.204155	0.30076	U	0.010471	T	0.23330	0.0564	N	0.19112	0.55	0.26314	N	0.97778	P	0.45827	0.867	B	0.36845	0.234	T	0.12528	-1.0544	10	0.40728	T	0.16	.	3.2629	0.06855	0.0:0.5075:0.2253:0.2672	.	151	O00570	SOX1_HUMAN	V	151	ENSP00000330218:A151V	ENSP00000330218:A151V	A	+	2	0	SOX1	111770425	0.953000	0.32496	1.000000	0.80357	0.662000	0.39071	1.979000	0.40608	0.414000	0.25790	0.450000	0.29827	GCG	SOX1	-	pfam_TF_SOX	ENSG00000182968		0.776	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX1	HGNC	protein_coding	OTTHUMT00000045817.3	-	0.00	11	0	C	NM_005986		112722424	+1	tier1	-	no_errors	ENST00000330949	ensembl	human	known	74_37	missense	47.37	10	9	SNP	1.000	T
SOX10	6663	genome.wustl.edu	37	22	38379482	38379482	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:38379482C>T	ENST00000396884.2	-	2	592	c.310G>A	c.(310-312)Gtc>Atc	p.V104I	POLR2F_ENST00000405557.1_Intron|SOX10_ENST00000360880.2_Missense_Mutation_p.V104I|SOX10_ENST00000470555.1_Intron|POLR2F_ENST00000407936.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	104					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					GGCCGCTTGACGTGCGGCTTG	0.667																																					Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												0													51.0	39.0	43.0					22																	38379482		2203	4299	6502	SO:0001583	missense	0				CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.310G>A	22.37:g.38379482C>T	ENSP00000380093:p.Val104Ile		B4DV62|Q6FHW7	Missense_Mutation	SNP	pfam_Sox_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.V104I	ENST00000396884.2	37	c.310	CCDS13964.1	22	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304212	0.81136	.	.	ENSG00000100146	ENST00000396884;ENST00000360880;ENST00000416937;ENST00000427770	D;D;D	0.97811	-4.55;-4.55;-4.55	4.39	4.39	0.52855	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	D	0.000001	D	0.95965	0.8686	N	0.04373	-0.215	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	D	0.95423	0.8509	9	.	.	.	.	17.1363	0.86740	0.0:1.0:0.0:0.0	.	104	P56693	SOX10_HUMAN	I	104	ENSP00000380093:V104I;ENSP00000354130:V104I;ENSP00000414853:V104I	.	V	-	1	0	SOX10	36709428	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.244000	0.78228	2.265000	0.75225	0.462000	0.41574	GTC	SOX10	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000100146		0.667	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SOX10	HGNC	protein_coding	OTTHUMT00000313875.1	-	0.00	147	0	C	NM_006941		38379482	-1	tier1	-	no_errors	ENST00000360880	ensembl	human	known	74_37	missense	26.88	117	43	SNP	1.000	T
SOX5	6660	genome.wustl.edu	37	12	23998970	23998970	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:23998970A>G	ENST00000451604.2	-	3	529	c.428T>C	c.(427-429)gTt>gCt	p.V143A	SOX5_ENST00000541536.1_Missense_Mutation_p.V130A|SOX5_ENST00000546136.1_Missense_Mutation_p.V130A|SOX5_ENST00000545921.1_Missense_Mutation_p.V133A|SOX5_ENST00000541847.1_Missense_Mutation_p.V133A|SOX5_ENST00000309359.1_Missense_Mutation_p.V130A|SOX5_ENST00000381381.2_Missense_Mutation_p.V130A|SOX5_ENST00000537393.1_Missense_Mutation_p.V108A|SOX5_ENST00000441133.2_Missense_Mutation_p.V108A			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	143					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.V143A(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						CAAGGTGTCAACAACATCAGC	0.498																																																	1	Substitution - Missense(1)	large_intestine(1)											131.0	119.0	123.0					12																	23998970		2203	4300	6503	SO:0001583	missense	0			AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.428T>C	12.37:g.23998970A>G	ENSP00000398273:p.Val143Ala		B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.V143A	ENST00000451604.2	37	c.428	CCDS8699.1	12	.	.	.	.	.	.	.	.	.	.	A	22.2	4.264197	0.80358	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000441133;ENST00000538083	D;D;D;D;D;D;D	0.97941	-4.62;-4.62;-4.6;-4.62;-4.5;-4.6;-4.62	5.79	5.79	0.91817	.	0.061993	0.64402	D	0.000004	D	0.98516	0.9505	M	0.77820	2.39	0.58432	D	0.999999	D;D;P;D	0.89917	0.998;0.999;0.954;1.0	D;D;D;D	0.85130	0.99;0.997;0.932;0.997	D	0.98863	1.0763	10	0.33141	T	0.24	.	16.1299	0.81422	1.0:0.0:0.0:0.0	.	108;108;130;143	G3V0H1;F5H0I3;P35711-4;P35711	.;.;.;SOX5_HUMAN	A	130;130;130;143;95;108;130;133;133;108;130	ENSP00000437487:V130A;ENSP00000308927:V130A;ENSP00000370788:V130A;ENSP00000398273:V143A;ENSP00000439832:V108A;ENSP00000441973:V130A;ENSP00000443520:V133A	ENSP00000308927:V130A	V	-	2	0	SOX5	23890237	1.000000	0.71417	0.203000	0.23512	0.997000	0.91878	8.946000	0.92992	2.215000	0.71742	0.528000	0.53228	GTT	SOX5	-	NULL	ENSG00000134532		0.498	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	HGNC	protein_coding	OTTHUMT00000402006.2	-	0.00	50	0	A	NM_006940		23998970	-1	tier1	-	no_errors	ENST00000451604	ensembl	human	known	74_37	missense	46.55	31	27	SNP	0.996	G
SPC25	57405	genome.wustl.edu	37	2	169746017	169746017	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:169746017C>T	ENST00000282074.2	-	2	154	c.13G>A	c.(13-15)Gaa>Aaa	p.E5K	SPC25_ENST00000472216.2_5'UTR	NM_020675.3	NP_065726.1	Q9HBM1	SPC25_HUMAN	SPC25, NDC80 kinetochore complex component	5	Interaction with the N-terminus of SPBC24.|Interaction with the NDC80-NUF2 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	condensed chromosome kinetochore (GO:0000777)|cytosol (GO:0005829)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.E5K(1)		central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	9						AGTGCCAGTTCGTCCTCTACC	0.363																																																	1	Substitution - Missense(1)	large_intestine(1)											55.0	51.0	53.0					2																	169746017		2203	4300	6503	SO:0001583	missense	0			AF225416	CCDS2229.1	2q31.1	2013-06-05	2013-06-05	2007-03-02	ENSG00000152253	ENSG00000152253			24031	protein-coding gene	gene with protein product		609395	"""spindle pole body component 25 homolog (S. cerevisiae)"", ""SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	SPBC25		12477932	Standard	NM_020675		Approved	MGC22228, AD024	uc002uel.3	Q9HBM1	OTTHUMG00000132181	ENST00000282074.2:c.13G>A	2.37:g.169746017C>T	ENSP00000282074:p.Glu5Lys		A8K4X8|D3DPC0	Missense_Mutation	SNP	pfam_Spc25	p.E5K	ENST00000282074.2	37	c.13	CCDS2229.1	2	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319099	0.23994	.	.	ENSG00000152253	ENST00000282074;ENST00000451987	.	.	.	6.16	5.28	0.74379	.	0.198673	0.52532	D	0.000075	T	0.35828	0.0945	L	0.34521	1.04	0.33383	D	0.57512	P	0.45902	0.868	B	0.37833	0.259	T	0.52388	-0.8582	9	0.37606	T	0.19	-13.641	13.6064	0.62050	0.0:0.8449:0.1551:0.0	.	5	Q9HBM1	SPC25_HUMAN	K	5	.	ENSP00000282074:E5K	E	-	1	0	SPC25	169454263	0.971000	0.33674	0.168000	0.22838	0.015000	0.08874	2.481000	0.45215	1.604000	0.50143	-0.182000	0.12963	GAA	SPC25	-	NULL	ENSG00000152253		0.363	SPC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPC25	HGNC	protein_coding	OTTHUMT00000255233.2		0.00	28	0	C	NM_020675		169746017	-1			no_errors	ENST00000282074	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.581	T
SPEF2	79925	genome.wustl.edu	37	5	35727842	35727842	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr5:35727842G>T	ENST00000356031.3	+	21	3134	c.2980G>T	c.(2980-2982)Gat>Tat	p.D994Y	SPEF2_ENST00000440995.2_Missense_Mutation_p.D989Y|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	994					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGACTCTACAGATACATCACC	0.403																																																	0													123.0	122.0	122.0					5																	35727842		1945	4139	6084	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2980G>T	5.37:g.35727842G>T	ENSP00000348314:p.Asp994Tyr		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.D994Y	ENST00000356031.3	37	c.2980	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	6.649	0.488262	0.12641	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.06849	3.26;3.25	4.88	3.08	0.35506	.	1.855360	0.02219	N	0.063833	T	0.11239	0.0274	L	0.36672	1.1	0.21697	N	0.99959	P;B	0.41848	0.763;0.38	B;B	0.41236	0.351;0.123	T	0.33624	-0.9861	10	0.59425	D	0.04	.	9.0294	0.36249	0.1772:0.0:0.8228:0.0	.	989;994	Q9C093-2;Q9C093	.;SPEF2_HUMAN	Y	994;989	ENSP00000348314:D994Y;ENSP00000412125:D989Y	ENSP00000348314:D994Y	D	+	1	0	SPEF2	35763599	0.379000	0.25123	0.059000	0.19551	0.009000	0.06853	1.348000	0.33987	0.733000	0.32492	0.650000	0.86243	GAT	SPEF2	-	NULL	ENSG00000152582		0.403	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1		0.00	45	0	G	NM_144722		35727842	+1			no_errors	ENST00000356031	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.148	T
SPR	6697	genome.wustl.edu	37	2	73115449	73115449	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:73115449T>A	ENST00000234454.5	+	2	384	c.311T>A	c.(310-312)cTt>cAt	p.L104H	SPR_ENST00000498749.1_Intron	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	104					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)			lung(4)|ovary(2)	6						TCAGGCTCTCTTGGGGATGTG	0.537											OREG0014704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													118.0	119.0	119.0					2																	73115449		2203	4300	6503	SO:0001583	missense	0				CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.311T>A	2.37:g.73115449T>A	ENSP00000234454:p.Leu104His	1142	A8K741|D6W5H2|Q53GI9|Q9UBB1	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,tigrfam_Sepiapterin_red	p.L104H	ENST00000234454.5	37	c.311	CCDS1920.1	2	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259857	0.80246	.	.	ENSG00000116096	ENST00000234454	D	0.90676	-2.71	5.62	4.43	0.53597	NAD(P)-binding domain (1);	0.239015	0.36303	N	0.002675	D	0.94591	0.8257	M	0.78456	2.415	0.54753	D	0.999983	D	0.76494	0.999	D	0.85130	0.997	D	0.94347	0.7576	10	0.87932	D	0	-2.8836	11.587	0.50925	0.0:0.0:0.1496:0.8504	.	104	P35270	SPRE_HUMAN	H	104	ENSP00000234454:L104H	ENSP00000234454:L104H	L	+	2	0	SPR	72968957	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	7.552000	0.82192	0.922000	0.37019	0.459000	0.35465	CTT	SPR	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,tigrfam_Sepiapterin_red	ENSG00000116096		0.537	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPR	HGNC	protein_coding	OTTHUMT00000251993.2		0.00	81	0	T			73115449	+1			no_errors	ENST00000234454	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	A
