#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA1	19	genome.wustl.edu	37	9	107646736	107646736	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:107646736C>A	ENST00000374736.3	-	4	668	c.274G>T	c.(274-276)Gga>Tga	p.G92*	ABCA1_ENST00000423487.2_Nonsense_Mutation_p.G92*|ABCA1_ENST00000374733.1_Nonsense_Mutation_p.G32*	NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	92					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	CCAACAACTCCGGGAGCCTCC	0.463																																																	0													68.0	72.0	71.0					9																	107646736		2203	4300	6503	SO:0001587	stop_gained	0			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.274G>T	9.37:g.107646736C>A	ENSP00000363868:p.Gly92*		Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G92*	ENST00000374736.3	37	c.274	CCDS6762.1	9	.	.	.	.	.	.	.	.	.	.	C	40	7.931217	0.98568	.	.	ENSG00000165029	ENST00000374736;ENST00000423487;ENST00000374733	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5422	0.95278	0.0:1.0:0.0:0.0	.	.	.	.	X	92;92;32	.	ENSP00000363865:G32X	G	-	1	0	ABCA1	106686557	1.000000	0.71417	0.880000	0.34516	0.984000	0.73092	7.724000	0.84798	2.703000	0.92315	0.655000	0.94253	GGA	ABCA1	-	NULL	ENSG00000165029		0.463	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1		0.00	59	0	C	NM_005502		107646736	-1			no_errors	ENST00000374736	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	1.000	A
ABCA13	154664	genome.wustl.edu	37	7	48634375	48634375	+	Missense_Mutation	SNP	C	C	T	rs369999071		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:48634375C>T	ENST00000435803.1	+	58	14734	c.14710C>T	c.(14710-14712)Cgg>Tgg	p.R4904W	ABCA13_ENST00000544596.1_Missense_Mutation_p.R634W	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4904	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAAGGAGGTTCGGGAAGGCTG	0.498																																																	0								C	TRP/ARG	0,3996		0,0,1998	146.0	151.0	149.0		14710	0.5	0.0	7		149	1,8345		0,1,4172	no	missense	ABCA13	NM_152701.3	101	0,1,6170	TT,TC,CC		0.012,0.0,0.0081	probably-damaging	4904/5059	48634375	1,12341	1998	4173	6171	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.14710C>T	7.37:g.48634375C>T	ENSP00000411096:p.Arg4904Trp		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R4904W	ENST00000435803.1	37	c.14710	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818236	0.50633	0.0	1.2E-4	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	T;T;T	0.42131	0.98;0.98;0.98	5.7	0.51	0.16983	ATPase, AAA+ type, core (1);ABC transporter-like (1);	1.724340	0.03316	N	0.191120	T	0.68723	0.3032	M	0.88181	2.935	0.09310	N	1	D;D;D	0.89917	0.998;0.999;1.0	P;D;P	0.64687	0.888;0.928;0.798	T	0.49184	-0.8966	10	0.87932	D	0	.	9.5364	0.39224	0.3635:0.282:0.3545:0.0	.	634;2606;4904	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	W	4904;677;634	ENSP00000411096:R4904W;ENSP00000391042:R677W;ENSP00000442634:R634W	ENSP00000391042:R677W	R	+	1	2	ABCA13	48604921	0.000000	0.05858	0.000000	0.03702	0.536000	0.34869	0.307000	0.19296	-0.183000	0.10585	-0.217000	0.12591	CGG	ABCA13	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000179869		0.498	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	73	0	C	NM_152701		48634375	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	32.35	46	22	SNP	0.000	T
ABCC5	10057	genome.wustl.edu	37	3	183665162	183665162	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:183665162C>T	ENST00000334444.6	-	23	3604	c.3364G>A	c.(3364-3366)Ggg>Agg	p.G1122R	ABCC5_ENST00000265586.6_Missense_Mutation_p.G1079R	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1122	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)	p.G1122R(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	GGAATCTGCCCGTGCATAAGA	0.562																																																	1	Substitution - Missense(1)	prostate(1)											45.0	53.0	50.0					3																	183665162		2065	4189	6254	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3364G>A	3.37:g.183665162C>T	ENSP00000333926:p.Gly1122Arg		B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.G1122R	ENST00000334444.6	37	c.3364	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956771	0.73902	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.97089	-4.24;-4.24	5.63	5.63	0.86233	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.108387	0.64402	D	0.000003	D	0.98327	0.9445	M	0.78223	2.4	0.80722	D	1	D;D	0.89917	1.0;0.961	D;P	0.68765	0.96;0.532	D	0.98429	1.0581	10	0.49607	T	0.09	-22.4555	19.6816	0.95965	0.0:1.0:0.0:0.0	.	1079;1122	Q86UX3;O15440	.;MRP5_HUMAN	R	1122;1079	ENSP00000333926:G1122R;ENSP00000265586:G1079R	ENSP00000265586:G1079R	G	-	1	0	ABCC5	185147856	0.985000	0.35326	0.801000	0.32222	0.451000	0.32288	3.268000	0.51585	2.654000	0.90174	0.655000	0.94253	GGG	ABCC5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000114770		0.562	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	-	0.00	28	0	C	NM_005688		183665162	-1	tier1	-	no_errors	ENST00000334444	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	T
ABCC8	6833	genome.wustl.edu	37	11	17430052	17430052	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:17430052T>A	ENST00000389817.3	-	23	2775	c.2707A>T	c.(2707-2709)Aag>Tag	p.K903*	ABCC8_ENST00000302539.4_Nonsense_Mutation_p.K904*			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	903	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	GTGCCATCCTTCATGGCAATG	0.542																																																	0													119.0	115.0	116.0					11																	17430052		2200	4293	6493	SO:0001587	stop_gained	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2707A>T	11.37:g.17430052T>A	ENSP00000374467:p.Lys903*		A6NMX8|E3UYX6|O75948|Q16583	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.K904*	ENST00000389817.3	37	c.2710	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	T	42	9.785547	0.99263	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3933	0.74767	0.0:0.0:0.0:1.0	.	.	.	.	X	903;904;907	.	ENSP00000303960:K904X	K	-	1	0	ABCC8	17386628	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.693000	0.84214	2.371000	0.80710	0.533000	0.62120	AAG	ABCC8	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000006071		0.542	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1		0.00	40	0	T	NM_000352		17430052	-1			no_errors	ENST00000302539	ensembl	human	known	74_37	nonsense	9.52	38	4	SNP	1.000	A
ACACA	31	genome.wustl.edu	37	17	35564696	35564696	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:35564696G>T	ENST00000394406.2	-	31	3805	c.3615C>A	c.(3613-3615)aaC>aaA	p.N1205K	ACACA_ENST00000360679.3_Missense_Mutation_p.N1147K|ACACA_ENST00000353139.5_Missense_Mutation_p.N1242K|ACACA_ENST00000335166.5_Missense_Mutation_p.N1127K	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1205					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)	p.N1147N(1)|p.N1242N(1)		NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGTGGTTGAGGTTGGAGGAGA	0.468																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												2	Substitution - coding silent(2)	large_intestine(2)											153.0	124.0	134.0					17																	35564696		2203	4300	6503	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.3615C>A	17.37:g.35564696G>T	ENSP00000377928:p.Asn1205Lys		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.N1242K	ENST00000394406.2	37	c.3726	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	G	6.270	0.417889	0.11870	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	D;D;D;D	0.94862	-3.54;-3.53;-3.54;-3.53	5.51	5.51	0.81932	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	D	0.88303	0.6400	N	0.14661	0.345	0.80722	D	1	B;B;B	0.21821	0.016;0.061;0.022	B;B;B	0.22152	0.02;0.038;0.022	D	0.83697	0.0180	10	0.05959	T	0.93	-19.4031	19.7929	0.96466	0.0:0.0:1.0:0.0	.	1242;1205;1147	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	K	1242;1147;1205;1229;1127	ENSP00000344789:N1242K;ENSP00000353898:N1147K;ENSP00000377928:N1205K;ENSP00000335323:N1127K	ENSP00000335323:N1127K	N	-	3	2	ACACA	32638809	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.485000	0.73625	2.741000	0.93983	0.650000	0.86243	AAC	ACACA	-	pfam_AcCoA_COase_cen	ENSG00000132142		0.468	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	-	0.00	56	0	G	NM_198836		35564696	-1	tier1	-	no_errors	ENST00000353139	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	T
ADAMTSL3	57188	genome.wustl.edu	37	15	84611717	84611717	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:84611717G>A	ENST00000286744.5	+	19	2597	c.2373G>A	c.(2371-2373)acG>acA	p.T791T	ADAMTSL3_ENST00000567476.1_Silent_p.T791T	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	791	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			AGCTGCTAACGGATGGCAGCT	0.547																																																	0													73.0	71.0	72.0					15																	84611717		2203	4300	6503	SO:0001819	synonymous_variant	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.2373G>A	15.37:g.84611717G>A			A1A566|A1A567|Q9ULI7	Silent	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.T791	ENST00000286744.5	37	c.2373	CCDS10326.1	15																																																																																			ADAMTSL3	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000156218		0.547	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2		0.00	29	0	G	NM_207517		84611717	+1			no_errors	ENST00000286744	ensembl	human	known	74_37	silent	18.18	18	4	SNP	0.023	A
ADCY10	55811	genome.wustl.edu	37	1	167873231	167873231	+	Splice_Site	SNP	T	T	C	rs142062218		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:167873231T>C	ENST00000367851.4	-	3	333		c.e3-2		ADCY10_ENST00000545172.1_Intron|ADCY10_ENST00000367848.1_Splice_Site	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)						cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CAGTAAAACCTGGAATAAATG	0.488																																																	0								T	,	1,4405	2.1+/-5.4	0,1,2202	106.0	97.0	100.0		,	5.6	1.0	1	dbSNP_134	100	0,8600		0,0,4300	no	intron,splice-3	ADCY10	NM_001167749.1,NM_018417.4	,	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	,	,	167873231	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.149-2A>G	1.37:g.167873231T>C			B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Splice_Site	SNP	-	e2-2	ENST00000367851.4	37	c.149-2	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	T	19.37	3.814723	0.70912	2.27E-4	0.0	ENSG00000143199	ENST00000367851	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1481	0.54034	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADCY10	166139855	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	4.439000	0.59968	2.111000	0.64477	0.533000	0.62120	.	ADCY10	-	-	ENSG00000143199		0.488	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	88	0	T	NM_018417	Intron	167873231	-1	tier1	rs142062218	no_errors	ENST00000367851	ensembl	human	known	74_37	splice_site	7.89	70	6	SNP	1.000	C
AKAP9	10142	genome.wustl.edu	37	7	91712605	91712605	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:91712605G>A	ENST00000359028.2	+	34	8543	c.8318G>A	c.(8317-8319)aGc>aAc	p.S2773N	AKAP9_ENST00000356239.3_Missense_Mutation_p.S2761N|AKAP9_ENST00000358100.2_Missense_Mutation_p.S2773N			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2773					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GTACAAGAAAGCAAAAAGGCC	0.423			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													88.0	84.0	85.0					7																	91712605		2203	4300	6503	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8318G>A	7.37:g.91712605G>A	ENSP00000351922:p.Ser2773Asn		A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.S2773N	ENST00000359028.2	37	c.8318		7	.	.	.	.	.	.	.	.	.	.	G	0.805	-0.754140	0.03041	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.40476	1.03;1.03;1.03;1.03	4.8	-1.56	0.08532	.	1.144530	0.06655	N	0.763408	T	0.21801	0.0525	N	0.13235	0.315	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.0;0.0;0.0;0.0	T	0.26849	-1.0091	10	0.05436	T	0.98	.	10.2912	0.43596	0.424:0.0:0.576:0.0	.	2765;2765;2773;2761;2753	F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3	.;.;AKAP9_HUMAN;.;.	N	2761;2773;2773;2765;607	ENSP00000348573:S2761N;ENSP00000351922:S2773N;ENSP00000350813:S2773N;ENSP00000378042:S607N	ENSP00000348573:S2761N	S	+	2	0	AKAP9	91550541	0.168000	0.22989	0.004000	0.12327	0.033000	0.12548	0.491000	0.22419	-0.154000	0.11118	-0.312000	0.09012	AGC	AKAP9	-	NULL	ENSG00000127914		0.423	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	0.00	37	0	G	NM_005751		91712605	+1	tier1	-	no_errors	ENST00000359028	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.014	A
ALDH3A1	218	genome.wustl.edu	37	17	19646651	19646651	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:19646651G>T	ENST00000457500.2	-	2	617	c.288C>A	c.(286-288)gaC>gaA	p.D96E	ALDH3A1_ENST00000485231.1_5'UTR|ALDH3A1_ENST00000395555.3_Missense_Mutation_p.D96E|ALDH3A1_ENST00000494157.2_Missense_Mutation_p.D23E|ALDH3A1_ENST00000444455.1_Missense_Mutation_p.D96E|ALDH3A1_ENST00000225740.6_Missense_Mutation_p.D96E	NM_001135168.1	NP_001128640.1	P30838	AL3A1_HUMAN	aldehyde dehydrogenase 3 family, member A1	96					aging (GO:0007568)|cellular aldehyde metabolic process (GO:0006081)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|alcohol dehydrogenase (NADP+) activity (GO:0008106)|aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)	p.D96D(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;4.01e-05)|all_epithelial(12;0.00301)|Breast(13;0.186)			Colorectal(15;0.0829)		TGTAGAGCTCGTCCTGCTGAG	0.612																																																	1	Substitution - coding silent(1)	urinary_tract(1)											126.0	109.0	114.0					17																	19646651		2203	4300	6503	SO:0001583	missense	0			M74542	CCDS11212.1	17p11.2	2010-05-07	2010-05-07		ENSG00000108602	ENSG00000108602	1.2.1.5	"""Aldehyde dehydrogenases"""	405	protein-coding gene	gene with protein product	"""aldehyde dehydrogenase, dimeric NADP-preferring"""	100660		ALDH3		7774944, 1737758	Standard	NM_000691		Approved		uc010cqu.3	P30838	OTTHUMG00000059469	ENST00000457500.2:c.288C>A	17.37:g.19646651G>T	ENSP00000411821:p.Asp96Glu		A8K828|Q9BT37	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	p.D96E	ENST00000457500.2	37	c.288	CCDS11212.1	17	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867524	0.51588	.	.	ENSG00000108602	ENST00000225740;ENST00000395555;ENST00000379258;ENST00000444455;ENST00000457500;ENST00000457844;ENST00000439102;ENST00000426645	T;T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89;-0.89	4.82	-6.17	0.02091	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	.	.	.	.	T	0.80633	0.4660	M	0.74647	2.275	0.47476	D	0.999435	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.81551	-0.0881	9	0.72032	D	0.01	-13.962	8.11	0.30909	0.3935:0.0:0.4952:0.1114	.	96;96	A8K828;P30838	.;AL3A1_HUMAN	E	96;96;154;96;96;23;96;96	ENSP00000225740:D96E;ENSP00000378923:D96E;ENSP00000388469:D96E;ENSP00000411821:D96E;ENSP00000389766:D96E	ENSP00000225740:D96E	D	-	3	2	ALDH3A1	19587243	0.003000	0.15002	0.329000	0.25429	0.419000	0.31324	-1.202000	0.03023	-0.716000	0.04962	-1.581000	0.00855	GAC	ALDH3A1	-	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH,pirsf_Aldehyde_DH_NAD(P)	ENSG00000108602		0.612	ALDH3A1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ALDH3A1	HGNC	protein_coding	OTTHUMT00000132265.4		0.00	50	0	G	NM_000691		19646651	-1			no_errors	ENST00000225740	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.048	T
ALG12	79087	genome.wustl.edu	37	22	50301593	50301593	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:50301593C>T	ENST00000330817.6	-	7	1042		c.e7-1			NM_024105.3	NP_077010.1	Q9BV10	ALG12_HUMAN	ALG12, alpha-1,6-mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosyltransferase activity (GO:0000009)|dol-P-Man:Man(7)GlcNAc(2)-PP-Dol alpha-1,6-mannosyltransferase activity (GO:0052917)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(3)	12		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		GCGGGGAGGTCTGCGGGCTGG	0.642																																																	0													36.0	41.0	39.0					22																	50301593		2202	4300	6502	SO:0001630	splice_region_variant	0			AJ303120	CCDS14081.1	22q13.33	2013-02-26	2013-02-26		ENSG00000182858	ENSG00000182858	2.4.1.260	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19358	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichol alpha-1,6-mannosyltransferase"", ""dol-P-Man dependent alpha-1,6-mannosyltransferase"""	607144	"""asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase)"", ""asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae)"""			11983712	Standard	NM_024105		Approved	ECM39	uc003biy.3	Q9BV10	OTTHUMG00000150289	ENST00000330817.6:c.769-1G>A	22.37:g.50301593C>T			A6PWM1|Q4KMH4|Q8NG10|Q96AA4	Splice_Site	SNP	-	e6-1	ENST00000330817.6	37	c.769-1	CCDS14081.1	22	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276161	0.40294	.	.	ENSG00000182858	ENST00000330817	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2417	0.89969	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALG12	48687597	1.000000	0.71417	0.979000	0.43373	0.507000	0.33981	4.267000	0.58877	2.378000	0.81104	0.655000	0.94253	.	ALG12	-	-	ENSG00000182858		0.642	ALG12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG12	HGNC	protein_coding	OTTHUMT00000317405.2	-	0.00	37	0	C	NM_024105	Intron	50301593	-1	tier1	-	no_errors	ENST00000330817	ensembl	human	known	74_37	splice_site	28.12	23	9	SNP	1.000	T
ANKRD45	339416	genome.wustl.edu	37	1	173596207	173596207	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:173596207G>T	ENST00000333279.2	-	4	648	c.588C>A	c.(586-588)gaC>gaA	p.D196E		NM_198493.2	NP_940895.1	Q5TZF3	ANR45_HUMAN	ankyrin repeat domain 45	212										NS(2)|endometrium(2)|large_intestine(4)|lung(3)|skin(1)	12						ACAGTACCTTGTCTTCCTTAA	0.363																																																	0													153.0	154.0	153.0					1																	173596207		2203	4300	6503	SO:0001583	missense	0				CCDS1309.1	1q25.1	2013-01-10			ENSG00000183831	ENSG00000183831		"""Ankyrin repeat domain containing"""	24786	protein-coding gene	gene with protein product	"""cancer/testis antigen 117"""						Standard	NM_198493		Approved	FLJ45235, CT117	uc001gja.1	Q5TZF3	OTTHUMG00000040546	ENST00000333279.2:c.588C>A	1.37:g.173596207G>T	ENSP00000331268:p.Asp196Glu		A1A4G2|Q6ZST1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D196E	ENST00000333279.2	37	c.588	CCDS1309.1	1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.340846	0.41498	.	.	ENSG00000183831	ENST00000333279	T	0.15487	2.42	5.35	0.0275	0.14155	.	0.123358	0.52532	D	0.000075	T	0.05364	0.0142	M	0.66560	2.04	0.32282	N	0.567433	B	0.33212	0.402	B	0.33196	0.159	T	0.32268	-0.9913	10	0.23891	T	0.37	-12.826	4.4342	0.11542	0.3316:0.0:0.5232:0.1452	.	212	Q5TZF3	ANR45_HUMAN	E	196	ENSP00000331268:D196E	ENSP00000331268:D196E	D	-	3	2	ANKRD45	171862830	1.000000	0.71417	0.993000	0.49108	0.959000	0.62525	0.980000	0.29513	-0.245000	0.09625	-0.321000	0.08615	GAC	ANKRD45	-	NULL	ENSG00000183831		0.363	ANKRD45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD45	HGNC	protein_coding	OTTHUMT00000097580.2	-	0.00	40	0	G	NM_198493		173596207	-1	tier1	-	no_errors	ENST00000333279	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.997	T
ARHGAP31	57514	genome.wustl.edu	37	3	119101232	119101232	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:119101232G>A	ENST00000264245.4	+	5	1057	c.525G>A	c.(523-525)gcG>gcA	p.A175A		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	175	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TGGTGTGGGCGCCAAACCTCC	0.557																																					Pancreas(7;176 297 5394 51128 51241)												0													61.0	71.0	68.0					3																	119101232		1942	4142	6084	SO:0001819	synonymous_variant	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.525G>A	3.37:g.119101232G>A			Q9ULL6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A175	ENST00000264245.4	37	c.525	CCDS43135.1	3																																																																																			ARHGAP31	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000031081		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	-	0.00	45	0	G			119101232	+1	tier1	-	no_errors	ENST00000264245	ensembl	human	known	74_37	silent	20.59	54	14	SNP	0.006	A
ARHGDIG	398	genome.wustl.edu	37	16	332775	332775	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:332775G>T	ENST00000219409.3	+	6	714	c.639G>T	c.(637-639)tgG>tgT	p.W213C	PDIA2_ENST00000404312.1_5'Flank|PDIA2_ENST00000219406.6_5'Flank	NM_001176.3	NP_001167.2	Q99819	GDIR3_HUMAN	Rho GDP dissociation inhibitor (GDI) gamma	213					negative regulation of cell adhesion (GO:0007162)|regulation of protein localization (GO:0032880)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			breast(1)|central_nervous_system(1)|large_intestine(1)	3		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				ACCTGTCCTGGGAGTGGGGTC	0.647											OREG0003697	type=REGULATORY REGION|Gene=PDIA2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													31.0	29.0	30.0					16																	332775		2200	4298	6498	SO:0001583	missense	0			U82532	CCDS10404.1	16p13.3	2008-07-29			ENSG00000242173	ENSG00000242173			680	protein-coding gene	gene with protein product	"""RhoGDI gamma"""	602844				9113980, 11967128	Standard	NM_001176		Approved	RHOGDI-3	uc002cgm.1	Q99819	OTTHUMG00000064892	ENST00000219409.3:c.639G>T	16.37:g.332775G>T	ENSP00000219409:p.Trp213Cys	587	Q4TT69|Q96S29	Missense_Mutation	SNP	pfam_Rho_GDI,superfamily_Ig_E-set,prints_Rho_GDI	p.W213C	ENST00000219409.3	37	c.639	CCDS10404.1	16	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468112	0.63625	.	.	ENSG00000242173	ENST00000219409;ENST00000414650	.	.	.	4.11	4.11	0.48088	Immunoglobulin E-set (1);	0.000000	0.51477	U	0.000089	D	0.83912	0.5357	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87409	0.2374	8	.	.	.	-13.4629	13.8384	0.63424	0.0:0.0:1.0:0.0	.	213	Q99819	GDIR3_HUMAN	C	213;105	.	.	W	+	3	0	ARHGDIG	272776	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	9.064000	0.93933	1.847000	0.53656	0.563000	0.77884	TGG	ARHGDIG	-	pfam_Rho_GDI,superfamily_Ig_E-set,prints_Rho_GDI	ENSG00000242173		0.647	ARHGDIG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGDIG	HGNC	protein_coding	OTTHUMT00000139321.1	-	0.00	63	0	G			332775	+1	tier1	-	no_errors	ENST00000219409	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
LRRC71	149499	genome.wustl.edu	37	1	156904759	156904759	+	IGR	SNP	T	T	A	rs111749122		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:156904759T>A	ENST00000337428.7	+	0	1959				ARHGEF11_ENST00000368194.3_3'UTR|ARHGEF11_ENST00000487682.1_5'UTR|MIR765_ENST00000390226.1_RNA	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71											endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						atatatatatttatatatata	0.308																																																	0																																										SO:0001628	intergenic_variant	0			BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298		1.37:g.156904759T>A			Q96M24	RNA	SNP	-	NULL	ENST00000337428.7	37	NULL	CCDS44249.1	1																																																																																			ARHGEF11	-	-	ENSG00000132694		0.308	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098961.1	-	0.00	50	0	T	NM_144702		156904759	-1	tier1	rs111749122	no_errors	ENST00000487682	ensembl	human	known	74_37	rna	6.02	78	5	SNP	0.722	A
ARSF	416	genome.wustl.edu	37	X	2990074	2990074	+	Silent	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:2990074T>C	ENST00000381127.1	+	3	240	c.19T>C	c.(19-21)Ttg>Ctg	p.L7L	ARSF_ENST00000359361.2_Silent_p.L7L|ARSF_ENST00000537104.1_Silent_p.L7L	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	7					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGGAGACCCTTGGTCTTCAT	0.488																																																	0													172.0	130.0	144.0					X																	2990074		2203	4300	6503	SO:0001819	synonymous_variant	0			X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.19T>C	X.37:g.2990074T>C			Q8TCC5	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.L7	ENST00000381127.1	37	c.19	CCDS14123.1	X																																																																																			ARSF	-	NULL	ENSG00000062096		0.488	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSF	HGNC	protein_coding	OTTHUMT00000055652.1	-	0.00	23	0	T			2990074	+1	tier1	-	no_errors	ENST00000359361	ensembl	human	known	74_37	silent	14.29	24	4	SNP	0.000	C
ARVCF	421	genome.wustl.edu	37	22	19969146	19969146	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:19969146C>T	ENST00000263207.3	-	5	775	c.484G>A	c.(484-486)Gcc>Acc	p.A162T	ARVCF_ENST00000401994.1_Missense_Mutation_p.A99T|ARVCF_ENST00000344269.3_Missense_Mutation_p.A99T|ARVCF_ENST00000487793.1_5'UTR|ARVCF_ENST00000406259.1_Missense_Mutation_p.A162T|ARVCF_ENST00000406522.1_Missense_Mutation_p.A99T	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	162					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					CGGTCCAGGGCACCATCTGCA	0.672																																																	0													30.0	37.0	35.0					22																	19969146		2173	4256	6429	SO:0001583	missense	0				CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.484G>A	22.37:g.19969146C>T	ENSP00000263207:p.Ala162Thr		B7WNV2	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A162T	ENST00000263207.3	37	c.484	CCDS13771.1	22	.	.	.	.	.	.	.	.	.	.	C	5.627	0.300426	0.10678	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	4.43	2.33	0.28932	.	0.479636	0.23577	N	0.046681	T	0.07954	0.0199	N	0.01352	-0.895	0.29374	N	0.863824	B	0.12630	0.006	B	0.12837	0.008	T	0.20009	-1.0288	9	.	.	.	-13.6528	2.8973	0.05694	0.2595:0.3011:0.4394:0.0	.	162	O00192	ARVC_HUMAN	T	162;99;99;99;162	ENSP00000263207:A162T;ENSP00000342042:A99T;ENSP00000384341:A99T;ENSP00000384732:A99T;ENSP00000385444:A162T	.	A	-	1	0	ARVCF	18349146	0.937000	0.31787	0.997000	0.53966	0.815000	0.46073	1.403000	0.34612	1.208000	0.43306	-0.371000	0.07208	GCC	ARVCF	-	NULL	ENSG00000099889		0.672	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARVCF	HGNC	protein_coding	OTTHUMT00000075314.5	-	0.00	46	0	C	NM_001670		19969146	-1	tier1	-	no_errors	ENST00000263207	ensembl	human	known	74_37	missense	43.48	26	20	SNP	1.000	T
ASNA1	439	genome.wustl.edu	37	19	12858341	12858341	+	Missense_Mutation	SNP	G	G	A	rs149156095	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:12858341G>A	ENST00000591090.1	+	7	952	c.850G>A	c.(850-852)Gac>Aac	p.D284N	ASNA1_ENST00000357332.3_Missense_Mutation_p.D284N					arsA arsenite transporter, ATP-binding, homolog 1 (bacterial)											endometrium(1)|lung(6)|ovary(3)	10						CGTCTTCCCCGACCCCGAGAA	0.562																																																	0								G	ASN/ASP	0,4406		0,0,2203	74.0	64.0	67.0		850	5.1	1.0	19	dbSNP_134	67	2,8598	2.2+/-6.3	0,2,4298	no	missense	ASNA1	NM_004317.2	23	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	284/349	12858341	2,13004	2203	4300	6503	SO:0001583	missense	0			U60276	CCDS32920.1	19p13.13	2010-08-05	2001-12-04			ENSG00000198356			752	protein-coding gene	gene with protein product	"""golgi to ER traffic 3 homolog (S. cerevisiae)"", ""transmembrane domain recognition complex, 40kDa"""	601913	"""arsA (bacterial) arsenite transporter, ATP-binding, homolog 1"""			8884272, 17382883	Standard	NM_004317		Approved	ARSA-I, GET3, TRC40	uc002muv.3	O43681		ENST00000591090.1:c.850G>A	19.37:g.12858341G>A	ENSP00000466379:p.Asp284Asn			Missense_Mutation	SNP	pfam_Anion-transp_ATPase-like_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,tigrfam_ATPase_ArsA/GET3	p.D284N	ENST00000591090.1	37	c.850	CCDS32920.1	19	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008035	0.54361	0.0	2.33E-4	ENSG00000198356	ENST00000357332	T	0.45668	0.89	5.1	5.1	0.69264	.	0.099904	0.64402	D	0.000004	T	0.32941	0.0846	L	0.31578	0.945	0.80722	D	1	B;B	0.25521	0.128;0.004	B;B	0.17098	0.017;0.003	T	0.06899	-1.0801	10	0.30078	T	0.28	-41.4305	17.2701	0.87098	0.0:0.0:1.0:0.0	.	266;284	E7EVN0;O43681	.;ASNA_HUMAN	N	284	ENSP00000349887:D284N	ENSP00000349887:D284N	D	+	1	0	ASNA1	12719341	1.000000	0.71417	0.959000	0.39883	0.814000	0.46013	9.111000	0.94308	2.363000	0.80096	0.655000	0.94253	GAC	ASNA1	-	pfam_Anion-transp_ATPase-like_dom,superfamily_P-loop_NTPase,tigrfam_ATPase_ArsA/GET3	ENSG00000198356		0.562	ASNA1-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ASNA1	HGNC	protein_coding	OTTHUMT00000450921.1	-	0.00	17	0	G	NM_004317		12858341	+1	tier1	rs149156095	no_errors	ENST00000357332	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.999	A
ATAD2	29028	genome.wustl.edu	37	8	124346560	124346560	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:124346560G>T	ENST00000287394.5	-	23	3321	c.3214C>A	c.(3214-3216)Cgt>Agt	p.R1072S	ATAD2_ENST00000521903.1_Missense_Mutation_p.R390S	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	1072					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTAATAAGACGATCTATGAAG	0.323																																																	0													44.0	43.0	43.0					8																	124346560		2201	4299	6500	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.3214C>A	8.37:g.124346560G>T	ENSP00000287394:p.Arg1072Ser		Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.R1072S	ENST00000287394.5	37	c.3214	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813471	0.90790	.	.	ENSG00000156802	ENST00000287394;ENST00000521903	T;T	0.11821	2.74;2.74	6.07	6.07	0.98685	Bromodomain (3);	0.096714	0.64402	D	0.000001	T	0.42200	0.1192	M	0.77103	2.36	0.80722	D	1	D	0.71674	0.998	D	0.69824	0.966	T	0.08659	-1.0711	10	0.56958	D	0.05	-15.089	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1072	Q6PL18	ATAD2_HUMAN	S	1072;390	ENSP00000287394:R1072S;ENSP00000429213:R390S	ENSP00000287394:R1072S	R	-	1	0	ATAD2	124415741	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	9.420000	0.97426	2.885000	0.99019	0.655000	0.94253	CGT	ATAD2	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000156802		0.323	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2		0.00	98	0	G	NM_014109		124346560	-1			no_errors	ENST00000287394	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
ATP1A2	477	genome.wustl.edu	37	1	160105632	160105632	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:160105632G>A	ENST00000361216.3	+	17	2377	c.2288G>A	c.(2287-2289)cGc>cAc	p.R763H	ATP1A2_ENST00000392233.3_Missense_Mutation_p.R763H	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	763					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CCCACAGGCCGCCTGATCTTT	0.572																																																	0			GRCh37	CM041248	ATP1A2	M							137.0	123.0	127.0					1																	160105632		2203	4300	6503	SO:0001583	missense	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2288G>A	1.37:g.160105632G>A	ENSP00000354490:p.Arg763His		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.R763H	ENST00000361216.3	37	c.2288	CCDS1196.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.6|27.6	4.843124|4.843124	0.91197|0.91197	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|D;D	.|0.97480	.|-4.4;-4.4	4.39|4.39	4.39|4.39	0.52855|0.52855	.|ATPase, P-type,  transmembrane domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99171|0.99171	0.9713|0.9713	H|H	0.99249|0.99249	4.485|4.485	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.98565|0.98565	1.0643|1.0643	5|10	.|0.87932	.|D	.|0	.|.	14.335|14.335	0.66584|0.66584	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|663;763	.|F5GXJ7;P50993	.|.;AT1A2_HUMAN	T|H	474|763;763;466	.|ENSP00000354490:R763H;ENSP00000376066:R763H	.|ENSP00000354490:R763H	A|R	+|+	1|2	0|0	ATP1A2|ATP1A2	158372256|158372256	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.536000|9.536000	0.98067|0.98067	2.427000|2.427000	0.82271|0.82271	0.561000|0.561000	0.74099|0.74099	GCC|CGC	ATP1A2	-	tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000018625		0.572	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2	-	0.00	48	0	G	NM_000702		160105632	+1	tier1	-	no_errors	ENST00000361216	ensembl	human	known	74_37	missense	13.70	63	10	SNP	1.000	A
ATP2B1	490	genome.wustl.edu	37	12	89992491	89992491	+	Silent	SNP	T	T	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:89992491T>G	ENST00000359142.3	-	20	3605	c.3381A>C	c.(3379-3381)ggA>ggC	p.G1127G	ATP2B1_ENST00000393164.2_Intron|ATP2B1_ENST00000261173.2_Intron|ATP2B1_ENST00000428670.3_Intron|ATP2B1_ENST00000348959.3_Intron	NM_001001323.1	NP_001001323.1	P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	1127	Calmodulin-binding subdomain B.				blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						GAATGGAACTTCCACTCTGGA	0.468																																																	0													177.0	172.0	174.0					12																	89992491		1942	4142	6084	SO:0001819	synonymous_variant	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000359142.3:c.3381A>C	12.37:g.89992491T>G			Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATP_Ca_trans_C,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.G1127	ENST00000359142.3	37	c.3381	CCDS41817.1	12																																																																																			ATP2B1	-	pfam_ATP_Ca_trans_C	ENSG00000070961		0.468	ATP2B1-002	KNOWN	basic|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406652.1		0.00	21	0	T	NM_001682		89992491	-1			no_errors	ENST00000359142	ensembl	human	known	74_37	silent	12.50	28	4	SNP	1.000	G
PTCD1	26024	genome.wustl.edu	37	7	99022949	99022949	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:99022949C>T	ENST00000292478.4	-	6	1456	c.1206G>A	c.(1204-1206)ccG>ccA	p.P402P	ATP5J2-PTCD1_ENST00000413834.1_Silent_p.P451P|PTCD1_ENST00000555673.1_Silent_p.P451P	NM_015545.3	NP_056360.2	O75127	PTCD1_HUMAN	pentatricopeptide repeat domain 1	402					tRNA 3'-end processing (GO:0042780)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			endometrium(5)|large_intestine(3)|lung(16)|ovary(2)|skin(1)	27	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			CTCTGGCTTCCGGAGGCTCTG	0.637																																																	0													92.0	91.0	92.0					7																	99022949		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014532	CCDS34691.1	7q22.1	2006-01-27				ENSG00000106246			22198	protein-coding gene	gene with protein product		614774					Standard	NM_015545		Approved	KIAA0632		O75127		ENST00000292478.4:c.1206G>A	7.37:g.99022949C>T			Q3ZB78|Q66K60|Q9UDV2	Silent	SNP	pfam_Pentatricopeptide_repeat,pfam_F1F0-ATPsyn_F_prd,tigrfam_Pentatricopeptide_repeat	p.P451	ENST00000292478.4	37	c.1353	CCDS34691.1	7																																																																																			ATP5J2-PTCD1	-	NULL	ENSG00000248919		0.637	PTCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5J2-PTCD1	HGNC	protein_coding	OTTHUMT00000336391.1	-	0.00	56	0	C	NM_015545		99022949	-1	tier1	-	no_errors	ENST00000413834	ensembl	human	known	74_37	silent	32.88	49	24	SNP	0.004	T
ATXN7L2	127002	genome.wustl.edu	37	1	110032706	110032706	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:110032706C>T	ENST00000369870.3	+	8	1207	c.1192C>T	c.(1192-1194)Ccc>Tcc	p.P398S		NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	398										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCTCCACCCACCCCCTGACTG	0.672																																																	0													50.0	53.0	52.0					1																	110032706		2203	4300	6503	SO:0001583	missense	0			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1192C>T	1.37:g.110032706C>T	ENSP00000358886:p.Pro398Ser			Missense_Mutation	SNP	pfam_SCA7_dom	p.P398S	ENST00000369870.3	37	c.1192	CCDS30794.1	1	.	.	.	.	.	.	.	.	.	.	C	8.061	0.768034	0.15983	.	.	ENSG00000162650	ENST00000369870;ENST00000541125;ENST00000369869	T	0.39997	1.05	5.82	0.185	0.15096	.	0.954835	0.08733	N	0.901727	T	0.06462	0.0166	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33624	-0.9861	10	0.33940	T	0.23	-0.462	2.3592	0.04303	0.1173:0.4328:0.1267:0.3232	.	398	Q5T6C5	AT7L2_HUMAN	S	398;398;25	ENSP00000358886:P398S	ENSP00000358885:P25S	P	+	1	0	ATXN7L2	109834229	0.000000	0.05858	0.987000	0.45799	0.994000	0.84299	-0.230000	0.09083	0.095000	0.17434	0.655000	0.94253	CCC	ATXN7L2	-	NULL	ENSG00000162650		0.672	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	HGNC	protein_coding	OTTHUMT00000030331.1	-	0.00	74	0	C	NM_153340		110032706	+1	tier1	-	no_errors	ENST00000369870	ensembl	human	known	74_37	missense	16.05	68	13	SNP	0.001	T
BACE2	25825	genome.wustl.edu	37	21	42647541	42647541	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr21:42647541G>A	ENST00000330333.6	+	9	2010	c.1547G>A	c.(1546-1548)cGc>cAc	p.R516H	BACE2_ENST00000347667.5_Missense_Mutation_p.R466H|BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_3'UTR	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	516					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				GTCAGACATCGCTGGAAATGA	0.547																																																	0													101.0	85.0	90.0					21																	42647541		2203	4300	6503	SO:0001583	missense	0			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.1547G>A	21.37:g.42647541G>A	ENSP00000332979:p.Arg516His		A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Missense_Mutation	SNP	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Pept_A1_BACE,prints_Pept_A1_BACE2,prints_Aspartic_peptidase,prints_Pept_A1_BACE1	p.R516H	ENST00000330333.6	37	c.1547	CCDS13668.1	21	.	.	.	.	.	.	.	.	.	.	G	29.6	5.021182	0.93462	.	.	ENSG00000182240	ENST00000330333;ENST00000347667;ENST00000544566	T;T	0.66638	-0.04;-0.22	5.48	4.59	0.56863	.	0.066187	0.64402	D	0.000008	T	0.72203	0.3431	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.75153	-0.3418	10	0.87932	D	0	.	13.8355	0.63406	0.0746:0.0:0.9254:0.0	.	466;516	Q9Y5Z0-2;Q9Y5Z0	.;BACE2_HUMAN	H	516;466;421	ENSP00000332979:R516H;ENSP00000327528:R466H	ENSP00000332979:R516H	R	+	2	0	BACE2	41569411	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.014000	0.70784	2.593000	0.87608	0.650000	0.86243	CGC	BACE2	-	NULL	ENSG00000182240		0.547	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BACE2	HGNC	protein_coding	OTTHUMT00000195056.1	-	0.00	9	0	G			42647541	+1	tier1	-	no_errors	ENST00000330333	ensembl	human	known	74_37	missense	44.44	5	4	SNP	1.000	A
BDNF	627	genome.wustl.edu	37	11	27680474	27680474	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:27680474C>T	ENST00000418212.1	-	2	325		c.e2-1		BDNF_ENST00000314915.6_Intron|BDNF_ENST00000395983.3_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000533246.1_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000438929.1_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000525528.1_5'UTR|BDNF_ENST00000395978.3_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000420794.1_Intron|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000584049.1_Intron	NM_001143814.1	NP_001137286.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						TCTGCTCATGCTGTCACGAGA	0.348																																																	0																																										SO:0001630	splice_region_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000418212.1:c.128-1G>A	11.37:g.27680474C>T			A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Splice_Site	SNP	-	e1-1	ENST00000418212.1	37	c.1-1	CCDS7866.1	11																																																																																			BDNF	-	-	ENSG00000176697		0.348	BDNF-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388097.1	-	0.00	63	0	C	NM_170735	Intron	27680474	-1	tier1	-	no_errors	ENST00000418212	ensembl	human	known	74_37	splice_site	7.02	53	4	SNP	0.999	T
BRDT	676	genome.wustl.edu	37	1	92428479	92428479	+	Silent	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:92428479G>T	ENST00000362005.3	+	3	586	c.168G>T	c.(166-168)gtG>gtT	p.V56V	BRDT_ENST00000399546.2_Silent_p.V56V|BRDT_ENST00000402388.1_Silent_p.V56V|BRDT_ENST00000394530.3_Silent_p.V56V|BRDT_ENST00000370389.2_Intron	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	56	Bromo 1. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		AACGTCCTGTGGATGCTGTGA	0.348																																																	0													112.0	111.0	111.0					1																	92428479		2203	4300	6503	SO:0001819	synonymous_variant	0			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.168G>T	1.37:g.92428479G>T			A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Silent	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.V56	ENST00000362005.3	37	c.168	CCDS735.1	1																																																																																			BRDT	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000137948		0.348	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	HGNC	protein_coding	OTTHUMT00000027980.2		0.00	52	0	G	NM_207189		92428479	+1			no_errors	ENST00000362005	ensembl	human	known	74_37	silent	5.26	53	3	SNP	0.962	T
BUB1	699	genome.wustl.edu	37	2	111419341	111419341	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:111419341C>T	ENST00000302759.6	-	10	1153	c.1035G>A	c.(1033-1035)caG>caA	p.Q345Q	BUB1_ENST00000535254.1_Silent_p.Q325Q|BUB1_ENST00000409311.1_Silent_p.Q345Q	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	345					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		CTGGTGTCTGCTGATAGGTTA	0.488																																																	0													146.0	138.0	141.0					2																	111419341		2203	4300	6503	SO:0001819	synonymous_variant	0			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.1035G>A	2.37:g.111419341C>T			E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Silent	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.Q345	ENST00000302759.6	37	c.1035	CCDS33273.1	2																																																																																			BUB1	-	NULL	ENSG00000169679		0.488	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	HGNC	protein_coding	OTTHUMT00000331925.1	-	0.00	35	0	C	NM_004336		111419341	-1	tier1	-	no_errors	ENST00000302759	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.012	T
BYSL	705	genome.wustl.edu	37	6	41897994	41897994	+	Missense_Mutation	SNP	A	A	T	rs140565706		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:41897994A>T	ENST00000230340.4	+	3	931	c.556A>T	c.(556-558)Agg>Tgg	p.R186W		NM_004053.3	NP_004044.3	Q13895	BYST_HUMAN	bystin-like	186					cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|female pregnancy (GO:0007565)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|trophectodermal cell differentiation (GO:0001829)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(5)|skin(1)	8	Colorectal(47;0.121)		STAD - Stomach adenocarcinoma(11;0.000204)|Epithelial(12;0.000473)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AGAAGTGTACAGGGGGGTCCG	0.597																																																	0													23.0	27.0	26.0					6																	41897994		2203	4300	6503	SO:0001583	missense	0			L36720	CCDS34450.1	6p21.1	2008-08-29			ENSG00000112578	ENSG00000112578			1157	protein-coding gene	gene with protein product		603871				9925933, 17381424	Standard	NM_004053		Approved		uc003orl.3	Q13895	OTTHUMG00000014687	ENST00000230340.4:c.556A>T	6.37:g.41897994A>T	ENSP00000230340:p.Arg186Trp		Q6P5W4|Q86W44|Q96IP8	Missense_Mutation	SNP	pfam_Bystin	p.R186W	ENST00000230340.4	37	c.556	CCDS34450.1	6	.	.	.	.	.	.	.	.	.	.	A	23.1	4.371714	0.82573	.	.	ENSG00000112578	ENST00000230340	T	0.47177	0.85	6.06	2.18	0.27775	.	0.216636	0.56097	D	0.000031	T	0.57814	0.2079	M	0.82323	2.585	0.51233	D	0.999918	D	0.59767	0.986	D	0.63957	0.92	T	0.66184	-0.5987	10	0.87932	D	0	-20.7023	13.4354	0.61082	0.6263:0.3737:0.0:0.0	.	186	Q13895	BYST_HUMAN	W	186	ENSP00000230340:R186W	ENSP00000230340:R186W	R	+	1	2	BYSL	42005972	1.000000	0.71417	0.997000	0.53966	0.823000	0.46562	3.566000	0.53805	0.132000	0.18615	-0.329000	0.08387	AGG	BYSL	-	pfam_Bystin	ENSG00000112578		0.597	BYSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BYSL	HGNC	protein_coding	OTTHUMT00000040535.2		0.00	39	0	A			41897994	+1			no_errors	ENST00000230340	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
C11orf95	65998	genome.wustl.edu	37	11	63533490	63533490	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:63533490C>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							GGATGTGGCGCTTGATGGTGC	0.632																																																	0													107.0	100.0	102.0					11																	63533490		692	1591	2283			0																															11.37:g.63533490C>T				RNA	SNP	-	NULL	ENST00000546282.2	37	NULL		11																																																																																			C11orf95	-	-	ENSG00000188070		0.632	RP11-466C23.4-001	KNOWN	basic	lincRNA	C11orf95	HGNC	lincRNA	OTTHUMT00000396567.2	-	0.00	68	0	C			63533490	-1	tier1	-	no_errors	ENST00000433688	ensembl	human	known	74_37	rna	24.44	34	11	SNP	1.000	T
CFAP54	144535	genome.wustl.edu	37	12	97178570	97178570	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:97178570G>A	ENST00000524981.4	+	61	8380	c.8357G>A	c.(8356-8358)gGt>gAt	p.G2786D				Q96N23	CL055_HUMAN		0																	AGCGCAGATGGTAGAAAAAAG	0.383																																																	0																																										SO:0001583	missense	0																														ENST00000524981.4:c.8357G>A	12.37:g.97178570G>A	ENSP00000431759:p.Gly2786Asp			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.G2786D	ENST00000524981.4	37	c.8357		12	.	.	.	.	.	.	.	.	.	.	G	10.14	1.267712	0.23136	.	.	ENSG00000188596	ENST00000524981	.	.	.	4.73	1.68	0.24146	.	.	.	.	.	T	0.18045	0.0433	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28396	-1.0045	5	0.11485	T	0.65	.	6.9962	0.24784	0.0:0.394:0.5012:0.1048	.	.	.	.	D	2786	.	ENSP00000431759:G2786D	G	+	2	0	C12orf63	95702701	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.514000	0.22786	0.540000	0.28808	-0.321000	0.08615	GGT	C12orf55	-	NULL	ENSG00000188596		0.383	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	53	0	G			97178570	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	27.27	48	18	SNP	0.001	A
RITA1	84934	genome.wustl.edu	37	12	113624799	113624799	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:113624799C>T	ENST00000548278.1	+	3	940	c.248C>T	c.(247-249)aCc>aTc	p.T83I	RP11-545P7.4_ENST00000552525.1_RNA|DDX54_ENST00000306014.5_5'Flank|C12orf52_ENST00000552495.1_Missense_Mutation_p.T107I|C12orf52_ENST00000549621.1_Missense_Mutation_p.T83I|DDX54_ENST00000314045.7_5'Flank	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		83					negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)			large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						TGTGAGACCACCCCCTCAAGG	0.592																																																	0													43.0	46.0	45.0					12																	113624799		2197	4299	6496	SO:0001583	missense	0																														ENST00000548278.1:c.248C>T	12.37:g.113624799C>T	ENSP00000449841:p.Thr83Ile		B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Missense_Mutation	SNP	NULL	p.T83I	ENST00000548278.1	37	c.248	CCDS9166.1	12	.	.	.	.	.	.	.	.	.	.	C	12.76	2.035106	0.35893	.	.	ENSG00000139405	ENST00000549621;ENST00000548278;ENST00000552495;ENST00000436053;ENST00000299731;ENST00000266813	T;T;T	0.32988	1.45;1.45;1.43	4.86	3.93	0.45458	.	0.660669	0.13473	N	0.385272	T	0.28863	0.0716	L	0.44542	1.39	0.09310	N	1	P;P;P	0.48016	0.904;0.904;0.904	P;P;P	0.45829	0.494;0.494;0.494	T	0.06844	-1.0804	10	0.34782	T	0.22	-8.2439	8.4293	0.32748	0.1709:0.6634:0.1656:0.0	.	83;107;83	Q96K30-2;F8VRG5;Q96K30	.;.;RITA_HUMAN	I	83;83;107;83;83;83	ENSP00000448289:T83I;ENSP00000449841:T83I;ENSP00000448680:T107I	ENSP00000266813:T83I	T	+	2	0	C12orf52	112109182	0.000000	0.05858	0.100000	0.21137	0.115000	0.19883	0.666000	0.25097	2.506000	0.84524	0.655000	0.94253	ACC	C12orf52	-	NULL	ENSG00000139405		0.592	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf52	HGNC	protein_coding	OTTHUMT00000405239.1	-	0.00	41	0	C			113624799	+1	tier1	-	no_errors	ENST00000548278	ensembl	human	known	74_37	missense	25.00	18	6	SNP	0.001	T
C17orf102	400591	genome.wustl.edu	37	17	32906277	32906277	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:32906277G>A	ENST00000357754.1	-	1	111	c.23C>T	c.(22-24)aCg>aTg	p.T8M	TMEM132E_ENST00000321639.5_5'Flank	NM_207454.2	NP_997337.2	A2RUQ5	CQ102_HUMAN	chromosome 17 open reading frame 102	8										central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(3)|ovary(1)	9						GCTAGCCGGCGTTGGGAAGGA	0.657																																																	0													9.0	12.0	11.0					17																	32906277		1808	4027	5835	SO:0001583	missense	0				CCDS42297.1	17q12	2009-02-11			ENSG00000197322	ENSG00000197322			34412	protein-coding gene	gene with protein product							Standard	NM_207454		Approved	FLJ44815	uc002hie.1	A2RUQ5	OTTHUMG00000156883	ENST00000357754.1:c.23C>T	17.37:g.32906277G>A	ENSP00000350392:p.Thr8Met		A5PKX0|Q6ZTB3	Missense_Mutation	SNP	NULL	p.T8M	ENST00000357754.1	37	c.23	CCDS42297.1	17	.	.	.	.	.	.	.	.	.	.	G	11.02	1.516160	0.27123	.	.	ENSG00000197322	ENST00000357754	T	0.37915	1.17	3.5	-2.52	0.06346	.	1.637620	0.04436	N	0.370142	T	0.19886	0.0478	N	0.14661	0.345	0.09310	N	1	B	0.20887	0.049	B	0.14023	0.01	T	0.28870	-1.0030	10	0.87932	D	0	.	3.4658	0.07549	0.47:0.0:0.3505:0.1795	.	8	A2RUQ5	CQ102_HUMAN	M	8	ENSP00000350392:T8M	ENSP00000350392:T8M	T	-	2	0	C17orf102	29930390	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.271000	0.08572	-0.288000	0.09051	0.555000	0.69702	ACG	C17orf102	-	NULL	ENSG00000197322		0.657	C17orf102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf102	HGNC	protein_coding	OTTHUMT00000346435.1	-	0.00	50	0	G	NM_207454		32906277	-1	tier1	-	no_errors	ENST00000357754	ensembl	human	known	74_37	missense	25.00	30	10	SNP	0.000	A
