#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACTN4	81	genome.wustl.edu	37	19	39191311	39191311	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:39191311C>A	ENST00000252699.2	+	2	310	c.234C>A	c.(232-234)ttC>ttA	p.F78L	ACTN4_ENST00000424234.2_Missense_Mutation_p.F78L|ACTN4_ENST00000390009.3_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	78	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ATGAGGACTTCCGAGACGGGC	0.607																																					Colon(168;199 1940 10254 46213 46384)												0													136.0	108.0	117.0					19																	39191311		2203	4300	6503	SO:0001583	missense	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.234C>A	19.37:g.39191311C>A	ENSP00000252699:p.Phe78Leu		A4K467|D6PXK4|O76048	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.F78L	ENST00000252699.2	37	c.234	CCDS12518.1	19	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278678	0.59758	.	.	ENSG00000130402	ENST00000252699;ENST00000445727;ENST00000424234	D;D	0.90197	-2.63;-2.63	4.35	2.02	0.26589	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	T	0.79185	0.4403	N	0.01576	-0.805	0.29694	N	0.84072	B;B	0.22480	0.002;0.07	B;B	0.41202	0.098;0.35	T	0.71394	-0.4606	10	0.19590	T	0.45	.	9.782	0.40653	0.0:0.863:0.0:0.137	.	78;78	E7EV83;O43707	.;ACTN4_HUMAN	L	78	ENSP00000252699:F78L;ENSP00000411187:F78L	ENSP00000252699:F78L	F	+	3	2	ACTN4	43883151	1.000000	0.71417	0.976000	0.42696	0.853000	0.48598	1.971000	0.40530	0.445000	0.26639	0.561000	0.74099	TTC	ACTN4	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000130402		0.607	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1		0.00	55	0	C			39191311	+1			no_errors	ENST00000252699	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
AGPAT9	84803	genome.wustl.edu	37	4	84508432	84508432	+	Silent	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:84508432C>A	ENST00000395226.2	+	5	722	c.504C>A	c.(502-504)atC>atA	p.I168I	AGPAT9_ENST00000264409.4_Silent_p.I168I	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	168					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				TCATTGGGATCAGTTTGCTGG	0.398																																																	0													162.0	159.0	160.0					4																	84508432		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.504C>A	4.37:g.84508432C>A			Q68CJ4|Q6GPI6|Q96NA3	Silent	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.I168	ENST00000395226.2	37	c.504	CCDS3606.1	4																																																																																			AGPAT9	-	NULL	ENSG00000138678		0.398	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT9	HGNC	protein_coding	OTTHUMT00000252821.3	-	0.00	95	0	C	NM_032717		84508432	+1	tier1	-	no_errors	ENST00000264409	ensembl	human	known	74_37	silent	6.78	55	4	SNP	0.976	A
ANGPTL3	27329	genome.wustl.edu	37	1	63069970	63069970	+	Intron	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:63069970C>A	ENST00000371129.3	+	6	1278				DOCK7_ENST00000404627.2_Intron|DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000251157.5_Intron|ANGPTL3_ENST00000493994.1_3'UTR	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3						acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						ACATTATTAGCTATTATCTGC	0.328																																																	0																																										SO:0001627	intron_variant	0			AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1198+64C>A	1.37:g.63069970C>A			A0JLS0|B1ALJ0|B2RCW1	RNA	SNP	-	NULL	ENST00000371129.3	37	NULL	CCDS622.1	1																																																																																			ANGPTL3	-	-	ENSG00000132855		0.328	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	HGNC	protein_coding	OTTHUMT00000025344.1	-	0.00	46	0	C	NM_014495		63069970	+1	tier1	-	no_errors	ENST00000493994	ensembl	human	putative	74_37	rna	9.38	29	3	SNP	0.022	A
ANKRD32	84250	genome.wustl.edu	37	5	94005956	94005956	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:94005956G>T	ENST00000265140.5	+	13	2052	c.1633G>T	c.(1633-1635)Gaa>Taa	p.E545*		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	545						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TAATTTAATTGAAAGTGAAGT	0.308																																																	0													40.0	34.0	36.0					5																	94005956		692	1590	2282	SO:0001587	stop_gained	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1633G>T	5.37:g.94005956G>T	ENSP00000265140:p.Glu545*		B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E545*	ENST00000265140.5	37	c.1633	CCDS4071.2	5	.	.	.	.	.	.	.	.	.	.	G	41	8.916900	0.99002	.	.	ENSG00000133302	ENST00000265140	.	.	.	5.87	3.86	0.44501	.	0.119957	0.37857	N	0.001902	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	4.6118	0.12406	0.3527:0.0:0.6473:0.0	.	.	.	.	X	545	.	ENSP00000265140:E545X	E	+	1	0	ANKRD32	94031712	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	2.032000	0.41127	1.481000	0.48307	0.591000	0.81541	GAA	ANKRD32	-	NULL	ENSG00000133302		0.308	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1		0.00	46	0	G	NM_032290		94005956	+1			no_errors	ENST00000265140	ensembl	human	known	74_37	nonsense	6.98	40	3	SNP	1.000	T
APBB1	322	genome.wustl.edu	37	11	6417032	6417032	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:6417032A>G	ENST00000609360.1	-	14	2048	c.1949T>C	c.(1948-1950)gTg>gCg	p.V650A	APBB1_ENST00000608655.1_Missense_Mutation_p.V430A|APBB1_ENST00000609331.1_Missense_Mutation_p.V415A|APBB1_ENST00000529519.1_Missense_Mutation_p.V175A|APBB1_ENST00000299402.6_Missense_Mutation_p.V648A|APBB1_ENST00000389906.2_Missense_Mutation_p.V650A|APBB1_ENST00000608704.1_Missense_Mutation_p.V391A|APBB1_ENST00000608394.1_Missense_Mutation_p.V391A|APBB1_ENST00000608645.1_Missense_Mutation_p.V391A|APBB1_ENST00000311051.3_Missense_Mutation_p.V648A|APBB1_ENST00000530885.1_Missense_Mutation_p.V428A|APBB1_ENST00000526240.1_5'UTR	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	650	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		CGCAGCCTGCACAGCCTCTGA	0.622																																					GBM(147;1810 2556 5672 39622)												0													59.0	60.0	60.0					11																	6417032		2201	4295	6496	SO:0001583	missense	0			L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1949T>C	11.37:g.6417032A>G	ENSP00000477213:p.Val650Ala		A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_WW_dom,pfam_PTB,superfamily_WW_dom,smart_WW_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_WW_dom	p.V650A	ENST00000609360.1	37	c.1949		11	.	.	.	.	.	.	.	.	.	.	A	19.93	3.917810	0.73098	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000536523;ENST00000544288;ENST00000530885	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	4.61	4.61	0.57282	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000003	T	0.56775	0.2008	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.97110	0.998;0.998;1.0	T	0.61969	-0.6953	10	0.56958	D	0.05	-17.6375	11.9567	0.52984	1.0:0.0:0.0:0.0	.	650;428;648	O00213;B7Z2Y0;O00213-2	APBB1_HUMAN;.;.	A	648;648;650;499;391;415;428	ENSP00000299402:V648A;ENSP00000311912:V648A;ENSP00000374556:V650A;ENSP00000433338:V428A	ENSP00000299402:V648A	V	-	2	0	APBB1	6373608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.201000	0.95017	1.712000	0.51347	0.397000	0.26171	GTG	APBB1	-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	ENSG00000166313		0.622	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	APBB1	HGNC	protein_coding	OTTHUMT00000471831.1	-	0.00	24	0	A	NM_001164		6417032	-1	tier1	-	no_errors	ENST00000389906	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	G
ARHGAP36	158763	genome.wustl.edu	37	X	130218356	130218356	+	Silent	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:130218356T>C	ENST00000276211.5	+	5	1068	c.723T>C	c.(721-723)gcT>gcC	p.A241A	ARHGAP36_ENST00000370922.1_Silent_p.A229A|ARHGAP36_ENST00000370921.1_Silent_p.A105A	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	241	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						TTGTTGAGGCTTGCTGCCAAT	0.448																																																	0													41.0	39.0	40.0					X																	130218356		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.723T>C	X.37:g.130218356T>C			B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A241	ENST00000276211.5	37	c.723	CCDS14628.1	X																																																																																			ARHGAP36	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000147256		0.448	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP36	HGNC	protein_coding	OTTHUMT00000355073.1	-	0.00	48	0	T	NM_144967		130218356	+1	tier1	-	no_errors	ENST00000276211	ensembl	human	known	74_37	silent	17.65	28	6	SNP	0.800	C
ARHGEF4	50649	genome.wustl.edu	37	2	131704257	131704257	+	Intron	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:131704257G>T	ENST00000326016.5	+	4	946				ARHGEF4_ENST00000409303.1_Intron|ARHGEF4_ENST00000428230.2_Intron|ARHGEF4_ENST00000392953.3_Intron|ARHGEF4_ENST00000525839.1_Intron|ARHGEF4_ENST00000409359.1_Nonstop_Mutation_p.*1015L	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		ATCCTGGCATGAAGGACAAGA	0.512																																																	0													52.0	49.0	50.0					2																	131704257		2203	4300	6503	SO:0001627	intron_variant	0			AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.427+49G>T	2.37:g.131704257G>T			Q9HDC6|Q9UPP0	Nonstop_Mutation	SNP	NULL	p.*1015L	ENST00000326016.5	37	c.3044	CCDS2165.1	2	.	.	.	.	.	.	.	.	.	.	G	4.154	0.026953	0.08054	.	.	ENSG00000136002	ENST00000409359	.	.	.	2.45	-1.61	0.08399	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.99999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.3855	0.04364	0.4124:0.0:0.3606:0.2271	.	.	.	.	L	1015	.	.	X	+	2	2	ARHGEF4	131420727	0.006000	0.16342	0.074000	0.20217	0.168000	0.22595	-0.446000	0.06837	-0.397000	0.07691	0.467000	0.42956	TGA	ARHGEF4	-	NULL	ENSG00000136002		0.512	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	-	0.00	60	0	G			131704257	+1	tier1	-	no_errors	ENST00000409359	ensembl	human	putative	74_37	nonstop	10.53	34	4	SNP	0.101	T
ATP10B	23120	genome.wustl.edu	37	5	159996679	159996679	+	Silent	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:159996679G>A	ENST00000327245.5	-	25	4608	c.3762C>T	c.(3760-3762)caC>caT	p.H1254H		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1254					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCACGACTCCGTGGAAAATGG	0.478																																																	0													52.0	57.0	55.0					5																	159996679		2053	4210	6263	SO:0001819	synonymous_variant	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3762C>T	5.37:g.159996679G>A			Q9H725	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.H1254	ENST00000327245.5	37	c.3762	CCDS43394.1	5																																																																																			ATP10B	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000118322		0.478	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1		0.00	33	0	G	NM_025153		159996679	-1			no_errors	ENST00000327245	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.101	A
ATP12A	479	genome.wustl.edu	37	13	25280563	25280563	+	Nonsense_Mutation	SNP	C	C	T	rs61998252	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr13:25280563C>T	ENST00000381946.3	+	15	2298	c.2131C>T	c.(2131-2133)Cag>Tag	p.Q711*	RNY1P7_ENST00000384743.1_RNA|ATP12A_ENST00000218548.6_Nonsense_Mutation_p.Q717*			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	711					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GACATCCCCCCAGCAGAAGCT	0.567																																					Pancreas(156;1582 1935 18898 22665 26498)												0													103.0	80.0	88.0					13																	25280563		2203	4300	6503	SO:0001587	stop_gained	0			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2131C>T	13.37:g.25280563C>T	ENSP00000371372:p.Gln711*		Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.Q717*	ENST00000381946.3	37	c.2149	CCDS31948.1	13	.	.	.	.	.	.	.	.	.	.	C	43	9.912529	0.99294	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	.	.	.	5.79	5.79	0.91817	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.5173	0.87777	0.0:1.0:0.0:0.0	.	.	.	.	X	717;711	.	ENSP00000218548:Q717X	Q	+	1	0	ATP12A	24178563	1.000000	0.71417	0.985000	0.45067	0.876000	0.50452	7.726000	0.84824	2.727000	0.93392	0.563000	0.77884	CAG	ATP12A	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000075673		0.567	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1	-	0.00	59	0	C	NM_001676		25280563	+1	tier1	-	no_errors	ENST00000218548	ensembl	human	known	74_37	nonsense	38.46	16	10	SNP	1.000	T
ATRNL1	26033	genome.wustl.edu	37	10	117154258	117154258	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:117154258C>A	ENST00000355044.3	+	20	3391	c.3265C>A	c.(3265-3267)Caa>Aaa	p.Q1089K	ATRNL1_ENST00000423111.2_Missense_Mutation_p.Q140K|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1089	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGACCAATGCCAATTGTAAGT	0.333																																																	0													110.0	103.0	105.0					10																	117154258		2203	4299	6502	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3265C>A	10.37:g.117154258C>A	ENSP00000347152:p.Gln1089Lys		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.Q1089K	ENST00000355044.3	37	c.3265	CCDS7592.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.47|17.47	3.398071|3.398071	0.62177|0.62177	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000526373|ENST00000355044;ENST00000423111	.|T;T	.|0.54071	.|0.59;0.59	5.61|5.61	5.61|5.61	0.85477|0.85477	.|EGF-like, laminin (1);	.|0.110458	.|0.64402	.|D	.|0.000004	T|T	0.69949|0.69949	0.3168|0.3168	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	.|D;D	.|0.58620	.|0.983;0.969	.|P;D	.|0.64877	.|0.622;0.93	T|T	0.72174|0.72174	-0.4370|-0.4370	5|10	.|0.66056	.|D	.|0.02	-14.7681|-14.7681	15.1377|15.1377	0.72583|0.72583	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|140;1089	.|B4DH41;Q5VV63	.|.;ATRN1_HUMAN	Q|K	172|1089;140	.|ENSP00000347152:Q1089K;ENSP00000409624:Q140K	.|ENSP00000347152:Q1089K	P|Q	+|+	2|1	0|0	ATRNL1|ATRNL1	117144248|117144248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.790000|0.790000	0.44656|0.44656	6.050000|6.050000	0.71063|0.71063	2.640000|2.640000	0.89533|0.89533	0.655000|0.655000	0.94253|0.94253	CCA|CAA	ATRNL1	-	smart_EGF_laminin	ENSG00000107518		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3		0.00	62	0	C	XM_049349		117154258	+1			no_errors	ENST00000355044	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
BAHCC1	57597	genome.wustl.edu	37	17	79411578	79411578	+	Frame_Shift_Del	DEL	G	G	-	rs555714796	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr17:79411578delG	ENST00000307745.7	+	11	2496	c.2496delG	c.(2494-2496)atgfs	p.M832fs																								CCCTGTGGATGGGGGGGCACT	0.716																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000307745.7:c.2496delG	17.37:g.79411578delG	ENSP00000303486:p.Met832fs			Frame_Shift_Del	DEL	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.H835fs	ENST00000307745.7	37	c.2496		17																																																																																			RP11-1055B8.7	-	NULL	ENSG00000171282		0.716	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	Clone_based_vega_gene	protein_coding			0.00	21	0	G			79411578	+1			no_errors	ENST00000307745	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	1.000	0
BTBD19	149478	genome.wustl.edu	37	1	45274534	45274534	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:45274534delT	ENST00000450269.1	+	1	381	c.42delT	c.(40-42)cctfs	p.P14fs	TCTEX1D4_ENST00000339355.2_5'Flank|BTBD19_ENST00000453418.1_Frame_Shift_Del_p.P14fs|BTBD19_ENST00000409335.2_Frame_Shift_Del_p.P14fs|TCTEX1D4_ENST00000372200.1_5'Flank	NM_001136537.1	NP_001130009.1	C9JJ37	BTBDJ_HUMAN	BTB (POZ) domain containing 19	14										breast(1)|endometrium(1)	2						AAGCTGAACCTTTTTCCGCAG	0.627																																																	0													111.0	106.0	108.0					1																	45274534		692	1591	2283	SO:0001589	frameshift_variant	0					1p34.1	2013-01-08			ENSG00000222009	ENSG00000222009		"""BTB/POZ domain containing"""	27145	protein-coding gene	gene with protein product							Standard	NM_001136537		Approved		uc010ole.1	C9JJ37	OTTHUMG00000008493	ENST00000450269.1:c.42delT	1.37:g.45274534delT	ENSP00000395461:p.Pro14fs		B4E384|B7ZC36|B7ZC37	Frame_Shift_Del	DEL	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S16fs	ENST00000450269.1	37	c.42		1																																																																																			BTBD19	-	superfamily_BTB/POZ_fold	ENSG00000222009		0.627	BTBD19-201	KNOWN	basic|appris_principal	protein_coding	BTBD19	HGNC	protein_coding			0.00	52	0	T	NM_001136537		45274534	+1	tier1		no_errors	ENST00000450269	ensembl	human	known	74_37	frame_shift_del	9.38	29	3	DEL	0.568	-
BTBD7	55727	genome.wustl.edu	37	14	93723588	93723588	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr14:93723588G>A	ENST00000334746.5	-	6	1868	c.1561C>T	c.(1561-1563)Cga>Tga	p.R521*	BTBD7_ENST00000393170.2_Nonsense_Mutation_p.R95*|BTBD7_ENST00000554565.1_Nonsense_Mutation_p.R170*	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	521					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		TGTTCAATTCGCACAAAAGGT	0.408																																																	0													166.0	156.0	159.0					14																	93723588		2203	4300	6503	SO:0001587	stop_gained	0			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1561C>T	14.37:g.93723588G>A	ENSP00000335615:p.Arg521*		A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.R521*	ENST00000334746.5	37	c.1561	CCDS32146.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.397032	0.96009	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	.	.	.	5.64	3.76	0.43208	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1131	0.72375	0.0:0.0:0.7415:0.2585	.	.	.	.	X	521;170;136;95	.	ENSP00000335615:R521X	R	-	1	2	BTBD7	92793341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.893000	0.56243	0.800000	0.34041	0.650000	0.86243	CGA	BTBD7	-	smart_BACK	ENSG00000011114		0.408	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD7	HGNC	protein_coding	OTTHUMT00000412701.1	-	0.00	100	0	G	NM_001002860		93723588	-1	tier1	-	no_errors	ENST00000334746	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	A
C10orf128	170371	genome.wustl.edu	37	10	50375962	50375962	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:50375962G>T	ENST00000474718.1	-	2	111	c.89C>A	c.(88-90)gCt>gAt	p.A30D	C10orf128_ENST00000374151.3_Missense_Mutation_p.A30D|C10orf128_ENST00000374148.1_Missense_Mutation_p.A30D|C10orf128_ENST00000470884.1_5'UTR|C10orf128_ENST00000374153.2_Missense_Mutation_p.A30D	NM_001010863.1	NP_001010863.1	Q5T292	CJ128_HUMAN	chromosome 10 open reading frame 128	30						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(1)	3						ACCAATTTCAGCCCCAGGGGT	0.562																																																	0													120.0	125.0	124.0					10																	50375962		1965	4148	6113	SO:0001583	missense	0			BC031641	CCDS41519.1, CCDS73128.1	10q11.23	2012-06-13			ENSG00000204161	ENSG00000204161			27274	protein-coding gene	gene with protein product						12477932	Standard	NM_001010863		Approved	Em:AC084727.5	uc001jhn.4	Q5T292	OTTHUMG00000018188	ENST00000474718.1:c.89C>A	10.37:g.50375962G>T	ENSP00000417246:p.Ala30Asp		A6XND2|Q5T289|Q5T291	Missense_Mutation	SNP	NULL	p.A30D	ENST00000474718.1	37	c.89	CCDS41519.1	10	.	.	.	.	.	.	.	.	.	.	G	10.42	1.344249	0.24339	.	.	ENSG00000204161	ENST00000374153;ENST00000474718;ENST00000453436;ENST00000374149;ENST00000374151;ENST00000374148	T;T;T;T;T	0.48201	0.84;0.89;0.83;0.82;0.83	4.59	2.52	0.30459	.	.	.	.	.	T	0.34193	0.0889	N	0.19112	0.55	0.09310	N	1	P;P;B;P	0.36837	0.571;0.571;0.343;0.571	B;B;B;B	0.42692	0.395;0.395;0.284;0.395	T	0.20638	-1.0269	9	0.52906	T	0.07	.	4.1721	0.10334	0.1227:0.0:0.6457:0.2316	.	30;30;30;30	Q5T292-2;Q5T292-3;Q5T292;Q5T292-4	.;.;CJ128_HUMAN;.	D	30;30;22;24;30;30	ENSP00000363268:A30D;ENSP00000417246:A30D;ENSP00000395067:A22D;ENSP00000363266:A30D;ENSP00000363263:A30D	ENSP00000363263:A30D	A	-	2	0	C10orf128	50045968	0.000000	0.05858	0.004000	0.12327	0.012000	0.07955	0.428000	0.21395	1.115000	0.41800	0.650000	0.86243	GCT	C10orf128	-	NULL	ENSG00000204161		0.562	C10orf128-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf128	HGNC	protein_coding	OTTHUMT00000047978.1	-	0.00	38	0	G	NM_001010863		50375962	-1	tier1	-	no_errors	ENST00000374151	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.002	T
C19orf68	374920	genome.wustl.edu	37	19	48699110	48699110	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:48699110G>A	ENST00000328759.7	+	4	1821	c.1789G>A	c.(1789-1791)Gtg>Atg	p.V597M	CARD8_ENST00000600800.1_Intron|ZNF114_ENST00000597695.1_Intron			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68	597					hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											TACCTGGAGGGTGGCCCAGCT	0.592																																																	0																																										SO:0001583	missense	0			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.1789G>A	19.37:g.48699110G>A	ENSP00000331363:p.Val597Met			Missense_Mutation	SNP	NULL	p.V597M	ENST00000328759.7	37	c.1789		19	.	.	.	.	.	.	.	.	.	.	G	8.116	0.779885	0.16120	.	.	ENSG00000185453	ENST00000328759	.	.	.	3.42	-1.53	0.08611	.	2.124770	0.02915	N	0.137201	T	0.19525	0.0469	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	9	0.52906	T	0.07	1.0183	4.9467	0.13993	0.2733:0.3668:0.3599:0.0	.	597	Q86XI8	CS068_HUMAN	M	597	.	ENSP00000331363:V597M	V	+	1	0	C19orf68	53390922	0.001000	0.12720	0.006000	0.13384	0.011000	0.07611	-0.830000	0.04410	-0.348000	0.08286	-0.471000	0.05019	GTG	C19orf68	-	NULL	ENSG00000185453		0.592	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	C19orf68	HGNC	protein_coding	OTTHUMT00000465598.1	-	0.00	143	0	G	XM_001713770		48699110	+1	tier1	-	no_errors	ENST00000328759	ensembl	human	known	74_37	missense	21.05	75	20	SNP	0.007	A
CAD	790	genome.wustl.edu	37	2	27446585	27446585	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:27446585G>T	ENST00000403525.1	+	7	1108	c.964G>T	c.(964-966)Ggc>Tgc	p.G322C	CAD_ENST00000264705.4_Missense_Mutation_p.G322C			O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCAATGAAGGCATTGTGCA	0.502																																																	0													253.0	240.0	244.0					2																	27446585		2203	4300	6503	SO:0001583	missense	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000403525.1:c.964G>T	2.37:g.27446585G>T	ENSP00000384510:p.Gly322Cys		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf	p.G322C	ENST00000403525.1	37	c.964		2	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591040	0.86851	.	.	ENSG00000084774	ENST00000264705;ENST00000403525	D;D	0.91945	-2.94;-2.94	5.45	5.45	0.79879	Glutamine amidotransferase type 1 (2);	0.000000	0.85682	D	0.000000	D	0.98292	0.9434	H	0.99939	4.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99601	1.0978	10	0.87932	D	0	-2.231	16.7618	0.85514	0.0:0.0:1.0:0.0	.	322;322	F8VPD4;P27708	.;PYR1_HUMAN	C	322	ENSP00000264705:G322C;ENSP00000384510:G322C	ENSP00000264705:G322C	G	+	1	0	CAD	27300089	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.191000	0.94940	2.559000	0.86315	0.491000	0.48974	GGC	CAD	-	pfam_GATASE,tigrfam_CarbamoylP_synth_ssu	ENSG00000084774		0.502	CAD-002	NOVEL	basic|exp_conf	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000324970.1		0.00	27	0	G			27446585	+1			no_errors	ENST00000264705	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
PDIA3	2923	genome.wustl.edu	37	15	44037277	44037277	+	5'Flank	SNP	G	G	T	rs2597079	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:44037277G>T	ENST00000300289.5	+	0	0				PDIA3_ENST00000538521.1_5'Flank|CATSPER2P1_ENST00000381680.2_RNA	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		GCAAATGCTCGATGAGAGAGA	0.463																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444		15.37:g.44037277G>T	Exception_encountered		Q13453|Q14255|Q8IYF8|Q9UMU7	RNA	SNP	-	NULL	ENST00000300289.5	37	NULL	CCDS10101.1	15																																																																																			CATSPER2P1	-	-	ENSG00000205771		0.463	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER2P1	HGNC	protein_coding	OTTHUMT00000103532.3	-	0.00	88	0	G	NM_005313		44037277	-1	tier1	-	no_errors	ENST00000381680	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.802	T
CD46	4179	genome.wustl.edu	37	1	207930538	207930538	+	Missense_Mutation	SNP	G	G	A	rs547298394		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:207930538G>A	ENST00000358170.2	+	2	433	c.277G>A	c.(277-279)Gcc>Acc	p.A93T	CD46_ENST00000357714.1_Missense_Mutation_p.A93T|CD46_ENST00000360212.2_Missense_Mutation_p.A93T|CD46_ENST00000322875.4_Missense_Mutation_p.A93T|CD46_ENST00000361067.1_Missense_Mutation_p.A93T|CD46_ENST00000367042.1_Missense_Mutation_p.A93T|CD46_ENST00000441839.2_Missense_Mutation_p.A93T|CD46_ENST00000367041.1_Missense_Mutation_p.A93T|CD46_ENST00000322918.5_Missense_Mutation_p.A93T|CD46_ENST00000354848.1_Missense_Mutation_p.A93T|CD46_ENST00000367047.1_Intron|CD46_ENST00000480003.1_Missense_Mutation_p.A93T|CD46_ENST00000469535.1_3'UTR	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	93	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						CTCAGATGACGCCTGTTATAG	0.363													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18702	0.0		0.0	False		,,,				2504	0.0																0													102.0	101.0	101.0					1																	207930538		2203	4300	6503	SO:0001583	missense	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.277G>A	1.37:g.207930538G>A	ENSP00000350893:p.Ala93Thr		A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	pirsf_M_CF_CD46,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.A93T	ENST00000358170.2	37	c.277	CCDS1485.1	1	.	.	.	.	.	.	.	.	.	.	G	9.516	1.107013	0.20714	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	T;T;T;T;T;T;T;T;T;T;T	0.34859	1.44;1.45;1.48;1.42;1.44;1.47;1.44;1.34;1.4;1.51;1.44	3.72	1.78	0.24846	Complement control module (1);Sushi/SCR/CCP (2);	1.261360	0.05878	N	0.625873	T	0.32823	0.0842	L	0.28400	0.85	0.09310	N	1	P;D;P;P;P;P;P;B;P;P;P;P;P;P	0.61697	0.858;0.99;0.615;0.858;0.885;0.644;0.858;0.335;0.858;0.923;0.915;0.644;0.923;0.742	B;P;B;B;B;B;B;B;B;B;B;B;B;B	0.50570	0.296;0.644;0.073;0.409;0.115;0.131;0.409;0.073;0.29;0.128;0.379;0.131;0.182;0.265	T	0.21314	-1.0249	10	0.17832	T	0.49	.	6.5631	0.22497	0.0:0.2003:0.5926:0.2071	.	93;93;93;93;93;93;93;93;93;93;93;93;93;93	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	T	93	ENSP00000350893:A93T;ENSP00000346912:A93T;ENSP00000314664:A93T;ENSP00000356009:A93T;ENSP00000356008:A93T;ENSP00000350346:A93T;ENSP00000313875:A93T;ENSP00000413543:A93T;ENSP00000354358:A93T;ENSP00000353342:A93T;ENSP00000418471:A93T	ENSP00000313875:A93T	A	+	1	0	CD46	205997161	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.725000	0.25970	0.515000	0.28320	-1.359000	0.01217	GCC	CD46	-	pirsf_M_CF_CD46,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117335		0.363	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3		0.00	51	0	G	NM_172361		207930538	+1			no_errors	ENST00000322875	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.000	A
CDH12	1010	genome.wustl.edu	37	5	21751951	21751951	+	Silent	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:21751951T>C	ENST00000382254.1	-	15	3366	c.2280A>G	c.(2278-2280)gaA>gaG	p.E760E	CDH12_ENST00000522262.1_Silent_p.E720E|CDH12_ENST00000504376.2_Silent_p.E760E|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	760					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CCTGGTCGGCTTCTGTGGTGA	0.512										HNSCC(59;0.17)																																							0													131.0	121.0	124.0					5																	21751951		2203	4300	6503	SO:0001819	synonymous_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2280A>G	5.37:g.21751951T>C			B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E760	ENST00000382254.1	37	c.2280	CCDS3890.1	5																																																																																			CDH12	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000154162		0.512	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	100	0	T	NM_004061		21751951	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	silent	8.93	51	5	SNP	0.265	C
CDH6	1004	genome.wustl.edu	37	5	31299614	31299614	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:31299614G>C	ENST00000265071.2	+	5	952	c.687G>C	c.(685-687)agG>agC	p.R229S	CDH6_ENST00000514738.1_Missense_Mutation_p.R174S	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	229	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GAGAAAACAGGGAGCAGTACC	0.453																																																	0													149.0	140.0	143.0					5																	31299614		2203	4300	6503	SO:0001583	missense	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.687G>C	5.37:g.31299614G>C	ENSP00000265071:p.Arg229Ser		A8K5H5|Q9BWS0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R229S	ENST00000265071.2	37	c.687	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	G	14.97	2.695163	0.48202	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.52526	0.66;0.66	6.07	2.72	0.32119	Cadherin (4);Cadherin-like (1);	0.129681	0.64402	D	0.000002	T	0.30008	0.0751	N	0.11154	0.105	0.44194	D	0.997015	B;P	0.44690	0.137;0.841	B;B	0.43331	0.084;0.416	T	0.15723	-1.0427	10	0.87932	D	0	.	9.3476	0.38118	0.351:0.0:0.649:0.0	.	229;229	P55285;P55285-2	CADH6_HUMAN;.	S	174;229	ENSP00000424843:R174S;ENSP00000265071:R229S	ENSP00000265071:R229S	R	+	3	2	CDH6	31335371	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.562000	0.36353	0.791000	0.33826	0.655000	0.94253	AGG	CDH6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113361		0.453	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	84	0	G	NM_004932		31299614	+1	tier1	-	no_errors	ENST00000265071	ensembl	human	known	74_37	missense	20.63	50	13	SNP	1.000	C
CDKN2AIPNL	91368	genome.wustl.edu	37	5	133747417	133747417	+	Silent	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:133747417G>A	ENST00000458198.2	-	1	172	c.129C>T	c.(127-129)ttC>ttT	p.F43F	CDKN2AIPNL_ENST00000395009.3_Silent_p.F43F	NM_080656.2	NP_542387.1	Q96HQ2	C2AIL_HUMAN	CDKN2A interacting protein N-terminal like	43										central_nervous_system(1)|kidney(2)|prostate(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGCGCAGGATGAATTCCATGC	0.662											OREG0016789	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													16.0	21.0	19.0					5																	133747417		2201	4296	6497	SO:0001819	synonymous_variant	0			BC008293	CCDS4175.1	5q31.1	2008-02-05			ENSG00000237190	ENSG00000237190			30545	protein-coding gene	gene with protein product						12477932	Standard	NM_080656		Approved	MGC13017	uc011cxs.2	Q96HQ2	OTTHUMG00000129123	ENST00000458198.2:c.129C>T	5.37:g.133747417G>A		1605	Q8WVE3	Silent	SNP	pfam_DUF3469	p.F43	ENST00000458198.2	37	c.129	CCDS4175.1	5																																																																																			CDKN2AIPNL	-	pfam_DUF3469	ENSG00000237190		0.662	CDKN2AIPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2AIPNL	HGNC	protein_coding	OTTHUMT00000251171.2	-	0.00	55	0	G	NM_080656		133747417	-1	tier1	-	no_errors	ENST00000458198	ensembl	human	known	74_37	silent	18.92	30	7	SNP	1.000	A