SSC5D	284297	genome.wustl.edu	37	19	56011964	56011964	+	Missense_Mutation	SNP	C	C	T	rs375187035		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:56011964C>T	ENST00000389623.6	+	11	2433	c.2410C>T	c.(2410-2412)Cgg>Tgg	p.R804W	SSC5D_ENST00000587166.1_Missense_Mutation_p.R804W	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	804	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CTGGGACCTGCGGGACGCCAC	0.657																																																	0								C	TRP/ARG,TRP/ARG	1,1383		0,1,691	66.0	68.0	67.0		2410,2410	1.0	0.9	19		67	0,3182		0,0,1591	no	missense,missense	SSC5D	NM_001144950.1,NM_001195267.1	101,101	0,1,2282	TT,TC,CC		0.0,0.0723,0.0219	probably-damaging,probably-damaging	804/1574,804/952	56011964	1,4565	692	1591	2283	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2410C>T	19.37:g.56011964C>T	ENSP00000374274:p.Arg804Trp		B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.R804W	ENST00000389623.6	37	c.2410	CCDS46196.1	19	.	.	.	.	.	.	.	.	.	.	C	16.81	3.227187	0.58668	7.23E-4	0.0	ENSG00000179954	ENST00000389623;ENST00000541230	T	0.36878	1.23	4.7	0.956	0.19608	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.54870	0.1885	M	0.77712	2.385	0.09310	N	1	D	0.89917	1.0	D	0.70935	0.971	T	0.37619	-0.9698	9	0.87932	D	0	.	7.0741	0.25195	0.3119:0.3985:0.2897:0.0	.	804	A1L4H1	SRCRL_HUMAN	W	804	ENSP00000374274:R804W	ENSP00000374274:R804W	R	+	1	2	SSC5D	60703776	0.000000	0.05858	0.911000	0.35937	0.905000	0.53344	-1.242000	0.02908	0.484000	0.27630	0.549000	0.68633	CGG	SSC5D	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000179954		0.657	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	-	0.00	143	0	C	XM_001718392		56011964	+1	tier1	-	no_errors	ENST00000389623	ensembl	human	known	74_37	missense	29.87	108	46	SNP	0.001	T
STAB1	23166	genome.wustl.edu	37	3	52556952	52556952	+	Silent	SNP	G	G	A	rs371622176		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:52556952G>A	ENST00000321725.6	+	62	6982	c.6906G>A	c.(6904-6906)gtG>gtA	p.V2302V		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	2302					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCTTCCGTGTGCAAGGTGTGT	0.602																																																	0													80.0	84.0	83.0					3																	52556952		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.6906G>A	3.37:g.52556952G>A			A7E297|Q8IUH0|Q8IUH1|Q93072	Silent	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.V2302	ENST00000321725.6	37	c.6906	CCDS33768.1	3																																																																																			STAB1	-	superfamily_C-type_lectin_fold,superfamily_FAS1_domain	ENSG00000010327		0.602	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	-	0.00	32	0	G	NM_015136		52556952	+1	tier1	-	no_errors	ENST00000321725	ensembl	human	known	74_37	silent	13.33	26	4	SNP	0.018	A
STEAP3	55240	genome.wustl.edu	37	2	120012354	120012354	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:120012354C>T	ENST00000354888.5	+	5	1619	c.1115C>T	c.(1114-1116)tCc>tTc	p.S372F	STEAP3_ENST00000393106.2_Missense_Mutation_p.S372F|STEAP3_ENST00000425223.2_Missense_Mutation_p.S372F|STEAP3_ENST00000450943.2_Missense_Mutation_p.S372F|STEAP3_ENST00000409811.1_Missense_Mutation_p.S372F|STEAP3_ENST00000393110.2_Missense_Mutation_p.S382F|STEAP3_ENST00000393107.2_Missense_Mutation_p.S372F|STEAP3_ENST00000393108.2_Missense_Mutation_p.S372F	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	372	Ferric oxidoreductase.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						GGCACGTTGTCCCTGCTGGCC	0.592																																																	0													114.0	98.0	104.0					2																	120012354		2203	4300	6503	SO:0001583	missense	0			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.1115C>T	2.37:g.120012354C>T	ENSP00000346961:p.Ser372Phe		A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.S382F	ENST00000354888.5	37	c.1145	CCDS2125.1	2	.	.	.	.	.	.	.	.	.	.	C	27.0	4.788281	0.90367	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000450943;ENST00000393110;ENST00000393106;ENST00000409811;ENST00000393107;ENST00000425223;ENST00000546236	D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.29	5.29	0.74685	Flavoprotein transmembrane component (1);	0.068992	0.64402	D	0.000011	D	0.92407	0.7590	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.81914	0.995;0.995;0.977	D	0.91098	0.4912	9	.	.	.	-42.322	18.0968	0.89493	0.0:1.0:0.0:0.0	.	372;382;372	B8ZZX6;Q658P3-2;Q658P3	.;.;STEA3_HUMAN	F	372;372;372;382;372;372;372;372;16	ENSP00000376820:S372F;ENSP00000346961:S372F;ENSP00000396873:S372F;ENSP00000376822:S382F;ENSP00000376818:S372F;ENSP00000386510:S372F;ENSP00000376819:S372F;ENSP00000396214:S372F	.	S	+	2	0	STEAP3	119728824	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.753000	0.62183	2.756000	0.94617	0.561000	0.74099	TCC	STEAP3	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000115107		0.592	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	HGNC	protein_coding	OTTHUMT00000254193.1		0.00	78	0	C	NM_018234		120012354	+1			no_errors	ENST00000393110	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152576221	152576221	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:152576221G>T	ENST00000367255.5	-	104	19865	c.19264C>A	c.(19264-19266)Ctt>Att	p.L6422I	SYNE1_ENST00000423061.1_Missense_Mutation_p.L6351I|SYNE1_ENST00000448038.1_Missense_Mutation_p.L6351I|SYNE1_ENST00000265368.4_Missense_Mutation_p.L6422I|SYNE1_ENST00000341594.5_Missense_Mutation_p.L6034I|SYNE1_ENST00000356820.4_Missense_Mutation_p.L946I	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6422					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTTGGCAAGAATCTAGAGG	0.333										HNSCC(10;0.0054)																																							0													56.0	50.0	52.0					6																	152576221		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19264C>A	6.37:g.152576221G>T	ENSP00000356224:p.Leu6422Ile		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L6422I	ENST00000367255.5	37	c.19264	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600398	0.87055	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.70631	-0.4;-0.44;-0.5;-0.43;-0.13;1.97	5.87	5.87	0.94306	.	0.000000	0.53938	D	0.000047	D	0.82365	0.5021	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.991;0.996	T	0.82157	-0.0596	10	0.62326	D	0.03	.	20.2181	0.98305	0.0:0.0:1.0:0.0	.	6422;6422;6351	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	I	6422;6351;6422;6351;6034;946	ENSP00000356224:L6422I;ENSP00000396024:L6351I;ENSP00000265368:L6422I;ENSP00000390975:L6351I;ENSP00000341887:L6034I;ENSP00000349276:L946I	ENSP00000265368:L6422I	L	-	1	0	SYNE1	152617914	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	7.159000	0.77483	2.785000	0.95823	0.655000	0.94253	CTT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.333	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	49	0	G	NM_182961		152576221	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	22.92	37	11	SNP	1.000	T
SYT4	6860	genome.wustl.edu	37	18	40857273	40857273	+	5'UTR	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr18:40857273G>A	ENST00000255224.3	-	0	342				SYT4_ENST00000586678.1_5'UTR|SYT4_ENST00000590752.1_5'UTR	NM_020783.3	NP_065834.1	Q9H2B2	SYT4_HUMAN	synaptotagmin IV						exocytosis (GO:0006887)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of vesicle fusion (GO:0031339)|neurotransmitter secretion (GO:0007269)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44						TGTCCGAGGTGCTGAAGGGAA	0.537																																					NSCLC(85;81 1419 2855 22820 35912)												0													122.0	109.0	114.0					18																	40857273		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			BC036538	CCDS11922.1	18q12.3	2013-01-21			ENSG00000132872	ENSG00000132872		"""Synaptotagmins"""	11512	protein-coding gene	gene with protein product		600103				8058779	Standard	NM_020783		Approved	KIAA1342, HsT1192	uc002law.3	Q9H2B2	OTTHUMG00000132610	ENST00000255224.3:c.-27C>T	18.37:g.40857273G>A			B4DEU3|Q9P2K4	RNA	SNP	-	NULL	ENST00000255224.3	37	NULL	CCDS11922.1	18																																																																																			SYT4	-	-	ENSG00000132872		0.537	SYT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT4	HGNC	protein_coding	OTTHUMT00000255851.2	-	0.00	83	0	G	NM_020783		40857273	-1	tier1	-	no_errors	ENST00000586678	ensembl	human	known	74_37	rna	9.76	37	4	SNP	1.000	A
SZT2	23334	genome.wustl.edu	37	1	43908862	43908862	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:43908862T>C	ENST00000562955.1	+	59	8252	c.8252T>C	c.(8251-8253)cTg>cCg	p.L2751P	SZT2_ENST00000372442.1_Missense_Mutation_p.L1909P	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	2808					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						CCCTCAGAGCTGGAGCGCCAG	0.567																																																	0													138.0	130.0	133.0					1																	43908862		2203	4300	6503	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.8252T>C	1.37:g.43908862T>C	ENSP00000457168:p.Leu2751Pro		A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.L2751P	ENST00000562955.1	37	c.8252	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.219140	0.39201	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.67	5.67	0.87782	.	0.152000	0.45361	D	0.000374	T	0.68568	0.3015	L	0.43152	1.355	0.48040	D	0.999571	D	0.76494	0.999	D	0.68943	0.961	T	0.68739	-0.5329	9	0.46703	T	0.11	.	15.9043	0.79412	0.0:0.0:0.0:1.0	.	2751	Q5T011-5	.	P	1909	.	ENSP00000361519:L1909P	L	+	2	0	SZT2	43681449	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	7.906000	0.87423	2.169000	0.68431	0.459000	0.35465	CTG	SZT2	-	NULL	ENSG00000198198		0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	-	0.00	77	0	T	NM_015284		43908862	+1	tier1	-	no_errors	ENST00000562955	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	C