CACNA1H	8912	genome.wustl.edu	37	16	1248689	1248689	+	Missense_Mutation	SNP	G	G	T	rs369630836		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:1248689G>T	ENST00000348261.5	+	6	966	c.718G>T	c.(718-720)Gtc>Ttc	p.V240F	CACNA1H_ENST00000565831.1_Missense_Mutation_p.V240F|CACNA1H_ENST00000358590.4_Missense_Mutation_p.V240F	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	240					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GTGCTTCTTCGTCTTCTTCAT	0.622																																																	0													155.0	172.0	166.0					16																	1248689		2186	4273	6459	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.718G>T	16.37:g.1248689G>T	ENSP00000334198:p.Val240Phe		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.V240F	ENST00000348261.5	37	c.718	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	G	21.5	4.159136	0.78226	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.98666	-5.06;-5.06	3.65	3.65	0.41850	Ion transport (1);	0.227351	0.36066	N	0.002804	D	0.98197	0.9404	L	0.37897	1.145	0.42017	D	0.990968	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97868	1.0284	10	0.36615	T	0.2	.	14.0887	0.64975	0.0:0.0:1.0:0.0	.	240;240	O95180-2;O95180	.;CAC1H_HUMAN	F	240	ENSP00000334198:V240F;ENSP00000351401:V240F	ENSP00000334198:V240F	V	+	1	0	CACNA1H	1188690	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	8.664000	0.91139	1.889000	0.54706	0.543000	0.68304	GTC	CACNA1H	-	pfam_Ion_trans_dom	ENSG00000196557		0.622	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1		0.00	36	0	G	NM_001005407		1248689	+1			no_errors	ENST00000348261	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
CCDC105	126402	genome.wustl.edu	37	19	15132449	15132449	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:15132449G>T	ENST00000292574.3	+	5	1145	c.1063G>T	c.(1063-1065)Gga>Tga	p.G355*		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	355						extracellular vesicular exosome (GO:0070062)		p.G355K(1)|p.G355R(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						TATGACGTTAGGACTGATGAG	0.587																																																	2	Substitution - Missense(2)	lung(2)											81.0	80.0	80.0					19																	15132449		2203	4300	6503	SO:0001587	stop_gained	0			AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1063G>T	19.37:g.15132449G>T	ENSP00000292574:p.Gly355*		Q8N7T5|Q8NDL5	Nonsense_Mutation	SNP	pfam_Tektin	p.G355*	ENST00000292574.3	37	c.1063	CCDS12322.1	19	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206895	0.58343	.	.	ENSG00000160994	ENST00000292574	.	.	.	3.91	3.91	0.45181	.	0.110416	0.36703	N	0.002455	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-17.8949	11.3526	0.49596	0.0:0.0:1.0:0.0	.	.	.	.	X	355	.	ENSP00000292574:G355X	G	+	1	0	CCDC105	14993449	0.996000	0.38824	0.158000	0.22627	0.082000	0.17680	3.984000	0.56923	2.033000	0.60031	0.549000	0.68633	GGA	CCDC105	-	pfam_Tektin	ENSG00000160994		0.587	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	HGNC	protein_coding	OTTHUMT00000466293.1		0.00	79	0	G	NM_173482		15132449	+1			no_errors	ENST00000292574	ensembl	human	known	74_37	nonsense	5.08	56	3	SNP	0.243	T
CCL20	6364	genome.wustl.edu	37	2	228680154	228680154	+	Intron	DEL	T	T	-	rs34834265		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:228680154delT	ENST00000358813.4	+	2	134				CCL20_ENST00000473642.1_3'UTR|CCL20_ENST00000409189.3_Intron			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TACCTTTCACTTTTTTTTTTT	0.363																																																	0													49.0	57.0	55.0					2																	228680154		2201	4300	6501	SO:0001627	intron_variant	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.77-16T>-	2.37:g.228680154delT			Q53S51|Q99664	RNA	DEL	-	NULL	ENST00000358813.4	37	NULL	CCDS2469.1	2																																																																																			CCL20	-	-	ENSG00000115009		0.363	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	HGNC	protein_coding	OTTHUMT00000331641.1		0.00	32	0	T	NM_004591		228680154	+1	tier1		no_errors	ENST00000473642	ensembl	human	known	74_37	rna	15.15	28	5	DEL	0.010	-
CD163L1	283316	genome.wustl.edu	37	12	7556131	7556131	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:7556131C>G	ENST00000313599.3	-	6	1465	c.1408G>C	c.(1408-1410)Gat>Cat	p.D470H	CD163L1_ENST00000396630.1_Splice_Site_p.D470H|CD163L1_ENST00000416109.2_Splice_Site_p.D480H			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	470						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						TGAACCTTACCAGAACAAATT	0.398																																																	0													74.0	72.0	73.0					12																	7556131		2203	4300	6503	SO:0001630	splice_region_variant	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1408+1G>C	12.37:g.7556131C>G			B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.D470H	ENST00000313599.3	37	c.1408	CCDS8577.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.90|16.90	3.248814|3.248814	0.59103|0.59103	.|.	.|.	ENSG00000177675|ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630|ENST00000545926	T;T;T|T	0.31769|0.32515	1.48;1.48;1.48|1.45	2.01|2.01	2.01|2.01	0.26516|0.26516	Speract/scavenger receptor-related (1);|.	.|.	.|.	.|.	.|.	T|T	0.38026|0.38026	0.1025|0.1025	M|M	0.62016|0.62016	1.91|1.91	0.29270|0.29270	N|N	0.870726|0.870726	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.72982|.	0.962;0.979|.	T|T	0.27606|0.27606	-1.0069|-1.0069	8|6	.|.	.|.	.|.	.|.	10.0339|10.0339	0.42118|0.42118	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	480;470|.	E7EVK4;Q9NR16|.	.;C163B_HUMAN|.	H|R	470;480;470|116	ENSP00000315945:D470H;ENSP00000393474:D480H;ENSP00000379871:D470H|ENSP00000439921:G116R	.|.	D|G	-|-	1|1	0|0	CD163L1|CD163L1	7447398|7447398	0.988000|0.988000	0.35896|0.35896	0.606000|0.606000	0.28943|0.28943	0.686000|0.686000	0.39977|0.39977	2.329000|2.329000	0.43876|0.43876	1.406000|1.406000	0.46857|0.46857	0.563000|0.563000	0.77884|0.77884	GAT|GGT	CD163L1	-	superfamily_Srcr_rcpt-rel	ENSG00000177675		0.398	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1		0.00	28	0	C	NM_174941	Missense_Mutation	7556131	-1			no_errors	ENST00000313599	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.998	G
CD177	57126	genome.wustl.edu	37	19	43859867	43859867	+	RNA	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:43859867G>A	ENST00000607517.1	+	0	490				CD177_ENST00000378012.2_RNA|CD177_ENST00000378009.4_RNA			Q8N6Q3	CD177_HUMAN	CD177 molecule						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Prostate(69;0.00682)				TGTCTGGAGGGGACAACAGAA	0.592																																																	0													57.0	55.0	56.0					19																	43859867		1867	4104	5971			0			AF146747	CCDS62700.1	19q13.31	2013-10-02	2006-03-28		ENSG00000204936	ENSG00000204936		"""CD molecules"""	30072	protein-coding gene	gene with protein product	"""polycythemia rubra vera 1"""	162860	"""CD177 antigen"""			10753836, 5552408	Standard	NM_020406		Approved	PRV1, HNA2A, NB1	uc002owi.3	Q8N6Q3	OTTHUMG00000185320		19.37:g.43859867G>A			Q711Q2|Q8NCV9|Q96QH1|Q9HDA5	Missense_Mutation	SNP	pfam_LY6_UPAR	p.G145E	ENST00000607517.1	37	c.434		19	.	.	.	.	.	.	.	.	.	.	g	2.127	-0.400144	0.04865	.	.	ENSG00000204936	ENST00000378009	T	0.66638	-0.22	3.27	-0.342	0.12635	CD59 antigen (1);	.	.	.	.	T	0.45915	0.1366	N	0.08118	0	0.09310	N	1	P	0.49307	0.922	P	0.45753	0.492	T	0.39292	-0.9621	9	0.66056	D	0.02	.	5.6602	0.17664	0.2825:0.5647:0.1528:0.0	.	145	Q8N6Q3	CD177_HUMAN	E	145	ENSP00000367248:G145E	ENSP00000367248:G145E	G	+	2	0	CD177	48551707	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.629000	0.05508	-0.017000	0.14103	-0.521000	0.04368	GGG	CD177	-	pfam_LY6_UPAR	ENSG00000204936		0.592	CD177-001	KNOWN	basic	polymorphic_pseudogene	CD177	HGNC	polymorphic_pseudogene	OTTHUMT00000470162.1	-	0.00	81	0	G	NM_020406		43859867	+1	tier1	-	no_errors	ENST00000378009	ensembl	human	known	74_37	missense	25.93	60	21	SNP	0.000	A
CDH12	1010	genome.wustl.edu	37	5	21755909	21755909	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:21755909C>T	ENST00000382254.1	-	14	2762	c.1676G>A	c.(1675-1677)cGc>cAc	p.R559H	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Missense_Mutation_p.R519H|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.R559H	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	559	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TTGCTGCCTGCGGCTGTATCC	0.428										HNSCC(59;0.17)																																							0													121.0	107.0	112.0					5																	21755909		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1676G>A	5.37:g.21755909C>T	ENSP00000371689:p.Arg559His		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R559H	ENST00000382254.1	37	c.1676	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	31	5.063062	0.93898	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.60040	0.22;0.22;0.22	5.37	5.37	0.77165	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.84302	0.5442	H	0.95917	3.74	0.58432	D	0.999998	D;D	0.89917	0.964;1.0	P;D	0.81914	0.749;0.995	D	0.89237	0.3581	10	0.72032	D	0.01	.	19.0963	0.93253	0.0:1.0:0.0:0.0	.	519;559	B7Z2U6;P55289	.;CAD12_HUMAN	H	559;559;519	ENSP00000423577:R559H;ENSP00000371689:R559H;ENSP00000428786:R519H	ENSP00000371689:R559H	R	-	2	0	CDH12	21791666	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.469000	0.80959	2.515000	0.84797	0.460000	0.39030	CGC	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.428	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	61	0	C	NM_004061		21755909	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	36.36	48	28	SNP	1.000	T
CELSR1	9620	genome.wustl.edu	37	22	46786324	46786324	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:46786324A>G	ENST00000262738.3	-	17	6309	c.6310T>C	c.(6310-6312)Tgt>Cgt	p.C2104R		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2104					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		ATGGTGGTACAGTTAAAGAGC	0.597											OREG0026656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													72.0	64.0	67.0					22																	46786324		2203	4300	6503	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.6310T>C	22.37:g.46786324A>G	ENSP00000262738:p.Cys2104Arg	941	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.C2104R	ENST00000262738.3	37	c.6310	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927834	0.73327	.	.	ENSG00000075275	ENST00000262738	D	0.90444	-2.67	4.34	4.34	0.51931	GPCR, family 2, extracellular hormone receptor domain (3);	0.000000	0.85682	U	0.000000	D	0.95475	0.8530	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96137	0.9097	10	0.87932	D	0	.	13.6449	0.62275	1.0:0.0:0.0:0.0	.	425;2104	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	R	2104	ENSP00000262738:C2104R	ENSP00000262738:C2104R	C	-	1	0	CELSR1	45164988	1.000000	0.71417	1.000000	0.80357	0.688000	0.40055	8.311000	0.89973	1.960000	0.56953	0.533000	0.62120	TGT	CELSR1	-	smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom	ENSG00000075275		0.597	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1		0.00	75	0	A	NM_014246		46786324	-1			no_errors	ENST00000262738	ensembl	human	known	74_37	missense	8.70	41	4	SNP	1.000	G
CENPE	1062	genome.wustl.edu	37	4	104066470	104066470	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:104066470C>T	ENST00000265148.3	-	32	4683	c.4594G>A	c.(4594-4596)Gag>Aag	p.E1532K	CENPE_ENST00000380026.3_Missense_Mutation_p.E1507K	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1532					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AATTGTTCCTCTTTCTCATAA	0.303																																																	0													40.0	40.0	40.0					4																	104066470		2202	4297	6499	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.4594G>A	4.37:g.104066470C>T	ENSP00000265148:p.Glu1532Lys		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1532K	ENST00000265148.3	37	c.4594	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	4.210	0.037682	0.08148	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.65364	-0.15;-0.11	4.08	0.0236	0.14138	.	.	.	.	.	T	0.44726	0.1307	L	0.43923	1.385	0.09310	N	1	B;B	0.33807	0.426;0.013	B;B	0.32090	0.14;0.006	T	0.24404	-1.0161	9	0.24483	T	0.36	.	2.6117	0.04893	0.0956:0.2909:0.3634:0.2501	.	1507;1532	Q02224-3;Q02224	.;CENPE_HUMAN	K	1532;1532;1507	ENSP00000265148:E1532K;ENSP00000369365:E1507K	ENSP00000265148:E1532K	E	-	1	0	CENPE	104285919	0.124000	0.22315	0.073000	0.20177	0.038000	0.13279	-0.051000	0.11885	0.053000	0.16036	-0.333000	0.08304	GAG	CENPE	-	superfamily_Signal_recog_particl_SRP54_hlx	ENSG00000138778		0.303	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		-	0.00	49	0	C			104066470	-1	tier1	-	no_errors	ENST00000265148	ensembl	human	known	74_37	missense	33.33	28	14	SNP	0.001	T
CHD3	1107	genome.wustl.edu	37	17	7798335	7798335	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:7798335A>T	ENST00000330494.7	+	9	1520	c.1370A>T	c.(1369-1371)gAg>gTg	p.E457V	CHD3_ENST00000380358.4_Missense_Mutation_p.E516V|CHD3_ENST00000358181.4_Missense_Mutation_p.E457V	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	457					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GATCACATGGAGTACTGCCGC	0.567																																																	0													192.0	134.0	154.0					17																	7798335		2203	4300	6503	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.1370A>T	17.37:g.7798335A>T	ENSP00000332628:p.Glu457Val		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E457V	ENST00000330494.7	37	c.1370	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	A	15.51	2.855221	0.51376	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	T;T;T	0.45276	0.9;0.9;0.9	5.11	5.11	0.69529	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, FYVE/PHD-type (1);	0.346100	0.21013	N	0.081656	T	0.43545	0.1252	N	0.08118	0	0.80722	D	1	D;D;D	0.76494	0.998;0.997;0.999	D;P;D	0.66351	0.943;0.879;0.915	T	0.55023	-0.8205	10	0.87932	D	0	-33.7845	14.7173	0.69280	1.0:0.0:0.0:0.0	.	457;457;516	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	V	516;457;457	ENSP00000369716:E516V;ENSP00000350907:E457V;ENSP00000332628:E457V	ENSP00000332628:E457V	E	+	2	0	CHD3	7739060	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.139000	0.94554	2.146000	0.66826	0.459000	0.35465	GAG	CHD3	-	superfamily_Znf_FYVE_PHD,pfscan_Znf_PHD-finger	ENSG00000170004		0.567	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	-	0.00	30	0	A	NM_001005273		7798335	+1	tier1	-	no_errors	ENST00000330494	ensembl	human	known	74_37	missense	39.29	17	11	SNP	1.000	T
CHML	1122	genome.wustl.edu	37	1	241798773	241798773	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:241798773G>T	ENST00000366553.1	-	1	459	c.296C>A	c.(295-297)aCa>aAa	p.T99K	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000469376.1_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	99					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)	p.T99R(1)		breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			AAAAGCTTCTGTGTGTTGAAT	0.438																																																	1	Substitution - Missense(1)	large_intestine(1)											207.0	208.0	208.0					1																	241798773		2203	4299	6502	SO:0001583	missense	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.296C>A	1.37:g.241798773G>T	ENSP00000355511:p.Thr99Lys		B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.T99K	ENST00000366553.1	37	c.296	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	G	0.037	-1.301273	0.01364	.	.	ENSG00000203668	ENST00000366553	T	0.59502	0.26	4.77	-2.35	0.06684	.	1.294060	0.05204	U	0.505455	T	0.31575	0.0801	.	.	.	0.09310	N	1	B	0.20887	0.049	B	0.23716	0.048	T	0.32107	-0.9919	9	0.05525	T	0.97	3.2416	10.0234	0.42057	0.7486:0.0:0.2514:0.0	.	99	P26374	RAE2_HUMAN	K	99	ENSP00000355511:T99K	ENSP00000355511:T99K	T	-	2	0	CHML	239865396	0.000000	0.05858	0.003000	0.11579	0.226000	0.24999	0.043000	0.13971	-0.482000	0.06782	-0.781000	0.03364	ACA	CHML	-	pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort	ENSG00000203668		0.438	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1		0.00	24	0	G	NM_001821		241798773	-1			no_errors	ENST00000366553	ensembl	human	known	74_37	missense	9.52	19	2	SNP	0.008	T
CHODL	140578	genome.wustl.edu	37	21	19628832	19628832	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr21:19628832A>G	ENST00000299295.2	+	2	477	c.86A>G	c.(85-87)aAg>aGg	p.K29R	CHODL_ENST00000400127.1_5'UTR|CHODL_ENST00000543733.1_Missense_Mutation_p.K10R|CHODL_ENST00000400135.1_5'UTR|CHODL_ENST00000400128.1_5'UTR|CHODL_ENST00000338326.3_5'UTR|CHODL_ENST00000400131.1_5'UTR	NM_001204175.1|NM_024944.2	NP_001191104.1|NP_079220.2	Q9H9P2	CHODL_HUMAN	chondrolectin	29					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)			kidney(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_epithelial(11;0.21)		Epithelial(23;0.000191)|all cancers(11;0.000827)|LUSC - Lung squamous cell carcinoma(23;0.00646)|Lung(58;0.0129)|OV - Ovarian serous cystadenocarcinoma(11;0.017)|COAD - Colon adenocarcinoma(22;0.03)|Colorectal(24;0.0917)		TCAGGCCAAAAGGTGTGTTTT	0.418																																																	0													24.0	27.0	26.0					21																	19628832		2203	4299	6502	SO:0001583	missense	0			AF257472	CCDS13570.1, CCDS56208.1, CCDS56209.1, CCDS56210.1	21q11.2	2006-04-03	2002-07-04		ENSG00000154645	ENSG00000154645			17807	protein-coding gene	gene with protein product		607247	"""chromosome 21 open reading frame 68"""	C21orf68		12079284	Standard	NM_024944		Approved	FLJ12627, PRED12, MT75	uc021whs.1	Q9H9P2	OTTHUMG00000074519	ENST00000299295.2:c.86A>G	21.37:g.19628832A>G	ENSP00000299295:p.Lys29Arg		B2R9C0|B4DJB8|Q7Z798|Q7Z799|Q7Z7A0|Q9HCY3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.K29R	ENST00000299295.2	37	c.86	CCDS13570.1	21	.	.	.	.	.	.	.	.	.	.	A	12.85	2.062271	0.36373	.	.	ENSG00000154645	ENST00000299295;ENST00000543733	T;T	0.17370	2.3;2.28	5.66	5.66	0.87406	.	0.042611	0.85682	D	0.000000	T	0.16300	0.0392	L	0.45581	1.43	0.80722	D	1	P	0.35433	0.501	B	0.30646	0.118	T	0.03493	-1.1031	9	.	.	.	-16.116	15.3478	0.74355	1.0:0.0:0.0:0.0	.	29	Q9H9P2	CHODL_HUMAN	R	29;10	ENSP00000299295:K29R;ENSP00000443566:K10R	.	K	+	2	0	CHODL	18550703	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.342000	0.52159	2.278000	0.76064	0.477000	0.44152	AAG	CHODL	-	NULL	ENSG00000154645		0.418	CHODL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHODL	HGNC	protein_coding	OTTHUMT00000158232.1	-	0.00	17	0	A	NM_024944		19628832	+1	tier1	-	no_errors	ENST00000299295	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	G
CLEC14A	161198	genome.wustl.edu	37	14	38724628	38724628	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:38724628G>C	ENST00000342213.2	-	1	946	c.600C>G	c.(598-600)agC>agG	p.S200R		NM_175060.2	NP_778230.1	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	200						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)		CCAGAGCGGCGCTGTGCAGCT	0.642																																																	0													48.0	51.0	50.0					14																	38724628		2197	4296	6493	SO:0001583	missense	0				CCDS9667.1	14q21.1	2010-04-27	2005-02-11	2005-02-11	ENSG00000176435	ENSG00000176435		"""C-type lectin domain containing"""	19832	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 27"""	C14orf27			Standard	NM_175060		Approved		uc001wum.2	Q86T13	OTTHUMG00000140248	ENST00000342213.2:c.600C>G	14.37:g.38724628G>C	ENSP00000353013:p.Ser200Arg		Q695G9|Q6PWT6|Q8N5V5	Missense_Mutation	SNP	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S200R	ENST00000342213.2	37	c.600	CCDS9667.1	14	.	.	.	.	.	.	.	.	.	.	G	12.43	1.937041	0.34189	.	.	ENSG00000176435	ENST00000342213	T	0.77620	-1.11	4.13	2.28	0.28536	.	0.172176	0.28104	N	0.016589	T	0.78291	0.4260	L	0.29908	0.895	0.31508	N	0.663918	D	0.89917	1.0	D	0.72075	0.976	T	0.77443	-0.2586	10	0.62326	D	0.03	-15.3739	8.6363	0.33950	0.1892:0.0:0.8108:0.0	.	200	Q86T13	CLC14_HUMAN	R	200	ENSP00000353013:S200R	ENSP00000353013:S200R	S	-	3	2	CLEC14A	37794379	1.000000	0.71417	0.560000	0.28344	0.065000	0.16274	1.474000	0.35398	0.691000	0.31592	-0.216000	0.12614	AGC	CLEC14A	-	NULL	ENSG00000176435		0.642	CLEC14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC14A	HGNC	protein_coding	OTTHUMT00000276729.1		0.00	41	0	G	NM_175060		38724628	-1			no_errors	ENST00000342213	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.965	C
COL11A1	1301	genome.wustl.edu	37	1	103380337	103380337	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:103380337C>T	ENST00000370096.3	-	51	4159	c.3847G>A	c.(3847-3849)Gaa>Aaa	p.E1283K	COL11A1_ENST00000358392.2_Missense_Mutation_p.E1295K|COL11A1_ENST00000353414.4_Missense_Mutation_p.E1244K|COL11A1_ENST00000512756.1_Missense_Mutation_p.E1167K	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1283	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GGACCAGCTTCCCCTTTCTCT	0.468																																																	0													49.0	48.0	48.0					1																	103380337		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3847G>A	1.37:g.103380337C>T	ENSP00000359114:p.Glu1283Lys		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.E1295K	ENST00000370096.3	37	c.3883	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.464613	0.84425	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.96587	-3.36;-3.18;-4.06;-4.06	5.73	5.73	0.89815	.	0.055265	0.64402	D	0.000001	D	0.97303	0.9118	L	0.52206	1.635	0.80722	D	1	D;D;P;D;D	0.71674	0.982;0.998;0.904;0.997;0.974	D;D;D;D;D	0.78314	0.952;0.991;0.931;0.98;0.969	D	0.97717	1.0194	10	0.72032	D	0.01	.	19.8928	0.96935	0.0:1.0:0.0:0.0	.	1167;1244;1295;1283;503	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	K	1283;1295;1244;503;1167	ENSP00000359114:E1283K;ENSP00000351163:E1295K;ENSP00000302551:E1244K;ENSP00000426533:E1167K	ENSP00000302551:E1244K	E	-	1	0	COL11A1	103152925	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.403000	0.79983	2.713000	0.92767	0.591000	0.81541	GAA	COL11A1	-	NULL	ENSG00000060718		0.468	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	54	0	C	NM_080630		103380337	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	33.33	26	13	SNP	1.000	T
CNTN2	6900	genome.wustl.edu	37	1	205039134	205039134	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:205039134C>T	ENST00000331830.4	+	18	2660	c.2376C>T	c.(2374-2376)aaC>aaT	p.N792N		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	792	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCAGCTACAACCGCCGCGGGG	0.662																																					Melanoma(183;2548 2817 37099 41192)												0													35.0	40.0	38.0					1																	205039134		2203	4299	6502	SO:0001819	synonymous_variant	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2376C>T	1.37:g.205039134C>T			P78432|Q5T054	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N792	ENST00000331830.4	37	c.2376	CCDS1449.1	1																																																																																			CNTN2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000184144		0.662	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	-	0.00	57	0	C	NM_005076		205039134	+1	tier1	-	no_errors	ENST00000331830	ensembl	human	known	74_37	silent	42.11	33	24	SNP	1.000	T
COMMD9	29099	genome.wustl.edu	37	11	36300161	36300161	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:36300161G>A	ENST00000263401.5	-	3	199	c.183C>T	c.(181-183)ctC>ctT	p.L61L	COMMD9_ENST00000452374.2_Silent_p.L19L|COMMD9_ENST00000532705.1_Silent_p.L61L	NM_014186.3	NP_054905.2	Q9P000	COMD9_HUMAN	COMM domain containing 9	61										kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	5	all_lung(20;0.211)	all_hematologic(20;0.107)				GCAGAGCCTGGAGCAGCTGCA	0.582																																																	0													54.0	52.0	52.0					11																	36300161		2202	4298	6500	SO:0001819	synonymous_variant	0			AY542164	CCDS7900.1, CCDS44571.1	11p13	2008-02-05			ENSG00000110442	ENSG00000110442			25014	protein-coding gene	gene with protein product		612299				15799966	Standard	NM_014186		Approved	HSPC166, FLJ31106	uc001mwn.4	Q9P000	OTTHUMG00000166333	ENST00000263401.5:c.183C>T	11.37:g.36300161G>A			E9PAN2|Q96FI2|Q9H0R0	Silent	SNP	pfam_HCaRG	p.L61	ENST00000263401.5	37	c.183	CCDS7900.1	11																																																																																			COMMD9	-	pfam_HCaRG	ENSG00000110442		0.582	COMMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMMD9	HGNC	protein_coding	OTTHUMT00000389196.1		0.00	22	0	G	NM_014186		36300161	-1			no_errors	ENST00000263401	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.997	A
COX7A2L	9167	genome.wustl.edu	37	2	42578455	42578455	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:42578455G>T	ENST00000378669.1	-	4	1078	c.249C>A	c.(247-249)gaC>gaA	p.D83E	COX7A2L_ENST00000482463.1_5'UTR|COX7A2L_ENST00000234301.2_Missense_Mutation_p.D83E			O14548	COX7R_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2 like	83					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			lung(4)	4						AAAGCATTTGGTCAGGCAGGC	0.473																																																	0													94.0	80.0	85.0					2																	42578455		2203	4300	6503	SO:0001583	missense	0			AB007618	CCDS1808.1	2p21	2010-06-14			ENSG00000115944	ENSG00000115944			2289	protein-coding gene	gene with protein product		605771				9418891	Standard	NM_004718		Approved	EB1, COX7RP, COX7AR, SIG81	uc002rsk.3	O14548	OTTHUMG00000128605	ENST00000378669.1:c.249C>A	2.37:g.42578455G>T	ENSP00000367938:p.Asp83Glu		Q9P118	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su7a,superfamily_Cyt_c_oxidase_su7a,pirsf_Cyt_c_oxidase_su7a-rel_mt	p.D83E	ENST00000378669.1	37	c.249	CCDS1808.1	2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796386	0.90453	.	.	ENSG00000115944	ENST00000378669;ENST00000234301	T;T	0.68331	-0.32;-0.32	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.84019	0.5380	H	0.94264	3.515	0.46096	D	0.998863	D	0.71674	0.998	D	0.69479	0.964	D	0.86798	0.1990	10	0.87932	D	0	-6.8798	8.3546	0.32323	0.168:0.0:0.832:0.0	.	83	O14548	COX7R_HUMAN	E	83	ENSP00000367938:D83E;ENSP00000234301:D83E	ENSP00000234301:D83E	D	-	3	2	COX7A2L	42431959	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.055000	0.64282	2.512000	0.84698	0.655000	0.94253	GAC	COX7A2L	-	pfam_Cyt_c_oxidase_su7a,superfamily_Cyt_c_oxidase_su7a,pirsf_Cyt_c_oxidase_su7a-rel_mt	ENSG00000115944		0.473	COX7A2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX7A2L	HGNC	protein_coding	OTTHUMT00000250466.3		0.00	69	0	G	NM_004718		42578455	-1			no_errors	ENST00000234301	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
CPSF2	53981	genome.wustl.edu	37	14	92609414	92609414	+	Missense_Mutation	SNP	C	C	T	rs376230933		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:92609414C>T	ENST00000298875.4	+	9	1201	c.916C>T	c.(916-918)Cgc>Tgc	p.R306C		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	306					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		GTTTCAGTTTCGCCATCTCTC	0.413																																					Ovarian(78;28 1788 18702 44111)												0								C	CYS/ARG	0,4406		0,0,2203	107.0	92.0	97.0		916	4.4	1.0	14		97	1,8599	1.2+/-3.3	0,1,4299	no	missense	CPSF2	NM_017437.2	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	306/783	92609414	1,13005	2203	4300	6503	SO:0001583	missense	0			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.916C>T	14.37:g.92609414C>T	ENSP00000298875:p.Arg306Cys		B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	pfam_Beta_Casp,pfam_RMMBL,pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.R306C	ENST00000298875.4	37	c.916	CCDS9902.1	14	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880687	0.72294	0.0	1.16E-4	ENSG00000165934	ENST00000298875	T	0.49139	0.79	5.29	4.4	0.53042	Beta-Casp domain (1);	0.000000	0.85682	D	0.000000	T	0.69575	0.3126	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	T	0.75266	-0.3378	10	0.87932	D	0	.	14.0026	0.64442	0.0:0.927:0.0:0.073	.	306	Q9P2I0	CPSF2_HUMAN	C	306	ENSP00000298875:R306C	ENSP00000298875:R306C	R	+	1	0	CPSF2	91679167	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.654000	0.61469	1.226000	0.43582	0.491000	0.48974	CGC	CPSF2	-	pfam_Beta_Casp	ENSG00000165934		0.413	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF2	HGNC	protein_coding	OTTHUMT00000412123.1	-	0.00	112	0	C			92609414	+1	tier1	-	no_errors	ENST00000298875	ensembl	human	known	74_37	missense	13.75	69	11	SNP	1.000	T
CYFIP2	26999	genome.wustl.edu	37	5	156746882	156746882	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:156746882C>T	ENST00000521420.1	+	13	1482	c.1391C>T	c.(1390-1392)aCg>aTg	p.T464M	CYFIP2_ENST00000435847.2_Missense_Mutation_p.T164M|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000541131.1_Missense_Mutation_p.T415M|CYFIP2_ENST00000318218.6_Missense_Mutation_p.T490M|CYFIP2_ENST00000347377.6_Missense_Mutation_p.T490M|CYFIP2_ENST00000522463.1_Missense_Mutation_p.T294M|CYFIP2_ENST00000377576.3_Missense_Mutation_p.T490M					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCCCAGGTGACGCTGCGTGAG	0.567																																																	0													150.0	155.0	153.0					5																	156746882		2203	4300	6503	SO:0001583	missense	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.1391C>T	5.37:g.156746882C>T	ENSP00000430904:p.Thr464Met			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.T490M	ENST00000521420.1	37	c.1469		5	.	.	.	.	.	.	.	.	.	.	C	28.4	4.917194	0.92249	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	5.97	5.97	0.96955	.	0.043296	0.85682	D	0.000000	T	0.52058	0.1711	M	0.74258	2.255	0.80722	D	1	D;D;D;D;P;D	0.71674	0.966;0.984;0.997;0.986;0.777;0.998	P;D;D;P;B;D	0.76071	0.629;0.932;0.939;0.761;0.099;0.987	T	0.49799	-0.8901	10	0.59425	D	0.04	-26.1381	15.8593	0.79009	0.0:0.8652:0.1348:0.0	.	354;294;464;490;490;490	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	M	490;294;464;490;490;415;164	ENSP00000325817:T490M;ENSP00000428009:T294M;ENSP00000430904:T464M;ENSP00000313567:T490M;ENSP00000366799:T490M;ENSP00000444645:T415M;ENSP00000403793:T164M	ENSP00000325817:T490M	T	+	2	0	CYFIP2	156679460	1.000000	0.71417	0.974000	0.42286	0.960000	0.62799	5.966000	0.70395	2.837000	0.97791	0.655000	0.94253	ACG	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.567	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	-	0.00	28	0	C	NM_001037332		156746882	+1	tier1	-	no_errors	ENST00000318218	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
CYP2C8	1558	genome.wustl.edu	37	10	96802803	96802803	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:96802803delA	ENST00000371270.3	-	7	1087	c.993delT	c.(991-993)attfs	p.I331fs	CYP2C8_ENST00000535898.1_Frame_Shift_Del_p.I229fs|CYP2C8_ENST00000539050.1_Frame_Shift_Del_p.I245fs	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	331					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	TGTGTCTGCCAATTACATGAT	0.468																																																	0													183.0	146.0	158.0					10																	96802803		2203	4300	6503	SO:0001589	frameshift_variant	0			M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.993delT	10.37:g.96802803delA	ENSP00000360317:p.Ile331fs		A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Frame_Shift_Del	DEL	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.I331fs	ENST00000371270.3	37	c.993	CCDS7438.1	10																																																																																			CYP2C8	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000138115		0.468	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C8	HGNC	protein_coding	OTTHUMT00000049499.2		0.00	53	0	A	NM_000770		96802803	-1	tier1		no_errors	ENST00000371270	ensembl	human	known	74_37	frame_shift_del	10.77	58	7	DEL	1.000	-
CYP3A7	1551	genome.wustl.edu	37	7	99308416	99308416	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:99308416G>T	ENST00000336374.2	-	10	967	c.965C>A	c.(964-966)gCc>gAc	p.A322D	AC069294.1_ENST00000408560.1_RNA	NM_000765.3	NP_000756.2	P24462	CP3A7_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 7	322					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			autonomic_ganglia(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	32	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Alfentanil(DB00802)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amlodipine(DB00381)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atorvastatin(DB01076)|Buprenorphine(DB00921)|Buspirone(DB00490)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clotrimazole(DB00257)|Cocaine(DB00907)|Codeine(DB00318)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diltiazem(DB00343)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Eplerenone(DB00700)|Erythromycin(DB00199)|Estradiol(DB00783)|Ethosuximide(DB00593)|Ethylmorphine(DB01466)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluticasone Propionate(DB00588)|Fluvoxamine(DB00176)|Gestodene(DB06730)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nifedipine(DB01115)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Testosterone(DB00624)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	AGGGTGAGTGGCCAGTTCATA	0.448																																																	0													91.0	79.0	83.0					7																	99308416		2203	4300	6503	SO:0001583	missense	0			AF315325	CCDS5673.1	7q21-q22.1	2007-12-14	2003-01-14		ENSG00000160870	ENSG00000160870		"""Cytochrome P450s"""	2640	protein-coding gene	gene with protein product		605340	"""cytochrome P450, subfamily IIIA, polypeptide 7"""			2722762	Standard	NM_000765		Approved	CP37, P450-HFLA		P24462	OTTHUMG00000156726	ENST00000336374.2:c.965C>A	7.37:g.99308416G>T	ENSP00000337450:p.Ala322Asp		A4D288|Q9H241	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_CYP3A,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.A322D	ENST00000336374.2	37	c.965	CCDS5673.1	7	.	.	.	.	.	.	.	.	.	.	g	16.97	3.268260	0.59540	.	.	ENSG00000160870	ENST00000292414;ENST00000336374	T	0.73258	-0.73	3.99	3.99	0.46301	.	0.000000	0.85682	D	0.000000	D	0.90957	0.7157	H	0.99758	4.755	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.94500	0.7709	10	0.87932	D	0	.	13.8987	0.63790	0.0:0.0:1.0:0.0	.	322	P24462	CP3A7_HUMAN	D	322	ENSP00000337450:A322D	ENSP00000292414:A322D	A	-	2	0	CYP3A7	99146352	1.000000	0.71417	0.918000	0.36340	0.262000	0.26303	9.476000	0.97823	1.909000	0.55274	0.455000	0.32223	GCC	CYP3A7	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	ENSG00000160870		0.448	CYP3A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP3A7	HGNC	protein_coding	OTTHUMT00000345484.1	-	0.00	59	0	G			99308416	-1	tier1	-	no_errors	ENST00000336374	ensembl	human	known	74_37	missense	6.06	93	6	SNP	1.000	T
CYP4V2	285440	genome.wustl.edu	37	4	187131993	187131994	+	IGR	INS	-	-	T	rs199938898|rs200614627|rs150697121	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:187131993_187131994insT	ENST00000378802.4	+	0	2042				CYP4V2_ENST00000502665.1_3'UTR	NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2						fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		ttttttctttattttttttttt	0.406													|||unknown(HR)	758	0.151358	0.1241	0.2017	5008	,	,		18502	0.1716		0.1938	False		,,,				2504	0.0879																0																																										SO:0001628	intergenic_variant	0			AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379		4.37:g.187132004_187132004dupT			B7U6W2|Q6ZTM4	RNA	INS	-	NULL	ENST00000378802.4	37	NULL	CCDS34119.1	4																																																																																			CYP4V2	-	-	ENSG00000145476		0.406	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4V2	HGNC	protein_coding	OTTHUMT00000360398.1		0.00	8	0	-	XM_209612		187131994	+1	tier1		no_errors	ENST00000502665	ensembl	human	known	74_37	rna	42.86	4	3	INS	0.075:0.089	T
DACH2	117154	genome.wustl.edu	37	X	86069837	86069837	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:86069837G>A	ENST00000373125.4	+	10	1684	c.1684G>A	c.(1684-1686)Gat>Aat	p.D562N	DACH2_ENST00000373131.1_Splice_Site_p.D549N|DACH2_ENST00000508860.1_Splice_Site_p.D395N|DACH2_ENST00000510272.1_Splice_Site_p.D343N	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	562					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GATGTTAAAAGGTAATGTCTG	0.418																																																	0													53.0	44.0	47.0					X																	86069837		2203	4300	6503	SO:0001630	splice_region_variant	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1684+1G>A	X.37:g.86069837G>A			B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.D562N	ENST00000373125.4	37	c.1684	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	G	18.40	3.615898	0.66672	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297;ENST00000484479	D;D	0.86097	-2.04;-2.07	4.76	4.76	0.60689	.	0.000000	0.64402	D	0.000006	D	0.84392	0.5462	L	0.32530	0.975	0.53688	D	0.999972	P;B;B;B	0.51933	0.949;0.365;0.211;0.39	P;B;B;B	0.51016	0.656;0.216;0.13;0.089	D	0.85580	0.1239	10	0.48119	T	0.1	.	17.002	0.86383	0.0:0.0:1.0:0.0	.	428;562;549;562	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	N	562;549;562;395;343;395;227	ENSP00000362223:D549N;ENSP00000362217:D562N	ENSP00000345134:D562N	D	+	1	0	DACH2	85956493	1.000000	0.71417	0.996000	0.52242	0.759000	0.43091	7.921000	0.87530	1.932000	0.55993	0.415000	0.27848	GAT	DACH2	-	NULL	ENSG00000126733		0.418	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	-	0.00	26	0	G	NM_053281	Missense_Mutation	86069837	+1	tier1	-	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	51.35	18	19	SNP	1.000	A
DDX19A	55308	genome.wustl.edu	37	16	70398975	70398975	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:70398975A>T	ENST00000302243.7	+	7	708	c.545A>T	c.(544-546)gAg>gTg	p.E182V	RP11-529K1.3_ENST00000567706.1_Intron|DDX19A_ENST00000417604.2_Missense_Mutation_p.E151V|DDX19A_ENST00000443119.2_Missense_Mutation_p.E92V	NM_018332.3	NP_060802.1	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A	182	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|N-terminal lobe. {ECO:0000250}.				mRNA transport (GO:0051028)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|urinary_tract(1)	11		Ovarian(137;0.221)				AAAGTGATTGAGCAGATGGGC	0.473																																																	0													122.0	110.0	114.0					16																	70398975		2198	4300	6498	SO:0001583	missense	0			AF183422	CCDS10889.1	16q22.1	2012-02-23	2012-02-23	2005-07-13	ENSG00000168872	ENSG00000168872		"""DEAD-boxes"""	25628	protein-coding gene	gene with protein product			"""DEAD (Asp-Glu-Ala-As) box polypeptide 19-like"""	DDX19L		12477932	Standard	NM_018332		Approved	FLJ11126		Q9NUU7	OTTHUMG00000137579	ENST00000302243.7:c.545A>T	16.37:g.70398975A>T	ENSP00000306117:p.Glu182Val		B2RPL0|B4DRZ7|Q53FM0	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E182V	ENST00000302243.7	37	c.545	CCDS10889.1	16	.	.	.	.	.	.	.	.	.	.	A	26.1	4.700832	0.88924	.	.	ENSG00000168872	ENST00000302243;ENST00000302227;ENST00000417604;ENST00000443119	T;T;T	0.16073	2.37;2.37;2.37	5.42	5.42	0.78866	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	L	0.45228	1.405	0.80722	D	1	D;B;D;P	0.76494	0.997;0.261;0.999;0.549	D;B;D;B	0.87578	0.954;0.221;0.998;0.392	T	0.01819	-1.1267	10	0.33141	T	0.24	.	13.4275	0.61035	1.0:0.0:0.0:0.0	.	92;151;182;183	B4DRZ7;B4DS24;Q9NUU7;Q7Z4W5	.;.;DD19A_HUMAN;.	V	182;74;151;92	ENSP00000306117:E182V;ENSP00000410243:E151V;ENSP00000399208:E92V	ENSP00000306209:E74V	E	+	2	0	DDX19A	68956476	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.785000	0.91822	2.052000	0.61016	0.533000	0.62120	GAG	DDX19A	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000168872		0.473	DDX19A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX19A	HGNC	protein_coding	OTTHUMT00000268967.2		0.00	55	0	A	NM_018332		70398975	+1			no_errors	ENST00000302243	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
DISC1	27185	genome.wustl.edu	37	1	232172460	232172460	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:232172460G>T	ENST00000439617.2	+	13	2501	c.2448G>T	c.(2446-2448)caG>caT	p.Q816H	DISC1_ENST00000366637.3_Missense_Mutation_p.Q126H	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	816	Interaction with ATF4 and ATF5.|Interaction with NDEL1.|Interaction with PAFAH1B1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)		p.Q848H(1)|p.Q848Q(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GGGAGCTCCAGATGGTGAAGG	0.582																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)											33.0	37.0	36.0					1																	232172460		2000	4170	6170	SO:0001583	missense	0			AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.2448G>T	1.37:g.232172460G>T	ENSP00000403888:p.Gln816His		A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	superfamily_Prefoldin	p.Q816H	ENST00000439617.2	37	c.2448		1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.331725	0.81690	.	.	ENSG00000162946	ENST00000439617;ENST00000366637;ENST00000366638;ENST00000532576	T	0.12255	2.7	5.51	5.51	0.81932	.	0.150456	0.44483	D	0.000459	T	0.25827	0.0629	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.73380	0.98;0.98	T	0.01312	-1.1388	10	0.72032	D	0.01	-13.595	17.8434	0.88721	0.0:0.0:1.0:0.0	.	794;816	Q9NRI5-2;Q9NRI5	.;DISC1_HUMAN	H	816;794;848;694	ENSP00000403888:Q816H	ENSP00000355597:Q794H	Q	+	3	2	DISC1	230239083	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.179000	0.71974	2.881000	0.98747	0.650000	0.86243	CAG	DISC1	-	NULL	ENSG00000162946		0.582	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	DISC1	HGNC	protein_coding	OTTHUMT00000092351.2	-	0.00	43	0	G	NM_018662		232172460	+1	tier1	-	no_errors	ENST00000439617	ensembl	human	known	74_37	missense	32.26	42	20	SNP	1.000	T
DNMT1	1786	genome.wustl.edu	37	19	10260136	10260136	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:10260136G>A	ENST00000340748.4	-	25	2766	c.2531C>T	c.(2530-2532)gCc>gTc	p.A844V	DNMT1_ENST00000540357.1_Missense_Mutation_p.A844V|DNMT1_ENST00000359526.4_Missense_Mutation_p.A860V			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	844	BAH 1. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	CACCTCCATGGCCCAGTTTTC	0.488																																																	0													174.0	182.0	179.0					19																	10260136		2203	4300	6503	SO:0001583	missense	0			X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.2531C>T	19.37:g.10260136G>A	ENSP00000345739:p.Ala844Val		A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Missense_Mutation	SNP	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.A860V	ENST00000340748.4	37	c.2579	CCDS12228.1	19	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214718	0.39102	.	.	ENSG00000130816	ENST00000359526;ENST00000540357;ENST00000340748;ENST00000541266	D;D;D	0.85773	-2.03;-2.03;-2.03	5.82	5.82	0.92795	Bromo adjacent homology (BAH) domain (3);	0.183650	0.48767	D	0.000178	T	0.75961	0.3921	L	0.34521	1.04	0.42644	D	0.993429	P;P;B	0.45902	0.575;0.868;0.434	B;B;B	0.39771	0.205;0.205;0.309	T	0.73329	-0.4017	10	0.15499	T	0.54	.	12.2315	0.54490	0.0785:0.0:0.9215:0.0	.	844;860;844	F5GX68;P26358-2;P26358	.;.;DNMT1_HUMAN	V	860;844;844;712	ENSP00000352516:A860V;ENSP00000440457:A844V;ENSP00000345739:A844V	ENSP00000345739:A844V	A	-	2	0	DNMT1	10121136	1.000000	0.71417	0.996000	0.52242	0.782000	0.44232	5.048000	0.64238	2.752000	0.94435	0.655000	0.94253	GCC	DNMT1	-	pirsf_DNA_C5-MeTrfase_1_euk,pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000130816		0.488	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	HGNC	protein_coding	OTTHUMT00000451166.1	-	0.00	66	0	G	NM_001379		10260136	-1	tier1	-	no_errors	ENST00000359526	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
DSPP	1834	genome.wustl.edu	37	4	88536371	88536371	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:88536371A>G	ENST00000282478.7	+	4	2590	c.2557A>G	c.(2557-2559)Agc>Ggc	p.S853G	DSPP_ENST00000399271.1_Missense_Mutation_p.S853G|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	853	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		cggcagtgatagcgacagcag	0.502																																																	0													83.0	104.0	97.0					4																	88536371		1650	2963	4613	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.2557A>G	4.37:g.88536371A>G	ENSP00000282478:p.Ser853Gly		A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.S853G	ENST00000282478.7	37	c.2557	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	a	4.691	0.128490	0.08981	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.87412	-2.25;-2.25	0.918	0.918	0.19386	.	.	.	.	.	T	0.73110	0.3545	L	0.31926	0.97	0.19300	N	0.999974	P	0.43701	0.815	B	0.36134	0.218	T	0.61964	-0.6954	9	0.14252	T	0.57	.	4.0869	0.09951	1.0:0.0:0.0:0.0	.	853	Q9NZW4	DSPP_HUMAN	G	853	ENSP00000382213:S853G;ENSP00000282478:S853G	ENSP00000282478:S853G	S	+	1	0	DSPP	88755395	0.002000	0.14202	0.007000	0.13788	0.004000	0.04260	-0.413000	0.07123	0.659000	0.30945	0.139000	0.15985	AGC	DSPP	-	NULL	ENSG00000152591		0.502	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3		0.00	94	0	A	NM_014208		88536371	+1			no_errors	ENST00000282478	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.663	G
DTX2	113878	genome.wustl.edu	37	7	76109743	76109743	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:76109743C>T	ENST00000324432.5	+	0	427				DTX2_ENST00000430490.2_5'UTR|AC007078.4_ENST00000479299.2_RNA|DTX2_ENST00000472426.1_3'UTR|DTX2_ENST00000307569.8_5'UTR|DTX2_ENST00000446820.2_5'Flank|DTX2_ENST00000446600.1_Intron|DTX2_ENST00000413936.2_5'UTR	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase						Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CACAGATCTGCCGGAGGCGCT	0.582																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.-84C>T	7.37:g.76109743C>T			Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	RNA	SNP	-	NULL	ENST00000324432.5	37	NULL	CCDS5587.1	7																																																																																			DTX2	-	-	ENSG00000091073		0.582	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	HGNC	protein_coding	OTTHUMT00000253104.2	-	0.00	25	0	C			76109743	+1	tier1	-	no_errors	ENST00000492339	ensembl	human	known	74_37	rna	22.73	17	5	SNP	0.278	T
DUS2	54920	genome.wustl.edu	37	16	68112718	68112718	+	Silent	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:68112718T>C	ENST00000565263.1	+	17	1805	c.1311T>C	c.(1309-1311)ccT>ccC	p.P437P	RP11-67A1.2_ENST00000548144.1_RNA|DUS2_ENST00000358896.6_Silent_p.P437P|DUS2_ENST00000432752.1_Silent_p.P402P	NM_017803.3	NP_060273.1	Q9NX74	DUS2L_HUMAN	dihydrouridine synthase 2	437					negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)|flavin adenine dinucleotide binding (GO:0050660)|protein kinase inhibitor activity (GO:0004860)|tRNA dihydrouridine synthase activity (GO:0017150)										AGGGCCTCCCTGAGGGTCGGC	0.632																																																	0													29.0	33.0	32.0					16																	68112718		2198	4298	6496	SO:0001819	synonymous_variant	0				CCDS10859.1, CCDS61970.1	16q22.1	2013-07-23	2013-07-23	2013-07-23	ENSG00000167264	ENSG00000167264			26014	protein-coding gene	gene with protein product	"""SMM1 homolog (S. cerevisiae)"""	609707	"""dihydrouridine synthase 2-like (SMM1, S. cerevisiae)"", ""dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae)"", ""dihydrouridine synthase 2-like"""	DUS2L		15994936, 22741570	Standard	NM_017803		Approved	FLJ20399, SMM1	uc002evj.4	Q9NX74	OTTHUMG00000137538	ENST00000565263.1:c.1311T>C	16.37:g.68112718T>C			A8K3G3|Q4H4D9	Silent	SNP	pfam_tRNA_hU_synthase,pfam_dsRNA-bd_dom,smart_dsRNA-bd_dom	p.P437	ENST00000565263.1	37	c.1311	CCDS10859.1	16																																																																																			DUS2	-	NULL	ENSG00000167264		0.632	DUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUS2	HGNC	protein_coding	OTTHUMT00000268869.2		0.00	65	0	T	NM_017803		68112718	+1			no_errors	ENST00000358896	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.990	C
EEPD1	80820	genome.wustl.edu	37	7	36194611	36194611	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:36194611G>A	ENST00000242108.4	+	2	1396	c.678G>A	c.(676-678)ctG>ctA	p.L226L	EEPD1_ENST00000534978.1_Silent_p.L226L	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	226					DNA repair (GO:0006281)		DNA binding (GO:0003677)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						CCCTGAGCCTGCAGAGTGAGG	0.662																																																	0													41.0	44.0	43.0					7																	36194611		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.678G>A	7.37:g.36194611G>A			Q96K64|Q9C0F7	Silent	SNP	pfam_HhH_motif,pfam_Endo/exonuclease/phosphatase,pfam_GspK,superfamily_Endo/exonuclease/phosphatase,superfamily_RuvA_2-like,smart_Hlx-hairpin-Hlx_DNA-bd_motif,tigrfam_Competence_ComEA_HhH	p.L226	ENST00000242108.4	37	c.678	CCDS34619.1	7																																																																																			EEPD1	-	NULL	ENSG00000122547		0.662	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEPD1	HGNC	protein_coding	OTTHUMT00000337602.1	-	0.00	50	0	G	NM_030636		36194611	+1	tier1	-	no_errors	ENST00000242108	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	A
EEPD1	80820	genome.wustl.edu	37	7	36338707	36338707	+	Silent	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:36338707G>T	ENST00000242108.4	+	8	2320	c.1602G>T	c.(1600-1602)gtG>gtT	p.V534V	EEPD1_ENST00000534978.1_Silent_p.V534V	NM_030636.2	NP_085139.2	Q7L9B9	EEPD1_HUMAN	endonuclease/exonuclease/phosphatase family domain containing 1	534					DNA repair (GO:0006281)		DNA binding (GO:0003677)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|skin(1)	18						ACTGCCCAGTGCTAGCCGAGT	0.587																																																	0													77.0	68.0	71.0					7																	36338707		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027386	CCDS34619.1	7p14.2	2007-12-07	2007-12-07		ENSG00000122547	ENSG00000122547			22223	protein-coding gene	gene with protein product							Standard	NM_030636		Approved	KIAA1706	uc003tfa.3	Q7L9B9	OTTHUMG00000154904	ENST00000242108.4:c.1602G>T	7.37:g.36338707G>T			Q96K64|Q9C0F7	Silent	SNP	pfam_HhH_motif,pfam_Endo/exonuclease/phosphatase,pfam_GspK,superfamily_Endo/exonuclease/phosphatase,superfamily_RuvA_2-like,smart_Hlx-hairpin-Hlx_DNA-bd_motif,tigrfam_Competence_ComEA_HhH	p.V534	ENST00000242108.4	37	c.1602	CCDS34619.1	7																																																																																			EEPD1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000122547		0.587	EEPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEPD1	HGNC	protein_coding	OTTHUMT00000337602.1	-	0.00	56	0	G	NM_030636		36338707	+1	tier1	-	no_errors	ENST00000242108	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	T