CHCHD3	54927	genome.wustl.edu	37	7	132754950	132754950	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:132754950G>T	ENST00000262570.5	-	2	265	c.121C>A	c.(121-123)Cca>Aca	p.P41T	CHCHD3_ENST00000542753.1_Missense_Mutation_p.P41T|CHCHD3_ENST00000476546.1_Intron|CHCHD3_ENST00000448878.1_Missense_Mutation_p.P41T	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3	41					inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						GAACCAGATGGAGAGGATTCC	0.358																																																	0													83.0	74.0	77.0					7																	132754950		2203	4300	6503	SO:0001583	missense	0			BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231	ENST00000262570.5:c.121C>A	7.37:g.132754950G>T	ENSP00000262570:p.Pro41Thr			Missense_Mutation	SNP	pfam_DUF737	p.P41T	ENST00000262570.5	37	c.121	CCDS5828.1	7	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392975	0.42410	.	.	ENSG00000106554	ENST00000262570;ENST00000448878;ENST00000542753	T;T;T	0.41758	0.99;0.99;0.99	6.03	3.19	0.36642	.	0.160356	0.56097	D	0.000026	T	0.36303	0.0962	L	0.56396	1.775	0.47905	D	0.999548	B;B;B	0.32653	0.314;0.379;0.167	B;B;B	0.34536	0.05;0.185;0.081	T	0.06516	-1.0822	10	0.26408	T	0.33	-0.7277	8.2575	0.31765	0.0798:0.2992:0.6209:0.0	.	41;41;41	G3V1K1;C9JRZ6;Q9NX63	.;.;CHCH3_HUMAN	T	41	ENSP00000262570:P41T;ENSP00000389297:P41T;ENSP00000440267:P41T	ENSP00000262570:P41T	P	-	1	0	CHCHD3	132405490	0.998000	0.40836	0.993000	0.49108	0.995000	0.86356	0.777000	0.26718	0.407000	0.25591	-0.176000	0.13171	CCA	CHCHD3	-	pfam_DUF737	ENSG00000106554		0.358	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHCHD3	HGNC	protein_coding	OTTHUMT00000338899.1	-	0.00	61	0	G	NM_017812		132754950	-1	tier1	-	no_errors	ENST00000423635	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	T
CHD2	1106	genome.wustl.edu	37	15	93524607	93524607	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:93524607G>T	ENST00000394196.4	+	24	4054	c.2986G>T	c.(2986-2988)Gat>Tat	p.D996Y	CHD2_ENST00000557381.1_Missense_Mutation_p.D996Y	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	996	Glu-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AATGGATATAGATGAAATTTT	0.358																																																	0													127.0	123.0	125.0					15																	93524607		2197	4298	6495	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2986G>T	15.37:g.93524607G>T	ENSP00000377747:p.Asp996Tyr		C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D996Y	ENST00000394196.4	37	c.2986	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532331	0.85812	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	T;T	0.02606	4.23;4.23	4.78	4.78	0.61160	.	0.000000	0.35179	U	0.003389	T	0.24392	0.0591	H	0.94385	3.53	0.80722	D	1	P;D	0.89917	0.932;1.0	P;D	0.80764	0.707;0.994	T	0.35475	-0.9787	10	0.87932	D	0	-27.622	18.1898	0.89804	0.0:0.0:1.0:0.0	.	996;996	O14647;O14647-2	CHD2_HUMAN;.	Y	996	ENSP00000377747:D996Y;ENSP00000451366:D996Y	ENSP00000377747:D996Y	D	+	1	0	CHD2	91325611	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.929000	0.92859	2.360000	0.80028	0.591000	0.81541	GAT	CHD2	-	NULL	ENSG00000173575		0.358	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	-	0.00	80	0	G	NM_001271		93524607	+1	tier1	-	no_errors	ENST00000557381	ensembl	human	putative	74_37	missense	6.78	55	4	SNP	1.000	T
CHD5	26038	genome.wustl.edu	37	1	6211155	6211155	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:6211155C>T	ENST00000262450.3	-	7	1030	c.931G>A	c.(931-933)Gtg>Atg	p.V311M	CHD5_ENST00000378021.1_De_novo_Start_InFrame	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TCGGAGCGCACGGAGGCACTG	0.592																																																	0													97.0	86.0	90.0					1																	6211155		2203	4300	6503	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.931G>A	1.37:g.6211155C>T	ENSP00000262450:p.Val311Met		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V311M	ENST00000262450.3	37	c.931	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	c	11.13	1.547218	0.27652	.	.	ENSG00000116254	ENST00000262450	D	0.90955	-2.76	4.0	0.962	0.19643	Zinc finger, FYVE/PHD-type (1);	0.187417	0.33916	N	0.004437	D	0.84192	0.5418	L	0.54323	1.7	0.80722	D	1	B	0.33883	0.43	B	0.19946	0.027	T	0.78679	-0.2110	10	0.45353	T	0.12	-13.1073	10.1389	0.42723	0.0:0.6859:0.0:0.3141	.	311	Q8TDI0	CHD5_HUMAN	M	311	ENSP00000262450:V311M	ENSP00000262450:V311M	V	-	1	0	CHD5	6133742	0.754000	0.28360	0.964000	0.40570	0.850000	0.48378	1.499000	0.35671	0.308000	0.22923	-0.389000	0.06534	GTG	CHD5	-	superfamily_Znf_FYVE_PHD	ENSG00000116254		0.592	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	-	0.00	32	0	C	NM_015557		6211155	-1	tier1	-	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	23.33	23	7	SNP	0.892	T
CHRM2	1129	genome.wustl.edu	37	7	136700565	136700565	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:136700565A>G	ENST00000445907.2	+	3	1481	c.953A>G	c.(952-954)gAg>gGg	p.E318G	hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000397608.3_Missense_Mutation_p.E318G|CHRM2_ENST00000402486.3_Missense_Mutation_p.E318G|CHRM2_ENST00000401861.1_Missense_Mutation_p.E318G|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000453373.1_Missense_Mutation_p.E318G|CHRM2_ENST00000320658.5_Missense_Mutation_p.E318G	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	318					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TCCAAAGATGAGAACTCTAAG	0.468																																																	0													97.0	99.0	98.0					7																	136700565		2203	4300	6503	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.953A>G	7.37:g.136700565A>G	ENSP00000399745:p.Glu318Gly		Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.E318G	ENST00000445907.2	37	c.953	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	A	6.986	0.551949	0.13374	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.61859	0.07;0.07;0.07;0.07;0.07;0.07	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.180851	0.37012	N	0.002300	T	0.35828	0.0945	N	0.04508	-0.205	0.36960	D	0.893275	B	0.02656	0.0	B	0.09377	0.004	T	0.33033	-0.9884	10	0.23302	T	0.38	-5.9838	15.427	0.75061	1.0:0.0:0.0:0.0	.	318	P08172	ACM2_HUMAN	G	318	ENSP00000399745:E318G;ENSP00000415386:E318G;ENSP00000319984:E318G;ENSP00000380733:E318G;ENSP00000384937:E318G;ENSP00000384401:E318G	ENSP00000319984:E318G	E	+	2	0	CHRM2	136351105	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.169000	0.58223	2.055000	0.61198	0.533000	0.62120	GAG	CHRM2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M2_rcpt	ENSG00000181072		0.468	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	-	0.00	58	0	A			136700565	+1	tier1	-	no_errors	ENST00000320658	ensembl	human	known	74_37	missense	17.07	34	7	SNP	1.000	G
CMC1	152100	genome.wustl.edu	37	3	28357823	28357823	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr3:28357823G>C	ENST00000466830.1	+	3	308		c.e3-1		CMC1_ENST00000423894.1_Splice_Site|CMC1_ENST00000469102.1_3'UTR	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						ATTTATTTCAGATTTTACCAA	0.289																																																	0													40.0	41.0	41.0					3																	28357823		2202	4294	6496	SO:0001630	splice_region_variant	0			BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.110-1G>C	3.37:g.28357823G>C			Q68DJ7	Splice_Site	SNP	-	e3-1	ENST00000466830.1	37	c.110-1	CCDS33722.1	3	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436057	0.62955	.	.	ENSG00000187118	ENST00000466830;ENST00000423894;ENST00000418849	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6138	0.95622	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CMC1	28332827	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.900000	0.87376	2.644000	0.89710	0.563000	0.77884	.	CMC1	-	-	ENSG00000187118		0.289	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CMC1	HGNC	protein_coding	OTTHUMT00000341087.1	-	0.00	139	0	G	NM_182523	Intron	28357823	+1	tier1	-	no_errors	ENST00000466830	ensembl	human	known	74_37	splice_site	15.29	72	13	SNP	1.000	C
COLEC12	81035	genome.wustl.edu	37	18	346460	346460	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr18:346460T>C	ENST00000400256.3	-	5	1369	c.1162A>G	c.(1162-1164)Acc>Gcc	p.T388A		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	388					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				TTGGCCAGGGTATTATTCAAG	0.458																																																	0													200.0	169.0	179.0					18																	346460		2203	4300	6503	SO:0001583	missense	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1162A>G	18.37:g.346460T>C	ENSP00000383115:p.Thr388Ala		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.T388A	ENST00000400256.3	37	c.1162	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	T	11.53	1.666650	0.29604	.	.	ENSG00000158270	ENST00000400256	T	0.78364	-1.17	5.76	4.53	0.55603	.	0.138605	0.64402	D	0.000004	T	0.58722	0.2142	N	0.14661	0.345	0.40179	D	0.977266	B	0.23591	0.088	B	0.17979	0.02	T	0.56306	-0.8001	10	0.23302	T	0.38	-13.4809	9.976	0.41783	0.2613:0.0:0.0:0.7387	.	388	Q5KU26	COL12_HUMAN	A	388	ENSP00000383115:T388A	ENSP00000383115:T388A	T	-	1	0	COLEC12	336460	1.000000	0.71417	0.886000	0.34754	0.515000	0.34225	3.738000	0.55067	2.197000	0.70478	0.533000	0.62120	ACC	COLEC12	-	NULL	ENSG00000158270		0.458	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1		0.00	149	0	T			346460	-1			no_errors	ENST00000400256	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	C
CREB5	9586	genome.wustl.edu	37	7	28450121	28450121	+	5'Flank	SNP	G	G	A	rs532159785		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:28450121G>A	ENST00000357727.2	+	0	0				CREB5_ENST00000396299.2_Intron|CREB5_ENST00000482692.1_3'UTR	NM_182898.2	NP_878901.2	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						adipose tissue development (GO:0060612)|fat cell differentiation (GO:0045444)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(13)|prostate(1)|skin(3)	32						GCTGCATCCCGCTTCTTCTTT	0.488																																																	0																																										SO:0001631	upstream_gene_variant	0			L05515	CCDS5417.1, CCDS5418.1, CCDS43562.1, CCDS43563.1	7p15	2013-01-10			ENSG00000146592	ENSG00000146592		"""basic leucine zipper proteins"""	16844	protein-coding gene	gene with protein product	"""cAMP response element binding protein CRE-Bpa"""					8378084, 8440710	Standard	XM_005249906		Approved	H_GS165L15.1, CRE-BPA	uc003szr.3	Q02930	OTTHUMG00000097081		7.37:g.28450121G>A	Exception_encountered		A8KA51|B4DU13|B5BUH3|C9JK47|Q05886|Q06246|Q75N02|Q86UJ9	RNA	SNP	-	NULL	ENST00000357727.2	37	NULL	CCDS5417.1	7																																																																																			CREB5	-	-	ENSG00000146592		0.488	CREB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB5	HGNC	protein_coding	OTTHUMT00000214204.4	-	0.00	75	0	G	NM_004904		28450121	+1	tier1	-	no_errors	ENST00000482692	ensembl	human	putative	74_37	rna	16.13	26	5	SNP	0.000	A
CTTNBP2	83992	genome.wustl.edu	37	7	117501265	117501265	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:117501265G>A	ENST00000160373.3	-	2	278	c.187C>T	c.(187-189)Cgg>Tgg	p.R63W		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	63					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		GTCCTTACCCGCAGGGCCTCG	0.483																																																	0													55.0	43.0	47.0					7																	117501265		2203	4300	6503	SO:0001583	missense	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.187C>T	7.37:g.117501265G>A	ENSP00000160373:p.Arg63Trp		O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R63W	ENST00000160373.3	37	c.187	CCDS5774.1	7	.	.	.	.	.	.	.	.	.	.	G	19.01	3.742961	0.69418	.	.	ENSG00000077063	ENST00000160373;ENST00000434890;ENST00000454375;ENST00000412853	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.63	0.655	0.17839	Cortactin-binding protein-2, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.62744	0.2453	M	0.67953	2.075	0.58432	D	0.999994	D	0.71674	0.998	D	0.64595	0.927	T	0.69094	-0.5236	10	0.87932	D	0	-0.2303	15.2708	0.73699	0.0:0.0:0.3934:0.6066	.	63	Q8WZ74	CTTB2_HUMAN	W	63;21;21;21	ENSP00000160373:R63W;ENSP00000396014:R21W;ENSP00000405831:R21W;ENSP00000393373:R21W	ENSP00000160373:R63W	R	-	1	2	CTTNBP2	117288501	0.998000	0.40836	1.000000	0.80357	0.818000	0.46254	0.440000	0.21592	0.304000	0.22809	0.591000	0.81541	CGG	CTTNBP2	-	pfam_Cortactin-binding_p2_N	ENSG00000077063		0.483	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	-	0.00	21	0	G	NM_033427		117501265	-1	tier1	-	no_errors	ENST00000160373	ensembl	human	known	74_37	missense	27.78	13	5	SNP	1.000	A
CUL4B	8450	genome.wustl.edu	37	X	119668405	119668405	+	Missense_Mutation	SNP	G	G	T	rs202209674		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:119668405G>T	ENST00000404115.3	-	19	2652	c.2251C>A	c.(2251-2253)Ctg>Atg	p.L751M	CUL4B_ENST00000336592.6_Missense_Mutation_p.L738M|CUL4B_ENST00000371322.5_Missense_Mutation_p.L733M	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	751					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGCAGCACCAGTGTTTGAAAA	0.343																																																	0													157.0	148.0	151.0					X																	119668405		2203	4300	6503	SO:0001583	missense	0			U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.2251C>A	X.37:g.119668405G>T	ENSP00000384109:p.Leu751Met		B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.L751M	ENST00000404115.3	37	c.2251	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600976	0.66332	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.74632	-0.86;-0.86;-0.86	5.88	5.01	0.66863	Cullin, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (2);	0.068521	0.64402	N	0.000014	D	0.84800	0.5552	M	0.73372	2.23	0.54753	D	0.999986	B;D;D	0.89917	0.002;1.0;1.0	B;D;D	0.97110	0.016;1.0;1.0	D	0.84974	0.0884	9	.	.	.	-2.2966	14.721	0.69305	0.0:0.0:0.855:0.145	.	555;751;733	Q13620-3;Q13620;Q13620-1	.;CUL4B_HUMAN;.	M	733;738;751	ENSP00000360373:L733M;ENSP00000338919:L738M;ENSP00000384109:L751M	.	L	-	1	2	CUL4B	119552433	1.000000	0.71417	0.993000	0.49108	0.983000	0.72400	3.786000	0.55431	1.225000	0.43566	0.544000	0.68410	CTG	CUL4B	-	pfam_Cullin_N,superfamily_Cullin_homology,pfscan_Cullin_homology	ENSG00000158290		0.343	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	-	0.00	77	0	G	NM_003588		119668405	-1	tier1	-	no_errors	ENST00000404115	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.991	T
CXCR1	3577	genome.wustl.edu	37	2	219029248	219029248	+	Silent	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:219029248C>A	ENST00000295683.2	-	2	807	c.687G>T	c.(685-687)ctG>ctT	p.L229L		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	229					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)			endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	GGGCCTTAAACAGTGTACGCA	0.552																																																	0													138.0	127.0	131.0					2																	219029248		2203	4300	6503	SO:0001819	synonymous_variant	0			U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.687G>T	2.37:g.219029248C>A			B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR1,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.L229	ENST00000295683.2	37	c.687	CCDS2409.1	2																																																																																			CXCR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2	ENSG00000163464		0.552	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR1	HGNC	protein_coding	OTTHUMT00000256773.2		0.00	60	0	C	NM_000634		219029248	-1			no_errors	ENST00000295683	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.951	A
CYLC1	1538	genome.wustl.edu	37	X	83127967	83127967	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:83127967T>G	ENST00000329312.4	+	4	288	c.251T>G	c.(250-252)aTt>aGt	p.I84S		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	84					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TTCAGAAAAATTTTGCAATGG	0.363																																																	0													33.0	31.0	32.0					X																	83127967		2200	4296	6496	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.251T>G	X.37:g.83127967T>G	ENSP00000331556:p.Ile84Ser		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.I84S	ENST00000329312.4	37	c.251	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	t	10.58	1.389208	0.25118	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.56103	0.48	4.58	-9.17	0.00691	.	.	.	.	.	T	0.39172	0.1068	L	0.54323	1.7	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.13407	0.009;0.009	T	0.29243	-1.0018	9	0.49607	T	0.09	11.152	6.0626	0.19846	0.632:0.0714:0.1813:0.1152	.	84;84	P35663;F5H4V5	CYLC1_HUMAN;.	S	84	ENSP00000331556:I84S	ENSP00000331556:I84S	I	+	2	0	CYLC1	83014623	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-4.642000	0.00204	-4.383000	0.00052	-0.405000	0.06341	ATT	CYLC1	-	NULL	ENSG00000183035		0.363	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	55	0	T	NM_021118		83127967	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	missense	28.07	40	16	SNP	0.000	G
DAPK1	1612	genome.wustl.edu	37	9	90321986	90321986	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr9:90321986T>G	ENST00000408954.3	+	26	4335	c.4000T>G	c.(4000-4002)Tta>Gta	p.L1334V	DAPK1_ENST00000358077.5_Missense_Mutation_p.L1334V|DAPK1_ENST00000491893.1_Missense_Mutation_p.L1268V|DAPK1_ENST00000472284.1_Missense_Mutation_p.L1334V|DAPK1_ENST00000469640.2_Missense_Mutation_p.L1359V	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1334	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						CGCCATGAACTTAGGCCTCCC	0.627									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													69.0	77.0	74.0					9																	90321986		2030	4165	6195	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.4000T>G	9.37:g.90321986T>G	ENSP00000386135:p.Leu1334Val		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.L1359V	ENST00000408954.3	37	c.4075	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	T	16.84	3.233366	0.58886	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	6.17	-1.95	0.07548	Death (3);DEATH-like (2);	0.000000	0.42053	D	0.000770	T	0.41903	0.1179	M	0.81614	2.55	0.58432	D	0.999995	B;B;B	0.25048	0.117;0.028;0.117	B;B;B	0.29524	0.103;0.036;0.103	T	0.39251	-0.9623	10	0.87932	D	0	.	9.1801	0.37136	0.0:0.4306:0.1046:0.4648	.	1268;1334;1334	B7ZLE7;P53355-3;P53355	.;.;DAPK1_HUMAN	V	1334;1334;1359;1334;1268	ENSP00000350785:L1334V;ENSP00000417076:L1334V;ENSP00000418885:L1359V;ENSP00000386135:L1334V;ENSP00000419026:L1268V	ENSP00000350785:L1334V	L	+	1	2	DAPK1	89511806	1.000000	0.71417	0.986000	0.45419	0.906000	0.53458	1.309000	0.33539	-0.256000	0.09473	-0.250000	0.11733	TTA	DAPK1	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	ENSG00000196730		0.627	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	-	0.00	117	0	T	NM_004938		90321986	+1	tier1	-	no_errors	ENST00000469640	ensembl	human	known	74_37	missense	16.67	30	6	SNP	0.963	G
DCHS1	8642	genome.wustl.edu	37	11	6662746	6662748	+	In_Frame_Del	DEL	CAG	CAG	-	rs370785084|rs372916982		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:6662746_6662748delCAG	ENST00000299441.3	-	2	508_510	c.97_99delCTG	c.(97-99)ctgdel	p.L33del		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	33					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.L33_G34insL(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCCCAGCCCCcagcagcagcagc	0.635																																																	1	Insertion - In frame(1)	prostate(1)								54,415,3471		8,0,38,73,269,1582						5.3	1.0		dbSNP_130	8	588,630,6394		117,13,341,89,439,2807	no	codingComplex	DCHS1	NM_003737.2		125,13,379,162,708,4389	A1A1,A1A2,A1R,A2A2,A2R,RR		16.0011,11.9036,14.6035				642,1045,9865				SO:0001651	inframe_deletion	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.97_99delCTG	11.37:g.6662755_6662757delCAG	ENSP00000299441:p.Leu33del		O15098	In_Frame_Del	DEL	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L33in_frame_del	ENST00000299441.3	37	c.99_97	CCDS7771.1	11																																																																																			DCHS1	-	NULL	ENSG00000166341		0.635	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1		0.00	54	0	CAG	NM_003737		6662748	-1	tier1		no_errors	ENST00000299441	ensembl	human	known	74_37	in_frame_del	11.76	45	6	DEL	1.000:1.000:1.000	-
DDAH1	23576	genome.wustl.edu	37	1	85787017	85787017	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:85787017A>C	ENST00000284031.8	-	0	1070				DDAH1_ENST00000542148.1_3'UTR|DDAH1_ENST00000426972.3_3'UTR|RP11-131L23.1_ENST00000427819.1_RNA|DDAH1_ENST00000539042.1_Intron|DDAH1_ENST00000483110.1_5'UTR|RP11-131L23.1_ENST00000426125.1_RNA|DDAH1_ENST00000535924.2_3'UTR	NM_012137.3	NP_036269.1	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process (GO:0006527)|citrulline metabolic process (GO:0000052)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of angiogenesis (GO:0045766)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of systemic arterial blood pressure (GO:0003073)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|catalytic activity (GO:0003824)|dimethylargininase activity (GO:0016403)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(1)|skin(1)	5				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	CAAATTTTGTAAACAAGAGTT	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB001915	CCDS705.1, CCDS44170.1	1p22	2008-02-05			ENSG00000153904	ENSG00000153904	3.5.3.18		2715	protein-coding gene	gene with protein product		604743				9874257	Standard	NM_012137		Approved	DDAH	uc001dlb.3	O94760	OTTHUMG00000010578	ENST00000284031.8:c.*118T>G	1.37:g.85787017A>C			Q5HYC8|Q86XK5	RNA	SNP	-	NULL	ENST00000284031.8	37	NULL	CCDS705.1	1																																																																																			DDAH1	-	-	ENSG00000153904		0.478	DDAH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDAH1	HGNC	protein_coding	OTTHUMT00000029189.1	-	0.00	92	0	A			85787017	-1	tier1	-	no_errors	ENST00000483110	ensembl	human	known	74_37	rna	8.62	53	5	SNP	1.000	C
DEPTOR	64798	genome.wustl.edu	37	8	120977623	120977623	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr8:120977623C>T	ENST00000286234.5	+	4	707	c.577C>T	c.(577-579)Ctt>Ttt	p.L193F	DEPTOR_ENST00000523492.1_Missense_Mutation_p.L92F	NM_022783.2	NP_073620.2	Q8TB45	DPTOR_HUMAN	DEP domain containing MTOR-interacting protein	193	DEP 2. {ECO:0000255|PROSITE- ProRule:PRU00066}.				intracellular signal transduction (GO:0035556)|negative regulation of cell size (GO:0045792)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of TOR signaling (GO:0032007)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)	intracellular (GO:0005622)				endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	18						TTGCCACCGGCTTATGGAGCA	0.532																																																	0													104.0	84.0	91.0					8																	120977623		2203	4300	6503	SO:0001583	missense	0				CCDS6331.1, CCDS64960.1	8q24.12	2011-12-13	2010-12-08	2010-12-08	ENSG00000155792	ENSG00000155792			22953	protein-coding gene	gene with protein product		612974	"""DEP domain containing 6"""	DEPDC6		19446321	Standard	NM_022783		Approved	DEP.6, FLJ12428	uc003yow.4	Q8TB45	OTTHUMG00000165052	ENST00000286234.5:c.577C>T	8.37:g.120977623C>T	ENSP00000286234:p.Leu193Phe		B2RCL9|B4DN97|E7EV87|Q96EQ1|Q9H0R7|Q9H894|Q9HA07	Missense_Mutation	SNP	pfam_DEP_dom,superfamily_PDZ,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ	p.L193F	ENST00000286234.5	37	c.577	CCDS6331.1	8	.	.	.	.	.	.	.	.	.	.	C	21.1	4.097835	0.76870	.	.	ENSG00000155792	ENST00000523492;ENST00000286234	T;T	0.47177	0.85;0.85	5.31	5.31	0.75309	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.73636	0.3612	M	0.85099	2.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78173	-0.2307	10	0.72032	D	0.01	-18.0141	18.9927	0.92800	0.0:1.0:0.0:0.0	.	92;193	E7EV87;Q8TB45	.;DPTOR_HUMAN	F	92;193	ENSP00000430457:L92F;ENSP00000286234:L193F	ENSP00000286234:L193F	L	+	1	0	DEPTOR	121046804	1.000000	0.71417	0.991000	0.47740	0.459000	0.32528	4.358000	0.59442	2.487000	0.83934	0.655000	0.94253	CTT	DEPTOR	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	ENSG00000155792		0.532	DEPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPTOR	HGNC	protein_coding	OTTHUMT00000381601.1		0.00	20	0	C	NM_022783		120977623	+1			no_errors	ENST00000286234	ensembl	human	known	74_37	missense	18.18	9	2	SNP	1.000	T
DMAP1	55929	genome.wustl.edu	37	1	44686001	44686001	+	Intron	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:44686001G>T	ENST00000372289.2	+	9	1607				DMAP1_ENST00000361745.6_Intron|DMAP1_ENST00000488433.1_Intron|DMAP1_ENST00000315913.5_Intron	NM_019100.4	NP_061973.1	Q9NPF5	DMAP1_HUMAN	DNA methyltransferase 1 associated protein 1						chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA methylation (GO:0006306)|DNA repair (GO:0006281)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription factor import into nucleus (GO:0042993)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|RNA polymerase II repressing transcription factor binding (GO:0001103)|transcription corepressor activity (GO:0003714)			breast(1)|cervix(1)|endometrium(6)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(166;0.155)					TGGACAGGCTGGGAGGCACGC	0.607											OREG0013438	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													22.0	22.0	22.0					1																	44686001		2186	4257	6443	SO:0001627	intron_variant	0			AB037846	CCDS509.1	1p34	2009-07-13			ENSG00000178028	ENSG00000178028			18291	protein-coding gene	gene with protein product		605077				10888872, 10718198	Standard	XM_005271039		Approved	DNMAP1, FLJ11543, KIAA1425, DNMTAP1, EAF2, MEAF2, SWC4	uc001clq.1	Q9NPF5	OTTHUMG00000007577	ENST00000372289.2:c.1344+20G>T	1.37:g.44686001G>T		925	A8K001|D3DPY8|Q0JSM4|Q5TG41|Q7Z3H7|Q9H0S8|Q9P2C2	RNA	SNP	-	NULL	ENST00000372289.2	37	NULL	CCDS509.1	1																																																																																			DMAP1	-	-	ENSG00000178028		0.607	DMAP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DMAP1	HGNC	protein_coding	OTTHUMT00000020027.3	-	0.00	32	0	G	NM_019100		44686001	+1	tier1	-	no_errors	ENST00000494092	ensembl	human	known	74_37	rna	17.65	27	6	SNP	0.008	T
DNAH14	127602	genome.wustl.edu	37	1	225534207	225534207	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:225534207G>A	ENST00000445597.2	+	49	8459	c.8459G>A	c.(8458-8460)cGg>cAg	p.R2820Q	DNAH14_ENST00000430092.1_Missense_Mutation_p.R3623Q|DNAH14_ENST00000439375.2_Missense_Mutation_p.R3623Q			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2820					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TTCTCTTTTCGGCTTTGCACT	0.318																																																	0													66.0	56.0	59.0					1																	225534207		692	1585	2277	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8459G>A	1.37:g.225534207G>A	ENSP00000409472:p.Arg2820Gln		A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.R3623Q	ENST00000445597.2	37	c.10868		1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426766	0.62733	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.50813	0.73;0.73;0.73	5.48	-0.829	0.10796	.	.	.	.	.	T	0.29158	0.0725	.	.	.	0.09310	N	1	D	0.57571	0.98	P	0.44422	0.449	T	0.14282	-1.0478	8	0.24483	T	0.36	.	1.4324	0.02336	0.1613:0.1589:0.2444:0.4353	.	3623	Q0VDD8-4	.	Q	2820;3623;3623	ENSP00000409472:R2820Q;ENSP00000414402:R3623Q;ENSP00000392061:R3623Q	ENSP00000414402:R3623Q	R	+	2	0	DNAH14	223600830	0.847000	0.29606	0.010000	0.14722	0.973000	0.67179	1.230000	0.32612	-0.108000	0.12066	0.508000	0.49915	CGG	DNAH14	-	NULL	ENSG00000185842		0.318	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	-	0.00	84	0	G	XM_059166		225534207	+1	tier1	-	no_errors	ENST00000430092	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.001	A
DNMBP	23268	genome.wustl.edu	37	10	101715538	101715538	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:101715538C>T	ENST00000324109.4	-	4	1784	c.1693G>A	c.(1693-1695)Ggg>Agg	p.G565R	DNMBP-AS1_ENST00000434409.1_RNA|DNMBP_ENST00000342239.3_Missense_Mutation_p.G565R	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	565					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GTGCCGGGCCCTGCCAAGCTC	0.483																																																	0													70.0	72.0	71.0					10																	101715538		2203	4300	6503	SO:0001583	missense	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.1693G>A	10.37:g.101715538C>T	ENSP00000315659:p.Gly565Arg		Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain,prints_p67phox,prints_Spectrin_alpha_SH3	p.G565R	ENST00000324109.4	37	c.1693	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	C	13.31	2.199842	0.38905	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.11277	2.85;2.79	5.24	3.37	0.38596	.	0.126803	0.36200	N	0.002727	T	0.09069	0.0224	L	0.50919	1.6	0.09310	N	0.999999	B	0.10296	0.003	B	0.08055	0.003	T	0.33803	-0.9854	10	0.12103	T	0.63	-15.0115	8.2952	0.31982	0.0:0.692:0.0:0.308	.	565	Q6XZF7	DNMBP_HUMAN	R	565	ENSP00000344914:G565R;ENSP00000315659:G565R	ENSP00000315659:G565R	G	-	1	0	DNMBP	101705528	0.000000	0.05858	0.996000	0.52242	0.865000	0.49528	0.276000	0.18716	1.446000	0.47643	0.561000	0.74099	GGG	DNMBP	-	NULL	ENSG00000107554		0.483	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	-	0.00	90	0	C	NM_015221		101715538	-1	tier1	-	no_errors	ENST00000342239	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.022	T
DOCK2	1794	genome.wustl.edu	37	5	169412843	169412843	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:169412843G>T	ENST00000256935.8	+	29	2990	c.2910G>T	c.(2908-2910)atG>atT	p.M970I	DOCK2_ENST00000520908.1_Missense_Mutation_p.M462I|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.M31I	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	970	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACTTCTTGATGGAGACCTTCA	0.433																																																	0													245.0	226.0	232.0					5																	169412843		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2910G>T	5.37:g.169412843G>T	ENSP00000256935:p.Met970Ile		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.M970I	ENST00000256935.8	37	c.2910	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466718	0.63625	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.25579	1.79;1.79;1.79	5.19	5.19	0.71726	.	0.039551	0.85682	D	0.000000	T	0.39332	0.1074	L	0.38838	1.175	0.58432	D	0.999998	P;P	0.50528	0.664;0.936	B;P	0.61201	0.217;0.885	T	0.03463	-1.1034	10	0.25751	T	0.34	.	18.7481	0.91802	0.0:0.0:1.0:0.0	.	462;970	E7ERW7;Q92608	.;DOCK2_HUMAN	I	970;462;31	ENSP00000256935:M970I;ENSP00000429283:M462I;ENSP00000438827:M31I	ENSP00000256935:M970I	M	+	3	0	DOCK2	169345421	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.813000	0.99286	2.426000	0.82243	0.561000	0.74099	ATG	DOCK2	-	superfamily_ARM-type_fold	ENSG00000134516		0.433	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2		0.00	81	0	G	NM_004946		169412843	+1			no_errors	ENST00000256935	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