TAF1	6872	genome.wustl.edu	37	X	70601714	70601714	+	Silent	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chrX:70601714G>T	ENST00000373790.4	+	9	1530	c.1479G>T	c.(1477-1479)cgG>cgT	p.R493R	TAF1_ENST00000449580.1_Silent_p.R493R|TAF1_ENST00000276072.3_Silent_p.R514R|TAF1_ENST00000423759.1_Silent_p.R514R	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	493					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CCATGCCCCGGCTGTTGGAAC	0.453																																																	0													103.0	87.0	93.0					X																	70601714		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1479G>T	X.37:g.70601714G>T			A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Silent	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R493	ENST00000373790.4	37	c.1479	CCDS35325.1	X																																																																																			TAF1	-	pirsf_TAF1_animal	ENSG00000147133		0.453	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2		0.00	51	0	G	NM_004606		70601714	+1			no_errors	ENST00000449580	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.000	T
TAF1C	9013	genome.wustl.edu	37	16	84216924	84216924	+	Silent	SNP	A	A	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:84216924A>G	ENST00000567759.1	-	5	516	c.334T>C	c.(334-336)Ttg>Ctg	p.L112L	TAF1C_ENST00000570117.1_Intron|TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000566732.1_Silent_p.L112L|TAF1C_ENST00000541676.1_Silent_p.L45L|TAF1C_ENST00000341690.6_Silent_p.L45L|TAF1C_ENST00000378541.4_Silent_p.L112L	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	112					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CCATGATCCAAGAGGAACCGG	0.622																																																	0													73.0	61.0	65.0					16																	84216924		2200	4300	6500	SO:0001819	synonymous_variant	0			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.334T>C	16.37:g.84216924A>G			B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	NULL	p.L43P	ENST00000567759.1	37	c.128	CCDS32496.1	16																																																																																			TAF1C	-	NULL	ENSG00000103168		0.622	TAF1C-001	KNOWN	basic|CCDS	protein_coding	TAF1C	HGNC	protein_coding	OTTHUMT00000433045.2	-	0.00	29	0	A	NM_139353		84216924	-1	tier1	-	no_errors	ENST00000569505	ensembl	human	known	74_37	missense	42.11	22	16	SNP	1.000	G
TANK	10010	genome.wustl.edu	37	2	162087607	162087607	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:162087607G>T	ENST00000392749.2	+	7	885	c.646G>T	c.(646-648)Gga>Tga	p.G216*	AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000406287.1_Intron|AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000405852.1_Nonsense_Mutation_p.G216*|TANK_ENST00000259075.2_Nonsense_Mutation_p.G216*|TANK_ENST00000402568.1_Intron	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	216					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.G216*(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						CACACCAAGAGGACTGTGCAG	0.403																																																	1	Substitution - Nonsense(1)	lung(1)											117.0	110.0	112.0					2																	162087607		2203	4300	6503	SO:0001587	stop_gained	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.646G>T	2.37:g.162087607G>T	ENSP00000376505:p.Gly216*		D3DPB5|Q7Z4J6|Q92885	Nonsense_Mutation	SNP	NULL	p.G216*	ENST00000392749.2	37	c.646	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111088	0.77210	.	.	ENSG00000136560	ENST00000259075;ENST00000392749;ENST00000405852;ENST00000437623	.	.	.	5.78	5.78	0.91487	.	0.054502	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.2046	20.3754	0.98918	0.0:0.0:1.0:0.0	.	.	.	.	X	216;216;216;107	.	ENSP00000259075:G216X	G	+	1	0	TANK	161795853	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.770000	0.85390	2.894000	0.99253	0.591000	0.81541	GGA	TANK	-	NULL	ENSG00000136560		0.403	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1		0.00	54	0	G	NM_133484		162087607	+1			no_errors	ENST00000259075	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	1.000	T
TATDN2	9797	genome.wustl.edu	37	3	10290963	10290964	+	Frame_Shift_Ins	INS	-	-	GG	rs369729618		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:10290963_10290964insGG	ENST00000287652.4	+	2	1130_1131	c.79_80insGG	c.(79-81)cggfs	p.R27fs	TATDN2_ENST00000448281.2_Frame_Shift_Ins_p.R27fs|RP11-438J1.1_ENST00000450534.1_5'Flank	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	27					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						CAGCTGCCTCCGGGAGCCCTGT	0.683																																																	0																																										SO:0001589	frameshift_variant	0			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.80_81dupGG	3.37:g.10290964_10290965dupGG	ENSP00000287652:p.Arg27fs		Q3MIL9|Q5BKU0	Frame_Shift_Ins	INS	pfam_TatD_family	p.E28fs	ENST00000287652.4	37	c.79_80	CCDS33698.1	3																																																																																			TATDN2	-	NULL	ENSG00000157014		0.683	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN2	HGNC	protein_coding	OTTHUMT00000339641.1		0.00	114	0	0	XM_376203		10290964	+1			no_errors	ENST00000287652	ensembl	human	known	74_37	frame_shift_ins	6.52	129	9	INS	1.000:1.000	GG
TDRKH	11022	genome.wustl.edu	37	1	151747924	151747924	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:151747924G>T	ENST00000368822.1	-	10	2011	c.1378C>A	c.(1378-1380)Cag>Aag	p.Q460K	TDRKH_ENST00000368823.1_Missense_Mutation_p.Q456K|TDRKH_ENST00000458431.2_Missense_Mutation_p.Q460K|TDRKH_ENST00000368824.3_Missense_Mutation_p.Q460K|TDRKH_ENST00000368827.6_Missense_Mutation_p.Q460K|TDRKH_ENST00000368825.3_Missense_Mutation_p.Q415K|TDRKH_ENST00000440583.2_Missense_Mutation_p.Q236K			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	460					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ATCCCAGTCTGGACATAGCTA	0.458																																																	0													155.0	146.0	149.0					1																	151747924		1952	4141	6093	SO:0001583	missense	0			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1378C>A	1.37:g.151747924G>T	ENSP00000357812:p.Gln460Lys		D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Tudor,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.Q460K	ENST00000368822.1	37	c.1378	CCDS41394.1	1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.401972	0.42613	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.22539	2.3;1.96;2.3;2.3;2.3;2.3;1.95	5.92	5.92	0.95590	.	0.422401	0.28098	N	0.016619	T	0.07052	0.0179	L	0.39633	1.23	0.38951	D	0.958352	B;B;B	0.24483	0.104;0.094;0.01	B;B;B	0.19148	0.024;0.016;0.004	T	0.08680	-1.0710	10	0.09338	T	0.73	-2.9605	12.2355	0.54514	0.0778:0.0:0.9222:0.0	.	415;456;460	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	K	460;415;460;456;460;460;236	ENSP00000357819:Q460K;ENSP00000357817:Q415K;ENSP00000357815:Q460K;ENSP00000357813:Q456K;ENSP00000357812:Q460K;ENSP00000395718:Q460K;ENSP00000416645:Q236K	ENSP00000357812:Q460K	Q	-	1	0	TDRKH	150014548	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.422000	0.66453	2.813000	0.96785	0.561000	0.74099	CAG	TDRKH	-	NULL	ENSG00000182134		0.458	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TDRKH	HGNC	protein_coding	OTTHUMT00000036648.2	-	0.00	68	0	G	NM_006862		151747924	-1	tier1	-	no_errors	ENST00000368822	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TIAM1	7074	genome.wustl.edu	37	21	32595768	32595768	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr21:32595768G>A	ENST00000286827.3	-	9	2420	c.1949C>T	c.(1948-1950)gCc>gTc	p.A650V	TIAM1_ENST00000541036.1_Missense_Mutation_p.A650V|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	650					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GCGGCCCATGGCCACTTTCGT	0.478																																																	0													85.0	88.0	87.0					21																	32595768		2203	4300	6503	SO:0001583	missense	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1949C>T	21.37:g.32595768G>A	ENSP00000286827:p.Ala650Val		B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.A650V	ENST00000286827.3	37	c.1949	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702157	0.88924	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.47869	0.83;0.83	4.5	4.5	0.54988	.	0.054556	0.64402	D	0.000001	T	0.52500	0.1738	L	0.55481	1.735	0.80722	D	1	D;P;D;D	0.57899	0.981;0.945;0.968;0.968	P;B;B;B	0.47705	0.555;0.267;0.353;0.353	T	0.60850	-0.7181	10	0.87932	D	0	.	17.7573	0.88453	0.0:0.0:1.0:0.0	.	650;650;491;650	F5GZ53;B7ZLR6;E9PD83;Q13009	.;.;.;TIAM1_HUMAN	V	650;491;650	ENSP00000286827:A650V;ENSP00000441570:A650V	ENSP00000286827:A650V	A	-	2	0	TIAM1	31517639	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	7.688000	0.84153	2.496000	0.84212	0.655000	0.94253	GCC	TIAM1	-	NULL	ENSG00000156299		0.478	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	113	0	G	NM_003253		32595768	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	missense	5.05	94	5	SNP	1.000	A