EHD1	10938	genome.wustl.edu	37	11	64627630	64627630	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:64627630C>T	ENST00000320631.3	-	3	935	c.681G>A	c.(679-681)caG>caA	p.Q227Q	EHD1_ENST00000359393.2_Silent_p.Q227Q	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	227	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						GCATCAGCTGCTGCGTCTCGA	0.582																																																	0													103.0	98.0	100.0					11																	64627630		2201	4297	6498	SO:0001819	synonymous_variant	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.681G>A	11.37:g.64627630C>T			O14611|Q2M3Q4|Q9UNR3	Silent	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.Q227	ENST00000320631.3	37	c.681	CCDS8084.1	11																																																																																			EHD1	-	superfamily_P-loop_NTPase	ENSG00000110047		0.582	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	-	0.00	58	0	C	NM_006795		64627630	-1	tier1	-	no_errors	ENST00000320631	ensembl	human	known	74_37	silent	7.55	49	4	SNP	1.000	T
EIF2S3	1968	genome.wustl.edu	37	X	24091268	24091268	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:24091268G>T	ENST00000253039.4	+	11	1496	c.1243G>T	c.(1243-1245)Ggg>Tgg	p.G415W	EIF2S3_ENST00000460032.1_3'UTR	NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	415					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						GTCAACAGGAGGGAGAGTTAG	0.408																																																	0													166.0	158.0	161.0					X																	24091268		2203	4300	6503	SO:0001583	missense	0			L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.1243G>T	X.37:g.24091268G>T	ENSP00000253039:p.Gly415Trp		B5BTZ4	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF2_gsu_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_EF_GTP-bd_dom	p.G415W	ENST00000253039.4	37	c.1243	CCDS14210.1	X	.	.	.	.	.	.	.	.	.	.	G	24.8	4.574486	0.86542	.	.	ENSG00000130741	ENST00000253039	T	0.69040	-0.37	4.97	4.97	0.65823	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation initiation factor 2, gamma subunit, C-terminal (1);	0.055440	0.64402	D	0.000001	D	0.88573	0.6473	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92984	0.6409	10	0.87932	D	0	.	17.6173	0.88071	0.0:0.0:1.0:0.0	.	415	P41091	IF2G_HUMAN	W	415	ENSP00000253039:G415W	ENSP00000253039:G415W	G	+	1	0	EIF2S3	24001189	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.365000	0.97139	2.176000	0.68965	0.594000	0.82650	GGG	EIF2S3	-	pfam_TIF2_gsu_C,superfamily_Transl_elong_EF1A/Init_IF2_C	ENSG00000130741		0.408	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S3	HGNC	protein_coding	OTTHUMT00000056079.1	-	0.00	48	0	G	NM_001415		24091268	+1	tier1	-	no_errors	ENST00000253039	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
EIF4G1	1981	genome.wustl.edu	37	3	184045115	184045115	+	Silent	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:184045115T>C	ENST00000346169.2	+	24	3811	c.3540T>C	c.(3538-3540)ccT>ccC	p.P1180P	EIF4G1_ENST00000350481.5_Silent_p.P1016P|EIF4G1_ENST00000434061.2_Silent_p.P985P|EIF4G1_ENST00000342981.4_Silent_p.P1181P|EIF4G1_ENST00000435046.2_Silent_p.P984P|EIF4G1_ENST00000319274.6_Silent_p.P1180P|EIF4G1_ENST00000411531.1_Silent_p.P1141P|EIF4G1_ENST00000352767.3_Silent_p.P1187P|EIF4G1_ENST00000427845.1_Silent_p.P1094P|EIF4G1_ENST00000441154.1_Silent_p.P1017P|EIF4G1_ENST00000424196.1_Silent_p.P1187P|EIF4G1_ENST00000382330.3_Silent_p.P1187P|EIF4G1_ENST00000392537.2_Silent_p.P1093P|EIF4G1_ENST00000414031.1_Silent_p.P1140P|SNORD66_ENST00000390856.1_RNA|EIF2B5_ENST00000444495.1_Intron	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1180					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CGCGGACACCTGCTACCAAGC	0.657																																																	0													44.0	48.0	47.0					3																	184045115		2203	4300	6503	SO:0001819	synonymous_variant	0			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.3540T>C	3.37:g.184045115T>C			D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Silent	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.P1187	ENST00000346169.2	37	c.3561	CCDS3259.1	3																																																																																			EIF4G1	-	NULL	ENSG00000114867		0.657	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	EIF4G1	HGNC	protein_coding	OTTHUMT00000345733.1		0.00	57	0	T	NM_182917		184045115	+1			no_errors	ENST00000352767	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.158	C
ELAVL2	1993	genome.wustl.edu	37	9	23692817	23692817	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:23692817C>T	ENST00000397312.2	-	7	1092	c.818G>A	c.(817-819)gGa>gAa	p.G273E	ELAVL2_ENST00000380110.4_Missense_Mutation_p.G303E|ELAVL2_ENST00000380117.1_Missense_Mutation_p.G273E|ELAVL2_ENST00000223951.6_Missense_Mutation_p.G260E|ELAVL2_ENST00000544538.1_Missense_Mutation_p.G273E	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	273					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		CCACCCTGTTCCAGGGTGCCC	0.463																																																	0													82.0	78.0	79.0					9																	23692817		2203	4300	6503	SO:0001583	missense	0			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.818G>A	9.37:g.23692817C>T	ENSP00000380479:p.Gly273Glu		D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.G273E	ENST00000397312.2	37	c.818	CCDS6515.1	9	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740637	0.69304	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598	T;T;T;T	0.05717	3.4;3.4;3.4;3.4	5.81	5.81	0.92471	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.14399	0.0348	M	0.73217	2.22	0.80722	D	1	B;B	0.32425	0.255;0.371	B;B	0.35813	0.071;0.211	T	0.00834	-1.1547	10	0.87932	D	0	.	20.0688	0.97709	0.0:1.0:0.0:0.0	.	273;260	Q12926;Q12926-2	ELAV2_HUMAN;.	E	260;273;273;260;273;301	ENSP00000223951:G260E;ENSP00000380479:G273E;ENSP00000440998:G273E;ENSP00000369460:G273E	ENSP00000223951:G260E	G	-	2	0	ELAVL2	23682817	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.468000	0.80943	2.751000	0.94390	0.555000	0.69702	GGA	ELAVL2	-	tigrfam_ELAD_HUD_SF	ENSG00000107105		0.463	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	ELAVL2	HGNC	protein_coding	OTTHUMT00000051943.2	-	0.00	11	0	C	NM_004432		23692817	-1	tier1	-	no_errors	ENST00000380117	ensembl	human	known	74_37	missense	40.00	9	6	SNP	1.000	T
ELOVL6	79071	genome.wustl.edu	37	4	110980902	110980902	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:110980902C>G	ENST00000394607.3	-	4	393	c.230G>C	c.(229-231)gGt>gCt	p.G77A	ELOVL6_ENST00000506461.1_5'UTR|ELOVL6_ENST00000302274.3_Missense_Mutation_p.G77A			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	77					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		TCGAAGAGCACCGAATATACT	0.403																																																	0													67.0	62.0	64.0					4																	110980902		2203	4300	6503	SO:0001583	missense	0			AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.230G>C	4.37:g.110980902C>G	ENSP00000378105:p.Gly77Ala		Q4W5L0|Q8NCD1	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.G77A	ENST00000394607.3	37	c.230	CCDS3690.1	4	.	.	.	.	.	.	.	.	.	.	C	33	5.228891	0.95173	.	.	ENSG00000170522	ENST00000394607;ENST00000302274;ENST00000506625;ENST00000503885	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.51	5.51	0.81932	.	0.099330	0.64402	D	0.000002	T	0.42810	0.1219	M	0.76170	2.325	0.80722	D	1	P	0.41313	0.745	P	0.49387	0.609	T	0.11470	-1.0586	10	0.15499	T	0.54	-19.5071	19.8016	0.96509	0.0:1.0:0.0:0.0	.	77	Q9H5J4	ELOV6_HUMAN	A	77	ENSP00000378105:G77A;ENSP00000304736:G77A;ENSP00000425488:G77A;ENSP00000426086:G77A	ENSP00000304736:G77A	G	-	2	0	ELOVL6	111200351	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.718000	0.84743	2.770000	0.95276	0.655000	0.94253	GGT	ELOVL6	-	pfam_GNS1_SUR4	ENSG00000170522		0.403	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELOVL6	HGNC	protein_coding	OTTHUMT00000255748.1		0.00	29	0	C	NM_024090		110980902	-1			no_errors	ENST00000394607	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	G
EML5	161436	genome.wustl.edu	37	14	89178750	89178750	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:89178750C>T	ENST00000380664.5	-	10	1521	c.1522G>A	c.(1522-1524)Gta>Ata	p.V508I	EML5_ENST00000352093.5_Missense_Mutation_p.V508I|EML5_ENST00000554922.1_Missense_Mutation_p.V508I			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	508						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ATTCCATTTACTTCAAGGCCT	0.348																																																	0													74.0	70.0	71.0					14																	89178750		1831	4096	5927	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.1522G>A	14.37:g.89178750C>T	ENSP00000370039:p.Val508Ile		B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V508I	ENST00000380664.5	37	c.1522	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827285	0.90955	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.60171	0.43;0.21;0.47	4.97	4.97	0.65823	WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	D	0.82346	0.5017	M	0.93854	3.465	0.53688	D	0.999977	D	0.67145	0.996	D	0.79108	0.992	D	0.86358	0.1715	10	0.54805	T	0.06	-16.5038	18.4169	0.90574	0.0:1.0:0.0:0.0	.	508	Q05BV3	EMAL5_HUMAN	I	508	ENSP00000451998:V508I;ENSP00000298315:V508I;ENSP00000370039:V508I	ENSP00000298315:V508I	V	-	1	0	EML5	88248503	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.562000	0.86427	0.650000	0.86243	GTA	EML5	-	superfamily_WD40_repeat_dom	ENSG00000165521		0.348	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	-	0.00	65	0	C			89178750	-1	tier1	-	no_errors	ENST00000554922	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	T
RP11-24M17.5	0	genome.wustl.edu	37	15	76074431	76074431	+	RNA	SNP	C	C	T	rs371238897		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:76074431C>T	ENST00000395215.3	+	0	610																		p.S190L(2)									CTCCAGTCCTCGAGCTGCAGA	0.547																																																	2	Substitution - Missense(2)	endometrium(2)																																										0																															15.37:g.76074431C>T				RNA	SNP	-	NULL	ENST00000395215.3	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	3.205	-0.162863	0.06502	.	.	ENSG00000187812	ENST00000395215	.	.	.	0.789	0.789	0.18607	.	.	.	.	.	T	0.29850	0.0746	.	.	.	.	.	.	B	0.20550	0.046	B	0.15870	0.014	T	0.30208	-0.9986	6	0.27082	T	0.32	.	7.4893	0.27452	0.0:0.9999:0.0:1.0E-4	.	190	B4DZE6	.	L	190	.	ENSP00000378641:S190L	S	+	2	0	AC019294.2	73861486	0.987000	0.35691	0.013000	0.15412	0.024000	0.10985	3.310000	0.51911	0.745000	0.32763	0.274000	0.19336	TCG	RP11-24M17.5	-	-	ENSG00000187812		0.547	RP11-24M17.5-001	KNOWN	basic	processed_transcript	ENSG00000187812	Clone_based_vega_gene	pseudogene	OTTHUMT00000420501.1		0.00	121	0	C			76074431	+1			no_errors	ENST00000395215	ensembl	human	known	74_37	rna	7.69	72	6	SNP	0.107	T
AC092812.1	0	genome.wustl.edu	37	1	96352173	96352173	+	RNA	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:96352173G>A	ENST00000408871.1	+	0	78																											ttgcaattacgtttgtaccat	0.313																																																	0																																												0																															1.37:g.96352173G>A				RNA	SNP	-	NULL	ENST00000408871.1	37	NULL		1																																																																																			AC092812.1	-	-	ENSG00000221798		0.313	AC092812.1-201	NOVEL	basic	miRNA	ENSG00000221798	Clone_based_ensembl_gene	miRNA		-	0.00	67	0	G			96352173	+1	tier1	-	no_errors	ENST00000408871	ensembl	human	novel	74_37	rna	42.11	22	16	SNP	0.006	A
LOC105370306	105370306	genome.wustl.edu	37	13	88840118	88840118	+	lincRNA	SNP	G	G	T	rs2346849	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr13:88840118G>T	ENST00000430214.1	+	0	234				AL354896.1_ENST00000411127.1_RNA																							TTATTAtgcggttttttgcca	0.333																																																	0																																												0																															13.37:g.88840118G>T				RNA	SNP	-	NULL	ENST00000430214.1	37	NULL		13																																																																																			AL354896.1	-	-	ENSG00000223059		0.333	RP11-545P6.2-001	KNOWN	basic	lincRNA	ENSG00000223059	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000339346.2	-	0.00	33	0	G			88840118	-1	tier1	-	no_errors	ENST00000411127	ensembl	human	novel	74_37	rna	26.92	19	7	SNP	0.032	T
AC103564.7	0	genome.wustl.edu	37	2	132587690	132587690	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:132587690G>A	ENST00000437330.1	-	0	245																											CAGCAGGTCCGGAGCGTCCGT	0.662																																																	0																																												0																															2.37:g.132587690G>A				RNA	SNP	-	NULL	ENST00000437330.1	37	NULL		2																																																																																			AC103564.7	-	-	ENSG00000229203		0.662	AC103564.7-001	KNOWN	basic	lincRNA	ENSG00000229203	Clone_based_vega_gene	lincRNA	OTTHUMT00000332207.1	-	0.00	145	0	G			132587690	-1	tier1	-	no_errors	ENST00000437330	ensembl	human	known	74_37	rna	31.46	60	28	SNP	1.000	A
RP5-947P14.1	0	genome.wustl.edu	37	1	106623892	106623892	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:106623892G>A	ENST00000437803.1	+	0	165																											GGTGTCACTCGTGCCATTCAG	0.612																																																	0																																												0																															1.37:g.106623892G>A				RNA	SNP	-	NULL	ENST00000437803.1	37	NULL		1																																																																																			RP5-947P14.1	-	-	ENSG00000237480		0.612	RP5-947P14.1-001	KNOWN	basic	lincRNA	ENSG00000237480	Clone_based_vega_gene	lincRNA	OTTHUMT00000030361.1	-	0.00	51	0	G			106623892	+1	tier1	-	no_errors	ENST00000429608	ensembl	human	known	74_37	rna	37.74	33	20	SNP	0.108	A
GUCY1A2	2977	genome.wustl.edu	37	11	106672094	106672094	+	Intron	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:106672094G>T	ENST00000526355.2	-	5	2161				AP001282.1_ENST00000578526.1_RNA|GUCY1A2_ENST00000347596.2_Intron|GUCY1A2_ENST00000282249.2_Intron	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	CTGGTAATTTGTCAAAGTTGT	0.328																																																	0																																										SO:0001627	intron_variant	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1692+8624C>A	11.37:g.106672094G>T			A1L4C4|B7ZLT5	RNA	SNP	-	NULL	ENST00000526355.2	37	NULL	CCDS8335.1	11																																																																																			AP001282.1	-	-	ENSG00000264542		0.328	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	ENSG00000264542	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000389003.2	-	0.00	42	0	G			106672094	-1	tier1	-	no_errors	ENST00000578526	ensembl	human	novel	74_37	rna	18.92	30	7	SNP	0.130	T
SLC2A11	66035	genome.wustl.edu	37	22	24199049	24199049	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:24199049C>T	ENST00000345044.6	+	0	160				KB-1125A3.11_ENST00000609825.1_RNA|SLC2A11_ENST00000405847.1_5'Flank|SLC2A11_ENST00000398356.2_5'Flank|SLC2A11_ENST00000316185.8_5'Flank|SLC2A11_ENST00000403208.3_5'Flank			Q9BYW1	GTR11_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 11						carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	12						CAAGTGCCCCCAGCATAAGTC	0.592																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AJ271290	CCDS13818.1, CCDS33616.1, CCDS46673.1, CCDS74828.1	22q11.23	2013-05-22			ENSG00000133460	ENSG00000133460		"""Solute carriers"""	14239	protein-coding gene	gene with protein product		610367					Standard	NM_001024938		Approved	GLUT11, GLUT10	uc002zyp.4	Q9BYW1	OTTHUMG00000166469	ENST00000345044.6:c.-109C>T	22.37:g.24199049C>T			E9PH55|Q542Y4|Q6ICJ5|Q8WXF9|Q8WYM4	RNA	SNP	-	NULL	ENST00000345044.6	37	NULL	CCDS46673.1	22																																																																																			KB-1125A3.11	-	-	ENSG00000272973		0.592	SLC2A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272973	Clone_based_vega_gene	protein_coding	OTTHUMT00000319889.3	-	0.00	18	0	C	NM_030807		24199049	-1	tier1	-	no_errors	ENST00000609825	ensembl	human	known	74_37	rna	43.75	9	7	SNP	0.000	T
ENTPD5	957	genome.wustl.edu	37	14	74436726	74436726	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:74436726C>T	ENST00000334696.6	-	15	1506	c.1187G>A	c.(1186-1188)aGc>aAc	p.S396N	ENTPD5_ENST00000557325.1_Missense_Mutation_p.S396N	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	396					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		TAAGACTGTGCTGTCTGCAAA	0.473																																																	0													154.0	133.0	140.0					14																	74436726		2203	4300	6503	SO:0001583	missense	0			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.1187G>A	14.37:g.74436726C>T	ENSP00000335246:p.Ser396Asn		A1L4C5|Q96RX0	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.S396N	ENST00000334696.6	37	c.1187	CCDS9825.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.714|2.714	-0.268204|-0.268204	0.05716|0.05716	.|.	.|.	ENSG00000187097|ENSG00000187097	ENST00000555829|ENST00000557325;ENST00000334696	.|T;T	.|0.11712	.|2.75;2.75	5.5|5.5	2.72|2.72	0.32119|0.32119	.|.	.|0.220224	.|0.53938	.|N	.|0.000044	T|T	0.04907|0.04907	0.0132|0.0132	N|N	0.11892|0.11892	0.195|0.195	0.80722|0.80722	D|D	1|1	.|B;B	.|0.09022	.|0.001;0.002	.|B;B	.|0.14023	.|0.01;0.006	T|T	0.41161|0.41161	-0.9524|-0.9524	5|10	.|0.20519	.|T	.|0.43	-29.5131|-29.5131	4.693|4.693	0.12790|0.12790	0.0:0.4626:0.1487:0.3887|0.0:0.4626:0.1487:0.3887	.|.	.|396;396	.|O75356;G3V4I0	.|ENTP5_HUMAN;.	T|N	71|396	.|ENSP00000451810:S396N;ENSP00000335246:S396N	.|ENSP00000335246:S396N	A|S	-|-	1|2	0|0	ENTPD5|ENTPD5	73506479|73506479	0.992000|0.992000	0.36948|0.36948	0.962000|0.962000	0.40283|0.40283	0.967000|0.967000	0.64934|0.64934	0.326000|0.326000	0.19646|0.19646	0.441000|0.441000	0.26529|0.26529	0.655000|0.655000	0.94253|0.94253	GCA|AGC	ENTPD5	-	pfam_GDA1_CD39_NTPase	ENSG00000187097		0.473	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD5	HGNC	protein_coding	OTTHUMT00000412637.1		0.00	41	0	C	NM_001249		74436726	-1			no_errors	ENST00000334696	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.999	T
EPG5	57724	genome.wustl.edu	37	18	43432583	43432583	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr18:43432583C>T	ENST00000282041.5	-	44	7623	c.7589G>A	c.(7588-7590)aGt>aAt	p.S2530N		NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	2530					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						ATACTGCTTACTTGATGCCAT	0.443																																																	0													186.0	172.0	177.0					18																	43432583		1945	4139	6084	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.7589G>A	18.37:g.43432583C>T	ENSP00000282041:p.Ser2530Asn		A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.S2530N	ENST00000282041.5	37	c.7589	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.470953	0.01044	.	.	ENSG00000152223	ENST00000282041;ENST00000540322	T	0.06768	3.26	6.02	5.07	0.68467	.	1.670800	0.02797	N	0.122720	T	0.05593	0.0147	N	0.11427	0.14	0.37490	D	0.916345	B	0.02656	0.0	B	0.06405	0.002	T	0.42068	-0.9473	10	0.02654	T	1	-2.3998	9.7346	0.40379	0.0:0.7886:0.0:0.2114	.	2530	Q9HCE0	EPG5_HUMAN	N	2530;458	ENSP00000282041:S2530N	ENSP00000282041:S2530N	S	-	2	0	EPG5	41686581	0.996000	0.38824	0.990000	0.47175	0.050000	0.14768	0.407000	0.21049	1.386000	0.46466	0.650000	0.86243	AGT	EPG5	-	NULL	ENSG00000152223		0.443	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	-	0.00	66	0	C	NM_020964		43432583	-1	tier1	-	no_errors	ENST00000282041	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.998	T
FAM120B	84498	genome.wustl.edu	37	6	170704669	170704669	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:170704669T>C	ENST00000476287.1	+	9	2800		c.e9+2		FAM120B_ENST00000537664.1_Splice_Site|FAM120B_ENST00000252510.9_Splice_Site|FAM120B_ENST00000540480.1_Splice_Site	NM_032448.1	NP_115824.1	Q96EK7	F120B_HUMAN	family with sequence similarity 120B						cell differentiation (GO:0030154)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(2)	44		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		AGGGACCAGGTAAGAAGGCCA	0.582																																																	0													40.0	33.0	35.0					6																	170704669		2194	4290	6484	SO:0001630	splice_region_variant	0			AB058741	CCDS5314.1, CCDS75555.1	6q27	2011-04-13	2006-07-04	2006-07-04	ENSG00000112584	ENSG00000112584			21109	protein-coding gene	gene with protein product	"""PPARgamma constitutive coactivator 1"", ""constitutive coactivator of PPAR-gamma"""	612266	"""KIAA1838"""	KIAA1838		14585507	Standard	NM_032448		Approved	PGCC1, CCPG	uc003qxp.3	Q96EK7	OTTHUMG00000016080	ENST00000476287.1:c.2692+2T>C	6.37:g.170704669T>C			B4DL34|Q86V68|Q96JI9	Splice_Site	SNP	-	e9+2	ENST00000476287.1	37	c.2761+2	CCDS5314.1	6	.	.	.	.	.	.	.	.	.	.	T	15.01	2.707025	0.48412	.	.	ENSG00000112584	ENST00000540480;ENST00000537664;ENST00000476287;ENST00000252510	.	.	.	4.81	2.4	0.29515	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.3861	0.11318	0.0:0.1023:0.204:0.6937	.	.	.	.	.	-1	.	.	.	+	.	.	FAM120B	170546594	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	1.519000	0.35888	0.935000	0.37341	0.533000	0.62120	.	FAM120B	-	-	ENSG00000112584		0.582	FAM120B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM120B	HGNC	protein_coding	OTTHUMT00000043259.2	-	0.00	22	0	T	NM_032448	Intron	170704669	+1	tier1	-	no_errors	ENST00000537664	ensembl	human	known	74_37	splice_site	20.00	12	3	SNP	1.000	C
FAM160A1	729830	genome.wustl.edu	37	4	152571290	152571290	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:152571290G>T	ENST00000505231.1	+	9	2256	c.2097G>T	c.(2095-2097)agG>agT	p.R699S	FAM160A1_ENST00000435205.1_Missense_Mutation_p.R699S			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	699	Glu-rich.									endometrium(2)|kidney(1)	3						AGTGGAATAGGGACAATTCAG	0.567																																																	0													72.0	89.0	84.0					4																	152571290		692	1591	2283	SO:0001583	missense	0				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.2097G>T	4.37:g.152571290G>T	ENSP00000421580:p.Arg699Ser		Q6ZUS2	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.R699S	ENST00000505231.1	37	c.2097	CCDS47146.1	4	.	.	.	.	.	.	.	.	.	.	G	8.863	0.947381	0.18356	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.11821	2.74;2.74	5.05	-1.31	0.09230	.	.	.	.	.	T	0.09247	0.0228	L	0.57536	1.79	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45977	-0.9224	9	0.08837	T	0.75	.	0.5131	0.00599	0.2578:0.2107:0.3161:0.2154	.	699	Q05DH4	F16A1_HUMAN	S	699	ENSP00000413196:R699S;ENSP00000421580:R699S	ENSP00000413196:R699S	R	+	3	2	FAM160A1	152790740	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.134000	0.15932	-0.585000	0.05905	0.650000	0.86243	AGG	FAM160A1	-	NULL	ENSG00000164142		0.567	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	-	0.00	56	0	G	NM_001109977		152571290	+1	tier1	-	no_errors	ENST00000435205	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.000	T
FAM180A	389558	genome.wustl.edu	37	7	135433402	135433402	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:135433402G>A	ENST00000338588.3	-	0	192				FAM180A_ENST00000415751.1_De_novo_Start_InFrame|FAM180A_ENST00000435869.1_5'UTR	NM_205855.3	NP_995327.1	Q6UWF9	F180A_HUMAN	family with sequence similarity 180, member A							extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)	14						TGCCCGTGCCGTTCTTCCCAG	0.537																																																	0																																												0			AC091736, AK290250, AK310180, AY358803	CCDS5841.1	7q33	2008-07-25			ENSG00000189320	ENSG00000189320			33773	protein-coding gene	gene with protein product						12975309, 12690205	Standard	NM_205855		Approved	HWKM1940, UNQ1940	uc003vtd.3	Q6UWF9	OTTHUMG00000155537		7.37:g.135433402G>A			B2RP85	RNA	SNP	-	NULL	ENST00000338588.3	37	NULL	CCDS5841.1	7																																																																																			FAM180A	-	-	ENSG00000189320		0.537	FAM180A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM180A	HGNC	protein_coding	OTTHUMT00000340554.2	-	0.00	23	0	G	NM_205855		135433402	-1	tier1	-	no_errors	ENST00000435869	ensembl	human	known	74_37	rna	41.67	14	10	SNP	0.000	A
FAM208A	23272	genome.wustl.edu	37	3	56707745	56707745	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:56707745G>A	ENST00000493960.2	-	2	350	c.340C>T	c.(340-342)Cag>Tag	p.Q114*	FAM208A_ENST00000355628.5_Nonsense_Mutation_p.Q114*	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	114							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						GTTAATGGCTGGAAAAGTGCT	0.289																																																	0													73.0	63.0	66.0					3																	56707745		692	1591	2283	SO:0001587	stop_gained	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.340C>T	3.37:g.56707745G>A	ENSP00000417509:p.Gln114*		A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Nonsense_Mutation	SNP	pfam_DUF3715	p.Q114*	ENST00000493960.2	37	c.340	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.352341	0.98231	.	.	ENSG00000163946	ENST00000493960;ENST00000355628	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-2.9973	19.2467	0.93905	0.0:0.0:1.0:0.0	.	.	.	.	X	114	.	ENSP00000347845:Q114X	Q	-	1	0	C3orf63	56682785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.990000	0.63876	2.557000	0.86248	0.591000	0.81541	CAG	FAM208A	-	NULL	ENSG00000163946		0.289	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	-	0.00	50	0	G	NM_015224		56707745	-1	tier1	-	no_errors	ENST00000355628	ensembl	human	known	74_37	nonsense	44.44	30	24	SNP	1.000	A
FAT1	2195	genome.wustl.edu	37	4	187542528	187542528	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:187542528G>T	ENST00000441802.2	-	10	5421	c.5212C>A	c.(5212-5214)Caa>Aaa	p.Q1738K		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	1738	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTAGTTCCTTGTATTATCAAT	0.393										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													94.0	91.0	92.0					4																	187542528		1891	4108	5999	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.5212C>A	4.37:g.187542528G>T	ENSP00000406229:p.Gln1738Lys			Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.Q1738K	ENST00000441802.2	37	c.5212	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	16.35	3.097648	0.56075	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.01665	4.7	5.5	5.5	0.81552	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.08088	0.0202	L	0.56280	1.765	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.51332	-0.8719	10	0.19147	T	0.46	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	1738	Q14517	FAT1_HUMAN	K	1738;1740	ENSP00000406229:Q1738K	ENSP00000260147:Q1740K	Q	-	1	0	FAT1	187779522	1.000000	0.71417	0.978000	0.43139	0.632000	0.37999	9.657000	0.98554	2.861000	0.98227	0.655000	0.94253	CAA	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.393	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3		0.00	14	0	G	NM_005245		187542528	-1			no_errors	ENST00000441802	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	T
FGFR1	2260	genome.wustl.edu	37	8	38285889	38285889	+	Silent	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:38285889T>A	ENST00000447712.2	-	4	1364	c.423A>T	c.(421-423)acA>acT	p.T141T	FGFR1_ENST00000397108.4_Silent_p.T141T|FGFR1_ENST00000356207.5_Silent_p.T52T|FGFR1_ENST00000425967.3_Silent_p.T174T|RP11-350N15.4_ENST00000528407.1_RNA|FGFR1_ENST00000326324.6_Silent_p.T52T|FGFR1_ENST00000335922.5_Silent_p.T133T|FGFR1_ENST00000341462.5_Silent_p.T144T|FGFR1_ENST00000532791.1_Silent_p.T141T|FGFR1_ENST00000397103.1_Silent_p.T52T|FGFR1_ENST00000397113.2_Silent_p.T141T|FGFR1_ENST00000397091.5_Silent_p.T141T	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	141					angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGGTGTTATCTGTTTCTTTCT	0.498		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	0													235.0	240.0	239.0					8																	38285889		1988	4167	6155	SO:0001819	synonymous_variant	0			M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.423A>T	8.37:g.38285889T>A			A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T174	ENST00000447712.2	37	c.522	CCDS6107.2	8																																																																																			FGFR1	-	pirsf_FGF_rcpt_fam	ENSG00000077782		0.498	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	HGNC	protein_coding			0.00	78	0	T			38285889	-1			no_errors	ENST00000425967	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.994	A
DMBT1P1	375940	genome.wustl.edu	37	10	124538819	124538819	+	RNA	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:124538819G>T	ENST00000439464.2	+	0	1563					NR_003570.1																						AGAATCACTTGCTAACAGTCC	0.343																																																	0																																												0																															10.37:g.124538819G>T				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.343	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1	-	0.00	47	0	G			124538819	+1	tier1	-	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	34.21	25	13	SNP	0.000	T
FLNC	2318	genome.wustl.edu	37	7	128488921	128488921	+	Silent	SNP	G	G	A	rs553400393		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:128488921G>A	ENST00000325888.8	+	28	5073	c.4812G>A	c.(4810-4812)ccG>ccA	p.P1604P	RP11-309L24.2_ENST00000469965.1_RNA|FLNC_ENST00000346177.6_Silent_p.P1604P	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1604					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CCTACCTGCCGGACATGAGTG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		15186	0.0		0.0	False		,,,				2504	0.001																0													107.0	127.0	120.0					7																	128488921		2134	4236	6370	SO:0001819	synonymous_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4812G>A	7.37:g.128488921G>A			B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.P1604	ENST00000325888.8	37	c.4812	CCDS43644.1	7																																																																																			FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.602	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	-	0.00	14	0	G			128488921	+1	tier1	-	no_errors	ENST00000325888	ensembl	human	known	74_37	silent	57.14	12	16	SNP	0.025	A
FOXG1	2290	genome.wustl.edu	37	14	29237560	29237560	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:29237560G>A	ENST00000313071.4	+	1	1274	c.1075G>A	c.(1075-1077)Gcc>Acc	p.A359T	FOXG1_ENST00000382535.3_Missense_Mutation_p.A359T	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	359					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CTTCTCCACCGCCAACGGCCT	0.677																																																	0													86.0	78.0	81.0					14																	29237560		2203	4300	6503	SO:0001583	missense	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1075G>A	14.37:g.29237560G>A	ENSP00000339004:p.Ala359Thr		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A359T	ENST00000313071.4	37	c.1075	CCDS9636.1	14	.	.	.	.	.	.	.	.	.	.	G	13.52	2.262296	0.39995	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93488	-3.23;-3.23	4.21	3.14	0.36123	.	0.209202	0.41938	U	0.000795	D	0.82342	0.5016	N	0.08118	0	0.36709	D	0.880536	B	0.25390	0.125	B	0.19946	0.027	T	0.79502	-0.1777	10	0.20046	T	0.44	.	9.4924	0.38967	0.0:0.0:0.506:0.494	.	359	P55316	FOXG1_HUMAN	T	359	ENSP00000371975:A359T;ENSP00000339004:A359T	ENSP00000339004:A359T	A	+	1	0	FOXG1	28307311	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	3.100000	0.50275	2.042000	0.60477	0.491000	0.48974	GCC	FOXG1	-	NULL	ENSG00000176165		0.677	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	52	0	G			29237560	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	missense	19.57	37	9	SNP	0.997	A
FOXJ1	2302	genome.wustl.edu	37	17	74133870	74133870	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:74133870G>A	ENST00000322957.6	-	3	1184	c.830C>T	c.(829-831)cCg>cTg	p.P277L	RNF157-AS1_ENST00000590137.1_RNA|RNF157-AS1_ENST00000585542.1_RNA	NM_001454.3	NP_001445.2	Q92949	FOXJ1_HUMAN	forkhead box J1	277				GWGAGEGRLGHKRKQPLPKRVAKVPR -> VWVQARAGWDI SPNTLCPRGGQGPA (in Ref. 2; CAA67729). {ECO:0000305}.	actin cytoskeleton organization (GO:0030036)|activation of Rho GTPase activity (GO:0032862)|brain development (GO:0007420)|central tolerance induction (GO:0002508)|cilium assembly (GO:0042384)|epithelium development (GO:0060429)|establishment of apical/basal cell polarity (GO:0035089)|glomerular parietal epithelial cell development (GO:0072016)|humoral immune response (GO:0006959)|left/right pattern formation (GO:0060972)|leukocyte migration (GO:0050900)|lung epithelium development (GO:0060428)|metanephric part of ureteric bud development (GO:0035502)|negative regulation of B cell activation (GO:0050869)|negative regulation of germinal center formation (GO:0002635)|negative regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002924)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pattern specification process (GO:0007389)|positive regulation of central B cell tolerance induction (GO:0002897)|positive regulation of lung ciliated cell differentiation (GO:1901248)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(1)|liver(1)|pancreas(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(166;0.187)			CTTGGGCAGCGGCTGTTTGCG	0.701																																																	0													8.0	10.0	10.0					17																	74133870		2092	4132	6224	SO:0001583	missense	0			X99349	CCDS32739.1	17q25.1	2008-05-14				ENSG00000129654		"""Forkhead boxes"""	3816	protein-coding gene	gene with protein product		602291		FKHL13		9073514, 16518568	Standard	NM_001454		Approved	HFH-4, HFH4	uc002jqx.3	Q92949		ENST00000322957.6:c.830C>T	17.37:g.74133870G>A	ENSP00000323880:p.Pro277Leu		O00630	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.P277L	ENST00000322957.6	37	c.830	CCDS32739.1	17	.	.	.	.	.	.	.	.	.	.	G	14.56	2.570842	0.45798	.	.	ENSG00000129654	ENST00000322957	D	0.95001	-3.58	4.78	4.78	0.61160	.	0.215403	0.49305	D	0.000155	D	0.92021	0.7472	M	0.68952	2.095	0.80722	D	1	P	0.37997	0.614	B	0.20955	0.032	D	0.92704	0.6177	10	0.56958	D	0.05	.	17.7978	0.88578	0.0:0.0:1.0:0.0	.	277	Q92949	FOXJ1_HUMAN	L	277	ENSP00000323880:P277L	ENSP00000323880:P277L	P	-	2	0	FOXJ1	71645465	1.000000	0.71417	0.947000	0.38551	0.924000	0.55760	4.942000	0.63547	2.197000	0.70478	0.462000	0.41574	CCG	FOXJ1	-	NULL	ENSG00000129654		0.701	FOXJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ1	HGNC	protein_coding	OTTHUMT00000449856.1	-	0.00	16	0	G	NM_001454		74133870	-1	tier1	-	no_errors	ENST00000322957	ensembl	human	known	74_37	missense	31.25	11	5	SNP	0.966	A
FREM1	158326	genome.wustl.edu	37	9	14851595	14851595	+	Missense_Mutation	SNP	G	G	A	rs369523355		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:14851595G>A	ENST00000380880.3	-	6	1622	c.839C>T	c.(838-840)gCg>gTg	p.A280V	FREM1_ENST00000422223.2_Missense_Mutation_p.A280V|FREM1_ENST00000380881.4_Missense_Mutation_p.A281V|RNU6-1260P_ENST00000362944.1_RNA			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	280					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AGGCAGCCACGCACTCTCTGA	0.403																																																	0								G	VAL/ALA	1,3805		0,1,1902	91.0	89.0	90.0		839	1.7	0.9	9		90	0,8266		0,0,4133	no	missense	FREM1	NM_144966.5	64	0,1,6035	AA,AG,GG		0.0,0.0263,0.0083	benign	280/2180	14851595	1,12071	1903	4133	6036	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.839C>T	9.37:g.14851595G>A	ENSP00000370262:p.Ala280Val		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.A281V	ENST00000380880.3	37	c.842	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	G	6.276	0.419033	0.11870	2.63E-4	0.0	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.09817	2.94;2.94;2.94	6.11	1.71	0.24356	.	0.355223	0.35040	N	0.003488	T	0.09202	0.0227	L	0.47716	1.5	0.24986	N	0.99157	B	0.12630	0.006	B	0.06405	0.002	T	0.36359	-0.9751	10	0.13470	T	0.59	-4.316	11.7012	0.51571	0.3324:0.0:0.6676:0.0	.	280	Q5H8C1	FREM1_HUMAN	V	281;280;280	ENSP00000370263:A281V;ENSP00000412940:A280V;ENSP00000370262:A280V	ENSP00000370257:A283V	A	-	2	0	FREM1	14841595	0.869000	0.29996	0.884000	0.34674	0.936000	0.57629	1.707000	0.37888	0.455000	0.26910	0.655000	0.94253	GCG	FREM1	-	NULL	ENSG00000164946		0.403	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2		0.00	27	0	G	NM_144966		14851595	-1			no_errors	ENST00000380881	ensembl	human	known	74_37	missense	5.56	33	2	SNP	0.357	A
FSHR	2492	genome.wustl.edu	37	2	49190735	49190735	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:49190735G>T	ENST00000406846.2	-	10	1344	c.1225C>A	c.(1225-1227)Ctc>Atc	p.L409I	FSHR_ENST00000346173.3_Missense_Mutation_p.L347I|FSHR_ENST00000304421.4_Missense_Mutation_p.L383I|FSHR_ENST00000541117.1_Missense_Mutation_p.L145I	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	409					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CCAATGCAGAGATCAGCAAAG	0.478									Gonadal Dysgenesis, 46 XX																																								0													141.0	136.0	138.0					2																	49190735		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.1225C>A	2.37:g.49190735G>T	ENSP00000384708:p.Leu409Ile		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.L409I	ENST00000406846.2	37	c.1225	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	G	13.98	2.398708	0.42512	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.38	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	0.129861	0.53938	D	0.000053	T	0.59636	0.2208	M	0.90309	3.105	0.58432	D	0.999999	P;P;P	0.42584	0.784;0.743;0.784	P;B;P	0.47864	0.559;0.423;0.559	T	0.60105	-0.7328	9	.	.	.	.	8.0813	0.30746	0.3342:0.0:0.6658:0.0	.	383;347;409	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	I	409;347;383;145	ENSP00000384708:L409I;ENSP00000333908:L347I;ENSP00000306780:L383I;ENSP00000444172:L145I	.	L	-	1	0	FSHR	49044239	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	3.478000	0.53158	0.316000	0.23135	0.655000	0.94253	CTC	FSHR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000170820		0.478	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2		0.00	32	0	G			49190735	-1			no_errors	ENST00000406846	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
FSIP2	401024	genome.wustl.edu	37	2	186666039	186666039	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:186666039G>A	ENST00000424728.1	+	17	12006	c.12006G>A	c.(12004-12006)tgG>tgA	p.W4002*	AC008174.3_ENST00000429929.1_RNA|FSIP2_ENST00000343098.5_Nonsense_Mutation_p.W4091*|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	4002										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						CTGTGTCCTGGCTCAATGAGA	0.338																																																	0																																										SO:0001587	stop_gained	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.12006G>A	2.37:g.186666039G>A	ENSP00000401306:p.Trp4002*		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Nonsense_Mutation	SNP	NULL	p.W4091*	ENST00000424728.1	37	c.12273		2	.	.	.	.	.	.	.	.	.	.	G	50	17.149531	0.99880	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	.	.	.	5.23	0.0359	0.14189	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	3.2637	0.06858	0.0808:0.2772:0.3573:0.2848	.	.	.	.	X	4091;4002	.	ENSP00000344403:W4091X	W	+	3	0	FSIP2	186374284	0.116000	0.22171	0.043000	0.18650	0.060000	0.15804	-0.175000	0.09825	-0.174000	0.10743	-0.310000	0.09108	TGG	FSIP2	-	NULL	ENSG00000188738		0.338	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3		0.00	51	0	G	NM_173651		186666039	+1			no_errors	ENST00000343098	ensembl	human	known	74_37	nonsense	7.55	49	4	SNP	0.070	A
FSTL4	23105	genome.wustl.edu	37	5	132537685	132537685	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:132537685G>T	ENST00000265342.7	-	15	2015	c.1766C>A	c.(1765-1767)cCc>cAc	p.P589H	CTB-49A3.2_ENST00000509051.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	589						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCCTGCAAAGGGTGTGCGGAT	0.567																																																	0													198.0	184.0	189.0					5																	132537685		2203	4300	6503	SO:0001583	missense	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1766C>A	5.37:g.132537685G>T	ENSP00000265342:p.Pro589His		Q8TBU0|Q9UPU1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal_dom,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.P589H	ENST00000265342.7	37	c.1766	CCDS34238.1	5	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760185	0.49468	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.60672	0.17	5.37	5.37	0.77165	WD40/YVTN repeat-like-containing domain (1);	0.052929	0.85682	D	0.000000	T	0.67116	0.2859	M	0.69823	2.125	0.42849	D	0.994072	B;P	0.37548	0.194;0.599	B;P	0.44946	0.059;0.465	T	0.69394	-0.5157	10	0.54805	T	0.06	-37.2259	18.4576	0.90727	0.0:0.0:1.0:0.0	.	589;238	Q6MZW2;B3KPF3	FSTL4_HUMAN;.	H	589;420	ENSP00000265342:P589H	ENSP00000265342:P589H	P	-	2	0	FSTL4	132565584	0.999000	0.42202	0.929000	0.37066	0.816000	0.46133	3.052000	0.49893	2.685000	0.91497	0.591000	0.81541	CCC	FSTL4	-	NULL	ENSG00000053108		0.567	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1	-	0.00	64	0	G	XM_048786		132537685	-1	tier1	-	no_errors	ENST00000265342	ensembl	human	known	74_37	missense	32.20	40	19	SNP	0.999	T
GALNT3	2591	genome.wustl.edu	37	2	166605343	166605343	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:166605343G>A	ENST00000392701.3	-	11	2625	c.1850C>T	c.(1849-1851)tCa>tTa	p.S617L	GALNT3_ENST00000409882.1_Missense_Mutation_p.S355L	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	617	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TGGGTTGCATGACACTAAACT	0.318																																																	0													92.0	89.0	90.0					2																	166605343		2203	4299	6502	SO:0001583	missense	0				CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1850C>T	2.37:g.166605343G>A	ENSP00000376465:p.Ser617Leu		Q53TG9|Q7Z476	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.S617L	ENST00000392701.3	37	c.1850	CCDS2226.1	2	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708561	0.30322	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	T;T	0.77620	-1.11;-1.11	5.86	4.04	0.47022	Ricin B-related lectin (1);Ricin B lectin (3);	0.795303	0.11868	N	0.521693	T	0.74176	0.3682	M	0.67397	2.05	0.26272	N	0.978401	B	0.02656	0.0	B	0.08055	0.003	T	0.62964	-0.6742	10	0.39692	T	0.17	.	8.7633	0.34687	0.068:0.0:0.6633:0.2686	.	617	Q14435	GALT3_HUMAN	L	617;355	ENSP00000376465:S617L;ENSP00000386955:S355L	ENSP00000376465:S617L	S	-	2	0	GALNT3	166313589	0.998000	0.40836	0.996000	0.52242	0.896000	0.52359	2.295000	0.43576	0.793000	0.33875	0.563000	0.77884	TCA	GALNT3	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000115339		0.318	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT3	HGNC	protein_coding	OTTHUMT00000255205.2	-	0.00	35	0	G	NM_004482		166605343	-1	tier1	-	no_errors	ENST00000392701	ensembl	human	known	74_37	missense	58.97	16	23	SNP	0.963	A
GDF2	2658	genome.wustl.edu	37	10	48414221	48414221	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:48414221C>T	ENST00000249598.1	-	2	806	c.647G>A	c.(646-648)cGg>cAg	p.R216Q		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	216					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R216Q(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						GGAGTCGGACCGGACCCAGCG	0.582																																																	1	Substitution - Missense(1)	prostate(1)											72.0	73.0	73.0					10																	48414221		2203	4300	6503	SO:0001583	missense	0			AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.647G>A	10.37:g.48414221C>T	ENSP00000249598:p.Arg216Gln		Q5VSQ9|Q9Y571	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.R216Q	ENST00000249598.1	37	c.647	CCDS7219.1	10	.	.	.	.	.	.	.	.	.	.	C	15.13	2.743086	0.49151	.	.	ENSG00000128802	ENST00000249598	T	0.64991	-0.13	5.59	4.68	0.58851	Transforming growth factor-beta, N-terminal (1);	0.270585	0.47455	D	0.000237	T	0.63803	0.2542	M	0.77103	2.36	0.30824	N	0.73742	D	0.61080	0.989	P	0.49528	0.614	T	0.63708	-0.6576	10	0.13470	T	0.59	.	7.5995	0.28067	0.0:0.713:0.1364:0.1506	.	216	Q9UK05	GDF2_HUMAN	Q	216	ENSP00000249598:R216Q	ENSP00000249598:R216Q	R	-	2	0	GDF2	48034227	0.068000	0.21057	0.989000	0.46669	0.322000	0.28314	0.351000	0.20096	1.350000	0.45770	0.591000	0.81541	CGG	GDF2	-	pfam_TGF-b_N	ENSG00000128802		0.582	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	HGNC	protein_coding	OTTHUMT00000047891.1	-	0.00	15	0	C	NM_016204		48414221	-1	tier1	-	no_errors	ENST00000249598	ensembl	human	known	74_37	missense	30.00	14	6	SNP	0.941	T
GK2	2712	genome.wustl.edu	37	4	80329257	80329257	+	Missense_Mutation	SNP	G	G	A	rs140376639	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:80329257G>A	ENST00000358842.3	-	1	115	c.98C>T	c.(97-99)gCg>gTg	p.A33V		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.A33G(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						AAGTAGTTCCGCTGTTTTTGA	0.493													G|||	4	0.000798722	0.003	0.0	5008	,	,		17608	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	endometrium(1)						G	VAL/ALA	9,4397	15.5+/-35.6	0,9,2194	98.0	97.0	98.0		98	3.6	0.7	4	dbSNP_134	98	0,8600		0,0,4300	yes	missense	GK2	NM_033214.2	64	0,9,6494	AA,AG,GG		0.0,0.2043,0.0692	possibly-damaging	33/554	80329257	9,12997	2203	4300	6503	SO:0001583	missense	0			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.98C>T	4.37:g.80329257G>A	ENSP00000351706:p.Ala33Val		Q7Z4Q4	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.A33V	ENST00000358842.3	37	c.98	CCDS3585.1	4	.	.	.	.	.	.	.	.	.	.	G	15.95	2.985012	0.53934	0.002043	0.0	ENSG00000196475	ENST00000358842	T	0.51325	0.71	3.57	3.57	0.40892	Carbohydrate kinase, FGGY, N-terminal (1);	0.052975	0.85682	D	0.000000	T	0.58991	0.2161	L	0.56280	1.765	0.53688	D	0.999972	D	0.71674	0.998	P	0.62560	0.904	T	0.61840	-0.6980	10	0.54805	T	0.06	-14.0824	13.4771	0.61314	0.0:0.0:1.0:0.0	.	33	Q14410	GLPK2_HUMAN	V	33	ENSP00000351706:A33V	ENSP00000351706:A33V	A	-	2	0	GK2	80548281	1.000000	0.71417	0.713000	0.30519	0.242000	0.25591	6.091000	0.71406	2.307000	0.77673	0.460000	0.39030	GCG	GK2	-	pfam_Carb_kinase_FGGY_N,tigrfam_Glycerol_kin	ENSG00000196475		0.493	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	-	0.00	50	0	G	NM_033214		80329257	-1	tier1	rs140376639	no_errors	ENST00000358842	ensembl	human	known	74_37	missense	28.30	38	15	SNP	0.998	A
GRAMD4	23151	genome.wustl.edu	37	22	47057313	47057313	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:47057313G>T	ENST00000406902.1	+	5	653	c.440G>T	c.(439-441)gGg>gTg	p.G147V	GRAMD4_ENST00000361034.3_Missense_Mutation_p.G147V			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	147					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CCCCCAAAAGGGCAGGCCCAG	0.617																																																	0													44.0	46.0	45.0					22																	47057313		2202	4300	6502	SO:0001583	missense	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.440G>T	22.37:g.47057313G>T	ENSP00000385689:p.Gly147Val		A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.G147V	ENST00000406902.1	37	c.440	CCDS33672.1	22	.	.	.	.	.	.	.	.	.	.	g	8.606	0.887950	0.17540	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.39229	1.09;1.09	5.13	4.1	0.47936	.	0.493820	0.16781	N	0.199768	T	0.24160	0.0585	N	0.08118	0	0.33380	D	0.574754	B	0.16396	0.017	B	0.20577	0.03	T	0.24154	-1.0168	10	0.28530	T	0.3	-27.2041	12.0535	0.53520	0.0:0.174:0.826:0.0	.	147	Q6IC98	GRAM4_HUMAN	V	147	ENSP00000385689:G147V;ENSP00000354313:G147V	ENSP00000354313:G147V	G	+	2	0	GRAMD4	45435977	0.229000	0.23729	0.165000	0.22776	0.492000	0.33523	1.355000	0.34068	1.286000	0.44565	0.552000	0.68991	GGG	GRAMD4	-	NULL	ENSG00000075240		0.617	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1	-	0.00	58	0	G	NM_015124		47057313	+1	tier1	-	no_errors	ENST00000361034	ensembl	human	known	74_37	missense	11.48	54	7	SNP	0.409	T
HABP4	22927	genome.wustl.edu	37	9	99252465	99252465	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:99252465G>A	ENST00000375249.4	+	0	1462				HABP4_ENST00000375251.3_3'UTR|HABP4_ENST00000466976.1_3'UTR	NM_014282.2	NP_055097.2			hyaluronan binding protein 4											NS(1)|cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				TTTGGGCTGAGCTGTTAGAGG	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF241831	CCDS6719.1	9q22.3-q31	2008-02-05			ENSG00000130956	ENSG00000130956			17062	protein-coding gene	gene with protein product						9523163, 10887182	Standard	XM_005251812		Approved	IHABP4, SERBP1L	uc010msg.3	Q5JVS0	OTTHUMG00000020298	ENST00000375249.4:c.*145G>A	9.37:g.99252465G>A				RNA	SNP	-	NULL	ENST00000375249.4	37	NULL	CCDS6719.1	9																																																																																			HABP4	-	-	ENSG00000130956		0.443	HABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP4	HGNC	protein_coding	OTTHUMT00000053269.1	-	0.00	77	0	G	NM_014282		99252465	+1	tier1	-	no_errors	ENST00000466976	ensembl	human	known	74_37	rna	6.10	77	5	SNP	0.002	A