DSG1	1828	genome.wustl.edu	37	18	28916468	28916468	+	Missense_Mutation	SNP	G	G	A	rs557916314		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr18:28916468G>A	ENST00000257192.4	+	9	1369	c.1157G>A	c.(1156-1158)cGt>cAt	p.R386H		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	386	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			CCAGTGTTTCGTCCAGGTTCA	0.373													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15573	0.0		0.0	False		,,,				2504	0.0																0													94.0	85.0	88.0					18																	28916468		2203	4300	6503	SO:0001583	missense	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1157G>A	18.37:g.28916468G>A	ENSP00000257192:p.Arg386His		B7Z845	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmosomal_cadherin	p.R386H	ENST00000257192.4	37	c.1157	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	G	7.373	0.627161	0.14257	.	.	ENSG00000134760	ENST00000257192	T	0.60920	0.15	5.57	4.68	0.58851	Cadherin (2);Cadherin-like (1);	0.503060	0.18178	N	0.149226	T	0.44787	0.1310	L	0.46947	1.48	0.80722	D	1	B	0.22800	0.075	B	0.14578	0.011	T	0.40627	-0.9553	10	0.30078	T	0.28	.	5.5407	0.17036	0.1412:0.2634:0.5954:0.0	.	386	Q02413	DSG1_HUMAN	H	386	ENSP00000257192:R386H	ENSP00000257192:R386H	R	+	2	0	DSG1	27170466	0.868000	0.29978	1.000000	0.80357	0.337000	0.28794	1.854000	0.39368	2.609000	0.88269	0.563000	0.77884	CGT	DSG1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000134760		0.373	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1	-	0.00	87	0	G	NM_001942		28916468	+1	tier1	-	no_errors	ENST00000257192	ensembl	human	known	74_37	missense	8.45	65	6	SNP	0.924	A
DSG3	1830	genome.wustl.edu	37	18	29056028	29056028	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr18:29056028G>T	ENST00000257189.4	+	16	2888	c.2805G>T	c.(2803-2805)gaG>gaT	p.E935D		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	935					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TAGTAACGGAGACTTACTCGG	0.507																																																	0													162.0	146.0	152.0					18																	29056028		2203	4300	6503	SO:0001583	missense	0			M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.2805G>T	18.37:g.29056028G>T	ENSP00000257189:p.Glu935Asp		A8K2V2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.E935D	ENST00000257189.4	37	c.2805	CCDS11898.1	18	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212734	0.39102	.	.	ENSG00000134757	ENST00000257189	D	0.81739	-1.53	5.54	-2.5	0.06384	.	0.121454	0.35903	N	0.002905	D	0.86146	0.5863	M	0.80332	2.49	0.30957	N	0.724114	D	0.89917	1.0	D	0.91635	0.999	T	0.82561	-0.0396	10	0.72032	D	0.01	.	7.6313	0.28240	0.565:0.0:0.3198:0.1152	.	935	P32926	DSG3_HUMAN	D	935	ENSP00000257189:E935D	ENSP00000257189:E935D	E	+	3	2	DSG3	27310026	0.788000	0.28762	0.070000	0.20053	0.026000	0.11368	-0.114000	0.10757	-0.777000	0.04572	-0.345000	0.07892	GAG	DSG3	-	NULL	ENSG00000134757		0.507	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG3	HGNC	protein_coding	OTTHUMT00000254949.1		0.00	33	0	G	NM_001944		29056028	+1			no_errors	ENST00000257189	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.862	T
EBF3	253738	genome.wustl.edu	37	10	131757221	131757221	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:131757221C>T	ENST00000355311.5	-	5	534	c.462G>A	c.(460-462)ctG>ctA	p.L154L	EBF3_ENST00000368648.3_Silent_p.L154L			Q9H4W6	COE3_HUMAN	early B-cell factor 3	154					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CGTGGGTCAGCAGCACACGGC	0.711																																																	0													33.0	36.0	35.0					10																	131757221		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.462G>A	10.37:g.131757221C>T			A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.L154	ENST00000355311.5	37	c.462		10																																																																																			EBF3	-	NULL	ENSG00000108001		0.711	EBF3-001	KNOWN	basic|appris_principal	protein_coding	EBF3	HGNC	protein_coding	OTTHUMT00000051015.2		0.00	133	0	C	NM_001005463		131757221	-1			no_errors	ENST00000355311	ensembl	human	known	74_37	silent	5.38	88	5	SNP	1.000	T
EMILIN1	11117	genome.wustl.edu	37	2	27308035	27308035	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:27308035delG	ENST00000380320.4	+	7	3082	c.2583delG	c.(2581-2583)gagfs	p.E861fs	KHK_ENST00000260599.6_5'Flank|KHK_ENST00000260598.5_5'Flank	NM_007046.3	NP_008977	Q9Y6C2	EMIL1_HUMAN	elastin microfibril interfacer 1	861	Collagen-like.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(1)|lung(14)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	26	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGAGTGGAGGGGGCACCAG	0.642																																																	0													57.0	58.0	58.0					2																	27308035		2203	4300	6503	SO:0001589	frameshift_variant	0			AF088916	CCDS1733.1	2p23.3-p23.2	2008-02-05			ENSG00000138080	ENSG00000138080		"""EMI domain containing"""	19880	protein-coding gene	gene with protein product		130660					Standard	NM_007046		Approved	DKFZp586M121, gp115	uc002rii.4	Q9Y6C2	OTTHUMG00000097069	ENST00000380320.4:c.2583delG	2.37:g.27308035delG	ENSP00000369677:p.Glu861fs		A5PL03|H0Y7A0|Q53SY9|Q96G58|Q96IH6|Q9UG76	Frame_Shift_Del	DEL	pfam_EMI_domain,pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.A863fs	ENST00000380320.4	37	c.2583	CCDS1733.1	2																																																																																			EMILIN1	-	pfam_Collagen	ENSG00000138080		0.642	EMILIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN1	HGNC	protein_coding	OTTHUMT00000214185.1		0.00	35	0	G	NM_007046		27308035	+1	tier1		no_errors	ENST00000380320	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	0.887	-
HP09025	100652929	genome.wustl.edu	37	17	77681216	77681216	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr17:77681216G>T	ENST00000397549.2	+	0	142				MIR4739_ENST00000577633.1_RNA																							CCCAGTGCCTGAGATGAAAGA	0.667																																																	0																																												0																															17.37:g.77681216G>T				RNA	SNP	-	NULL	ENST00000397549.2	37	NULL		17	.	.	.	.	.	.	.	.	.	.	g	7.299	0.612732	0.14066	.	.	ENSG00000214105	ENST00000397549	.	.	.	1.6	0.511	0.16989	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3564	0.11181	0.221:0.0:0.779:0.0	.	.	.	.	L	47	.	.	X	+	2	2	AC105337.1	75295811	0.000000	0.05858	0.018000	0.16275	0.209000	0.24338	-0.436000	0.06922	0.201000	0.20466	0.298000	0.19748	TGA	CTD-2116F7.1	-	-	ENSG00000214105		0.667	CTD-2116F7.1-001	KNOWN	basic	lincRNA	ENSG00000214105	Clone_based_vega_gene	lincRNA	OTTHUMT00000437037.1	-	0.00	212	0	G			77681216	+1	tier1	-	no_errors	ENST00000397549	ensembl	human	known	74_37	rna	13.04	120	18	SNP	0.023	T
TCTN1	79600	genome.wustl.edu	37	12	111070425	111070425	+	Intron	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:111070425A>C	ENST00000551590.1	+	5	868				TCTN1_ENST00000397655.3_Intron|HVCN1_ENST00000548312.1_Intron|AC144522.1_ENST00000408319.1_RNA|TCTN1_ENST00000551555.2_Intron|TCTN1_ENST00000397659.4_Intron|TCTN1_ENST00000377654.3_Intron			Q2MV58	TECT1_HUMAN	tectonic family member 1						central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						gttggtggaaaagtagttgcg	0.358																																																	0																																										SO:0001627	intron_variant	0			AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.712+61A>C	12.37:g.111070425A>C			A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	RNA	SNP	-	NULL	ENST00000551590.1	37	NULL	CCDS41835.1	12																																																																																			AC144522.1	-	-	ENSG00000221246		0.358	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	ENSG00000221246	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000316016.2	-	0.00	60	0	A	NM_024549		111070425	+1	tier1	-	no_errors	ENST00000408319	ensembl	human	novel	74_37	rna	19.35	50	12	SNP	0.009	C
TPTE2P6	374491	genome.wustl.edu	37	13	25171389	25171389	+	RNA	DEL	A	A	-			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr13:25171389delA	ENST00000453498.1	+	0	1394				TPTE2P6_ENST00000440905.1_RNA																							ACTGAGACACAAAAAAGGGGC	0.433																																																	0																																												0																															13.37:g.25171389delA				RNA	DEL	-	NULL	ENST00000453498.1	37	NULL		13																																																																																			RP11-556N21.1	-	-	ENSG00000243008		0.433	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000243008	Clone_based_vega_gene	processed_transcript	OTTHUMT00000044193.1		0.00	37	0	A			25171389	+1	tier1		no_errors	ENST00000453498	ensembl	human	known	74_37	rna	5.56	34	2	DEL	0.008	-
CYFIP2	26999	genome.wustl.edu	37	5	156811453	156811453	+	Intron	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:156811453G>A	ENST00000521420.1	+	27	3220				CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000318218.6_Intron|CTB-47B11.3_ENST00000520658.1_RNA|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000522463.1_Intron|CTB-47B11.3_ENST00000508443.1_RNA|CYFIP2_ENST00000541131.1_Intron					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCATTCCGGCGGTCCTCTTTG	0.443																																																	0																																										SO:0001627	intron_variant	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.3129+1086G>A	5.37:g.156811453G>A				RNA	SNP	-	NULL	ENST00000521420.1	37	NULL		5	.	.	.	.	.	.	.	.	.	.	G	5.421	0.262774	0.10294	.	.	ENSG00000204823	ENST00000377571	.	.	.	2.05	-3.36	0.04913	.	.	.	.	.	T	0.35335	0.0928	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40997	-0.9533	5	0.87932	D	0	.	4.4223	0.11486	0.5501:0.188:0.2619:0.0	.	.	.	.	Q	126	.	ENSP00000366794:R126Q	R	+	2	0	AC008676.1	156744031	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-1.199000	0.03032	-1.176000	0.02747	-1.218000	0.01608	CGG	CTB-47B11.3	-	-	ENSG00000248544		0.443	CYFIP2-001	NOVEL	basic	protein_coding	ENSG00000248544	Clone_based_vega_gene	protein_coding	OTTHUMT00000373710.1	-	0.00	89	0	G	NM_001037332		156811453	-1	tier1	-	no_errors	ENST00000508443	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.000	A
AC005926.1	0	genome.wustl.edu	37	X	30333279	30333280	+	RNA	INS	-	-	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:30333279_30333280insC	ENST00000582731.1	-	0	15_16																											aattacttttgcaccaaactaa	0.287																																																	0																																												0																															X.37:g.30333280_30333280dupC				RNA	INS	-	NULL	ENST00000582731.1	37	NULL		X																																																																																			AC005926.1	-	-	ENSG00000266257		0.287	AC005926.1-201	NOVEL	basic	miRNA	ENSG00000266257	Clone_based_ensembl_gene	miRNA			0.00	15	0	-			30333280	-1	tier1		no_errors	ENST00000582731	ensembl	human	novel	74_37	rna	28.57	5	2	INS	0.014:0.011	C
EOMES	8320	genome.wustl.edu	37	3	27763406	27763408	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr3:27763406_27763408delGCG	ENST00000295743.4	-	1	581_583	c.378_380delCGC	c.(376-381)gccgcg>gcg	p.126_127AA>A	EOMES_ENST00000461503.1_Intron|EOMES_ENST00000449599.1_In_Frame_Del_p.126_127AA>A|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	126	Ala-rich.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						ggccgcagccgcggcggcggcgg	0.778																																																	0										85,33,494		40,0,5,13,7,241						-3.4	0.0		dbSNP_126	1	353,77,1382		157,0,39,28,21,661	no	codingComplex	EOMES	NM_005442.2		197,0,44,41,28,902	A1A1,A1A2,A1R,A2A2,A2R,RR		23.7307,19.281,22.6073				438,110,1876				SO:0001651	inframe_deletion	0			BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.378_380delCGC	3.37:g.27763415_27763417delGCG	ENSP00000295743:p.Ala130del		B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	In_Frame_Del	DEL	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A130in_frame_del	ENST00000295743.4	37	c.380_378	CCDS2646.1	3																																																																																			EOMES	-	NULL	ENSG00000163508		0.778	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	HGNC	protein_coding	OTTHUMT00000252995.1		0.00	12	0	GCG	NM_005442		27763408	-1			no_errors	ENST00000449599	ensembl	human	known	74_37	in_frame_del	33.33	4	2	DEL	0.013:0.007:0.006	0
FAHD2B	151313	genome.wustl.edu	37	2	97751910	97751910	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:97751910G>A	ENST00000414820.1	-	5	758	c.488C>T	c.(487-489)gCc>gTc	p.A163V	FAHD2B_ENST00000440566.2_Missense_Mutation_p.A163V|FAHD2B_ENST00000272610.3_Missense_Mutation_p.A163V|FAHD2B_ENST00000468548.1_5'Flank			Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing 2B	163							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.A163V(1)		kidney(5)|large_intestine(2)|lung(3)|skin(2)	12						AATGACCACGGCCAGCTCCAC	0.587																																																	1	Substitution - Missense(1)	skin(1)											75.0	54.0	61.0					2																	97751910		2203	4297	6500	SO:0001583	missense	0				CCDS2030.1	2q11.2	2012-06-29			ENSG00000144199	ENSG00000144199			25318	protein-coding gene	gene with protein product							Standard	NM_199336		Approved	DKFZp434N062	uc002sxm.3	Q6P2I3	OTTHUMG00000130533	ENST00000414820.1:c.488C>T	2.37:g.97751910G>A	ENSP00000410470:p.Ala163Val		D3DXH7|Q8NDK1	Missense_Mutation	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.A163V	ENST00000414820.1	37	c.488	CCDS2030.1	2	.	.	.	.	.	.	.	.	.	.	g	15.53	2.860223	0.51482	.	.	ENSG00000144199	ENST00000414820;ENST00000272610;ENST00000440566	D;D;D	0.97870	-4.58;-4.58;-4.58	0.624	0.624	0.17659	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.055877	0.64402	N	0.000001	D	0.96172	0.8752	L	0.44542	1.39	0.43678	D	0.996116	P	0.52692	0.955	P	0.56216	0.794	D	0.92921	0.6355	10	0.32370	T	0.25	.	7.0501	0.25069	1.0E-4:0.0:0.9999:0.0	.	163	Q6P2I3	FAH2B_HUMAN	V	163	ENSP00000410470:A163V;ENSP00000272610:A163V;ENSP00000444599:A163V	ENSP00000272610:A163V	A	-	2	0	FAHD2B	97115637	1.000000	0.71417	0.746000	0.31095	0.314000	0.28054	5.592000	0.67543	0.587000	0.29643	0.306000	0.20318	GCC	FAHD2B	-	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	ENSG00000144199		0.587	FAHD2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAHD2B	HGNC	protein_coding	OTTHUMT00000339482.1	-	0.00	88	0	G	NM_199336		97751910	-1	tier1	-	no_errors	ENST00000272610	ensembl	human	known	74_37	missense	15.00	51	9	SNP	1.000	A
FAM160B2	64760	genome.wustl.edu	37	8	21959806	21959806	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr8:21959806C>T	ENST00000289921.7	+	15	2018	c.1972C>T	c.(1972-1974)Cta>Tta	p.L658L		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	658										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						CTGCAGGAGCCTATTCTCCGT	0.637																																																	0													51.0	54.0	53.0					8																	21959806		2011	4156	6167	SO:0001819	synonymous_variant	0			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1972C>T	8.37:g.21959806C>T			B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Silent	SNP	pfam_RetinoicA-induced_16-like	p.L658	ENST00000289921.7	37	c.1972	CCDS6021.2	8																																																																																			FAM160B2	-	NULL	ENSG00000158863		0.637	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160B2	HGNC	protein_coding	OTTHUMT00000375334.2	-	0.00	85	0	C			21959806	+1	tier1	-	no_errors	ENST00000289921	ensembl	human	known	74_37	silent	17.65	56	12	SNP	1.000	T
FAM189A1	23359	genome.wustl.edu	37	15	29415678	29415678	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:29415678T>C	ENST00000261275.4	-	11	1483	c.1484A>G	c.(1483-1485)aAg>aGg	p.K495R		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	495						integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						TTCCAAAAACTTGGCCACCAA	0.612																																																	0													108.0	99.0	102.0					15																	29415678		692	1591	2283	SO:0001583	missense	0				CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.1484A>G	15.37:g.29415678T>C	ENSP00000261275:p.Lys495Arg		A0PK09	Missense_Mutation	SNP	pfam_CD20-like	p.K495R	ENST00000261275.4	37	c.1484	CCDS45198.1	15	.	.	.	.	.	.	.	.	.	.	T	15.21	2.766308	0.49574	.	.	ENSG00000104059	ENST00000261275	T	0.12774	2.65	5.36	5.36	0.76844	.	0.167975	0.50627	D	0.000105	T	0.15609	0.0376	L	0.54323	1.7	0.41963	D	0.990719	P	0.42409	0.779	B	0.42282	0.382	T	0.05582	-1.0876	10	0.09338	T	0.73	0.2404	14.5359	0.67960	0.0:0.0:0.0:1.0	.	495	O60320	F1891_HUMAN	R	495	ENSP00000261275:K495R	ENSP00000261275:K495R	K	-	2	0	FAM189A1	27202970	1.000000	0.71417	0.824000	0.32777	0.838000	0.47535	4.730000	0.62015	2.027000	0.59764	0.528000	0.53228	AAG	FAM189A1	-	NULL	ENSG00000104059		0.612	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A1	HGNC	protein_coding	OTTHUMT00000417254.1	-	0.00	95	0	T	NM_015307		29415678	-1	tier1	-	no_errors	ENST00000261275	ensembl	human	known	74_37	missense	12.28	50	7	SNP	1.000	C
FRMPD2	143162	genome.wustl.edu	37	10	49367277	49367277	+	Intron	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:49367277T>C	ENST00000374201.3	-	29	4184				FRMPD2_ENST00000305531.3_Intron|FRMPD2_ENST00000474573.1_Intron|FRMPD2_ENST00000407470.4_Intron|FRMPD2_ENST00000463706.1_5'UTR	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2						tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ggatttacagtatctctaaga	0.443																																																	0																																										SO:0001627	intron_variant	0			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.3882-1864A>G	10.37:g.49367277T>C			B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	RNA	SNP	-	NULL	ENST00000374201.3	37	NULL	CCDS31195.1	10																																																																																			FRMPD2	-	-	ENSG00000170324		0.443	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	-	0.00	126	0	T	NM_152428		49367277	-1	tier1	-	no_errors	ENST00000463706	ensembl	human	known	74_37	rna	15.79	80	15	SNP	0.000	C
FRYL	285527	genome.wustl.edu	37	4	48584704	48584704	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:48584704G>T	ENST00000503238.1	-	17	1795	c.1796C>A	c.(1795-1797)aCt>aAt	p.T599N	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000506685.1_Missense_Mutation_p.T305N|FRYL_ENST00000358350.4_Missense_Mutation_p.T599N|FRYL_ENST00000537810.1_Missense_Mutation_p.T599N|FRYL_ENST00000507711.1_Missense_Mutation_p.T599N			O94915	FRYL_HUMAN	FRY-like	599					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TGCCTGCAGAGTATTGAAAGC	0.388																																																	0													101.0	95.0	97.0					4																	48584704		1863	4108	5971	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1796C>A	4.37:g.48584704G>T	ENSP00000426064:p.Thr599Asn		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T599N	ENST00000503238.1	37	c.1796	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628487	0.87560	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T;T	0.67171	3.53;3.53;3.53;3.53;-0.25	5.63	5.63	0.86233	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.74688	0.3749	L	0.27053	0.805	0.80722	D	1	D;P	0.62365	0.991;0.891	D;P	0.76071	0.987;0.781	T	0.76542	-0.2921	10	0.66056	D	0.02	.	20.0499	0.97621	0.0:0.0:1.0:0.0	.	599;599	F2Z2S2;O94915	.;FRYL_HUMAN	N	599;599;599;599;305	ENSP00000426064:T599N;ENSP00000351113:T599N;ENSP00000441114:T599N;ENSP00000421584:T599N;ENSP00000425592:T305N	ENSP00000351113:T599N	T	-	2	0	FRYL	48279461	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.420000	0.97426	2.798000	0.96311	0.655000	0.94253	ACT	FRYL	-	superfamily_ARM-type_fold	ENSG00000075539		0.388	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	57	0	G			48584704	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
FUZ	80199	genome.wustl.edu	37	19	50310555	50310555	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:50310555delC	ENST00000313777.4	-	11	1273	c.1110delG	c.(1108-1110)gggfs	p.G370fs	FUZ_ENST00000445575.2_Intron|FUZ_ENST00000528094.1_Frame_Shift_Del_p.G334fs|AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000533418.1_Frame_Shift_Del_p.G320fs	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	370	Leu-rich.				cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		GTTCCTCAGTCCCCAACACCA	0.637																																																	0													59.0	53.0	55.0					19																	50310555		2203	4300	6503	SO:0001589	frameshift_variant	0			BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.1110delG	19.37:g.50310555delC	ENSP00000313309:p.Gly370fs		B2RD86|B5MDH0|Q6PJY0|Q9H613	Frame_Shift_Del	DEL	NULL	p.T371fs	ENST00000313777.4	37	c.1110	CCDS12781.1	19																																																																																			FUZ	-	NULL	ENSG00000010361		0.637	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUZ	HGNC	protein_coding	OTTHUMT00000393986.1		0.00	53	0	C	NM_025129		50310555	-1	tier1		no_errors	ENST00000313777	ensembl	human	known	74_37	frame_shift_del	11.76	30	4	DEL	0.035	-
GAB1	2549	genome.wustl.edu	37	4	144354697	144354697	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:144354697G>A	ENST00000262994.4	+	3	723	c.421G>A	c.(421-423)Gct>Act	p.A141T	GAB1_ENST00000262995.4_Missense_Mutation_p.A141T|GAB1_ENST00000505913.1_Missense_Mutation_p.A38T	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	141					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					TTTACCTTTAGCTATAAATAC	0.443																																																	0													144.0	125.0	131.0					4																	144354697		2203	4300	6503	SO:0001583	missense	0			U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.421G>A	4.37:g.144354697G>A	ENSP00000262994:p.Ala141Thr		A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A141T	ENST00000262994.4	37	c.421	CCDS3759.1	4	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452585	0.43531	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000514639;ENST00000515366;ENST00000505913;ENST00000509992	T;T;T;T;T	0.30182	2.77;2.77;1.54;2.26;1.54	5.91	3.11	0.35812	.	0.587198	0.19071	N	0.123503	T	0.17492	0.0420	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.21177	-1.0253	10	0.15499	T	0.54	-0.5925	12.8754	0.57988	0.0654:0.5052:0.4294:0.0	.	141;141	Q13480;Q13480-2	GAB1_HUMAN;.	T	141;141;141;38;38;120	ENSP00000262995:A141T;ENSP00000262994:A141T;ENSP00000427435:A141T;ENSP00000424554:A38T;ENSP00000425921:A120T	ENSP00000262994:A141T	A	+	1	0	GAB1	144574147	0.039000	0.19947	0.005000	0.12908	0.252000	0.25951	0.461000	0.21940	0.319000	0.23209	0.655000	0.94253	GCT	GAB1	-	NULL	ENSG00000109458		0.443	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB1	HGNC	protein_coding	OTTHUMT00000364998.1	-	0.00	74	0	G	NM_002039		144354697	+1	tier1	-	no_errors	ENST00000262995	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.040	A
GGTLC3	728226	genome.wustl.edu	37	22	20366476	20366476	+	Silent	SNP	G	G	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr22:20366476G>C	ENST00000404912.1	-	6	702	c.570C>G	c.(568-570)acC>acG	p.T190T	GGTLC3_ENST00000424787.2_Silent_p.T201T			B5MD39	GGTL3_HUMAN	gamma-glutamyltransferase light chain 3	190					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)			lung(1)	1						ATGCGATCTGGGTGTGATGGT	0.657																																																	0																																										SO:0001819	synonymous_variant	0			L10397		22q11.21	2014-04-10			ENSG00000183038	ENSG00000274252		"""Gamma-glutamyltransferases"""	33426	other	unknown		612340				18357469	Standard	NG_011826		Approved			B5MD39	OTTHUMG00000188352	ENST00000404912.1:c.570C>G	22.37:g.20366476G>C			A6NEA2	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.T190	ENST00000404912.1	37	c.570		22																																																																																			GGTLC3	-	pfam_GGT_peptidase	ENSG00000183038		0.657	GGTLC3-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GGTLC3	HGNC	protein_coding	OTTHUMT00000319077.1	-	0.00	76	0	G	XM_001128310		20366476	-1	tier1	-	no_errors	ENST00000404912	ensembl	human	known	74_37	silent	24.68	58	19	SNP	0.470	C
GHDC	84514	genome.wustl.edu	37	17	40342279	40342279	+	Missense_Mutation	SNP	G	G	T	rs138138681	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr17:40342279G>T	ENST00000301671.8	-	8	1739	c.1298C>A	c.(1297-1299)gCg>gAg	p.A433E	GHDC_ENST00000414034.3_Silent_p.R463R|GHDC_ENST00000428494.2_Missense_Mutation_p.A394E|GHDC_ENST00000587427.1_Missense_Mutation_p.A433E|GHDC_ENST00000436923.2_Silent_p.R463R|GHDC_ENST00000593209.1_Missense_Mutation_p.A433E|GHDC_ENST00000590520.1_5'Flank			Q8N2G8	GHDC_HUMAN	GH3 domain containing	433						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		AGCAGAGCCCGCAGAGGAATC	0.547																																																	0													105.0	97.0	100.0					17																	40342279		2203	4300	6503	SO:0001583	missense	0			AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.1298C>A	17.37:g.40342279G>T	ENSP00000301671:p.Ala433Glu		B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	pfam_GH3	p.A433E	ENST00000301671.8	37	c.1298	CCDS11422.1	17	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.318127	0.00235	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000301671	.	.	.	4.6	-0.384	0.12474	.	0.428709	0.24708	N	0.036254	T	0.11324	0.0276	.	.	.	0.18873	N	0.999987	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.20240	-1.0281	8	0.06757	T	0.87	-1.1605	1.6576	0.02785	0.1517:0.369:0.163:0.3163	.	394;433	E9PDB5;Q8N2G8	.;GHDC_HUMAN	E	377;394;433	.	ENSP00000301671:A433E	A	-	2	0	GHDC	37595805	0.005000	0.15991	0.029000	0.17559	0.030000	0.12068	1.254000	0.32897	-0.274000	0.09232	-1.334000	0.01262	GCG	GHDC	-	pfam_GH3	ENSG00000167925		0.547	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GHDC	HGNC	protein_coding	OTTHUMT00000449794.1		0.00	49	0	G	NM_032484		40342279	-1			no_errors	ENST00000301671	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.120	T
GNAI2	2771	genome.wustl.edu	37	3	50294505	50294505	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr3:50294505G>A	ENST00000313601.6	+	7	1244	c.860G>A	c.(859-861)tGc>tAc	p.C287Y	GNAI2_ENST00000451956.1_Missense_Mutation_p.C250Y|GNAI2_ENST00000440628.1_Missense_Mutation_p.C235Y|GNAI2_ENST00000422163.1_Missense_Mutation_p.C271Y|GNAI2_ENST00000266027.5_Missense_Mutation_p.C271Y|GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000536647.1_Missense_Mutation_p.C206Y	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2	287					activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		CTGACCATCTGCTTCCCTGAG	0.547											OREG0015582	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													124.0	107.0	113.0					3																	50294505		2203	4300	6503	SO:0001583	missense	0			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.860G>A	3.37:g.50294505G>A	ENSP00000312999:p.Cys287Tyr	968	B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I,prints_Fungi_Gprotein_alpha	p.C287Y	ENST00000313601.6	37	c.860	CCDS2813.1	3	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516970	0.85495	.	.	ENSG00000114353	ENST00000422163;ENST00000313601;ENST00000536647;ENST00000540560;ENST00000440628;ENST00000451956;ENST00000266027	D;D;D;D;D;D	0.86097	-2.07;-2.07;-2.07;-2.07;-2.07;-2.07	4.49	4.49	0.54785	.	0.093138	0.85682	D	0.000000	D	0.89269	0.6667	L	0.46614	1.455	0.80722	D	1	D;B;D;D	0.89917	1.0;0.356;1.0;1.0	D;P;D;D	0.87578	0.998;0.627;0.998;0.995	D	0.88885	0.3342	10	0.46703	T	0.11	.	15.0757	0.72074	0.0:0.0:1.0:0.0	.	250;287;271;271	B4DYA0;P04899;B3KTZ0;P04899-2	.;GNAI2_HUMAN;.;.	Y	271;287;206;287;235;250;271	ENSP00000406871:C271Y;ENSP00000312999:C287Y;ENSP00000444360:C206Y;ENSP00000395736:C235Y;ENSP00000406369:C250Y;ENSP00000266027:C271Y	ENSP00000266027:C271Y	C	+	2	0	GNAI2	50269509	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.596000	0.98267	2.522000	0.85027	0.655000	0.94253	TGC	GNAI2	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su,prints_Gprotein_alpha_I,prints_Fungi_Gprotein_alpha	ENSG00000114353		0.547	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	HGNC	protein_coding	OTTHUMT00000346688.1	-	0.00	25	0	G	NM_002070		50294505	+1	tier1	-	no_errors	ENST00000313601	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	A
GNB2L1	10399	genome.wustl.edu	37	5	180670803	180670803	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:180670803C>T	ENST00000512805.1	-	0	406				SNORD95_ENST00000579879.1_RNA|SNORD96A_ENST00000606577.1_RNA|GNB2L1_ENST00000511900.1_5'UTR|GNB2L1_ENST00000511566.1_5'UTR|GNB2L1_ENST00000504726.1_5'UTR|GNB2L1_ENST00000376817.4_5'UTR|CTC-338M12.4_ENST00000506340.1_RNA|GNB2L1_ENST00000505461.1_5'UTR|GNB2L1_ENST00000456394.2_5'UTR|CTC-338M12.4_ENST00000511331.1_RNA	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		TCAGTCATGGCGGCGGCGAGA	0.607																																																	0													92.0	66.0	75.0					5																	180670803		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.-3G>A	5.37:g.180670803C>T			B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	RNA	SNP	-	NULL	ENST00000512805.1	37	NULL	CCDS34324.1	5																																																																																			GNB2L1	-	-	ENSG00000204628		0.607	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	GNB2L1	HGNC	protein_coding	OTTHUMT00000372943.2	-	0.00	77	0	C	NM_006098		180670803	-1	tier1	-	no_errors	ENST00000503170	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.023	T