TMPRSS4	56649	genome.wustl.edu	37	11	117969749	117969749	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr11:117969749G>T	ENST00000437212.3	+	3	307	c.93G>T	c.(91-93)aaG>aaT	p.K31N	TMPRSS4_ENST00000523251.1_Intron|TMPRSS4_ENST00000522824.1_Missense_Mutation_p.K31N|TMPRSS4_ENST00000522307.1_5'UTR|TMPRSS4_ENST00000534111.1_Missense_Mutation_p.K29N			Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4	31					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	19	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)		CCTTCAGAAAGGTGGGGATCC	0.532																																																	0													216.0	182.0	193.0					11																	117969749		2200	4296	6496	SO:0001583	missense	0			AF179224	CCDS31684.1, CCDS44743.1, CCDS53716.1, CCDS53717.1	11q23.3	2010-04-13			ENSG00000137648	ENSG00000137648		"""Serine peptidases / Transmembrane"""	11878	protein-coding gene	gene with protein product	"""transmembrane serine protease 3"", ""membrane-type serine protease 2"", ""type II membrane serine protease"""	606565				10825129	Standard	NM_001083947		Approved	TMPRSS3, MT-SP2	uc021qrd.1	Q9NRS4	OTTHUMG00000164122	ENST00000437212.3:c.93G>T	11.37:g.117969749G>T	ENSP00000416037:p.Lys31Asn		A8MU84|B0YJB0|B7Z8C5|E7ERX8|Q5XKQ6|Q6UX37|Q9NZA5	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.K31N	ENST00000437212.3	37	c.93	CCDS31684.1	11	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978737	0.34942	.	.	ENSG00000137648	ENST00000534111;ENST00000437212;ENST00000522824;ENST00000522151	D;D;D;T	0.88818	-2.42;-2.43;-2.43;0.05	4.31	2.42	0.29668	.	0.260983	0.26757	N	0.022652	D	0.86632	0.5979	M	0.62723	1.935	0.34088	D	0.66037	P;P;P	0.49783	0.799;0.883;0.928	B;B;P	0.44359	0.343;0.261;0.447	D	0.88129	0.2837	10	0.66056	D	0.02	.	8.911	0.35552	0.1925:0.0:0.8075:0.0	.	6;31;29	B7Z900;Q9NRS4;Q9NRS4-3	.;TMPS4_HUMAN;.	N	29;31;31;29	ENSP00000435184:K29N;ENSP00000416037:K31N;ENSP00000430547:K31N;ENSP00000428407:K29N	ENSP00000416037:K31N	K	+	3	2	TMPRSS4	117474959	0.998000	0.40836	0.998000	0.56505	0.466000	0.32739	0.420000	0.21263	0.543000	0.28864	0.456000	0.33151	AAG	TMPRSS4	-	NULL	ENSG00000137648		0.532	TMPRSS4-004	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS4	HGNC	protein_coding	OTTHUMT00000377328.2	-	0.00	57	0	G	NM_019894		117969749	+1	tier1	-	no_errors	ENST00000437212	ensembl	human	known	74_37	missense	8.33	43	4	SNP	0.995	T
TMTC1	83857	genome.wustl.edu	37	12	29936476	29936476	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:29936476C>T	ENST00000539277.1	-	1	267	c.209G>A	c.(208-210)cGc>cAc	p.R70H	TMTC1_ENST00000381224.2_Intron|TMTC1_ENST00000551659.1_Missense_Mutation_p.R70H|TMTC1_ENST00000552618.1_Missense_Mutation_p.R70H|TMTC1_ENST00000256062.5_Intron	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	70						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GATGCCCCAGCGGAGCGGGGC	0.667																																																	0																																										SO:0001583	missense	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.209G>A	12.37:g.29936476C>T	ENSP00000442046:p.Arg70His		D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R70H	ENST00000539277.1	37	c.209	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787152	0.49997	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	D;D;D	0.93953	-3.32;-3.32;-3.32	3.16	1.06	0.20224	.	.	.	.	.	D	0.89504	0.6734	L	0.48642	1.525	0.80722	D	1	.	.	.	.	.	.	T	0.80797	-0.1222	6	.	.	.	.	1.7899	0.03049	0.392:0.329:0.1671:0.1118	.	.	.	.	H	70	ENSP00000448112:R70H;ENSP00000449043:R70H;ENSP00000442046:R70H	.	R	-	2	0	TMTC1	29827743	0.803000	0.28956	0.811000	0.32455	0.975000	0.68041	1.058000	0.30504	0.004000	0.14682	0.484000	0.47621	CGC	TMTC1	-	NULL	ENSG00000133687		0.667	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	-	0.00	152	0	C	NM_031920		29936476	-1	tier1	-	no_errors	ENST00000539277	ensembl	human	putative	74_37	missense	29.06	143	59	SNP	0.994	T
TOMM70A	9868	genome.wustl.edu	37	3	100119483	100119483	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:100119483G>C	ENST00000284320.5	-	1	759	c.311C>G	c.(310-312)gCt>gGt	p.A104G	LNP1_ENST00000383693.3_5'Flank|LNP1_ENST00000489752.1_5'Flank	NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	104					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						GTCCAAGTGAGCACCGGGACC	0.672																																																	0													12.0	13.0	13.0					3																	100119483		2165	4207	6372	SO:0001583	missense	0			AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.311C>G	3.37:g.100119483G>C	ENSP00000284320:p.Ala104Gly		D3DN48	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A104G	ENST00000284320.5	37	c.311	CCDS33807.1	3	.	.	.	.	.	.	.	.	.	.	G	11.27	1.589853	0.28357	.	.	ENSG00000154174	ENST00000284320	T	0.10099	2.91	4.61	1.69	0.24217	.	0.696518	0.13960	N	0.350891	T	0.04363	0.0120	N	0.08118	0	0.24960	N	0.991732	B	0.02656	0.0	B	0.01281	0.0	T	0.44590	-0.9318	10	0.18276	T	0.48	0.5344	4.1928	0.10430	0.0903:0.1522:0.589:0.1685	.	104	O94826	TOM70_HUMAN	G	104	ENSP00000284320:A104G	ENSP00000284320:A104G	A	-	2	0	TOMM70A	101602173	0.995000	0.38212	0.429000	0.26710	0.943000	0.58893	1.224000	0.32539	0.231000	0.21079	0.561000	0.74099	GCT	TOMM70A	-	NULL	ENSG00000154174		0.672	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM70A	HGNC	protein_coding	OTTHUMT00000353141.2	-	0.00	121	0	G			100119483	-1	tier1	-	no_errors	ENST00000284320	ensembl	human	known	74_37	missense	27.03	81	30	SNP	0.855	C
TP53	7157	genome.wustl.edu	37	17	7578526	7578526	+	Missense_Mutation	SNP	C	C	A	rs587781991		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr17:7578526C>A	ENST00000269305.4	-	5	593	c.404G>T	c.(403-405)tGc>tTc	p.C135F	TP53_ENST00000359597.4_Missense_Mutation_p.C135F|TP53_ENST00000413465.2_Missense_Mutation_p.C135F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C135F|TP53_ENST00000445888.2_Missense_Mutation_p.C135F|TP53_ENST00000420246.2_Missense_Mutation_p.C135F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135Y(60)|p.C135F(43)|p.C135S(8)|p.0?(8)|p.C42Y(4)|p.C3Y(4)|p.C135fs*9(3)|p.N131fs*27(2)|p.C3F(2)|p.C42F(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*15(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C42S(1)|p.M133fs*13(1)|p.C3S(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCAGTTGGCAAAACATCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	152	Substitution - Missense(126)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	large_intestine(19)|breast(17)|oesophagus(16)|haematopoietic_and_lymphoid_tissue(13)|urinary_tract(13)|upper_aerodigestive_tract(12)|prostate(11)|lung(9)|ovary(9)|liver(7)|bone(6)|stomach(5)|central_nervous_system(5)|soft_tissue(2)|autonomic_ganglia(2)|eye(1)|kidney(1)|pancreas(1)|skin(1)|NS(1)|pituitary(1)											50.0	50.0	50.0					17																	7578526		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.404G>T	17.37:g.7578526C>A	ENSP00000269305:p.Cys135Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C135F	ENST00000269305.4	37	c.404	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574878	0.86542	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99797	-6.79;-6.79;-6.79;-6.79;-6.79;-6.79;-6.79;-6.79;-6.79	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;P;D;D;D;D	0.97110	0.997;1.0;0.904;1.0;1.0;1.0;1.0	D	0.97349	0.9962	10	0.72032	D	0.01	-26.815	17.2272	0.86973	0.0:1.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135F;ENSP00000352610:C135F;ENSP00000269305:C135F;ENSP00000398846:C135F;ENSP00000391127:C135F;ENSP00000391478:C135F;ENSP00000425104:C3F;ENSP00000423862:C42F;ENSP00000424104:C135F	ENSP00000269305:C135F	C	-	2	0	TP53	7519251	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.772000	0.85439	2.733000	0.93635	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	55	0	C	NM_000546		7578526	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	57.89	16	22	SNP	1.000	A
TP53TG3D	729264	genome.wustl.edu	37	16	32265836	32265836	+	IGR	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:32265836C>T	ENST00000354614.3	+	0	412				TP53TG3D_ENST00000569631.1_3'UTR|TP53TG3D_ENST00000564810.1_3'UTR|TP53TG3D_ENST00000398664.3_Intron|RP11-56L13.7_ENST00000562604.1_RNA			Q9ULZ0	T53G3_HUMAN	TP53 target 3D							cytoplasm (GO:0005737)|nucleus (GO:0005634)											GAGGAGAAAACGTCACAGCGG	0.602																																																	0																																										SO:0001628	intergenic_variant	0				CCDS58456.1	16p11.2	2012-12-11			ENSG00000205456	ENSG00000205456			44657	protein-coding gene	gene with protein product							Standard	NM_001243722		Approved		uc021tgy.1	Q9ULZ0	OTTHUMG00000132469		16.37:g.32265836C>T			B2R5K6|Q4KN31|Q9ULY9	RNA	SNP	-	NULL	ENST00000354614.3	37	NULL		16																																																																																			TP53TG3D	-	-	ENSG00000205456		0.602	TP53TG3D-201	KNOWN	basic|appris_candidate_longest	protein_coding	TP53TG3D	HGNC	protein_coding		-	0.00	150	0	C	NM_001243722		32265836	+1	tier1	-	no_errors	ENST00000564810	ensembl	human	known	74_37	rna	36.50	126	73	SNP	0.373	T
TRAPPC9	83696	genome.wustl.edu	37	8	140922425	140922425	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:140922425T>C	ENST00000438773.2	-	20	3063	c.2930A>G	c.(2929-2931)gAg>gGg	p.E977G	TRAPPC9_ENST00000389328.4_Missense_Mutation_p.E1075G|RP11-284H18.1_ENST00000518354.1_RNA|TRAPPC9_ENST00000522504.1_5'Flank|TRAPPC9_ENST00000389327.3_Missense_Mutation_p.E968G	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	977					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						GCTGTGGATCTCCAGGCCTCG	0.582																																																	0													55.0	62.0	59.0					8																	140922425		2203	4300	6503	SO:0001583	missense	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.2930A>G	8.37:g.140922425T>C	ENSP00000405060:p.Glu977Gly		Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.E1075G	ENST00000438773.2	37	c.3224	CCDS55278.1	8	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929170	0.73327	.	.	ENSG00000167632	ENST00000389328;ENST00000389327;ENST00000438773	.	.	.	5.62	5.62	0.85841	.	0.057545	0.64402	D	0.000002	T	0.64516	0.2605	L	0.44542	1.39	0.43642	D	0.996047	D;P;P;P	0.61080	0.989;0.939;0.622;0.925	P;P;B;P	0.60236	0.871;0.724;0.204;0.691	T	0.60073	-0.7334	9	0.23302	T	0.38	.	15.0083	0.71530	0.0:0.0:0.0:1.0	.	1075;977;968;1075	A6NIF0;Q96Q05;Q96Q05-3;Q96Q05-2	.;TPPC9_HUMAN;.;.	G	1075;968;977	.	ENSP00000373978:E968G	E	-	2	0	TRAPPC9	140991607	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	7.044000	0.76578	2.149000	0.67028	0.533000	0.62120	GAG	TRAPPC9	-	NULL	ENSG00000167632		0.582	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	-	0.00	78	0	T	NM_031466		140922425	-1	tier1	-	no_errors	ENST00000389328	ensembl	human	known	74_37	missense	15.62	81	15	SNP	1.000	C