GRIN3A	116443	genome.wustl.edu	37	9	104449448	104449448	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:104449448G>T	ENST00000361820.3	-	2	1334	c.734C>A	c.(733-735)tCa>tAa	p.S245*		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	245					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGAACTTAATGAATTTTCTAA	0.383																																																	0													77.0	77.0	77.0					9																	104449448		2203	4300	6503	SO:0001587	stop_gained	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.734C>A	9.37:g.104449448G>T	ENSP00000355155:p.Ser245*		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Nonsense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.S245*	ENST00000361820.3	37	c.734	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	G	43	9.971429	0.99308	.	.	ENSG00000198785	ENST00000361820	.	.	.	5.69	5.69	0.88448	.	1.199680	0.05801	N	0.612250	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8176	0.96576	0.0:0.0:1.0:0.0	.	.	.	.	X	245	.	ENSP00000355155:S245X	S	-	2	0	GRIN3A	103489269	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.702000	0.91338	2.690000	0.91761	0.455000	0.32223	TCA	GRIN3A	-	superfamily_Peripla_BP_I	ENSG00000198785		0.383	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1		0.00	32	0	G			104449448	-1			no_errors	ENST00000361820	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	1.000	T
HAS3	3038	genome.wustl.edu	37	16	69149029	69149029	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:69149029A>G	ENST00000306560.1	+	4	1678	c.1522A>G	c.(1522-1524)Aca>Gca	p.T508A	HAS3_ENST00000569188.1_Missense_Mutation_p.T508A|HAS3_ENST00000219322.3_Intron	NM_005329.2	NP_005320.2	O00219	HYAS3_HUMAN	hyaluronan synthase 3	508					carbohydrate metabolic process (GO:0005975)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of transcription, DNA-templated (GO:0045893)|small molecule metabolic process (GO:0044281)	hyaluranon cable (GO:0036117)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|urinary_tract(2)	16		Ovarian(137;0.101)		OV - Ovarian serous cystadenocarcinoma(108;0.0694)		GTTCAGTGAGACAGAGCTAGC	0.557																																																	0													149.0	138.0	141.0					16																	69149029		2198	4300	6498	SO:0001583	missense	0			BC021853	CCDS10870.1, CCDS10871.1	16q22.1	2013-02-22			ENSG00000103044	ENSG00000103044	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4820	protein-coding gene	gene with protein product		602428				9169154, 9083017	Standard	NM_005329		Approved		uc010cfh.3	O00219	OTTHUMG00000137562	ENST00000306560.1:c.1522A>G	16.37:g.69149029A>G	ENSP00000304440:p.Thr508Ala		A8K5T5|Q8WTZ0|Q9NYP0	Missense_Mutation	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.T508A	ENST00000306560.1	37	c.1522	CCDS10871.1	16	.	.	.	.	.	.	.	.	.	.	A	8.237	0.806024	0.16467	.	.	ENSG00000103044	ENST00000306560	T	0.42131	0.98	5.76	5.76	0.90799	.	0.043114	0.85682	D	0.000000	T	0.33498	0.0865	L	0.46157	1.445	0.50171	D	0.99985	P	0.35745	0.518	B	0.30316	0.114	T	0.13442	-1.0509	10	0.10636	T	0.68	-13.7176	16.0247	0.80536	1.0:0.0:0.0:0.0	.	508	O00219	HAS3_HUMAN	A	508	ENSP00000304440:T508A	ENSP00000304440:T508A	T	+	1	0	HAS3	67706530	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	4.342000	0.59341	2.324000	0.78689	0.533000	0.62120	ACA	HAS3	-	NULL	ENSG00000103044		0.557	HAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS3	HGNC	protein_coding	OTTHUMT00000268898.2		0.00	54	0	A	NM_138612		69149029	+1			no_errors	ENST00000306560	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	G
HAX1	10456	genome.wustl.edu	37	1	154245866	154245866	+	Silent	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:154245866A>G	ENST00000328703.7	+	2	321	c.108A>G	c.(106-108)gaA>gaG	p.E36E	HAX1_ENST00000532105.1_Intron|HAX1_ENST00000483970.2_Silent_p.E36E|HAX1_ENST00000457918.2_Intron	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	36	Asp/Glu-rich (highly acidic).|Required for localization in mitochondria. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)			cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATGATGAGGAAGAAGAAGAAG	0.517									Kostmann syndrome																																								0													58.0	58.0	58.0					1																	154245866		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.108A>G	1.37:g.154245866A>G			A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Silent	SNP	pirsf_HS1--assoc_X-1	p.E36	ENST00000328703.7	37	c.108	CCDS1064.1	1																																																																																			HAX1	-	pirsf_HS1--assoc_X-1	ENSG00000143575		0.517	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAX1	HGNC	protein_coding	OTTHUMT00000087650.1		0.00	28	0	A	NM_006118		154245866	+1			no_errors	ENST00000483970	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.715	G
HECTD4	283450	genome.wustl.edu	37	12	112747374	112747374	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:112747374C>T	ENST00000430131.2	-	0	979				HECTD4_ENST00000377560.5_Missense_Mutation_p.G195D|HECTD4_ENST00000550722.1_Missense_Mutation_p.G195D			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4						glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CCTGAGAGTACCATGTAATCC	0.448																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.-167G>A	12.37:g.112747374C>T			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.G195D	ENST00000430131.2	37	c.584		12	.	.	.	.	.	.	.	.	.	.	C	31	5.081359	0.94050	.	.	ENSG00000173064	ENST00000377560;ENST00000550722	T;T	0.75938	-0.98;0.06	5.68	5.68	0.88126	.	.	.	.	.	T	0.70937	0.3281	N	0.14661	0.345	0.80722	D	1	.	.	.	.	.	.	T	0.75554	-0.3277	7	0.87932	D	0	.	17.9793	0.89136	0.0:1.0:0.0:0.0	.	.	.	.	D	195	ENSP00000366783:G195D;ENSP00000449784:G195D	ENSP00000366783:G195D	G	-	2	0	C12orf51	111231757	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.325000	0.79124	2.687000	0.91594	0.563000	0.77884	GGT	HECTD4	-	NULL	ENSG00000173064		0.448	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	53	0	C	NM_173813		112747374	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62203546	62203546	+	Missense_Mutation	SNP	C	C	T	rs374328737		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr20:62203546C>T	ENST00000467148.1	-	1	262	c.193G>A	c.(193-195)Gca>Aca	p.A65T	HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	65					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.A65T(1)									ACCATCTGTGCGTGCTCCGAG	0.657																																																	1	Substitution - Missense(1)	endometrium(1)						C	THR/ALA	1,4367	2.1+/-5.4	0,1,2183	37.0	31.0	33.0		193	1.0	0.0	20		33	2,8586	2.2+/-6.3	0,2,4292	no	missense	PRIC285	NM_001037335.2	58	0,3,6475	TT,TC,CC		0.0233,0.0229,0.0232	benign	65/2650	62203546	3,12953	2184	4294	6478	SO:0001583	missense	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.193G>A	20.37:g.62203546C>T	ENSP00000417401:p.Ala65Thr		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.A65T	ENST00000467148.1	37	c.193	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	C	3.231	-0.157528	0.06544	2.29E-4	2.33E-4	ENSG00000130589	ENST00000467148	T	0.02472	4.28	4.12	1.03	0.20045	.	0.701012	0.13229	N	0.403818	T	0.01592	0.0051	L	0.33485	1.01	0.09310	N	1	P;B	0.43314	0.803;0.136	B;B	0.29598	0.104;0.016	T	0.44236	-0.9341	10	0.11485	T	0.65	-14.6011	5.3932	0.16255	0.1433:0.618:0.0:0.2387	.	65;65	Q4VXQ0;Q9BYK8	.;PR285_HUMAN	T	65	ENSP00000417401:A65T	ENSP00000417401:A65T	A	-	1	0	RP4-697K14.7	61673990	0.000000	0.05858	0.042000	0.18584	0.004000	0.04260	-0.613000	0.05610	0.733000	0.32492	-0.150000	0.13652	GCA	HELZ2	-	NULL	ENSG00000130589		0.657	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	-	0.00	135	0	C	NM_001037335		62203546	-1	tier1	-	no_errors	ENST00000467148	ensembl	human	known	74_37	missense	33.33	68	34	SNP	0.000	T
HERC6	55008	genome.wustl.edu	37	4	89304465	89304465	+	Missense_Mutation	SNP	G	G	T	rs375413927		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:89304465G>T	ENST00000264346.7	+	2	351	c.292G>T	c.(292-294)Gca>Tca	p.A98S	HERC6_ENST00000380265.5_Missense_Mutation_p.A98S|HERC6_ENST00000273960.3_Missense_Mutation_p.A98S	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	98					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		AAGGGTCTTCGCATGGGGAGC	0.483																																																	0													59.0	66.0	64.0					4																	89304465		1920	4137	6057	SO:0001583	missense	0			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.292G>T	4.37:g.89304465G>T	ENSP00000264346:p.Ala98Ser		B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.A98S	ENST00000264346.7	37	c.292	CCDS47098.1	4	.	.	.	.	.	.	.	.	.	.	G	8.184	0.794422	0.16327	.	.	ENSG00000138642	ENST00000380265;ENST00000438983;ENST00000511939;ENST00000273960;ENST00000264346	D;D;D	0.83506	-1.73;-1.73;-1.73	5.01	3.1	0.35709	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.213819	0.31909	N	0.006879	T	0.50820	0.1638	N	0.02266	-0.62	0.27562	N	0.950141	P;P	0.36712	0.51;0.566	B;B	0.31290	0.085;0.127	T	0.57177	-0.7856	10	0.05833	T	0.94	.	6.2183	0.20667	0.0957:0.0:0.6037:0.3007	.	98;98	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	S	98	ENSP00000369617:A98S;ENSP00000273960:A98S;ENSP00000264346:A98S	ENSP00000264346:A98S	A	+	1	0	HERC6	89523488	0.850000	0.29656	0.366000	0.25914	0.988000	0.76386	1.249000	0.32839	1.331000	0.45412	0.485000	0.47835	GCA	HERC6	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	ENSG00000138642		0.483	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2		0.00	63	0	G			89304465	+1			no_errors	ENST00000264346	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.723	T
HINFP	25988	genome.wustl.edu	37	11	119004769	119004769	+	Intron	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:119004769G>T	ENST00000350777.2	+	10	1202				HINFP_ENST00000527410.1_Missense_Mutation_p.A393S	NM_001243259.1|NM_015517.4|NM_198971.2	NP_001230188.1|NP_056332.2|NP_945322.1	Q9BQA5	HINFP_HUMAN	histone H4 transcription factor						DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|establishment of protein localization (GO:0045184)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|myoblast differentiation (GO:0045445)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23						TGGGTTTGCTGCCCTTTATGC	0.517																																																	0													49.0	52.0	51.0					11																	119004769		2200	4295	6495	SO:0001627	intron_variant	0			AL080201	CCDS8414.1, CCDS58188.1	11q23.3	2013-01-08	2009-01-22	2009-01-22	ENSG00000172273	ENSG00000172273		"""Zinc fingers, C2H2-type"""	17850	protein-coding gene	gene with protein product	"""histone nuclear factor P"""	607099	"""MBD2-interacting zinc finger 1"", ""MBD2-interacting zinc finger"""	MIZF		11553631	Standard	NM_015517		Approved	DKFZP434F162, HiNF-P, ZNF743	uc001pvq.3	Q9BQA5	OTTHUMG00000166168	ENST00000350777.2:c.1140-25G>T	11.37:g.119004769G>T			B3KPH6|B4DWB4|E9PQF4|Q96E65|Q9Y4M7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A393S	ENST00000350777.2	37	c.1177	CCDS8414.1	11	.	.	.	.	.	.	.	.	.	.	G	11.17	1.561144	0.27915	.	.	ENSG00000172273	ENST00000527410	T	0.09163	3.01	4.29	-1.67	0.08238	.	.	.	.	.	T	0.03305	0.0096	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.44922	-0.9296	6	0.08179	T	0.78	.	3.412	0.07361	0.1551:0.2397:0.4829:0.1223	.	.	.	.	S	393	ENSP00000436815:A393S	ENSP00000436815:A393S	A	+	1	0	HINFP	118509979	0.061000	0.20836	0.002000	0.10522	0.517000	0.34286	0.167000	0.16602	-0.074000	0.12820	-0.176000	0.13171	GCC	HINFP	-	NULL	ENSG00000172273		0.517	HINFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HINFP	HGNC	protein_coding	OTTHUMT00000388201.2	-	0.00	76	0	G	NM_015517		119004769	+1	tier1	-	no_errors	ENST00000527410	ensembl	human	putative	74_37	missense	6.15	61	4	SNP	0.002	T
HIVEP2	3097	genome.wustl.edu	37	6	143095361	143095361	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:143095361T>A	ENST00000367604.1	-	4	1154	c.515A>T	c.(514-516)cAg>cTg	p.Q172L	HIVEP2_ENST00000012134.2_Missense_Mutation_p.Q172L|HIVEP2_ENST00000367603.2_Missense_Mutation_p.Q172L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	172					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.Q172R(1)		NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CTCTTCTGCCTGTTCAATACT	0.438																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												1	Substitution - Missense(1)	large_intestine(1)											138.0	132.0	134.0					6																	143095361		1867	4110	5977	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.515A>T	6.37:g.143095361T>A	ENSP00000356576:p.Gln172Leu		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q172L	ENST00000367604.1	37	c.515	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	T	13.87	2.367242	0.41902	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02656	4.21;4.21;4.21	5.79	3.29	0.37713	.	0.117281	0.64402	N	0.000013	T	0.01320	0.0043	L	0.56769	1.78	0.33838	D	0.631133	B	0.02656	0.0	B	0.04013	0.001	T	0.41016	-0.9532	10	0.41790	T	0.15	-9.1507	7.9716	0.30130	0.1285:0.0:0.2685:0.6031	.	172	P31629	ZEP2_HUMAN	L	172	ENSP00000356576:Q172L;ENSP00000356575:Q172L;ENSP00000012134:Q172L	ENSP00000012134:Q172L	Q	-	2	0	HIVEP2	143137054	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	3.191000	0.50981	0.404000	0.25506	0.533000	0.62120	CAG	HIVEP2	-	NULL	ENSG00000010818		0.438	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1		0.00	29	0	T			143095361	-1			no_errors	ENST00000012134	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.996	A
HMBOX1	79618	genome.wustl.edu	37	8	28876382	28876382	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:28876382G>T	ENST00000397358.3	+	7	1507	c.803G>T	c.(802-804)cGa>cTa	p.R268L	HMBOX1_ENST00000444075.1_Missense_Mutation_p.R268L|HMBOX1_ENST00000355231.5_Missense_Mutation_p.R268L|HMBOX1_ENST00000558662.1_Missense_Mutation_p.R268L|HMBOX1_ENST00000524238.1_Missense_Mutation_p.R268L|HMBOX1_ENST00000519047.1_Missense_Mutation_p.R268L|HMBOX1_ENST00000523613.1_Missense_Mutation_p.R268L|HMBOX1_ENST00000403668.2_Missense_Mutation_p.R268L|HMBOX1_ENST00000287701.10_Missense_Mutation_p.R268L	NM_024567.3	NP_078843.2	Q6NT76	HMBX1_HUMAN	homeobox containing 1	268					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R268Q(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	11		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CGACTGCGACGAGGGAGTCGA	0.498																																																	1	Substitution - Missense(1)	large_intestine(1)											134.0	118.0	124.0					8																	28876382		2203	4300	6503	SO:0001583	missense	0			AY522342	CCDS6071.1	8p12	2013-05-23			ENSG00000147421	ENSG00000147421		"""Homeoboxes / HNF class"""	26137	protein-coding gene	gene with protein product	"""homeobox telomere-binding protein 1"""					16825764	Standard	NM_024567		Approved	HNF1LA, PBHNF, FLJ21616, HOT1	uc003xhd.4	Q6NT76	OTTHUMG00000172138	ENST00000397358.3:c.803G>T	8.37:g.28876382G>T	ENSP00000380516:p.Arg268Leu		A4K385|A8K3R8|B4DHY5|D3DSU0|Q3Y6P1|Q96GS5|Q9H701	Missense_Mutation	SNP	pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R268L	ENST00000397358.3	37	c.803	CCDS6071.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.618184	0.96649	.	.	ENSG00000147421	ENST00000287701;ENST00000444075;ENST00000403668;ENST00000519047;ENST00000397358;ENST00000524238;ENST00000517340;ENST00000355231	D;D;D;D;D;D	0.99888	-4.14;-4.14;-7.54;-4.14;-4.14;-4.14	5.79	5.79	0.91817	Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99924	0.9965	H	0.95365	3.66	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.994;1.0	D;D;D;D;D;D	0.91635	0.999;0.997;0.999;0.998;0.982;0.999	D	0.96365	0.9269	10	0.87932	D	0	-6.5205	20.024	0.97514	0.0:0.0:1.0:0.0	.	268;268;268;268;268;268	Q6NT76-5;D3DSU2;Q6NT76-2;Q6NT76-3;Q6NT76;E5RGZ2	.;.;.;.;HMBX1_HUMAN;.	L	268	ENSP00000287701:R268L;ENSP00000401769:R268L;ENSP00000384261:R268L;ENSP00000430059:R268L;ENSP00000380516:R268L;ENSP00000430110:R268L	ENSP00000287701:R268L	R	+	2	0	HMBOX1	28932301	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.476000	0.97823	2.718000	0.92993	0.655000	0.94253	CGA	HMBOX1	-	superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000147421		0.498	HMBOX1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HMBOX1	HGNC	protein_coding	OTTHUMT00000255267.4		0.00	57	0	G	NM_024567		28876382	+1			no_errors	ENST00000444075	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
HOXC11	3227	genome.wustl.edu	37	12	54367154	54367154	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:54367154G>T	ENST00000546378.1	+	1	245	c.129G>T	c.(127-129)gaG>gaT	p.E43D	HOTAIR_ENST00000424518.1_RNA|HOTAIR_ENST00000455246.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.E43D			O43248	HXC11_HUMAN	homeobox C11	43					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						ACATGCCCGAGTTCTCCACGG	0.647			T	NUP98	AML																																			Dom	yes		12	12q13.3	3227	homeo box C11		L	0													115.0	120.0	119.0					12																	54367154		2203	4300	6503	SO:0001583	missense	0				CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.129G>T	12.37:g.54367154G>T	ENSP00000446680:p.Glu43Asp		A8K7D1|Q96DH2	Missense_Mutation	SNP	pfam_DUF3528,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.E43D	ENST00000546378.1	37	c.129	CCDS8867.1	12	.	.	.	.	.	.	.	.	.	.	G	5.675	0.309160	0.10733	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	T;T	0.35605	1.3;1.3	4.47	4.47	0.54385	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.052375	0.85682	D	0.000000	T	0.13415	0.0325	N	0.02266	-0.62	0.42084	D	0.991263	B	0.13594	0.008	B	0.19666	0.026	T	0.15636	-1.0430	10	0.07482	T	0.82	.	10.1024	0.42513	0.0943:0.0:0.9057:0.0	.	43	O43248	HXC11_HUMAN	D	43	ENSP00000446680:E43D;ENSP00000243082:E43D	ENSP00000243082:E43D	E	+	3	2	HOXC11	52653421	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.729000	0.38115	2.471000	0.83476	0.561000	0.74099	GAG	HOXC11	-	pfam_DUF3528	ENSG00000123388		0.647	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC11	HGNC	protein_coding	OTTHUMT00000358869.2	-	0.00	33	0	G			54367154	+1	tier1	-	no_errors	ENST00000546378	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
HPS1	3257	genome.wustl.edu	37	10	100190889	100190889	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:100190889T>C	ENST00000325103.6	-	7	900	c.667A>G	c.(667-669)Agc>Ggc	p.S223G	HPS1_ENST00000467246.1_5'UTR|HPS1_ENST00000361490.4_Splice_Site_p.S223G|HPS1_ENST00000338546.5_Splice_Site_p.S223G|MIR4685_ENST00000578185.1_RNA	NM_000195.3	NP_000186.2	Q92902	HPS1_HUMAN	Hermansky-Pudlak syndrome 1	223					blood coagulation (GO:0007596)|eye pigmentation (GO:0048069)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of natural killer cell activation (GO:0032816)|retina development in camera-type eye (GO:0060041)|secretion of lysosomal enzymes (GO:0033299)|visual perception (GO:0007601)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.234)		Epithelial(162;3.87e-12)|all cancers(201;5.63e-10)		TGAGCTCACCTAGAGTAGAAT	0.612									Hermansky-Pudlak syndrome																																								0													57.0	51.0	53.0					10																	100190889		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	HPS, HPS1-8	U79136	CCDS7475.1, CCDS7476.1	10q23.1-q23.3	2014-06-18		2002-05-01	ENSG00000107521	ENSG00000107521			5163	protein-coding gene	gene with protein product		604982	"""Hermansky-Pudlak syndrome"""	HPS		8541858, 7573033	Standard	NM_182639		Approved		uc021pwv.1	Q92902	OTTHUMG00000018876	ENST00000325103.6:c.668+1A>G	10.37:g.100190889T>C			A8MRT2|O15402|O15502|Q5TAA3|Q8WXE5	Missense_Mutation	SNP	NULL	p.S223G	ENST00000325103.6	37	c.667	CCDS7475.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.58|14.58	2.578804|2.578804	0.46006|0.46006	.|.	.|.	ENSG00000107521|ENSG00000107521	ENST00000325103;ENST00000361490;ENST00000407891;ENST00000359632;ENST00000338546|ENST00000414009	T;T;T;T|.	0.52526|.	1.47;1.47;0.66;1.47|.	5.3|5.3	2.92|2.92	0.33932|0.33932	.|.	0.208502|.	0.64402|.	N|.	0.000019|.	T|.	0.51109|.	0.1655|.	L|L	0.37630|0.37630	1.12|1.12	0.42130|0.42130	D|D	0.991462|0.991462	B;B;B;B|.	0.11235|.	0.002;0.004;0.002;0.004|.	B;B;B;B|.	0.14578|.	0.005;0.004;0.005;0.011|.	T|.	0.40905|.	-0.9538|.	10|.	0.40728|.	T|.	0.16|.	.|.	9.2141|9.2141	0.37337|0.37337	0.0:0.1511:0.0:0.8489|0.0:0.1511:0.0:0.8489	.|.	223;223;223;223|.	Q92902;Q92902-3;Q8WXE5;D3DR62|.	HPS1_HUMAN;.;.;.|.	G|W	223;223;223;51;223|90	ENSP00000326649:S223G;ENSP00000355310:S223G;ENSP00000352652:S51G;ENSP00000343638:S223G|.	ENSP00000326649:S223G|.	S|X	-|-	1|2	0|0	HPS1|HPS1	100180879|100180879	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.900000|0.900000	0.52787|0.52787	4.686000|4.686000	0.61700|0.61700	0.811000|0.811000	0.34303|0.34303	0.459000|0.459000	0.35465|0.35465	AGC|TAG	HPS1	-	NULL	ENSG00000107521		0.612	HPS1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS1	HGNC	protein_coding	OTTHUMT00000049776.1	-	0.00	48	0	T	NM_000195, NM_182637, NM_182638, NM_182639	Missense_Mutation	100190889	-1	tier1	-	no_errors	ENST00000325103	ensembl	human	known	74_37	missense	24.14	44	14	SNP	1.000	C
HSFY1P1	27437	genome.wustl.edu	37	22	17308780	17308780	+	RNA	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:17308780G>T	ENST00000425038.1	+	0	417					NR_003607.1				heat shock transcription factor, Y-linked 1 pseudogene 1																		CTTCAAGAAAGAAAATTTGGA	0.303																																																	0																																												0			AY026053		22q11.2	2010-08-04	2010-08-04	2010-08-04	ENSG00000229027	ENSG00000229027			1846	pseudogene	pseudogene			"""cat eye syndrome chromosome region, candidate 8"", ""cat eye syndrome chromosome region, candidate 8 (non-protein coding)"""	CECR8		11381032	Standard	NR_003607		Approved	HSFYP1, HSFYL1	uc010gqr.1		OTTHUMG00000143727		22.37:g.17308780G>T				RNA	SNP	-	NULL	ENST00000425038.1	37	NULL		22																																																																																			HSFY1P1	-	-	ENSG00000229027		0.303	HSFY1P1-002	KNOWN	basic	processed_transcript	HSFY1P1	HGNC	pseudogene	OTTHUMT00000289790.2	-	0.00	31	0	G	NR_003607		17308780	+1	tier1	-	no_errors	ENST00000425038	ensembl	human	known	74_37	rna	26.47	24	9	SNP	0.004	T
HTRA4	203100	genome.wustl.edu	37	8	38840024	38840024	+	Silent	SNP	G	G	A	rs551752587		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:38840024G>A	ENST00000302495.4	+	7	1222	c.1122G>A	c.(1120-1122)gcG>gcA	p.A374A		NM_153692.3	NP_710159.1	P83105	HTRA4_HUMAN	HtrA serine peptidase 4	374					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.A374A(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	11		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			CAGGAAAGGCGTTTTCAAATA	0.423													G|||	1	0.000199681	0.0	0.0	5008	,	,		21989	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	central_nervous_system(1)											155.0	153.0	154.0					8																	38840024		2203	4300	6503	SO:0001819	synonymous_variant	0			AK075205	CCDS6110.1	8p11.23	2008-02-05			ENSG00000169495	ENSG00000169495			26909	protein-coding gene	gene with protein product		610700					Standard	NM_153692		Approved	FLJ90724	uc003xmj.3	P83105	OTTHUMG00000164070	ENST00000302495.4:c.1122G>A	8.37:g.38840024G>A			Q542Z4|Q6PF13	Silent	SNP	pfam_Peptidase_S1,pfam_PDZ,pfam_Kazal_dom,superfamily_Trypsin-like_Pept_dom,superfamily_PDZ,smart_Kazal_dom,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.A374	ENST00000302495.4	37	c.1122	CCDS6110.1	8																																																																																			HTRA4	-	NULL	ENSG00000169495		0.423	HTRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA4	HGNC	protein_coding	OTTHUMT00000377077.1		0.00	34	0	G	NM_153692		38840024	+1			no_errors	ENST00000302495	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.245	A
IGDCC3	9543	genome.wustl.edu	37	15	65623905	65623905	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:65623905C>A	ENST00000327987.4	-	8	1492	c.1241G>T	c.(1240-1242)aGg>aTg	p.R414M	IGDCC3_ENST00000559231.1_5'UTR	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	414	Ig-like C2-type 4.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TACGGTCAGCCTGGCACTGGC	0.617																																																	0													41.0	40.0	40.0					15																	65623905		2201	4299	6500	SO:0001583	missense	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.1241G>T	15.37:g.65623905C>A	ENSP00000332773:p.Arg414Met		O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R414M	ENST00000327987.4	37	c.1241	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	23.6	4.440938	0.83993	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.67865	-0.29	4.92	4.92	0.64577	Immunoglobulin I-set (1);Fibronectin, type III (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.056875	0.64402	D	0.000001	T	0.78578	0.4305	L	0.51853	1.615	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.81161	-0.1059	10	0.87932	D	0	-16.5646	18.1374	0.89624	0.0:1.0:0.0:0.0	.	414	Q8IVU1	IGDC3_HUMAN	M	414;277	ENSP00000332773:R414M	ENSP00000332773:R414M	R	-	2	0	IGDCC3	63410958	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	7.761000	0.85260	2.241000	0.73720	0.655000	0.94253	AGG	IGDCC3	-	pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000174498		0.617	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	-	0.00	32	0	C	NM_004884		65623905	-1	tier1	-	no_errors	ENST00000327987	ensembl	human	known	74_37	missense	43.33	17	13	SNP	1.000	A
IL18BP	10068	genome.wustl.edu	37	11	71711506	71711506	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:71711506C>G	ENST00000393703.4	+	3	675	c.138C>G	c.(136-138)agC>agG	p.S46R	IL18BP_ENST00000393705.4_Missense_Mutation_p.S46R|IL18BP_ENST00000260049.5_Missense_Mutation_p.S46R|IL18BP_ENST00000531053.1_Missense_Mutation_p.S46R|IL18BP_ENST00000497194.2_Missense_Mutation_p.S46R|IL18BP_ENST00000404792.1_Missense_Mutation_p.S46R|IL18BP_ENST00000337131.5_Missense_Mutation_p.S46R|IL18BP_ENST00000393707.4_Missense_Mutation_p.S46R	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein	46					cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						CAGTTAGAAGCACAAAGGACC	0.602																																																	0													81.0	94.0	89.0					11																	71711506		2112	4231	6343	SO:0001583	missense	0			AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713	ENST00000393703.4:c.138C>G	11.37:g.71711506C>G	ENSP00000377306:p.Ser46Arg		B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Missense_Mutation	SNP	pfscan_Ig-like_dom	p.S46R	ENST00000393703.4	37	c.138	CCDS8206.2	11	.	.	.	.	.	.	.	.	.	.	C	11.93	1.786534	0.31593	.	.	ENSG00000137496	ENST00000393703;ENST00000497194;ENST00000393705;ENST00000337131;ENST00000531053;ENST00000404792;ENST00000260049;ENST00000393707	T;T;T;T;T;T;T	0.35048	1.36;1.33;1.36;1.36;1.33;1.36;1.36	3.52	1.62	0.23740	.	0.804240	0.10816	N	0.631009	T	0.28333	0.0700	L	0.36672	1.1	0.09310	N	1	P;P;P	0.49253	0.921;0.531;0.531	B;B;B	0.43701	0.428;0.259;0.259	T	0.14727	-1.0462	10	0.66056	D	0.02	-1.2847	4.8557	0.13557	0.0:0.6578:0.2209:0.1213	.	46;46;46	O95998-3;G3V1C5;O95998	.;.;I18BP_HUMAN	R	46	ENSP00000377306:S46R;ENSP00000434717:S46R;ENSP00000377308:S46R;ENSP00000338723:S46R;ENSP00000434835:S46R;ENSP00000384212:S46R;ENSP00000260049:S46R	ENSP00000260049:S46R	S	+	3	2	IL18BP	71389154	0.000000	0.05858	0.000000	0.03702	0.245000	0.25701	0.000000	0.12993	0.484000	0.27630	0.555000	0.69702	AGC	IL18BP	-	NULL	ENSG00000137496		0.602	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL18BP	HGNC	protein_coding	OTTHUMT00000258012.2		0.00	47	0	C	NM_173042		71711506	+1			no_errors	ENST00000260049	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.000	G
INPP5A	3632	genome.wustl.edu	37	10	134591286	134591286	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:134591286G>T	ENST00000368594.3	+	13	1366	c.1089G>T	c.(1087-1089)cgG>cgT	p.R363R	INPP5A_ENST00000368593.3_Silent_p.R363R	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	363					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)			cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		TGGTGCTGCGGGTGAGTGTGT	0.692																																					Pancreas(63;823 1267 11107 20380 51626)												0													74.0	56.0	62.0					10																	134591286		2198	4296	6494	SO:0001630	splice_region_variant	0			X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.1089+1G>T	10.37:g.134591286G>T			D3DXI3|Q14640|Q5JSF1	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.R363	ENST00000368594.3	37	c.1089	CCDS7669.2	10																																																																																			INPP5A	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000068383		0.692	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5A	HGNC	protein_coding	OTTHUMT00000051085.1		0.00	77	0	G	NM_005539	Silent	134591286	+1			no_errors	ENST00000368594	ensembl	human	known	74_37	silent	6.35	59	4	SNP	1.000	T
ITGA1	3672	genome.wustl.edu	37	5	52145257	52145257	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:52145257C>T	ENST00000282588.6	+	2	578	c.120C>T	c.(118-120)agC>agT	p.S40S		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	40					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TGACTTTCAGCGGCCCGGTGG	0.348																																																	0													132.0	132.0	132.0					5																	52145257		2203	4300	6503	SO:0001819	synonymous_variant	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.120C>T	5.37:g.52145257C>T			B2RNU0	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S40	ENST00000282588.6	37	c.120	CCDS3955.1	5																																																																																			ITGA1	-	NULL	ENSG00000213949		0.348	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	HGNC	protein_coding	OTTHUMT00000253855.3	-	0.00	50	0	C	NM_181501		52145257	+1	tier1	-	no_errors	ENST00000282588	ensembl	human	known	74_37	silent	15.56	38	7	SNP	0.151	T
ITGA3	3675	genome.wustl.edu	37	17	48145589	48145589	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:48145589G>A	ENST00000320031.8	+	4	914	c.584G>A	c.(583-585)gGc>gAc	p.G195D	ITGA3_ENST00000544892.1_Intron|ITGA3_ENST00000007722.7_Missense_Mutation_p.G195D	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	195					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						CTGGAGACGGGCATGTGCCAG	0.592																																																	0													119.0	102.0	108.0					17																	48145589		2203	4300	6503	SO:0001583	missense	0			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.584G>A	17.37:g.48145589G>A	ENSP00000315190:p.Gly195Asp		A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G195D	ENST00000320031.8	37	c.584	CCDS11558.1	17	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031777	0.93575	.	.	ENSG00000005884	ENST00000007722;ENST00000538917;ENST00000320031	D;D	0.92545	-3.06;-3.06	5.36	5.36	0.76844	.	0.049143	0.85682	D	0.000000	D	0.96611	0.8894	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.70016	0.967;0.965	D	0.97270	0.9910	10	0.87932	D	0	.	17.8421	0.88718	0.0:0.0:1.0:0.0	.	195;195	P26006-1;P26006	.;ITA3_HUMAN	D	195;181;195	ENSP00000007722:G195D;ENSP00000315190:G195D	ENSP00000007722:G195D	G	+	2	0	ITGA3	45500588	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.465000	0.97660	2.486000	0.83907	0.650000	0.86243	GGC	ITGA3	-	NULL	ENSG00000005884		0.592	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	HGNC	protein_coding	OTTHUMT00000366298.1		0.00	36	0	G	NM_005501		48145589	+1			no_errors	ENST00000320031	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
KCNN2	3781	genome.wustl.edu	37	5	113831724	113831724	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:113831724A>C	ENST00000512097.3	+	9	2603	c.1585A>C	c.(1585-1587)Agc>Cgc	p.S529R	KCNN2_ENST00000503706.1_Missense_Mutation_p.S181R|KCNN2_ENST00000264773.3_Missense_Mutation_p.S529R|RP11-492A10.1_ENST00000514115.1_RNA			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	529					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	TGGGCTCATAAGCCAGACCAT	0.507																																																	0													127.0	126.0	126.0					5																	113831724		2202	4300	6502	SO:0001583	missense	0			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1585A>C	5.37:g.113831724A>C	ENSP00000427120:p.Ser529Arg		A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.S529R	ENST00000512097.3	37	c.1585	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	A	20.3	3.965948	0.74131	.	.	ENSG00000080709	ENST00000264773;ENST00000503706	D;D	0.98649	-5.05;-3.37	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.97548	0.9197	M	0.76574	2.34	0.80722	D	1	B	0.24483	0.104	B	0.22601	0.04	D	0.97324	0.9946	10	0.28530	T	0.3	.	14.9059	0.70718	1.0:0.0:0.0:0.0	.	529	Q9H2S1	KCNN2_HUMAN	R	529;181	ENSP00000264773:S529R;ENSP00000421439:S181R	ENSP00000264773:S529R	S	+	1	0	KCNN2	113859623	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	5.569000	0.67391	2.009000	0.58944	0.523000	0.50628	AGC	KCNN2	-	NULL	ENSG00000080709		0.507	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	-	0.00	50	0	A	NM_021614		113831724	+1	tier1	-	no_errors	ENST00000264773	ensembl	human	known	74_37	missense	22.95	47	14	SNP	1.000	C
KCTD5	54442	genome.wustl.edu	37	16	2749901	2749901	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:2749901G>A	ENST00000301738.4	+	4	607	c.533G>A	c.(532-534)gGc>gAc	p.G178D	KCTD5_ENST00000564195.1_Silent_p.R147R	NM_018992.3	NP_061865.1	Q9NXV2	KCTD5_HUMAN	potassium channel tetramerization domain containing 5	178				G -> R (in Ref. 1). {ECO:0000305}.	protein homooligomerization (GO:0051260)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						ATGTCCGACGGCTGGAAGTTC	0.612																																					Ovarian(56;981 1456 4301 50892)												0													122.0	87.0	99.0					16																	2749901		2198	4300	6498	SO:0001583	missense	0			AK000047	CCDS10475.1	16p13.3	2013-06-20	2013-06-20		ENSG00000167977	ENSG00000167977			21423	protein-coding gene	gene with protein product		611285	"""potassium channel tetramerisation domain containing 5"""			12477932	Standard	NM_018992		Approved	FLJ20040	uc002crd.3	Q9NXV2	OTTHUMG00000128930	ENST00000301738.4:c.533G>A	16.37:g.2749901G>A	ENSP00000301738:p.Gly178Asp		D3DU96	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.G178D	ENST00000301738.4	37	c.533	CCDS10475.1	16	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494926	0.64186	.	.	ENSG00000167977	ENST00000301738	T	0.57752	0.38	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.74869	0.3773	M	0.88310	2.945	0.80722	D	1	D	0.59767	0.986	D	0.64237	0.923	T	0.79572	-0.1748	10	0.52906	T	0.07	-15.7816	15.8017	0.78456	0.0:0.0:1.0:0.0	.	178	Q9NXV2	KCTD5_HUMAN	D	178	ENSP00000301738:G178D	ENSP00000301738:G178D	G	+	2	0	KCTD5	2689902	1.000000	0.71417	0.996000	0.52242	0.893000	0.52053	9.191000	0.94940	2.318000	0.78349	0.561000	0.74099	GGC	KCTD5	-	NULL	ENSG00000167977		0.612	KCTD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD5	HGNC	protein_coding	OTTHUMT00000250909.2	-	0.00	39	0	G	NM_018992		2749901	+1	tier1	-	no_errors	ENST00000301738	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
KIAA0355	9710	genome.wustl.edu	37	19	34819033	34819033	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:34819033G>A	ENST00000299505.6	+	6	1954	c.1081G>A	c.(1081-1083)Gcc>Acc	p.A361T		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	361										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					TGAGTCGGCCGCCGACAATCT	0.517																																																	0													53.0	56.0	55.0					19																	34819033		2203	4300	6503	SO:0001583	missense	0				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.1081G>A	19.37:g.34819033G>A	ENSP00000299505:p.Ala361Thr		Q2M3W4	Missense_Mutation	SNP	NULL	p.A361T	ENST00000299505.6	37	c.1081	CCDS12436.1	19	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037865	0.75617	.	.	ENSG00000166398	ENST00000299505;ENST00000543188	.	.	.	5.55	4.52	0.55395	.	0.059976	0.64402	D	0.000003	T	0.37046	0.0989	N	0.08118	0	0.47584	D	0.999462	B	0.14438	0.01	B	0.10450	0.005	T	0.25676	-1.0125	9	0.87932	D	0	-11.1873	10.8121	0.46553	0.1447:0.0:0.8553:0.0	.	361	O15063	K0355_HUMAN	T	361;64	.	ENSP00000299505:A361T	A	+	1	0	KIAA0355	39510873	1.000000	0.71417	0.332000	0.25469	0.953000	0.61014	5.224000	0.65288	1.362000	0.46000	0.544000	0.68410	GCC	KIAA0355	-	NULL	ENSG00000166398		0.517	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4		0.00	33	0	G	NM_014686		34819033	+1			no_errors	ENST00000299505	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.781	A
CFAP97	57587	genome.wustl.edu	37	4	186085253	186085253	+	Silent	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:186085253A>G	ENST00000458385.2	-	4	1520	c.1401T>C	c.(1399-1401)aaT>aaC	p.N467N		NM_020827.1	NP_065878.1	Q9P2B7	K1430_HUMAN		467										endometrium(3)|kidney(2)|large_intestine(5)|upper_aerodigestive_tract(1)	11		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;9.44e-26)|Epithelial(43;2.64e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.66e-11)|Colorectal(24;6.03e-05)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000331)|COAD - Colon adenocarcinoma(29;0.000427)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00924)|READ - Rectum adenocarcinoma(43;0.165)		GATAGCCCATATTGCGATGAT	0.383																																																	0													166.0	160.0	162.0					4																	186085253		1907	4129	6036	SO:0001819	synonymous_variant	0																														ENST00000458385.2:c.1401T>C	4.37:g.186085253A>G			B3KRP7|D3DP60|Q05CU1|Q4W5M4|Q8N6E7|Q9UF45	Silent	SNP	NULL	p.N467	ENST00000458385.2	37	c.1401	CCDS47168.1	4																																																																																			KIAA1430	-	NULL	ENSG00000164323		0.383	KIAA1430-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KIAA1430	HGNC	protein_coding	OTTHUMT00000360717.2	-	0.00	38	0	A			186085253	-1	tier1	-	no_errors	ENST00000458385	ensembl	human	novel	74_37	silent	8.00	46	4	SNP	0.367	G
KIAA1598	57698	genome.wustl.edu	37	10	118704457	118704457	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:118704457T>C	ENST00000355371.4	-	8	1186	c.689A>G	c.(688-690)aAa>aGa	p.K230R	KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000392903.2_Missense_Mutation_p.K230R|KIAA1598_ENST00000392901.4_Missense_Mutation_p.K170R|KIAA1598_ENST00000260777.10_Missense_Mutation_p.K230R	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	230					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		TGACTCTGCTTTCTTTCGAAG	0.428																																																	0													176.0	165.0	169.0					10																	118704457		2203	4300	6503	SO:0001583	missense	0			BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.689A>G	10.37:g.118704457T>C	ENSP00000347532:p.Lys230Arg		A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Missense_Mutation	SNP	superfamily_Adenylate_cyclase-assoc_CAP_N	p.K230R	ENST00000355371.4	37	c.689	CCDS44482.1	10	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059249	0.36373	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	T;T;T;T	0.25085	2.76;2.76;2.76;1.82	5.9	4.77	0.60923	.	0.193586	0.56097	N	0.000039	T	0.21921	0.0528	L	0.47716	1.5	0.32736	N	0.50837	B;B;B	0.21606	0.037;0.008;0.058	B;B;B	0.20184	0.024;0.009;0.028	T	0.18335	-1.0340	10	0.38643	T	0.18	-22.9443	8.4212	0.32700	0.0:0.1494:0.0:0.8506	.	230;230;200	A0MZ66;A0MZ66-2;A0MZ66-6	SHOT1_HUMAN;.;.	R	230;230;230;170	ENSP00000376636:K230R;ENSP00000260777:K230R;ENSP00000347532:K230R;ENSP00000376635:K170R	ENSP00000260777:K230R	K	-	2	0	KIAA1598	118694447	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.065000	0.57513	1.067000	0.40740	0.528000	0.53228	AAA	KIAA1598	-	NULL	ENSG00000187164		0.428	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1598	HGNC	protein_coding		-	0.00	39	0	T	NM_018330		118704457	-1	tier1	-	no_errors	ENST00000392903	ensembl	human	known	74_37	missense	20.00	44	11	SNP	1.000	C
KIF13A	63971	genome.wustl.edu	37	6	17799582	17799582	+	Missense_Mutation	SNP	G	G	A	rs532977529	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:17799582G>A	ENST00000259711.6	-	22	2810	c.2705C>T	c.(2704-2706)aCg>aTg	p.T902M	KIF13A_ENST00000378814.5_Missense_Mutation_p.T902M|KIF13A_ENST00000378816.5_Missense_Mutation_p.T902M|KIF13A_ENST00000378826.2_Missense_Mutation_p.T902M|KIF13A_ENST00000378843.2_Missense_Mutation_p.T902M	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	902					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			GGCAGCCACCGTAGACTCACA	0.493													G|||	2	0.000399361	0.0	0.0	5008	,	,		16458	0.002		0.0	False		,,,				2504	0.0																0													53.0	53.0	53.0					6																	17799582		1892	4106	5998	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.2705C>T	6.37:g.17799582G>A	ENSP00000259711:p.Thr902Met		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T902M	ENST00000259711.6	37	c.2705	CCDS47381.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.53|18.53	3.643855|3.643855	0.67244|0.67244	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000358380|ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	.|T;T;T;T;T	.|0.72394	.|-0.65;-0.65;-0.65;-0.65;-0.65	5.65|5.65	4.78|4.78	0.61160|0.61160	.|.	.|0.096756	.|0.64402	.|D	.|0.000001	T|T	0.73305|0.73305	0.3570|0.3570	L|L	0.48642|0.48642	1.525|1.525	0.44492|0.44492	D|D	0.997435|0.997435	.|P;D;P;D	.|0.89917	.|0.538;1.0;0.607;1.0	.|B;D;B;D	.|0.71414	.|0.144;0.961;0.107;0.973	T|T	0.77938|0.77938	-0.2400|-0.2400	5|10	.|0.72032	.|D	.|0.01	.|.	14.7723|14.7723	0.69688|0.69688	0.0697:0.0:0.9303:0.0|0.0697:0.0:0.9303:0.0	.|.	.|902;902;902;902	.|Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.|.;.;KI13A_HUMAN;.	W|M	296|902	.|ENSP00000368091:T902M;ENSP00000259711:T902M;ENSP00000368103:T902M;ENSP00000368120:T902M;ENSP00000368093:T902M	.|ENSP00000259711:T902M	R|T	-|-	1|2	2|0	KIF13A|KIF13A	17907561|17907561	1.000000|1.000000	0.71417|0.71417	0.479000|0.479000	0.27329|0.27329	0.756000|0.756000	0.42949|0.42949	4.791000|4.791000	0.62460|0.62460	1.386000|1.386000	0.46466|0.46466	0.563000|0.563000	0.77884|0.77884	CGG|ACG	KIF13A	-	NULL	ENSG00000137177		0.493	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	-	0.00	47	0	G			17799582	-1	tier1	-	no_errors	ENST00000259711	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.987	A
KIT	3815	genome.wustl.edu	37	4	55561936	55561936	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:55561936T>A	ENST00000288135.5	+	2	423	c.326T>A	c.(325-327)gTg>gAg	p.V109E		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	109	Ig-like C2-type 1.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCCATTTATGTGTTTGTTAGA	0.413		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													56.0	56.0	56.0					4																	55561936		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.326T>A	4.37:g.55561936T>A	ENSP00000288135:p.Val109Glu		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V109E	ENST00000288135.5	37	c.326	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	T	18.53	3.643387	0.67244	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	T;T	0.20598	2.06;2.06	5.2	5.2	0.72013	Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000048	T	0.48768	0.1518	M	0.82323	2.585	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	T	0.54689	-0.8256	10	0.87932	D	0	.	12.9423	0.58352	0.0:0.0:0.0:1.0	.	109;109	P10721-2;P10721	.;KIT_HUMAN	E	109	ENSP00000288135:V109E;ENSP00000390987:V109E	ENSP00000288135:V109E	V	+	2	0	KIT	55256693	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	4.494000	0.60347	2.189000	0.69895	0.533000	0.62120	GTG	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,smart_Ig_sub	ENSG00000157404		0.413	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	57	0	T			55561936	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
KIT	3815	genome.wustl.edu	37	4	55604601	55604601	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:55604601T>C	ENST00000288135.5	+	21	2906	c.2809T>C	c.(2809-2811)Tcc>Ccc	p.S937P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	937	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCAGATTTACTCCAACTTAGC	0.488		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													174.0	165.0	168.0					4																	55604601		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2809T>C	4.37:g.55604601T>C	ENSP00000288135:p.Ser937Pro		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S937P	ENST00000288135.5	37	c.2809	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	T	17.19	3.327693	0.60743	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	T;T	0.78246	-1.16;-1.16	5.62	5.62	0.85841	Protein kinase, catalytic domain (1);	0.225831	0.31519	N	0.007519	T	0.74627	0.3741	N	0.24115	0.695	0.30797	N	0.740311	D;D	0.58620	0.982;0.983	P;P	0.55871	0.786;0.649	T	0.74405	-0.3676	10	0.36615	T	0.2	.	11.0191	0.47707	0.0:0.0:0.1553:0.8447	.	933;937	P10721-2;P10721	.;KIT_HUMAN	P	937;933	ENSP00000288135:S937P;ENSP00000390987:S933P	ENSP00000288135:S937P	S	+	1	0	KIT	55299358	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	3.659000	0.54489	2.140000	0.66376	0.459000	0.35465	TCC	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_dom	ENSG00000157404		0.488	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	45	0	T			55604601	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	9.68	56	6	SNP	1.000	C
KLK15	55554	genome.wustl.edu	37	19	51330175	51330175	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:51330175G>A	ENST00000598239.1	-	3	470	c.440C>T	c.(439-441)tCc>tTc	p.S147F	KLK15_ENST00000596931.1_Missense_Mutation_p.S146F|KLK15_ENST00000416184.1_Intron|KLK15_ENST00000301421.2_Missense_Mutation_p.S147F|KLK15_ENST00000326856.4_Missense_Mutation_p.S146F	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	147	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.			SHNEPGTAGSPRSQ -> PLSSP (in Ref. 2). {ECO:0000305}.		extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CTCGTTGTGGGACACCAGGCC	0.692																																					Pancreas(140;10 2513 7143 9246)												0													27.0	29.0	28.0					19																	51330175		2203	4300	6503	SO:0001583	missense	0			AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.440C>T	19.37:g.51330175G>A	ENSP00000469315:p.Ser147Phe		A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.S147F	ENST00000598239.1	37	c.440	CCDS12805.1	19	.	.	.	.	.	.	.	.	.	.	g	15.43	2.831012	0.50845	.	.	ENSG00000174562	ENST00000326856;ENST00000301421;ENST00000544946	D	0.88741	-2.42	4.5	3.46	0.39613	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.511690	0.16561	N	0.209046	D	0.87006	0.6070	L	0.43757	1.38	0.21290	N	0.99974	P;P;P	0.50443	0.935;0.539;0.458	P;P;P	0.51615	0.629;0.675;0.575	T	0.76586	-0.2905	10	0.25751	T	0.34	.	8.5953	0.33712	0.1061:0.0:0.8939:0.0	.	147;146;147	Q6UBM2;Q6ISI0;Q9H2R5	.;.;KLK15_HUMAN	F	147	ENSP00000301421:S147F	ENSP00000301421:S147F	S	-	2	0	KLK15	56021987	0.023000	0.18921	0.501000	0.27601	0.433000	0.31745	2.251000	0.43187	1.263000	0.44181	0.555000	0.69702	TCC	KLK15	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000174562		0.692	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK15	HGNC	protein_coding	OTTHUMT00000465160.1	-	0.00	37	0	G	NM_017509		51330175	-1	tier1	-	no_errors	ENST00000598239	ensembl	human	known	74_37	missense	32.50	27	13	SNP	0.389	A
KPNA1	3836	genome.wustl.edu	37	3	122144782	122144782	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:122144782C>T	ENST00000344337.6	-	0	2843				RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|KPNA1_ENST00000466923.1_5'Flank|RP11-299J3.8_ENST00000609469.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA	NM_002264.3	NP_002255.3	P52294	IMA5_HUMAN	karyopherin alpha 1 (importin alpha 5)						apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|regulation of DNA recombination (GO:0000018)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	21				GBM - Glioblastoma multiforme(114;0.0898)		AAGTTACTTTCAAAAGTATGT	0.388																																					Melanoma(12;340 801 11196 19797)												0																																										SO:0001624	3_prime_UTR_variant	0			S75295	CCDS3013.1	3q21	2013-02-14			ENSG00000114030	ENSG00000114030		"""Importins"", ""Armadillo repeat containing"""	6394	protein-coding gene	gene with protein product		600686				8052633	Standard	NM_002264		Approved	SRP1, RCH2, NPI-1, IPOA5	uc003efe.2	P52294	OTTHUMG00000159487	ENST00000344337.6:c.*1050G>A	3.37:g.122144782C>T			D3DN93|Q6IBQ9|Q9BQ56	RNA	SNP	-	NULL	ENST00000344337.6	37	NULL	CCDS3013.1	3																																																																																			KPNA1	-	-	ENSG00000114030		0.388	KPNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA1	HGNC	protein_coding	OTTHUMT00000355740.1	-	0.00	33	0	C	NM_002264		122144782	-1	tier1	-	no_errors	ENST00000470904	ensembl	human	known	74_37	rna	36.59	26	15	SNP	0.054	T
KRT20	54474	genome.wustl.edu	37	17	39036471	39036471	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:39036471C>T	ENST00000167588.3	-	4	714	c.673G>A	c.(673-675)Gtg>Atg	p.V225M		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	225	Linker 12.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				TCAACCTCCACATTGACAGTG	0.458																																																	0													142.0	123.0	130.0					17																	39036471		2203	4300	6503	SO:0001583	missense	0			BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.673G>A	17.37:g.39036471C>T	ENSP00000167588:p.Val225Met		B2R6W7	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.V225M	ENST00000167588.3	37	c.673	CCDS11379.1	17	.	.	.	.	.	.	.	.	.	.	C	19.71	3.878136	0.72294	.	.	ENSG00000171431	ENST00000167588	D	0.92299	-3.01	5.29	5.29	0.74685	Filament (1);	0.000000	0.53938	D	0.000046	D	0.96097	0.8728	M	0.79123	2.44	0.53688	D	0.999974	D	0.89917	1.0	D	0.81914	0.995	D	0.96481	0.9356	10	0.87932	D	0	.	18.9237	0.92536	0.0:1.0:0.0:0.0	.	225	P35900	K1C20_HUMAN	M	225	ENSP00000167588:V225M	ENSP00000167588:V225M	V	-	1	0	KRT20	36289997	1.000000	0.71417	0.510000	0.27712	0.392000	0.30506	7.331000	0.79192	2.469000	0.83416	0.491000	0.48974	GTG	KRT20	-	pfam_IF,prints_Keratin_I	ENSG00000171431		0.458	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT20	HGNC	protein_coding	OTTHUMT00000257202.2	-	0.00	37	0	C			39036471	-1	tier1	-	no_errors	ENST00000167588	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