GPR133	283383	genome.wustl.edu	37	12	131439027	131439027	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:131439027G>A	ENST00000261654.5	+	1	576	c.17G>A	c.(16-18)cGg>cAg	p.R6Q	GPR133_ENST00000535015.1_Missense_Mutation_p.R6Q	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	6					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		AAGCTGCTGCGGCTGTGCTGC	0.537																																																	0													67.0	66.0	67.0					12																	131439027		2203	4300	6503	SO:0001583	missense	0			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.17G>A	12.37:g.131439027G>A	ENSP00000261654:p.Arg6Gln		B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.R6Q	ENST00000261654.5	37	c.17	CCDS9272.1	12	.	.	.	.	.	.	.	.	.	.	G	12.03	1.815531	0.32145	.	.	ENSG00000111452	ENST00000261654;ENST00000543826;ENST00000542091;ENST00000535015	T;T	0.40225	1.06;1.04	4.41	-1.34	0.09143	.	1.932270	0.02920	N	0.137890	T	0.24160	0.0585	N	0.22421	0.69	0.09310	N	1	B;B	0.31459	0.324;0.058	B;B	0.16289	0.015;0.015	T	0.11421	-1.0588	10	0.48119	T	0.1	.	2.618	0.04908	0.1362:0.2617:0.4212:0.181	.	6;6	B7ZLF7;Q6QNK2	.;GP133_HUMAN	Q	6	ENSP00000261654:R6Q;ENSP00000444425:R6Q	ENSP00000261654:R6Q	R	+	2	0	GPR133	130004980	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.397000	0.20883	-0.260000	0.09418	-0.304000	0.09214	CGG	GPR133	-	NULL	ENSG00000111452		0.537	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	HGNC	protein_coding	OTTHUMT00000399356.1	-	0.00	88	0	G	NM_198827		131439027	+1	tier1	-	no_errors	ENST00000261654	ensembl	human	known	74_37	missense	14.29	54	9	SNP	0.000	A
GPRC6A	222545	genome.wustl.edu	37	6	117127659	117127659	+	Silent	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr6:117127659G>A	ENST00000310357.3	-	3	1230	c.1209C>T	c.(1207-1209)ctC>ctT	p.L403L	GPRC6A_ENST00000368549.3_Silent_p.L403L|GPRC6A_ENST00000530250.1_Intron	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	403					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CATAGTCCCAGAGGAAGTCAT	0.443																																																	0													121.0	108.0	112.0					6																	117127659		2203	4299	6502	SO:0001819	synonymous_variant	0			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1209C>T	6.37:g.117127659G>A			Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.L403	ENST00000310357.3	37	c.1209	CCDS5112.1	6																																																																																			GPRC6A	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000173612		0.443	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	HGNC	protein_coding	OTTHUMT00000041966.2	-	0.00	97	0	G			117127659	-1	tier1	-	no_errors	ENST00000310357	ensembl	human	known	74_37	silent	9.88	73	8	SNP	0.113	A
GRIA1	2890	genome.wustl.edu	37	5	153149892	153149892	+	Silent	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:153149892G>T	ENST00000285900.5	+	13	2530	c.2187G>T	c.(2185-2187)cgG>cgT	p.R729R	GRIA1_ENST00000448073.4_Silent_p.R739R|GRIA1_ENST00000518142.1_Silent_p.R649R|GRIA1_ENST00000518783.1_Silent_p.R739R|GRIA1_ENST00000340592.5_Silent_p.R729R|GRIA1_ENST00000521843.2_Silent_p.R660R	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	729					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TTGAGCAGCGGAAACCCTGTG	0.507																																																	0													113.0	96.0	101.0					5																	153149892		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2187G>T	5.37:g.153149892G>T			B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R739	ENST00000285900.5	37	c.2217	CCDS4322.1	5																																																																																			GRIA1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000155511		0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	-	0.00	92	0	G			153149892	+1	tier1	-	no_errors	ENST00000448073	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	T
H2AFV	94239	genome.wustl.edu	37	7	44874113	44874113	+	Missense_Mutation	SNP	T	T	C	rs1802437		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:44874113T>C	ENST00000308153.4	-	5	465	c.374A>G	c.(373-375)cAg>cGg	p.Q125R	H2AFV_ENST00000381124.5_3'UTR|H2AFV_ENST00000349299.3_Missense_Mutation_p.Q87R|H2AFV_ENST00000521529.1_3'UTR|H2AFV_ENST00000350771.3_Missense_Mutation_p.Q99R|H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000222690.6_Intron	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	125			Q -> R (in dbSNP:rs1802437).			extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						AGCAGTTTTCTGCTGTCCCTT	0.373																																																	0													90.0	79.0	83.0					7																	44874113		2203	4300	6503	SO:0001583	missense	0			AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.374A>G	7.37:g.44874113T>C	ENSP00000308405:p.Gln125Arg		A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.Q125R	ENST00000308153.4	37	c.374	CCDS5496.1	7	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461982	0.63513	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.82619	0.93;-1.63;0.94	5.91	5.91	0.95273	Histone-fold (1);Histone H2A (1);	.	.	.	.	T	0.71600	0.3359	N	0.17474	0.49	0.80722	D	1	B;B;P	0.41673	0.0;0.029;0.759	B;B;B	0.37267	0.001;0.009;0.245	T	0.76405	-0.2971	9	0.59425	D	0.04	-19.8855	14.2973	0.66321	0.0:0.0:0.0:1.0	rs1802437	99;87;125	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	R	87;125;99	ENSP00000342714:Q87R;ENSP00000308405:Q125R;ENSP00000340708:Q99R	ENSP00000308405:Q125R	Q	-	2	0	H2AFV	44840638	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.465000	0.80898	2.261000	0.74972	0.533000	0.62120	CAG	H2AFV	-	smart_Histone_H2A	ENSG00000105968		0.373	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	H2AFV	HGNC	protein_coding	OTTHUMT00000251305.1		0.00	103	0	T	NM_012412		44874113	-1			no_errors	ENST00000308153	ensembl	human	known	74_37	missense	8.45	65	6	SNP	1.000	C
HERC2	8924	genome.wustl.edu	37	15	28421704	28421704	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:28421704C>T	ENST00000261609.7	-	63	9664	c.9556G>A	c.(9556-9558)Ggc>Agc	p.G3186S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCGCCCCGGCCCAGTTTTCCA	0.498																																																	0													79.0	88.0	85.0					15																	28421704		2203	4300	6503	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9556G>A	15.37:g.28421704C>T	ENSP00000261609:p.Gly3186Ser			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.G3186S	ENST00000261609.7	37	c.9556	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.503699	0.96371	.	.	ENSG00000128731	ENST00000261609	D	0.98732	-5.1	5.65	5.65	0.86999	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.99625	0.9863	H	0.99475	4.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97415	1.0005	10	0.87932	D	0	.	19.7107	0.96095	0.0:1.0:0.0:0.0	.	3186	O95714	HERC2_HUMAN	S	3186	ENSP00000261609:G3186S	ENSP00000261609:G3186S	G	-	1	0	HERC2	26095299	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.487000	0.81328	2.659000	0.90383	0.585000	0.79938	GGC	HERC2	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000128731		0.498	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	259	0	C	NM_004667		28421704	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	16.06	183	35	SNP	1.000	T
HERC6	55008	genome.wustl.edu	37	4	89319299	89319299	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:89319299G>A	ENST00000264346.7	+	8	1089	c.1030G>A	c.(1030-1032)Gtg>Atg	p.V344M	HERC6_ENST00000380265.5_Missense_Mutation_p.V344M	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	344					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		TTTAGACTTCGTGGATGTTCA	0.294																																																	0													76.0	73.0	74.0					4																	89319299		1815	4068	5883	SO:0001583	missense	0			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1030G>A	4.37:g.89319299G>A	ENSP00000264346:p.Val344Met		B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.V344M	ENST00000264346.7	37	c.1030	CCDS47098.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.529|9.529	1.110295|1.110295	0.20714|0.20714	.|.	.|.	ENSG00000138642|ENSG00000138642	ENST00000438983|ENST00000380265;ENST00000511939;ENST00000264346	.|T;T	.|0.80304	.|-1.36;-1.36	4.57|4.57	2.66|2.66	0.31614|0.31614	.|Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (1);	.|1.208980	.|0.05987	.|N	.|0.645448	D|D	0.83505|0.83505	0.5269|0.5269	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	1|1	.|D;D	.|0.69078	.|0.997;0.996	.|P;P	.|0.54499	.|0.754;0.572	T|T	0.68059|0.68059	-0.5509|-0.5509	6|10	0.02654|0.42905	T|T	1|0.14	.|.	7.8843|7.8843	0.29640|0.29640	0.2247:0.0:0.7753:0.0|0.2247:0.0:0.7753:0.0	.|.	.|344;344	.|Q8IVU3-2;Q8IVU3	.|.;HERC6_HUMAN	H|M	298|344	.|ENSP00000369617:V344M;ENSP00000264346:V344M	ENSP00000415718:R298H|ENSP00000264346:V344M	R|V	+|+	2|1	0|0	HERC6|HERC6	89538322|89538322	0.002000|0.002000	0.14202|0.14202	0.539000|0.539000	0.28077|0.28077	0.717000|0.717000	0.41224|0.41224	0.323000|0.323000	0.19593|0.19593	1.148000|1.148000	0.42385|0.42385	0.297000|0.297000	0.19635|0.19635	CGT|GTG	HERC6	-	superfamily_RCC1/BLIP-II	ENSG00000138642		0.294	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2	-	0.00	67	0	G			89319299	+1	tier1	-	no_errors	ENST00000264346	ensembl	human	known	74_37	missense	23.53	39	12	SNP	0.037	A
HNRNPA2B1	3181	genome.wustl.edu	37	7	26233231	26233231	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:26233231C>T	ENST00000354667.4	-	9	1009	c.841G>A	c.(841-843)Ggg>Agg	p.G281R	HNRNPA2B1_ENST00000476233.1_5'Flank|HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.G269R	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	281	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						CCGTAGCCCCCACCCTGGTTG	0.458			T	ETV1	prostate																																			Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	0													113.0	110.0	111.0					7																	26233231		2203	4300	6503	SO:0001583	missense	0			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.841G>A	7.37:g.26233231C>T	ENSP00000346694:p.Gly281Arg		A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.G281R	ENST00000354667.4	37	c.841	CCDS43557.1	7	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315197	0.60524	.	.	ENSG00000122566	ENST00000354667;ENST00000356674	D;D	0.86627	-2.15;-2.15	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000001	D	0.92140	0.7508	M	0.67569	2.06	0.50039	D	0.999841	D;D	0.62365	0.989;0.991	D;P	0.66847	0.947;0.887	D	0.87852	0.2658	10	0.15066	T	0.55	.	20.2544	0.98414	0.0:1.0:0.0:0.0	.	269;281	P22626-2;P22626	.;ROA2_HUMAN	R	281;269	ENSP00000346694:G281R;ENSP00000349101:G269R	ENSP00000346694:G281R	G	-	1	0	HNRNPA2B1	26199756	1.000000	0.71417	1.000000	0.80357	0.334000	0.28698	7.416000	0.80143	2.885000	0.99019	0.655000	0.94253	GGG	HNRNPA2B1	-	NULL	ENSG00000122566		0.458	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	HNRNPA2B1	HGNC	protein_coding	OTTHUMT00000214109.1	-	0.00	139	0	C	NM_002137		26233231	-1	tier1	-	no_errors	ENST00000354667	ensembl	human	known	74_37	missense	8.04	103	9	SNP	1.000	T
HPCA	3208	genome.wustl.edu	37	1	33354763	33354763	+	Silent	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:33354763G>A	ENST00000373467.3	+	2	366	c.264G>A	c.(262-264)gcG>gcA	p.A88A	HPCA_ENST00000480118.1_3'UTR	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin	88	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				TCATCATTGCGCTGAGCGTGA	0.587																																																	0													120.0	109.0	113.0					1																	33354763		2203	4300	6503	SO:0001819	synonymous_variant	0			BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.264G>A	1.37:g.33354763G>A			B2R9T3|D3DPQ7|P32076|P41211|P70510	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.A88	ENST00000373467.3	37	c.264	CCDS370.1	1																																																																																			HPCA	-	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	ENSG00000121905		0.587	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCA	HGNC	protein_coding	OTTHUMT00000011480.1	-	0.00	45	0	G	NM_002143		33354763	+1	tier1	-	no_errors	ENST00000373467	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.589	A
IGSF1	3547	genome.wustl.edu	37	X	130409498	130409498	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:130409498A>C	ENST00000361420.3	-	16	3217	c.3138T>G	c.(3136-3138)agT>agG	p.S1046R	IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Missense_Mutation_p.S1051R|IGSF1_ENST00000370910.1_Missense_Mutation_p.S1037R|IGSF1_ENST00000370904.1_Missense_Mutation_p.S1037R			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1046	Ig-like C2-type 10.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TCTTGATAGAACTGGTCCAGT	0.517																																																	0													160.0	136.0	144.0					X																	130409498		2203	4300	6503	SO:0001583	missense	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3138T>G	X.37:g.130409498A>C	ENSP00000355010:p.Ser1046Arg		B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S1051R	ENST00000361420.3	37	c.3153	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	A	12.54	1.967801	0.34754	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.15487	2.42;2.42;2.42;2.42	5.32	0.793	0.18632	Immunoglobulin-like fold (1);	0.112822	0.40728	N	0.001033	T	0.23886	0.0578	L	0.40543	1.245	0.09310	N	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.79784	0.976;0.978;0.993	T	0.06232	-1.0838	10	0.87932	D	0	.	2.9909	0.05982	0.4052:0.0:0.3979:0.1969	.	1037;490;1046	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	R	1037;1046;1037;1051	ENSP00000359947:S1037R;ENSP00000355010:S1046R;ENSP00000359941:S1037R;ENSP00000359940:S1051R	ENSP00000355010:S1046R	S	-	3	2	IGSF1	130237179	0.155000	0.22806	0.048000	0.18961	0.706000	0.40770	0.431000	0.21444	0.151000	0.19162	-0.287000	0.09952	AGT	IGSF1	-	smart_Ig_sub	ENSG00000147255		0.517	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	-	0.00	45	0	A			130409498	-1	tier1	-	no_errors	ENST00000370903	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.011	C
INPP4A	3631	genome.wustl.edu	37	2	99172218	99172218	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:99172218C>A	ENST00000523221.1	+	15	1784	c.1784C>A	c.(1783-1785)tCa>tAa	p.S595*	INPP4A_ENST00000074304.5_Nonsense_Mutation_p.S595*|INPP4A_ENST00000409540.3_Intron|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000545415.1_Intron|INPP4A_ENST00000409016.4_Intron|INPP4A_ENST00000409851.3_Nonsense_Mutation_p.S590*			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	595					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GTCCCCTCCTCACCATGCCCC	0.577																																																	0													232.0	240.0	237.0					2																	99172218		692	1591	2283	SO:0001587	stop_gained	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1784C>A	2.37:g.99172218C>A	ENSP00000427722:p.Ser595*		O15326|Q13187|Q53TD8|Q8TC02	Nonsense_Mutation	SNP	superfamily_C2_dom	p.S595*	ENST00000523221.1	37	c.1784	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	C	41	9.096505	0.99064	.	.	ENSG00000040933	ENST00000409851;ENST00000074304;ENST00000523221	.	.	.	5.27	5.27	0.74061	.	0.277119	0.27159	N	0.020659	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-8.9563	18.0416	0.89320	0.0:1.0:0.0:0.0	.	.	.	.	X	590;595;595	.	.	S	+	2	0	INPP4A	98538650	1.000000	0.71417	0.980000	0.43619	0.990000	0.78478	6.412000	0.73303	2.748000	0.94277	0.655000	0.94253	TCA	INPP4A	-	NULL	ENSG00000040933		0.577	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	-	0.00	48	0	C	NM_001566		99172218	+1	tier1	-	no_errors	ENST00000074304	ensembl	human	known	74_37	nonsense	15.15	28	5	SNP	0.999	A
ITGAX	3687	genome.wustl.edu	37	16	31368637	31368637	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr16:31368637C>T	ENST00000268296.4	+	5	503	c.382C>T	c.(382-384)Ctc>Ttc	p.L128F	ITGAX_ENST00000562918.1_Intron|ITGAX_ENST00000562522.1_Missense_Mutation_p.L128F	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	128					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						ACTCTGCTTCCTCCTGGGCCC	0.682																																																	0													25.0	21.0	23.0					16																	31368637		2196	4300	6496	SO:0001583	missense	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.382C>T	16.37:g.31368637C>T	ENSP00000268296:p.Leu128Phe		Q8IVA6	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.L128F	ENST00000268296.4	37	c.382	CCDS10711.1	16	.	.	.	.	.	.	.	.	.	.	C	20.6	4.012622	0.75161	.	.	ENSG00000140678	ENST00000268296	T	0.79033	-1.23	4.99	2.97	0.34412	.	.	.	.	.	D	0.85504	0.5712	M	0.83603	2.65	0.26566	N	0.973643	D	0.69078	0.997	P	0.61070	0.883	T	0.75172	-0.3411	9	0.59425	D	0.04	.	9.6941	0.40147	0.1547:0.6945:0.1508:0.0	.	128	P20702	ITAX_HUMAN	F	128	ENSP00000268296:L128F	ENSP00000268296:L128F	L	+	1	0	ITGAX	31276138	0.516000	0.26218	0.947000	0.38551	0.069000	0.16628	0.498000	0.22530	2.601000	0.87937	0.585000	0.79938	CTC	ITGAX	-	NULL	ENSG00000140678		0.682	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	-	0.00	82	0	C	NM_000887		31368637	+1	tier1	-	no_errors	ENST00000268296	ensembl	human	known	74_37	missense	17.02	39	8	SNP	0.848	T
JPH3	57338	genome.wustl.edu	37	16	87723837	87723838	+	Frame_Shift_Ins	INS	-	-	C	rs34767155	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr16:87723837_87723838insC	ENST00000284262.2	+	4	2113_2114	c.1871_1872insC	c.(1870-1875)catcccfs	p.P625fs	JPH3_ENST00000563609.1_3'UTR	NM_020655.2	NP_065706.2	Q8WXH2	JPH3_HUMAN	junctophilin 3	625					calcium ion transport into cytosol (GO:0060402)|exploration behavior (GO:0035640)|learning (GO:0007612)|locomotion (GO:0040011)|memory (GO:0007613)|neuromuscular process controlling balance (GO:0050885)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)	calcium-release channel activity (GO:0015278)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(80;0.0287)		ATGGAGACGCATCCCCAGAAAA	0.658																																																	0																																										SO:0001589	frameshift_variant	0			AB042636	CCDS10962.1	16q24.3	2008-02-05	2002-11-13		ENSG00000154118	ENSG00000154118			14203	protein-coding gene	gene with protein product		605268	"""trinucleotide repeat containing 22"""	TNRC22		10949023, 10891348	Standard	NM_020655		Approved	JP-3, CAGL237, HDL2, JP3	uc002fkd.4	Q8WXH2	OTTHUMG00000137656	Exception_encountered	16.37:g.87723837_87723838insC	ENSP00000284262:p.Pro625fs		D3DUN2|Q8N471|Q9HDC3|Q9HDC4	Frame_Shift_Ins	INS	pirsf_Junctophilin,pfam_MORN,smart_MORN	p.P625fs	ENST00000284262.2	37	c.1871_1872	CCDS10962.1	16																																																																																			JPH3	-	pirsf_Junctophilin	ENSG00000154118		0.658	JPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH3	HGNC	protein_coding	OTTHUMT00000269108.2		0.00	96	0	0			87723838	+1			no_errors	ENST00000284262	ensembl	human	known	74_37	frame_shift_ins	6.25	60	4	INS	1.000:1.000	C
KCNH2	3757	genome.wustl.edu	37	7	150647326	150647326	+	Silent	SNP	G	G	A	rs8179015		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:150647326G>A	ENST00000262186.5	-	9	2729	c.2328C>T	c.(2326-2328)ctC>ctT	p.L776L	KCNH2_ENST00000330883.4_Silent_p.L436L|KCNH2_ENST00000430723.3_Silent_p.L776L|KCNH2_ENST00000392968.2_Silent_p.L680L	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	776					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	ACAGGGCGGTGAGCAGGTCCC	0.672																																					GBM(137;110 1844 13671 20123 45161)												0													89.0	71.0	77.0					7																	150647326		2203	4300	6503	SO:0001819	synonymous_variant	0			U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.2328C>T	7.37:g.150647326G>A			A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_cNMP-bd_dom,pfam_PAS_fold,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.L776	ENST00000262186.5	37	c.2328	CCDS5910.1	7																																																																																			KCNH2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000055118		0.672	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH2	HGNC	protein_coding	OTTHUMT00000350741.2	-	0.00	86	0	G	NM_000238		150647326	-1	tier1	-	no_errors	ENST00000262186	ensembl	human	known	74_37	silent	11.11	56	7	SNP	1.000	A
KCNK2	3776	genome.wustl.edu	37	1	215256745	215256745	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:215256745C>T	ENST00000444842.2	+	1	167	c.17C>T	c.(16-18)tCg>tTg	p.S6L	KCNK2_ENST00000391895.2_Intron|KCNK2_ENST00000391894.2_Intron	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	6					G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)	p.S6W(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	CCCAGCGCCTCGCGGGAGAGA	0.547																																																	2	Substitution - Missense(2)	urinary_tract(2)											67.0	76.0	73.0					1																	215256745		2203	4300	6503	SO:0001583	missense	0			AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.17C>T	1.37:g.215256745C>T	ENSP00000394033:p.Ser6Leu		A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.S6L	ENST00000444842.2	37	c.17	CCDS41467.1	1	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707250	0.48412	.	.	ENSG00000082482	ENST00000444842	T	0.21191	2.02	4.27	1.18	0.20946	.	0.933707	0.08889	N	0.878957	T	0.15609	0.0376	N	0.22421	0.69	0.23594	N	0.997333	P	0.44241	0.829	B	0.40134	0.32	T	0.23404	-1.0189	10	0.39692	T	0.17	.	11.786	0.52043	0.0:0.4634:0.5366:0.0	.	6	O95069	KCNK2_HUMAN	L	6	ENSP00000394033:S6L	ENSP00000394033:S6L	S	+	2	0	KCNK2	213323368	0.083000	0.21467	0.998000	0.56505	0.998000	0.95712	0.229000	0.17833	0.061000	0.16311	0.655000	0.94253	TCG	KCNK2	-	NULL	ENSG00000082482		0.547	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK2	HGNC	protein_coding	OTTHUMT00000089856.2	-	0.00	83	0	C	NM_014217		215256745	+1	tier1	-	no_errors	ENST00000444842	ensembl	human	known	74_37	missense	8.47	54	5	SNP	1.000	T
KMT2E	55904	genome.wustl.edu	37	7	104702724	104702724	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:104702724C>T	ENST00000311117.3	+	4	730	c.185C>T	c.(184-186)gCg>gTg	p.A62V	KMT2E_ENST00000257745.4_Splice_Site_p.A62V|KMT2E_ENST00000334877.4_Splice_Site_p.A62V|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000476671.1_Splice_Site_p.A62V	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	62					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTGCCCTATGCGGTAAGTGTT	0.383																																																	0													128.0	117.0	121.0					7																	104702724		2203	4300	6503	SO:0001630	splice_region_variant	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.186+1C>T	7.37:g.104702724C>T			B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.A62V	ENST00000311117.3	37	c.185	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.643767	0.96704	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000495267;ENST00000476671;ENST00000474203	D;D;D;T;D	0.94457	-3.08;-2.67;-3.08;1.36;-3.43	5.9	5.9	0.94986	.	0.053521	0.85682	D	0.000000	D	0.96522	0.8865	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.987	D	0.96486	0.9360	10	0.72032	D	0.01	.	20.2786	0.98501	0.0:1.0:0.0:0.0	.	62;62	Q8IZD2;Q8IZD2-3	MLL5_HUMAN;.	V	62	ENSP00000312379:A62V;ENSP00000335599:A62V;ENSP00000257745:A62V;ENSP00000420415:A62V;ENSP00000417888:A62V	ENSP00000257745:A62V	A	+	2	0	MLL5	104489960	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.752000	0.85141	2.799000	0.96334	0.650000	0.86243	GCG	KMT2E	-	NULL	ENSG00000005483		0.383	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	-	0.00	82	0	C		Missense_Mutation	104702724	+1	tier1	-	no_errors	ENST00000257745	ensembl	human	known	74_37	missense	8.45	65	6	SNP	1.000	T
KIAA1549	57670	genome.wustl.edu	37	7	138603609	138603609	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:138603609T>G	ENST00000422774.1	-	2	811	c.763A>C	c.(763-765)Act>Cct	p.T255P	KIAA1549_ENST00000242365.4_Missense_Mutation_p.T205P|KIAA1549_ENST00000440172.1_Missense_Mutation_p.T255P			Q9HCM3	K1549_HUMAN	KIAA1549	255						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						TAAGCATCAGTAGGATAAAGC	0.488			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													80.0	81.0	80.0					7																	138603609		1990	4150	6140	SO:0001583	missense	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.763A>C	7.37:g.138603609T>G	ENSP00000416040:p.Thr255Pro		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.T255P	ENST00000422774.1	37	c.763	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690157	0.48097	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.35236	1.32;1.32;1.32	4.89	-0.594	0.11664	.	0.601203	0.14824	N	0.296282	T	0.17408	0.0418	N	0.17082	0.46	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.09377	0.002;0.004	T	0.13415	-1.0510	10	0.35671	T	0.21	.	3.8759	0.09056	0.1246:0.0807:0.4659:0.3287	.	255;255	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	P	255;205;255	ENSP00000406661:T255P;ENSP00000242365:T205P;ENSP00000416040:T255P	ENSP00000242365:T205P	T	-	1	0	KIAA1549	138254149	0.024000	0.19004	0.041000	0.18516	0.931000	0.56810	-0.240000	0.08952	-0.238000	0.09724	-0.396000	0.06452	ACT	KIAA1549	-	NULL	ENSG00000122778		0.488	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	-	0.00	32	0	T			138603609	-1	tier1	-	no_errors	ENST00000422774	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.013	G
LINC00471	151477	genome.wustl.edu	37	2	232373919	232373919	+	RNA	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:232373919C>T	ENST00000313064.2	-	0	499					NR_024079.1		Q8N535	CB052_HUMAN	long intergenic non-protein coding RNA 471																		TGGTGGCTCTCACGGTCCTTG	0.517																																																	0													234.0	222.0	226.0					2																	232373919		2203	4300	6503			0			BC033054		2q37.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000181798	ENSG00000181798		"""Long non-coding RNAs"""	28668	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 52"""	C2orf52		12477932	Standard	NR_024079		Approved	MGC43122	uc002vrx.1	Q8N535	OTTHUMG00000133227		2.37:g.232373919C>T				RNA	SNP	-	NULL	ENST00000313064.2	37	NULL		2																																																																																			LINC00471	-	-	ENSG00000181798		0.517	LINC00471-001	KNOWN	basic	processed_transcript	LINC00471	HGNC	processed_transcript	OTTHUMT00000256963.2	-	0.00	82	0	C	NM_173513		232373919	-1	tier1	-	no_errors	ENST00000313064	ensembl	human	known	74_37	rna	10.14	62	7	SNP	0.002	T
LRP1	4035	genome.wustl.edu	37	12	57556223	57556223	+	Frame_Shift_Del	DEL	C	C	-	rs34108076		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:57556223delC	ENST00000243077.3	+	14	2792	c.2326delC	c.(2326-2328)cccfs	p.P777fs		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	777					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGGAGGCGCACCCCCCACTGT	0.607																																																	0													150.0	122.0	132.0					12																	57556223		2203	4300	6503	SO:0001589	frameshift_variant	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.2326delC	12.37:g.57556223delC	ENSP00000243077:p.Pro777fs		Q2PP12|Q86SW0|Q8IVG8	Frame_Shift_Del	DEL	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T778fs	ENST00000243077.3	37	c.2326	CCDS8932.1	12																																																																																			LRP1	-	NULL	ENSG00000123384		0.607	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2		0.00	47	0	C	NM_002332		57556223	+1	tier1		no_errors	ENST00000243077	ensembl	human	known	74_37	frame_shift_del	9.68	28	3	DEL	0.102	-
LRRC28	123355	genome.wustl.edu	37	15	99796292	99796292	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:99796292G>T	ENST00000301981.3	+	2	370	c.130G>T	c.(130-132)Gag>Tag	p.E44*	LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000558879.1_Nonsense_Mutation_p.E44*|LRRC28_ENST00000442993.2_Nonsense_Mutation_p.E44*|LRRC28_ENST00000422500.2_Nonsense_Mutation_p.E44*|AC022819.1_ENST00000581052.1_RNA|LRRC28_ENST00000447360.2_Nonsense_Mutation_p.E44*|LRRC28_ENST00000331450.5_Nonsense_Mutation_p.E44*	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	44										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			GCAGTACTTGGAGAGACTCTA	0.363																																																	0													75.0	75.0	75.0					15																	99796292		2197	4297	6494	SO:0001587	stop_gained	0			AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.130G>T	15.37:g.99796292G>T	ENSP00000304923:p.Glu44*		A8KA22|Q6UY49|Q6ZSS6	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E44*	ENST00000301981.3	37	c.130	CCDS10380.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.193137	0.94960	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993;ENST00000331450	.	.	.	5.63	4.72	0.59763	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	13.3077	0.60362	0.0752:0.0:0.9248:0.0	.	.	.	.	X	44	.	ENSP00000304923:E44X	E	+	1	0	LRRC28	97613815	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.343000	0.79319	1.380000	0.46344	0.650000	0.86243	GAG	LRRC28	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000168904		0.363	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC28	HGNC	protein_coding	OTTHUMT00000313546.1	-	0.00	79	0	G	NM_144598		99796292	+1	tier1	-	no_errors	ENST00000301981	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
LRRC8C	84230	genome.wustl.edu	37	1	90178841	90178841	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:90178841G>C	ENST00000370454.4	+	3	967	c.712G>C	c.(712-714)Gct>Cct	p.A238P	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	238					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		AGGTGAGCAGGCTAAGGCCTT	0.428																																																	0													79.0	81.0	80.0					1																	90178841		2203	4300	6503	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.712G>C	1.37:g.90178841G>C	ENSP00000359483:p.Ala238Pro		B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A238P	ENST00000370454.4	37	c.712	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070564	0.76301	.	.	ENSG00000171488	ENST00000370454	T	0.52754	0.65	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.68229	0.2978	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69431	-0.5147	10	0.87932	D	0	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	238	Q8TDW0	LRC8C_HUMAN	P	238	ENSP00000359483:A238P	ENSP00000359483:A238P	A	+	1	0	LRRC8C	89951429	1.000000	0.71417	0.986000	0.45419	0.970000	0.65996	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	GCT	LRRC8C	-	NULL	ENSG00000171488		0.428	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	-	0.00	107	0	G	NM_032270		90178841	+1	tier1	-	no_errors	ENST00000370454	ensembl	human	known	74_37	missense	15.48	71	13	SNP	1.000	C