TSHZ3	57616	genome.wustl.edu	37	19	31770238	31770240	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:31770238_31770240delCTG	ENST00000240587.4	-	2	786_788	c.459_461delCAG	c.(457-462)agcagt>agt	p.153_154SS>S		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	153	Ser-rich.				in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					gctgctgctactgctgctgctgc	0.611																																																	0																																										SO:0001651	inframe_deletion	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.459_461delCAG	19.37:g.31770247_31770249delCTG	ENSP00000240587:p.Ser159del		Q9H0G6|Q9P254	In_Frame_Del	DEL	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S157in_frame_del	ENST00000240587.4	37	c.461_459	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.611	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2		0.00	62	0	CTG	NM_020856		31770240	-1	tier1		no_errors	ENST00000240587	ensembl	human	known	74_37	in_frame_del	9.38	58	6	DEL	1.000:1.000:1.000	-
TSNAXIP1	55815	genome.wustl.edu	37	16	67858589	67858589	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:67858589G>T	ENST00000388833.3	+	6	800	c.423G>T	c.(421-423)gaG>gaT	p.E141D	TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.E195D|TSNAXIP1_ENST00000562321.1_Intron|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.E126D	NM_018430.2	NP_060900.2			translin-associated factor X interacting protein 1											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|prostate(1)|soft_tissue(1)|urinary_tract(1)	22		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		GAGCTGAGGAGAAATATGAAA	0.468																																																	0													64.0	63.0	63.0					16																	67858589		1942	4156	6098	SO:0001583	missense	0			AF132730	CCDS10846.2, CCDS73903.1, CCDS73904.1	16q22.2	2008-02-05			ENSG00000102904	ENSG00000102904			18586	protein-coding gene	gene with protein product		607720				12036294	Standard	XM_005256051		Approved	TXI1	uc002euj.3	Q2TAA8	OTTHUMG00000137545	ENST00000388833.3:c.423G>T	16.37:g.67858589G>T	ENSP00000373485:p.Glu141Asp			Missense_Mutation	SNP	NULL	p.E141D	ENST00000388833.3	37	c.423	CCDS10846.2	16	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894261	0.72639	.	.	ENSG00000102904	ENST00000415766;ENST00000388833	T;T	0.01084	5.36;5.36	6.17	4.17	0.49024	.	0.074389	0.52532	N	0.000080	T	0.03608	0.0103	M	0.72894	2.215	0.39334	D	0.965473	P;P;B	0.37207	0.587;0.587;0.38	P;P;B	0.48166	0.569;0.569;0.229	T	0.31251	-0.9950	10	0.87932	D	0	-25.8093	10.2445	0.43332	0.0714:0.1357:0.7929:0.0	.	126;195;141	E7ENJ7;B4DXD0;Q2TAA8	.;.;TXIP1_HUMAN	D	126;141	ENSP00000411472:E126D;ENSP00000373485:E141D	ENSP00000373485:E141D	E	+	3	2	TSNAXIP1	66416090	1.000000	0.71417	0.942000	0.38095	0.640000	0.38277	1.998000	0.40796	0.888000	0.36160	0.655000	0.94253	GAG	TSNAXIP1	-	NULL	ENSG00000102904		0.468	TSNAXIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TSNAXIP1	HGNC	protein_coding	OTTHUMT00000268876.2	-	0.00	71	0	G	NM_018430		67858589	+1	tier1	-	no_errors	ENST00000388833	ensembl	human	known	74_37	missense	23.81	64	20	SNP	0.997	T
TTC28	23331	genome.wustl.edu	37	22	28388606	28388606	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr22:28388606G>A	ENST00000397906.2	-	19	5663	c.5522C>T	c.(5521-5523)gCc>gTc	p.A1841V	TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000433317.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000430853.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1841					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CGTCTCGGAGGCAGTGATGAG	0.562																																																	0													64.0	65.0	65.0					22																	28388606		692	1591	2283	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.5522C>T	22.37:g.28388606G>A	ENSP00000381003:p.Ala1841Val		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A1841V	ENST00000397906.2	37	c.5522	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318562	0.81469	.	.	ENSG00000100154	ENST00000397906;ENST00000431039	D	0.88741	-2.42	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.83252	0.5214	L	0.27053	0.805	0.80722	D	1	B	0.25351	0.124	B	0.20767	0.031	T	0.78924	-0.2012	10	0.35671	T	0.21	-20.4336	18.2611	0.90035	0.0:0.0:1.0:0.0	.	1841	Q96AY4	TTC28_HUMAN	V	1841;128	ENSP00000381003:A1841V	ENSP00000381003:A1841V	A	-	2	0	TTC28	26718606	1.000000	0.71417	0.974000	0.42286	0.943000	0.58893	8.983000	0.93477	2.625000	0.88918	0.655000	0.94253	GCC	TTC28	-	NULL	ENSG00000100154		0.562	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2		0.00	90	0	G	XM_929318		28388606	-1			no_errors	ENST00000397906	ensembl	human	novel	74_37	missense	5.00	114	6	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179447301	179447301	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:179447301G>T	ENST00000591111.1	-	264	61183	c.60959C>A	c.(60958-60960)gCa>gAa	p.A20320E	TTN_ENST00000342992.6_Missense_Mutation_p.A19393E|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A13021E|TTN_ENST00000460472.2_Missense_Mutation_p.A12896E|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A13088E|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A21961E|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000438095.1_RNA			Q8WZ42	TITIN_HUMAN	titin	20320	Fibronectin type-III 47. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTAACAGATGCTGGAGGACC	0.438																																																	0													72.0	67.0	69.0					2																	179447301		1857	4099	5956	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.60959C>A	2.37:g.179447301G>T	ENSP00000465570:p.Ala20320Glu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A19393E	ENST00000591111.1	37	c.58178		2	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334832	0.24253	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.76	4.87	0.63330	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49115	0.1538	N	0.13003	0.285	0.44880	D	0.997893	P;P;P;P	0.50819	0.939;0.939;0.939;0.892	P;P;P;P	0.51324	0.666;0.666;0.666;0.575	T	0.58216	-0.7675	9	0.87932	D	0	.	17.0266	0.86448	0.0:0.127:0.873:0.0	.	12896;13021;13088;20320	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	19393;12896;13088;13021;12894	ENSP00000343764:A19393E;ENSP00000434586:A12896E;ENSP00000340554:A13088E;ENSP00000352154:A13021E	ENSP00000340554:A13088E	A	-	2	0	TTN	179155547	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	6.663000	0.74431	1.405000	0.46838	0.655000	0.94253	GCA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	34	0	G	NM_133378		179447301	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
UBAP1	51271	genome.wustl.edu	37	9	34250735	34250735	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:34250735T>C	ENST00000297661.4	+	6	1581	c.1346T>C	c.(1345-1347)aTg>aCg	p.M449T	UBAP1_ENST00000379186.4_Missense_Mutation_p.M388T|UBAP1_ENST00000543944.1_Missense_Mutation_p.M485T|UBAP1_ENST00000545103.1_Missense_Mutation_p.M513T|UBAP1_ENST00000359544.2_Missense_Mutation_p.M449T|UBAP1_ENST00000536252.1_Missense_Mutation_p.M449T|UBAP1_ENST00000540348.1_Missense_Mutation_p.M449T	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	449					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)			endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			GCTCTGGAAATGCACCAGTGT	0.473																																					NSCLC(109;1074 1634 14978 20375 39620)												0													104.0	97.0	100.0					9																	34250735		2203	4300	6503	SO:0001583	missense	0			AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.1346T>C	9.37:g.34250735T>C	ENSP00000297661:p.Met449Thr		B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Missense_Mutation	SNP	superfamily_UBA-like,pfscan_UBA/transl_elong_EF1B_N_euk	p.M513T	ENST00000297661.4	37	c.1538	CCDS6550.1	9	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273767	0.59649	.	.	ENSG00000165006	ENST00000545103;ENST00000543944;ENST00000536252;ENST00000540348;ENST00000297661;ENST00000379186;ENST00000359544	T;T;T;T;T;T;T	0.51071	0.73;0.72;0.76;0.76;0.76;1.05;0.76	6.17	6.17	0.99709	.	0.039530	0.85682	D	0.000000	T	0.43831	0.1265	L	0.46157	1.445	0.80722	D	1	P;B;P;P	0.42692	0.787;0.017;0.675;0.675	B;B;B;B	0.39258	0.295;0.011;0.295;0.295	T	0.30208	-0.9986	10	0.30854	T	0.27	-4.5317	16.8222	0.85835	0.0:0.0:0.0:1.0	.	513;485;513;449	F5GXE2;F5H0J8;B7Z8N9;Q9NZ09	.;.;.;UBAP1_HUMAN	T	513;485;449;449;449;388;449	ENSP00000441024:M513T;ENSP00000439806:M485T;ENSP00000440456:M449T;ENSP00000439976:M449T;ENSP00000297661:M449T;ENSP00000368484:M388T;ENSP00000352541:M449T	ENSP00000297661:M449T	M	+	2	0	UBAP1	34240735	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.741000	0.68638	2.371000	0.80710	0.533000	0.62120	ATG	UBAP1	-	superfamily_UBA-like	ENSG00000165006		0.473	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP1	HGNC	protein_coding	OTTHUMT00000001084.1		0.00	81	0	T			34250735	+1			no_errors	ENST00000545103	ensembl	human	known	74_37	missense	5.10	93	5	SNP	1.000	C
UBE3B	89910	genome.wustl.edu	37	12	109949113	109949113	+	Intron	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr12:109949113G>A	ENST00000342494.3	+	18	2551				UBE3B_ENST00000434735.2_Intron|UBE3B_ENST00000280774.5_Intron|UBE3B_ENST00000535900.1_3'UTR	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						AAAAACGTGAGTTGCACTCAG	0.517																																																	0													140.0	100.0	114.0					12																	109949113		2203	4300	6503	SO:0001627	intron_variant	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.1956+5G>A	12.37:g.109949113G>A			A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	RNA	SNP	-	NULL	ENST00000342494.3	37	NULL	CCDS9129.1	12																																																																																			UBE3B	-	-	ENSG00000151148		0.517	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	-	0.00	61	0	G	NM_183415		109949113	+1	tier1	-	no_errors	ENST00000535900	ensembl	human	known	74_37	rna	46.27	36	31	SNP	1.000	A