KRTAP2-4	85294	genome.wustl.edu	37	17	39221946	39221946	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:39221946G>A	ENST00000394015.2	-	1	185	c.152C>T	c.(151-153)aCg>aTg	p.T51M		NM_033184.3	NP_149440.1	Q9BYR9	KRA24_HUMAN	keratin associated protein 2-4	51	10 X 5 AA repeats of C-C-[CDPQRW]- [ADPRS]-[CIPSTV].					keratin filament (GO:0045095)				skin(1)	1		Breast(137;0.000496)|Myeloproliferative disorder(1115;0.204)	STAD - Stomach adenocarcinoma(17;0.000371)			GATGGGGCGCGTGCAGCGGGG	0.756																																																	0													1.0	1.0	1.0					17																	39221946		578	1494	2072	SO:0001583	missense	0			AJ406930		17q21.2	2012-04-19			ENSG00000213417	ENSG00000213417		"""Keratin associated proteins"""	18891	protein-coding gene	gene with protein product						11279113	Standard	NM_033184		Approved	KAP2.4	uc002hvy.3	Q9BYR9	OTTHUMG00000133594	ENST00000394015.2:c.152C>T	17.37:g.39221946G>A	ENSP00000377583:p.Thr51Met		Q495J2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.T51M	ENST00000394015.2	37	c.152	CCDS32648.1	17	.	.	.	.	.	.	.	.	.	.	.	22.1	4.243762	0.79912	.	.	ENSG00000213417	ENST00000394015	T	0.32515	1.45	5.54	4.55	0.56014	.	2.283200	0.02472	U	0.087596	T	0.46249	0.1383	L	0.56769	1.78	0.31474	N	0.667983	.	.	.	.	.	.	T	0.40794	-0.9544	8	0.87932	D	0	.	10.9531	0.47341	0.0:0.2429:0.7571:0.0	.	.	.	.	M	51	ENSP00000377583:T51M	ENSP00000377583:T51M	T	-	2	0	KRTAP2-4	36475472	0.885000	0.30320	0.999000	0.59377	0.998000	0.95712	1.175000	0.31944	2.620000	0.88729	0.650000	0.86243	ACG	KRTAP2-4	-	pfam_Keratin-assoc	ENSG00000213417		0.756	KRTAP2-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP2-4	HGNC	protein_coding	OTTHUMT00000257698.1	-	0.00	25	0	G	NM_033184		39221946	-1	tier1	-	no_errors	ENST00000394015	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	A
LACTB2	51110	genome.wustl.edu	37	8	71574044	71574044	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:71574044G>T	ENST00000276590.4	-	2	247	c.211C>A	c.(211-213)Cag>Aag	p.Q71K	RP11-382J12.1_ENST00000499227.2_3'UTR|LACTB2_ENST00000522447.1_Missense_Mutation_p.Q71K	NM_016027.2	NP_057111.1	Q53H82	LACB2_HUMAN	lactamase, beta 2	71						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|prostate(1)	10	Breast(64;0.0716)		Epithelial(68;0.00319)|all cancers(69;0.0175)|OV - Ovarian serous cystadenocarcinoma(28;0.0628)|BRCA - Breast invasive adenocarcinoma(89;0.166)			ACAATTTCCTGGATTGCTGTG	0.378																																																	0													214.0	192.0	199.0					8																	71574044		2203	4300	6503	SO:0001583	missense	0			AF151841	CCDS6208.1	8q13.3	2005-10-14			ENSG00000147592	ENSG00000147592			18512	protein-coding gene	gene with protein product							Standard	NM_016027		Approved	CGI-83	uc003xyp.3	Q53H82	OTTHUMG00000164430	ENST00000276590.4:c.211C>A	8.37:g.71574044G>T	ENSP00000276590:p.Gln71Lys		A8K2D6|Q9Y392	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.Q71K	ENST00000276590.4	37	c.211	CCDS6208.1	8	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647768	0.67358	.	.	ENSG00000147592	ENST00000522447;ENST00000276590	T;T	0.77229	-1.08;-1.08	5.77	5.77	0.91146	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	T	0.81049	0.4742	L	0.29908	0.895	0.80722	D	1	D	0.63880	0.993	D	0.63381	0.914	T	0.76113	-0.3078	10	0.21014	T	0.42	-11.6196	19.9983	0.97395	0.0:0.0:1.0:0.0	.	71	Q53H82	LACB2_HUMAN	K	71	ENSP00000428801:Q71K;ENSP00000276590:Q71K	ENSP00000276590:Q71K	Q	-	1	0	LACTB2	71736598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.514000	0.81750	2.724000	0.93272	0.561000	0.74099	CAG	LACTB2	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000147592		0.378	LACTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LACTB2	HGNC	protein_coding	OTTHUMT00000378748.1	-	0.00	53	0	G	NM_016027		71574044	-1	tier1	-	no_errors	ENST00000276590	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
LEF1	51176	genome.wustl.edu	37	4	109088687	109088687	+	Intron	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:109088687G>T	ENST00000265165.1	-	1	868				LEF1_ENST00000379951.2_Intron|LEF1_ENST00000510624.1_5'Flank|LEF1-AS1_ENST00000436413.1_RNA|LEF1_ENST00000438313.2_Intron|LEF1_ENST00000512172.1_5'Flank	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1						alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		ACGCCTCTCGGAACTGGGGCA	0.622																																																	0													71.0	69.0	70.0					4																	109088687		2203	4300	6503	SO:0001627	intron_variant	0				CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.213+23C>A	4.37:g.109088687G>T			B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	RNA	SNP	-	NULL	ENST00000265165.1	37	NULL	CCDS3679.1	4																																																																																			LEF1-AS1	-	-	ENSG00000232021		0.622	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEF1-AS1	HGNC	protein_coding	OTTHUMT00000254749.2	-	0.00	28	0	G			109088687	+1	tier1	-	no_errors	ENST00000436413	ensembl	human	known	74_37	rna	45.45	12	10	SNP	0.000	T
LINC00621	100996930	genome.wustl.edu	37	13	23490263	23490263	+	lincRNA	SNP	T	T	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr13:23490263T>G	ENST00000577004.1	-	0	245				RP11-124N19.3_ENST00000575845.1_lincRNA					long intergenic non-protein coding RNA 621																		CAGCAAGAACTTCTGGGCCTA	0.388																																																	0																																												0			AK091626		13q12.12	2012-10-12			ENSG00000262619	ENSG00000262619		"""Long non-coding RNAs"""	44227	non-coding RNA	RNA, long non-coding							Standard			Approved				OTTHUMG00000177835		13.37:g.23490263T>G				RNA	SNP	-	NULL	ENST00000577004.1	37	NULL		13																																																																																			LINC00621	-	-	ENSG00000262619		0.388	LINC00621-001	KNOWN	basic	lincRNA	LINC00621	HGNC	lincRNA	OTTHUMT00000439167.1	-	0.00	46	0	T			23490263	-1	tier1	-	no_errors	ENST00000577004	ensembl	human	known	74_37	rna	21.43	22	6	SNP	1.000	G
LMF2	91289	genome.wustl.edu	37	22	50942261	50942261	+	Silent	SNP	C	C	T	rs199878629	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:50942261C>T	ENST00000474879.2	-	13	1806	c.1791G>A	c.(1789-1791)acG>acA	p.T597T	LMF2_ENST00000505981.1_5'Flank|LMF2_ENST00000380796.3_Silent_p.T484T|LMF2_ENST00000216080.5_Silent_p.T572T	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	597						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GCCTGAGCAGCGTCTCCAGCG	0.647																																																	0										0,4406		0,0,2203	61.0	67.0	65.0		1791	-2.1	0.0	22		65	1,8599		0,1,4299	no	coding-synonymous	LMF2	NM_033200.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		597/708	50942261	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.1791G>A	22.37:g.50942261C>T			A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Silent	SNP	pfam_LMF	p.T597	ENST00000474879.2	37	c.1791	CCDS14093.2	22	.	.	.	.	.	.	.	.	.	.	c	9.107	1.005557	0.19199	0.0	1.16E-4	ENSG00000100258	ENST00000487499	.	.	.	5.51	-2.08	0.07254	.	.	.	.	.	T	0.20170	0.0485	.	.	.	0.23496	N	0.997559	.	.	.	.	.	.	T	0.25363	-1.0134	4	.	.	.	-10.7483	2.5447	0.04734	0.1164:0.285:0.3768:0.2218	.	.	.	.	T	604	.	.	A	-	1	0	LMF2	49289127	0.000000	0.05858	0.010000	0.14722	0.904000	0.53231	-2.186000	0.01251	-0.532000	0.06332	-0.219000	0.12488	GCT	LMF2	-	NULL	ENSG00000100258		0.647	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMF2	HGNC	protein_coding	OTTHUMT00000316833.2	-	0.00	96	0	C	NM_033200		50942261	-1	tier1	rs199878629	no_errors	ENST00000474879	ensembl	human	known	74_37	silent	18.00	82	18	SNP	0.007	T
EML2-AS1	100287177	genome.wustl.edu	37	19	46145701	46145701	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:46145701C>G	ENST00000593161.1	+	3	489	c.242C>G	c.(241-243)gCc>gGc	p.A81G	AC006132.1_ENST00000591087.1_3'UTR|EML2_ENST00000536630.1_Intron|EML2_ENST00000587152.1_Intron	NM_001242348.1	NP_001229277.1																					AAGCGGGGGGCCAGCCACGCC	0.642																																																	0																																										SO:0001583	missense	0																														ENST00000593161.1:c.242C>G	19.37:g.46145701C>G	ENSP00000464956:p.Ala81Gly			Missense_Mutation	SNP	NULL	p.A81G	ENST00000593161.1	37	c.242	CCDS59398.1	19																																																																																			AC006132.1	-	NULL	ENSG00000267757		0.642	AC006132.1-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	LOC100287177	Clone_based_vega_gene	protein_coding	OTTHUMT00000459639.1	-	0.00	52	0	C			46145701	+1	tier1	-	no_errors	ENST00000593161	ensembl	human	putative	74_37	missense	29.17	34	14	SNP	0.001	G
PDCD6IPP2	646278	genome.wustl.edu	37	15	29052119	29052119	+	RNA	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:29052119G>A	ENST00000562423.1	+	0	602																											AGAAGCAACCGATAATGATTT	0.313																																																	0																																												0																															15.37:g.29052119G>A				RNA	SNP	-	NULL	ENST00000562423.1	37	NULL		15																																																																																			RP11-578F21.12	-	-	ENSG00000261377		0.313	RP11-578F21.12-004	PUTATIVE	basic	processed_transcript	LOC101929232	Clone_based_vega_gene	pseudogene	OTTHUMT00000431789.1	-	0.00	87	0	G			29052119	+1	tier1	-	no_errors	ENST00000562423	ensembl	human	putative	74_37	rna	19.23	63	15	SNP	1.000	A
BMS1P17	101101776	genome.wustl.edu	37	14	19685493	19685493	+	lincRNA	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:19685493C>A	ENST00000418499.3	+	0	2604																											CCCGCTTCTTCATCGCACTTG	0.766																																																	0													2.0	3.0	3.0					14																	19685493		459	1199	1658			0																															14.37:g.19685493C>A				RNA	SNP	-	NULL	ENST00000418499.3	37	NULL		14	.	.	.	.	.	.	.	.	.	.	c	1.564	-0.535921	0.04082	.	.	ENSG00000206197	ENST00000383040	.	.	.	.	.	.	.	.	.	.	.	T	0.48390	0.1497	.	.	.	.	.	.	.	.	.	.	.	.	T	0.58719	-0.7587	2	0.87932	D	0	.	.	.	.	.	.	.	.	L	117	.	ENSP00000372510:F117L	F	+	3	2	AL589743.1	18755493	0.068000	0.21057	0.016000	0.15963	0.017000	0.09413	1.103000	0.31062	0.107000	0.17824	0.109000	0.15622	TTC	AL589743.1	-	-	ENSG00000225210		0.766	AL589743.1-003	KNOWN	basic	lincRNA	LOC440157	Clone_based_vega_gene	lincRNA	OTTHUMT00000317887.3	-	0.00	74	0	C			19685493	+1	tier1	-	no_errors	ENST00000418499	ensembl	human	known	74_37	rna	8.22	67	6	SNP	0.017	A
LRP2	4036	genome.wustl.edu	37	2	170177381	170177381	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:170177381C>T	ENST00000263816.3	-	2	378	c.93G>A	c.(91-93)gcG>gcA	p.A31A	LRP2_ENST00000443831.1_Silent_p.A31A	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	31	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.A31A(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGCGAAAATGCGCACTGTCAC	0.388																																																	1	Substitution - coding silent(1)	breast(1)											113.0	96.0	102.0					2																	170177381		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.93G>A	2.37:g.170177381C>T			O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A31	ENST00000263816.3	37	c.93	CCDS2232.1	2																																																																																			LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.388	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	69	0	C	NM_004525		170177381	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.000	T
LRRIQ1	84125	genome.wustl.edu	37	12	85492201	85492201	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:85492201G>T	ENST00000393217.2	+	12	3017	c.2956G>T	c.(2956-2958)Ggt>Tgt	p.G986C		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	986										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TAATACAAAAGGTCTTTGTGA	0.333																																																	0													73.0	73.0	73.0					12																	85492201		2203	4298	6501	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.2956G>T	12.37:g.85492201G>T	ENSP00000376910:p.Gly986Cys		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.G986C	ENST00000393217.2	37	c.2956	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230481	0.79688	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.25579	1.79	4.83	4.83	0.62350	.	0.144445	0.46758	D	0.000278	T	0.52403	0.1732	M	0.71206	2.165	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.57510	-0.7799	10	0.87932	D	0	.	18.2873	0.90118	0.0:0.0:1.0:0.0	.	986;961	Q96JM4;C9JI57	LRIQ1_HUMAN;.	C	986;961;986	ENSP00000376910:G986C	ENSP00000256007:G986C	G	+	1	0	LRRIQ1	84016332	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.700000	0.74619	2.372000	0.80975	0.561000	0.74099	GGT	LRRIQ1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000133640		0.333	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	62	0	G	NM_032165		85492201	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	13.56	51	8	SNP	1.000	T
LTBP4	8425	genome.wustl.edu	37	19	41117292	41117292	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:41117292C>G	ENST00000308370.7	+	16	2246	c.2246C>G	c.(2245-2247)cCc>cGc	p.P749R	LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000243562.9_5'Flank|LTBP4_ENST00000396819.3_Missense_Mutation_p.P682R|LTBP4_ENST00000545697.1_Missense_Mutation_p.P202R|LTBP4_ENST00000204005.9_Missense_Mutation_p.P712R	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	749	Cys-rich.|EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCCGGGGCCCCCTGCCAAGGT	0.667																																																	0													24.0	27.0	26.0					19																	41117292		1900	4096	5996	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.2246C>G	19.37:g.41117292C>G	ENSP00000311905:p.Pro749Arg		O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P749R	ENST00000308370.7	37	c.2246		19	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640192	0.47153	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819	D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9	5.27	5.27	0.74061	EGF-like region, conserved site (1);EGF-like calcium-binding (2);	0.000000	0.39834	N	0.001258	D	0.90126	0.6915	N	0.05078	-0.115	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.97110	1.0;0.998;0.998	D	0.88360	0.2987	10	0.18276	T	0.48	.	15.7896	0.78343	0.0:1.0:0.0:0.0	.	682;749;712	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	R	712;202;749;682	ENSP00000204005:P712R;ENSP00000441054:P202R;ENSP00000311905:P749R;ENSP00000380031:P682R	ENSP00000204005:P712R	P	+	2	0	LTBP4	45809132	0.746000	0.28272	1.000000	0.80357	0.998000	0.95712	0.934000	0.28910	2.459000	0.83118	0.650000	0.86243	CCC	LTBP4	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000090006		0.667	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		-	0.00	61	0	C	NM_003573		41117292	+1	tier1	-	no_errors	ENST00000308370	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	G
LY75	4065	genome.wustl.edu	37	2	160661723	160661723	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:160661723G>A	ENST00000263636.4	-	35	5028	c.5001C>T	c.(4999-5001)taC>taT	p.Y1667Y	LY75-CD302_ENST00000504764.1_Intron|LY75-CD302_ENST00000505052.1_Intron|LY75_ENST00000554112.1_Intron|LY75_ENST00000553424.1_Intron	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1667					endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		CTATTGCTGTGTAATCAGGGC	0.423																																																	0													94.0	86.0	88.0					2																	160661723		2203	4300	6503	SO:0001819	synonymous_variant	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.5001C>T	2.37:g.160661723G>A			O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.Y1667	ENST00000263636.4	37	c.5001	CCDS2211.1	2																																																																																			LY75	-	NULL	ENSG00000054219		0.423	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1		0.00	57	0	G			160661723	-1			no_errors	ENST00000263636	ensembl	human	known	74_37	silent	5.77	49	3	SNP	1.000	A
LYPLAL1	127018	genome.wustl.edu	37	1	219347271	219347271	+	Silent	SNP	C	C	T	rs372613753		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:219347271C>T	ENST00000366928.5	+	1	86	c.39C>T	c.(37-39)atC>atT	p.I13I	LYPLAL1_ENST00000483635.1_3'UTR|LYPLAL1_ENST00000366927.3_Silent_p.I13I|RP11-135J2.4_ENST00000441331.1_RNA	NM_138794.3	NP_620149	Q5VWZ2	LYPL1_HUMAN	lysophospholipase-like 1	13					negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|protein depalmitoylation (GO:0002084)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	lysophospholipase activity (GO:0004622)			large_intestine(1)|lung(5)	6				GBM - Glioblastoma multiforme(131;0.055)|all cancers(67;0.105)|OV - Ovarian serous cystadenocarcinoma(81;0.116)		AGCGCTGTATCGTGTCGCCGG	0.632																																																	0													73.0	65.0	68.0					1																	219347271		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016711	CCDS1522.1, CCDS73032.1	1q41	2008-02-05			ENSG00000143353	ENSG00000143353			20440	protein-coding gene	gene with protein product							Standard	XM_005273046		Approved	Q96AV0	uc001hlq.4	Q5VWZ2	OTTHUMG00000037141	ENST00000366928.5:c.39C>T	1.37:g.219347271C>T			A8K677|Q5VWZ3|Q7Z4A3|Q96AV0	Silent	SNP	pfam_PLipase/COase/thioEstase,pfam_Dienelactn_hydro,pfam_Esterase_put	p.I13	ENST00000366928.5	37	c.39	CCDS1522.1	1																																																																																			LYPLAL1	-	pfam_PLipase/COase/thioEstase	ENSG00000143353		0.632	LYPLAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPLAL1	HGNC	protein_coding	OTTHUMT00000090208.1	-	0.00	63	0	C	NM_138794		219347271	+1	tier1	-	no_errors	ENST00000366928	ensembl	human	known	74_37	silent	36.11	23	13	SNP	0.096	T
MAMDC4	158056	genome.wustl.edu	37	9	139751367	139751367	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:139751367G>A	ENST00000317446.2	+	16	1896	c.1846G>A	c.(1846-1848)Gtg>Atg	p.V616M	MAMDC4_ENST00000445819.1_Missense_Mutation_p.V695M|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		AGGCCACTTTGTGCTCCTGGA	0.672																																																	0													31.0	36.0	34.0					9																	139751367		2198	4297	6495	SO:0001583	missense	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.1846G>A	9.37:g.139751367G>A	ENSP00000319388:p.Val616Met			Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt	p.V695M	ENST00000317446.2	37	c.2083	CCDS7010.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.022|0.022	-1.417612|-1.417612	0.01136|0.01136	.|.	.|.	ENSG00000177943|ENSG00000177943	ENST00000413647|ENST00000317446;ENST00000445819	.|T;T	.|0.01516	.|4.81;4.81	4.75|4.75	-5.5|-5.5	0.02576|0.02576	.|.	.|0.413357	.|0.22613	.|N	.|0.057818	T|T	0.00384|0.00384	0.0012|0.0012	N|N	0.00517|0.00517	-1.405|-1.405	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.15141	.|0.012	.|B	.|0.12837	.|0.008	T|T	0.33854|0.33854	-0.9852|-0.9852	5|10	.|0.02654	.|T	.|1	-11.1346|-11.1346	1.0067|1.0067	0.01488|0.01488	0.3602:0.1168:0.2949:0.2281|0.3602:0.1168:0.2949:0.2281	.|.	.|616	.|Q6UXC1-2	.|.	Y|M	680|616;695	.|ENSP00000319388:V616M;ENSP00000411339:V695M	.|ENSP00000319388:V616M	C|V	+|+	2|1	0|0	MAMDC4|MAMDC4	138871188|138871188	0.000000|0.000000	0.05858|0.05858	0.064000|0.064000	0.19789|0.19789	0.537000|0.537000	0.34900|0.34900	-1.157000|-1.157000	0.03157|0.03157	-1.333000|-1.333000	0.02247|0.02247	-0.459000|-0.459000	0.05422|0.05422	TGT|GTG	MAMDC4	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000177943		0.672	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	MAMDC4	HGNC	protein_coding	OTTHUMT00000254642.3	-	0.00	57	0	G	NM_206920		139751367	+1	tier1	-	no_errors	ENST00000445819	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.039	A
MAP2K5	5607	genome.wustl.edu	37	15	67878257	67878257	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:67878257C>T	ENST00000178640.5	+	5	979	c.352C>T	c.(352-354)Cat>Tat	p.H118Y	MAP2K5_ENST00000395476.2_Missense_Mutation_p.H118Y|MAP2K5_ENST00000354498.5_Missense_Mutation_p.H82Y|MAP2K5_ENST00000560591.1_3'UTR	NM_145160.2	NP_660143.1	Q13163	MP2K5_HUMAN	mitogen-activated protein kinase kinase 5	118	Interaction with MAPK7. {ECO:0000250}.		H -> R (in dbSNP:rs56241934). {ECO:0000269|PubMed:17344846}.		activation of MAPK activity (GO:0000187)|cellular response to growth factor stimulus (GO:0071363)|cellular response to laminar fluid shear stress (GO:0071499)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000342)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|skin(1)	16						ACGGAACATACATGGCCTGAA	0.363																																																	0													153.0	135.0	141.0					15																	67878257		2200	4298	6498	SO:0001583	missense	0			U25265	CCDS10224.1, CCDS42051.1, CCDS55970.1	15q22.31	2011-06-09			ENSG00000137764	ENSG00000137764		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6845	protein-coding gene	gene with protein product		602520		PRKMK5		7759517	Standard	NM_002757		Approved	MEK5, MAPKK5, HsT17454	uc002aqu.3	Q13163	OTTHUMG00000133264	ENST00000178640.5:c.352C>T	15.37:g.67878257C>T	ENSP00000178640:p.His118Tyr		B4DE43|Q92961|Q92962	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_OPR_PB1,superfamily_Kinase-like_dom,smart_OPR_PB1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H118Y	ENST00000178640.5	37	c.352	CCDS10224.1	15	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374157	0.61735	.	.	ENSG00000137764	ENST00000541298;ENST00000395476;ENST00000178640;ENST00000354498;ENST00000439036	T;T;T;T	0.72394	-0.46;-0.65;-0.6;0.76	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.74816	0.3766	L	0.29908	0.895	0.80722	D	1	P;D;D;D	0.62365	0.928;0.991;0.963;0.985	P;P;P;P	0.59115	0.477;0.852;0.477;0.574	T	0.75317	-0.3360	10	0.46703	T	0.11	-22.1766	19.3031	0.94150	0.0:1.0:0.0:0.0	.	82;118;118;118	B4DE43;Q13163-2;Q13163;B2RD76	.;.;MP2K5_HUMAN;.	Y	118;118;118;82;51	ENSP00000378859:H118Y;ENSP00000178640:H118Y;ENSP00000346493:H82Y;ENSP00000390196:H51Y	ENSP00000178640:H118Y	H	+	1	0	MAP2K5	65665311	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.576000	0.86940	0.467000	0.42956	CAT	MAP2K5	-	NULL	ENSG00000137764		0.363	MAP2K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K5	HGNC	protein_coding	OTTHUMT00000257041.1	-	0.00	92	0	C	NM_145162		67878257	+1	tier1	-	no_errors	ENST00000178640	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
MAP9	79884	genome.wustl.edu	37	4	156274462	156274462	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:156274462C>T	ENST00000311277.4	-	11	1674	c.1411G>A	c.(1411-1413)Gca>Aca	p.A471T	AC097467.2_ENST00000608544.1_RNA|AC097467.2_ENST00000608406.1_RNA|AC097467.2_ENST00000608463.1_RNA|AC097467.2_ENST00000595229.1_RNA|AC097467.2_ENST00000593387.2_RNA|AC097467.2_ENST00000608762.1_RNA|AC097467.2_ENST00000597939.1_RNA|AC097467.2_ENST00000601977.1_RNA|AC097467.2_ENST00000608092.1_RNA|AC097467.2_ENST00000610249.1_RNA|MAP9_ENST00000515654.1_Missense_Mutation_p.A447T|AC097467.2_ENST00000609486.1_RNA|AC097467.2_ENST00000417474.1_RNA|AC097467.2_ENST00000598252.1_RNA|AC097467.2_ENST00000609716.1_RNA|AC097467.2_ENST00000609254.1_RNA|AC097467.2_ENST00000599555.2_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	471					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		TCAAATGATGCTAATGCTTCT	0.323																																																	0													70.0	68.0	68.0					4																	156274462		2203	4297	6500	SO:0001583	missense	0			AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.1411G>A	4.37:g.156274462C>T	ENSP00000310593:p.Ala471Thr		Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	NULL	p.A471T	ENST00000311277.4	37	c.1411	CCDS35493.1	4	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973560	0.92919	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024	T;T;T	0.09630	2.96;2.96;2.96	5.37	5.37	0.77165	.	0.285191	0.38381	N	0.001708	T	0.33469	0.0864	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.998	T	0.01899	-1.1251	10	0.87932	D	0	-19.6892	16.1819	0.81915	0.0:1.0:0.0:0.0	.	446;471;471	B4DVG9;B9EJB6;Q49MG5	.;.;MAP9_HUMAN	T	471;447;470	ENSP00000310593:A471T;ENSP00000427402:A447T;ENSP00000394048:A470T	ENSP00000310593:A471T	A	-	1	0	MAP9	156493912	1.000000	0.71417	0.965000	0.40720	0.993000	0.82548	5.192000	0.65115	2.670000	0.90874	0.655000	0.94253	GCA	MAP9	-	NULL	ENSG00000164114		0.323	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP9	HGNC	protein_coding	OTTHUMT00000257771.3	-	0.00	49	0	C	NM_001039580		156274462	-1	tier1	-	no_errors	ENST00000311277	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.996	T
MAST1	22983	genome.wustl.edu	37	19	12975991	12975991	+	Splice_Site	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:12975991A>G	ENST00000251472.4	+	14	1676	c.1637A>G	c.(1636-1638)cAg>cGg	p.Q546R		NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CTGGACAAACAGGTGTGTGTG	0.622																																																	0													63.0	61.0	61.0					19																	12975991		2203	4300	6503	SO:0001630	splice_region_variant	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1638+1A>G	19.37:g.12975991A>G				Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.Q546R	ENST00000251472.4	37	c.1637	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	A	23.0	4.365415	0.82463	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.23552	1.9	4.78	4.78	0.61160	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.28234	0.0697	N	0.13198	0.31	0.80722	D	1	P	0.49862	0.929	P	0.56916	0.809	T	0.12451	-1.0547	10	0.87932	D	0	-15.6228	12.5681	0.56320	1.0:0.0:0.0:0.0	.	546	Q9Y2H9	MAST1_HUMAN	R	546	ENSP00000251472:Q546R	ENSP00000251472:Q546R	Q	+	2	0	MAST1	12836991	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.339000	0.96797	1.940000	0.56252	0.459000	0.35465	CAG	MAST1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105613		0.622	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	-	0.00	44	0	A	NM_014975	Missense_Mutation	12975991	+1	tier1	-	no_errors	ENST00000251472	ensembl	human	known	74_37	missense	38.89	11	7	SNP	1.000	G
MBOAT2	129642	genome.wustl.edu	37	2	9008633	9008633	+	Silent	SNP	G	G	A	rs201477086		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:9008633G>A	ENST00000305997.3	-	9	1128	c.930C>T	c.(928-930)gaC>gaT	p.D310D	MBOAT2_ENST00000486484.1_5'UTR	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	310					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CTCCATTTTCGTCATACCCTC	0.333																																					Ovarian(194;1699 3813 22401)												0													99.0	106.0	103.0					2																	9008633		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.930C>T	2.37:g.9008633G>A			A9EDR2|Q8NCE7|Q96KY4	Silent	SNP	pfam_MBOAT_fam,superfamily_MFS_dom_general_subst_transpt	p.D310	ENST00000305997.3	37	c.930	CCDS1660.1	2																																																																																			MBOAT2	-	pfam_MBOAT_fam	ENSG00000143797		0.333	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT2	HGNC	protein_coding	OTTHUMT00000206735.1	-	0.00	57	0	G	NM_138799		9008633	-1	tier1	rs201477086	no_errors	ENST00000305997	ensembl	human	known	74_37	silent	47.92	25	23	SNP	1.000	A
MC1R	4157	genome.wustl.edu	37	16	89985940	89985940	+	Missense_Mutation	SNP	G	G	T	rs2228479	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:89985940G>T	ENST00000555147.1	+	1	1654	c.274G>T	c.(274-276)Gtg>Ttg	p.V92L	TUBB3_ENST00000556922.1_Missense_Mutation_p.V92L|MC1R_ENST00000555427.1_Missense_Mutation_p.V92L|TUBB3_ENST00000554444.1_5'Flank|RP11-566K11.4_ENST00000554623.1_RNA|RP11-566K11.7_ENST00000570217.1_RNA	NM_002386.3	NP_002377.4	Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)	92			V -> M (associated with a risk for developing melanoma; predominantly found in type I skin; shows a moderate and not significant decreased of cAMP production to NDP-MSH stimulation; dbSNP:rs2228479). {ECO:0000269|PubMed:10101176, ECO:0000269|PubMed:18987736, ECO:0000269|PubMed:8990005, ECO:0000269|PubMed:9302268, ECO:0000269|Ref.12}.		G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		CGGGAGCAACGTGCTGGAGAC	0.637									Melanoma, Familial Clustering of																																								0			GRCh37	CM014730	MC1R	M	rs2228479						48.0	58.0	55.0					16																	89985940		2192	4284	6476	SO:0001583	missense	0	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555147.1:c.274G>T	16.37:g.89985940G>T	ENSP00000451605:p.Val92Leu		Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MSH_rcpt,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn,prints_Melancort_rcpt	p.V92L	ENST00000555147.1	37	c.274	CCDS56011.1	16	.	.	.	.	.	.	.	.	.	.	G	8.908	0.957964	0.18507	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258839	ENST00000555427;ENST00000556922;ENST00000555147	T;T;T	0.04454	3.62;3.62;3.62	4.86	0.165	0.14995	GPCR, rhodopsin-like superfamily (1);	0.270105	0.18936	U	0.127063	T	0.03136	0.0092	N	0.21617	0.685	0.27460	N	0.953181	B	0.06786	0.001	B	0.13407	0.009	T	0.43814	-0.9368	9	.	.	.	.	8.2022	0.31432	0.1814:0.3993:0.4193:0.0	.	92	Q01726	MSHR_HUMAN	L	92	ENSP00000451760:V92L;ENSP00000451560:V92L;ENSP00000451605:V92L	.	V	+	1	0	MC1R;RP11-566K11.2	88513441	0.750000	0.28316	0.359000	0.25824	0.182000	0.23217	1.008000	0.29872	0.100000	0.17581	-1.360000	0.01215	GTG	MC1R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000258839		0.637	MC1R-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	MC1R	HGNC	protein_coding	OTTHUMT00000412014.1	-	0.00	31	0	G	NM_002386		89985940	+1	tier1	-	no_errors	ENST00000555147	ensembl	human	known	74_37	missense	47.62	11	10	SNP	1.000	T
MCM3AP	8888	genome.wustl.edu	37	21	47690475	47690475	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr21:47690475T>C	ENST00000397708.1	-	10	2722	c.2468A>G	c.(2467-2469)gAa>gGa	p.E823G	MCM3AP_ENST00000291688.1_Missense_Mutation_p.E823G			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	823	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CTGTTGTACTTCTCTGTTAAT	0.328																																																	0													65.0	63.0	64.0					21																	47690475		2203	4300	6503	SO:0001583	missense	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.2468A>G	21.37:g.47690475T>C	ENSP00000380820:p.Glu823Gly		C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.E823G	ENST00000397708.1	37	c.2468	CCDS13734.1	21	.	.	.	.	.	.	.	.	.	.	T	28.9	4.958994	0.92726	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.33654	1.4;1.4	5.98	5.98	0.97165	.	0.043465	0.85682	D	0.000000	T	0.63105	0.2483	M	0.80616	2.505	0.80722	D	1	D	0.63046	0.992	D	0.74348	0.983	T	0.65763	-0.6089	10	0.52906	T	0.07	-27.6302	16.4578	0.84025	0.0:0.0:0.0:1.0	.	823	O60318	MCM3A_HUMAN	G	823	ENSP00000380820:E823G;ENSP00000291688:E823G	ENSP00000291688:E823G	E	-	2	0	MCM3AP	46514903	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.774000	0.85478	2.288000	0.76882	0.482000	0.46254	GAA	MCM3AP	-	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	ENSG00000160294		0.328	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	-	0.00	83	0	T	NM_003906		47690475	-1	tier1	-	no_errors	ENST00000291688	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	C
MCM6	4175	genome.wustl.edu	37	2	136616981	136616981	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:136616981A>G	ENST00000264156.2	-	9	1312	c.1252T>C	c.(1252-1254)Tac>Cac	p.Y418H	MCM6_ENST00000492091.1_Intron	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	418	MCM.				DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CCACTGGTGTAGACAGCTCTG	0.468																																					Ovarian(196;141 2104 8848 24991 25939)												0													89.0	80.0	83.0					2																	136616981		2203	4300	6503	SO:0001583	missense	0				CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1252T>C	2.37:g.136616981A>G	ENSP00000264156:p.Tyr418His		B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM6,prints_MCM_DNA-dep_ATPase	p.Y418H	ENST00000264156.2	37	c.1252	CCDS2179.1	2	.	.	.	.	.	.	.	.	.	.	A	29.7	5.028949	0.93518	.	.	ENSG00000076003	ENST00000264156	T	0.10382	2.88	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.48277	0.1491	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65487	-0.6156	10	0.87932	D	0	-11.4199	16.2874	0.82727	1.0:0.0:0.0:0.0	.	418	Q14566	MCM6_HUMAN	H	418	ENSP00000264156:Y418H	ENSP00000264156:Y418H	Y	-	1	0	MCM6	136333451	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.761000	0.91691	2.235000	0.73313	0.533000	0.62120	TAC	MCM6	-	pfam_MCM_DNA-dep_ATPase,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	ENSG00000076003		0.468	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM6	HGNC	protein_coding	OTTHUMT00000254658.1	-	0.00	61	0	A	NM_005915		136616981	-1	tier1	-	no_errors	ENST00000264156	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	G
MED24	9862	genome.wustl.edu	37	17	38187474	38187474	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:38187474G>A	ENST00000394128.2	-	12	1173	c.1092C>T	c.(1090-1092)ctC>ctT	p.L364L	MED24_ENST00000394127.2_Silent_p.L351L|MED24_ENST00000356271.3_Silent_p.L351L|MED24_ENST00000501516.3_Silent_p.L383L|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000394126.1_Silent_p.L389L	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	364					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					CACATTCTTGGAGCAGGAAGT	0.567																																																	0													64.0	50.0	55.0					17																	38187474		2197	4296	6493	SO:0001819	synonymous_variant	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1092C>T	17.37:g.38187474G>A			A8K4S5|B3KMR9|Q14143|Q9NNY5	Silent	SNP	pfam_Mediator_Med24_N	p.L364	ENST00000394128.2	37	c.1092	CCDS11359.1	17																																																																																			MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.567	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	-	0.00	54	0	G	NM_014815		38187474	-1	tier1	-	no_errors	ENST00000394128	ensembl	human	known	74_37	silent	27.40	53	20	SNP	0.948	A
MEGF6	1953	genome.wustl.edu	37	1	3431195	3431195	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:3431195T>C	ENST00000356575.4	-	7	998	c.772A>G	c.(772-774)Agg>Ggg	p.R258G	MEGF6_ENST00000294599.4_Missense_Mutation_p.R153G	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	258	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		ACCTGGCACCTGTGCATGCAG	0.697																																					Ovarian(73;978 3658)												0													19.0	30.0	26.0					1																	3431195		2058	4175	6233	SO:0001583	missense	0			AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.772A>G	1.37:g.3431195T>C	ENSP00000348982:p.Arg258Gly		Q4AC86|Q5VV39	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.R258G	ENST00000356575.4	37	c.772	CCDS41237.1	1	.	.	.	.	.	.	.	.	.	.	T	2.051	-0.417749	0.04766	.	.	ENSG00000162591	ENST00000294599;ENST00000356575	D;D	0.87103	-2.21;-2.21	4.47	3.3	0.37823	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.233700	0.05509	N	0.559786	T	0.77143	0.4087	N	0.13140	0.3	0.09310	N	1	B;B	0.29253	0.239;0.228	B;B	0.29598	0.07;0.104	T	0.64909	-0.6296	10	0.30854	T	0.27	-1.0633	6.3486	0.21363	0.1437:0.0:0.2814:0.5749	.	258;153	O75095;O75095-2	MEGF6_HUMAN;.	G	153;258	ENSP00000294599:R153G;ENSP00000348982:R258G	ENSP00000294599:R153G	R	-	1	2	MEGF6	3421055	0.002000	0.14202	0.882000	0.34594	0.375000	0.29983	-0.018000	0.12568	0.699000	0.31761	0.402000	0.26972	AGG	MEGF6	-	smart_EG-like_dom,smart_EGF-like_Ca-bd_dom	ENSG00000162591		0.697	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	HGNC	protein_coding	OTTHUMT00000354866.1		0.00	24	0	T	NM_001409		3431195	-1			no_errors	ENST00000356575	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.168	C
MFSD6	54842	genome.wustl.edu	37	2	191300945	191300945	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:191300945A>T	ENST00000392328.1	+	3	514	c.190A>T	c.(190-192)Ata>Tta	p.I64L	MFSD6_ENST00000281416.7_Missense_Mutation_p.I64L	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	64					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TTGTGTTAAGATAAACAACGA	0.408																																																	0													97.0	101.0	100.0					2																	191300945		2203	4300	6503	SO:0001583	missense	0				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.190A>T	2.37:g.191300945A>T	ENSP00000376141:p.Ile64Leu		D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I64L	ENST00000392328.1	37	c.190	CCDS2306.1	2	.	.	.	.	.	.	.	.	.	.	A	12.19	1.864417	0.32977	.	.	ENSG00000151690	ENST00000432036;ENST00000392328;ENST00000445546;ENST00000281416	T;T	0.36157	1.27;1.27	5.49	3.02	0.34903	Major facilitator superfamily domain, general substrate transporter (1);	0.184901	0.56097	D	0.000040	T	0.21962	0.0529	N	0.19112	0.55	0.80722	D	1	B	0.14438	0.01	B	0.10450	0.005	T	0.04103	-1.0977	10	0.46703	T	0.11	-16.5622	8.1166	0.30946	0.7943:0.135:0.0707:0.0	.	64	Q6ZSS7	MFSD6_HUMAN	L	64	ENSP00000376141:I64L;ENSP00000281416:I64L	ENSP00000281416:I64L	I	+	1	0	MFSD6	191009190	0.996000	0.38824	0.442000	0.26870	0.882000	0.50991	1.532000	0.36029	0.466000	0.27193	0.528000	0.53228	ATA	MFSD6	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000151690		0.408	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	-	0.00	27	0	A			191300945	+1	tier1	-	no_errors	ENST00000281416	ensembl	human	known	74_37	missense	55.88	15	19	SNP	0.852	T
MFSD6L	162387	genome.wustl.edu	37	17	8702343	8702343	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:8702343C>T	ENST00000329805.4	-	1	324	c.96G>A	c.(94-96)ccG>ccA	p.P32P		NM_152599.3	NP_689812.3	Q8IWD5	MFS6L_HUMAN	major facilitator superfamily domain containing 6-like	32						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|skin(4)	17						GGGTCAGGAACGGGGTCACGC	0.667																																																	0													31.0	35.0	34.0					17																	8702343		2203	4297	6500	SO:0001819	synonymous_variant	0			AK093092	CCDS11146.1	17p13.1	2014-05-30			ENSG00000185156	ENSG00000185156			26656	protein-coding gene	gene with protein product							Standard	NM_152599		Approved	FLJ35773	uc002glp.2	Q8IWD5	OTTHUMG00000178584	ENST00000329805.4:c.96G>A	17.37:g.8702343C>T			Q6YL34|Q8NA76	Silent	SNP	superfamily_MFS_dom_general_subst_transpt	p.P32	ENST00000329805.4	37	c.96	CCDS11146.1	17																																																																																			MFSD6L	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000185156		0.667	MFSD6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6L	HGNC	protein_coding	OTTHUMT00000442554.1		0.00	42	0	C	NM_152599		8702343	-1			no_errors	ENST00000329805	ensembl	human	known	74_37	silent	23.68	29	9	SNP	1.000	T
MOGAT3	346606	genome.wustl.edu	37	7	100843572	100843572	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:100843572C>T	ENST00000223114.4	-	3	397	c.231G>A	c.(229-231)tcG>tcA	p.S77S	MOGAT3_ENST00000440203.2_Silent_p.S77S|MOGAT3_ENST00000379423.3_Silent_p.S77S	NM_178176.2	NP_835470.1	Q86VF5	MOGT3_HUMAN	monoacylglycerol O-acyltransferase 3	77					glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(3)	22	Lung NSC(181;0.168)|all_lung(186;0.215)					TTATCCACTCCGAACGCCTTC	0.567																																																	0													177.0	171.0	173.0					7																	100843572		2203	4300	6503	SO:0001819	synonymous_variant	0			AY229854	CCDS5714.1, CCDS75643.1	7q22	2012-09-06			ENSG00000106384	ENSG00000106384	2.3.1.20, 2.3.1.22		23249	protein-coding gene	gene with protein product		610184				12618427, 14970677	Standard	XM_005250309		Approved	DC7, MGAT3	uc003uyc.3	Q86VF5	OTTHUMG00000023328	ENST00000223114.4:c.231G>A	7.37:g.100843572C>T			Q496A6|Q496A7|Q496A8|Q9UDW7	Silent	SNP	pfam_DAGAT	p.S77	ENST00000223114.4	37	c.231	CCDS5714.1	7																																																																																			MOGAT3	-	pfam_DAGAT	ENSG00000106384		0.567	MOGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT3	HGNC	protein_coding	OTTHUMT00000059649.3	-	0.00	35	0	C	NM_178176		100843572	-1	tier1	-	no_errors	ENST00000440203	ensembl	human	known	74_37	silent	9.43	48	5	SNP	0.000	T
MT-CO1	4512	genome.wustl.edu	37	M	6075	6075	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrM:6075G>A	ENST00000361624.2	+	1	172	c.172G>A	c.(172-174)Gtc>Atc	p.V58I	MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	58					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACAACGTTATCGTCACAGCCC	0.498																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.172G>A	M.37:g.6075G>A	ENSP00000354499:p.Val58Ile		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.V58I	ENST00000361624.2	37	c.172		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	ENSG00000198804		0.498	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	59	0	G	YP_003024028		6075	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	10.53	17	2	SNP	NULL	A
MT-CO1	4512	genome.wustl.edu	37	M	6079	6079	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrM:6079C>A	ENST00000361624.2	+	1	176	c.176C>A	c.(175-177)aCa>aAa	p.T59K	MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	59					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGTTATCGTCACAGCCCATGC	0.488																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.176C>A	M.37:g.6079C>A	ENSP00000354499:p.Thr59Lys		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.T59K	ENST00000361624.2	37	c.176		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	ENSG00000198804		0.488	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	57	0	C	YP_003024028		6079	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	11.11	16	2	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13498	13498	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrM:13498G>A	ENST00000361567.2	+	1	1162	c.1162G>A	c.(1162-1164)Ggt>Agt	p.G388S	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	388					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTTTCCTCACAGGTTTCTACT	0.453																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1162G>A	M.37:g.13498G>A	ENSP00000354813:p.Gly388Ser		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.G388S	ENST00000361567.2	37	c.1162		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.453	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	23	0	G	YP_003024036		13498	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	62.50	3	5	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13573	13573	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrM:13573C>T	ENST00000361567.2	+	1	1237	c.1237C>T	c.(1237-1239)Ctc>Ttc	p.L413F	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	413					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TATCTATTACTCTCATCGCTA	0.453																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1237C>T	M.37:g.13573C>T	ENSP00000354813:p.Leu413Phe		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L413F	ENST00000361567.2	37	c.1237		MT																																																																																			MT-ND5	-	tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.453	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	26	0	C	YP_003024036		13573	+1	tier1	rs28462226	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	25.00	6	2	SNP	NULL	T
MT-ND5	4540	genome.wustl.edu	37	M	14059	14059	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrM:14059A>T	ENST00000361567.2	+	1	1723	c.1723A>T	c.(1723-1725)Atc>Ttc	p.I575F	MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	575					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCTCCACCTCCATCATCACCT	0.433																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1723A>T	M.37:g.14059A>T	ENSP00000354813:p.Ile575Phe		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.I575F	ENST00000361567.2	37	c.1723		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C	ENSG00000198786		0.433	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	31	0	A	YP_003024036		14059	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	25.00	6	2	SNP	NULL	T
MUC16	94025	genome.wustl.edu	37	19	9047103	9047103	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:9047103A>G	ENST00000397910.4	-	5	34731	c.34528T>C	c.(34528-34530)Tcc>Ccc	p.S11510P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11512	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTACTATGGGAAAACTTGGGA	0.498																																																	0													148.0	144.0	145.0					19																	9047103		2057	4202	6259	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34528T>C	19.37:g.9047103A>G	ENSP00000381008:p.Ser11510Pro		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S11510P	ENST00000397910.4	37	c.34528	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	4.722	0.134314	0.09032	.	.	ENSG00000181143	ENST00000397910	T	0.03212	4.01	2.48	-3.51	0.04696	.	.	.	.	.	T	0.04003	0.0112	L	0.41824	1.3	.	.	.	B	0.27166	0.17	B	0.31614	0.133	T	0.28004	-1.0057	8	0.87932	D	0	.	8.9024	0.35503	0.3084:0.0:0.6916:0.0	.	11510	B5ME49	.	P	11510	ENSP00000381008:S11510P	ENSP00000381008:S11510P	S	-	1	0	MUC16	8908103	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.949000	0.03893	-1.024000	0.03338	-0.471000	0.05019	TCC	MUC16	-	NULL	ENSG00000181143		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	71	0	A	NM_024690		9047103	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	17.65	42	9	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9049508	9049508	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:9049508G>A	ENST00000397910.4	-	5	32326	c.32123C>T	c.(32122-32124)gCc>gTc	p.A10708V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10710	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAAGGTGTGGCATCTGATTC	0.478																																																	0													232.0	211.0	218.0					19																	9049508		1978	4163	6141	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32123C>T	19.37:g.9049508G>A	ENSP00000381008:p.Ala10708Val		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.A10708V	ENST00000397910.4	37	c.32123	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	7.646	0.681954	0.14907	.	.	ENSG00000181143	ENST00000397910	T	0.02709	4.19	2.34	-4.68	0.03309	.	.	.	.	.	T	0.01454	0.0047	N	0.14661	0.345	.	.	.	B	0.31174	0.311	B	0.26614	0.071	T	0.45234	-0.9275	8	0.87932	D	0	.	0.8561	0.01182	0.1455:0.2167:0.3098:0.3279	.	10708	B5ME49	.	V	10708	ENSP00000381008:A10708V	ENSP00000381008:A10708V	A	-	2	0	MUC16	8910508	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-5.763000	0.00100	-0.797000	0.04450	0.479000	0.44913	GCC	MUC16	-	NULL	ENSG00000181143		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	73	0	G	NM_024690		9049508	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.000	A
MVB12B	89853	genome.wustl.edu	37	9	129266836	129266836	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:129266836G>T	ENST00000361171.3	+	0	2335				MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										GTCCTGGGCAGCCCACAGTAG	0.677																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.*1294G>T	9.37:g.129266836G>T			Q8N6S7	RNA	SNP	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																			MVB12B	-	-	ENSG00000196814		0.677	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12B	HGNC	protein_coding	OTTHUMT00000054110.1	-	0.00	60	0	G	XM_088525		129266836	+1	tier1	-	no_errors	ENST00000485886	ensembl	human	known	74_37	rna	32.50	54	26	SNP	0.004	T
MXRA5	25878	genome.wustl.edu	37	X	3241682	3241682	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:3241682G>A	ENST00000217939.6	-	5	2198	c.2044C>T	c.(2044-2046)Cgc>Tgc	p.R682C		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	682						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				GCACCTGGGCGTCTGCCTCTT	0.532																																																	0													79.0	73.0	75.0					X																	3241682		2203	4300	6503	SO:0001583	missense	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2044C>T	X.37:g.3241682G>A	ENSP00000217939:p.Arg682Cys		Q6P1M7|Q9Y3Y8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R682C	ENST00000217939.6	37	c.2044	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	g	11.77	1.738176	0.30774	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	T	0.66815	-0.23	3.48	3.48	0.39840	.	0.561089	0.14863	U	0.293997	T	0.58779	0.2146	N	0.08118	0	0.31286	N	0.689964	D	0.76494	0.999	P	0.54924	0.764	T	0.64728	-0.6339	10	0.56958	D	0.05	.	13.0265	0.58819	0.0:0.0:1.0:0.0	.	682	Q9NR99	MXRA5_HUMAN	C	682	ENSP00000217939:R682C	ENSP00000217939:R682C	R	-	1	0	MXRA5	3251682	0.995000	0.38212	0.006000	0.13384	0.006000	0.05464	2.998000	0.49465	1.370000	0.46153	0.529000	0.55759	CGC	MXRA5	-	NULL	ENSG00000101825		0.532	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	-	0.00	33	0	G	NM_015419		3241682	-1	tier1	-	no_errors	ENST00000217939	ensembl	human	known	74_37	missense	57.14	11	16	SNP	0.691	A