LTBP1	4052	genome.wustl.edu	37	2	33468795	33468795	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:33468795A>T	ENST00000404816.2	+	10	2296	c.1943A>T	c.(1942-1944)tAt>tTt	p.Y648F	LTBP1_ENST00000402934.1_Missense_Mutation_p.Y322F|LTBP1_ENST00000354476.3_Missense_Mutation_p.Y648F|LTBP1_ENST00000407925.1_Missense_Mutation_p.Y322F|LTBP1_ENST00000418533.2_Missense_Mutation_p.Y322F|LTBP1_ENST00000390003.4_Missense_Mutation_p.Y322F|LTBP1_ENST00000404525.1_Missense_Mutation_p.Y322F			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	648	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ATGGGCAGCTATCGATGTACC	0.383																																																	0													189.0	170.0	177.0					2																	33468795		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.1943A>T	2.37:g.33468795A>T	ENSP00000386043:p.Tyr648Phe		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.Y648F	ENST00000404816.2	37	c.1943	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	A	18.62	3.663065	0.67700	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000413303	D;D;D;D;D;D;D;T	0.90261	-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;-2.64;1.16	6.04	6.04	0.98038	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.86134	0.5860	N	0.20986	0.625	0.80722	D	1	P;B;B;B;B;B	0.37038	0.579;0.067;0.37;0.082;0.031;0.322	B;B;B;B;B;B	0.39771	0.302;0.058;0.309;0.057;0.034;0.081	D	0.85282	0.1062	9	0.33940	T	0.23	.	16.5763	0.84648	1.0:0.0:0.0:0.0	.	648;322;322;322;322;648	Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	LTBP1_HUMAN;.;.;.;.;.	F	648;648;322;322;322;322;322;4	ENSP00000386043:Y648F;ENSP00000346467:Y648F;ENSP00000374653:Y322F;ENSP00000393057:Y322F;ENSP00000384373:Y322F;ENSP00000385359:Y322F;ENSP00000384091:Y322F;ENSP00000415412:Y4F	ENSP00000346467:Y648F	Y	+	2	0	LTBP1	33322299	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	6.778000	0.75043	2.317000	0.78254	0.459000	0.35465	TAT	LTBP1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000049323		0.383	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	133	0	A	NM_206943		33468795	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	13.33	78	12	SNP	1.000	T
MATR3	9782	genome.wustl.edu	37	5	138658285	138658285	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:138658285A>C	ENST00000394805.3	+	12	2113		c.e12-1		MATR3_ENST00000502929.1_Splice_Site|MATR3_ENST00000361059.2_Splice_Site|MATR3_ENST00000510056.1_Splice_Site|MATR3_ENST00000504203.1_Splice_Site|MATR3_ENST00000503811.1_Splice_Site|MATR3_ENST00000502499.1_Splice_Site|MATR3_ENST00000394800.2_Splice_Site|MATR3_ENST00000509990.1_Splice_Site	NM_001194955.1|NM_018834.5	NP_001181884.1|NP_061322.2	P43243	MATR3_HUMAN	matrin 3						cell death (GO:0008219)	membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TTTTGATTTCAGAAAAAGATC	0.343																																																	0													76.0	78.0	77.0					5																	138658285		2202	4299	6501	SO:0001630	splice_region_variant	0			M63483	CCDS4210.1, CCDS54908.1, CCDS75316.1	5q31.3	2010-08-12			ENSG00000015479	ENSG00000015479			6912	protein-coding gene	gene with protein product		164015	"""myopathy, distal 2"""	MPD2		2033075, 19344878	Standard	NM_018834		Approved	KIAA0723, MGC9105, VCPDM	uc003ldx.3	P43243	OTTHUMG00000129229	ENST00000394805.3:c.1779-1A>C	5.37:g.138658285A>C			B7ZAV5|D3DQC3|Q9UHW0|Q9UQ27	Splice_Site	SNP	-	e11-2	ENST00000394805.3	37	c.1779-2	CCDS4210.1	5	.	.	.	.	.	.	.	.	.	.	A	10.29	1.310492	0.23821	.	.	ENSG00000015479	ENST00000509990;ENST00000361059;ENST00000504203;ENST00000502929;ENST00000394800;ENST00000394805;ENST00000502499;ENST00000510056;ENST00000503811	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4317	0.75105	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MATR3	138686184	0.998000	0.40836	0.949000	0.38748	0.200000	0.23975	4.388000	0.59633	2.030000	0.59900	0.533000	0.62120	.	MATR3	-	-	ENSG00000015479		0.343	MATR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MATR3	HGNC	protein_coding	OTTHUMT00000251324.2		0.00	51	0	A	NM_018834	Intron	138658285	+1			no_errors	ENST00000361059	ensembl	human	known	74_37	splice_site	11.90	37	5	SNP	0.993	C
MC4R	4160	genome.wustl.edu	37	18	58038662	58038662	+	Silent	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr18:58038662T>C	ENST00000299766.3	-	1	1339	c.921A>G	c.(919-921)caA>caG	p.Q307Q		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	307					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				TCCTCAGTTCTTGACTCCGGA	0.413																																																	0													127.0	120.0	123.0					18																	58038662		2203	4300	6503	SO:0001819	synonymous_variant	0			AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.921A>G	18.37:g.58038662T>C			B2RAC3|Q16317|Q3MIJ6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melcrt_ACTH_rcpt,prints_Mcort_rcpt_4,prints_GPCR_Rhodpsn,prints_Melancort_rcpt,prints_Cnbnoid_rcpt	p.Q307	ENST00000299766.3	37	c.921	CCDS11976.1	18																																																																																			MC4R	-	pfam_7TM_GPCR_olfarory/Srsx,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn,prints_Cnbnoid_rcpt	ENSG00000166603		0.413	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC4R	HGNC	protein_coding	OTTHUMT00000256139.1	-	0.00	34	0	T	NM_005912		58038662	-1	tier1	-	no_errors	ENST00000299766	ensembl	human	known	74_37	silent	21.43	22	6	SNP	1.000	C
MFF	56947	genome.wustl.edu	37	2	228221914	228221914	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:228221914C>A	ENST00000353339.3	+	0	1551				MFF_ENST00000337110.7_3'UTR|MFF_ENST00000409565.1_3'UTR|MFF_ENST00000354503.6_3'UTR|MFF_ENST00000304593.9_3'UTR|MFF_ENST00000392059.1_3'UTR|MFF_ENST00000349901.7_3'UTR|MFF_ENST00000476924.1_3'UTR	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor						mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						TCTGTCTCTGCATTGTATGCC	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.*81C>A	2.37:g.228221914C>A			Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	RNA	SNP	-	NULL	ENST00000353339.3	37	NULL	CCDS2465.1	2																																																																																			MFF	-	-	ENSG00000168958		0.393	MFF-001	KNOWN	basic|CCDS	protein_coding	MFF	HGNC	protein_coding	OTTHUMT00000256887.2	-	0.00	80	0	C	NM_020194		228221914	+1	tier1	-	no_errors	ENST00000476924	ensembl	human	known	74_37	rna	6.45	58	4	SNP	1.000	A
MIR377	494326	genome.wustl.edu	37	14	101526154	101526154	+	RNA	SNP	T	T	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr14:101526154T>G	ENST00000362145.2	+	0	0				MIR154_ENST00000385243.1_RNA|MIR496_ENST00000385226.1_RNA	NR_029869.1				microRNA 377																		TCATACACGGTTGACCTATTT	0.502																																																	0													213.0	196.0	201.0					14																	101526154		1568	3582	5150			0					14q32.31	2011-09-12		2008-12-18	ENSG00000199015	ENSG00000199015		"""ncRNAs / Micro RNAs"""	31870	non-coding RNA	RNA, micro				MIRN377			Standard	NR_029869		Approved	hsa-mir-377	uc010awh.1				14.37:g.101526154T>G				RNA	SNP	-	NULL	ENST00000362145.2	37	NULL		14																																																																																			MIR154	-	-	ENSG00000207978		0.502	MIR377-201	KNOWN	basic	miRNA	MIR154	HGNC	miRNA		-	0.00	121	0	T	NR_029869		101526154	+1	tier1	-	no_errors	ENST00000385243	ensembl	human	known	74_37	rna	14.29	65	11	SNP	0.999	G
UQCC2	84300	genome.wustl.edu	37	6	33665934	33665934	+	Intron	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr6:33665934T>C	ENST00000607484.1	-	4	324				UQCC2_ENST00000374214.3_Intron|MIR3934_ENST00000579806.1_RNA|SBP1_ENST00000594414.1_5'Flank	NM_032340.3	NP_115716.1	Q9BRT2	UQCC2_HUMAN	ubiquinol-cytochrome c reductase complex assembly factor 2						regulation of insulin secretion (GO:0050796)|regulation of oxidative phosphorylation (GO:0002082)|regulation of skeletal muscle cell differentiation (GO:2001014)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											agttttcaggtgtggaaactg	0.552																																																	0																																										SO:0001627	intron_variant	0				CCDS4784.1	6p21.31	2013-09-20	2013-09-20	2013-09-20	ENSG00000137288	ENSG00000137288		"""Mitochondrial respiratory chain complex assembly factors"""	21237	protein-coding gene	gene with protein product	"""cytochrome B protein synthesis 6 homolog (S. cerevisiae)"""	614461	"""chromosome 6 open reading frame 125"", ""mitochondrial nucleoid factor 1"""	C6orf125, MNF1		19643811	Standard	NM_032340		Approved	MGC14833, bA6B20.2, M19, Cbp6	uc003ofa.2	Q9BRT2	OTTHUMG00000014534	ENST00000607484.1:c.284-407A>G	6.37:g.33665934T>C			B2R4I0	RNA	SNP	-	NULL	ENST00000607484.1	37	NULL	CCDS4784.1	6																																																																																			MIR3934	-	-	ENSG00000266509		0.552	UQCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3934	HGNC	protein_coding	OTTHUMT00000040207.2	-	0.00	42	0	T	NM_032340		33665934	+1	tier1	-	no_errors	ENST00000579806	ensembl	human	known	74_37	rna	14.29	18	3	SNP	0.001	C
NIFK	84365	genome.wustl.edu	37	2	122493308	122493310	+	In_Frame_Del	DEL	GTT	GTT	-	rs190300336		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	GTT	GTT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:122493308_122493310delGTT	ENST00000285814.4	-	2	194_196	c.122_124delAAC	c.(121-126)caactt>ctt	p.Q41del		NM_032390.4	NP_115766.3	Q9BYG3	MK67I_HUMAN		41					negative regulation of phosphatase activity (GO:0010923)|protein complex assembly (GO:0006461)|rRNA metabolic process (GO:0016072)|rRNA transcription (GO:0009303)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|pancreas(1)|urinary_tract(1)	12						CCAGGAGTAAGTTGTTCTTGTTT	0.409																																																	0																																										SO:0001651	inframe_deletion	0																														ENST00000285814.4:c.122_124delAAC	2.37:g.122493311_122493313delGTT	ENSP00000285814:p.Gln41del		A8K788|Q8TB66|Q96ED4	In_Frame_Del	DEL	pfam_hNIFK_FHA_Ki67_binding,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q41in_frame_del	ENST00000285814.4	37	c.124_122	CCDS2135.1	2																																																																																			MKI67IP	-	NULL	ENSG00000155438		0.409	MKI67IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKI67IP	HGNC	protein_coding	OTTHUMT00000254239.2		0.00	117	0	GTT			122493310	-1	tier1		no_errors	ENST00000285814	ensembl	human	known	74_37	in_frame_del	13.25	72	11	DEL	0.012:0.000:0.001	-
MROH2A	339766	genome.wustl.edu	37	2	234688027	234688027	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:234688027C>A	ENST00000389758.3	+	2	189	c.23C>A	c.(22-24)gCa>gAa	p.A8E				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	38																	ATTACAGAAGCAGCAGTAGCC	0.458																																																	0																																										SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.23C>A	2.37:g.234688027C>A	ENSP00000374408:p.Ala8Glu			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A8E	ENST00000389758.3	37	c.23		2	.	.	.	.	.	.	.	.	.	.	C	8.589	0.884044	0.17467	.	.	ENSG00000185038	ENST00000430892;ENST00000428446;ENST00000389758	T;T;T	0.06768	3.26;3.26;3.26	4.51	-1.27	0.09347	.	.	.	.	.	T	0.03220	0.0094	N	0.16478	0.41	0.09310	N	1	.	.	.	.	.	.	T	0.44711	-0.9310	7	0.11485	T	0.65	.	0.3257	0.00310	0.2318:0.3008:0.1498:0.3176	.	.	.	.	E	8	ENSP00000392128:A8E;ENSP00000404614:A8E;ENSP00000374408:A8E	ENSP00000374408:A8E	A	+	2	0	HEATR7B1	234352766	0.506000	0.26139	0.037000	0.18230	0.155000	0.21991	-0.277000	0.08502	-0.240000	0.09696	0.650000	0.86243	GCA	MROH2A	-	NULL	ENSG00000185038		0.458	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	MROH2A	HGNC	protein_coding	OTTHUMT00000130646.6	-	0.00	60	0	C	XM_291007		234688027	+1	tier1	-	no_errors	ENST00000389758	ensembl	human	novel	74_37	missense	7.41	50	4	SNP	0.057	A
MT-ND5	4540	genome.wustl.edu	37	M	12552	12552	+	Silent	SNP	A	A	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrM:12552A>G	ENST00000361567.2	+	1	216	c.216A>G	c.(214-216)caA>caG	p.Q72Q	MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	72					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GCCACAACCCAAACAACCCAG	0.418																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.216A>G	M.37:g.12552A>G			Q34773|Q8WCY3	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.Q72	ENST00000361567.2	37	c.216		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.418	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	29	0	A	YP_003024036		12552	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	silent	28.57	5	2	SNP	NULL	G
MTPAP	55149	genome.wustl.edu	37	10	30602572	30602572	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:30602572G>T	ENST00000263063.4	-	9	1758	c.1715C>A	c.(1714-1716)aCc>aAc	p.T572N	MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_Missense_Mutation_p.T702N	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	572					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						CTTCCCACTGGTTTTTGTGAA	0.358																																																	0													159.0	158.0	159.0					10																	30602572		2203	4300	6503	SO:0001583	missense	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1715C>A	10.37:g.30602572G>T	ENSP00000263063:p.Thr572Asn		D3DRX0|Q659E3|Q6P7E5|Q9HA74	Missense_Mutation	SNP	pfam_PAP_assoc	p.T702N	ENST00000263063.4	37	c.2105	CCDS7165.1	10	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307150	0.40795	.	.	ENSG00000107951	ENST00000358107;ENST00000263063	T;T	0.35048	2.04;1.33	5.64	3.63	0.41609	.	1.424900	0.03978	N	0.292785	T	0.53706	0.1813	M	0.72118	2.19	0.09310	N	1	D;D	0.63880	0.993;0.966	P;P	0.57776	0.827;0.543	T	0.18967	-1.0320	10	0.25106	T	0.35	-1.531	7.991	0.30239	0.0:0.167:0.532:0.301	.	702;572	Q9NVV4-2;Q9NVV4	.;PAPD1_HUMAN	N	702;572	ENSP00000350820:T702N;ENSP00000263063:T572N	ENSP00000263063:T572N	T	-	2	0	MTPAP	30642578	0.004000	0.15560	0.005000	0.12908	0.004000	0.04260	0.872000	0.28037	1.338000	0.45544	0.655000	0.94253	ACC	MTPAP	-	NULL	ENSG00000107951		0.358	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2		0.00	82	0	G	NM_018109		30602572	-1			no_errors	ENST00000358107	ensembl	human	known	74_37	missense	5.95	79	5	SNP	0.003	T
MUC16	94025	genome.wustl.edu	37	19	9015384	9015384	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:9015384A>C	ENST00000397910.4	-	30	38407	c.38204T>G	c.(38203-38205)cTt>cGt	p.L12735R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12737	SEA 5. {ECO:0000255|PROSITE- ProRule:PRU00188}.			G -> S (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATGGGACCAAGCTGTGGAGG	0.562																																																	0													152.0	131.0	138.0					19																	9015384		2037	4194	6231	SO:0001630	splice_region_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38203-1T>G	19.37:g.9015384A>C			Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L12735R	ENST00000397910.4	37	c.38204	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	12.14	1.848387	0.32699	.	.	ENSG00000181143	ENST00000397910	T	0.67698	-0.28	2.82	2.82	0.32997	.	.	.	.	.	T	0.81427	0.4820	M	0.89287	3.02	.	.	.	D	0.76494	0.999	D	0.87578	0.998	D	0.85082	0.0946	8	0.87932	D	0	.	7.3598	0.26739	1.0:0.0:0.0:0.0	.	12735	B5ME49	.	R	12735	ENSP00000381008:L12735R	ENSP00000381008:L12735R	L	-	2	0	MUC16	8876384	0.765000	0.28485	0.576000	0.28549	0.017000	0.09413	4.383000	0.59600	1.274000	0.44362	0.254000	0.18369	CTT	MUC16	-	pfam_SEA_dom	ENSG00000181143		0.562	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	121	0	A	NM_024690	Missense_Mutation	9015384	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	16.67	85	17	SNP	0.723	C
MUC17	140453	genome.wustl.edu	37	7	100696339	100696339	+	Silent	SNP	C	C	T	rs141631949	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:100696339C>T	ENST00000306151.4	+	10	13240	c.13176C>T	c.(13174-13176)taC>taT	p.Y4392Y		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	4392					cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCTGGTGTACGGCCTCGTGG	0.597													c|||	15	0.00299521	0.0113	0.0	5008	,	,		18164	0.0		0.0	False		,,,				2504	0.0																0								T		66,4340	61.7+/-98.7	1,64,2138	90.0	79.0	83.0		13176	-5.6	0.0	7	dbSNP_134	83	0,8600		0,0,4300	no	coding-synonymous	MUC17	NM_001040105.1		1,64,6438	TT,TC,CC		0.0,1.498,0.5075		4392/4494	100696339	66,12940	2203	4300	6503	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.13176C>T	7.37:g.100696339C>T			O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.Y4392	ENST00000306151.4	37	c.13176	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.597	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1		0.00	40	0	C	NM_001040105		100696339	+1			no_errors	ENST00000306151	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.038	T
NBEA	26960	genome.wustl.edu	37	13	35751218	35751218	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr13:35751218G>A	ENST00000400445.3	+	28	5174	c.4640G>A	c.(4639-4641)cGt>cAt	p.R1547H	NBEA_ENST00000379939.2_Missense_Mutation_p.R1544H|NBEA_ENST00000310336.4_Missense_Mutation_p.R1547H|NBEA_ENST00000540320.1_Missense_Mutation_p.R1547H	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1547					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AATCGCCTTCGTGCTGTTGTC	0.373																																																	0													165.0	142.0	149.0					13																	35751218		1873	4106	5979	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4640G>A	13.37:g.35751218G>A	ENSP00000383295:p.Arg1547His		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.R1547H	ENST00000400445.3	37	c.4640	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.138745	0.94560	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	T;T;T;T	0.63417	-0.03;-0.04;-0.03;-0.03	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.79839	0.4515	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.69479	0.869;0.964	T	0.79480	-0.1786	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1547;1544	Q8NFP9;Q5T321	NBEA_HUMAN;.	H	1547;1547;1544;1547;206	ENSP00000440951:R1547H;ENSP00000383295:R1547H;ENSP00000369271:R1544H;ENSP00000308534:R1547H	ENSP00000308534:R1547H	R	+	2	0	NBEA	34649218	1.000000	0.71417	0.967000	0.41034	0.563000	0.35712	9.718000	0.98758	2.941000	0.99782	0.655000	0.94253	CGT	NBEA	-	NULL	ENSG00000172915		0.373	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	112	0	G	NM_015678		35751218	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	14.29	66	11	SNP	1.000	A
NIN	51199	genome.wustl.edu	37	14	51239789	51239789	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr14:51239789G>T	ENST00000382041.3	-	8	881	c.691C>A	c.(691-693)Ctt>Att	p.L231I	NIN_ENST00000245441.5_Missense_Mutation_p.L231I|NIN_ENST00000389868.3_Missense_Mutation_p.L231I|NIN_ENST00000530997.2_Missense_Mutation_p.L231I|NIN_ENST00000324330.9_Missense_Mutation_p.L231I|NIN_ENST00000382043.4_Missense_Mutation_p.L231I|NIN_ENST00000453196.1_Missense_Mutation_p.L231I	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	231	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					TCAGGATCAAGATTATGGAAT	0.358			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													96.0	94.0	94.0					14																	51239789		2203	4300	6503	SO:0001583	missense	0			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.691C>A	14.37:g.51239789G>T	ENSP00000371472:p.Leu231Ile		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_hand_dom	p.L231I	ENST00000382041.3	37	c.691	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500455	0.85176	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	D;T;D;T;D;D;T	0.95588	-3.75;-0.49;-3.75;1.37;-3.75;-3.75;2.9	4.88	4.88	0.63580	EF-hand-like domain (1);	0.130542	0.53938	D	0.000054	D	0.95749	0.8617	L	0.27053	0.805	0.48185	D	0.999602	D;D;D;D;D	0.89917	1.0;1.0;0.999;0.996;0.998	D;D;D;D;D	0.91635	0.999;0.998;0.997;0.935;0.99	D	0.95894	0.8909	10	0.45353	T	0.12	-6.2678	17.3719	0.87381	0.0:0.0:1.0:0.0	.	237;231;231;231;231	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	I	231;231;231;231;237;231;231;231;193	ENSP00000245441:L231I;ENSP00000374518:L231I;ENSP00000371474:L231I;ENSP00000371472:L231I;ENSP00000324210:L231I;ENSP00000412391:L231I;ENSP00000398641:L193I	ENSP00000245441:L231I	L	-	1	0	NIN	50309539	1.000000	0.71417	0.984000	0.44739	0.901000	0.52897	7.920000	0.87521	2.403000	0.81681	0.467000	0.42956	CTT	NIN	-	NULL	ENSG00000100503		0.358	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2		0.00	49	0	G	NM_182946		51239789	-1			no_errors	ENST00000245441	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
NPTXR	23467	genome.wustl.edu	37	22	39222643	39222643	+	Silent	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr22:39222643G>A	ENST00000333039.2	-	3	1083	c.960C>T	c.(958-960)acC>acT	p.T320T		NM_014293.3	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	320	Pentaxin.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			central_nervous_system(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	Melanoma(58;0.04)					ACATGCAGGCGGTGAATGCGT	0.622																																					Pancreas(139;2521 3281 36965)												0													88.0	78.0	82.0					22																	39222643		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052163	CCDS33647.1	22q13.1	2007-01-25			ENSG00000221890	ENSG00000221890			7954	protein-coding gene	gene with protein product		609474				16497176	Standard	NM_014293		Approved		uc003awk.3	O95502	OTTHUMG00000150458	ENST00000333039.2:c.960C>T	22.37:g.39222643G>A				Silent	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.T320	ENST00000333039.2	37	c.960	CCDS33647.1	22																																																																																			NPTXR	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	ENSG00000221890		0.622	NPTXR-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	NPTXR	HGNC	protein_coding	OTTHUMT00000318194.2		0.00	33	0	G	NM_014293		39222643	-1			no_errors	ENST00000333039	ensembl	human	known	74_37	silent	7.14	39	3	SNP	0.323	A
NPY2R	4887	genome.wustl.edu	37	4	156135424	156135424	+	Silent	SNP	C	C	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:156135424C>G	ENST00000329476.3	+	2	822	c.333C>G	c.(331-333)acC>acG	p.T111T	NPY2R_ENST00000506608.1_Silent_p.T111T	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	111					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	TTACCTATACCTTAATGGGGG	0.493																																																	0													70.0	72.0	72.0					4																	156135424		2203	4300	6503	SO:0001819	synonymous_variant	0			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.333C>G	4.37:g.156135424C>G			Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.T111	ENST00000329476.3	37	c.333	CCDS3791.1	4																																																																																			NPY2R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY_rcpt,prints_NPFF_rcpt	ENSG00000185149		0.493	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	HGNC	protein_coding	OTTHUMT00000365128.1		0.00	54	0	C	NM_000910		156135424	+1			no_errors	ENST00000329476	ensembl	human	known	74_37	silent	11.54	23	3	SNP	0.989	G
NRG1	3084	genome.wustl.edu	37	8	32463100	32463100	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr8:32463100A>T	ENST00000405005.3	+	3	299	c.299A>T	c.(298-300)aAc>aTc	p.N100I	NRG1_ENST00000521670.1_Missense_Mutation_p.N100I|NRG1_ENST00000519301.1_Missense_Mutation_p.N79I|NRG1_ENST00000356819.4_Missense_Mutation_p.N100I|NRG1_ENST00000287845.5_Missense_Mutation_p.N100I|NRG1_ENST00000520407.1_Missense_Mutation_p.N315I|NRG1_ENST00000287842.3_Missense_Mutation_p.N100I|NRG1_ENST00000338921.4_Missense_Mutation_p.N100I|NRG1_ENST00000523079.1_Missense_Mutation_p.N100I|NRG1_ENST00000341377.5_Missense_Mutation_p.N100I			Q02297	NRG1_HUMAN	neuregulin 1	100	Ig-like C2-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTTCGCATTAACAAAGCATCA	0.378																																																	0													174.0	158.0	164.0					8																	32463100		2203	4300	6503	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.299A>T	8.37:g.32463100A>T	ENSP00000384620:p.Asn100Ile		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.N100I	ENST00000405005.3	37	c.299	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	10.18	1.279415	0.23307	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000520407;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T;T;T;T;T;T;T;T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28;-0.28	5.8	-4.65	0.03339	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.942027	0.09093	N	0.849541	T	0.56863	0.2014	L	0.34521	1.04	0.24874	N	0.992263	P;B;B;B;B;P;B;P;B;B;B;P	0.50943	0.459;0.21;0.154;0.25;0.351;0.459;0.127;0.724;0.27;0.27;0.404;0.94	B;B;B;B;B;B;B;P;B;B;B;P	0.46758	0.157;0.068;0.143;0.231;0.239;0.295;0.071;0.511;0.109;0.239;0.353;0.526	T	0.57528	-0.7796	10	0.48119	T	0.1	-1.5477	11.4391	0.50086	0.4381:0.0938:0.4681:0.0	.	100;100;100;99;99;100;100;100;100;100;100;315	E9PHH4;F8W9E3;Q7RTW4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8;Q02297-9	.;.;.;.;.;.;.;NRG1_HUMAN;.;.;.;.	I	79;79;315;168;100;100;100;100;100;100;100;100;100	ENSP00000430053:N79I;ENSP00000429582:N79I;ENSP00000434640:N315I;ENSP00000429067:N168I;ENSP00000430120:N100I;ENSP00000343395:N100I;ENSP00000349275:N100I;ENSP00000287840:N100I;ENSP00000287845:N100I;ENSP00000340497:N100I;ENSP00000287842:N100I;ENSP00000384620:N100I;ENSP00000428828:N100I	ENSP00000287840:N100I	N	+	2	0	NRG1	32582642	0.865000	0.29922	0.036000	0.18154	0.060000	0.15804	0.052000	0.14163	-1.004000	0.03421	-1.162000	0.01777	AAC	NRG1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000157168		0.378	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	75	0	A			32463100	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	missense	12.28	50	7	SNP	0.004	T
NSA2	10412	genome.wustl.edu	37	5	74066483	74066483	+	Missense_Mutation	SNP	G	G	T	rs185653889		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:74066483G>T	ENST00000296802.5	+	4	739	c.370G>T	c.(370-372)Gta>Tta	p.V124L	NSA2_ENST00000513356.1_3'UTR	NM_014886.3	NP_055701.1	O95478	NSA2_HUMAN	NSA2 ribosome biogenesis homolog (S. cerevisiae)	124	Lys-rich.				rRNA processing (GO:0006364)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|skin(1)	7						TCTGCCTAAAGTACGTGCCCA	0.353																																																	0													77.0	80.0	79.0					5																	74066483		2203	4300	6503	SO:0001583	missense	0			AF077615	CCDS4025.1, CCDS75260.1	5q13.3	2010-01-18			ENSG00000164346	ENSG00000164346			30728	protein-coding gene	gene with protein product	"""hairy cell leukemia protein 1"", ""TGF beta-inducible nuclear protein 1"""	612497				11124703, 10486207	Standard	NM_014886		Approved	HUSSY-29, HCLG1, FLJ94393, TINP1	uc003kdk.2	O95478	OTTHUMG00000131273	ENST00000296802.5:c.370G>T	5.37:g.74066483G>T	ENSP00000296802:p.Val124Leu			Missense_Mutation	SNP	pfam_Ribosomal_S8e/biogenesis_NSA2	p.V124L	ENST00000296802.5	37	c.370	CCDS4025.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.194925|5.194925	0.94960|0.94960	.|.	.|.	ENSG00000164346|ENSG00000164346	ENST00000515524|ENST00000296802	.|T	.|0.58506	.|0.33	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83069|0.83069	0.5174|0.5174	M|M	0.93197|0.93197	3.39|3.39	0.80722|0.80722	D|D	1|1	.|D	.|0.63046	.|0.992	.|D	.|0.79108	.|0.992	D|D	0.87114|0.87114	0.2187|0.2187	5|10	.|0.87932	.|D	.|0	.|.	19.577|19.577	0.95449|0.95449	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|124	.|O95478	.|NSA2_HUMAN	I|L	32|124	.|ENSP00000296802:V124L	.|ENSP00000296802:V124L	S|V	+|+	2|1	0|0	NSA2|NSA2	74102239|74102239	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	9.302000|9.302000	0.96175|0.96175	2.693000|2.693000	0.91896|0.91896	0.650000|0.650000	0.86243|0.86243	AGT|GTA	NSA2	-	pfam_Ribosomal_S8e/biogenesis_NSA2	ENSG00000164346		0.353	NSA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSA2	HGNC	protein_coding	OTTHUMT00000254041.3		0.00	94	0	G	NM_014886		74066483	+1			no_errors	ENST00000296802	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
LINC01378	103689918	genome.wustl.edu	37	4	118497013	118497013	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:118497013C>T	ENST00000422145.3	+	0	159				NT5C3AP1_ENST00000441170.1_RNA																							CCGTTATTATCTGAAGTTTGG	0.383																																																	0																																												0																															4.37:g.118497013C>T				RNA	SNP	-	NULL	ENST00000422145.3	37	NULL		4																																																																																			NT5C3AP1	-	-	ENSG00000213492		0.383	AC092661.1-002	KNOWN	basic	lincRNA	NT5C3AP1	HGNC	lincRNA	OTTHUMT00000291362.3	-	0.00	67	0	C			118497013	-1	tier1	-	no_errors	ENST00000441170	ensembl	human	known	74_37	rna	14.63	35	6	SNP	1.000	T
NUP37	79023	genome.wustl.edu	37	12	102471230	102471230	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:102471230G>T	ENST00000552283.1	-	7	731	c.592C>A	c.(592-594)Caa>Aaa	p.Q198K	RP11-554E23.4_ENST00000552707.1_RNA|NUP37_ENST00000543021.1_5'Flank|NUP37_ENST00000251074.1_Missense_Mutation_p.Q198K			Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	198					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)		p.Q198K(1)		endometrium(3)|large_intestine(3)|lung(10)|ovary(1)	17						ATAGCCTGTTGGGCCAAAAGA	0.378																																																	1	Substitution - Missense(1)	lung(1)											135.0	141.0	139.0					12																	102471230		2203	4300	6503	SO:0001583	missense	0			AF514994	CCDS9089.1	12q23.2	2014-08-12			ENSG00000075188	ENSG00000075188		"""WD repeat domain containing"""	29929	protein-coding gene	gene with protein product		609264				12196509	Standard	NM_024057		Approved	MGC5585, FLJ22618	uc001tjc.3	Q8NFH4	OTTHUMG00000170478	ENST00000552283.1:c.592C>A	12.37:g.102471230G>T	ENSP00000448054:p.Gln198Lys		Q9H644	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q198K	ENST00000552283.1	37	c.592	CCDS9089.1	12	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121417	0.37436	.	.	ENSG00000075188	ENST00000552283;ENST00000251074	T;T	0.27557	1.66;1.66	6.02	6.02	0.97574	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.194501	0.56097	D	0.000029	T	0.27765	0.0683	L	0.28274	0.84	0.80722	D	1	B	0.17038	0.02	B	0.16722	0.016	T	0.02464	-1.1155	10	0.38643	T	0.18	-5.7104	20.5407	0.99260	0.0:0.0:1.0:0.0	.	198	Q8NFH4	NUP37_HUMAN	K	198	ENSP00000448054:Q198K;ENSP00000251074:Q198K	ENSP00000251074:Q198K	Q	-	1	0	NUP37	100995360	1.000000	0.71417	0.945000	0.38365	0.972000	0.66771	9.147000	0.94646	2.865000	0.98341	0.655000	0.94253	CAA	NUP37	-	superfamily_WD40_repeat_dom	ENSG00000075188		0.378	NUP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP37	HGNC	protein_coding	OTTHUMT00000409330.1		0.00	48	0	G	NM_024057		102471230	-1			no_errors	ENST00000251074	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