UQCRC2	7385	genome.wustl.edu	37	16	21964747	21964747	+	Start_Codon_SNP	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:21964747G>T	ENST00000268379.4	+	1	767	c.3G>T	c.(1-3)atG>atT	p.M1I	UQCRC2_ENST00000561553.1_Start_Codon_SNP_p.M1I	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	1					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		CTTGAATCATGAAGCTACTAA	0.562																																					Colon(123;450 1645 12841 25393 45623)												0													54.0	52.0	53.0					16																	21964747		2198	4300	6498	SO:0001582	initiator_codon_variant	0			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.3G>T	16.37:g.21964747G>T	ENSP00000268379:p.Met1Ile		B3KSN4|Q9BQ05	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.M1I	ENST00000268379.4	37	c.3	CCDS10601.1	16	.	.	.	.	.	.	.	.	.	.	G	16.43	3.119890	0.56613	.	.	ENSG00000140740	ENST00000268379	T	0.10573	2.86	5.51	5.51	0.81932	.	0.034211	0.85682	D	0.000000	T	0.28797	0.0714	.	.	.	0.80722	D	1	P	0.45126	0.851	P	0.58391	0.838	T	0.00087	-1.2093	9	0.56958	D	0.05	-17.3239	15.2722	0.73712	0.0:0.0:1.0:0.0	.	1	P22695	QCR2_HUMAN	I	1	ENSP00000268379:M1I	ENSP00000268379:M1I	M	+	3	0	UQCRC2	21872248	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	4.474000	0.60203	2.736000	0.93811	0.655000	0.94253	ATG	UQCRC2	-	NULL	ENSG00000140740		0.562	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	HGNC	protein_coding	OTTHUMT00000254466.1		0.00	40	0	G	NM_003366	Missense_Mutation	21964747	+1			no_errors	ENST00000268379	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
USF1	7391	genome.wustl.edu	37	1	161011971	161011971	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:161011971G>T	ENST00000368021.3	-	5	415	c.211C>A	c.(211-213)Ctg>Atg	p.L71M	USF1_ENST00000435396.1_Missense_Mutation_p.L12M|USF1_ENST00000368019.1_Missense_Mutation_p.L71M|USF1_ENST00000368020.1_Missense_Mutation_p.L71M	NM_007122.3	NP_009053.1	P22415	USF1_HUMAN	upstream transcription factor 1	71					carbon catabolite regulation of transcription (GO:0045990)|cellular response to insulin stimulus (GO:0032869)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|late viral transcription (GO:0019086)|lipid homeostasis (GO:0055088)|negative regulation of fibrinolysis (GO:0051918)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter by glucose (GO:0000430)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(3)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(52;6.73e-18)|Breast(13;0.012)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TGGCCATCCAGCTGCCCCTCA	0.537																																																	0													77.0	69.0	71.0					1																	161011971		2203	4300	6503	SO:0001583	missense	0			BC035505	CCDS1214.1	1q22-q23	2013-05-21			ENSG00000158773	ENSG00000158773		"""Basic helix-loop-helix proteins"""	12593	protein-coding gene	gene with protein product		191523				8486371	Standard	NM_007122		Approved	UEF, MLTFI, bHLHb11	uc031pqv.1	P22415	OTTHUMG00000031472	ENST00000368021.3:c.211C>A	1.37:g.161011971G>T	ENSP00000357000:p.Leu71Met		B2RBZ4|Q5SY46|Q7Z5Y1	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L71M	ENST00000368021.3	37	c.211	CCDS1214.1	1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.833076	0.50951	.	.	ENSG00000158773	ENST00000368020;ENST00000368021;ENST00000435396;ENST00000368019;ENST00000531842;ENST00000534633	D;D;D;D;D	0.95238	-3.37;-3.37;-3.65;-3.4;-2.9	4.74	3.8	0.43715	.	0.000000	0.85682	D	0.000000	D	0.91205	0.7229	L	0.53249	1.67	0.45464	D	0.99843	P	0.39044	0.656	P	0.44732	0.459	D	0.90934	0.4792	10	0.48119	T	0.1	-9.114	12.8257	0.57718	0.0:0.1658:0.8342:0.0	.	71	P22415	USF1_HUMAN	M	71;71;12;71;71;12	ENSP00000356999:L71M;ENSP00000357000:L71M;ENSP00000390109:L12M;ENSP00000356998:L71M;ENSP00000435005:L71M	ENSP00000356998:L71M	L	-	1	2	USF1	159278595	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.042000	0.49815	1.313000	0.45069	0.609000	0.83330	CTG	USF1	-	NULL	ENSG00000158773		0.537	USF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USF1	HGNC	protein_coding	OTTHUMT00000077050.1		0.00	73	0	G	NM_007122		161011971	-1			no_errors	ENST00000368020	ensembl	human	known	74_37	missense	6.06	61	4	SNP	1.000	T
USP10	9100	genome.wustl.edu	37	16	84779188	84779188	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:84779188C>T	ENST00000219473.7	+	4	1214	c.1101C>T	c.(1099-1101)ccC>ccT	p.P367P	USP10_ENST00000570191.1_Silent_p.P371P	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	367					autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						ATTCCCCTCCCGCCATATCTC	0.512																																																	0													16.0	17.0	16.0					16																	84779188		1835	4087	5922	SO:0001819	synonymous_variant	0			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1101C>T	16.37:g.84779188C>T			B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Ataxin-2_C,pfscan_Peptidase_C19/C67	p.P371	ENST00000219473.7	37	c.1113	CCDS45537.1	16																																																																																			USP10	-	NULL	ENSG00000103194		0.512	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	USP10	HGNC	protein_coding	OTTHUMT00000433660.1	-	0.00	137	0	C			84779188	+1	tier1	-	no_errors	ENST00000570191	ensembl	human	known	74_37	silent	45.36	100	83	SNP	0.998	T
WBP1	23559	genome.wustl.edu	37	2	74687409	74687410	+	Frame_Shift_Ins	INS	-	-	C	rs574091294	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:74687409_74687410insC	ENST00000233615.2	+	4	685_686	c.411_412insC	c.(412-414)cccfs	p.P138fs	WBP1_ENST00000393972.3_Frame_Shift_Ins_p.P172fs|MOGS_ENST00000462443.1_5'Flank|WBP1_ENST00000409737.1_Frame_Shift_Ins_p.P135fs|WBP1_ENST00000494741.1_3'UTR	NM_012477.3	NP_036609.1	Q96G27	WBP1_HUMAN	WW domain binding protein 1	138							WW domain binding (GO:0050699)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	8						CAGGCACACCACCCCCCCCTTA	0.584																																																	0																																										SO:0001589	frameshift_variant	0			U79457	CCDS1943.1	2p12	2012-04-20			ENSG00000239779	ENSG00000239779			12737	protein-coding gene	gene with protein product		606961				7644498	Standard	NM_012477		Approved	WBP-1	uc002slj.2	Q96G27	OTTHUMG00000129958	ENST00000233615.2:c.419dupC	2.37:g.74687417_74687417dupC	ENSP00000233615:p.Pro138fs		B2RE02|O95637	Frame_Shift_Ins	INS	pfam_Uncharacterised_WW-bd	p.Y140fs	ENST00000233615.2	37	c.411_412	CCDS1943.1	2																																																																																			WBP1	-	pfam_Uncharacterised_WW-bd	ENSG00000239779		0.584	WBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WBP1	HGNC	protein_coding	OTTHUMT00000252221.2		0.00	122	0	-	NM_012477		74687410	+1	tier1		no_errors	ENST00000233615	ensembl	human	known	74_37	frame_shift_ins	31.48	74	34	INS	0.119:0.993	C
VIL1	7429	genome.wustl.edu	37	2	219303392	219303392	+	Silent	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:219303392C>T	ENST00000248444.5	+	18	2260	c.2172C>T	c.(2170-2172)tcC>tcT	p.S724S	VIL1_ENST00000392114.2_Silent_p.S413S	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	724	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACACCAAATCCTATGAGGACC	0.537																																																	0													58.0	56.0	56.0					2																	219303392		2203	4300	6503	SO:0001819	synonymous_variant	0			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.2172C>T	2.37:g.219303392C>T			B2R9A7|Q53S11|Q96AC8	Silent	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.S724	ENST00000248444.5	37	c.2172	CCDS2417.1	2																																																																																			VIL1	-	NULL	ENSG00000127831		0.537	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3	-	0.00	95	0	C	NM_007127		219303392	+1	tier1	-	no_errors	ENST00000248444	ensembl	human	known	74_37	silent	32.53	56	27	SNP	0.998	T
WDFY4	57705	genome.wustl.edu	37	10	50190923	50190924	+	3'UTR	INS	-	-	AA	rs398075124|rs61366126|rs397723327	byFrequency	TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr10:50190923_50190924insAA	ENST00000325239.5	+	0	9885_9886				RP11-523O18.1_ENST00000422966.1_RNA|WDFY4_ENST00000413659.2_3'UTR|MIR4294_ENST00000584548.1_RNA|WDFY4_ENST00000465910.1_3'UTR|RP11-523O18.5_ENST00000428825.4_RNA	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4							integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTATTGCACTGAAAAAAAAAAA	0.396																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.*304->AA	10.37:g.50190932_50190933dupAA			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	RNA	INS	-	NULL	ENST00000325239.5	37	NULL	CCDS44385.1	10																																																																																			WDFY4	-	-	ENSG00000128815		0.396	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding			0.00	18	0	-	XM_033379		50190924	+1	tier1		no_errors	ENST00000465910	ensembl	human	known	74_37	rna	17.39	19	4	INS	0.898:0.023	AA
XPO6	23214	genome.wustl.edu	37	16	28109896	28109896	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:28109896C>T	ENST00000304658.5	-	24	3841	c.3341G>A	c.(3340-3342)tGc>tAc	p.C1114Y	XPO6_ENST00000565698.1_Missense_Mutation_p.C1100Y	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	1114					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						GCTGTCGTTGCAGAGTCTGTA	0.612																																																	0													85.0	101.0	95.0					16																	28109896		2159	4264	6423	SO:0001583	missense	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.3341G>A	16.37:g.28109896C>T	ENSP00000302790:p.Cys1114Tyr		A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.C1114Y	ENST00000304658.5	37	c.3341	CCDS42135.1	16	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688980	0.88735	.	.	ENSG00000169180	ENST00000304658	T	0.48522	0.81	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.62171	0.2406	M	0.61703	1.905	0.80722	D	1	D;D	0.69078	0.997;0.991	P;P	0.57679	0.825;0.687	T	0.64765	-0.6330	10	0.66056	D	0.02	-13.0705	16.8596	0.86014	0.0:1.0:0.0:0.0	.	1113;1114	B7ZM10;Q96QU8	.;XPO6_HUMAN	Y	1114	ENSP00000302790:C1114Y	ENSP00000302790:C1114Y	C	-	2	0	XPO6	28017397	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.751000	0.85126	2.587000	0.87381	0.655000	0.94253	TGC	XPO6	-	NULL	ENSG00000169180		0.612	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1		0.00	51	0	C	XM_055195		28109896	-1			no_errors	ENST00000304658	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