MYCBP2	23077	genome.wustl.edu	37	13	77672299	77672299	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr13:77672299G>A	ENST00000544440.2	-	56	8893	c.8876C>T	c.(8875-8877)aCc>aTc	p.T2959I	MYCBP2_ENST00000360084.5_Missense_Mutation_p.T482I|MYCBP2_ENST00000482517.1_5'UTR|MYCBP2_ENST00000357337.6_Missense_Mutation_p.T2959I|MYCBP2_ENST00000407578.2_Missense_Mutation_p.T2997I|MYCBP2-AS1_ENST00000593933.1_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTTGGGCCTGGTGTGTCTATT	0.408																																																	0													141.0	139.0	140.0					13																	77672299		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.8876C>T	13.37:g.77672299G>A	ENSP00000444596:p.Thr2959Ile			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.T2997I	ENST00000544440.2	37	c.8990		13	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031493	0.35797	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440;ENST00000360084	T;T;T;T	0.51071	1.6;1.6;1.6;0.72	5.56	5.56	0.83823	.	0.216110	0.48767	D	0.000170	T	0.34978	0.0916	L	0.29908	0.895	0.38109	D	0.937499	B;B;B	0.27140	0.169;0.001;0.006	B;B;B	0.24394	0.053;0.002;0.005	T	0.33111	-0.9881	10	0.56958	D	0.05	.	10.0645	0.42295	0.149:0.0:0.851:0.0	.	345;2959;2959	Q9UG08;O75592-2;O75592	.;.;MYCB2_HUMAN	I	2959;2997;2959;482	ENSP00000349892:T2959I;ENSP00000384288:T2997I;ENSP00000444596:T2959I;ENSP00000353197:T482I	ENSP00000349892:T2959I	T	-	2	0	MYCBP2	76570300	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.819000	0.48049	2.619000	0.88677	0.585000	0.79938	ACC	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.408	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	75	0	G	NM_015057		77672299	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.997	A
MYH13	8735	genome.wustl.edu	37	17	10212976	10212976	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:10212976G>A	ENST00000418404.3	-	33	4991	c.4828C>T	c.(4828-4830)Cgc>Tgc	p.R1610C	MYH13_ENST00000252172.4_Missense_Mutation_p.R1610C|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1610					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1610C(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TTCCGGCTGCGGATTTCAGCA	0.552																																																	2	Substitution - Missense(2)	lung(2)											53.0	54.0	53.0					17																	10212976		2175	4292	6467	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4828C>T	17.37:g.10212976G>A	ENSP00000404570:p.Arg1610Cys		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1610C	ENST00000418404.3	37	c.4828	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259609	0.59321	.	.	ENSG00000006788	ENST00000252172	D	0.82344	-1.6	4.18	-0.786	0.10946	Myosin tail (1);	.	.	.	.	D	0.92541	0.7631	H	0.95114	3.625	0.39981	D	0.974917	D	0.89917	1.0	D	0.72338	0.977	D	0.93749	0.7057	9	0.87932	D	0	.	13.7656	0.62992	0.0:0.0:0.2291:0.7709	.	1610	Q9UKX3	MYH13_HUMAN	C	1610	ENSP00000252172:R1610C	ENSP00000252172:R1610C	R	-	1	0	MYH13	10153701	0.006000	0.16342	0.991000	0.47740	0.919000	0.55068	-0.074000	0.11450	0.107000	0.17824	0.462000	0.41574	CGC	MYH13	-	pfam_Myosin_tail	ENSG00000006788		0.552	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1		0.00	34	0	G	NM_003802		10212976	-1			no_errors	ENST00000252172	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.997	A
MYLK	4638	genome.wustl.edu	37	3	123375992	123375992	+	Silent	SNP	C	C	T	rs574785619		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:123375992C>T	ENST00000475616.1	-	21	4268	c.4269G>A	c.(4267-4269)acG>acA	p.T1423T	MYLK_ENST00000360304.3_Silent_p.T1423T|MYLK_ENST00000346322.5_Silent_p.T1354T|MYLK_ENST00000359169.1_Silent_p.T1423T|MYLK_ENST00000354792.5_Silent_p.T223T|MYLK_ENST00000360772.3_Silent_p.T1423T			Q15746	MYLK_HUMAN	myosin light chain kinase	1423	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TCTCTCCTACCGTTGTGAGTT	0.493													C|||	1	0.000199681	0.0	0.0	5008	,	,		22533	0.0		0.0	False		,,,				2504	0.001																0													144.0	134.0	137.0					3																	123375992		2203	4300	6503	SO:0001819	synonymous_variant	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4269G>A	3.37:g.123375992C>T			B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Silent	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T1423	ENST00000475616.1	37	c.4269	CCDS46896.1	3																																																																																			MYLK	-	superfamily_Fibronectin_type3	ENSG00000065534		0.493	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	-	0.00	63	0	C	NM_053025		123375992	-1	tier1	-	no_errors	ENST00000360304	ensembl	human	known	74_37	silent	35.38	42	23	SNP	0.000	T
NFS1	9054	genome.wustl.edu	37	20	34287270	34287270	+	5'UTR	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr20:34287270G>T	ENST00000374092.4	-	0	11				NFS1_ENST00000374085.1_5'Flank|NFS1_ENST00000541387.1_5'UTR|ROMO1_ENST00000374072.1_5'Flank|ROMO1_ENST00000397416.1_5'Flank|ROMO1_ENST00000336695.4_5'Flank|ROMO1_ENST00000374077.3_5'Flank|NFS1_ENST00000306750.3_5'Flank|ROMO1_ENST00000374078.1_5'UTR|NFS1_ENST00000540053.1_5'UTR|NFS1_ENST00000397425.1_5'UTR	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase						cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	CAGGCTCCCGGAAGTGCTGCC	0.716											OREG0004048|OREG0004049	type=REGULATORY REGION|Gene=C20orf52|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=NFS1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0																																										SO:0001623	5_prime_UTR_variant	0			AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.-60C>A	20.37:g.34287270G>T		846	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	RNA	SNP	-	NULL	ENST00000374092.4	37	NULL	CCDS13262.1	20																																																																																			NFS1	-	-	ENSG00000244005		0.716	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFS1	HGNC	protein_coding	OTTHUMT00000078936.4	-	0.00	21	0	G	NM_021100		34287270	-1	tier1	-	no_errors	ENST00000421540	ensembl	human	known	74_37	rna	20.69	22	6	SNP	1.000	T
NID1	4811	genome.wustl.edu	37	1	236187408	236187408	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:236187408C>G	ENST00000264187.6	-	9	2172	c.2090G>C	c.(2089-2091)tGc>tCc	p.C697S	NID1_ENST00000366595.3_Missense_Mutation_p.C697S	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	697	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GCCGATGGAGCACTCGCAGGT	0.592																																																	0													72.0	64.0	67.0					1																	236187408		2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.2090G>C	1.37:g.236187408C>G	ENSP00000264187:p.Cys697Ser		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.C697S	ENST00000264187.6	37	c.2090	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.137865	0.94517	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.99903	-7.67;-7.67	5.85	5.85	0.93711	EGF domain, merozoite surface protein 1-like (1);Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99939	0.9973	H	0.99336	4.52	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.95	D	0.96611	0.9452	10	0.49607	T	0.09	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	697;697	P14543-2;P14543	.;NID1_HUMAN	S	697	ENSP00000264187:C697S;ENSP00000355554:C697S	ENSP00000264187:C697S	C	-	2	0	NID1	234254031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.476000	0.81055	2.767000	0.95098	0.655000	0.94253	TGC	NID1	-	smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000116962		0.592	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	-	0.00	46	0	C	NM_002508		236187408	-1	tier1	-	no_errors	ENST00000264187	ensembl	human	known	74_37	missense	27.03	27	10	SNP	1.000	G
NOXRED1	122945	genome.wustl.edu	37	14	77861025	77861025	+	Silent	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:77861025G>T	ENST00000380835.2	-	6	1195	c.1029C>A	c.(1027-1029)atC>atA	p.I343I		NM_001113475.2	NP_001106946.1	Q6NXP6	NXRD1_HUMAN	NADP-dependent oxidoreductase domain containing 1	343					proline biosynthetic process (GO:0006561)		pyrroline-5-carboxylate reductase activity (GO:0004735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	9						TGGTTAGGGAGATGCCAAATG	0.448																																																	0													152.0	137.0	141.0					14																	77861025		1568	3582	5150	SO:0001819	synonymous_variant	0			AK057371	CCDS45142.1	14q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000165555	ENSG00000165555			20487	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 148"""	C14orf148			Standard	NM_001113475		Approved	FLJ32809	uc001xtr.3	Q6NXP6	OTTHUMG00000171554	ENST00000380835.2:c.1029C>A	14.37:g.77861025G>T			B3KQ47|O95435	Silent	SNP	NULL	p.I343	ENST00000380835.2	37	c.1029	CCDS45142.1	14																																																																																			NOXRED1	-	NULL	ENSG00000165555		0.448	NOXRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOXRED1	HGNC	protein_coding	OTTHUMT00000414103.1	-	0.00	77	0	G	NM_138791		77861025	-1	tier1	-	no_errors	ENST00000380835	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.595	T
NRXN1	9378	genome.wustl.edu	37	2	50149340	50149340	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:50149340T>G	ENST00000406316.2	-	22	5652	c.4176A>C	c.(4174-4176)gaA>gaC	p.E1392D	NRXN1_ENST00000402717.3_Missense_Mutation_p.E1414D|NRXN1_ENST00000404971.1_Missense_Mutation_p.E1462D|NRXN1_ENST00000401669.2_Missense_Mutation_p.E1422D|NRXN1_ENST00000401710.1_Missense_Mutation_p.E410D|NRXN1_ENST00000406859.3_Missense_Mutation_p.E1392D|NRXN1_ENST00000342183.5_Missense_Mutation_p.E357D|NRXN1_ENST00000405472.3_Missense_Mutation_p.E1414D	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1392					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CCCGGATCACTTCTGCTGAGC	0.532																																																	0													64.0	54.0	58.0					2																	50149340		2203	4300	6503	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4176A>C	2.37:g.50149340T>G	ENSP00000384311:p.Glu1392Asp		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.E1414D	ENST00000406316.2	37	c.4242	CCDS54360.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.74|17.74|17.74	3.463667|3.463667|3.463667	0.63513|0.63513|0.63513	.|.|.	.|.|.	ENSG00000179915|ENSG00000179915|ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859|ENST00000412315|ENST00000378262	T;T;T;T;T;T;T;T|.|.	0.72615|.|.	0.81;2.06;0.04;0.02;-0.67;-0.56;-0.26;-0.11|.|.	5.95|5.95|5.95	0.32|0.32|0.32	0.15878|0.15878|0.15878	.|.|.	0.244914|.|.	0.22086|.|.	U|.|.	0.064829|.|.	T|T|T	0.54951|0.54951|0.54951	0.1890|0.1890|0.1890	M|M|M	0.76574|0.76574|0.76574	2.34|2.34|2.34	0.29993|0.29993|0.29993	N|N|N	0.816668|0.816668|0.816668	P;D;P;D;D;P|.|.	0.69078|.|.	0.862;0.997;0.937;0.996;0.996;0.892|.|.	P;D;D;D;D;P|.|.	0.77004|.|.	0.627;0.942;0.935;0.987;0.989;0.797|.|.	T|T|T	0.56098|0.56098|0.56098	-0.8035|-0.8035|-0.8035	10|5|5	0.52906|.|.	T|.|.	0.07|.|.	.|.|.	10.1441|10.1441|10.1441	0.42753|0.42753|0.42753	0.0:0.5209:0.0:0.4791|0.0:0.5209:0.0:0.4791|0.0:0.5209:0.0:0.4791	.|.|.	57;1462;357;1392;1411;54|.|.	B4DIT5;Q9ULB1-3;P58400;F8WB18;A7E294;Q5HYI0|.|.	.;.;NRX1B_HUMAN;.;.;.|.|.	D|T|R	357;311;410;1462;1392;1414;1422;1463;1414;1392|125|59	ENSP00000341184:E357D;ENSP00000385580:E410D;ENSP00000385142:E1462D;ENSP00000384311:E1392D;ENSP00000434015:E1414D;ENSP00000385017:E1422D;ENSP00000385434:E1414D;ENSP00000385681:E1392D|.|.	ENSP00000341184:E357D|.|.	E|K|S	-|-|-	3|2|1	2|0|0	NRXN1|NRXN1|NRXN1	50002844|50002844|50002844	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.996000|0.996000|0.996000	0.52242|0.52242|0.52242	0.988000|0.988000|0.988000	0.76386|0.76386|0.76386	1.245000|1.245000|1.245000	0.32790|0.32790|0.32790	0.040000|0.040000|0.040000	0.15660|0.15660|0.15660	0.460000|0.460000|0.460000	0.39030|0.39030|0.39030	GAA|AAG|AGT	NRXN1	-	NULL	ENSG00000179915		0.532	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	41	0	T			50149340	-1	tier1	-	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	23.08	30	9	SNP	1.000	G
NXPH4	11247	genome.wustl.edu	37	12	57610780	57610780	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:57610780T>A	ENST00000349394.5	+	1	203	c.28T>A	c.(28-30)Ttg>Atg	p.L10M		NM_007224.3	NP_009155.1	O95158	NXPH4_HUMAN	neurexophilin 4	10					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)	10						ATGGTTCCTCTTGCTCTTTGG	0.711																																																	0													28.0	28.0	28.0					12																	57610780		2198	4298	6496	SO:0001583	missense	0			AF043469	CCDS8933.1	12q13.3	2014-09-04			ENSG00000182379	ENSG00000182379			8078	protein-coding gene	gene with protein product		604637				9570794	Standard	NM_007224		Approved	NPH4	uc009zpj.4	O95158	OTTHUMG00000171241	ENST00000349394.5:c.28T>A	12.37:g.57610780T>A	ENSP00000333593:p.Leu10Met		A8K4I4|Q7Z6L3|Q8N462	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.L10M	ENST00000349394.5	37	c.28	CCDS8933.1	12	.	.	.	.	.	.	.	.	.	.	T	29.8	5.036008	0.93630	.	.	ENSG00000182379	ENST00000349394	.	.	.	2.78	0.245	0.15512	.	.	.	.	.	T	0.18467	0.0443	N	0.08118	0	0.23445	N	0.997667	D	0.59357	0.985	P	0.48677	0.586	T	0.11717	-1.0576	8	0.87932	D	0	0.6683	4.7965	0.13276	0.0:0.3154:0.0:0.6846	.	10	O95158	NXPH4_HUMAN	M	10	.	ENSP00000333593:L10M	L	+	1	2	NXPH4	55897047	0.098000	0.21812	0.997000	0.53966	0.992000	0.81027	-0.085000	0.11250	0.221000	0.20879	0.403000	0.27427	TTG	NXPH4	-	pirsf_Neurexophilin	ENSG00000182379		0.711	NXPH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH4	HGNC	protein_coding	OTTHUMT00000412474.1	-	0.00	43	0	T	NM_007224		57610780	+1	tier1	-	no_errors	ENST00000349394	ensembl	human	known	74_37	missense	35.29	22	12	SNP	0.935	A
OBSCN	84033	genome.wustl.edu	37	1	228404905	228404905	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:228404905G>A	ENST00000422127.1	+	8	2613	c.2569G>A	c.(2569-2571)Gca>Aca	p.A857T	OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000570156.2_Missense_Mutation_p.A857T|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A857T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	857	Ig-like 8.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCGGCTGGTGGCAGCCACAGT	0.657																																																	0													42.0	50.0	47.0					1																	228404905		2151	4255	6406	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.2569G>A	1.37:g.228404905G>A	ENSP00000409493:p.Ala857Thr		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.A857T	ENST00000422127.1	37	c.2569	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	12.77	2.036476	0.35893	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.66815	-0.23;-0.23	4.82	3.88	0.44766	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.806988	0.10949	N	0.616251	T	0.54549	0.1865	N	0.13098	0.295	0.28106	N	0.931215	P;P	0.47910	0.801;0.902	B;B	0.44133	0.272;0.442	T	0.48281	-0.9049	10	0.41790	T	0.15	.	13.687	0.62522	0.0:0.1562:0.8438:0.0	.	857;857	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	T	857	ENSP00000284548:A857T;ENSP00000409493:A857T	ENSP00000284548:A857T	A	+	1	0	OBSCN	226471528	0.092000	0.21681	0.004000	0.12327	0.380000	0.30137	0.771000	0.26633	1.214000	0.43395	0.655000	0.94253	GCA	OBSCN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154358		0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding			0.00	78	0	G	NM_052843		228404905	+1			no_errors	ENST00000422127	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.029	A
OBSL1	23363	genome.wustl.edu	37	2	220432568	220432568	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:220432568G>A	ENST00000404537.1	-	3	1462	c.1406C>T	c.(1405-1407)cCg>cTg	p.P469L	OBSL1_ENST00000603926.1_Missense_Mutation_p.P469L|OBSL1_ENST00000289656.3_Missense_Mutation_p.P56L|OBSL1_ENST00000373873.4_Missense_Mutation_p.P469L|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000265318.4_Missense_Mutation_p.P469L|OBSL1_ENST00000373876.1_Missense_Mutation_p.P469L	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	469					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GCAGATGACCGGCAGCTCCTC	0.632																																																	0													43.0	48.0	46.0					2																	220432568		2150	4259	6409	SO:0001583	missense	0			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1406C>T	2.37:g.220432568G>A	ENSP00000385636:p.Pro469Leu		A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P469L	ENST00000404537.1	37	c.1406	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	G	9.299	1.052491	0.19907	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28;-1.28	4.83	3.94	0.45596	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80449	0.4625	L	0.29908	0.895	0.23492	N	0.997566	D;B;P	0.89917	1.0;0.124;0.642	D;B;B	0.91635	0.999;0.013;0.087	T	0.68014	-0.5521	9	0.49607	T	0.09	.	3.1736	0.06561	0.1469:0.1488:0.5511:0.1533	.	469;56;469	O75147;A8MSZ8;O75147-2	OBSL1_HUMAN;.;.	L	469;469;469;469;56	ENSP00000265318:P469L;ENSP00000385636:P469L;ENSP00000362983:P469L;ENSP00000362980:P469L;ENSP00000289656:P56L	ENSP00000265318:P469L	P	-	2	0	OBSL1	220140812	0.006000	0.16342	0.952000	0.39060	0.124000	0.20399	0.326000	0.19646	2.235000	0.73313	0.484000	0.47621	CCG	OBSL1	-	smart_Ig_sub	ENSG00000124006		0.632	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	-	0.00	62	0	G			220432568	-1	tier1	-	no_errors	ENST00000404537	ensembl	human	known	74_37	missense	57.97	29	40	SNP	0.047	A
OR10J1	26476	genome.wustl.edu	37	1	159410362	159410362	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:159410362C>T	ENST00000423932.3	+	1	851	c.814C>T	c.(814-816)Ccc>Tcc	p.P272S	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	272					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					CTACCTCAAGCCCAAGTCAGA	0.522																																																	0													161.0	132.0	142.0					1																	159410362		2203	4300	6503	SO:0001583	missense	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.814C>T	1.37:g.159410362C>T	ENSP00000399078:p.Pro272Ser		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P272S	ENST00000423932.3	37	c.814	CCDS1185.1	1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216114	0.58452	.	.	ENSG00000196184	ENST00000423932	T	0.00262	8.4	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41097	D	0.000944	T	0.00210	0.0006	M	0.71871	2.18	0.32398	N	0.552387	P	0.44195	0.828	P	0.50934	0.654	T	0.59600	-0.7424	10	0.66056	D	0.02	.	14.9127	0.70770	0.0:1.0:0.0:0.0	.	272	P30954	O10J1_HUMAN	S	272	ENSP00000399078:P272S	ENSP00000399078:P272S	P	+	1	0	OR10J1	157676986	0.429000	0.25530	1.000000	0.80357	0.988000	0.76386	1.867000	0.39499	2.423000	0.82170	0.650000	0.86243	CCC	OR10J1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196184		0.522	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	-	0.00	46	0	C	NM_012351		159410362	+1	tier1	-	no_errors	ENST00000423932	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
OR11H12	440153	genome.wustl.edu	37	14	19377744	19377744	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:19377744G>A	ENST00000550708.1	+	1	223	c.151G>A	c.(151-153)Gca>Aca	p.A51T		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACAACATATGCACTGACTAT	0.403																																																	0													76.0	83.0	80.0					14																	19377744		1635	3342	4977	SO:0001583	missense	0				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.151G>A	14.37:g.19377744G>A	ENSP00000449002:p.Ala51Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A51T	ENST00000550708.1	37	c.151	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	g	3.520	-0.098030	0.07010	.	.	ENSG00000257115	ENST00000550708	T	0.02974	4.09	.	.	.	.	2.010050	0.03332	N	0.193590	T	0.02156	0.0067	N	0.11201	0.11	0.23665	N	0.997167	B	0.02656	0.0	B	0.08055	0.003	T	0.43829	-0.9367	8	0.42905	T	0.14	.	6.4784	0.22049	2.0E-4:0.0:0.9998:0.0	.	51	B2RN74	O11HC_HUMAN	T	51	ENSP00000449002:A51T	ENSP00000449002:A51T	A	+	1	0	CR383656.1	18447744	0.000000	0.05858	0.787000	0.31911	0.058000	0.15608	-3.915000	0.00335	0.413000	0.25759	0.064000	0.15345	GCA	OR11H12	-	prints_GPCR_Rhodpsn	ENSG00000257115		0.403	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1	-	0.00	132	0	G	NM_001013354		19377744	+1	tier1	-	no_errors	ENST00000550708	ensembl	human	known	74_37	missense	19.28	67	16	SNP	0.131	A
OR1N1	138883	genome.wustl.edu	37	9	125289092	125289092	+	Missense_Mutation	SNP	T	T	C	rs569728151	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:125289092T>C	ENST00000304880.2	-	1	480	c.481A>G	c.(481-483)Atg>Gtg	p.M161V		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.M161V(1)		breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AACCGAGCCATGAGGAACGTG	0.517													T|||	3	0.000599042	0.0	0.0	5008	,	,		23160	0.003		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	central_nervous_system(1)											102.0	84.0	90.0					9																	125289092		2203	4300	6503	SO:0001583	missense	0			U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.481A>G	9.37:g.125289092T>C	ENSP00000306974:p.Met161Val		A3KFM1|O43870|Q6IF16|Q96R93	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M161V	ENST00000304880.2	37	c.481	CCDS6844.1	9	.	.	.	.	.	.	.	.	.	.	T	8.086	0.773469	0.16051	.	.	ENSG00000171505	ENST00000304880	T	0.00058	8.79	3.75	-7.31	0.01441	GPCR, rhodopsin-like superfamily (1);	0.178299	0.26373	U	0.024742	T	0.00039	0.0001	N	0.02697	-0.525	0.09310	N	1	B	0.18166	0.026	B	0.20577	0.03	T	0.40515	-0.9559	10	0.07030	T	0.85	.	9.1007	0.36667	0.0:0.1575:0.5634:0.2791	.	161	Q8NGS0	OR1N1_HUMAN	V	161	ENSP00000306974:M161V	ENSP00000306974:M161V	M	-	1	0	OR1N1	124328913	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-2.501000	0.00966	-1.071000	0.03145	-0.508000	0.04489	ATG	OR1N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171505		0.517	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N1	HGNC	protein_coding	OTTHUMT00000053938.1	-	0.00	29	0	T			125289092	-1	tier1	-	no_errors	ENST00000304880	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.000	C
OR5I1	10798	genome.wustl.edu	37	11	55703643	55703643	+	Missense_Mutation	SNP	G	G	T	rs144543203		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:55703643G>T	ENST00000301532.3	-	1	233	c.234C>A	c.(232-234)gaC>gaA	p.D78E		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	78					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D78E(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TGGGAACAATGTCTGAGAAAT	0.383																																																	1	Substitution - Missense(1)	prostate(1)											49.0	51.0	50.0					11																	55703643		2198	4295	6493	SO:0001583	missense	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.234C>A	11.37:g.55703643G>T	ENSP00000301532:p.Asp78Glu		Q6IEU4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D78E	ENST00000301532.3	37	c.234	CCDS7949.1	11	.	.	.	.	.	.	.	.	.	.	G	11.17	1.558810	0.27827	.	.	ENSG00000167825	ENST00000301532	T	0.00428	7.44	5.05	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.338625	0.21274	N	0.077269	T	0.00241	0.0007	L	0.34521	1.04	0.09310	N	1	B	0.17667	0.023	B	0.12837	0.008	T	0.49716	-0.8910	10	0.72032	D	0.01	.	1.8233	0.03115	0.1784:0.1621:0.4922:0.1674	.	78	Q13606	OR5I1_HUMAN	E	78	ENSP00000301532:D78E	ENSP00000301532:D78E	D	-	3	2	OR5I1	55460219	0.000000	0.05858	0.974000	0.42286	0.631000	0.37964	-1.582000	0.02117	0.624000	0.30286	0.637000	0.83480	GAC	OR5I1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000167825		0.383	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	-	0.00	28	0	G	NM_006637		55703643	-1	tier1	-	no_errors	ENST00000301532	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.024	T
OR6C68	403284	genome.wustl.edu	37	12	55886563	55886563	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:55886563G>T	ENST00000548615.1	+	1	402	c.402G>T	c.(400-402)atG>atT	p.M134I	OR6C68_ENST00000379662.1_Missense_Mutation_p.M139I|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						TGGCAATCATGAGCAACAAAG	0.403																																																	0													161.0	147.0	152.0					12																	55886563		2203	4300	6503	SO:0001583	missense	0				CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.402G>T	12.37:g.55886563G>T	ENSP00000448811:p.Met134Ile			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.M139I	ENST00000548615.1	37	c.417	CCDS31826.2	12	.	.	.	.	.	.	.	.	.	.	G	10.46	1.355972	0.24598	.	.	ENSG00000205327	ENST00000379662;ENST00000548615	T;T	0.00551	6.65;6.65	4.77	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000008	T	0.01222	0.0040	M	0.85859	2.78	0.31817	N	0.626436	B	0.27625	0.183	B	0.28638	0.092	T	0.03112	-1.1071	10	0.62326	D	0.03	.	17.9913	0.89170	0.0:0.0:1.0:0.0	.	134	A6NDL8	O6C68_HUMAN	I	139;134	ENSP00000368983:M139I;ENSP00000448811:M134I	ENSP00000368983:M139I	M	+	3	0	OR6C68	54172830	1.000000	0.71417	0.993000	0.49108	0.014000	0.08584	3.745000	0.55119	2.648000	0.89879	0.603000	0.83216	ATG	OR6C68	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000205327		0.403	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C68	HGNC	protein_coding	OTTHUMT00000406677.1	-	0.00	53	0	G			55886563	+1	tier1	-	no_errors	ENST00000379662	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ORC3	23595	genome.wustl.edu	37	6	88313147	88313147	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:88313147G>T	ENST00000392844.3	+	4	271	c.223G>T	c.(223-225)Gaa>Taa	p.E75*	ORC3_ENST00000417380.2_Nonsense_Mutation_p.E22*|ORC3_ENST00000257789.4_Nonsense_Mutation_p.E75*|ORC3_ENST00000546266.1_5'UTR	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	75					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						CAATCTGATTGAATTTCTGCA	0.323																																																	0													63.0	63.0	63.0					6																	88313147		2203	4300	6503	SO:0001587	stop_gained	0			AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.223G>T	6.37:g.88313147G>T	ENSP00000376586:p.Glu75*		A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Nonsense_Mutation	SNP	pfam_ORC3	p.E75*	ENST00000392844.3	37	c.223	CCDS43486.1	6	.	.	.	.	.	.	.	.	.	.	G	16.18	3.049890	0.55218	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000417380	.	.	.	5.66	4.79	0.61399	.	0.463597	0.24820	N	0.035331	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	15.991	11.3586	0.49630	0.1572:0.0:0.8428:0.0	.	.	.	.	X	75;75;22	.	ENSP00000257789:E75X	E	+	1	0	ORC3	88369866	1.000000	0.71417	0.991000	0.47740	0.074000	0.17049	1.921000	0.40035	1.404000	0.46819	0.585000	0.79938	GAA	ORC3	-	pfam_ORC3	ENSG00000135336		0.323	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ORC3	HGNC	protein_coding	OTTHUMT00000041452.2		0.00	46	0	G			88313147	+1			no_errors	ENST00000257789	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	0.997	T
OTOG	340990	genome.wustl.edu	37	11	17667382	17667382	+	Missense_Mutation	SNP	G	G	A	rs375127426		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:17667382G>A	ENST00000399391.2	+	55	8669	c.8669G>A	c.(8668-8670)cGt>cAt	p.R2890H	OTOG_ENST00000399397.1_Missense_Mutation_p.R2817H	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	2890	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						AAGTGCTGCCGTGAGGTGGGC	0.607																																																	0																																										SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.8669G>A	11.37:g.17667382G>A	ENSP00000382323:p.Arg2890His		A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.R2890H	ENST00000399391.2	37	c.8669	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.272956	0.95429	.	.	ENSG00000188162	ENST00000399391;ENST00000399397	T;T	0.17854	2.25;2.36	5.03	5.03	0.67393	.	0.000000	0.51477	U	0.000082	T	0.37865	0.1019	M	0.68593	2.085	0.58432	D	0.999998	.	.	.	.	.	.	T	0.12451	-1.0547	8	0.56958	D	0.05	.	18.3898	0.90478	0.0:0.0:1.0:0.0	.	.	.	.	H	2890;2817	ENSP00000382323:R2890H;ENSP00000382329:R2817H	ENSP00000382323:R2890H	R	+	2	0	OTOG	17623958	1.000000	0.71417	0.948000	0.38648	0.988000	0.76386	9.041000	0.93788	2.349000	0.79799	0.561000	0.74099	CGT	OTOG	-	smart_Cys_knot_C,pfscan_Cys_knot_C	ENSG00000188162		0.607	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		-	0.00	17	0	G			17667382	+1	tier1	-	no_errors	ENST00000399391	ensembl	human	known	74_37	missense	44.44	15	12	SNP	1.000	A
OTUB2	78990	genome.wustl.edu	37	14	94503806	94503806	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:94503806C>A	ENST00000203664.5	+	2	293	c.84C>A	c.(82-84)taC>taA	p.Y28*	OTUB2_ENST00000553723.1_Nonsense_Mutation_p.Y28*	NM_023112.3	NP_075601.1	Q96DC9	OTUB2_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 2	28					cellular amino acid metabolic process (GO:0006520)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)	5		all_cancers(154;0.12)		Epithelial(152;0.124)|all cancers(159;0.21)|COAD - Colon adenocarcinoma(157;0.215)		ACAGGATTTACCGGAGGAAAA	0.458											OREG0022890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													60.0	60.0	60.0					14																	94503806		2203	4300	6503	SO:0001587	stop_gained	0			AF318378	CCDS9917.1	14q32.13-q32.2	2014-02-24	2014-02-24	2004-05-28		ENSG00000089723		"""OTU domain containing"""	20351	protein-coding gene	gene with protein product		608338	"""chromosome 14 open reading frame 137"", ""OTU domain, ubiquitin aldehyde binding 2"""	C14orf137		12704427, 19996094	Standard	NM_023112		Approved	FLJ21916, MGC3102	uc001ych.4	Q96DC9		ENST00000203664.5:c.84C>A	14.37:g.94503806C>A	ENSP00000203664:p.Tyr28*	163	Q6IA10|Q9H6T1	Nonsense_Mutation	SNP	pfam_Peptidase_C65_otubain,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	p.Y28*	ENST00000203664.5	37	c.84	CCDS9917.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.961977	0.97151	.	.	ENSG00000089723	ENST00000203664;ENST00000553723	.	.	.	5.77	2.97	0.34412	.	0.305618	0.31963	N	0.006784	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.1455	6.8608	0.24066	0.0:0.662:0.0:0.338	.	.	.	.	X	28	.	ENSP00000203664:Y28X	Y	+	3	2	OTUB2	93573559	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	0.223000	0.17719	0.912000	0.36772	0.655000	0.94253	TAC	OTUB2	-	pfam_Peptidase_C65_otubain,pirsf_Ubiquitin_thioesterase_Otubain	ENSG00000089723		0.458	OTUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB2	HGNC	protein_coding	OTTHUMT00000412855.1	-	0.00	51	0	C			94503806	+1	tier1	-	no_errors	ENST00000203664	ensembl	human	known	74_37	nonsense	23.08	30	9	SNP	1.000	A
P2RY6	5031	genome.wustl.edu	37	11	73007970	73007970	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:73007970A>T	ENST00000393590.2	+	2	706	c.407A>T	c.(406-408)cAc>cTc	p.H136L	P2RY6_ENST00000393591.1_Missense_Mutation_p.H136L|P2RY6_ENST00000393592.2_Missense_Mutation_p.H136L|P2RY6_ENST00000542092.1_Missense_Mutation_p.H136L|P2RY6_ENST00000349767.2_Missense_Mutation_p.H136L|P2RY6_ENST00000540342.1_Missense_Mutation_p.H136L|P2RY6_ENST00000538328.1_Missense_Mutation_p.H136L|P2RY6_ENST00000540124.1_Missense_Mutation_p.H136L	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	136					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						GCCCCCTGGCACAAACGTGGG	0.657																																																	0													43.0	46.0	45.0					11																	73007970		2200	4293	6493	SO:0001583	missense	0				CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.407A>T	11.37:g.73007970A>T	ENSP00000377215:p.His136Leu		Q15754	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y6_rcpt,prints_GPCR_Rhodpsn,prints_P2Y3_rcpt,prints_Protea_act_rcpt	p.H136L	ENST00000393590.2	37	c.407	CCDS8220.1	11	.	.	.	.	.	.	.	.	.	.	A	16.24	3.068310	0.55539	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	4.31	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.258871	0.38605	N	0.001635	T	0.65678	0.2714	N	0.05414	-0.055	0.44719	D	0.997716	D	0.64830	0.994	P	0.61658	0.892	T	0.69818	-0.5042	10	0.42905	T	0.14	.	13.0927	0.59174	1.0:0.0:0.0:0.0	.	136	Q15077	P2RY6_HUMAN	L	136	ENSP00000443427:H136L;ENSP00000445652:H136L;ENSP00000309771:H136L;ENSP00000377217:H136L;ENSP00000377216:H136L;ENSP00000442551:H136L;ENSP00000377215:H136L;ENSP00000440770:H136L;ENSP00000442990:H136L	ENSP00000309771:H136L	H	+	2	0	P2RY6	72685618	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.666000	0.54540	1.922000	0.55676	0.402000	0.26972	CAC	P2RY6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y3_rcpt	ENSG00000171631		0.657	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	P2RY6	HGNC	protein_coding	OTTHUMT00000397349.1		0.00	36	0	A			73007970	+1			no_errors	ENST00000349767	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
PARN	5073	genome.wustl.edu	37	16	14540882	14540882	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:14540882G>T	ENST00000437198.2	-	23	1868	c.1727C>A	c.(1726-1728)gCt>gAt	p.A576D	PARN_ENST00000539279.1_Missense_Mutation_p.A401D|PARN_ENST00000420015.2_Missense_Mutation_p.A530D|PARN_ENST00000341484.7_Missense_Mutation_p.A515D	NM_001134477.2|NM_002582.3	NP_001127949.1|NP_002573.1	O95453	PARN_HUMAN	poly(A)-specific ribonuclease	576					female gamete generation (GO:0007292)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA metabolic process (GO:0016070)|RNA modification (GO:0009451)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|nuclease activity (GO:0004518)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(A)-specific ribonuclease activity (GO:0004535)|protein kinase binding (GO:0019901)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|urinary_tract(1)	21						CTCCAGGCCAGCTTCCTCTTG	0.493																																																	0													82.0	80.0	81.0					16																	14540882		1909	4128	6037	SO:0001583	missense	0			AJ005698	CCDS45419.1, CCDS45420.1, CCDS58425.1	16p13	2014-08-08	2011-07-07		ENSG00000140694	ENSG00000140694	3.1.13.4		8609	protein-coding gene	gene with protein product	"""deadenylation nuclease"""	604212	"""poly(A)-specific ribonuclease (deadenylation nuclease)"""			10640832	Standard	NM_002582		Approved	DAN	uc010uzd.2	O95453	OTTHUMG00000173199	ENST00000437198.2:c.1727C>A	16.37:g.14540882G>T	ENSP00000387911:p.Ala576Asp		B2RCB3|B4DDG8|B4DWR4|B4E1H6	Missense_Mutation	SNP	pfam_RNase_CAF1,pfam_PolyA-riboNase_RNA_binding,pfam_R3H_ss-bd,superfamily_RNaseH-like_dom,pfscan_R3H_ss-bd	p.A576D	ENST00000437198.2	37	c.1727	CCDS45419.1	16	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130571	0.37630	.	.	ENSG00000140694	ENST00000437198;ENST00000341484;ENST00000420015;ENST00000539279	.	.	.	5.51	2.33	0.28932	.	1.113020	0.06882	N	0.802654	T	0.22003	0.0530	N	0.24115	0.695	0.09310	N	1	P;B;B	0.35433	0.501;0.006;0.007	B;B;B	0.25140	0.058;0.005;0.007	T	0.14282	-1.0478	9	0.18710	T	0.47	-0.021	10.1596	0.42844	0.0:0.2778:0.5782:0.144	.	401;530;576	B4DSB0;B4DWR4;O95453	.;.;PARN_HUMAN	D	576;515;530;401	.	ENSP00000345456:A515D	A	-	2	0	PARN	14448383	0.957000	0.32711	0.001000	0.08648	0.862000	0.49288	1.186000	0.32078	0.319000	0.23209	0.650000	0.86243	GCT	PARN	-	NULL	ENSG00000140694		0.493	PARN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARN	HGNC	protein_coding	OTTHUMT00000422383.1	-	0.00	61	0	G	NM_002582		14540882	-1	tier1	-	no_errors	ENST00000437198	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.034	T
PAX4	5078	genome.wustl.edu	37	7	127251732	127251733	+	Splice_Site	INS	-	-	A	rs35434068|rs375404897|rs386411245		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:127251732_127251733insA	ENST00000341640.2	-	8	953		c.e8-2		PAX4_ENST00000338516.3_Splice_Site|PAX4_ENST00000463946.1_Splice_Site|PAX4_ENST00000378740.2_Splice_Site	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4						cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						AGGGGACTGCTAAAAAAAAAAA	0.569																																					Ovarian(113;737 1605 7858 27720 34092)												0																																										SO:0001630	splice_region_variant	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.748-2->T	7.37:g.127251743_127251743dupA			O95161|Q6B0H0	Splice_Site	INS	-	e8-2	ENST00000341640.2	37	c.748-3_748-2	CCDS5797.1	7																																																																																			PAX4	-	-	ENSG00000106331		0.569	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1		0.00	16	0	-		Intron	127251733	-1	tier1		no_errors	ENST00000341640	ensembl	human	known	74_37	splice_site_ins	21.05	15	4	INS	0.745:0.624	A
PAX4	5078	genome.wustl.edu	37	7	127255001	127255001	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:127255001A>G	ENST00000341640.2	-	2	474	c.269T>C	c.(268-270)cTc>cCc	p.L90P	PAX4_ENST00000338516.3_Missense_Mutation_p.L98P|PAX4_ENST00000463946.1_Missense_Mutation_p.L88P|PAX4_ENST00000378740.2_Missense_Mutation_p.L90P	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	98	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						CCAGGCAAAGAGGGCTGGACA	0.602																																					Ovarian(113;737 1605 7858 27720 34092)												0													67.0	62.0	64.0					7																	127255001		2203	4300	6503	SO:0001583	missense	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.269T>C	7.37:g.127255001A>G	ENSP00000339906:p.Leu90Pro		O95161|Q6B0H0	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.L90P	ENST00000341640.2	37	c.269	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	A	21.9	4.213052	0.79352	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740;ENST00000463946	D;D;D	0.99494	-6.01;-6.01;-6.01	5.63	5.63	0.86233	Paired box protein, N-terminal (3);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.132950	0.50627	D	0.000117	D	0.99190	0.9719	L	0.52573	1.65	0.80722	D	1	D;D;D;D	0.76494	0.991;0.997;0.985;0.999	P;D;D;D	0.68192	0.891;0.952;0.956;0.95	D	0.99342	1.0912	10	0.87932	D	0	.	13.7833	0.63094	1.0:0.0:0.0:0.0	.	90;88;98;88	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	P	90;98;98;88	ENSP00000339906:L90P;ENSP00000344297:L98P;ENSP00000451923:L88P	ENSP00000344297:L98P	L	-	2	0	PAX4	127042237	1.000000	0.71417	0.768000	0.31515	0.787000	0.44495	9.173000	0.94815	2.130000	0.65690	0.533000	0.62120	CTC	PAX4	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom	ENSG00000106331		0.602	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1		0.00	24	0	A			127255001	-1			no_errors	ENST00000341640	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	G
PCDH11X	27328	genome.wustl.edu	37	X	91090519	91090519	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:91090519G>T	ENST00000373094.1	+	1	861	c.16G>T	c.(16-18)Ggg>Tgg	p.G6W	PCDH11X_ENST00000406881.1_Missense_Mutation_p.G6W|PCDH11X_ENST00000298274.8_Missense_Mutation_p.G6W|PCDH11X_ENST00000395337.2_Missense_Mutation_p.G6W|PCDH11X_ENST00000504220.2_Missense_Mutation_p.G6W|PCDH11X_ENST00000361724.1_Missense_Mutation_p.G6W|PCDH11X_ENST00000361655.2_Missense_Mutation_p.G6W|PCDH11X_ENST00000373097.1_Missense_Mutation_p.G6W|PCDH11X_ENST00000373088.1_Missense_Mutation_p.G6W	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	6					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTTGTTGTCCGGGACGTACAT	0.478																																					NSCLC(38;925 1092 2571 38200 45895)												0													127.0	105.0	113.0					X																	91090519		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.16G>T	X.37:g.91090519G>T	ENSP00000362186:p.Gly6Trp		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G6W	ENST00000373094.1	37	c.16	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	15.38	2.816952	0.50633	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.53640	0.62;0.65;0.66;0.61;0.67;0.65;0.64;0.67;0.67	4.46	4.46	0.54185	.	0.191668	0.38326	N	0.001732	T	0.48943	0.1528	N	0.08118	0	0.35670	D	0.813245	D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.79784	0.981;0.99;0.993;0.993;0.993;0.985;0.989;0.989	T	0.65944	-0.6045	10	0.59425	D	0.04	.	15.517	0.75833	0.0:0.0:1.0:0.0	.	6;6;6;6;6;6;6;6	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	W	6	ENSP00000378746:G6W;ENSP00000362186:G6W;ENSP00000362189:G6W;ENSP00000355040:G6W;ENSP00000362180:G6W;ENSP00000423762:G6W;ENSP00000355105:G6W;ENSP00000384758:G6W;ENSP00000298274:G6W	ENSP00000298274:G6W	G	+	1	0	PCDH11X	90977175	1.000000	0.71417	1.000000	0.80357	0.694000	0.40290	5.530000	0.67141	1.935000	0.56089	0.415000	0.27848	GGG	PCDH11X	-	NULL	ENSG00000102290		0.478	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	52	0	G	NM_032969		91090519	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	54.55	30	36	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55912910	55912910	+	Silent	SNP	A	A	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:55912910A>C	ENST00000320301.6	-	14	2128	c.1734T>G	c.(1732-1734)acT>acG	p.T578T	PCDH15_ENST00000409834.1_Silent_p.T189T|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000437009.1_Silent_p.T578T|PCDH15_ENST00000373965.2_Silent_p.T585T|PCDH15_ENST00000373955.1_Silent_p.T578T|PCDH15_ENST00000414778.1_Silent_p.T583T|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395445.1_Silent_p.T585T|PCDH15_ENST00000395430.1_Silent_p.T578T|PCDH15_ENST00000395446.1_Silent_p.T578T|PCDH15_ENST00000395432.2_Silent_p.T541T|PCDH15_ENST00000373957.3_Silent_p.T556T|PCDH15_ENST00000395433.1_Silent_p.T556T|PCDH15_ENST00000395438.1_Silent_p.T578T|PCDH15_ENST00000361849.3_Silent_p.T578T	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	578	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGAGTGCGTAAGTCCGCCCGA	0.488										HNSCC(58;0.16)																																							0													137.0	119.0	125.0					10																	55912910		2203	4300	6503	SO:0001819	synonymous_variant	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1734T>G	10.37:g.55912910A>C			A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T578	ENST00000320301.6	37	c.1734	CCDS7248.1	10																																																																																			PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000150275		0.488	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	49	0	A	NM_033056		55912910	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.861	C
PCDHA1	56147	genome.wustl.edu	37	5	140167566	140167566	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:140167566C>T	ENST00000504120.2	+	1	1691	c.1691C>T	c.(1690-1692)gCg>gTg	p.A564V	PCDHA1_ENST00000378133.3_Missense_Mutation_p.A564V|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	564	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACGCGCCGGCGCTGCTGGCG	0.677																																																	0													83.0	83.0	83.0					5																	140167566		2203	4299	6502	SO:0001583	missense	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.1691C>T	5.37:g.140167566C>T	ENSP00000420840:p.Ala564Val		O75288|Q9NRT7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A564V	ENST00000504120.2	37	c.1691	CCDS54913.1	5	.	.	.	.	.	.	.	.	.	.	c	0.989	-0.694663	0.03303	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	T;T	0.34667	1.35;1.35	3.68	-0.641	0.11490	Cadherin (3);Cadherin-like (1);	0.685951	0.11751	N	0.532999	T	0.09598	0.0236	N	0.01874	-0.695	0.09310	N	1	B;B	0.16166	0.014;0.016	B;B	0.15484	0.002;0.013	T	0.28776	-1.0033	10	0.09084	T	0.74	.	1.0763	0.01633	0.1619:0.3761:0.1608:0.3012	.	564;564	Q9Y5I3;Q9Y5I3-3	PCDA1_HUMAN;.	V	564	ENSP00000420840:A564V;ENSP00000367373:A564V	ENSP00000367373:A564V	A	+	2	0	PCDHA1	140147750	0.000000	0.05858	0.004000	0.12327	0.317000	0.28152	-0.323000	0.07997	-0.126000	0.11682	-0.516000	0.04426	GCG	PCDHA1	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000204970		0.677	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	-	0.00	148	0	C	NM_018900		140167566	+1	tier1	-	no_errors	ENST00000504120	ensembl	human	known	74_37	missense	22.14	102	29	SNP	0.003	T
PCDHA6	56142	genome.wustl.edu	37	5	140207737	140207737	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:140207737C>T	ENST00000529310.1	+	1	175	c.61C>T	c.(61-63)Ctc>Ttc	p.L21F	PCDHA6_ENST00000527624.1_Missense_Mutation_p.L21F|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	21					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTCTGCTCCTCGCAGCCTG	0.577																																																	0													83.0	95.0	91.0					5																	140207737		2203	4300	6503	SO:0001583	missense	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.61C>T	5.37:g.140207737C>T	ENSP00000433378:p.Leu21Phe		O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L21F	ENST00000529310.1	37	c.61	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	C	8.675	0.903795	0.17760	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.57273	0.57;0.41	4.4	0.452	0.16634	.	0.265359	0.19702	U	0.108008	T	0.43411	0.1246	L	0.49571	1.57	0.09310	N	0.999996	B;B;D	0.54601	0.016;0.005;0.967	B;B;P	0.46543	0.029;0.013;0.52	T	0.43829	-0.9367	10	0.09590	T	0.72	.	9.0853	0.36577	0.0:0.5808:0.0:0.4192	.	21;21;21	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	F	21	ENSP00000433378:L21F;ENSP00000434113:L21F	ENSP00000434113:L21F	L	+	1	0	PCDHA6	140187921	0.000000	0.05858	0.038000	0.18304	0.218000	0.24690	-0.360000	0.07622	0.081000	0.16988	0.313000	0.20887	CTC	PCDHA6	-	NULL	ENSG00000081842		0.577	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	-	0.00	66	0	C	NM_018909		140207737	+1	tier1	-	no_errors	ENST00000529310	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.616	T
PCNX	22990	genome.wustl.edu	37	14	71571966	71571966	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:71571966G>T	ENST00000304743.2	+	33	6556	c.6110G>T	c.(6109-6111)tGc>tTc	p.C2037F	PCNX_ENST00000238570.5_Missense_Mutation_p.C1965F|PCNX_ENST00000556272.1_3'UTR|PCNX_ENST00000439984.3_Missense_Mutation_p.C1926F	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	2037						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AGGAAAGGTTGCGGAGCTGGA	0.428																																																	0													94.0	86.0	89.0					14																	71571966		2203	4300	6503	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.6110G>T	14.37:g.71571966G>T	ENSP00000304192:p.Cys2037Phe		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.C2037F	ENST00000304743.2	37	c.6110	CCDS9806.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.50|19.50	3.839320|3.839320	0.71488|0.71488	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|T;T;T	.|0.12672	.|2.96;3.04;2.66	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.43077|0.43077	0.1231|0.1231	M|M	0.79693|0.79693	2.465|2.465	0.52501|0.52501	D|D	0.999951|0.999951	.|D;D;D	.|0.76494	.|0.999;0.997;0.998	.|D;D;D	.|0.83275	.|0.996;0.945;0.993	T|T	0.34976|0.34976	-0.9807|-0.9807	5|10	.|0.59425	.|D	.|0.04	.|.	19.4064|19.4064	0.94649|0.94649	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1965;1926;2037	.|Q96RV3-3;B2RTR6;Q96RV3	.|.;.;PCX1_HUMAN	S|F	1024|2037;1965;1926	.|ENSP00000304192:C2037F;ENSP00000238570:C1965F;ENSP00000396617:C1926F	.|ENSP00000238570:C1965F	A|C	+|+	1|2	0|0	PCNX|PCNX	70641719|70641719	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	9.476000|9.476000	0.97823|0.97823	2.582000|2.582000	0.87167|0.87167	0.655000|0.655000	0.94253|0.94253	GCG|TGC	PCNX	-	NULL	ENSG00000100731		0.428	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	-	0.00	69	0	G	NM_014982		71571966	+1	tier1	-	no_errors	ENST00000304743	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PCOLCE2	26577	genome.wustl.edu	37	3	142606566	142606566	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:142606566C>T	ENST00000295992.3	-	2	443	c.137G>A	c.(136-138)aGt>aAt	p.S46N	PCOLCE2_ENST00000485766.1_Missense_Mutation_p.S46N|PCOLCE2_ENST00000461818.1_5'UTR	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	46	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)	p.S46I(1)		NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						AAAACCTTCACTGCCAATAAA	0.388																																																	1	Substitution - Missense(1)	endometrium(1)											84.0	85.0	85.0					3																	142606566		2203	4300	6503	SO:0001583	missense	0			AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.137G>A	3.37:g.142606566C>T	ENSP00000295992:p.Ser46Asn		B2RCH9|D3DNG4|Q9BRH3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Netrin_module_non-TIMP,superfamily_CUB_dom,superfamily_TIMP-like_OB-fold,smart_CUB_dom,smart_Netrin_module_non-TIMP,pfscan_CUB_dom,pfscan_Netrin_domain	p.S46N	ENST00000295992.3	37	c.137	CCDS3127.1	3	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933143	0.92458	.	.	ENSG00000163710	ENST00000295992;ENST00000485766	T;T	0.30981	1.51;1.51	5.66	5.66	0.87406	CUB (5);	0.000000	0.85682	D	0.000000	T	0.71143	0.3305	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81949	-0.0699	10	0.87932	D	0	-29.6912	17.2324	0.86988	0.0:1.0:0.0:0.0	.	46	Q9UKZ9	PCOC2_HUMAN	N	46	ENSP00000295992:S46N;ENSP00000419842:S46N	ENSP00000295992:S46N	S	-	2	0	PCOLCE2	144089256	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.053000	0.76641	2.662000	0.90505	0.655000	0.94253	AGT	PCOLCE2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000163710		0.388	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	HGNC	protein_coding	OTTHUMT00000354509.1		0.00	18	0	C	NM_013363		142606566	-1			no_errors	ENST00000295992	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
PGC	5225	genome.wustl.edu	37	6	41710097	41710097	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:41710097G>T	ENST00000373025.3	-	5	640	c.578C>A	c.(577-579)aCc>aAc	p.T193N	PGC_ENST00000425343.2_Missense_Mutation_p.T193N	NM_002630.3	NP_002621.1	P20142	PEPC_HUMAN	progastricsin (pepsinogen C)	193					digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.T193I(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|skin(1)	16	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			CATAGCTGTGGTGGCCTCATC	0.607																																																	1	Substitution - Missense(1)	large_intestine(1)											124.0	92.0	103.0					6																	41710097		2203	4300	6503	SO:0001583	missense	0				CCDS4859.1, CCDS55000.1	6p21.1	2012-10-02			ENSG00000096088	ENSG00000096088	3.4.23.3		8890	protein-coding gene	gene with protein product		169740					Standard	NM_002630		Approved		uc003ora.2	P20142	OTTHUMG00000014683	ENST00000373025.3:c.578C>A	6.37:g.41710097G>T	ENSP00000362116:p.Thr193Asn		B4DVZ3|Q5T3D7|Q5T3D8	Missense_Mutation	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.T193N	ENST00000373025.3	37	c.578	CCDS4859.1	6	.	.	.	.	.	.	.	.	.	.	G	12.71	2.018421	0.35606	.	.	ENSG00000096088	ENST00000373025;ENST00000424183;ENST00000356667;ENST00000425343	T;T;T	0.58210	0.35;0.35;0.35	4.42	2.63	0.31362	Peptidase aspartic (1);Peptidase aspartic, catalytic (1);	0.135895	0.47093	D	0.000254	T	0.42720	0.1215	M	0.79693	2.465	0.33398	D	0.576943	D	0.54047	0.964	P	0.46076	0.503	T	0.48647	-0.9017	10	0.59425	D	0.04	.	9.4833	0.38913	0.08:0.1434:0.7767:0.0	.	193	P20142	PEPC_HUMAN	N	193;114;114;193	ENSP00000362116:T193N;ENSP00000349094:T114N;ENSP00000405094:T193N	ENSP00000349094:T114N	T	-	2	0	PGC	41818075	1.000000	0.71417	0.566000	0.28421	0.029000	0.11900	2.772000	0.47678	0.494000	0.27859	0.561000	0.74099	ACC	PGC	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom	ENSG00000096088		0.607	PGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGC	HGNC	protein_coding	OTTHUMT00000040521.2		0.00	27	0	G			41710097	-1			no_errors	ENST00000373025	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.997	T