OR1N2	138882	genome.wustl.edu	37	9	125315791	125315791	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr9:125315791C>A	ENST00000373688.2	+	1	401	c.343C>A	c.(343-345)Ctt>Att	p.L115I		NM_001004457.1	NP_001004457.1	Q8NGR9	OR1N2_HUMAN	olfactory receptor, family 1, subfamily N, member 2	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(6)|lung(10)|ovary(2)|skin(3)|stomach(3)	26						TTCTGGGTGTCTTGCACAGCT	0.493																																																	0													230.0	222.0	224.0					9																	125315791		2203	4300	6503	SO:0001583	missense	0				CCDS35123.1	9q33.2	2013-09-20			ENSG00000171501	ENSG00000171501		"""GPCR / Class A : Olfactory receptors"""	15111	protein-coding gene	gene with protein product							Standard	NM_001004457		Approved		uc011lyx.2	Q8NGR9	OTTHUMG00000020607	ENST00000373688.2:c.343C>A	9.37:g.125315791C>A	ENSP00000362792:p.Leu115Ile		A3KFM2|B2RNY4|Q6IF17|Q96RA3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L115I	ENST00000373688.2	37	c.343	CCDS35123.1	9	.	.	.	.	.	.	.	.	.	.	C	10.83	1.462115	0.26248	.	.	ENSG00000171501	ENST00000373688	T	0.00344	8.02	4.41	0.293	0.15742	GPCR, rhodopsin-like superfamily (1);	0.284658	0.09782	N	0.756534	T	0.00178	0.0005	L	0.43646	1.37	0.09310	N	1	P	0.36048	0.534	B	0.31751	0.135	T	0.05801	-1.0863	10	0.13470	T	0.59	.	3.3883	0.07280	0.328:0.3825:0.0:0.2894	.	115	Q8NGR9	OR1N2_HUMAN	I	115	ENSP00000362792:L115I	ENSP00000362792:L115I	L	+	1	0	OR1N2	124355612	0.000000	0.05858	0.748000	0.31131	0.973000	0.67179	-1.680000	0.01939	0.513000	0.28278	0.644000	0.83932	CTT	OR1N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000171501		0.493	OR1N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N2	HGNC	protein_coding	OTTHUMT00000053937.2		0.00	46	0	C			125315791	+1			no_errors	ENST00000373688	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.038	A
OR2AJ1	127608	genome.wustl.edu	37	1	248097553	248097553	+	Silent	SNP	T	T	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:248097553T>G	ENST00000318244.3	+	1	483	c.483T>G	c.(481-483)gcT>gcG	p.A161A	OR2L13_ENST00000366478.2_5'Flank			Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						TCCACACAGCTTATGCACTGC	0.522																																																	0																																										SO:0001819	synonymous_variant	0					1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.483T>G	1.37:g.248097553T>G				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A161	ENST00000318244.3	37	c.483		1																																																																																			OR2AJ1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177275		0.522	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	OR2AJ1	HGNC	protein_coding	OTTHUMT00000096863.1	-	0.00	73	0	T	NG_004652		248097553	+1	tier1	-	no_errors	ENST00000318244	ensembl	human	known	74_37	silent	18.18	27	6	SNP	0.000	G
OR7D4	125958	genome.wustl.edu	37	19	9324972	9324972	+	Missense_Mutation	SNP	G	G	A	rs142332857	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:9324972G>A	ENST00000308682.2	-	1	570	c.542C>T	c.(541-543)cCg>cTg	p.P181L		NM_001005191.2	NP_001005191.1	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D, member 4	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|skin(3)|stomach(1)	26						GACCTGAGCCGGTTCACAGAA	0.498													G|||	2	0.000399361	0.0015	0.0	5008	,	,		21513	0.0		0.0	False		,,,				2504	0.0																0													103.0	97.0	99.0					19																	9324972		2203	4300	6503	SO:0001583	missense	0				CCDS32901.1	19p13.2	2013-12-17		2004-03-10	ENSG00000174667	ENSG00000174667		"""GPCR / Class A : Olfactory receptors"""	8380	protein-coding gene	gene with protein product		611538		OR7D4P			Standard	NM_001005191		Approved	hg105, OR19-B	uc002mla.2	Q8NG98	OTTHUMG00000179936	ENST00000308682.2:c.542C>T	19.37:g.9324972G>A	ENSP00000310488:p.Pro181Leu		A8CAH8|A8CAH9|A8CAI0|A8CAI1|B9EH79	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P181L	ENST00000308682.2	37	c.542	CCDS32901.1	19	.	.	.	.	.	.	.	.	.	.	G	0	-2.602749	0.00123	.	.	ENSG00000174667	ENST00000308682	T	0.35236	1.32	4.0	2.96	0.34315	GPCR, rhodopsin-like superfamily (1);	0.669254	0.12970	N	0.424237	T	0.07593	0.0191	N	0.00215	-1.835	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32107	-0.9919	10	0.02654	T	1	.	8.4312	0.32759	0.9027:0.0:0.0973:0.0	.	181	Q8NG98	OR7D4_HUMAN	L	181	ENSP00000310488:P181L	ENSP00000310488:P181L	P	-	2	0	OR7D4	9185972	0.000000	0.05858	0.143000	0.22291	0.102000	0.19082	-0.237000	0.08990	0.723000	0.32274	-0.602000	0.04101	CCG	OR7D4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000174667		0.498	OR7D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D4	HGNC	protein_coding	OTTHUMT00000449004.1	-	0.00	109	0	G			9324972	-1	tier1	rs142332857	no_errors	ENST00000308682	ensembl	human	known	74_37	missense	9.52	76	8	SNP	0.001	A
OR8D4	338662	genome.wustl.edu	37	11	123777178	123777178	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:123777178C>A	ENST00000321355.2	+	1	70	c.40C>A	c.(40-42)Ctt>Att	p.L14I		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	14						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		TGAGTTTCTTCTTTCAGGATT	0.413																																																	0													86.0	82.0	83.0					11																	123777178		2202	4299	6501	SO:0001583	missense	0			AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.40C>A	11.37:g.123777178C>A	ENSP00000325381:p.Leu14Ile		Q6IFE9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L14I	ENST00000321355.2	37	c.40	CCDS31698.1	11	.	.	.	.	.	.	.	.	.	.	C	13.05	2.122112	0.37436	.	.	ENSG00000181518	ENST00000321355	T	0.00561	6.59	5.44	3.52	0.40303	.	0.000000	0.40908	D	0.000985	T	0.00815	0.0027	M	0.80508	2.5	0.27885	N	0.939525	B	0.28900	0.227	B	0.33521	0.165	T	0.35325	-0.9793	10	0.66056	D	0.02	.	4.1919	0.10424	0.1659:0.5901:0.0:0.2441	.	14	Q8NGM9	OR8D4_HUMAN	I	14	ENSP00000325381:L14I	ENSP00000325381:L14I	L	+	1	0	OR8D4	123282388	0.011000	0.17503	0.039000	0.18376	0.919000	0.55068	0.149000	0.16243	0.606000	0.29965	0.561000	0.74099	CTT	OR8D4	-	NULL	ENSG00000181518		0.413	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D4	HGNC	protein_coding	OTTHUMT00000387262.1		0.00	59	0	C	NM_001005197		123777178	+1			no_errors	ENST00000321355	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.818	A
PABPN1	8106	genome.wustl.edu	37	14	23792218	23792218	+	Silent	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr14:23792218G>T	ENST00000216727.4	+	3	658	c.477G>T	c.(475-477)gtG>gtT	p.V159V	PABPN1_ENST00000557702.1_Silent_p.V31V|PABPN1_ENST00000397276.2_Silent_p.V159V|AL049829.1_ENST00000594872.1_5'Flank|BCL2L2-PABPN1_ENST00000553781.1_Silent_p.V186V|BCL2L2-PABPN1_ENST00000557008.1_Silent_p.V186V|PABPN1_ENST00000556821.1_Silent_p.V31V	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	159	Necessary for homooligomerization.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		CTGGCCCGGTGATCATGTCCA	0.463																																																	0													139.0	145.0	143.0					14																	23792218		2203	4300	6503	SO:0001819	synonymous_variant	0			AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.477G>T	14.37:g.23792218G>T			D3DS49|O43484	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V159	ENST00000216727.4	37	c.477	CCDS9592.1	14																																																																																			PABPN1	-	NULL	ENSG00000100836		0.463	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PABPN1	HGNC	protein_coding	OTTHUMT00000071767.4	-	0.00	87	0	G	NM_004643		23792218	+1	tier1	-	no_errors	ENST00000216727	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	T
PALLD	23022	genome.wustl.edu	37	4	169815804	169815804	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:169815804G>T	ENST00000505667.1	+	12	2348	c.2175G>T	c.(2173-2175)gaG>gaT	p.E725D	CBR4_ENST00000509108.1_5'UTR|PALLD_ENST00000507735.1_Missense_Mutation_p.E238D|PALLD_ENST00000261509.6_Missense_Mutation_p.E725D|PALLD_ENST00000512127.1_Missense_Mutation_p.E343D|PALLD_ENST00000335742.7_Missense_Mutation_p.E567D			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	949	Pro-rich.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		ATATTCAGGAGCCAGAAGAGG	0.413									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)												0													87.0	78.0	81.0					4																	169815804		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.2175G>T	4.37:g.169815804G>T	ENSP00000425556:p.Glu725Asp		B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E725D	ENST00000505667.1	37	c.2175	CCDS54818.1	4	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396095	0.25205	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127;ENST00000510998;ENST00000393726;ENST00000507735	T;T;T;T;T;T;T	0.62941	-0.01;-0.01;0.29;0.02;0.43;0.26;0.29	5.16	2.37	0.29283	.	.	.	.	.	T	0.47728	0.1461	L	0.52364	1.645	0.80722	D	1	B;B;B;B	0.06786	0.001;0.0;0.0;0.001	B;B;B;B	0.08055	0.003;0.001;0.001;0.003	T	0.29549	-1.0008	9	0.16896	T	0.51	.	4.7086	0.12861	0.2456:0.0:0.5802:0.1742	.	725;949;343;725	B7ZMM5;Q8WX93;B3KTG2;B2RTX2	.;PALLD_HUMAN;.;.	D	725;567;725;343;18;18;238	ENSP00000261509:E725D;ENSP00000336735:E567D;ENSP00000425556:E725D;ENSP00000426947:E343D;ENSP00000422135:E18D;ENSP00000377327:E18D;ENSP00000424016:E238D	ENSP00000261509:E725D	E	+	3	2	PALLD	170052379	1.000000	0.71417	1.000000	0.80357	0.242000	0.25591	1.261000	0.32980	1.136000	0.42199	0.585000	0.79938	GAG	PALLD	-	NULL	ENSG00000129116		0.413	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	HGNC	protein_coding	OTTHUMT00000363762.1		0.00	96	0	G	NM_016081		169815804	+1			no_errors	ENST00000261509	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
AKAP2	11217	genome.wustl.edu	37	9	112900341	112900341	+	Missense_Mutation	SNP	G	G	T	rs373159646|rs34665027|rs150402481	byFrequency	TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr9:112900341G>T	ENST00000259318.7	+	2	2031	c.1824G>T	c.(1822-1824)gaG>gaT	p.E608D	AKAP2_ENST00000510514.5_Missense_Mutation_p.E839D|AKAP2_ENST00000374525.1_Missense_Mutation_p.E697D|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.E839D|AKAP2_ENST00000434623.2_Missense_Mutation_p.E697D|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.E839D|AKAP2_ENST00000555236.1_Missense_Mutation_p.E839D	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	608								p.E839_E840insEA(1)|p.E697_E698insEA(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CGACTGTAGAGGAAGCTGAAG	0.507																																																	2	Insertion - In frame(2)	lung(2)											35.0	41.0	39.0					9																	112900341		2203	4300	6503	SO:0001583	missense	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1824G>T	9.37:g.112900341G>T	ENSP00000259318:p.Glu608Asp		B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.E839D	ENST00000259318.7	37	c.2517	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	G	8.566	0.878867	0.17395	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.52526	2.01;2.0;2.01;2.0;1.25;0.67;0.66;1.59	5.74	2.71	0.32032	.	0.830795	0.11118	N	0.597729	T	0.41789	0.1174	L	0.54323	1.7	0.30106	N	0.806963	B;B;B;B;B;B;B;B	0.33549	0.189;0.288;0.293;0.417;0.293;0.008;0.008;0.332	B;B;B;B;B;B;B;B	0.32928	0.034;0.155;0.054;0.116;0.054;0.011;0.011;0.108	T	0.43327	-0.9398	10	0.51188	T	0.08	-17.9654	8.2558	0.31756	0.0741:0.0:0.6511:0.2747	.	608;697;691;697;698;839;839;657	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	D	839;839;839;839;697;697;657;608	ENSP00000363654:E839D;ENSP00000305861:E839D;ENSP00000451476:E839D;ENSP00000421522:E839D;ENSP00000404782:E697D;ENSP00000363649:E697D;ENSP00000419268:E657D;ENSP00000259318:E608D	ENSP00000259318:E608D	E	+	3	2	PALM2-AKAP2;AKAP2	111940162	0.983000	0.35010	0.941000	0.38009	0.190000	0.23558	1.200000	0.32247	0.860000	0.35481	0.650000	0.86243	GAG	PALM2-AKAP2	-	NULL	ENSG00000157654		0.507	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3		0.00	35	0	G	NM_001004065		112900341	+1			no_errors	ENST00000374530	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.985	T
PCDHB4	56131	genome.wustl.edu	37	5	140502330	140502330	+	Silent	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:140502330C>A	ENST00000194152.1	+	1	750	c.750C>A	c.(748-750)gtC>gtA	p.V250V	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	250	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGGTGCAGGTCCTGGAAAACA	0.483																																																	0													103.0	109.0	107.0					5																	140502330		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.750C>A	5.37:g.140502330C>A			Q4V761	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V250	ENST00000194152.1	37	c.750	CCDS4246.1	5																																																																																			PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000081818		0.483	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	-	0.00	68	0	C	NM_018938		140502330	+1	tier1	-	no_errors	ENST00000194152	ensembl	human	known	74_37	silent	17.95	32	7	SNP	0.009	A
PDHA2	5161	genome.wustl.edu	37	4	96762049	96762049	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:96762049C>A	ENST00000295266.4	+	1	811	c.748C>A	c.(748-750)Cta>Ata	p.L250I		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	250					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		TATCCCTGGGCTAAAGGTCGA	0.458																																																	0													128.0	131.0	130.0					4																	96762049		2203	4300	6503	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.748C>A	4.37:g.96762049C>A	ENSP00000295266:p.Leu250Ile		B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.L250I	ENST00000295266.4	37	c.748	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	C	2.101	-0.406124	0.04832	.	.	ENSG00000163114	ENST00000295266	D	0.95447	-3.71	4.91	3.01	0.34805	Dehydrogenase, E1 component (1);	0.221786	0.36703	N	0.002446	D	0.86628	0.5978	N	0.03268	-0.37	0.20821	N	0.999842	B	0.14012	0.009	B	0.27380	0.079	T	0.73694	-0.3902	10	0.13470	T	0.59	-11.9771	11.7028	0.51581	0.3152:0.6848:0.0:0.0	.	250	P29803	ODPAT_HUMAN	I	250	ENSP00000295266:L250I	ENSP00000295266:L250I	L	+	1	2	PDHA2	96981072	0.563000	0.26594	0.040000	0.18447	0.480000	0.33159	1.227000	0.32576	1.403000	0.46800	0.467000	0.42956	CTA	PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000163114		0.458	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	-	0.00	34	0	C			96762049	+1	tier1	-	no_errors	ENST00000295266	ensembl	human	known	74_37	missense	21.43	22	6	SNP	0.118	A
POF1B	79983	genome.wustl.edu	37	X	84600956	84600956	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:84600956C>T	ENST00000262753.4	-	6	778	c.633G>A	c.(631-633)caG>caA	p.Q211Q	POF1B_ENST00000373145.3_Silent_p.Q211Q	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	211						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						CTTGGATTTGCTGGCTAGAAT	0.458																																																	0													231.0	185.0	200.0					X																	84600956		2203	4300	6503	SO:0001819	synonymous_variant	0			BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.633G>A	X.37:g.84600956C>T			A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Silent	SNP	NULL	p.Q211	ENST00000262753.4	37	c.633	CCDS14452.1	X																																																																																			POF1B	-	NULL	ENSG00000124429		0.458	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	-	0.00	66	0	C	NM_024921		84600956	-1	tier1	-	no_errors	ENST00000373145	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.000	T
PRAMEF4	400735	genome.wustl.edu	37	1	12942190	12942190	+	Silent	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:12942190T>C	ENST00000235349.5	-	3	430	c.360A>G	c.(358-360)gaA>gaG	p.E120E		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	120					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCATAGCTTCAGACCAAA	0.488																																																	0													24.0	29.0	27.0					1																	12942190		1300	2494	3794	SO:0001819	synonymous_variant	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.360A>G	1.37:g.12942190T>C			Q5LJB5	Silent	SNP	NULL	p.E120	ENST00000235349.5	37	c.360	CCDS30592.1	1																																																																																			PRAMEF4	-	NULL	ENSG00000243073		0.488	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	-	0.00	282	0	T	NM_001009611		12942190	-1	tier1	-	no_errors	ENST00000235349	ensembl	human	known	74_37	silent	8.89	205	20	SNP	0.033	C
PRPF40A	55660	genome.wustl.edu	37	2	153533010	153533010	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:153533010G>T	ENST00000410080.1	-	10	1481	c.940C>A	c.(940-942)Caa>Aaa	p.Q314K		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	341					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						CTAGTAAGTTGTGCTTGTTCC	0.388																																																	0													85.0	80.0	82.0					2																	153533010		1898	4116	6014	SO:0001583	missense	0			AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.940C>A	2.37:g.153533010G>T	ENSP00000386458:p.Gln314Lys		O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom,prints_Antifreeze_1	p.Q314K	ENST00000410080.1	37	c.940	CCDS46430.1	2	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755688	0.31046	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961;ENST00000545856;ENST00000493468	T	0.28666	1.6	5.49	5.49	0.81192	.	0.404770	0.27881	N	0.017469	T	0.35189	0.0923	N	0.19112	0.55	0.48511	D	0.999663	P;P;P	0.43578	0.713;0.811;0.664	P;P;B	0.60789	0.678;0.879;0.275	T	0.02132	-1.1208	10	0.05351	T	0.99	-17.1862	17.1506	0.86777	0.0:0.0:1.0:0.0	.	341;323;314	O75400;O75400-3;E9PFS0	PR40A_HUMAN;.;.	K	314;323;210;261;341;316	ENSP00000386458:Q314K	ENSP00000348770:Q323K	Q	-	1	0	PRPF40A	153241256	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.477000	0.66799	2.584000	0.87258	0.557000	0.71058	CAA	PRPF40A	-	NULL	ENSG00000196504		0.388	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	HGNC	protein_coding	OTTHUMT00000333559.2		0.00	61	0	G	XM_371575		153533010	-1			no_errors	ENST00000410080	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
TAS2R14	50840	genome.wustl.edu	37	12	11126225	11126225	+	Intron	SNP	T	T	C	rs547327427		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:11126225T>C	ENST00000381852.4	-	4	492				PRR4_ENST00000536668.1_Intron			Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14						detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						TTTCATTTGATCCTGTGTTAC	0.403													T|||	1	0.000199681	0.0	0.0	5008	,	,		17311	0.0		0.0	False		,,,				2504	0.001																0													69.0	65.0	66.0					12																	11126225		1868	4108	5976	SO:0001627	intron_variant	0			AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000381852.4:c.1170+28A>G	12.37:g.11126225T>C			Q645X3	RNA	SNP	-	NULL	ENST00000381852.4	37	NULL		12																																																																																			PRR4	-	-	ENSG00000111215		0.403	TAS2R14-002	KNOWN	basic	processed_transcript	PRR4	HGNC	protein_coding	OTTHUMT00000402305.1	-	0.00	49	0	T	NM_023922		11126225	-1	tier1	-	no_errors	ENST00000534923	ensembl	human	known	74_37	rna	15.62	27	5	SNP	0.012	C
PTCHD2	57540	genome.wustl.edu	37	1	11561238	11561238	+	Silent	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:11561238C>A	ENST00000294484.6	+	2	327	c.189C>A	c.(187-189)acC>acA	p.T63T	PTCHD2_ENST00000389575.3_Silent_p.T63T	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	63					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TCTGGAGTACCCTGGGCTGGG	0.662																																																	0													57.0	60.0	59.0					1																	11561238		1990	4162	6152	SO:0001819	synonymous_variant	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.189C>A	1.37:g.11561238C>A			Q5VTU9|Q9UJD6	Silent	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.T63	ENST00000294484.6	37	c.189	CCDS41247.1	1																																																																																			PTCHD2	-	NULL	ENSG00000204624		0.662	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	60	0	C	XM_052561		11561238	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	silent	20.83	38	10	SNP	0.664	A
PTPRE	5791	genome.wustl.edu	37	10	129875962	129875962	+	Missense_Mutation	SNP	G	G	A	rs376366402		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:129875962G>A	ENST00000254667.3	+	19	2086	c.1807G>A	c.(1807-1809)Gag>Aag	p.E603K	PTPRE_ENST00000419012.2_Missense_Mutation_p.E603K|PTPRE_ENST00000306042.5_Missense_Mutation_p.E545K	NM_006504.4	NP_006495.1	P23469	PTPRE_HUMAN	protein tyrosine phosphatase, receptor type, E	603	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of insulin receptor signaling pathway (GO:0046627)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of mast cell activation (GO:0033003)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	22		all_epithelial(44;1.66e-05)|all_lung(145;0.00456)|Lung NSC(174;0.0066)|all_neural(114;0.0936)|Colorectal(57;0.141)|Breast(234;0.166)|Melanoma(40;0.203)			Alendronate(DB00630)	GATTCCCGCCGAGGGCAAAGG	0.662																																					Colon(52;977 1184 20575 41685)												0								G	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	68.0	62.0	64.0		1807,1633	4.4	0.9	10		64	0,8600		0,0,4300	no	missense,missense	PTPRE	NM_006504.4,NM_130435.3	56,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	603/701,545/643	129875962	1,13005	2203	4300	6503	SO:0001583	missense	0			AF406557	CCDS7657.1, CCDS7658.1	10q26	2011-06-09			ENSG00000132334	ENSG00000132334		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9669	protein-coding gene	gene with protein product		600926				8595895	Standard	NM_130435		Approved	PTPE	uc001lkb.3	P23469	OTTHUMG00000019254	ENST00000254667.3:c.1807G>A	10.37:g.129875962G>A	ENSP00000254667:p.Glu603Lys		Q13345|Q5VWH3|Q5VWH4|Q96KQ6	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E603K	ENST00000254667.3	37	c.1807	CCDS7657.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.184963	0.94885	2.27E-4	0.0	ENSG00000132334	ENST00000254667;ENST00000439034;ENST00000419012;ENST00000306042	T;T;T	0.11169	2.8;2.8;2.8	4.44	4.44	0.53790	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.062614	0.64402	D	0.000007	T	0.15176	0.0366	L	0.37750	1.13	0.80722	D	1	D;P;P;P	0.59767	0.986;0.869;0.842;0.869	P;P;B;P	0.48571	0.555;0.582;0.371;0.582	T	0.01795	-1.1272	10	0.72032	D	0.01	.	17.2389	0.87007	0.0:0.0:1.0:0.0	.	581;603;545;603	F5H0X4;Q5VWH4;P23469-2;P23469	.;.;.;PTPRE_HUMAN	K	603;581;603;545	ENSP00000254667:E603K;ENSP00000402337:E603K;ENSP00000303350:E545K	ENSP00000254667:E603K	E	+	1	0	PTPRE	129765952	1.000000	0.71417	0.937000	0.37676	0.817000	0.46193	9.654000	0.98509	2.315000	0.78130	0.561000	0.74099	GAG	PTPRE	-	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132334		0.662	PTPRE-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRE	HGNC	protein_coding	OTTHUMT00000050990.1	-	0.00	127	0	G			129875962	+1	tier1	-	no_errors	ENST00000254667	ensembl	human	known	74_37	missense	9.64	72	8	SNP	1.000	A
QSOX1	5768	genome.wustl.edu	37	1	180135646	180135646	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:180135646C>T	ENST00000367602.3	+	2	360	c.286C>T	c.(286-288)Ctc>Ttc	p.L96F	QSOX1_ENST00000367600.5_Missense_Mutation_p.L96F			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	96	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGCCCTGTATCTCGCCGCCCT	0.592																																																	0													78.0	74.0	75.0					1																	180135646		2203	4300	6503	SO:0001583	missense	0			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.286C>T	1.37:g.180135646C>T	ENSP00000356574:p.Leu96Phe		Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	pfam_ERV/ALR_sulphydryl_oxidase,pfam_Thioredoxin_domain,superfamily_ERV/ALR_sulphydryl_oxidase,superfamily_Thioredoxin-like_fold	p.L96F	ENST00000367602.3	37	c.286	CCDS1337.1	1	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609600	0.46527	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.14766	2.48;2.48	4.83	3.83	0.44106	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.145674	0.45867	D	0.000336	T	0.23370	0.0565	L	0.33792	1.035	0.41132	D	0.985899	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.995;0.992;0.991	T	0.00865	-1.1535	10	0.72032	D	0.01	-21.391	10.0198	0.42035	0.0:0.7327:0.2673:0.0	.	96;96;96	A8K477;O00391;O00391-2	.;QSOX1_HUMAN;.	F	96	ENSP00000356574:L96F;ENSP00000356572:L96F	ENSP00000356572:L96F	L	+	1	0	QSOX1	178402269	0.064000	0.20934	0.723000	0.30687	0.320000	0.28249	0.393000	0.20817	2.393000	0.81446	0.563000	0.77884	CTC	QSOX1	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000116260		0.592	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	HGNC	protein_coding	OTTHUMT00000085289.1		0.00	48	0	C	NM_002826		180135646	+1			no_errors	ENST00000367602	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.409	T
RASGEF1C	255426	genome.wustl.edu	37	5	179564942	179564942	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr5:179564942C>T	ENST00000393371.2	-	1	407	c.111G>A	c.(109-111)gcG>gcA	p.A37A	RASGEF1C_ENST00000519883.1_5'Flank|RASGEF1C_ENST00000361132.4_Silent_p.A37A|RASGEF1C_ENST00000522500.1_5'Flank			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	37	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGAGGATGGCGCTCCATCCA	0.677																																																	0													56.0	52.0	53.0					5																	179564942		2203	4299	6502	SO:0001819	synonymous_variant	0			AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.111G>A	5.37:g.179564942C>T			D3DWQ7|Q7Z4T0|Q8NA49	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A37	ENST00000393371.2	37	c.111	CCDS4452.1	5																																																																																			RASGEF1C	-	superfamily_Ras_GEF_dom,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000146090		0.677	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RASGEF1C	HGNC	protein_coding	OTTHUMT00000253506.2	-	0.00	51	0	C	NM_175062		179564942	-1	tier1	-	no_errors	ENST00000361132	ensembl	human	known	74_37	silent	26.47	25	9	SNP	0.998	T
RBAK	57786	genome.wustl.edu	37	7	5104054	5104054	+	Missense_Mutation	SNP	G	G	C	rs551440532		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr7:5104054G>C	ENST00000353796.3	+	6	1291	c.967G>C	c.(967-969)Ggg>Cgg	p.G323R	RBAK_ENST00000396912.1_Missense_Mutation_p.G323R|RBAK-RBAKDN_ENST00000407184.1_Intron|RBAK-RBAKDN_ENST00000396904.2_Intron	NM_001204456.1	NP_001191385.1	Q9NYW8	RBAK_HUMAN	RB-associated KRAB zinc finger	323					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(2)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	10		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TAATGAATGTGGGAAAACCTT	0.428																																																	0													88.0	90.0	89.0					7																	5104054		2203	4300	6503	SO:0001583	missense	0			AF226869	CCDS5337.1	7p22.1	2013-01-08			ENSG00000146587	ENSG00000146587		"""Zinc fingers, C2H2-type"", ""-"""	17680	protein-coding gene	gene with protein product		608191					Standard	NM_021163		Approved	ZNF769	uc003sns.1	Q9NYW8	OTTHUMG00000121155	ENST00000353796.3:c.967G>C	7.37:g.5104054G>C	ENSP00000275423:p.Gly323Arg		A6NDF2|A8KAK4|B2RN44|B9EGS1|F8W6M7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G323R	ENST00000353796.3	37	c.967	CCDS5337.1	7	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416819	0.62511	.	.	ENSG00000146587	ENST00000353796;ENST00000396912	T;T	0.01484	4.84;4.84	3.61	2.73	0.32206	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.121727	0.37906	N	0.001886	T	0.08268	0.0206	M	0.77820	2.39	0.40644	D	0.981977	D	0.89917	1.0	D	0.97110	1.0	T	0.06935	-1.0799	8	.	.	.	.	8.9713	0.35908	0.1144:0.0:0.8856:0.0	.	323	Q9NYW8	RBAK_HUMAN	R	323	ENSP00000275423:G323R;ENSP00000380120:G323R	.	G	+	1	0	RBAK	5070580	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.894000	0.69806	1.096000	0.41439	0.555000	0.69702	GGG	RBAK	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000146587		0.428	RBAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBAK	HGNC	protein_coding	OTTHUMT00000241640.2		0.00	42	0	G	NM_021163		5104054	+1			no_errors	ENST00000353796	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	C
RFC3	5983	genome.wustl.edu	37	13	34410304	34410304	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr13:34410304G>A	ENST00000380071.3	+	9	1073	c.943G>A	c.(943-945)Gca>Aca	p.A315T	RFC3_ENST00000434425.1_Intron	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	315					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		GGCACAAATGGCAGCTTACTA	0.388																																																	0													150.0	136.0	141.0					13																	34410304		2203	4300	6503	SO:0001583	missense	0				CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.943G>A	13.37:g.34410304G>A	ENSP00000369411:p.Ala315Thr		C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.A315T	ENST00000380071.3	37	c.943	CCDS9352.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.557847	0.96514	.	.	ENSG00000133119	ENST00000380071	T	0.52754	0.65	5.67	5.67	0.87782	DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);DNA polymerase III, clamp-loader complex, subunit E, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75258	0.3825	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78745	-0.2084	10	0.66056	D	0.02	-20.405	19.1047	0.93290	0.0:0.0:1.0:0.0	.	315	P40938	RFC3_HUMAN	T	315	ENSP00000369411:A315T	ENSP00000369411:A315T	A	+	1	0	RFC3	33308304	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.405000	0.97313	2.819000	0.97034	0.655000	0.94253	GCA	RFC3	-	superfamily_DNA_pol3_clamp-load_cplx_C	ENSG00000133119		0.388	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC3	HGNC	protein_coding	OTTHUMT00000044450.2	-	0.00	109	0	G	NM_002915		34410304	+1	tier1	-	no_errors	ENST00000380071	ensembl	human	known	74_37	missense	5.48	68	4	SNP	1.000	A
RFPL2	10739	genome.wustl.edu	37	22	32588920	32588920	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr22:32588920C>T	ENST00000400237.1	-	4	1460	c.525G>A	c.(523-525)ctG>ctA	p.L175L	RFPL2_ENST00000248983.4_Silent_p.L85L|RFPL2_ENST00000248980.4_Silent_p.L114L|RFPL2_ENST00000400236.3_Silent_p.L85L|RFPL2_ENST00000489846.1_5'UTR			O75678	RFPL2_HUMAN	ret finger protein-like 2	175	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|skin(2)	21						GGTTCATCTGCAGAATCTTCT	0.522																																																	0													128.0	129.0	129.0					22																	32588920		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ010231	CCDS43009.1, CCDS46694.1, CCDS43009.2	22q12.3	2008-06-12				ENSG00000128253		"""RING-type (C3HC4) zinc fingers"""	9979	protein-coding gene	gene with protein product		605969				10508838	Standard	NM_001098527		Approved	RNF79	uc003amg.3	O75678		ENST00000400237.1:c.525G>A	22.37:g.32588920C>T				Silent	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.L175	ENST00000400237.1	37	c.525	CCDS43009.2	22																																																																																			RFPL2	-	pfam_RDM_domain_RFPL,pfscan_B30.2/SPRY	ENSG00000128253		0.522	RFPL2-001	KNOWN	basic|CCDS	protein_coding	RFPL2	HGNC	protein_coding	OTTHUMT00000075262.2	-	0.00	118	0	C	NM_006605		32588920	-1	tier1	-	no_errors	ENST00000400237	ensembl	human	known	74_37	silent	13.19	79	12	SNP	0.039	T