WDR59	79726	genome.wustl.edu	37	16	74946165	74946165	+	Silent	SNP	G	G	A	rs371325788		TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr16:74946165G>A	ENST00000262144.6	-	14	1450	c.1320C>T	c.(1318-1320)aaC>aaT	p.N440N		NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	440	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						AAGGGGCGGCGTTGTTTGGGT	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		17228	0.0		0.0	False		,,,				2504	0.001																0								G		0,4396		0,0,2198	228.0	203.0	212.0		1320	-3.7	0.9	16		212	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	WDR59	NM_030581.3		0,1,6497	AA,AG,GG		0.0116,0.0,0.0077		440/975	74946165	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	0			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.1320C>T	16.37:g.74946165G>A			B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_UBQ-conjugating_enzyme/RWD,smart_WD40_repeat,smart_RWD-domain,pfscan_RWD-domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N440	ENST00000262144.6	37	c.1320	CCDS32488.1	16																																																																																			WDR59	-	superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain	ENSG00000103091		0.537	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	HGNC	protein_coding	OTTHUMT00000410601.3	-	0.00	48	0	G	NM_030581		74946165	-1	tier1	-	no_errors	ENST00000262144	ensembl	human	known	74_37	silent	5.56	85	5	SNP	0.969	A
YARS	8565	genome.wustl.edu	37	1	33241585	33241585	+	Silent	SNP	G	G	A			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:33241585G>A	ENST00000373477.4	-	13	2492	c.1584C>T	c.(1582-1584)agC>agT	p.S528S	YARS_ENST00000469100.1_5'UTR	NM_003680.3	NP_003671.1	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase	528					apoptotic process (GO:0006915)|gene expression (GO:0010467)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)|tyrosyl-tRNA aminoacylation (GO:0006437)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|interleukin-8 receptor binding (GO:0005153)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)|tRNA binding (GO:0000049)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	GGGCTGGCTAGCTAATGTTCC	0.507																																																	0													114.0	103.0	107.0					1																	33241585		2203	4300	6503	SO:0001819	synonymous_variant	0			U89436	CCDS368.1	1p35.1	2014-09-17			ENSG00000134684	ENSG00000134684	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	12840	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 1, cytoplasmic"""	603623				8552597, 9162081	Standard	NM_003680		Approved	YTS, YRS, tyrRS	uc001bvy.1	P54577	OTTHUMG00000003933	ENST00000373477.4:c.1584C>T	1.37:g.33241585G>A			B3KWK4|D3DPQ4|O43276|Q53EN1	Silent	SNP	pfam_aa-tRNA-synth_Ic,pfam_tRNA-bd_dom,superfamily_NA-bd_OB-fold,prints_Tyr-tRNA-ligase,pfscan_tRNA-bd_dom,tigrfam_Tyr-tRNA-ligase	p.S528	ENST00000373477.4	37	c.1584	CCDS368.1	1																																																																																			YARS	-	superfamily_NA-bd_OB-fold	ENSG00000134684		0.507	YARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS	HGNC	protein_coding	OTTHUMT00000011225.1		0.00	57	0	G	NM_003680		33241585	-1			no_errors	ENST00000373477	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	A
XPR1	9213	genome.wustl.edu	37	1	180843070	180843070	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:180843070G>T	ENST00000367590.4	+	13	1998	c.1800G>T	c.(1798-1800)gaG>gaT	p.E600D	XPR1_ENST00000367589.3_Missense_Mutation_p.E535D	NM_004736.3	NP_004727.2	Q9UBH6	XPR1_HUMAN	xenotropic and polytropic retrovirus receptor 1	600	EXS. {ECO:0000255|PROSITE- ProRule:PRU00712}.				G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	35						CCCCACTTGAGGTTTTCCGGT	0.358																																																	0													94.0	82.0	86.0					1																	180843070		2203	4300	6503	SO:0001583	missense	0			AF099082	CCDS1340.1, CCDS44284.1	1q25.1	2013-07-18	2010-04-23		ENSG00000143324	ENSG00000143324			12827	protein-coding gene	gene with protein product		605237	"""xenotropic and polytropic retrovirus receptor"""			9990033	Standard	NM_004736		Approved	SYG1, X3	uc001goi.3	Q9UBH6	OTTHUMG00000035116	ENST00000367590.4:c.1800G>T	1.37:g.180843070G>T	ENSP00000356562:p.Glu600Asp		O95719|Q7L8K9|Q8IW20|Q9NT19|Q9UFB9	Missense_Mutation	SNP	pfam_EXS_C,pfam_SPX_N	p.E600D	ENST00000367590.4	37	c.1800	CCDS1340.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082018	0.76528	.	.	ENSG00000143324	ENST00000367590;ENST00000367589	D;D	0.84298	-1.83;-1.83	5.43	3.54	0.40534	EXS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.92708	0.7682	M	0.90309	3.105	0.34318	D	0.686216	D;D	0.76494	0.985;0.999	P;D	0.75484	0.868;0.986	D	0.95734	0.8777	10	0.87932	D	0	-10.2424	11.7332	0.51750	0.1472:0.0:0.8528:0.0	.	535;600	Q9UBH6-2;Q9UBH6	.;XPR1_HUMAN	D	600;535	ENSP00000356562:E600D;ENSP00000356561:E535D	ENSP00000356561:E535D	E	+	3	2	XPR1	179109693	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.669000	0.46825	1.299000	0.44798	0.650000	0.86243	GAG	XPR1	-	pfam_EXS_C	ENSG00000143324		0.358	XPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPR1	HGNC	protein_coding	OTTHUMT00000084996.2		0.00	76	0	G	NM_004736		180843070	+1			no_errors	ENST00000367590	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
ZBTB12	221527	genome.wustl.edu	37	6	31868356	31868357	+	Frame_Shift_Ins	INS	-	-	GT			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr6:31868356_31868357insGT	ENST00000375527.2	-	2	901_902	c.726_727insAC	c.(724-729)caccttfs	p.L243fs	EHMT2_ENST00000375537.4_5'Flank|C2_ENST00000452323.2_5'Flank|C2_ENST00000469372.1_Intron|EHMT2_ENST00000375530.4_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	243	Gly-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						AGCTCCCCAAGGTGGCCACCCA	0.668																																																	0																																										SO:0001589	frameshift_variant	0			BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.725_726dupAC	6.37:g.31868357_31868358dupGT	ENSP00000364677:p.Leu243fs		B0UY00|Q5JQ98	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L242fs	ENST00000375527.2	37	c.727_726	CCDS4727.1	6																																																																																			ZBTB12	-	NULL	ENSG00000204366		0.668	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB12	HGNC	protein_coding	OTTHUMT00000076315.2		0.00	98	0	-	NM_181842		31868357	-1	tier1		no_errors	ENST00000375527	ensembl	human	known	74_37	frame_shift_ins	38.26	92	57	INS	0.994:0.996	GT
ZBTB5	9925	genome.wustl.edu	37	9	37442366	37442366	+	Silent	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr9:37442366G>T	ENST00000307750.4	-	2	371	c.183C>A	c.(181-183)acC>acA	p.T61T		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	61	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		TCATGTTCATGGTCTGATCTC	0.542																																																	0													202.0	154.0	171.0					9																	37442366		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.183C>A	9.37:g.37442366G>T				Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T61	ENST00000307750.4	37	c.183	CCDS6610.1	9																																																																																			ZBTB5	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000168795		0.542	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB5	HGNC	protein_coding	OTTHUMT00000052462.1	-	0.00	30	0	G	NM_014872		37442366	-1	tier1	-	no_errors	ENST00000307750	ensembl	human	known	74_37	silent	7.55	49	4	SNP	1.000	T
ZEB2	9839	genome.wustl.edu	37	2	145147113	145147113	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr2:145147113C>G	ENST00000558170.2	-	10	4734	c.3550G>C	c.(3550-3552)Gag>Cag	p.E1184Q	ZEB2_ENST00000303660.4_Missense_Mutation_p.E1184Q|ZEB2_ENST00000539609.3_Missense_Mutation_p.E1160Q|ZEB2_ENST00000409487.3_Missense_Mutation_p.E1184Q	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	1184	Glu-rich (acidic).				cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		TCTCCAGTCTCTTCTTCATCT	0.463																																					Melanoma(33;1235 1264 5755 16332)												0													266.0	250.0	256.0					2																	145147113		2203	4300	6503	SO:0001583	missense	0			AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.3550G>C	2.37:g.145147113C>G	ENSP00000454157:p.Glu1184Gln		A0JP09|B7Z2P2|F5H814|Q9UED1	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.E1184Q	ENST00000558170.2	37	c.3550	CCDS2186.1	2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588883	0.86851	.	.	ENSG00000169554	ENST00000539609;ENST00000303660;ENST00000409487	T;T;T	0.16324	2.37;2.35;2.35	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.12263	0.0298	N	0.08118	0	0.80722	D	1	B;B;B	0.32573	0.376;0.259;0.259	B;B;B	0.31751	0.135;0.064;0.064	T	0.18053	-1.0349	10	0.87932	D	0	-11.2078	19.7945	0.96474	0.0:1.0:0.0:0.0	.	1160;1183;1184	F5H814;A0JP08;O60315	.;.;ZEB2_HUMAN	Q	1160;1184;1184	ENSP00000443792:E1160Q;ENSP00000302501:E1184Q;ENSP00000386854:E1184Q	ENSP00000302501:E1184Q	E	-	1	0	ZEB2	144863583	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.746000	0.94184	0.591000	0.81541	GAG	ZEB2	-	NULL	ENSG00000169554		0.463	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	-	0.00	82	0	C	NM_014795		145147113	-1	tier1	-	no_errors	ENST00000303660	ensembl	human	known	74_37	missense	13.89	62	10	SNP	1.000	G
ZFP42	132625	genome.wustl.edu	37	4	188924760	188924760	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr4:188924760C>T	ENST00000326866.4	+	4	1207	c.799C>T	c.(799-801)Cgc>Tgc	p.R267C	ZFP42_ENST00000509524.1_Missense_Mutation_p.R267C	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	267					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TACGCACGTGCGCATCCACAC	0.502																																																	0													76.0	74.0	74.0					4																	188924760		2203	4300	6503	SO:0001583	missense	0			AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.799C>T	4.37:g.188924760C>T	ENSP00000317686:p.Arg267Cys		D3DP65|Q8WXE2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R267C	ENST00000326866.4	37	c.799	CCDS3849.1	4	.	.	.	.	.	.	.	.	.	.	C	13.07	2.127432	0.37533	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.25749	1.78;1.78	4.39	0.78	0.18556	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.146151	0.47852	N	0.000220	T	0.23806	0.0576	M	0.84156	2.68	0.40041	D	0.975658	P	0.41366	0.747	B	0.28232	0.087	T	0.14420	-1.0473	10	0.87932	D	0	.	8.2385	0.31640	0.0:0.6476:0.0:0.3524	.	267	Q96MM3	ZFP42_HUMAN	C	267	ENSP00000317686:R267C;ENSP00000424662:R267C	ENSP00000317686:R267C	R	+	1	0	ZFP42	189161754	0.978000	0.34361	0.107000	0.21349	0.057000	0.15508	1.857000	0.39399	0.096000	0.17463	-0.140000	0.14226	CGC	ZFP42	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179059		0.502	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP42	HGNC	protein_coding	OTTHUMT00000359794.1	-	0.00	51	0	C	NM_174900		188924760	+1	tier1	-	no_errors	ENST00000326866	ensembl	human	known	74_37	missense	47.83	12	11	SNP	0.890	T