PIP4K2B	8396	genome.wustl.edu	37	17	36927513	36927513	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:36927513G>T	ENST00000269554.3	-	8	1300	c.820C>A	c.(820-822)Ctg>Atg	p.L274M		NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	274	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						ATGATCTTCAGCTGTGCCAAG	0.572																																																	0													93.0	77.0	82.0					17																	36927513		2203	4300	6503	SO:0001583	missense	0			U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.820C>A	17.37:g.36927513G>T	ENSP00000269554:p.Leu274Met		Q5U0E8|Q8TBP2	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.L274M	ENST00000269554.3	37	c.820	CCDS11329.1	17	.	.	.	.	.	.	.	.	.	.	G	16.97	3.267511	0.59540	.	.	ENSG00000141720	ENST00000269554	T	0.33654	1.4	5.29	5.29	0.74685	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.080159	0.51477	D	0.000081	T	0.43055	0.1230	L	0.49256	1.55	0.80722	D	1	P	0.36974	0.576	B	0.43360	0.417	T	0.28299	-1.0048	10	0.49607	T	0.09	-13.4518	17.7431	0.88412	0.0:0.0:1.0:0.0	.	274	P78356	PI42B_HUMAN	M	274	ENSP00000269554:L274M	ENSP00000269554:L274M	L	-	1	2	PIP4K2B	34181039	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.602000	0.46257	2.776000	0.95493	0.644000	0.83932	CTG	PIP4K2B	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000141720		0.572	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2B	HGNC	protein_coding	OTTHUMT00000256791.1	-	0.00	43	0	G	NM_003559		36927513	-1	tier1	-	no_errors	ENST00000269554	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
PLEKHH2	130271	genome.wustl.edu	37	2	43965591	43965591	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:43965591G>T	ENST00000282406.4	+	20	3165	c.3055G>T	c.(3055-3057)Gaa>Taa	p.E1019*		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	1019	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCTGCAGAATGAAATTTGCTG	0.393																																																	0													91.0	94.0	93.0					2																	43965591		2203	4300	6503	SO:0001587	stop_gained	0			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.3055G>T	2.37:g.43965591G>T	ENSP00000282406:p.Glu1019*		Q5JPJ6|Q6P4Q1|Q8N3Q3	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.E1019*	ENST00000282406.4	37	c.3055	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	G	43	10.127693	0.99343	.	.	ENSG00000152527	ENST00000282406	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.0299	19.4557	0.94886	0.0:0.0:1.0:0.0	.	.	.	.	X	1019	.	ENSP00000282406:E1019X	E	+	1	0	PLEKHH2	43819095	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.420000	0.97426	2.587000	0.87381	0.561000	0.74099	GAA	PLEKHH2	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000152527		0.393	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1		0.00	16	0	G	NM_172069		43965591	+1			no_errors	ENST00000282406	ensembl	human	known	74_37	nonsense	9.38	29	3	SNP	1.000	T
PLEKHO1	51177	genome.wustl.edu	37	1	150131624	150131624	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:150131624T>C	ENST00000369124.4	+	6	1414	c.1136T>C	c.(1135-1137)cTg>cCg	p.L379P	PLEKHO1_ENST00000369126.1_Missense_Mutation_p.L196P|PLEKHO1_ENST00000025469.6_Missense_Mutation_p.L345P	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	379	Negative regulator of AP-1 activity.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCAGGGAGCTGAGAGACCTG	0.607																																																	0													40.0	44.0	43.0					1																	150131624		2203	4300	6503	SO:0001583	missense	0			AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.1136T>C	1.37:g.150131624T>C	ENSP00000358120:p.Leu379Pro		Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L345P	ENST00000369124.4	37	c.1034	CCDS945.1	1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.288253	0.80803	.	.	ENSG00000023902	ENST00000369126;ENST00000025469;ENST00000369124	T;T	0.72505	-0.66;-0.31	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000001	T	0.69468	0.3114	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76016	-0.3113	10	0.87932	D	0	-15.1474	14.2814	0.66216	0.0:0.0:0.0:1.0	.	379	Q53GL0	PKHO1_HUMAN	P	196;345;379	ENSP00000025469:L345P;ENSP00000358120:L379P	ENSP00000025469:L345P	L	+	2	0	PLEKHO1	148398248	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.064000	0.76721	2.155000	0.67459	0.533000	0.62120	CTG	PLEKHO1	-	NULL	ENSG00000023902		0.607	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHO1	HGNC	protein_coding	OTTHUMT00000034962.1	-	0.00	50	0	T	NM_016274		150131624	+1	tier1	-	no_errors	ENST00000025469	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
PON3	5446	genome.wustl.edu	37	7	94991782	94991782	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:94991782T>G	ENST00000265627.5	-	8	808	c.798A>C	c.(796-798)ttA>ttC	p.L266F	PON3_ENST00000427422.1_Intron|PON3_ENST00000451904.1_Intron|PON1_ENST00000542556.1_Intron	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	266					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	GGTTATCCACTAAGGTGCCCA	0.478																																																	0													79.0	73.0	75.0					7																	94991782		2203	4300	6503	SO:0001583	missense	0			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.798A>C	7.37:g.94991782T>G	ENSP00000265627:p.Leu266Phe		A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2	p.L266F	ENST00000265627.5	37	c.798	CCDS5639.1	7	.	.	.	.	.	.	.	.	.	.	T	4.405	0.074796	0.08485	.	.	ENSG00000105852	ENST00000265627	T	0.41400	1.0	4.98	-3.5	0.04710	Six-bladed beta-propeller, TolB-like (1);	0.203281	0.40640	N	0.001055	T	0.31702	0.0805	M	0.79123	2.44	0.37067	D	0.898361	B	0.23591	0.088	B	0.23275	0.045	T	0.09818	-1.0657	10	0.44086	T	0.13	-0.0094	0.1418	0.00084	0.3353:0.1684:0.2107:0.2856	.	266	Q15166	PON3_HUMAN	F	266	ENSP00000265627:L266F	ENSP00000265627:L266F	L	-	3	2	PON3	94829718	0.000000	0.05858	0.755000	0.31263	0.011000	0.07611	-3.056000	0.00625	-0.439000	0.07222	-1.705000	0.00719	TTA	PON3	-	pfam_SGL	ENSG00000105852		0.478	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON3	HGNC	protein_coding	OTTHUMT00000333007.1	-	0.00	48	0	T	NM_000940		94991782	-1	tier1	-	no_errors	ENST00000265627	ensembl	human	known	74_37	missense	33.33	32	16	SNP	0.360	G
POT1	25913	genome.wustl.edu	37	7	124503425	124503425	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:124503425G>T	ENST00000357628.3	-	8	1123	c.525C>A	c.(523-525)gaC>gaA	p.D175E	POT1_ENST00000393329.1_Missense_Mutation_p.D44E	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	175					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						ATGATGCTCCGTCCACTTCTG	0.383																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												0													103.0	99.0	100.0					7																	124503425		2203	4300	6503	SO:0001583	missense	0			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.525C>A	7.37:g.124503425G>T	ENSP00000350249:p.Asp175Glu		O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	p.D175E	ENST00000357628.3	37	c.525	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	G	18.06	3.539091	0.65085	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T;T	0.51071	0.88;0.72	5.38	1.59	0.23543	Nucleic acid-binding, OB-fold-like (1);	0.000000	0.85682	D	0.000000	T	0.61337	0.2339	M	0.75264	2.295	0.39918	D	0.974127	D	0.67145	0.996	D	0.69307	0.963	T	0.58142	-0.7688	10	0.34782	T	0.22	-5.0537	9.0101	0.36135	0.7629:0.0:0.2371:0.0	.	175	Q9NUX5	POTE1_HUMAN	E	175;44;175;175;175;174	ENSP00000350249:D175E;ENSP00000377002:D44E	ENSP00000265391:D174E	D	-	3	2	POT1	124290661	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	1.110000	0.31147	0.052000	0.16007	-1.068000	0.02270	GAC	POT1	-	superfamily_NA-bd_OB-fold	ENSG00000128513		0.383	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	HGNC	protein_coding	OTTHUMT00000347861.1		0.00	18	0	G			124503425	-1			no_errors	ENST00000357628	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
PPP1R21	129285	genome.wustl.edu	37	2	48685277	48685279	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	TCT	TCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:48685277_48685279delTCT	ENST00000294952.8	+	4	443_445	c.286_288delTCT	c.(286-288)tctdel	p.S98del	PPP1R21_ENST00000449090.2_In_Frame_Del_p.S98del|PPP1R21_ENST00000281394.4_In_Frame_Del_p.S98del	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	98						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						AAGTGGAGAATCTTCTTCTCAGT	0.365																																																	0									,,	15,4251		7,1,2125					,,	-1.4	1.0			119	14,8240		7,0,4120	no	coding,coding,coding	KLRAQ1	NM_152994.4,NM_001193475.1,NM_001135629.2	,,	14,1,6245	A1A1,A1R,RR		0.1696,0.3516,0.2316	,,	,,		29,12491				SO:0001651	inframe_deletion	0			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.286_288delTCT	2.37:g.48685283_48685285delTCT	ENSP00000294952:p.Ser98del		B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	In_Frame_Del	DEL	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin-like_SF	p.S98in_frame_del	ENST00000294952.8	37	c.286_288	CCDS46278.1	2																																																																																			PPP1R21	-	pfam_Unchr_KLRAQ/TTKRSYEDQ_N	ENSG00000162869		0.365	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	HGNC	protein_coding	OTTHUMT00000251238.4		0.00	24	0	TCT	NM_152994		48685279	+1	tier1		no_errors	ENST00000294952	ensembl	human	known	74_37	in_frame_del	22.73	17	5	DEL	1.000:1.000:1.000	-
PPP1R3C	5507	genome.wustl.edu	37	10	93390347	93390347	+	Silent	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:93390347C>A	ENST00000238994.5	-	2	375	c.291G>T	c.(289-291)gcG>gcT	p.A97A		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C											breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				AGACATGGATCGCAGTGAGAG	0.493																																																	0													109.0	110.0	109.0					10																	93390347		2203	4300	6503	SO:0001819	synonymous_variant	0			Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.291G>T	10.37:g.93390347C>A				Silent	SNP	pfam_CBM_21,pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	p.A97	ENST00000238994.5	37	c.291	CCDS7416.1	10																																																																																			PPP1R3C	-	pirsf_Pase-1_Glycogen_target-su_met	ENSG00000119938		0.493	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3C	HGNC	protein_coding	OTTHUMT00000049372.1	-	0.00	57	0	C	NM_005398		93390347	-1	tier1	-	no_errors	ENST00000238994	ensembl	human	known	74_37	silent	26.79	41	15	SNP	0.004	A
PPP6R1	22870	genome.wustl.edu	37	19	55743292	55743292	+	Silent	SNP	T	T	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:55743292T>G	ENST00000412770.2	-	19	2750	c.2184A>C	c.(2182-2184)cgA>cgC	p.R728R	PPP6R1_ENST00000587283.1_Silent_p.R728R|TMEM86B_ENST00000327042.4_5'Flank|AC010327.1_ENST00000581390.1_RNA	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	728	Pro-rich.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CCCCGGAGACTCGGGGGCTGG	0.687																																																	0													13.0	15.0	14.0					19																	55743292		1892	4106	5998	SO:0001819	synonymous_variant	0			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.2184A>C	19.37:g.55743292T>G			Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Silent	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.R728	ENST00000412770.2	37	c.2184	CCDS46186.1	19																																																																																			PPP6R1	-	NULL	ENSG00000105063		0.687	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP6R1	HGNC	protein_coding	OTTHUMT00000452663.1	-	0.00	70	0	T	NM_014931		55743292	-1	tier1	-	no_errors	ENST00000412770	ensembl	human	known	74_37	silent	30.85	65	29	SNP	0.000	G
PRORSD1P	344405	genome.wustl.edu	37	2	55511335	55511335	+	RNA	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:55511335C>T	ENST00000563365.1	+	0	1881				Y_RNA_ENST00000384237.1_RNA	NR_027258.1		A6NEY8	PRXD1_HUMAN	prolyl-tRNA synthetase associated domain containing 1, pseudogene								aminoacyl-tRNA editing activity (GO:0002161)										GATGAAACAGCCATGCTAGAA	0.428																																																	0																																												0			CR612843		2p16.1	2013-09-26	2010-09-28	2010-09-27	ENSG00000162997	ENSG00000162997			34379	pseudogene	pseudogene	"""YBak domain containing 1"""		"""non-protein coding RNA 117"", ""PrdX deacylase domain containing 1, pseudogene"""	NCRNA00117, PRDXDD1P			Standard	NR_027258		Approved	Prdxdd1, Ybakd1	uc010yoy.2	A6NEY8	OTTHUMG00000176755		2.37:g.55511335C>T				RNA	SNP	-	NULL	ENST00000563365.1	37	NULL		2																																																																																			PRORSD1P	-	-	ENSG00000162997		0.428	PRORSD1P-002	KNOWN	basic	processed_transcript	PRORSD1P	HGNC	pseudogene	OTTHUMT00000433571.1	-	0.00	29	0	C	NR_027258		55511335	+1	tier1	-	no_errors	ENST00000563365	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.997	T
PRR14L	253143	genome.wustl.edu	37	22	32110959	32110959	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:32110959C>T	ENST00000327423.6	-	4	3055	c.2866G>A	c.(2866-2868)Gta>Ata	p.V956I	PRR14L_ENST00000461722.1_5'Flank|PRR14L_ENST00000434485.1_Missense_Mutation_p.V956I|PRR14L_ENST00000397493.2_Missense_Mutation_p.V956I	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	956										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						ACTGATTTTACATTTTTAAAA	0.398																																																	0													147.0	99.0	113.0					22																	32110959		692	1591	2283	SO:0001583	missense	0			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.2866G>A	22.37:g.32110959C>T	ENSP00000331845:p.Val956Ile		Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NULL	p.V956I	ENST00000327423.6	37	c.2866	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	C	0.879	-0.729287	0.03135	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.07567	3.18;3.2;3.19	5.22	-3.5	0.04710	.	0.983847	0.08296	N	0.967674	T	0.04634	0.0126	N	0.19112	0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.45833	-0.9234	9	.	.	.	0.2987	6.6666	0.23044	0.1192:0.4029:0.0:0.4779	.	956;956;956	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	I	956	ENSP00000380630:V956I;ENSP00000331845:V956I;ENSP00000388314:V956I	.	V	-	1	0	PRR14L	30440959	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.528000	0.02225	-0.923000	0.03785	-1.084000	0.02203	GTA	PRR14L	-	NULL	ENSG00000183530		0.398	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	-	0.00	49	0	C	NM_173566		32110959	-1	tier1	-	no_errors	ENST00000397493	ensembl	human	known	74_37	missense	18.18	36	8	SNP	0.000	T
PSG3	5671	genome.wustl.edu	37	19	43236999	43236999	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:43236999C>A	ENST00000327495.5	-	3	830	c.646G>T	c.(646-648)Gaa>Taa	p.E216*	PSG3_ENST00000490592.1_5'Flank|PSG3_ENST00000595140.1_Nonsense_Mutation_p.E216*	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	216	Ig-like C2-type 1.				defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				ATTTCACATTCATAGGGTCCT	0.507																																																	0													232.0	237.0	236.0					19																	43236999		2203	4298	6501	SO:0001587	stop_gained	0				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.646G>T	19.37:g.43236999C>A	ENSP00000332215:p.Glu216*		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E216*	ENST00000327495.5	37	c.646	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	-	15.97	2.990659	0.54041	.	.	ENSG00000221826	ENST00000327495	.	.	.	1.59	0.389	0.16269	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	5.6521	0.17622	0.0:0.653:0.347:0.0	.	.	.	.	X	216	.	ENSP00000332215:E216X	E	-	1	0	PSG3	47928839	0.178000	0.23122	0.340000	0.25575	0.015000	0.08874	-0.075000	0.11431	-0.000000	0.14550	-0.751000	0.03497	GAA	PSG3	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000221826		0.507	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	HGNC	protein_coding	OTTHUMT00000321423.2	-	0.00	214	0	C	NM_021016		43236999	-1	tier1	-	no_errors	ENST00000327495	ensembl	human	known	74_37	nonsense	28.57	160	64	SNP	0.933	A
PSG1	5669	genome.wustl.edu	37	19	43373045	43373045	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:43373045G>A	ENST00000436291.2	-	4	967	c.851C>T	c.(850-852)cCc>cTc	p.P284L	PSG1_ENST00000244296.2_Missense_Mutation_p.P284L|PSG1_ENST00000403380.3_Missense_Mutation_p.P191L|PSG1_ENST00000595124.1_Missense_Mutation_p.P191L|PSG1_ENST00000595356.1_Missense_Mutation_p.P284L|PSG1_ENST00000312439.6_Missense_Mutation_p.P284L	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	284	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CTTTACCCTGGGACTGACCGG	0.473																																																	0													30.0	37.0	35.0					19																	43373045		1494	2687	4181	SO:0001583	missense	0				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.851C>T	19.37:g.43373045G>A	ENSP00000413041:p.Pro284Leu		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P284L	ENST00000436291.2	37	c.851	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	10.97	1.500335	0.26861	.	.	ENSG00000231924	ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	1.63	-3.26	0.05064	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.29423	0.0733	M	0.80028	2.48	0.09310	N	1	P;B;D;B;P;D;P	0.63046	0.788;0.361;0.96;0.239;0.951;0.992;0.907	B;B;P;P;P;D;P	0.70227	0.352;0.426;0.862;0.459;0.637;0.968;0.767	T	0.13872	-1.0493	9	0.87932	D	0	.	3.382	0.07257	0.0:0.2347:0.3076:0.4577	.	284;191;284;191;284;156;284	P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;B4DTG5;P11464-2	.;.;PSG1_HUMAN;.;.;.;.	L	284;191;284;284	ENSP00000413041:P284L;ENSP00000385386:P191L;ENSP00000308970:P284L;ENSP00000244296:P284L	ENSP00000244296:P284L	P	-	2	0	PSG1	48064885	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.025000	0.01435	-0.682000	0.05197	0.195000	0.17529	CCC	PSG1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000231924		0.473	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	-	0.00	140	0	G			43373045	-1	tier1	-	no_errors	ENST00000312439	ensembl	human	known	74_37	missense	20.00	116	29	SNP	0.000	A
PRRG2	5639	genome.wustl.edu	37	19	50086513	50086513	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:50086513G>A	ENST00000246794.5	+	2	206	c.37G>A	c.(37-39)Gca>Aca	p.A13T	PRRG2_ENST00000596700.1_Intron|NOSIP_ENST00000339093.3_5'Flank|NOSIP_ENST00000596358.1_5'Flank|NOSIP_ENST00000391853.3_5'Flank	NM_000951.2	NP_000942.1	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2	13						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			lung(1)|skin(1)|soft_tissue(1)	3		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		GCTATATATGGCATTAACCAC	0.537																																																	0													112.0	99.0	103.0					19																	50086513		2203	4300	6503	SO:0001583	missense	0				CCDS12773.1	19q13.33	2008-02-05	2004-05-27						9470	protein-coding gene	gene with protein product		604429	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 2"""			9256434	Standard	NM_000951		Approved	PRGP2	uc002pon.3	O14669		ENST00000246794.5:c.37G>A	19.37:g.50086513G>A	ENSP00000246794:p.Ala13Thr		Q6IBF8	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.A13T	ENST00000246794.5	37	c.37	CCDS12773.1	19	.	.	.	.	.	.	.	.	.	.	G	10.92	1.488255	0.26686	.	.	ENSG00000126460	ENST00000246794	D	0.97303	-4.33	4.52	4.52	0.55395	.	0.643908	0.14784	N	0.298613	D	0.91112	0.7202	N	0.08118	0	0.80722	D	1	B	0.26975	0.165	B	0.20955	0.032	D	0.88163	0.2859	10	0.29301	T	0.29	-9.0645	12.6706	0.56864	0.0:0.0:1.0:0.0	.	13	O14669	TMG2_HUMAN	T	13	ENSP00000246794:A13T	ENSP00000246794:A13T	A	+	1	0	PRRG2	54778325	0.945000	0.32115	0.992000	0.48379	0.045000	0.14185	2.599000	0.46231	2.371000	0.80710	0.558000	0.71614	GCA	PRRG2	-	NULL	ENSG00000126460		0.537	PRRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG2	HGNC	protein_coding	OTTHUMT00000465257.1	-	0.00	64	0	G	NM_000951		50086513	+1	tier1	-	no_errors	ENST00000246794	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.975	A
PSMC1	5700	genome.wustl.edu	37	14	90736682	90736682	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:90736682G>T	ENST00000261303.8	+	10	1277	c.1174G>T	c.(1174-1176)Ggt>Tgt	p.G392C	PSMC1_ENST00000543772.2_Missense_Mutation_p.G319C	NM_002802.2	NP_002793.2	P62191	PRS4_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 1	392					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|upper_aerodigestive_tract(2)	6		all_cancers(154;0.142)		COAD - Colon adenocarcinoma(157;0.21)		TGACCTCTCTGGTGCTGACAT	0.493																																																	0													40.0	30.0	34.0					14																	90736682		2203	4300	6503	SO:0001583	missense	0			L02426	CCDS32139.1	14q32.11	2010-04-21			ENSG00000100764	ENSG00000100764		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9547	protein-coding gene	gene with protein product		602706				9473509	Standard	NM_002802		Approved	S4, p56	uc001xyf.3	P62191		ENST00000261303.8:c.1174G>T	14.37:g.90736682G>T	ENSP00000261303:p.Gly392Cys		B4DR63|P49014|Q03527|Q6IAW0|Q6NW36|Q96AZ3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DUF815,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.G392C	ENST00000261303.8	37	c.1174	CCDS32139.1	14	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591028	0.86851	.	.	ENSG00000100764	ENST00000261303;ENST00000543772	D;D	0.95588	-3.75;-3.75	5.17	5.17	0.71159	.	0.094593	0.64402	D	0.000001	D	0.98701	0.9564	H	0.97587	4.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99521	1.0958	10	0.72032	D	0.01	-8.7761	19.0295	0.92950	0.0:0.0:1.0:0.0	.	392	P62191	PRS4_HUMAN	C	392;319	ENSP00000261303:G392C;ENSP00000445147:G319C	ENSP00000261303:G392C	G	+	1	0	PSMC1	89806435	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.452000	0.97615	2.579000	0.87056	0.563000	0.77884	GGT	PSMC1	-	superfamily_P-loop_NTPase,tigrfam_26S_Psome_P45	ENSG00000100764		0.493	PSMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC1	HGNC	protein_coding	OTTHUMT00000411253.1		0.00	36	0	G	NM_002802		90736682	+1			no_errors	ENST00000261303	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
PTCHD1	139411	genome.wustl.edu	37	X	23410816	23410816	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:23410816C>T	ENST00000379361.4	+	3	2041	c.1181C>T	c.(1180-1182)aCg>aTg	p.T394M		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	394	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						AGCCCTTTCACGAACATTGAG	0.478																																																	0													126.0	107.0	113.0					X																	23410816		2203	4300	6503	SO:0001583	missense	0			AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1181C>T	X.37:g.23410816C>T	ENSP00000368666:p.Thr394Met		B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.T394M	ENST00000379361.4	37	c.1181	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	C	17.24	3.340282	0.60963	.	.	ENSG00000165186	ENST00000379361	D	0.91686	-2.89	5.32	5.32	0.75619	Sterol-sensing domain (1);	0.000000	0.85682	D	0.000000	D	0.95538	0.8550	M	0.66297	2.02	0.58432	D	0.999998	D	0.71674	0.998	D	0.81914	0.995	D	0.95584	0.8649	10	0.56958	D	0.05	.	18.3219	0.90241	0.0:1.0:0.0:0.0	.	394	Q96NR3	PTHD1_HUMAN	M	394	ENSP00000368666:T394M	ENSP00000368666:T394M	T	+	2	0	PTCHD1	23320737	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.445000	0.80570	2.353000	0.79882	0.600000	0.82982	ACG	PTCHD1	-	pfam_Patched,pfscan_SSD	ENSG00000165186		0.478	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	-	0.00	21	0	C	NM_173495		23410816	+1	tier1	-	no_errors	ENST00000379361	ensembl	human	known	74_37	missense	59.38	13	19	SNP	1.000	T
PTCHD4	442213	genome.wustl.edu	37	6	48036096	48036096	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:48036096C>A	ENST00000339488.4	-	1	329	c.296G>T	c.(295-297)aGc>aTc	p.S99I	PTCHD4_ENST00000543600.1_Missense_Mutation_p.S82I	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	99						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										ATAGAGCTGGCTTTTGGACTG	0.632																																																	0													77.0	84.0	82.0					6																	48036096		1931	4135	6066	SO:0001583	missense	0				CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.296G>T	6.37:g.48036096C>A	ENSP00000341914:p.Ser99Ile		B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.S99I	ENST00000339488.4	37	c.296	CCDS34473.2	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.12|11.12	1.545036|1.545036	0.27652|0.27652	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000398738|ENST00000339488;ENST00000543600	T|D;T	0.54866|0.92249	0.55|-3.0;0.63	5.03|5.03	4.17|4.17	0.49024|0.49024	.|.	.|0.100459	.|0.64402	.|D	.|0.000003	T|T	0.76990|0.76990	0.4065|0.4065	L|L	0.36672|0.36672	1.1|1.1	0.38594|0.38594	D|D	0.950493|0.950493	.|B;B	.|0.33073	.|0.104;0.396	.|B;B	.|0.29176	.|0.044;0.099	T|T	0.73329|0.73329	-0.4017|-0.4017	7|10	0.25751|0.20519	T|T	0.34|0.43	.|.	9.1974|9.1974	0.37237|0.37237	0.0:0.7754:0.1477:0.0769|0.0:0.7754:0.1477:0.0769	.|.	.|99;82	.|Q6ZW05;B0QZ29	.|CF138_HUMAN;.	N|I	98|99;82	ENSP00000381722:K98N|ENSP00000341914:S99I;ENSP00000439864:S82I	ENSP00000381722:K98N|ENSP00000341914:S99I	K|S	-|-	3|2	2|0	C6orf138|C6orf138	48144055|48144055	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	3.575000|3.575000	0.53870|0.53870	1.111000|1.111000	0.41721|0.41721	-0.216000|-0.216000	0.12614|0.12614	AAG|AGC	PTCHD4	-	NULL	ENSG00000244694		0.632	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD4	HGNC	protein_coding	OTTHUMT00000317987.2	-	0.00	75	0	C	NM_001013732		48036096	-1	tier1	-	no_errors	ENST00000339488	ensembl	human	known	74_37	missense	31.15	42	19	SNP	1.000	A
PTPRA	5786	genome.wustl.edu	37	20	3003439	3003439	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr20:3003439G>A	ENST00000216877.6	+	15	1806	c.1406G>A	c.(1405-1407)cGg>cAg	p.R469Q	PTPRA_ENST00000318266.5_Missense_Mutation_p.R469Q|PTPRA_ENST00000356147.3_Missense_Mutation_p.R469Q|PTPRA_ENST00000380393.3_Missense_Mutation_p.R478Q|PTPRA_ENST00000425918.2_Missense_Mutation_p.R489Q|PTPRA_ENST00000358719.4_Missense_Mutation_p.R334Q|PTPRA_ENST00000399903.2_Missense_Mutation_p.R478Q	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	478	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AGCCGGATCCGGGCACAGCGC	0.547																																																	0													157.0	108.0	125.0					20																	3003439		2203	4300	6503	SO:0001583	missense	0				CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1406G>A	20.37:g.3003439G>A	ENSP00000216877:p.Arg469Gln		A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R489Q	ENST00000216877.6	37	c.1466	CCDS13039.1	20	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938836	0.92526	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000542217;ENST00000425918;ENST00000318266;ENST00000356147	D;D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	5.72	4.78	0.61160	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	U	0.000000	D	0.97093	0.9050	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;0.962;0.992	D;P;D	0.81914	0.995;0.479;0.918	D	0.98283	1.0509	10	0.87932	D	0	.	14.4635	0.67467	0.0703:0.0:0.9297:0.0	.	489;478;469	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Q	478;469;478;334;88;489;469;469	ENSP00000369756:R478Q;ENSP00000216877:R469Q;ENSP00000382787:R478Q;ENSP00000351559:R334Q;ENSP00000393553:R489Q;ENSP00000314568:R469Q;ENSP00000348468:R469Q	ENSP00000216877:R469Q	R	+	2	0	PTPRA	2951439	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.824000	0.99380	1.430000	0.47334	0.561000	0.74099	CGG	PTPRA	-	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132670		0.547	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRA	HGNC	protein_coding	OTTHUMT00000077682.3		0.00	30	0	G			3003439	+1			no_errors	ENST00000425918	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	A
PTPRD	5789	genome.wustl.edu	37	9	8518133	8518133	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:8518133C>A	ENST00000381196.4	-	18	1801	c.1258G>T	c.(1258-1260)Gcc>Tcc	p.A420S	PTPRD_ENST00000537002.1_Missense_Mutation_p.A417S|PTPRD_ENST00000360074.4_Missense_Mutation_p.A407S|PTPRD_ENST00000358503.5_Missense_Mutation_p.A407S|PTPRD_ENST00000355233.5_Missense_Mutation_p.A420S|PTPRD_ENST00000397617.3_Missense_Mutation_p.A410S|PTPRD_ENST00000486161.1_Missense_Mutation_p.A420S|PTPRD_ENST00000540109.1_Missense_Mutation_p.A420S|PTPRD_ENST00000356435.5_Missense_Mutation_p.A420S|PTPRD_ENST00000397606.3_Missense_Mutation_p.A410S|PTPRD_ENST00000397611.3_Missense_Mutation_p.A417S	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	420	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TCCCTCGGGGCACTGGATGGT	0.512										TSP Lung(15;0.13)																																							0													163.0	156.0	158.0					9																	8518133		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1258G>T	9.37:g.8518133C>A	ENSP00000370593:p.Ala420Ser		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.A420S	ENST00000381196.4	37	c.1258	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	C	16.33	3.094197	0.56075	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52;-0.52	5.31	5.31	0.75309	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.055637	0.64402	D	0.000001	T	0.77370	0.4120	L	0.47078	1.49	0.54753	D	0.999981	P;P;P;P;B;P;P;P;P	0.49253	0.921;0.868;0.866;0.755;0.041;0.712;0.828;0.744;0.881	P;P;P;P;B;P;P;P;P	0.61328	0.887;0.808;0.666;0.566;0.059;0.637;0.527;0.626;0.517	T	0.75445	-0.3315	9	.	.	.	.	14.5752	0.68240	0.0:0.854:0.146:0.0	.	410;414;420;420;417;417;407;420;420	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	S	420;420;407;407;420;410;417;417;420;420;420;410	ENSP00000370593:A420S;ENSP00000348812:A420S;ENSP00000353187:A407S;ENSP00000351293:A407S;ENSP00000347373:A420S;ENSP00000380741:A410S;ENSP00000380735:A417S;ENSP00000440515:A417S;ENSP00000438164:A420S;ENSP00000417093:A420S;ENSP00000380731:A410S	.	A	-	1	0	PTPRD	8508133	1.000000	0.71417	1.000000	0.80357	0.114000	0.19823	5.960000	0.70348	2.484000	0.83849	0.467000	0.42956	GCC	PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.512	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	23	0	C			8518133	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	34.78	15	8	SNP	1.000	A
PTPRS	5802	genome.wustl.edu	37	19	5214445	5214445	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:5214445C>T	ENST00000587303.1	-	29	4640	c.4541G>A	c.(4540-4542)gGc>gAc	p.G1514D	PTPRS_ENST00000262963.6_Missense_Mutation_p.G1494D|PTPRS_ENST00000348075.2_Missense_Mutation_p.G1476D|PTPRS_ENST00000588012.1_Missense_Mutation_p.G1476D|PTPRS_ENST00000592099.1_Missense_Mutation_p.G1067D|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000353284.2_Missense_Mutation_p.G1067D|PTPRS_ENST00000357368.4_Missense_Mutation_p.G1514D|PTPRS_ENST00000372412.4_Missense_Mutation_p.G1515D			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	1514	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.G1514V(1)		NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	CTGGATGAAGCCGTAGGTCTC	0.587																																																	1	Substitution - Missense(1)	ovary(1)											137.0	103.0	114.0					19																	5214445		2203	4300	6503	SO:0001583	missense	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.4541G>A	19.37:g.5214445C>T	ENSP00000467537:p.Gly1514Asp		O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.G1515D	ENST00000587303.1	37	c.4544	CCDS45930.1	19	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333536	0.60853	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	3.12	3.12	0.35913	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.64402	U	0.000004	T	0.69324	0.3098	M	0.90145	3.09	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.986;1.0;0.999;1.0;1.0	D;P;D;D;D;D	0.97110	1.0;0.815;1.0;0.92;1.0;1.0	T	0.78788	-0.2067	10	0.87932	D	0	.	14.721	0.69305	0.0:1.0:0.0:0.0	.	1096;1067;1071;1476;1514;1109	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	D	1109;1515;1514;1514;1505;1494;1476;1096;1071;1067	ENSP00000361489:G1515D;ENSP00000349932:G1514D;ENSP00000262963:G1494D;ENSP00000269907:G1476D;ENSP00000327313:G1067D	ENSP00000262963:G1494D	G	-	2	0	PTPRS	5165445	1.000000	0.71417	1.000000	0.80357	0.346000	0.29079	7.447000	0.80620	1.772000	0.52199	0.313000	0.20887	GGC	PTPRS	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000105426		0.587	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2		0.00	54	0	C			5214445	-1			no_errors	ENST00000372412	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
PTPRS	5802	genome.wustl.edu	37	19	5244269	5244269	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:5244269C>T	ENST00000587303.1	-	10	1312	c.1213G>A	c.(1213-1215)Gtc>Atc	p.V405I	PTPRS_ENST00000262963.6_Missense_Mutation_p.V401I|PTPRS_ENST00000348075.2_Missense_Mutation_p.V392I|PTPRS_ENST00000588012.1_Missense_Mutation_p.V392I|PTPRS_ENST00000592099.1_Missense_Mutation_p.V392I|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000353284.2_Missense_Mutation_p.V392I|PTPRS_ENST00000357368.4_Missense_Mutation_p.V405I|PTPRS_ENST00000372412.4_Missense_Mutation_p.V406I			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	405	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	ATGGAGTTGACGGCCGACACC	0.667																																																	0													53.0	47.0	49.0					19																	5244269		2203	4300	6503	SO:0001583	missense	0			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1213G>A	19.37:g.5244269C>T	ENSP00000467537:p.Val405Ile		O75255|O75870|Q15718|Q16341|Q2M3R7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom	p.V406I	ENST00000587303.1	37	c.1216	CCDS45930.1	19	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774337	0.31411	.	.	ENSG00000105426	ENST00000536396;ENST00000372412;ENST00000357368;ENST00000355005;ENST00000356037;ENST00000262963;ENST00000348075;ENST00000355322;ENST00000544524;ENST00000353284	T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09	3.93	3.93	0.45458	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.095040	0.41938	U	0.000784	T	0.67277	0.2876	M	0.77616	2.38	0.22591	N	0.998958	P;P;P;D;P;P	0.58970	0.56;0.723;0.588;0.984;0.939;0.92	B;B;B;P;P;B	0.50708	0.216;0.216;0.172;0.648;0.603;0.265	T	0.64037	-0.6501	10	0.42905	T	0.14	.	16.1378	0.81497	0.0:1.0:0.0:0.0	.	405;392;396;392;405;418	F8W800;Q13332-7;F5H2T4;Q13332-6;Q13332;Q59FX6	.;.;.;.;PTPRS_HUMAN;.	I	418;406;405;405;405;401;392;405;396;392	ENSP00000361489:V406I;ENSP00000349932:V405I;ENSP00000262963:V401I;ENSP00000269907:V392I;ENSP00000327313:V392I	ENSP00000262963:V401I	V	-	1	0	PTPRS	5195269	0.989000	0.36119	0.858000	0.33744	0.269000	0.26545	2.834000	0.48167	2.052000	0.61016	0.462000	0.41574	GTC	PTPRS	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000105426		0.667	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2	-	0.00	74	0	C			5244269	-1	tier1	-	no_errors	ENST00000372412	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.969	T
PVRL4	81607	genome.wustl.edu	37	1	161042504	161042504	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:161042504C>T	ENST00000368012.3	-	9	1782	c.1480G>A	c.(1480-1482)Gcc>Acc	p.A494T	PVRL4_ENST00000453926.2_Missense_Mutation_p.A203T|ARHGAP30_ENST00000368013.3_5'Flank|ARHGAP30_ENST00000368015.1_5'Flank|PVRL4_ENST00000486694.1_5'UTR	NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	494					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GTGGGCTTGGCCCGTAGGGTC	0.597																																					NSCLC(76;1160 1387 14476 16172 29359)												0													140.0	119.0	126.0					1																	161042504		2203	4300	6503	SO:0001583	missense	0			AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.1480G>A	1.37:g.161042504C>T	ENSP00000356991:p.Ala494Thr		B4DQW3|Q96K15	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A494T	ENST00000368012.3	37	c.1480	CCDS1216.1	1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635364	0.87760	.	.	ENSG00000143217	ENST00000368012;ENST00000453926	T;T	0.50277	0.75;1.17	4.85	4.85	0.62838	.	0.000000	0.47455	D	0.000239	T	0.45357	0.1338	N	0.19112	0.55	0.41494	D	0.988249	D;D;D	0.69078	0.993;0.993;0.997	D;D;D	0.77004	0.956;0.956;0.989	T	0.52193	-0.8608	10	0.59425	D	0.04	.	15.5133	0.75802	0.0:1.0:0.0:0.0	.	203;148;494	B4DQW3;B4DWD4;Q96NY8	.;.;PVRL4_HUMAN	T	494;203	ENSP00000356991:A494T;ENSP00000406015:A203T	ENSP00000356991:A494T	A	-	1	0	PVRL4	159309128	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.636000	0.61339	2.504000	0.84457	0.655000	0.94253	GCC	PVRL4	-	NULL	ENSG00000143217		0.597	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL4	HGNC	protein_coding	OTTHUMT00000077074.1		0.00	52	0	C	NM_030916		161042504	-1			no_errors	ENST00000368012	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
RAG1	5896	genome.wustl.edu	37	11	36595270	36595270	+	Missense_Mutation	SNP	G	G	T	rs140648865		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:36595270G>T	ENST00000299440.5	+	2	528	c.416G>T	c.(415-417)gGc>gTc	p.G139V		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	139	Interaction with importin alpha-1.				adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				AAAACCCTAGGCCTTTTACGA	0.498									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)												0								G	VAL/GLY	0,4404		0,0,2202	92.0	88.0	89.0		416	-9.8	0.1	11	dbSNP_134	89	1,8595	1.2+/-3.3	0,1,4297	no	missense	RAG1	NM_000448.2	109	0,1,6499	TT,TG,GG		0.0116,0.0,0.0077	benign	139/1044	36595270	1,12999	2202	4298	6500	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.416G>T	11.37:g.36595270G>T	ENSP00000299440:p.Gly139Val		E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.G139V	ENST00000299440.5	37	c.416	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	G	7.620	0.676598	0.14841	0.0	1.16E-4	ENSG00000166349	ENST00000534663;ENST00000299440	T;T	0.73681	-0.77;-0.77	6.14	-9.78	0.00496	.	0.501323	0.21734	N	0.069931	T	0.34221	0.0890	N	0.03903	-0.33	0.26209	N	0.97933	B	0.02656	0.0	B	0.01281	0.0	T	0.20338	-1.0278	10	0.33141	T	0.24	.	0.6463	0.00819	0.3229:0.2819:0.1416:0.2536	.	139	P15918	RAG1_HUMAN	V	139	ENSP00000434610:G139V;ENSP00000299440:G139V	ENSP00000299440:G139V	G	+	2	0	RAG1	36551846	0.022000	0.18835	0.059000	0.19551	0.961000	0.63080	0.099000	0.15210	-1.951000	0.01029	-0.893000	0.02921	GGC	RAG1	-	NULL	ENSG00000166349		0.498	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1	-	0.00	35	0	G	NM_000448		36595270	+1	tier1	rs140648865	no_errors	ENST00000299440	ensembl	human	known	74_37	missense	11.76	29	4	SNP	0.019	T
RBM33	155435	genome.wustl.edu	37	7	155532610	155532610	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:155532610C>T	ENST00000401878.3	+	12	2137	c.1939C>T	c.(1939-1941)Cct>Tct	p.P647S		NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	647	Pro-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		CGTCCCGCCCCCTCCTTTGAT	0.711																																																	0													20.0	22.0	21.0					7																	155532610		2159	4211	6370	SO:0001583	missense	0			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.1939C>T	7.37:g.155532610C>T	ENSP00000384160:p.Pro647Ser		A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.P647S	ENST00000401878.3	37	c.1939	CCDS5941.2	7	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822101	0.50739	.	.	ENSG00000184863	ENST00000401878	T	0.45668	0.89	5.13	5.13	0.70059	.	0.106867	0.41938	D	0.000782	T	0.39545	0.1082	L	0.56769	1.78	0.80722	D	1	P;P	0.44139	0.827;0.827	B;B	0.41510	0.359;0.359	T	0.31308	-0.9948	10	0.06891	T	0.86	.	16.7597	0.85508	0.0:1.0:0.0:0.0	.	364;647	B4DVQ2;Q96EV2	.;RBM33_HUMAN	S	647	ENSP00000384160:P647S	ENSP00000384160:P647S	P	+	1	0	RBM33	155225371	0.998000	0.40836	0.924000	0.36721	0.770000	0.43624	4.875000	0.63072	2.393000	0.81446	0.467000	0.42956	CCT	RBM33	-	NULL	ENSG00000184863		0.711	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	-	0.00	37	0	C	NM_001008408		155532610	+1	tier1	-	no_errors	ENST00000401878	ensembl	human	known	74_37	missense	30.23	30	13	SNP	0.992	T
RBMXL2	27288	genome.wustl.edu	37	11	7110479	7110479	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:7110479G>A	ENST00000306904.5	+	1	315	c.128G>A	c.(127-129)cGa>cAa	p.R43Q		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	43	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ATGAAAGACCGAGAAACCAAC	0.587																																																	0													45.0	43.0	44.0					11																	7110479		2201	4296	6497	SO:0001583	missense	0			AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.128G>A	11.37:g.7110479G>A	ENSP00000304139:p.Arg43Gln		Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.R43Q	ENST00000306904.5	37	c.128	CCDS7777.1	11	.	.	.	.	.	.	.	.	.	.	G	13.80	2.345522	0.41498	.	.	ENSG00000170748	ENST00000306904	D	0.85629	-2.01	2.39	1.47	0.22746	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	T	0.76111	0.3942	L	0.49699	1.58	0.45648	D	0.998574	P	0.34546	0.456	B	0.27500	0.08	T	0.72168	-0.4372	10	0.66056	D	0.02	.	7.1841	0.25789	0.146:0.0:0.854:0.0	.	43	O75526	HNRGT_HUMAN	Q	43	ENSP00000304139:R43Q	ENSP00000304139:R43Q	R	+	2	0	RBMXL2	7067055	1.000000	0.71417	0.989000	0.46669	0.946000	0.59487	5.940000	0.70187	0.552000	0.29026	0.455000	0.32223	CGA	RBMXL2	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000170748		0.587	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	HGNC	protein_coding	OTTHUMT00000384552.1	-	0.00	57	0	G	NM_014469		7110479	+1	tier1	-	no_errors	ENST00000306904	ensembl	human	known	74_37	missense	36.49	47	27	SNP	0.998	A
RBMXL3	139804	genome.wustl.edu	37	X	114424865	114424865	+	Silent	SNP	C	C	T	rs199932185		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:114424865C>T	ENST00000424776.3	+	1	903	c.861C>T	c.(859-861)cgC>cgT	p.R287R	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	287							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						ACAGGGGTCGCGACCATGAGT	0.627													C|||	3	0.000794702	0.0	0.0	3775	,	,		11484	0.0		0.002	False		,,,				2504	0.001																0								C	,	0,1209		0,0,0,517,175	28.0	31.0	30.0		861,	-1.7	0.0	X		30	11,2380		0,6,5,794,786	no	coding-synonymous,intron	LRCH2,RBMXL3	NM_001145346.1,NM_020871.3	,	0,6,5,1311,961	TT,TC,T,CC,C		0.4601,0.0,0.3056	,	287/1068,	114424865	11,3589	692	1591	2283	SO:0001819	synonymous_variant	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.861C>T	X.37:g.114424865C>T			B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R287	ENST00000424776.3	37	c.861	CCDS55478.1	X																																																																																			RBMXL3	-	NULL	ENSG00000175718		0.627	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	25	0	C	NM_001145346		114424865	+1	tier1	rs199932185	no_errors	ENST00000424776	ensembl	human	known	74_37	silent	77.78	8	28	SNP	0.057	T
RELL2	285613	genome.wustl.edu	37	5	141019164	141019164	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:141019164G>A	ENST00000297164.3	+	4	1651	c.451G>A	c.(451-453)Gaa>Aaa	p.E151K	RELL2_ENST00000518025.1_3'UTR|FCHSD1_ENST00000435817.2_3'UTR|RELL2_ENST00000521367.1_Missense_Mutation_p.E85K|FCHSD1_ENST00000523856.1_5'UTR|HDAC3_ENST00000305264.3_5'Flank|RELL2_ENST00000444782.1_Missense_Mutation_p.E151K|RELL2_ENST00000518856.1_Missense_Mutation_p.E85K	NM_173828.4	NP_776189.3	Q8NC24	RELL2_HUMAN	RELT-like 2	151					positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCTCCAAGGAAGGAAAAAG	0.652																																																	0													37.0	42.0	40.0					5																	141019164		2202	4300	6502	SO:0001583	missense	0			AK054889	CCDS4265.1	5q31.3	2011-10-11	2007-06-15	2007-06-15	ENSG00000164620	ENSG00000164620			26902	protein-coding gene	gene with protein product		611213	"""chromosome 5 open reading frame 16"""	C5orf16		12975309, 16389068	Standard	NM_173828		Approved	FLJ90583	uc003lli.3	Q8NC24	OTTHUMG00000129612	ENST00000297164.3:c.451G>A	5.37:g.141019164G>A	ENSP00000297164:p.Glu151Lys		D3DQE2|Q6P4E7|Q6UXY2	Missense_Mutation	SNP	pfam_TNF_rcpt_RELT	p.E151K	ENST00000297164.3	37	c.451	CCDS4265.1	5	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967549	0.74131	.	.	ENSG00000164620	ENST00000444782;ENST00000521367;ENST00000297164;ENST00000518856	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.32	4.45	0.53987	.	0.135604	0.48286	N	0.000185	T	0.33030	0.0849	L	0.38531	1.155	0.80722	D	1	D;P	0.71674	0.998;0.889	D;B	0.66084	0.941;0.444	T	0.02288	-1.1182	10	0.35671	T	0.21	-12.359	13.6096	0.62068	0.0758:0.0:0.9242:0.0	.	85;151	E5RHA7;Q8NC24	.;RELL2_HUMAN	K	151;85;151;85	ENSP00000409443:E151K;ENSP00000430948:E85K;ENSP00000297164:E151K;ENSP00000427992:E85K	ENSP00000297164:E151K	E	+	1	0	RELL2	140999348	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.720000	0.74723	1.237000	0.43756	0.655000	0.94253	GAA	RELL2	-	NULL	ENSG00000164620		0.652	RELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RELL2	HGNC	protein_coding	OTTHUMT00000251807.2	-	0.00	79	0	G	NM_173828		141019164	+1	tier1	-	no_errors	ENST00000297164	ensembl	human	known	74_37	missense	11.54	46	6	SNP	1.000	A
RGS12	6002	genome.wustl.edu	37	4	3418813	3418813	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:3418813delA	ENST00000344733.5	+	8	3505	c.2601delA	c.(2599-2601)ccafs	p.P867fs	RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000336727.3_Frame_Shift_Del_p.P867fs|RGS12_ENST00000306648.7_Frame_Shift_Del_p.P265fs|RGS12_ENST00000543385.1_3'UTR|RGS12_ENST00000382788.3_Frame_Shift_Del_p.P867fs|RGS12_ENST00000338806.4_Frame_Shift_Del_p.P219fs|RGS12_ENST00000538395.1_Frame_Shift_Del_p.P209fs	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	867					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGTCCACGCCAAAAAAGGTGA	0.637																																																	0													32.0	34.0	33.0					4																	3418813		2203	4300	6503	SO:0001589	frameshift_variant	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2601delA	4.37:g.3418813delA	ENSP00000339381:p.Pro867fs		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Frame_Shift_Del	DEL	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.K869fs	ENST00000344733.5	37	c.2601	CCDS3366.1	4																																																																																			RGS12	-	NULL	ENSG00000159788		0.637	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1		0.00	54	0	A	NM_002926		3418813	+1	tier1		no_errors	ENST00000344733	ensembl	human	known	74_37	frame_shift_del	5.71	33	2	DEL	0.018	-
RGS3	5998	genome.wustl.edu	37	9	116259657	116259657	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:116259657G>A	ENST00000374140.2	+	10	1023	c.814G>A	c.(814-816)Gcc>Acc	p.A272T	RGS3_ENST00000317613.6_Missense_Mutation_p.A160T|RGS3_ENST00000350696.5_Missense_Mutation_p.A272T	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	272					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CTTGAAGGTGGCCAGGCGGCG	0.627																																																	0													67.0	61.0	63.0					9																	116259657		2203	4300	6503	SO:0001583	missense	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.814G>A	9.37:g.116259657G>A	ENSP00000363255:p.Ala272Thr		A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_RGS_dom,pfam_C2_dom,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_dom,superfamily_PDZ,smart_C2_dom,smart_PDZ,smart_Regulat_G_prot_signal_superfam,pfscan_C2_dom,pfscan_PDZ,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.A272T	ENST00000374140.2	37	c.814	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.345664	0.95807	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613	T;T;T	0.48201	0.82;0.82;1.2	5.69	5.69	0.88448	.	0.161152	0.40222	N	0.001155	T	0.65749	0.2721	L	0.60455	1.87	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.77557	0.99;0.983;0.99	T	0.64368	-0.6424	10	0.49607	T	0.09	.	16.9835	0.86335	0.0:0.0:1.0:0.0	.	162;160;272	B3KWG8;P49796-5;P49796	.;.;RGS3_HUMAN	T	272;272;160	ENSP00000363255:A272T;ENSP00000259406:A272T;ENSP00000312844:A160T	ENSP00000312844:A160T	A	+	1	0	RGS3	115299478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.273000	0.58914	2.684000	0.91462	0.650000	0.86243	GCC	RGS3	-	NULL	ENSG00000138835		0.627	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	-	0.00	66	0	G	NM_017790		116259657	+1	tier1	-	no_errors	ENST00000350696	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