RGS8	85397	genome.wustl.edu	37	1	182635137	182635137	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:182635137C>T	ENST00000483095.2	-	5	417	c.160G>A	c.(160-162)Gca>Aca	p.A54T	RGS8_ENST00000258302.4_Missense_Mutation_p.A72T|RGS8_ENST00000491420.2_5'UTR|RGS8_ENST00000367557.4_Missense_Mutation_p.A54T|RGS8_ENST00000367556.1_Missense_Mutation_p.A54T			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	54					positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						AAGGAATCTGCCCACCTCGTA	0.403																																					Ovarian(189;1262 3804 41973)												0													170.0	170.0	170.0					1																	182635137		2203	4300	6503	SO:0001583	missense	0			AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.160G>A	1.37:g.182635137C>T	ENSP00000426289:p.Ala54Thr		B4DGL9|Q3SYD2	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.A72T	ENST00000483095.2	37	c.214	CCDS41443.1	1	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671316	0.67814	.	.	ENSG00000135824	ENST00000483095;ENST00000258302;ENST00000367557;ENST00000367556;ENST00000508450	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.47	5.47	0.80525	Regulator of G protein signalling (1);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.058699	0.64402	D	0.000002	T	0.33498	0.0865	L	0.61218	1.895	0.49213	D	0.999764	B;B	0.31435	0.071;0.323	B;B	0.28638	0.02;0.092	T	0.10474	-1.0628	10	0.46703	T	0.11	.	16.2314	0.82344	0.0:1.0:0.0:0.0	.	54;72	P57771;P57771-2	RGS8_HUMAN;.	T	54;72;54;54;54	ENSP00000426289:A54T;ENSP00000258302:A72T;ENSP00000356528:A54T;ENSP00000356527:A54T	ENSP00000258302:A72T	A	-	1	0	RGS8	180901760	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.135000	0.42112	2.561000	0.86390	0.655000	0.94253	GCA	RGS8	-	superfamily_Regulat_G_prot_signal_superfam,prints_RGS_dom	ENSG00000135824		0.403	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RGS8	HGNC	protein_coding	OTTHUMT00000358979.1	-	0.00	59	0	C	NM_033345		182635137	-1	tier1	-	no_errors	ENST00000258302	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
RIBC1	158787	genome.wustl.edu	37	X	53455374	53455374	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:53455374G>T	ENST00000375327.3	+	5	496	c.343G>T	c.(343-345)Gat>Tat	p.D115Y	RIBC1_ENST00000457095.1_Missense_Mutation_p.D115Y|RIBC1_ENST00000414955.2_Intron	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1	115										lung(2)	2						TAGTCTTTGGGATCCAGGCCA	0.522																																																	0													94.0	77.0	83.0					X																	53455374		2203	4300	6503	SO:0001583	missense	0			AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.343G>T	X.37:g.53455374G>T	ENSP00000364476:p.Asp115Tyr		B4E297|E9PDU2|Q5H931|Q96A80	Missense_Mutation	SNP	pfam_RIB43A	p.D115Y	ENST00000375327.3	37	c.343	CCDS35299.1	X	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007826	0.35415	.	.	ENSG00000158423	ENST00000329209;ENST00000457095;ENST00000375327	T;T;T	0.35236	1.32;1.32;1.32	5.18	0.268	0.15626	.	0.599363	0.17249	N	0.181258	T	0.54062	0.1835	M	0.78285	2.405	0.20196	N	0.999924	P;D	0.89917	0.955;1.0	P;D	0.66351	0.577;0.943	T	0.46992	-0.9151	10	0.72032	D	0.01	-0.7878	9.5836	0.39504	0.3914:0.0:0.6086:0.0	.	115;115	Q8N443;Q8N443-2	RIBC1_HUMAN;.	Y	115	ENSP00000332142:D115Y;ENSP00000402080:D115Y;ENSP00000364476:D115Y	ENSP00000332142:D115Y	D	+	1	0	RIBC1	53472099	0.311000	0.24536	0.031000	0.17742	0.513000	0.34164	0.748000	0.26305	-0.122000	0.11766	0.600000	0.82982	GAT	RIBC1	-	pfam_RIB43A	ENSG00000158423		0.522	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RIBC1	HGNC	protein_coding	OTTHUMT00000056762.1	-	0.00	33	0	G	NM_144968		53455374	+1	tier1	-	no_errors	ENST00000375327	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.129	T
SDK2	54549	genome.wustl.edu	37	17	71415408	71415408	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr17:71415408G>T	ENST00000392650.3	-	16	2083	c.2083C>A	c.(2083-2085)Cag>Aag	p.Q695K	SDK2_ENST00000388726.3_Missense_Mutation_p.Q695K	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	695	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ATGACGTTCTGTGGAGGGGCC	0.557																																																	0													55.0	50.0	52.0					17																	71415408		2203	4300	6503	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2083C>A	17.37:g.71415408G>T	ENSP00000376421:p.Gln695Lys		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q695K	ENST00000392650.3	37	c.2083	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	G	15.21	2.767225	0.49574	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.57273	0.41;0.41	4.87	4.87	0.63330	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.49372	0.1553	L	0.59967	1.855	0.80722	D	1	B;B	0.20368	0.036;0.044	B;B	0.28011	0.051;0.085	T	0.49390	-0.8945	10	0.05620	T	0.96	.	18.0116	0.89225	0.0:0.0:1.0:0.0	.	695;695	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	K	319;695;695;695	ENSP00000376421:Q695K;ENSP00000373378:Q695K	ENSP00000324967:Q695K	Q	-	1	0	SDK2	68927003	1.000000	0.71417	0.998000	0.56505	0.815000	0.46073	5.258000	0.65479	2.266000	0.75297	0.462000	0.41574	CAG	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.557	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2		0.00	88	0	G	NM_019064		71415408	-1			no_errors	ENST00000392650	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
SEMA4A	64218	genome.wustl.edu	37	1	156130700	156130700	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:156130700C>T	ENST00000368285.3	+	8	957	c.690C>T	c.(688-690)gaC>gaT	p.D230D	SEMA4A_ENST00000368286.2_Silent_p.D98D|SEMA4A_ENST00000368284.1_Silent_p.D98D|SEMA4A_ENST00000487358.1_3'UTR|SEMA4A_ENST00000355014.2_Silent_p.D230D|SEMA4A_ENST00000368282.1_Silent_p.D230D	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	230	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					CCGCAGATGACGCCTCCTTTG	0.597																																																	0													82.0	84.0	83.0					1																	156130700		2203	4300	6503	SO:0001819	synonymous_variant	0			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.690C>T	1.37:g.156130700C>T			B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.D230	ENST00000368285.3	37	c.690	CCDS1132.1	1																																																																																			SEMA4A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000196189		0.597	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4A	HGNC	protein_coding	OTTHUMT00000039484.2	-	0.00	41	0	C	NM_022367		156130700	+1	tier1	-	no_errors	ENST00000355014	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.993	T
SGSH	6448	genome.wustl.edu	37	17	78188874	78188874	+	Missense_Mutation	SNP	G	G	A	rs375755239		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr17:78188874G>A	ENST00000326317.6	-	3	399	c.313C>T	c.(313-315)Cgg>Tgg	p.R105W	SGSH_ENST00000570923.1_Silent_p.C116C|SGSH_ENST00000572208.1_5'UTR|SGSH_ENST00000534910.1_Intron	NM_000199.3	NP_000190.1	P51688	SPHM_HUMAN	N-sulfoglucosamine sulfohydrolase	105					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan metabolic process (GO:0006029)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	catalytic activity (GO:0003824)|metal ion binding (GO:0046872)|N-sulfoglucosamine sulfohydrolase activity (GO:0016250)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GGCAGGCTCCGCACCTTGTCG	0.667																																																	0									TRP/ARG	0,4400		0,0,2200	60.0	52.0	55.0		313	3.7	1.0	17		55	2,8598	2.2+/-6.3	0,2,4298	no	missense	SGSH	NM_000199.3	101	0,2,6498	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	105/503	78188874	2,12998	2200	4300	6500	SO:0001583	missense	0			BC047318	CCDS11770.1	17q25.3	2011-11-08	2008-07-31			ENSG00000181523	3.10.1.1		10818	protein-coding gene	gene with protein product	"""sulfamidase"", ""mucopolysaccharidosis type IIIA"""	605270				7493035	Standard	NM_000199		Approved	HSS, MPS3A, SFMD	uc002jxz.4	P51688		ENST00000326317.6:c.313C>T	17.37:g.78188874G>A	ENSP00000314606:p.Arg105Trp		A8K5E2	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.R105W	ENST00000326317.6	37	c.313	CCDS11770.1	17	.	.	.	.	.	.	.	.	.	.	g	24.8	4.569887	0.86542	0.0	2.33E-4	ENSG00000181523	ENST00000326317	D	0.98633	-5.04	3.65	3.65	0.41850	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.413104	0.24271	N	0.039988	D	0.98626	0.9540	M	0.69358	2.11	0.80722	D	1	D;D	0.89917	0.995;1.0	P;D	0.71870	0.846;0.975	D	0.98842	1.0755	10	0.87932	D	0	.	10.8727	0.46894	0.0:0.0:0.8115:0.1885	.	105;108	P51688;Q59EB1	SPHM_HUMAN;.	W	105	ENSP00000314606:R105W	ENSP00000314606:R105W	R	-	1	2	SGSH	75803469	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.319000	0.59197	1.865000	0.54081	0.558000	0.71614	CGG	SGSH	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000181523		0.667	SGSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSH	HGNC	protein_coding	OTTHUMT00000437695.1	-	0.00	137	0	G	NM_000199		78188874	-1	tier1	-	no_errors	ENST00000326317	ensembl	human	known	74_37	missense	12.99	67	10	SNP	1.000	A
SIM2	6493	genome.wustl.edu	37	21	38114049	38114049	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr21:38114049C>T	ENST00000290399.6	+	8	1495	c.882C>T	c.(880-882)taC>taT	p.Y294Y	SIM2_ENST00000430056.3_Silent_p.Y294Y	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	294	PAC.				cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						CCACCAAGTACTACCGGCTGC	0.652																																																	0													52.0	36.0	41.0					21																	38114049		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.882C>T	21.37:g.38114049C>T			O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Silent	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom	p.Y294	ENST00000290399.6	37	c.882	CCDS13646.1	21																																																																																			SIM2	-	pfam_PAS_fold_3,superfamily_PAS,smart_PAC	ENSG00000159263		0.652	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM2	HGNC	protein_coding	OTTHUMT00000194692.1		0.00	93	0	C	NM_009586		38114049	+1			no_errors	ENST00000290399	ensembl	human	known	74_37	silent	6.15	61	4	SNP	1.000	T
SLC12A1	6557	genome.wustl.edu	37	15	48522690	48522690	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:48522690G>A	ENST00000558405.1	+	6	979	c.965G>A	c.(964-966)tGg>tAg	p.W322*	SLC12A1_ENST00000559723.1_3'UTR|SLC12A1_ENST00000380993.3_Nonsense_Mutation_p.W322*|SLC12A1_ENST00000396577.3_Nonsense_Mutation_p.W322*|SLC12A1_ENST00000330289.6_Nonsense_Mutation_p.W322*			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	322					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	GGAATGGAATGGGAGGCAAAG	0.423																																																	0													68.0	61.0	63.0					15																	48522690		2198	4297	6495	SO:0001587	stop_gained	0				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.965G>A	15.37:g.48522690G>A	ENSP00000453409:p.Trp322*		A8JYA2|E9PDW4	Nonsense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.W322*	ENST00000558405.1	37	c.965	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	G	37	6.382268	0.97520	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000330289	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3096	0.94182	0.0:0.0:1.0:0.0	.	.	.	.	X	135;322;322;322	.	ENSP00000331550:W322X	W	+	2	0	SLC12A1	46309982	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.548000	0.85928	0.650000	0.86243	TGG	SLC12A1	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000074803		0.423	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1		0.00	51	0	G			48522690	+1			no_errors	ENST00000380993	ensembl	human	known	74_37	nonsense	9.68	28	3	SNP	1.000	A
SLC22A25	387601	genome.wustl.edu	37	11	62996898	62996898	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:62996898G>T	ENST00000306494.6	-	1	226	c.227C>A	c.(226-228)tCc>tAc	p.S76Y	SLC22A10_ENST00000535888.1_Intron|SLC22A25_ENST00000403374.2_5'Flank|SLC22A10_ENST00000525620.1_Intron	NM_199352.3	NP_955384.3			solute carrier family 22, member 25											NS(2)|breast(2)|endometrium(4)|kidney(2)|large_intestine(7)|lung(7)|ovary(3)|skin(7)	34						GAATGGGATGGAGATTCTCAG	0.512																																																	0													135.0	122.0	127.0					11																	62996898		2201	4298	6499	SO:0001583	missense	0			AY437532	CCDS31592.1	11q12.3	2014-05-20			ENSG00000196600	ENSG00000196600		"""Solute carriers"""	32935	protein-coding gene	gene with protein product		610792	"""MGI:2442751, MGI:2385316, MGI:3042283, MGI:3645714, MGI:3605624, MGI:2442750"""			17714910	Standard	NM_199352		Approved	UST6, HIMTP, MGC120420	uc001nwr.1	Q6T423	OTTHUMG00000165340	ENST00000306494.6:c.227C>A	11.37:g.62996898G>T	ENSP00000307443:p.Ser76Tyr			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S76Y	ENST00000306494.6	37	c.227	CCDS31592.1	11	.	.	.	.	.	.	.	.	.	.	G	13.73	2.324875	0.41197	.	.	ENSG00000196600	ENST00000306494;ENST00000451441	T	0.37752	1.18	3.54	2.61	0.31194	Major facilitator superfamily domain (1);	0.200640	0.43260	D	0.000596	T	0.50000	0.1590	M	0.86740	2.835	0.80722	D	1	D;P	0.55800	0.973;0.939	P;P	0.51974	0.686;0.456	T	0.51849	-0.8653	10	0.56958	D	0.05	.	7.0866	0.25261	0.1343:0.0:0.8657:0.0	.	74;76	A4IF29;Q6T423	.;S22AP_HUMAN	Y	76	ENSP00000307443:S76Y	ENSP00000307443:S76Y	S	-	2	0	SLC22A25	62753474	1.000000	0.71417	0.999000	0.59377	0.514000	0.34195	0.895000	0.28363	0.607000	0.29982	0.289000	0.19496	TCC	SLC22A25	-	pfscan_MFS_dom	ENSG00000196600		0.512	SLC22A25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A25	HGNC	protein_coding	OTTHUMT00000383519.3		0.00	115	0	G	NM_199352		62996898	-1			no_errors	ENST00000306494	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.996	T
SLITRK1	114798	genome.wustl.edu	37	13	84455509	84455509	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr13:84455509T>C	ENST00000377084.2	-	1	1019	c.134A>G	c.(133-135)aAg>aGg	p.K45R		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	45	LRRNT 1.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)		p.K45fs*64(1)		NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		TGTGAAGCCCTTTTTTTCACA	0.463																																																	1	Deletion - Frameshift(1)	large_intestine(1)											90.0	89.0	89.0					13																	84455509		2203	4300	6503	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.134A>G	13.37:g.84455509T>C	ENSP00000366288:p.Lys45Arg		Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K45R	ENST00000377084.2	37	c.134	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	T	3.734	-0.054985	0.07362	.	.	ENSG00000178235	ENST00000377084	T	0.51817	0.69	4.59	4.59	0.56863	.	0.103397	0.64402	D	0.000003	T	0.26810	0.0656	N	0.10809	0.05	0.41694	D	0.989363	B	0.09022	0.002	B	0.16722	0.016	T	0.09997	-1.0649	10	0.09338	T	0.73	-14.5951	13.2304	0.59941	0.0:0.0:0.0:1.0	.	45	Q96PX8	SLIK1_HUMAN	R	45	ENSP00000366288:K45R	ENSP00000366288:K45R	K	-	2	0	SLITRK1	83353510	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.889000	0.48601	2.050000	0.60909	0.459000	0.35465	AAG	SLITRK1	-	NULL	ENSG00000178235		0.463	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1		0.00	47	0	T	NM_052910		84455509	-1			no_errors	ENST00000377084	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	C
SLITRK2	84631	genome.wustl.edu	37	X	144906321	144906321	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chrX:144906321delA	ENST00000370490.1	+	1	6633	c.2378delA	c.(2377-2379)caafs	p.Q793fs	SLITRK2_ENST00000413937.2_Frame_Shift_Del_p.Q793fs|SLITRK2_ENST00000434188.2_Frame_Shift_Del_p.Q793fs|SLITRK2_ENST00000447897.2_Frame_Shift_Del_p.Q793fs|TMEM257_ENST00000408967.2_5'Flank|SLITRK2_ENST00000428560.2_Frame_Shift_Del_p.Q793fs			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	793					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TCTCGACGCCAAAACCAAGAC	0.473																																																	0													124.0	119.0	120.0					X																	144906321		2203	4300	6503	SO:0001589	frameshift_variant	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.2378delA	X.37:g.144906321delA	ENSP00000359521:p.Gln793fs		A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Frame_Shift_Del	DEL	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.N794fs	ENST00000370490.1	37	c.2378	CCDS14680.1	X																																																																																			SLITRK2	-	NULL	ENSG00000185985		0.473	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1		0.00	58	0	A	NM_032539		144906321	+1	tier1		no_errors	ENST00000370490	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	1.000	-
SMAD4	4089	genome.wustl.edu	37	18	48573628	48573628	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr18:48573628G>A	ENST00000342988.3	+	2	750	c.212G>A	c.(211-213)tGt>tAt	p.C71Y	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000452201.2_Missense_Mutation_p.C71Y|SMAD4_ENST00000398417.2_Missense_Mutation_p.C71Y|SMAD4_ENST00000588745.1_Missense_Mutation_p.C71Y	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	71	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(5)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CCTAGTAAATGTGTTACCATA	0.353																																																	41	Whole gene deletion(36)|Unknown(5)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|oesophagus(1)|NS(1)											119.0	130.0	126.0					18																	48573628		2203	4300	6503	SO:0001583	missense	0			U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.212G>A	18.37:g.48573628G>A	ENSP00000341551:p.Cys71Tyr		A8K405	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.C71Y	ENST00000342988.3	37	c.212	CCDS11950.1	18	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441503	0.83993	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	D;D;D	0.89552	-2.53;-2.53;-2.53	5.64	5.64	0.86602	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.96281	0.8787	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97079	0.9783	10	0.87932	D	0	.	18.4607	0.90737	0.0:0.0:1.0:0.0	.	71	Q13485	SMAD4_HUMAN	Y	71	ENSP00000409551:C71Y;ENSP00000341551:C71Y;ENSP00000381452:C71Y	ENSP00000341551:C71Y	C	+	2	0	SMAD4	46827626	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.657000	0.90304	0.655000	0.94253	TGT	SMAD4	-	pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_MAD_homology_MH1	ENSG00000141646		0.353	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD4	HGNC	protein_coding	OTTHUMT00000255993.3		0.00	44	0	G	NM_005359		48573628	+1			no_errors	ENST00000342988	ensembl	human	known	74_37	missense	6.67	27	2	SNP	1.000	A
SNHG14	104472715	genome.wustl.edu	37	15	25427435	25427435	+	RNA	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:25427435C>T	ENST00000424208.1	+	0	232				SNORD115-6_ENST00000363942.1_RNA|SNHG14_ENST00000441592.2_RNA|SNHG14_ENST00000365306.1_RNA|SNORD115-8_ENST00000363856.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		CACTGAAGATCGGGCCCTTCC	0.632																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25427435C>T				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.632	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	45	0	C			25427435	+1	tier1	-	no_errors	ENST00000424208	ensembl	human	known	74_37	rna	12.20	36	5	SNP	0.000	T
MTCL1	23255	genome.wustl.edu	37	18	8819009	8819009	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr18:8819009C>G	ENST00000306329.11	+	11	3865	c.3865C>G	c.(3865-3867)Caa>Gaa	p.Q1289E	SOGA2_ENST00000517570.1_Missense_Mutation_p.Q929E|SOGA2_ENST00000306285.7_Intron|SOGA2_ENST00000518815.1_Intron|SOGA2_ENST00000359865.3_Missense_Mutation_p.Q970E|SOGA2_ENST00000400050.3_Missense_Mutation_p.Q929E																							CCTCTGTGATCAAAAAGACGG	0.507																																																	0													71.0	81.0	78.0					18																	8819009		2203	4300	6503	SO:0001583	missense	0																														ENST00000306329.11:c.3865C>G	18.37:g.8819009C>G	ENSP00000305027:p.Gln1289Glu			Missense_Mutation	SNP	pfam_SOGA	p.Q970E	ENST00000306329.11	37	c.2908		18	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319650	0.23994	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.42131	0.98;0.98;0.98	5.96	5.08	0.68730	.	0.817365	0.10679	N	0.646594	T	0.39009	0.1062	L	0.54323	1.7	0.31070	N	0.713125	B	0.30634	0.288	B	0.30401	0.115	T	0.29088	-1.0023	10	0.15499	T	0.54	-0.6732	12.628	0.56640	0.0:0.8698:0.0:0.1302	.	970	Q9Y4B5-3	.	E	991;929;970;929	ENSP00000429556:Q929E;ENSP00000352927:Q970E;ENSP00000382924:Q929E	ENSP00000305027:Q991E	Q	+	1	0	CCDC165	8809009	0.571000	0.26659	0.171000	0.22900	0.294000	0.27393	2.270000	0.43355	2.813000	0.96785	0.655000	0.94253	CAA	SOGA2	-	NULL	ENSG00000168502		0.507	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	-	0.00	55	0	C			8819009	+1	tier1	-	no_errors	ENST00000359865	ensembl	human	known	74_37	missense	16.39	51	10	SNP	0.060	G
SORBS1	10580	genome.wustl.edu	37	10	97154774	97154774	+	Silent	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr10:97154774G>T	ENST00000361941.3	-	12	1307	c.1281C>A	c.(1279-1281)atC>atA	p.I427I	SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000607232.1_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000393949.1_Silent_p.I418I|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371245.3_Intron|SORBS1_ENST00000347291.4_Silent_p.I295I|SORBS1_ENST00000277982.5_Silent_p.I427I|SORBS1_ENST00000371247.2_Silent_p.I427I|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000353505.5_Intron|SORBS1_ENST00000354106.3_Silent_p.I418I|SORBS1_ENST00000371246.2_Silent_p.I427I|SORBS1_ENST00000371227.4_Intron	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AAGTTTGCTGGATTTCAGGAA	0.408																																																	0													253.0	302.0	286.0					10																	97154774		2203	4300	6503	SO:0001819	synonymous_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.1281C>A	10.37:g.97154774G>T				Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.I427	ENST00000361941.3	37	c.1281	CCDS31255.1	10																																																																																			SORBS1	-	pfscan_Sorb	ENSG00000095637		0.408	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	-	0.00	117	0	G			97154774	-1	tier1	-	no_errors	ENST00000361941	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	T
SRP54	6729	genome.wustl.edu	37	14	35468837	35468837	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr14:35468837A>T	ENST00000556994.1	+	4	549	c.152A>T	c.(151-153)cAa>cTa	p.Q51L	SRP54_ENST00000555535.1_3'UTR|SRP54_ENST00000555557.1_Intron|SRP54_ENST00000546080.1_Intron|SRP54_ENST00000216774.6_Missense_Mutation_p.Q51L			P61011	SRP54_HUMAN	signal recognition particle 54kDa	51	G-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		CTAGTGAAGCAACTAAGAGAA	0.323																																																	0													108.0	112.0	111.0					14																	35468837		2203	4299	6502	SO:0001583	missense	0			X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.152A>T	14.37:g.35468837A>T	ENSP00000451818:p.Gln51Leu		B2R759|B4DUW6|P13624	Missense_Mutation	SNP	pfam_SRP54_GTPase_dom,pfam_Signal_recog_particle_SRP54_M,pfam_Signal_recog_particl_SRP54_hlx,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP54_M,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	p.Q51L	ENST00000556994.1	37	c.152	CCDS9652.1	14	.	.	.	.	.	.	.	.	.	.	A	17.70	3.453895	0.63290	.	.	ENSG00000100883	ENST00000556994;ENST00000555746;ENST00000216774	.	.	.	5.64	5.64	0.86602	Signal recognition particle, SRP54 subunit, helical bundle (4);	0.000000	0.85682	D	0.000000	T	0.73613	0.3609	M	0.90309	3.105	0.80722	D	1	B	0.29085	0.232	B	0.26094	0.066	T	0.76310	-0.3006	9	0.72032	D	0.01	-11.417	15.862	0.79032	1.0:0.0:0.0:0.0	.	51	P61011	SRP54_HUMAN	L	51	.	ENSP00000216774:Q51L	Q	+	2	0	SRP54	34538588	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.109000	0.77062	2.145000	0.66743	0.460000	0.39030	CAA	SRP54	-	pfam_Signal_recog_particl_SRP54_hlx,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,tigrfam_SRP54_euk	ENSG00000100883		0.323	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP54	HGNC	protein_coding	OTTHUMT00000276643.2	-	0.00	67	0	A	NM_003136		35468837	+1	tier1	-	no_errors	ENST00000216774	ensembl	human	known	74_37	missense	9.26	49	5	SNP	1.000	T
STK16	8576	genome.wustl.edu	37	2	220111885	220111885	+	Silent	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:220111885C>T	ENST00000409638.3	+	4	529	c.357C>T	c.(355-357)ttC>ttT	p.F119F	GLB1L_ENST00000356283.3_5'Flank|STK16_ENST00000396738.2_Silent_p.F119F|STK16_ENST00000409743.1_Silent_p.F119F|STK16_ENST00000486813.1_3'UTR|GLB1L_ENST00000295759.7_5'Flank|STK16_ENST00000409516.3_Intron|STK16_ENST00000409260.1_Silent_p.F164F|GLB1L_ENST00000392089.2_5'Flank	NM_001008910.2	NP_001008910.1	O75716	STK16_HUMAN	serine/threonine kinase 16	119	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|protein autophosphorylation (GO:0046777)	Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAGGCAACTTCCTGACCGAGG	0.527																																					Pancreas(34;887 922 17165 36961 39622)												0													87.0	90.0	89.0					2																	220111885		1997	4164	6161	SO:0001819	synonymous_variant	0			AF060798	CCDS42822.1	2q35	2010-04-16			ENSG00000115661	ENSG00000115661			11394	protein-coding gene	gene with protein product		604719				9712705	Standard	NM_001008910		Approved	PKL12, MPSK	uc002vko.2	O75716	OTTHUMG00000154520	ENST00000409638.3:c.357C>T	2.37:g.220111885C>T			A8K9H9|Q5U0F8|Q96KI2|Q9BUH4|Q9UEN3|Q9UP78	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F119	ENST00000409638.3	37	c.357	CCDS42822.1	2																																																																																			STK16	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000115661		0.527	STK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK16	HGNC	protein_coding	OTTHUMT00000335679.1	-	0.00	107	0	C			220111885	+1	tier1	-	no_errors	ENST00000396738	ensembl	human	known	74_37	silent	8.00	69	6	SNP	1.000	T
SYT10	341359	genome.wustl.edu	37	12	33560221	33560221	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:33560221C>A	ENST00000228567.3	-	3	876	c.580G>T	c.(580-582)Gaa>Taa	p.E194*	SYT10_ENST00000535526.1_Nonsense_Mutation_p.E13*|SYT10_ENST00000567656.1_5'Flank|RP11-438D14.2_ENST00000561632.1_lincRNA	NM_198992.3	NP_945343.1	Q6XYQ8	SYT10_HUMAN	synaptotagmin X	194					regulation of calcium ion-dependent exocytosis (GO:0017158)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.E194*(2)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(3)|skin(4)|urinary_tract(1)	42	Lung NSC(5;8.37e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0334)					AAAACAGGTTCTGTGCCCATG	0.448																																																	2	Substitution - Nonsense(2)	large_intestine(1)|lung(1)											162.0	150.0	154.0					12																	33560221		2203	4300	6503	SO:0001587	stop_gained	0			AY198413	CCDS8732.1	12p11	2013-01-21			ENSG00000110975	ENSG00000110975		"""Synaptotagmins"""	19266	protein-coding gene	gene with protein product							Standard	NM_198992		Approved		uc001rll.1	Q6XYQ8	OTTHUMG00000169269	ENST00000228567.3:c.580G>T	12.37:g.33560221C>A	ENSP00000228567:p.Glu194*		Q495U2	Nonsense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.E194*	ENST00000228567.3	37	c.580	CCDS8732.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.224620	0.97390	.	.	ENSG00000110975	ENST00000228567;ENST00000535526	.	.	.	4.66	4.66	0.58398	.	0.162759	0.28425	U	0.015386	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	15.5979	0.76602	0.0:1.0:0.0:0.0	.	.	.	.	X	194;13	.	ENSP00000228567:E194X	E	-	1	0	SYT10	33451488	0.996000	0.38824	0.860000	0.33809	0.845000	0.48019	3.103000	0.50298	2.524000	0.85096	0.563000	0.77884	GAA	SYT10	-	NULL	ENSG00000110975		0.448	SYT10-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYT10	HGNC	protein_coding	OTTHUMT00000403222.1		0.00	58	0	C	NM_198992		33560221	-1			no_errors	ENST00000228567	ensembl	human	known	74_37	nonsense	6.90	27	2	SNP	0.996	A
TBRG1	84897	genome.wustl.edu	37	11	124501301	124501301	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:124501301C>T	ENST00000441174.3	+	8	1282	c.1078C>T	c.(1078-1080)Ccc>Tcc	p.P360S	TBRG1_ENST00000438907.2_3'UTR|TBRG1_ENST00000375005.4_Missense_Mutation_p.P209S	NM_032811.2	NP_116200.2	Q3YBR2	TBRG1_HUMAN	transforming growth factor beta regulator 1	360					cell cycle arrest (GO:0007050)|DNA replication (GO:0006260)|negative regulation of cell proliferation (GO:0008285)|nucleolus to nucleoplasm transport (GO:0032066)|protein stabilization (GO:0050821)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				kidney(1)|prostate(1)	2	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0218)		TCAGAATGATCCCCTTCTGCC	0.453																																																	0													181.0	187.0	185.0					11																	124501301		2201	4299	6500	SO:0001583	missense	0			AK074140	CCDS8448.2	11q24.2	2008-02-05			ENSG00000154144	ENSG00000154144			29551	protein-coding gene	gene with protein product	"""nuclear interactor of ARF and MDM2"""	610614				7654366, 17110379	Standard	NM_032811		Approved	FLJ14621, TB-5, NIAM	uc001qak.4	Q3YBR2	OTTHUMG00000153024	ENST00000441174.3:c.1078C>T	11.37:g.124501301C>T	ENSP00000409016:p.Pro360Ser		Q53GJ5|Q66ZJ6|Q69YS7|Q8TCS4|Q8TEI4|Q96SV0	Missense_Mutation	SNP	pfam_FYrich_N,pfam_FYrich_C,smart_FYrich_N,smart_FYrich_C	p.P360S	ENST00000441174.3	37	c.1078	CCDS8448.2	11	.	.	.	.	.	.	.	.	.	.	C	9.621	1.133808	0.21123	.	.	ENSG00000154144	ENST00000441174;ENST00000375005	T;T	0.79653	-1.29;-1.02	5.96	4.09	0.47781	.	0.299705	0.37809	N	0.001934	T	0.61085	0.2319	N	0.17082	0.46	0.26033	N	0.981717	B;B	0.13594	0.001;0.008	B;B	0.12837	0.001;0.008	T	0.43343	-0.9397	10	0.15499	T	0.54	-2.9666	5.4789	0.16713	0.1591:0.6738:0.0:0.1672	.	360;209	Q3YBR2;Q3YBR2-2	TBRG1_HUMAN;.	S	360;209	ENSP00000409016:P360S;ENSP00000364144:P209S	ENSP00000364144:P209S	P	+	1	0	TBRG1	124006511	0.989000	0.36119	0.991000	0.47740	0.600000	0.36913	0.825000	0.27393	0.845000	0.35118	-0.137000	0.14449	CCC	TBRG1	-	NULL	ENSG00000154144		0.453	TBRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBRG1	HGNC	protein_coding	OTTHUMT00000329057.2	-	0.00	63	0	C	NM_032811		124501301	+1	tier1	-	no_errors	ENST00000441174	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
TCP11L2	255394	genome.wustl.edu	37	12	106729445	106729445	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:106729445A>G	ENST00000299045.3	+	7	975	c.801A>G	c.(799-801)atA>atG	p.I267M		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	267										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						CAGAATGGATAAAAGAATCTG	0.423																																																	0													60.0	64.0	63.0					12																	106729445		2203	4300	6503	SO:0001583	missense	0			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.801A>G	12.37:g.106729445A>G	ENSP00000299045:p.Ile267Met		B2RA65|G3V1Y9	Missense_Mutation	SNP	pfam_Tcp11	p.I267M	ENST00000299045.3	37	c.801	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	A	18.10	3.547586	0.65311	.	.	ENSG00000166046	ENST00000299045	T	0.12147	2.71	6.03	2.18	0.27775	.	0.080690	0.85682	D	0.000000	T	0.20536	0.0494	L	0.50333	1.59	0.80722	D	1	D	0.53885	0.963	P	0.58266	0.836	T	0.01899	-1.1251	10	0.54805	T	0.06	0.0322	4.2701	0.10782	0.6225:0.1991:0.0648:0.1136	.	267	Q8N4U5	T11L2_HUMAN	M	267	ENSP00000299045:I267M	ENSP00000299045:I267M	I	+	3	3	TCP11L2	105253575	0.998000	0.40836	0.989000	0.46669	0.997000	0.91878	0.522000	0.22909	0.120000	0.18254	0.533000	0.62120	ATA	TCP11L2	-	pfam_Tcp11	ENSG00000166046		0.423	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	HGNC	protein_coding	OTTHUMT00000407206.1	-	0.00	60	0	A	NM_152772		106729445	+1	tier1	-	no_errors	ENST00000299045	ensembl	human	known	74_37	missense	8.93	51	5	SNP	1.000	G