ZFPM2	23414	genome.wustl.edu	37	8	106813340	106813340	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr8:106813340G>T	ENST00000407775.2	+	8	1280	c.1030G>T	c.(1030-1032)Gct>Tct	p.A344S	ZFPM2_ENST00000522296.1_3'UTR|RP11-152P17.2_ENST00000509144.2_RNA|RP11-152P17.2_ENST00000520433.1_RNA|ZFPM2_ENST00000517361.1_Missense_Mutation_p.A212S|ZFPM2_ENST00000378472.4_Missense_Mutation_p.A75S|RP11-152P17.2_ENST00000524045.2_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.A212S|RP11-152P17.2_ENST00000521622.1_RNA|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	344					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TAGCTACACTGCTGATTCCGT	0.463																																																	0													201.0	194.0	196.0					8																	106813340		2017	4197	6214	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1030G>T	8.37:g.106813340G>T	ENSP00000384179:p.Ala344Ser		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A344S	ENST00000407775.2	37	c.1030	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	19.55	3.849221	0.71603	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.66	5.66	0.87406	Zinc finger, C2H2-like (1);	0.103125	0.64402	D	0.000003	T	0.44973	0.1319	L	0.28344	0.845	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.15954	-1.0419	10	0.33940	T	0.23	.	20.1225	0.97967	0.0:0.0:1.0:0.0	.	344	Q8WW38	FOG2_HUMAN	S	344;212;212;75	ENSP00000384179:A344S;ENSP00000430757:A212S;ENSP00000428720:A212S;ENSP00000367733:A75S	ENSP00000367733:A75S	A	+	1	0	ZFPM2	106882516	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.420000	0.97426	2.831000	0.97527	0.650000	0.86243	GCT	ZFPM2	-	smart_Znf_C2H2-like	ENSG00000169946		0.463	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	-	0.00	86	0	G			106813340	+1	tier1	-	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	27.17	67	25	SNP	1.000	T
ZIC4	84107	genome.wustl.edu	37	3	147124452	147124453	+	5'UTR	INS	-	-	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr3:147124452_147124453insT	ENST00000383075.3	-	0	194_195				ZIC4_ENST00000425731.3_5'Flank|ZIC1_ENST00000282928.4_5'Flank|ZIC4_ENST00000491672.1_5'UTR|ZIC4_ENST00000484399.1_5'Flank|ZIC4_ENST00000525172.2_5'Flank|ZIC4_ENST00000473123.1_5'Flank	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CAACCCACAACTTTTTTTTTTC	0.45																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.-319->A	3.37:g.147124462_147124462dupT			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	INS	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.450	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1		0.00	54	0	-			147124453	-1	tier1		no_errors	ENST00000464144	ensembl	human	putative	74_37	rna	10.17	53	6	INS	1.000:1.000	T
ZNF441	126068	genome.wustl.edu	37	19	11892530	11892530	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr19:11892530C>G	ENST00000357901.4	+	4	1993	c.1891C>G	c.(1891-1893)Cga>Gga	p.R631G	ZNF441_ENST00000454339.2_Missense_Mutation_p.R564G	NM_152355.2	NP_689568.2	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	631					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AAGTTACTTACGAATACACGA	0.408																																																	0													65.0	59.0	61.0					19																	11892530		2203	4300	6503	SO:0001583	missense	0			AK095956	CCDS12266.2	19p13.13	2013-01-08			ENSG00000197044	ENSG00000197044		"""Zinc fingers, C2H2-type"", ""-"""	20875	protein-coding gene	gene with protein product							Standard	NM_152355		Approved	FLJ38637	uc010dyj.3	Q8N8Z8	OTTHUMG00000154449	ENST00000357901.4:c.1891C>G	19.37:g.11892530C>G	ENSP00000350576:p.Arg631Gly			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R631G	ENST00000357901.4	37	c.1891	CCDS12266.2	19	.	.	.	.	.	.	.	.	.	.	c	12.28	1.890160	0.33348	.	.	ENSG00000197044	ENST00000409902;ENST00000357901;ENST00000454339	T;T	0.07114	3.22;3.22	1.4	-2.79	0.05841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07413	0.0187	M	0.63208	1.945	0.09310	N	1	P	0.37612	0.602	B	0.37601	0.254	T	0.23084	-1.0198	9	0.28530	T	0.3	.	1.4271	0.02325	0.4964:0.1965:0.1651:0.142	.	631	Q8N8Z8	ZN441_HUMAN	G	587;631;564	ENSP00000350576:R631G;ENSP00000403738:R564G	ENSP00000350576:R631G	R	+	1	2	ZNF441	11753530	0.000000	0.05858	0.000000	0.03702	0.468000	0.32798	-0.106000	0.10890	-0.851000	0.04147	0.305000	0.20034	CGA	ZNF441	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197044		0.408	ZNF441-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF441	HGNC	protein_coding	OTTHUMT00000335273.3		0.00	66	0	C	NM_152355		11892530	+1			no_errors	ENST00000357901	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.000	G
ZNF804B	219578	genome.wustl.edu	37	7	88964965	88964965	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:88964965A>C	ENST00000333190.4	+	4	3278	c.2669A>C	c.(2668-2670)aAg>aCg	p.K890T		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	890							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGGCCCATGAAGTGTAACTCC	0.438										HNSCC(36;0.09)																																							0													66.0	69.0	68.0					7																	88964965		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2669A>C	7.37:g.88964965A>C	ENSP00000329638:p.Lys890Thr		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.K890T	ENST00000333190.4	37	c.2669	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	A	5.267	0.234674	0.09969	.	.	ENSG00000182348	ENST00000333190	T	0.05786	3.39	4.89	0.964	0.19655	.	0.827728	0.10700	N	0.644149	T	0.03434	0.0099	N	0.08118	0	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.43278	-0.9401	10	0.49607	T	0.09	0.0	6.2964	0.21089	0.6686:0.1232:0.2082:0.0	.	890	A4D1E1	Z804B_HUMAN	T	890	ENSP00000329638:K890T	ENSP00000329638:K890T	K	+	2	0	ZNF804B	88802901	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.037000	0.13840	0.078000	0.16900	0.460000	0.39030	AAG	ZNF804B	-	NULL	ENSG00000182348		0.438	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	75	0	A	NM_181646		88964965	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	28.57	55	22	SNP	0.001	C
ZNF804B	219578	genome.wustl.edu	37	7	88965418	88965418	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:88965418A>T	ENST00000333190.4	+	4	3731	c.3122A>T	c.(3121-3123)aAc>aTc	p.N1041I		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1041							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CAGTCACTAAACATAAAAAGG	0.328										HNSCC(36;0.09)																																							0													66.0	63.0	64.0					7																	88965418		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.3122A>T	7.37:g.88965418A>T	ENSP00000329638:p.Asn1041Ile		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.N1041I	ENST00000333190.4	37	c.3122	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	A	14.99	2.701794	0.48307	.	.	ENSG00000182348	ENST00000333190	T	0.05855	3.38	5.04	2.7	0.31948	.	0.150855	0.47455	D	0.000229	T	0.10723	0.0262	L	0.29908	0.895	0.30059	N	0.811107	D	0.63880	0.993	P	0.60789	0.879	T	0.02581	-1.1138	10	0.72032	D	0.01	-12.6339	8.1923	0.31376	0.7406:0.0:0.2594:0.0	.	1041	A4D1E1	Z804B_HUMAN	I	1041	ENSP00000329638:N1041I	ENSP00000329638:N1041I	N	+	2	0	ZNF804B	88803354	0.998000	0.40836	0.973000	0.42090	0.868000	0.49771	1.961000	0.40432	0.508000	0.28173	-0.250000	0.11733	AAC	ZNF804B	-	NULL	ENSG00000182348		0.328	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	46	0	A	NM_181646		88965418	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.996	T
ZNF767P	79970	genome.wustl.edu	37	7	149318616	149318616	+	RNA	SNP	G	G	T			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr7:149318616G>T	ENST00000463567.1	-	0	220					NR_027788.1		Q75MW2	ZN767_HUMAN												central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)	5	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00434)			CCTCTCCATGGCCTGAATCGT	0.517																																																	0													77.0	75.0	76.0					7																	149318616		2203	4300	6503			0																															7.37:g.149318616G>T			D3DWG6|Q86WY4|Q9H9J3	RNA	SNP	-	NULL	ENST00000463567.1	37	NULL		7																																																																																			ZNF767	-	-	ENSG00000133624		0.517	ZNF767-001	KNOWN	basic	processed_transcript	ZNF767	HGNC	pseudogene	OTTHUMT00000352753.2		0.00	80	0	G			149318616	-1			no_errors	ENST00000463567	ensembl	human	known	74_37	rna	5.26	72	4	SNP	0.023	T
ZZZ3	26009	genome.wustl.edu	37	1	78030139	78030139	+	IGR	DEL	A	A	-			TCGA-L5-A8NT-01A-11D-A37C-09	TCGA-L5-A8NT-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e143e72-fabb-477f-a577-53f0ab1c2a5c	5a9e8a71-e4fd-4699-bd7a-a02771c76ebc	g.chr1:78030139delA	ENST00000370801.3	-	0	4328				ZZZ3_ENST00000476275.1_5'Flank	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TAACACTGGTAAAAAAAAAAA	0.279																																																	0																																										SO:0001628	intergenic_variant	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652		1.37:g.78030139delA			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	RNA	DEL	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																			ZZZ3	-	-	ENSG00000036549		0.279	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1		0.00	40	0	A	NM_015534		78030139	-1	tier1		no_errors	ENST00000481346	ensembl	human	known	74_37	rna	9.09	30	3	DEL	0.000	-