TG	7038	genome.wustl.edu	37	8	133883696	133883696	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr8:133883696C>A	ENST00000220616.4	+	4	418	c.378C>A	c.(376-378)taC>taA	p.Y126*	TG_ENST00000377869.1_Nonsense_Mutation_p.Y126*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	126	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.Y126Y(1)		NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAGGGGACTACGCGCCTGTTC	0.552																																																	1	Substitution - coding silent(1)	large_intestine(1)											201.0	158.0	173.0					8																	133883696		2203	4300	6503	SO:0001587	stop_gained	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.378C>A	8.37:g.133883696C>A	ENSP00000220616:p.Tyr126*		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.Y126*	ENST00000220616.4	37	c.378	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400007	0.25291	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	.	.	.	5.58	-2.59	0.06209	.	0.117488	0.38272	N	0.001745	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.8974	0.58108	0.0:0.414:0.0:0.586	.	.	.	.	X	126	.	ENSP00000220616:Y126X	Y	+	3	2	TG	133952878	0.002000	0.14202	0.002000	0.10522	0.053000	0.15095	-0.234000	0.09028	-0.418000	0.07450	0.460000	0.39030	TAC	TG	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.552	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	56	0	C	NM_003235		133883696	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	0.000	A
THSD7B	80731	genome.wustl.edu	37	2	138376070	138376070	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:138376070G>A	ENST00000409968.1	+	19	3852	c.3674G>A	c.(3673-3675)tGt>tAt	p.C1225Y	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.C1228Y|THSD7B_ENST00000413152.2_Missense_Mutation_p.C1197Y			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1227	TSP type-1 15. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATGGACCAATGTGAGCAGGTA	0.468																																																	0													92.0	101.0	98.0					2																	138376070		2111	4241	6352	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3674G>A	2.37:g.138376070G>A	ENSP00000387145:p.Cys1225Tyr			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.C1228Y	ENST00000409968.1	37	c.3683		2	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264016	0.80358	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.72835	-0.69;-0.69;-0.69	5.09	5.09	0.68999	.	0.072216	0.85682	D	0.000000	D	0.84170	0.5413	M	0.77313	2.365	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.85794	0.1369	10	0.66056	D	0.02	.	17.4245	0.87522	0.0:0.0:1.0:0.0	.	1197	C9JKN6	.	Y	1225;1228;1197	ENSP00000387145:C1225Y;ENSP00000272643:C1228Y;ENSP00000413841:C1197Y	ENSP00000272643:C1228Y	C	+	2	0	THSD7B	138092540	1.000000	0.71417	0.955000	0.39395	0.871000	0.50021	9.051000	0.93849	2.638000	0.89438	0.650000	0.86243	TGT	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt	ENSG00000144229		0.468	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	90	0	G	XM_046570.9		138376070	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	16.18	57	11	SNP	1.000	A
TMCO5B	100652857	genome.wustl.edu	37	15	33533784	33533784	+	RNA	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr15:33533784G>T	ENST00000529696.1	-	0	71							A8MYB1	TMC5B_HUMAN	transmembrane and coiled-coil domains 5B, pseudogene							integral component of membrane (GO:0016021)											ATCTTCCTCAGAACTTCCTGG	0.373																																																	0																																												0					15q13.3	2013-09-26	2010-09-29		ENSG00000215296	ENSG00000215296			34243	pseudogene	pseudogene			"""transmembrane and coiled-coil domains 5B"""				Standard	NR_046005		Approved		uc031qri.1	A8MYB1	OTTHUMG00000167569		15.37:g.33533784G>T				RNA	SNP	-	NULL	ENST00000529696.1	37	NULL		15																																																																																			TMCO5B	-	-	ENSG00000215296		0.373	TMCO5B-001	KNOWN	basic	processed_transcript	TMCO5B	HGNC	pseudogene	OTTHUMT00000395082.1	-	0.00	42	0	G			33533784	-1	tier1	-	no_errors	ENST00000529696	ensembl	human	known	74_37	rna	15.79	16	3	SNP	1.000	T
TRHDE	29953	genome.wustl.edu	37	12	73012754	73012754	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:73012754C>T	ENST00000261180.4	+	13	2366	c.2270C>T	c.(2269-2271)gCc>gTc	p.A757V		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	757					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TGGCATGCTGCCAGCCGAGCT	0.358																																																	0													52.0	57.0	55.0					12																	73012754		2201	4300	6501	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2270C>T	12.37:g.73012754C>T	ENSP00000261180:p.Ala757Val		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A757V	ENST00000261180.4	37	c.2270	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.246806	0.95305	.	.	ENSG00000072657	ENST00000261180	T	0.05580	3.42	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.22166	0.0534	L	0.55990	1.75	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.00036	-1.2255	10	0.35671	T	0.21	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	757	Q9UKU6	TRHDE_HUMAN	V	757	ENSP00000261180:A757V	ENSP00000261180:A757V	A	+	2	0	TRHDE	71299021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.160000	0.77495	2.885000	0.99019	0.655000	0.94253	GCC	TRHDE	-	NULL	ENSG00000072657		0.358	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	72	0	C	NM_013381		73012754	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	10.17	53	6	SNP	1.000	T
TMEM132C	92293	genome.wustl.edu	37	12	129189710	129189710	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr12:129189710T>G	ENST00000435159.2	+	9	2197	c.2197T>G	c.(2197-2199)Ttc>Gtc	p.F733V	TMEM132C_ENST00000537538.1_Missense_Mutation_p.F118V|TMEM132C_ENST00000315208.8_Missense_Mutation_p.F349V	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	733						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CACCAAGGACTTCTCCCTGGC	0.637																																																	0													56.0	56.0	56.0					12																	129189710		692	1591	2283	SO:0001583	missense	0			AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2197T>G	12.37:g.129189710T>G	ENSP00000410852:p.Phe733Val		Q69YX8	Missense_Mutation	SNP	NULL	p.F733V	ENST00000435159.2	37	c.2197		12	.	.	.	.	.	.	.	.	.	.	T	25.5	4.644645	0.87859	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.14640	2.49;2.49;2.49	4.84	4.84	0.62591	.	0.000000	0.64402	D	0.000009	T	0.40619	0.1124	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40175	-0.9577	10	0.54805	T	0.06	.	14.4293	0.67238	0.0:0.0:0.0:1.0	.	733	Q8N3T6	T132C_HUMAN	V	733;349;118	ENSP00000410852:F733V;ENSP00000324458:F349V;ENSP00000438477:F118V	ENSP00000324458:F349V	F	+	1	0	TMEM132C	127755663	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.756000	0.85195	1.810000	0.52873	0.533000	0.62120	TTC	TMEM132C	-	NULL	ENSG00000181234		0.637	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding			0.00	53	0	T	XM_044062		129189710	+1			no_errors	ENST00000435159	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	G
TRPA1	8989	genome.wustl.edu	37	8	72969981	72969981	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr8:72969981C>T	ENST00000262209.4	-	9	1271	c.1064G>A	c.(1063-1065)tGg>tAg	p.W355*		NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	355					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	TACAATATTCCAAGATGCAGA	0.383																																																	0													101.0	101.0	101.0					8																	72969981		2203	4300	6503	SO:0001587	stop_gained	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1064G>A	8.37:g.72969981C>T	ENSP00000262209:p.Trp355*		A6NIN6	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.W355*	ENST00000262209.4	37	c.1064	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.880885	0.97062	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	.	.	.	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-10.1354	19.4942	0.95065	0.0:1.0:0.0:0.0	.	.	.	.	X	207;355	.	ENSP00000262209:W355X	W	-	2	0	TRPA1	73132535	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.294000	0.72738	2.602000	0.87976	0.655000	0.94253	TGG	TRPA1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.383	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	-	0.00	61	0	C	NM_007332		72969981	-1	tier1	-	no_errors	ENST00000262209	ensembl	human	known	74_37	nonsense	10.53	34	4	SNP	1.000	T
USP17L10	100287144	genome.wustl.edu	37	4	9213418	9213418	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:9213418T>C	ENST00000417945.1	+	1	1036	c.1036T>C	c.(1036-1038)Tgg>Cgg	p.W346R	USP17L13_ENST00000421288.2_Intron	NM_001256852.1	NP_001243781.1	C9JJH3	U17LA_HUMAN	ubiquitin specific peptidase 17-like family member 10	346	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)										AGAAGGCCAGTGGTATAAAAT	0.502																																																	0																																										SO:0001583	missense	0				CCDS59454.1	4p16.1	2014-02-12	2012-10-09		ENSG00000231396	ENSG00000231396			44438	protein-coding gene	gene with protein product							Standard	NM_001256852		Approved		uc031sdg.1	C9JJH3	OTTHUMG00000160160	ENST00000417945.1:c.1036T>C	4.37:g.9213418T>C	ENSP00000403760:p.Trp346Arg			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.W346R	ENST00000417945.1	37	c.1036	CCDS59454.1	4	.	.	.	.	.	.	.	.	.	.	.	12.95	2.092696	0.36952	.	.	ENSG00000231396	ENST00000417945	T	0.33654	1.4	0.337	0.337	0.15966	.	0.000000	0.64402	D	0.000011	T	0.70116	0.3187	H	0.98769	4.325	0.33296	D	0.564231	.	.	.	.	.	.	T	0.79624	-0.1726	6	.	.	.	.	.	.	.	.	.	.	.	R	346	ENSP00000403760:W346R	.	W	+	1	0	RP11-1286E23.5	8941770	1.000000	0.71417	0.467000	0.27180	0.310000	0.27922	3.526000	0.53509	0.373000	0.24621	0.102000	0.15555	TGG	USP17L10	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000231396		0.502	USP17L10-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP17L10	HGNC	protein_coding	OTTHUMT00000359428.1	-	0.00	51	0	T	NM_001256852		9213418	+1	tier1	-	no_errors	ENST00000417945	ensembl	human	novel	74_37	missense	10.81	33	4	SNP	1.000	C
UNC5C	8633	genome.wustl.edu	37	4	96140296	96140296	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:96140296G>T	ENST00000453304.1	-	9	1817	c.1469C>A	c.(1468-1470)cCc>cAc	p.P490H	UNC5C_ENST00000506749.1_Missense_Mutation_p.P509H	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	490					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GTCATCTTGGGGGGTGACAGC	0.502																																																	0													226.0	207.0	213.0					4																	96140296		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1469C>A	4.37:g.96140296G>T	ENSP00000406022:p.Pro490His		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.P490H	ENST00000453304.1	37	c.1469	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	G	22.0	4.223804	0.79576	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.58210	0.66;0.35;0.36	5.45	5.45	0.79879	.	0.104165	0.64402	D	0.000002	T	0.70307	0.3209	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.87578	0.923;0.998;0.998	T	0.71994	-0.4424	10	0.72032	D	0.01	.	19.2996	0.94138	0.0:0.0:1.0:0.0	.	490;509;490	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	H	490;449;509;509	ENSP00000406022:P490H;ENSP00000426924:P509H;ENSP00000426153:P509H	ENSP00000328673:P449H	P	-	2	0	UNC5C	96359319	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	7.639000	0.83342	2.555000	0.86185	0.655000	0.94253	CCC	UNC5C	-	NULL	ENSG00000182168		0.502	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	-	0.00	60	0	G	NM_003728		96140296	-1	tier1	-	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
VAMP4	8674	genome.wustl.edu	37	1	171688329	171688329	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr1:171688329C>A	ENST00000236192.7	-	4	532	c.146G>T	c.(145-147)aGa>aTa	p.R49I	VAMP4_ENST00000415773.1_Missense_Mutation_p.R48I|VAMP4_ENST00000482519.1_5'UTR|VAMP4_ENST00000367740.2_Missense_Mutation_p.R48I	NM_001185127.1|NM_003762.4	NP_001172056.1|NP_003753.2	O75379	VAMP4_HUMAN	vesicle-associated membrane protein 4	49					Golgi to plasma membrane protein transport (GO:0043001)|regulation of Golgi to plasma membrane protein transport (GO:0042996)|SNARE complex assembly (GO:0035493)	cell surface (GO:0009986)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|SNARE complex (GO:0031201)|trans-Golgi network (GO:0005802)				large_intestine(4)	4	all_cancers(6;1.42e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					TTTATCATTTCTAGGTCCAAA	0.333																																																	0													64.0	65.0	65.0					1																	171688329		2203	4300	6503	SO:0001583	missense	0			AF044310	CCDS1298.1, CCDS53430.1	1q24-q25	2013-02-13			ENSG00000117533	ENSG00000117533		"""Vesicle-associated membrane proteins"""	12645	protein-coding gene	gene with protein product		606909				9553086	Standard	NM_003762		Approved		uc001ghx.2	O75379	OTTHUMG00000034788	ENST00000236192.7:c.146G>T	1.37:g.171688329C>A	ENSP00000236192:p.Arg49Ile		A2IDD8|Q96IY9|Q96J20|Q9UEL7	Missense_Mutation	SNP	pfam_Synaptobrevin,pfscan_Synaptobrevin,prints_Synaptobrevin	p.R49I	ENST00000236192.7	37	c.146	CCDS1298.1	1	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814933	0.50527	.	.	ENSG00000117533	ENST00000236192;ENST00000415773;ENST00000367740	T;T;T	0.30714	1.52;1.52;1.52	5.84	3.99	0.46301	.	0.214386	0.49305	D	0.000159	T	0.11879	0.0289	N	0.19112	0.55	0.58432	D	0.999995	B;P	0.37176	0.405;0.586	B;B	0.42692	0.395;0.377	T	0.06643	-1.0815	10	0.40728	T	0.16	.	9.6186	0.39708	0.0:0.7747:0.0:0.2253	.	48;49	O75379-2;O75379	.;VAMP4_HUMAN	I	49;48;48	ENSP00000236192:R49I;ENSP00000415627:R48I;ENSP00000356714:R48I	ENSP00000236192:R49I	R	-	2	0	VAMP4	169954952	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.857000	0.39399	0.829000	0.34733	0.655000	0.94253	AGA	VAMP4	-	NULL	ENSG00000117533		0.333	VAMP4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VAMP4	HGNC	protein_coding	OTTHUMT00000304033.2	-	0.00	81	0	C	NM_003762		171688329	-1	tier1	-	no_errors	ENST00000236192	ensembl	human	known	74_37	missense	5.41	69	4	SNP	0.994	A
WDR17	116966	genome.wustl.edu	37	4	177061048	177061048	+	Silent	SNP	A	A	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr4:177061048A>T	ENST00000280190.4	+	11	1593	c.1437A>T	c.(1435-1437)ggA>ggT	p.G479G	WDR17_ENST00000393643.2_Silent_p.G455G|WDR17_ENST00000508596.1_Silent_p.G455G|WDR17_ENST00000507824.2_Silent_p.G462G			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	479										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TGAAGCATGGAACAAATGGAA	0.313																																																	0													160.0	179.0	173.0					4																	177061048		2203	4299	6502	SO:0001819	synonymous_variant	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1437A>T	4.37:g.177061048A>T			E7EQX0|Q0QD35	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G479	ENST00000280190.4	37	c.1437	CCDS3825.1	4																																																																																			WDR17	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000150627		0.313	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	-	0.00	81	0	A			177061048	+1	tier1	-	no_errors	ENST00000280190	ensembl	human	known	74_37	silent	10.00	36	4	SNP	1.000	T
WIZ	58525	genome.wustl.edu	37	19	15540460	15540460	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:15540460G>T	ENST00000389282.4	-	5	3250	c.3037C>A	c.(3037-3039)Ccc>Acc	p.P1013T	WIZ_ENST00000599910.2_Missense_Mutation_p.P197T|WIZ_ENST00000545156.1_Missense_Mutation_p.P194T|WIZ_ENST00000599686.3_Missense_Mutation_p.P197T|WIZ_ENST00000263381.7_Intron			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1013					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						GCCGGCCGGGGGCTCAGGGAC	0.652																																																	0																																										SO:0001583	missense	0			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3037C>A	19.37:g.15540460G>T	ENSP00000373933:p.Pro1013Thr		B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1013T	ENST00000389282.4	37	c.3037		19	.	.	.	.	.	.	.	.	.	.	G	15.00	2.701972	0.48307	.	.	ENSG00000011451	ENST00000389282;ENST00000416927;ENST00000545156	T	0.32023	1.47	4.92	4.92	0.64577	.	0.000000	0.53938	D	0.000052	T	0.49609	0.1567	.	.	.	0.38465	D	0.94731	D;P	0.69078	0.997;0.642	P;B	0.60789	0.879;0.13	T	0.53365	-0.8449	9	0.44086	T	0.13	-22.6513	15.1144	0.72388	0.0:0.0:1.0:0.0	.	1013;197	O95785;B3KVH1	WIZ_HUMAN;.	T	1013;197;194	ENSP00000373933:P1013T	ENSP00000373933:P1013T	P	-	1	0	WIZ	15401460	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.915000	0.56409	2.298000	0.77334	0.485000	0.47835	CCC	WIZ	-	NULL	ENSG00000011451		0.652	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		-	0.00	88	0	G	NM_021241		15540460	-1	tier1	-	no_errors	ENST00000389282	ensembl	human	known	74_37	missense	10.00	45	5	SNP	1.000	T
WNT9B	7484	genome.wustl.edu	37	17	44952592	44952592	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr17:44952592C>T	ENST00000290015.2	+	3	513	c.460C>T	c.(460-462)Cgg>Tgg	p.R154W	WNT9B_ENST00000393461.2_Missense_Mutation_p.R154W	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B	154					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GCTGGAGAGCCGGCAGGCCTG	0.662																																																	0													58.0	61.0	60.0					17																	44952592		2203	4300	6503	SO:0001583	missense	0			AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.460C>T	17.37:g.44952592C>T	ENSP00000290015:p.Arg154Trp		Q6UXT4|Q96Q09	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt	p.R154W	ENST00000290015.2	37	c.460	CCDS11506.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707667	0.89018	.	.	ENSG00000158955	ENST00000376843;ENST00000393461;ENST00000290015	T;T	0.76709	-1.04;-1.04	4.61	3.63	0.41609	.	0.058491	0.64402	D	0.000001	D	0.88672	0.6500	M	0.87097	2.86	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.983	D	0.90582	0.4530	10	0.66056	D	0.02	.	14.3984	0.67027	0.1489:0.8511:0.0:0.0	.	154;154	E7EPC3;O14905	.;WNT9B_HUMAN	W	148;154;154	ENSP00000377105:R154W;ENSP00000290015:R154W	ENSP00000290015:R154W	R	+	1	2	WNT9B	42307591	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.904000	0.56325	1.262000	0.44165	0.462000	0.41574	CGG	WNT9B	-	pfam_Wnt,smart_Wnt	ENSG00000158955		0.662	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT9B	HGNC	protein_coding	OTTHUMT00000440433.1	-	0.00	71	0	C	NM_003396		44952592	+1	tier1	-	no_errors	ENST00000290015	ensembl	human	known	74_37	missense	14.75	52	9	SNP	1.000	T
ZNF143	7702	genome.wustl.edu	37	11	9492878	9492878	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:9492878G>T	ENST00000396602.2	+	2	142	c.23G>T	c.(22-24)cGa>cTa	p.R8L	ZNF143_ENST00000530463.1_Missense_Mutation_p.R8L|ZNF143_ENST00000396604.1_Missense_Mutation_p.R8L|ZNF143_ENST00000396597.3_Missense_Mutation_p.R8L|ZNF143_ENST00000299606.2_Missense_Mutation_p.R8L	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	8					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		CAAATAAATCGAGATTCTCAG	0.423																																																	0													152.0	140.0	144.0					11																	9492878		2201	4294	6495	SO:0001583	missense	0			U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.23G>T	11.37:g.9492878G>T	ENSP00000379847:p.Arg8Leu		A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R8L	ENST00000396602.2	37	c.23	CCDS7799.2	11	.	.	.	.	.	.	.	.	.	.	G	35	5.536379	0.96460	.	.	ENSG00000166478	ENST00000531943;ENST00000396604;ENST00000396602;ENST00000530463;ENST00000533542;ENST00000532577;ENST00000396597;ENST00000438144;ENST00000526657;ENST00000299606;ENST00000534265;ENST00000412390;ENST00000414370;ENST00000417726	T;T;T;T;T;T;T;T;T;T;T;T	0.54479	0.66;2.72;2.72;2.72;0.6;0.69;2.44;0.68;0.57;2.53;0.68;0.68	5.89	5.89	0.94794	.	0.000000	0.39544	U	0.001336	T	0.69797	0.3151	L	0.51422	1.61	0.80722	D	1	D;D;D	0.63046	0.992;0.987;0.987	D;D;D	0.72982	0.979;0.931;0.931	T	0.69639	-0.5091	10	0.72032	D	0.01	.	20.2576	0.98430	0.0:0.0:1.0:0.0	.	8;8;8	P52747-2;E7ER34;P52747	.;.;ZN143_HUMAN	L	8	ENSP00000434638:R8L;ENSP00000379849:R8L;ENSP00000379847:R8L;ENSP00000432154:R8L;ENSP00000434922:R8L;ENSP00000433221:R8L;ENSP00000379843:R8L;ENSP00000409432:R8L;ENSP00000435881:R8L;ENSP00000299606:R8L;ENSP00000433743:R8L;ENSP00000388628:R8L	ENSP00000299606:R8L	R	+	2	0	ZNF143	9449454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.435000	0.97529	2.783000	0.95769	0.655000	0.94253	CGA	ZNF143	-	NULL	ENSG00000166478		0.423	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF143	HGNC	protein_coding	OTTHUMT00000313921.2		0.00	51	0	G	NM_003442		9492878	+1			no_errors	ENST00000396602	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
WT1-AS	51352	genome.wustl.edu	37	11	32460813	32460813	+	RNA	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr11:32460813G>A	ENST00000395900.1	+	0	1691				WT1-AS_ENST00000494911.1_RNA|WT1-AS_ENST00000442957.1_RNA|WT1-AS_ENST00000459866.1_RNA|WT1-AS_ENST00000525436.1_RNA|WT1-AS_ENST00000426618.2_RNA|WT1-AS_ENST00000478367.1_RNA	NR_023920.1		Q06250	WIT1_HUMAN	WT1 antisense RNA											endometrium(1)|large_intestine(2)|lung(2)|prostate(1)	6						GCTGCCTGTCGCGGGAGAGGA	0.706																																																	0																																												0			BC002734		11p13	2012-10-19	2012-08-15	2012-01-25	ENSG00000183242	ENSG00000183242		"""Long non-coding RNAs"", ""-"""	18135	non-coding RNA	RNA, long non-coding	"""Wilms tumor associated protein"""	607899	"""Wilms tumor upstream neighbor 1"", ""WT1 antisense RNA (non-protein coding)"""	WIT1		2173145, 8406502, 17210670	Standard	NR_120546		Approved	WIT-1, WT1AS, WT1-AS1	uc010red.2	Q06250	OTTHUMG00000039557		11.37:g.32460813G>A			Q4KMY0|Q96A27	RNA	SNP	-	NULL	ENST00000395900.1	37	NULL		11																																																																																			WT1-AS	-	-	ENSG00000183242		0.706	WT1-AS-001	KNOWN	basic	antisense	WT1-AS	HGNC	antisense	OTTHUMT00000095437.1		0.00	8	0	G	NR_023920		32460813	+1			no_errors	ENST00000395900	ensembl	human	known	74_37	rna	20.00	16	4	SNP	0.000	A
ZNF192P1	651302	genome.wustl.edu	37	6	28134854	28134854	+	RNA	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr6:28134854A>C	ENST00000440790.2	+	0	957					NR_103448.1				zinc finger protein 192 pseudogene 1																		GCCCTCATCAAGCATCAGAGA	0.433																																																	0													69.0	67.0	68.0					6																	28134854		692	1591	2283			0					6p22.1	2012-10-05	2011-08-31	2011-08-31	ENSG00000226314	ENSG00000226314			18777	pseudogene	pseudogene	"""zinc finger protein 389, pseudogene"""		"""zinc finger protein 389"""	ZNF389			Standard	NR_103448		Approved	dJ265C24.4, ZNF389P	uc021yrq.2		OTTHUMG00000014513		6.37:g.28134854A>C				RNA	SNP	-	NULL	ENST00000440790.2	37	NULL		6																																																																																			ZNF192P1	-	-	ENSG00000226314		0.433	ZNF192P1-001	KNOWN	basic	processed_transcript	ZNF192P1	HGNC	pseudogene	OTTHUMT00000040181.1	-	0.00	121	0	A			28134854	+1	tier1	-	no_errors	ENST00000440790	ensembl	human	known	74_37	rna	17.50	66	14	SNP	0.000	C
ZNF2	7549	genome.wustl.edu	37	2	95847259	95847259	+	Missense_Mutation	SNP	C	C	A	rs372354364		TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr2:95847259C>A	ENST00000340539.5	+	5	1148	c.686C>A	c.(685-687)cCc>cAc	p.P229H	ZNF2_ENST00000425369.1_Missense_Mutation_p.P149H|ZNF2_ENST00000453539.2_Missense_Mutation_p.P242H|ZNF2_ENST00000295210.6_Missense_Mutation_p.P191H|ZNF2_ENST00000398107.2_Missense_Mutation_p.P187H	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		GGGGAGAGCCCCTACGAGTGC	0.557																																																	0													88.0	100.0	96.0					2																	95847259		2194	4300	6494	SO:0001583	missense	0			X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.686C>A	2.37:g.95847259C>A	ENSP00000345392:p.Pro229His		A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P229H	ENST00000340539.5	37	c.686	CCDS42712.1	2	.	.	.	.	.	.	.	.	.	.	C	15.94	2.981572	0.53827	.	.	ENSG00000163067	ENST00000398107;ENST00000340539;ENST00000425369;ENST00000295210;ENST00000453539	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.16	5.16	0.70880	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000154	T	0.59390	0.2190	M	0.82923	2.615	0.54753	D	0.999981	P;P;D	0.89917	0.805;0.483;1.0	P;B;D	0.75484	0.473;0.347;0.986	T	0.64257	-0.6450	10	0.72032	D	0.01	-18.7934	16.1933	0.82006	0.0:1.0:0.0:0.0	.	191;187;228	B4DIR4;A8MWV7;Q9BSG1	.;.;ZNF2_HUMAN	H	187;229;149;191;242	ENSP00000381178:P187H;ENSP00000345392:P229H;ENSP00000406017:P149H;ENSP00000295210:P191H;ENSP00000411051:P242H	ENSP00000295210:P191H	P	+	2	0	ZNF2	95210986	1.000000	0.71417	0.973000	0.42090	0.003000	0.03518	5.659000	0.68010	2.696000	0.92011	0.655000	0.94253	CCC	ZNF2	-	pfscan_Znf_C2H2	ENSG00000163067		0.557	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF2	HGNC	protein_coding	OTTHUMT00000338595.2	-	0.00	97	0	C	NM_021088		95847259	+1	tier1	-	no_errors	ENST00000340539	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
ZNF234	10780	genome.wustl.edu	37	19	44661481	44661481	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:44661481C>T	ENST00000426739.2	+	6	1570	c.1312C>T	c.(1312-1314)Cgt>Tgt	p.R438C	ZNF234_ENST00000592437.1_Missense_Mutation_p.R438C	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	438					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				TAAAGCCTTCCGTCAGAGTTC	0.418																																																	0													60.0	61.0	61.0					19																	44661481		2072	4242	6314	SO:0001583	missense	0			X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1312C>T	19.37:g.44661481C>T	ENSP00000400878:p.Arg438Cys		A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R438C	ENST00000426739.2	37	c.1312	CCDS46101.1	19	.	.	.	.	.	.	.	.	.	.	C	15.28	2.787923	0.49997	.	.	ENSG00000167380	ENST00000426739	T	0.07444	3.19	3.94	-3.5	0.04710	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13329	0.0323	M	0.64170	1.965	0.09310	N	1	D	0.76494	0.999	P	0.57679	0.825	T	0.17319	-1.0373	9	0.59425	D	0.04	.	0.8763	0.01224	0.3896:0.1956:0.238:0.1768	.	438	Q14588	ZN234_HUMAN	C	438	ENSP00000400878:R438C	ENSP00000400878:R438C	R	+	1	0	ZNF226	49353321	0.000000	0.05858	0.359000	0.25824	0.995000	0.86356	-1.171000	0.03115	-0.230000	0.09840	0.591000	0.81541	CGT	ZNF234	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000263002		0.418	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	HGNC	protein_coding	OTTHUMT00000460586.2	-	0.00	115	0	C			44661481	+1	tier1	-	no_errors	ENST00000426739	ensembl	human	known	74_37	missense	14.29	78	13	SNP	0.040	T
ZNF681	148213	genome.wustl.edu	37	19	23927146	23927146	+	Silent	SNP	A	A	C			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:23927146A>C	ENST00000402377.3	-	4	1347	c.1206T>G	c.(1204-1206)gcT>gcG	p.A402A	ZNF681_ENST00000395385.3_Silent_p.A333A	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ACTTGTTAAAAGCTTTGCCAC	0.398																																																	0													69.0	74.0	72.0					19																	23927146		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1206T>G	19.37:g.23927146A>C			B3KVF7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A402	ENST00000402377.3	37	c.1206	CCDS12414.2	19																																																																																			ZNF681	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196172		0.398	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	-	0.00	70	0	A	NM_138286		23927146	-1	tier1	-	no_errors	ENST00000402377	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.006	C
ZNF667	63934	genome.wustl.edu	37	19	56954005	56954005	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:56954005G>T	ENST00000504904.3	-	7	1078	c.359C>A	c.(358-360)aCa>aAa	p.T120K	ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000342634.3_Missense_Mutation_p.T248K|ZNF667_ENST00000292069.6_Missense_Mutation_p.T120K			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		ACTCTTTCGTGTAGGAGCTTT	0.398																																																	0													92.0	98.0	96.0					19																	56954005		2201	4295	6496	SO:0001583	missense	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.359C>A	19.37:g.56954005G>T	ENSP00000439402:p.Thr120Lys		B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T248K	ENST00000504904.3	37	c.743	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	G	3.127	-0.179345	0.06380	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069	T;T;T	0.05717	3.4;3.55;3.55	4.77	3.73	0.42828	.	0.165188	0.28977	N	0.013536	T	0.06690	0.0171	L	0.40543	1.245	0.28324	N	0.922081	P;P	0.41313	0.745;0.535	B;B	0.41236	0.351;0.247	T	0.14727	-1.0462	10	0.38643	T	0.18	-3.6902	8.699	0.34314	0.1032:0.0:0.8968:0.0	.	248;120	E7EPS0;Q5HYK9	.;ZN667_HUMAN	K	248;120;120	ENSP00000344699:T248K;ENSP00000439402:T120K;ENSP00000292069:T120K	ENSP00000292069:T120K	T	-	2	0	ZNF667	61645817	.	.	0.876000	0.34364	0.006000	0.05464	.	.	1.369000	0.46134	0.650000	0.86243	ACA	ZNF667	-	NULL	ENSG00000198046		0.398	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1		0.00	116	0	G	NM_022103		56954005	-1			no_errors	ENST00000342634	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.807	T
ZNF256	10172	genome.wustl.edu	37	19	58452307	58452307	+	Silent	SNP	G	G	A			TCGA-L5-A8NU-01A-11D-A36J-09	TCGA-L5-A8NU-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	917fd740-cafe-43d8-b6fa-276dcc14838c	303bf8fd-fe5c-4e93-ac3f-15411403fef0	g.chr19:58452307G>A	ENST00000282308.3	-	3	2065	c.1869C>T	c.(1867-1869)aaC>aaT	p.N623N	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	623					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		CCTTGTGAACGTTCTGATGTT	0.393																																					NSCLC(55;1313 1552 8040 11996)												0													101.0	93.0	96.0					19																	58452307		2203	4300	6503	SO:0001819	synonymous_variant	0			AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.1869C>T	19.37:g.58452307G>A			B2RA92|Q53Y85|Q9BV71	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N623	ENST00000282308.3	37	c.1869	CCDS12966.1	19																																																																																			ZNF256	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152454		0.393	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF256	HGNC	protein_coding	OTTHUMT00000466702.1	-	0.00	182	0	G			58452307	-1	tier1	-	no_errors	ENST00000282308	ensembl	human	known	74_37	silent	14.29	102	17	SNP	0.000	A