RND3	390	genome.wustl.edu	37	2	151331459	151331459	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:151331459G>T	ENST00000375734.2	-	3	527	c.278C>A	c.(277-279)cCt>cAt	p.P93H	RND3_ENST00000263895.4_Missense_Mutation_p.P93H|RND3_ENST00000409557.1_De_novo_Start_OutOfFrame|RND3_ENST00000472416.1_5'UTR	NM_001254738.1	NP_001241667.1	P61587	RND3_HUMAN	Rho family GTPase 3	93					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.106)		ATCCGAATCAGGGTAAGAGAG	0.458																																																	0													93.0	91.0	92.0					2																	151331459		2203	4300	6503	SO:0001583	missense	0				CCDS2190.1	2q23.3	2008-02-05	2005-01-24	2005-01-27	ENSG00000115963	ENSG00000115963			671	protein-coding gene	gene with protein product		602924	"""ras homolog gene family, member E"""	ARHE		8649376	Standard	NM_001254738		Approved	RhoE, Rho8	uc002txe.3	P61587	OTTHUMG00000131859	ENST00000375734.2:c.278C>A	2.37:g.151331459G>T	ENSP00000364886:p.Pro93His		D3DP95|P52199	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.P93H	ENST00000375734.2	37	c.278	CCDS2190.1	2	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043018	0.93685	.	.	ENSG00000115963	ENST00000375734;ENST00000263895;ENST00000439275;ENST00000454202	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	6.02	6.02	0.97574	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84602	0.5508	M	0.84948	2.725	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.80764	0.953;0.994;0.992	D	0.85766	0.1352	10	0.87932	D	0	-24.8673	19.5289	0.95219	0.0:0.0:1.0:0.0	.	93;93;93	B2R838;D3DP96;P61587	.;.;RND3_HUMAN	H	93	ENSP00000364886:P93H;ENSP00000263895:P93H;ENSP00000395997:P93H;ENSP00000411950:P93H	ENSP00000263895:P93H	P	-	2	0	RND3	151039705	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.751000	0.98889	2.865000	0.98341	0.655000	0.94253	CCT	RND3	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000115963		0.458	RND3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RND3	HGNC	protein_coding	OTTHUMT00000254809.1	-	0.00	64	0	G	NM_005168		151331459	-1	tier1	-	no_errors	ENST00000263895	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
ROR2	4920	genome.wustl.edu	37	9	94519695	94519695	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:94519695G>A	ENST00000375708.3	-	3	520	c.322C>T	c.(322-324)Cgg>Tgg	p.R108W	ROR2_ENST00000375715.1_5'UTR|ROR2_ENST00000550066.1_5'UTR	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	108	Ig-like C2-type.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						ATGATGATCCGCCGCGGCTCC	0.592																																																	0													153.0	136.0	142.0					9																	94519695		2203	4300	6503	SO:0001583	missense	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.322C>T	9.37:g.94519695G>A	ENSP00000364860:p.Arg108Trp		Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R108W	ENST00000375708.3	37	c.322	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692698	0.68271	.	.	ENSG00000169071	ENST00000375708	T	0.70749	-0.51	5.04	3.01	0.34805	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39407	N	0.001370	D	0.85588	0.5731	M	0.90759	3.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88760	0.3256	10	0.87932	D	0	.	13.3566	0.60631	0.0:0.0:0.558:0.442	.	108;108	A1L4F5;Q01974	.;ROR2_HUMAN	W	108	ENSP00000364860:R108W	ENSP00000364860:R108W	R	-	1	2	ROR2	93559516	0.980000	0.34600	0.092000	0.20876	0.757000	0.42996	2.537000	0.45702	1.424000	0.47217	0.655000	0.94253	CGG	ROR2	-	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000169071		0.592	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1		0.00	47	0	G			94519695	-1			no_errors	ENST00000375708	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.808	A
RPL23AP53	644128	genome.wustl.edu	37	8	163654	163654	+	RNA	SNP	C	C	T	rs2906362	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:163654C>T	ENST00000606975.1	-	0	267									ribosomal protein L23a pseudogene 53																		CCTTTAAAGCCTTCACTTTGG	0.483													.|||	1371	0.273762	0.413	0.2291	5008	,	,		15294	0.1994		0.2256	False		,,,				2504	0.2434																0																																												0					8p23.3	2014-06-17			ENSG00000223508	ENSG00000223508			35921	pseudogene	pseudogene						19123937	Standard	NR_003572		Approved		uc010lrb.4				8.37:g.163654C>T				RNA	SNP	-	NULL	ENST00000606975.1	37	NULL		8																																																																																			RPL23AP53	-	-	ENSG00000223508		0.483	RPL23AP53-002	KNOWN	basic	processed_transcript	RPL23AP53	HGNC	pseudogene	OTTHUMT00000470409.1		0.00	128	0	C	NR_003572		163654	-1			no_errors	ENST00000606975	ensembl	human	known	74_37	rna	12.62	90	13	SNP	1.000	T
RPTOR	57521	genome.wustl.edu	37	17	78704474	78704474	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:78704474C>T	ENST00000306801.3	+	5	984	c.622C>T	c.(622-624)Cag>Tag	p.Q208*	RPTOR_ENST00000570891.1_Nonsense_Mutation_p.Q208*|RPTOR_ENST00000537330.1_Nonsense_Mutation_p.Q23*|RPTOR_ENST00000544334.2_Nonsense_Mutation_p.Q208*	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	208					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GTCCTTCAAGCAGTTCGCACT	0.577																																																	0													109.0	88.0	95.0					17																	78704474		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.622C>T	17.37:g.78704474C>T	ENSP00000307272:p.Gln208*		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Nonsense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.Q208*	ENST00000306801.3	37	c.622	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	C	44	11.193373	0.99528	.	.	ENSG00000141564	ENST00000537330;ENST00000306801;ENST00000544334	.	.	.	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5855	0.87980	0.0:1.0:0.0:0.0	.	.	.	.	X	23;208;208	.	ENSP00000307272:Q208X	Q	+	1	0	RPTOR	76319069	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.558000	0.82253	2.337000	0.79520	0.655000	0.94253	CAG	RPTOR	-	NULL	ENSG00000141564		0.577	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	-	0.00	35	0	C	NM_020761		78704474	+1	tier1	-	no_errors	ENST00000306801	ensembl	human	known	74_37	nonsense	15.91	37	7	SNP	1.000	T
RRM1	6240	genome.wustl.edu	37	11	4142839	4142839	+	Silent	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:4142839T>C	ENST00000300738.5	+	10	1086	c.882T>C	c.(880-882)ccT>ccC	p.P294P	RRM1_ENST00000423050.2_Silent_p.P197P|RRM1_ENST00000537197.1_5'UTR|RRM1_ENST00000534285.1_Silent_p.P72P|RRM1_ENST00000528470.1_3'UTR	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	294					cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	ACTAGCGTCCTGGGGCATTTG	0.373																																					NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)												0													83.0	84.0	84.0					11																	4142839		2201	4298	6499	SO:0001819	synonymous_variant	0			X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.882T>C	11.37:g.4142839T>C			Q9UNN2	Silent	SNP	pfam_RNR_lg_C,pfam_RNR_lsu_N,pfam_ATP-cone,superfamily_RNR_R1-su_N,pfscan_ATP-cone,prints_RNR_lg_C,tigrfam_NrdE_NrdA	p.P294	ENST00000300738.5	37	c.882	CCDS7750.1	11																																																																																			RRM1	-	pfam_RNR_lg_C,prints_RNR_lg_C,tigrfam_NrdE_NrdA	ENSG00000167325		0.373	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRM1	HGNC	protein_coding	OTTHUMT00000257197.1	-	0.00	40	0	T	NM_001033		4142839	+1	tier1	-	no_errors	ENST00000300738	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	C
RXFP1	59350	genome.wustl.edu	37	4	159538284	159538284	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:159538284G>T	ENST00000307765.5	+	9	933	c.682G>T	c.(682-684)Gtc>Ttc	p.V228F	RXFP1_ENST00000343542.5_Splice_Site_p.V228F|RXFP1_ENST00000460056.2_Splice_Site_p.V147F|RXFP1_ENST00000470033.1_Splice_Site_p.V195F|RXFP1_ENST00000448688.2_Splice_Site_p.V147F	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	228					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		CTTTTTCAGAGTCCTGATGAA	0.373																																																	0													164.0	157.0	159.0					4																	159538284		1853	4103	5956	SO:0001630	splice_region_variant	0			AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.681-1G>T	4.37:g.159538284G>T			B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.V228F	ENST00000307765.5	37	c.682	CCDS43276.1	4	.	.	.	.	.	.	.	.	.	.	G	9.165	1.019657	0.19355	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;D;T	0.83673	3.61;3.61;4.29;-1.75;3.61	5.53	4.69	0.59074	.	0.384497	0.28214	N	0.016169	T	0.57770	0.2076	N	0.01076	-1.035	0.45015	D	0.998034	B;B;B;B;B;B;B;B;B	0.17465	0.001;0.004;0.001;0.0;0.0;0.0;0.0;0.022;0.001	B;B;B;B;B;B;B;B;B	0.21917	0.009;0.009;0.008;0.003;0.003;0.001;0.002;0.037;0.005	T	0.56829	-0.7914	10	0.09338	T	0.73	.	13.7312	0.62789	0.0757:0.0:0.9243:0.0	.	239;255;147;228;195;147;98;165;228	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q4W5D9;Q9HBX9	.;.;.;.;.;.;.;.;RXFP1_HUMAN	F	147;228;147;228;195;98	ENSP00000423306:V147F;ENSP00000303248:V228F;ENSP00000414885:V147F;ENSP00000345889:V228F;ENSP00000420712:V195F	ENSP00000303248:V228F	V	+	1	0	RXFP1	159757734	1.000000	0.71417	0.829000	0.32907	0.828000	0.46876	3.392000	0.52537	1.466000	0.48025	0.650000	0.86243	GTC	RXFP1	-	NULL	ENSG00000171509		0.373	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP1	HGNC	protein_coding	OTTHUMT00000314865.1	-	0.00	52	0	G	NM_021634	Missense_Mutation	159538284	+1	tier1	-	no_errors	ENST00000307765	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.988	T
SCNN1G	6340	genome.wustl.edu	37	16	23197645	23197645	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:23197645C>T	ENST00000300061.2	+	2	196	c.53C>T	c.(52-54)aCg>aTg	p.T18M		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	18					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)	p.T18M(1)		NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CTGCCCGTGACGGGCCCTCAG	0.612																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											53.0	56.0	55.0					16																	23197645		2197	4300	6497	SO:0001583	missense	0			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.53C>T	16.37:g.23197645C>T	ENSP00000300061:p.Thr18Met		P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.T18M	ENST00000300061.2	37	c.53	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	C	10.94	1.491946	0.26774	.	.	ENSG00000166828	ENST00000300061	T	0.72051	-0.62	5.43	-2.44	0.06502	.	0.938103	0.08828	N	0.887744	T	0.57902	0.2085	N	0.08118	0	0.09310	N	1	D	0.65815	0.995	P	0.49387	0.609	T	0.58267	-0.7666	10	0.56958	D	0.05	-8.3931	14.0839	0.64942	0.1861:0.2155:0.5984:0.0	.	18	P51170	SCNNG_HUMAN	M	18	ENSP00000300061:T18M	ENSP00000300061:T18M	T	+	2	0	SCNN1G	23105146	0.003000	0.15002	0.008000	0.14137	0.041000	0.13682	-0.084000	0.11268	-0.754000	0.04715	0.561000	0.74099	ACG	SCNN1G	-	NULL	ENSG00000166828		0.612	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1		0.00	30	0	C	NM_001039		23197645	+1			no_errors	ENST00000300061	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.002	T
SEC23A	10484	genome.wustl.edu	37	14	39536423	39536423	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:39536423A>T	ENST00000307712.6	-	10	1698	c.1181T>A	c.(1180-1182)aTg>aAg	p.M394K	SEC23A_ENST00000536508.1_Missense_Mutation_p.M268K|SEC23A_ENST00000537403.1_Missense_Mutation_p.M192K|SEC23A_ENST00000545328.2_Missense_Mutation_p.M365K|SEC23A_ENST00000553925.1_5'Flank	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	394					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		CTGTCCATGCATGTCTTTGGT	0.353																																																	0													119.0	115.0	116.0					14																	39536423		2203	4300	6503	SO:0001583	missense	0			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1181T>A	14.37:g.39536423A>T	ENSP00000306881:p.Met394Lys		B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.M394K	ENST00000307712.6	37	c.1181	CCDS9668.1	14	.	.	.	.	.	.	.	.	.	.	A	7.038	0.562041	0.13498	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328;ENST00000554645	D;D;D;D	0.87491	-2.03;-2.08;-2.26;-2.03	5.31	4.09	0.47781	.	0.252384	0.46758	D	0.000262	T	0.65502	0.2697	N	0.03608	-0.345	0.34914	D	0.747736	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.63229	-0.6684	10	0.07325	T	0.83	-8.9005	6.6274	0.22837	0.7662:0.156:0.0778:0.0	.	282;365;268;394	G3V531;F5H365;F5H6C4;Q15436	.;.;.;SC23A_HUMAN	K	192;394;268;365;282	ENSP00000444193:M192K;ENSP00000306881:M394K;ENSP00000437715:M268K;ENSP00000445393:M365K	ENSP00000306881:M394K	M	-	2	0	SEC23A	38606174	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.257000	0.43240	2.008000	0.58898	0.454000	0.30748	ATG	SEC23A	-	NULL	ENSG00000100934		0.353	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	HGNC	protein_coding	OTTHUMT00000276728.2	-	0.00	81	0	A			39536423	-1	tier1	-	no_errors	ENST00000307712	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
SEC31B	25956	genome.wustl.edu	37	10	102249885	102249885	+	Missense_Mutation	SNP	G	G	A	rs146812157		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:102249885G>A	ENST00000370345.3	-	21	2942	c.2845C>T	c.(2845-2847)Cgc>Tgc	p.R949C		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	949	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GAGACCATGCGGCCGGGACCT	0.627													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17095	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	5,4401	8.1+/-20.4	0,5,2198	80.0	80.0	80.0		2845	2.7	0.0	10	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense	SEC31B	NM_015490.3	180	0,6,6497	AA,AG,GG		0.0116,0.1135,0.0461	benign	949/1180	102249885	6,13000	2203	4300	6503	SO:0001583	missense	0			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2845C>T	10.37:g.102249885G>A	ENSP00000359370:p.Arg949Cys		B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R949C	ENST00000370345.3	37	c.2845	CCDS7495.1	10	.	.	.	.	.	.	.	.	.	.	G	4.417	0.077122	0.08485	0.001135	1.16E-4	ENSG00000075826	ENST00000370345	T	0.51817	0.69	5.52	2.65	0.31530	.	0.771926	0.12938	N	0.426849	T	0.26484	0.0647	N	0.08118	0	0.09310	N	1	P;P	0.43633	0.813;0.536	B;B	0.42798	0.398;0.157	T	0.04840	-1.0923	10	0.39692	T	0.17	-0.5664	4.4856	0.11788	0.1807:0.0:0.6412:0.1781	.	948;949	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	C	949	ENSP00000359370:R949C	ENSP00000359370:R949C	R	-	1	0	SEC31B	102239875	0.010000	0.17322	0.007000	0.13788	0.001000	0.01503	1.312000	0.33574	0.691000	0.31592	-0.310000	0.09108	CGC	SEC31B	-	NULL	ENSG00000075826		0.627	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	HGNC	protein_coding	OTTHUMT00000051198.1	-	0.00	67	0	G	NM_015490		102249885	-1	tier1	rs146812157	no_errors	ENST00000370345	ensembl	human	known	74_37	missense	38.78	30	19	SNP	0.002	A
SETBP1	26040	genome.wustl.edu	37	18	42531877	42531877	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr18:42531877G>A	ENST00000282030.5	+	4	2868	c.2572G>A	c.(2572-2574)Gag>Aag	p.E858K		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	858			E -> K (in ACML; somatic mutation in ACML and other myeloid malignancies). {ECO:0000269|PubMed:23222956, ECO:0000269|PubMed:23628959}.			nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCCTGTGAGCGAGTCCCACAG	0.572									Schinzel-Giedion syndrome																																								0													82.0	53.0	63.0					18																	42531877		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.2572G>A	18.37:g.42531877G>A	ENSP00000282030:p.Glu858Lys		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.E858K	ENST00000282030.5	37	c.2572	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414826	0.83449	.	.	ENSG00000152217	ENST00000282030	D	0.91011	-2.77	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.93374	0.7887	L	0.34521	1.04	0.54753	D	0.999984	D	0.89917	1.0	D	0.85130	0.997	D	0.93393	0.6753	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	858	Q9Y6X0	SETBP_HUMAN	K	858	ENSP00000282030:E858K	ENSP00000282030:E858K	E	+	1	0	SETBP1	40785875	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	9.835000	0.99442	2.941000	0.99782	0.655000	0.94253	GAG	SETBP1	-	NULL	ENSG00000152217		0.572	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	41	0	G	NM_001130110		42531877	+1	tier1	-	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	15.56	37	7	SNP	1.000	A
SERPINB5	5268	genome.wustl.edu	37	18	61160254	61160254	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr18:61160254G>A	ENST00000382771.4	+	5	785	c.493G>A	c.(493-495)Gcc>Acc	p.A165T	SERPINB5_ENST00000489441.1_Missense_Mutation_p.A165T|SERPINB5_ENST00000464346.1_3'UTR	NM_002639.4	NP_002630.2	P36952	SPB5_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 5	165					cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelium (GO:0002009)|negative regulation of endopeptidase activity (GO:0010951)|prostate gland morphogenesis (GO:0060512)|regulation of epithelial cell proliferation (GO:0050678)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.A165T(1)		kidney(3)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)	12						GGTTAATGCTGCCTACTTTGT	0.408																																																	1	Substitution - Missense(1)	lung(1)											153.0	146.0	148.0					18																	61160254		2203	4300	6503	SO:0001583	missense	0			U04313	CCDS32839.1	18q21.33	2014-02-18	2005-08-18		ENSG00000206075	ENSG00000206075		"""Serine (or cysteine) peptidase inhibitors"""	8949	protein-coding gene	gene with protein product	"""protease inhibitor 5 (maspin)"""	154790	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5"""	PI5		8290962, 7724531, 16720730, 24172014	Standard	NM_002639		Approved	maspin	uc002liz.4	P36952	OTTHUMG00000141307	ENST00000382771.4:c.493G>A	18.37:g.61160254G>A	ENSP00000372221:p.Ala165Thr		B2R6Y4|Q6N0B4|Q8WW89	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Serpin_B9/Maspin	p.A165T	ENST00000382771.4	37	c.493	CCDS32839.1	18	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602812	0.87157	.	.	ENSG00000206075	ENST00000382771	D	0.84370	-1.84	6.05	6.05	0.98169	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.91260	0.7245	L	0.54323	1.7	0.54753	D	0.999983	D;P	0.89917	1.0;0.71	D;B	0.80764	0.994;0.201	D	0.90808	0.4699	10	0.66056	D	0.02	.	20.2037	0.98272	0.0:0.0:1.0:0.0	.	165;165	P36952;P36952-2	SPB5_HUMAN;.	T	165	ENSP00000372221:A165T	ENSP00000372221:A165T	A	+	1	0	SERPINB5	59311234	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	4.367000	0.59498	2.880000	0.98712	0.655000	0.94253	GCC	SERPINB5	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000206075		0.408	SERPINB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB5	HGNC	protein_coding	OTTHUMT00000280629.1		0.00	55	0	G	NM_002639		61160254	+1			no_errors	ENST00000382771	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
SGCZ	137868	genome.wustl.edu	37	8	13947970	13947970	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:13947970G>T	ENST00000382080.1	-	8	1636	c.921C>A	c.(919-921)aaC>aaA	p.N307K	SGCZ_ENST00000421524.2_Missense_Mutation_p.N260K	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	294					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)				NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		ACAGGCAGATGTTGCTACTGG	0.493																																																	0													181.0	167.0	172.0					8																	13947970		2203	4300	6503	SO:0001583	missense	0			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.921C>A	8.37:g.13947970G>T	ENSP00000371512:p.Asn307Lys		Q6REU0	Missense_Mutation	SNP	pfam_Sarcoglycan	p.N307K	ENST00000382080.1	37	c.921	CCDS5992.2	8	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892218	0.33442	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	T;T	0.10763	2.84;2.84	5.5	5.5	0.81552	.	0.368863	0.35805	N	0.002970	T	0.11879	0.0289	L	0.53249	1.67	0.25229	N	0.989848	B;B	0.30634	0.084;0.288	B;B	0.32533	0.07;0.147	T	0.22941	-1.0202	10	0.15066	T	0.55	.	12.131	0.53942	0.0781:0.0:0.9219:0.0	.	260;307	Q08AT0;Q96LD1-2	.;.	K	307;260	ENSP00000371512:N307K;ENSP00000405224:N260K	ENSP00000371512:N307K	N	-	3	2	SGCZ	13992341	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	3.963000	0.56773	2.760000	0.94817	0.655000	0.94253	AAC	SGCZ	-	NULL	ENSG00000185053		0.493	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	HGNC	protein_coding	OTTHUMT00000207636.2	-	0.00	44	0	G	NM_139167		13947970	-1	tier1	-	no_errors	ENST00000382080	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.999	T
SIGLEC12	89858	genome.wustl.edu	37	19	52003613	52003613	+	Intron	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:52003613C>T	ENST00000291707.3	-	2	483				SIGLEC12_ENST00000598614.1_Silent_p.L5L	NM_053003.2	NP_443729.1	Q96PQ1	SIG12_HUMAN	sialic acid binding Ig-like lectin 12 (gene/pseudogene)						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(2)|biliary_tract(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(1)|lung(23)|ovary(4)|prostate(2)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)	61		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TTGCCCATAGCAGGGGCAGCA	0.637																																																	0													14.0	13.0	14.0					19																	52003613		1327	2309	3636	SO:0001627	intron_variant	0			AF282256	CCDS12833.1, CCDS59416.1	19q13.41	2013-01-29	2011-06-29	2004-10-20	ENSG00000254521	ENSG00000254521		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15482	protein-coding gene	gene with protein product		606094	"""SIGLEC-like 1"", ""sialic acid binding Ig-like lectin 12"""	SIGLECL1		11409877, 11328818, 21555517	Standard	NM_053003		Approved	SLG, S2V, Siglec-XII, Siglec-12, Siglec-L1	uc002pwx.1	Q96PQ1	OTTHUMG00000165524	ENST00000291707.3:c.428-59G>A	19.37:g.52003613C>T			Q8IYH7	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L5	ENST00000291707.3	37	c.15	CCDS12833.1	19																																																																																			SIGLEC12	-	NULL	ENSG00000254521		0.637	SIGLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC12	HGNC	protein_coding	OTTHUMT00000384641.2	-	0.00	15	0	C	NM_053003		52003613	-1	tier1	-	no_errors	ENST00000598614	ensembl	human	putative	74_37	silent	20.00	15	4	SNP	0.374	T
SIGLEC6	946	genome.wustl.edu	37	19	52033988	52033988	+	Missense_Mutation	SNP	G	G	A	rs368576884		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:52033988G>A	ENST00000425629.3	-	3	807	c.653C>T	c.(652-654)aCg>aTg	p.T218M	SIGLEC6_ENST00000346477.3_Missense_Mutation_p.T218M|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.T218M|SIGLEC6_ENST00000391797.3_Missense_Mutation_p.T207M|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.T218M|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.T182M|SIGLEC6_ENST00000474054.1_5'Flank	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	218	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TCCAGGGAACGTCACCTGACA	0.667																																																	0								G	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	0,4404		0,0,2202	62.0	69.0	67.0		545,653,620,653,653,653	-6.9	0.0	19		67	1,8599		0,1,4299	no	missense,missense,missense,missense,missense,missense	SIGLEC6	NM_001177547.1,NM_001177548.1,NM_001177549.1,NM_001245.5,NM_198845.4,NM_198846.4	81,81,81,81,81,81	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign,benign	182/402,218/390,207/343,218/454,218/438,218/354	52033988	1,13003	2202	4300	6502	SO:0001583	missense	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.653C>T	19.37:g.52033988G>A	ENSP00000401502:p.Thr218Met		A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T218M	ENST00000425629.3	37	c.653	CCDS12834.3	19	.	.	.	.	.	.	.	.	.	.	G	6.448	0.450790	0.12223	0.0	1.16E-4	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458;ENST00000343300	T;T;T;T;T	0.03772	3.86;3.81;3.81;3.81;3.81	3.6	-6.92	0.01644	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	5.984710	0.02965	N	0.143647	T	0.04452	0.0122	L	0.49455	1.56	0.09310	N	1	P;P;B;B;P;P	0.46220	0.874;0.651;0.419;0.384;0.763;0.472	B;B;B;B;B;B	0.38428	0.273;0.1;0.245;0.092;0.202;0.068	T	0.19549	-1.0302	10	0.54805	T	0.06	.	2.6878	0.05112	0.1864:0.0994:0.4508:0.2634	.	218;182;207;218;218;218	F8WA78;C9JBE5;O43699-4;O43699-2;O43699-3;O43699	.;.;.;.;.;SIGL6_HUMAN	M	207;218;218;218;182;218	ENSP00000375674:T218M;ENSP00000401502:T218M;ENSP00000353071:T218M;ENSP00000410679:T182M;ENSP00000345907:T218M	ENSP00000345907:T218M	T	-	2	0	SIGLEC6	56725800	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.021000	0.00311	-2.258000	0.00694	-2.619000	0.00157	ACG	SIGLEC6	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105492		0.667	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	-	0.00	71	0	G	NM_001245		52033988	-1	tier1	-	no_errors	ENST00000425629	ensembl	human	known	74_37	missense	40.98	36	25	SNP	0.000	A
SLAMF1	6504	genome.wustl.edu	37	1	160593951	160593951	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:160593951G>A	ENST00000302035.6	-	4	1074	c.725C>T	c.(724-726)gCt>gTt	p.A242V	SLAMF1_ENST00000235739.5_Intron|SLAMF1_ENST00000538290.1_Missense_Mutation_p.A242V|SLAMF1_ENST00000355199.3_Missense_Mutation_p.A242V	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	242					lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TAACAGCCCAGCATACACTGC	0.383																																																	0													177.0	165.0	169.0					1																	160593951		2203	4300	6503	SO:0001583	missense	0			U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.725C>T	1.37:g.160593951G>A	ENSP00000306190:p.Ala242Val		Q5W172|Q9HBE8	Missense_Mutation	SNP	pfam_Sig_lymph_act_molc_N,pfscan_Ig-like_dom	p.A242V	ENST00000302035.6	37	c.725	CCDS1207.1	1	.	.	.	.	.	.	.	.	.	.	G	0.710	-0.787550	0.02884	.	.	ENSG00000117090	ENST00000302035;ENST00000538290;ENST00000355199	T;T;T	0.44083	0.93;0.93;0.93	3.65	-2.84	0.05751	.	2.744850	0.01361	N	0.012242	T	0.08935	0.0221	N	0.21142	0.635	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.08638	-1.0712	10	0.09590	T	0.72	-22.512	8.8973	0.35472	0.5912:0.0:0.4088:0.0	.	242	Q13291	SLAF1_HUMAN	V	242	ENSP00000306190:A242V;ENSP00000438406:A242V;ENSP00000347333:A242V	ENSP00000306190:A242V	A	-	2	0	SLAMF1	158860575	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.650000	0.05378	-0.645000	0.05458	-0.827000	0.03088	GCT	SLAMF1	-	NULL	ENSG00000117090		0.383	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF1	HGNC	protein_coding	OTTHUMT00000060454.1		0.00	46	0	G			160593951	-1			no_errors	ENST00000302035	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.000	A
SLC22A13	9390	genome.wustl.edu	37	3	38316550	38316550	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:38316550G>A	ENST00000311856.4	+	4	757	c.708G>A	c.(706-708)ggG>ggA	p.G236G	SLC22A13_ENST00000450935.2_Missense_Mutation_p.A144T	NM_004256.3	NP_004247.2	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 13	236					nicotinate transport (GO:2001142)|organic cation transport (GO:0015695)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	nicotinate transporter activity (GO:0090416)|organic cation transmembrane transporter activity (GO:0015101)	p.G236G(2)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		TCTCCCTCGGGCAGATGGTGC	0.607																																																	2	Substitution - coding silent(2)	lung(2)											130.0	125.0	127.0					3																	38316550		2203	4300	6503	SO:0001819	synonymous_variant	0			AB010438	CCDS2676.1	3p22.2	2013-07-18	2013-07-18	2003-10-15	ENSG00000172940	ENSG00000172940		"""Solute carriers"""	8494	protein-coding gene	gene with protein product		604047	"""organic cationic transporter-like 3"", ""solute carrier family 22 (organic anion transporter), member 13"""	ORCTL3		10072596, 18411268	Standard	NM_004256		Approved	OCTL1, OCTL3, OAT10	uc003chz.3	Q9Y226	OTTHUMG00000131086	ENST00000311856.4:c.708G>A	3.37:g.38316550G>A			B2RCV9|Q8IYG1	Missense_Mutation	SNP	NULL	p.A144T	ENST00000311856.4	37	c.430	CCDS2676.1	3	.	.	.	.	.	.	.	.	.	.	G	2.467	-0.322789	0.05350	.	.	ENSG00000172940	ENST00000450935	T	0.51574	0.7	4.84	-1.91	0.07641	.	.	.	.	.	T	0.27832	0.0685	.	.	.	0.19575	N	0.999961	.	.	.	.	.	.	T	0.26538	-1.0100	6	0.21540	T	0.41	.	4.313	0.10979	0.4817:0.0:0.2379:0.2804	.	.	.	.	T	144	ENSP00000406929:A144T	ENSP00000395106:A170T	A	+	1	0	SLC22A13	38291554	0.000000	0.05858	0.032000	0.17829	0.073000	0.16967	-1.791000	0.01758	-0.288000	0.09051	0.655000	0.94253	GCA	SLC22A13	-	NULL	ENSG00000172940		0.607	SLC22A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A13	HGNC	protein_coding	OTTHUMT00000253746.2		0.00	50	0	G	NM_004256		38316550	+1			no_errors	ENST00000450935	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.435	A
SLC25A17	10478	genome.wustl.edu	37	22	41173083	41173083	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:41173083C>T	ENST00000435456.2	-	7	787	c.654G>A	c.(652-654)acG>acA	p.T218T	SLC25A17_ENST00000402844.3_Silent_p.T136T|SLC25A17_ENST00000542412.1_Silent_p.T145T|SLC25A17_ENST00000544408.1_Silent_p.T181T|SLC25A17_ENST00000491545.1_5'UTR	NM_006358.2	NP_006349.1	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kDa), member 17	218					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|cellular lipid metabolic process (GO:0044255)|coenzyme A transmembrane transport (GO:0035349)|FAD transmembrane transport (GO:0035350)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|fatty acid transport (GO:0015908)|NAD transport (GO:0043132)|nucleotide transmembrane transport (GO:1901679)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|chaperone binding (GO:0051087)|coenzyme A transmembrane transporter activity (GO:0015228)|FAD transmembrane transporter activity (GO:0015230)|FMN transmembrane transporter activity (GO:0044610)|NAD transporter activity (GO:0051724)			central_nervous_system(1)|large_intestine(4)|lung(2)|skin(1)	8						GATAGGTCACCGTGGTGGCAA	0.453																																																	0													95.0	78.0	84.0					22																	41173083		2203	4300	6503	SO:0001819	synonymous_variant	0			Y12860	CCDS14005.1, CCDS74868.1	22q13.2	2013-05-22	2002-08-29		ENSG00000100372	ENSG00000100372		"""Solute carriers"""	10987	protein-coding gene	gene with protein product	"""peroxisomal membrane protein (34kD)"""	606795	"""solute carrier family 25 (mitochondrial carrier; peroxisomal membrane protein, 34kD), member 17"""			9874197	Standard	NM_006358		Approved	PMP34	uc003azc.3	O43808	OTTHUMG00000151139	ENST00000435456.2:c.654G>A	22.37:g.41173083C>T			A8KA59|Q5TFL0|Q9UGW8|Q9UGY7	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.T218	ENST00000435456.2	37	c.654	CCDS14005.1	22																																																																																			SLC25A17	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000100372		0.453	SLC25A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A17	HGNC	protein_coding	OTTHUMT00000321487.1	-	0.00	34	0	C	NM_006358		41173083	-1	tier1	-	no_errors	ENST00000435456	ensembl	human	known	74_37	silent	36.36	21	12	SNP	0.003	T
SLC4A7	9497	genome.wustl.edu	37	3	27463270	27463270	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:27463270C>G	ENST00000295736.5	-	9	1310	c.1240G>C	c.(1240-1242)Gtt>Ctt	p.V414L	SLC4A7_ENST00000446700.1_Splice_Site_p.V406L|RN7SL859P_ENST00000578725.1_RNA|SLC4A7_ENST00000425128.2_Splice_Site_p.V406L|SLC4A7_ENST00000388777.4_Intron|SLC4A7_ENST00000440156.1_Splice_Site_p.V410L|SLC4A7_ENST00000455077.1_Splice_Site_p.V295L|SLC4A7_ENST00000445684.1_Splice_Site_p.V410L|SLC4A7_ENST00000437179.1_Splice_Site_p.V295L|SLC4A7_ENST00000454389.1_Splice_Site_p.V423L|SLC4A7_ENST00000435667.2_Splice_Site_p.V299L|SLC4A7_ENST00000428386.1_Splice_Site_p.V290L	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	414					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	TTCATATCAACCTATTGACaa	0.348																																																	0													44.0	47.0	46.0					3																	27463270		2203	4300	6503	SO:0001630	splice_region_variant	0			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.1240-1G>C	3.37:g.27463270C>G			A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.V423L	ENST00000295736.5	37	c.1267	CCDS33721.1	3	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964342	0.74131	.	.	ENSG00000033867	ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000425128;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23;-1.23	5.55	5.55	0.83447	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.000000	0.85682	D	0.000000	T	0.77123	0.4084	N	0.17901	0.54	0.58432	D	0.99999	B;B;B;P;B;B;B;B	0.51537	0.193;0.01;0.096;0.946;0.193;0.008;0.193;0.01	B;B;B;P;B;B;B;B	0.62298	0.147;0.044;0.147;0.9;0.147;0.026;0.147;0.044	T	0.69624	-0.5095	10	0.05959	T	0.93	.	19.5162	0.95167	0.0:1.0:0.0:0.0	.	410;295;406;410;423;290;414;295	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;S4A7_HUMAN;.	L	414;290;423;410;295;406;295;410;299;406;310	ENSP00000295736:V414L;ENSP00000416368:V290L;ENSP00000390394:V423L;ENSP00000414797:V410L;ENSP00000394252:V295L;ENSP00000406605:V406L;ENSP00000407382:V295L;ENSP00000406804:V410L;ENSP00000395336:V299L;ENSP00000401949:V406L;ENSP00000388703:V310L	ENSP00000295736:V414L	V	-	1	0	SLC4A7	27438274	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.003000	0.70701	2.621000	0.88768	0.655000	0.94253	GTT	SLC4A7	-	pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk	ENSG00000033867		0.348	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2		0.00	24	0	C	NM_003615	Missense_Mutation	27463270	-1			no_errors	ENST00000454389	ensembl	human	known	74_37	missense	30.43	16	7	SNP	1.000	G
SLC5A11	115584	genome.wustl.edu	37	16	24902396	24902396	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:24902396G>T	ENST00000347898.3	+	9	1492		c.e9+1		SLC5A11_ENST00000449109.2_Intron|SLC5A11_ENST00000545376.1_Splice_Site|SLC5A11_ENST00000424767.2_Splice_Site|SLC5A11_ENST00000567758.1_Splice_Site|SLC5A11_ENST00000565769.1_Splice_Site|SLC5A11_ENST00000539472.1_Splice_Site|SLC5A11_ENST00000569071.1_Intron|SLC5A11_ENST00000568579.1_Splice_Site	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CACGGATCAGGTACAGGACAG	0.502																																																	0													94.0	87.0	89.0					16																	24902396		2197	4300	6497	SO:0001630	splice_region_variant	0			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.870+1G>T	16.37:g.24902396G>T				Splice_Site	SNP	-	e8+1	ENST00000347898.3	37	c.870+1	CCDS10625.1	16	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724388	0.89298	.	.	ENSG00000158865	ENST00000347898;ENST00000424767;ENST00000545376;ENST00000539472	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0849	0.86609	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC5A11	24809897	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.687000	0.98667	2.643000	0.89663	0.650000	0.86243	.	SLC5A11	-	-	ENSG00000158865		0.502	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	-	0.00	19	0	G	NM_052944	Intron	24902396	+1	tier1	-	no_errors	ENST00000347898	ensembl	human	known	74_37	splice_site	23.08	10	3	SNP	1.000	T
SLC6A6	6533	genome.wustl.edu	37	3	14508095	14508095	+	Silent	SNP	G	G	T	rs561563380	byFrequency	TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:14508095G>T	ENST00000454876.2	+	7	1133	c.804G>T	c.(802-804)ccG>ccT	p.P268P	SLC6A6_ENST00000360861.3_Silent_p.P268P			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6	268					amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TGACGCTGCCGGGCGCGGGCG	0.617																																																	0													87.0	74.0	78.0					3																	14508095		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.804G>T	3.37:g.14508095G>T			B2RNU7|Q9BRI2|Q9BXB0	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_taurine	p.P268	ENST00000454876.2	37	c.804	CCDS33705.1	3																																																																																			SLC6A6	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000131389		0.617	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A6	HGNC	protein_coding	OTTHUMT00000340507.1	-	0.00	24	0	G	NM_003043		14508095	+1	tier1	-	no_errors	ENST00000360861	ensembl	human	known	74_37	silent	12.50	28	4	SNP	0.820	T
SLCO3A1	28232	genome.wustl.edu	37	15	92706285	92706285	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:92706285G>A	ENST00000318445.6	+	10	2267	c.2053G>A	c.(2053-2055)Gca>Aca	p.A685T	SLCO3A1_ENST00000424469.2_Intron|SLCO3A1_ENST00000555549.1_3'UTR|RP11-24J19.1_ENST00000557683.1_RNA|RP11-152L20.3_ENST00000561674.1_RNA	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	685					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CCCTGTGCCCGCAAACCAGAC	0.493																																																	0													83.0	91.0	88.0					15																	92706285		2198	4298	6496	SO:0001583	missense	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.2053G>A	15.37:g.92706285G>A	ENSP00000320634:p.Ala685Thr		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.A685T	ENST00000318445.6	37	c.2053	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	G	11.72	1.722216	0.30503	.	.	ENSG00000176463	ENST00000318445;ENST00000555549	T	0.38401	1.14	5.32	3.31	0.37934	.	0.508271	0.20927	N	0.083171	T	0.16128	0.0388	N	0.08118	0	0.28073	N	0.932504	B	0.27971	0.196	B	0.12156	0.007	T	0.13872	-1.0493	10	0.19147	T	0.46	.	10.3627	0.44003	0.0:0.6005:0.2876:0.1119	.	685	Q9UIG8	SO3A1_HUMAN	T	685;404	ENSP00000320634:A685T	ENSP00000320634:A685T	A	+	1	0	SLCO3A1	90507289	0.917000	0.31117	0.908000	0.35775	0.996000	0.88848	0.673000	0.25203	1.125000	0.41998	0.655000	0.94253	GCA	SLCO3A1	-	NULL	ENSG00000176463		0.493	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1		0.00	40	0	G	NM_013272		92706285	+1			no_errors	ENST00000318445	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.973	A
SMYD1	150572	genome.wustl.edu	37	2	88387576	88387576	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:88387576C>T	ENST00000419482.2	+	3	595	c.510C>T	c.(508-510)atC>atT	p.I170I	SMYD1_ENST00000444564.2_Silent_p.I170I|SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000438570.1_Intron	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	170	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						TGCAGTACATCTCGCACATCT	0.607																																																	0													111.0	71.0	85.0					2																	88387576		2203	4300	6503	SO:0001819	synonymous_variant	0			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.510C>T	2.37:g.88387576C>T			A0AV30|A6NE13	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.I170	ENST00000419482.2	37	c.510	CCDS33240.1	2																																																																																			SMYD1	-	pfam_SET_dom,smart_SET_dom	ENSG00000115593		0.607	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	HGNC	protein_coding	OTTHUMT00000338229.2		0.00	76	0	C	XM_097915		88387576	+1			no_errors	ENST00000419482	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
SNRPN	6638	genome.wustl.edu	37	15	25223558	25223558	+	Silent	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:25223558A>G	ENST00000400100.1	+	13	1580	c.690A>G	c.(688-690)ccA>ccG	p.P230P	SNRPN_ENST00000444203.2_Silent_p.P234P|SNRPN_ENST00000554227.2_Silent_p.P234P|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000400098.1_Silent_p.P230P|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000400097.1_Silent_p.P230P|SNRPN_ENST00000577565.1_Silent_p.P230P|SNRPN_ENST00000346403.6_Silent_p.P230P|SNRPN_ENST00000390687.4_Silent_p.P230P|SNHG14_ENST00000551631.2_RNA	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	230	Repeat-rich region.				response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		TTCCAGGTCCACCTCCCCCAG	0.468									Prader-Willi syndrome																																								0													283.0	271.0	275.0					15																	25223558		1918	4121	6039	SO:0001819	synonymous_variant	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.690A>G	15.37:g.25223558A>G			B3KVR1|P14648|P17135|Q0D2Q5	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	p.P234	ENST00000400100.1	37	c.702	CCDS10017.1	15																																																																																			SNRPN	-	pirsf_snRNP-assoc_SmB/SmN	ENSG00000128739		0.468	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	26	0	A	NM_003097		25223558	+1	tier1	-	no_errors	ENST00000444203	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.998	G
SNX13	23161	genome.wustl.edu	37	7	17836453	17836453	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:17836453G>A	ENST00000409389.1	-	25	2828	c.2656C>T	c.(2656-2658)Cca>Tca	p.P886S	SNX13_ENST00000496855.1_5'UTR|SNX13_ENST00000428135.3_Missense_Mutation_p.P875S			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	886					intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					CACTCACCTGGCATAATTGCA	0.353																																																	0													174.0	156.0	162.0					7																	17836453		1843	4085	5928	SO:0001583	missense	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.2656C>T	7.37:g.17836453G>A	ENSP00000386705:p.Pro886Ser		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,superfamily_Cyt_c_oxidase_su5A/6,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.P875S	ENST00000409389.1	37	c.2623		7	.	.	.	.	.	.	.	.	.	.	G	17.42	3.383960	0.61845	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.36878	1.23;1.23	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.57021	0.2025	L	0.53671	1.685	0.80722	D	1	D;D;P	0.71674	0.964;0.998;0.955	P;D;P	0.70935	0.722;0.971;0.717	T	0.55927	-0.8063	10	0.52906	T	0.07	.	19.214	0.93768	0.0:0.0:1.0:0.0	.	672;886;875	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	S	886;875;923	ENSP00000386705:P886S;ENSP00000398789:P875S	ENSP00000242044:P923S	P	-	1	0	SNX13	17802978	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.476000	0.97823	2.529000	0.85273	0.557000	0.71058	CCA	SNX13	-	pfam_Sorting_nexin_C	ENSG00000071189		0.353	SNX13-002	NOVEL	basic|exp_conf	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327608.1		0.00	32	0	G	NM_015132		17836453	-1			no_errors	ENST00000428135	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
SOGA3	387104	genome.wustl.edu	37	6	127797352	127797352	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:127797352C>T	ENST00000525778.1	-	6	2564	c.1819G>A	c.(1819-1821)Gaa>Aaa	p.E607K	SOGA3_ENST00000465909.2_Missense_Mutation_p.E607K|SOGA3_ENST00000481848.2_Missense_Mutation_p.E607K|SOGA3_ENST00000368268.2_Missense_Mutation_p.E607K|SOGA3_ENST00000474293.2_5'Flank|SOGA3_ENST00000556132.1_Missense_Mutation_p.E607K			Q5TF21	SOGA3_HUMAN	SOGA family member 3	607					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											ACCTCCAGTTCGACGATTTTC	0.612																																																	0													155.0	166.0	163.0					6																	127797352		2137	4259	6396	SO:0001583	missense	0			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.1819G>A	6.37:g.127797352C>T	ENSP00000434570:p.Glu607Lys			Missense_Mutation	SNP	pfam_SOGA	p.E607K	ENST00000525778.1	37	c.1819	CCDS43505.1	6	.	.	.	.	.	.	.	.	.	.	C	28.8	4.948582	0.92593	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.51574	0.7;0.7;0.7;0.71	5.4	5.4	0.78164	.	0.045214	0.85682	D	0.000000	T	0.63236	0.2494	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64546	-0.6382	10	0.56958	D	0.05	-9.1882	19.1651	0.93553	0.0:1.0:0.0:0.0	.	607	Q5TF21	CF174_HUMAN	K	607	ENSP00000451768:E607K;ENSP00000357251:E607K;ENSP00000434570:E607K;ENSP00000435559:E607K	ENSP00000435559:E607K	E	-	1	0	C6orf174	127839045	1.000000	0.71417	0.824000	0.32777	0.982000	0.71751	7.770000	0.85390	2.543000	0.85770	0.555000	0.69702	GAA	SOGA3	-	pfam_SOGA	ENSG00000214338		0.612	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SOGA3	HGNC	protein_coding	OTTHUMT00000388246.1	-	0.00	65	0	C	NM_001012279		127797352	-1	tier1	-	no_errors	ENST00000368268	ensembl	human	known	74_37	missense	35.29	44	24	SNP	1.000	T
SPATA31D1	389763	genome.wustl.edu	37	9	84608354	84608354	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:84608354C>A	ENST00000344803.2	+	4	3016	c.2969C>A	c.(2968-2970)tCc>tAc	p.S990Y		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	990					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.S990Y(2)									CACCCTGTCTCCTCACCTGTC	0.502																																																	2	Substitution - Missense(2)	lung(2)											140.0	143.0	142.0					9																	84608354		1951	4146	6097	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2969C>A	9.37:g.84608354C>A	ENSP00000341988:p.Ser990Tyr			Missense_Mutation	SNP	NULL	p.S990Y	ENST00000344803.2	37	c.2969	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	4.448	0.082879	0.08533	.	.	ENSG00000214929	ENST00000344803	T	0.06371	3.31	2.45	-0.636	0.11508	.	.	.	.	.	T	0.06917	0.0176	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	P	0.61592	0.891	T	0.36089	-0.9762	9	0.72032	D	0.01	.	5.2446	0.15490	0.0:0.5394:0.0:0.4606	.	990	Q6ZQQ2	F75D1_HUMAN	Y	990	ENSP00000341988:S990Y	ENSP00000341988:S990Y	S	+	2	0	FAM75D1	83798174	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	0.138000	0.16016	-0.122000	0.11766	-0.300000	0.09419	TCC	SPATA31D1	-	NULL	ENSG00000214929		0.502	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	100	0	C	NM_001001670		84608354	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	36.84	60	35	SNP	0.006	A
SPEF2	79925	genome.wustl.edu	37	5	35793299	35793299	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:35793299G>A	ENST00000356031.3	+	32	4747	c.4593G>A	c.(4591-4593)gaG>gaA	p.E1531E	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Silent_p.E1526E|SPEF2_ENST00000303129.4_Silent_p.E328E	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1531					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TCAACTCCGAGTTCGTGGACT	0.433																																																	0													99.0	92.0	94.0					5																	35793299		1884	4111	5995	SO:0001819	synonymous_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.4593G>A	5.37:g.35793299G>A			Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Silent	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.E1531	ENST00000356031.3	37	c.4593	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.433	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	45	0	G	NM_144722		35793299	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	silent	37.78	28	17	SNP	0.504	A
SPN	6693	genome.wustl.edu	37	16	29676104	29676104	+	Missense_Mutation	SNP	G	G	T	rs541956371		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:29676104G>T	ENST00000360121.3	+	2	1147	c.1055G>T	c.(1054-1056)cGc>cTc	p.R352L	SPN_ENST00000395389.2_Missense_Mutation_p.R352L	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0			DRA -> GQT (in a primary colorectal cancer).		anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						CGGAAGTCTCGCCAGGGCTCC	0.672													g|||	1	0.000199681	0.0	0.0	5008	,	,		16576	0.0		0.0	False		,,,				2504	0.001																0													10.0	11.0	11.0					16																	29676104		2189	4290	6479	SO:0001583	missense	0			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.1055G>T	16.37:g.29676104G>T	ENSP00000353238:p.Arg352Leu		A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Missense_Mutation	SNP	NULL	p.R352L	ENST00000360121.3	37	c.1055	CCDS10650.1	16	.	.	.	.	.	.	.	.	.	.	.	22.9	4.343745	0.82022	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	T;T;T	0.35789	1.3;1.29;1.3	5.18	-2.82	0.05787	.	0.664725	0.13241	N	0.402846	T	0.39118	0.1066	L	0.53249	1.67	0.09310	N	1	D	0.56287	0.975	P	0.55713	0.782	T	0.27054	-1.0085	10	0.49607	T	0.09	0.3642	5.5013	0.16831	0.5026:0.1459:0.3515:0.0	.	352	P16150	LEUK_HUMAN	L	352	ENSP00000378787:R352L;ENSP00000412907:R352L;ENSP00000353238:R352L	ENSP00000353238:R352L	R	+	2	0	SPN	29583605	0.000000	0.05858	0.697000	0.30258	0.820000	0.46376	-0.386000	0.07370	-0.304000	0.08843	0.467000	0.42956	CGC	SPN	-	NULL	ENSG00000197471		0.672	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPN	HGNC	protein_coding	OTTHUMT00000215001.2	-	0.00	29	0	G			29676104	+1	tier1	-	no_errors	ENST00000360121	ensembl	human	known	74_37	missense	35.71	18	10	SNP	0.111	T
SPTA1	6708	genome.wustl.edu	37	1	158639308	158639308	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:158639308G>A	ENST00000368147.4	-	14	1903	c.1723C>T	c.(1723-1725)Cgt>Tgt	p.R575C		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	575					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGCAATCTACGTCTAGTGGCA	0.448																																																	0													171.0	159.0	163.0					1																	158639308		1939	4145	6084	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1723C>T	1.37:g.158639308G>A	ENSP00000357129:p.Arg575Cys		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.R575C	ENST00000368147.4	37	c.1723	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464772	0.63513	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54279	0.58;0.58	4.72	2.73	0.32206	.	0.319683	0.16110	N	0.229160	T	0.65688	0.2715	M	0.85630	2.765	0.41841	D	0.990124	D	0.89917	1.0	D	0.76575	0.988	T	0.70088	-0.4968	10	0.59425	D	0.04	.	12.2276	0.54470	0.0:0.0:0.6804:0.3196	.	575	P02549	SPTA1_HUMAN	C	575	ENSP00000357130:R575C;ENSP00000357129:R575C	ENSP00000357129:R575C	R	-	1	0	SPTA1	156905932	1.000000	0.71417	0.001000	0.08648	0.010000	0.07245	3.869000	0.56062	0.631000	0.30412	0.655000	0.94253	CGT	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.448	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3		0.00	52	0	G	NM_003126		158639308	-1			no_errors	ENST00000368147	ensembl	human	known	74_37	missense	5.36	52	3	SNP	0.852	A
SRCAP	10847	genome.wustl.edu	37	16	30740303	30740303	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:30740303A>G	ENST00000262518.4	+	26	6060	c.5675A>G	c.(5674-5676)aAg>aGg	p.K1892R	SRCAP_ENST00000395059.2_Missense_Mutation_p.K1830R|SRCAP_ENST00000344771.4_Missense_Mutation_p.K1734R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1892					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CTGGAGGAAAAGCGGAAGCGG	0.522																																																	0													66.0	75.0	72.0					16																	30740303		2197	4300	6497	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.5675A>G	16.37:g.30740303A>G	ENSP00000262518:p.Lys1892Arg		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.K1892R	ENST00000262518.4	37	c.5675	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568915	0.28003	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.91351	-2.81;-2.83;-2.83	5.93	4.84	0.62591	.	0.000000	0.56097	D	0.000032	T	0.79003	0.4373	N	0.04508	-0.205	0.22500	N	0.999049	B;B	0.22003	0.063;0.037	B;B	0.17433	0.018;0.005	T	0.68187	-0.5475	10	0.41790	T	0.15	-17.6467	11.169	0.48560	0.927:0.0:0.073:0.0	.	1830;1892	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	R	1892;1830;1734	ENSP00000262518:K1892R;ENSP00000378499:K1830R;ENSP00000343042:K1734R	ENSP00000262518:K1892R	K	+	2	0	SRCAP	30647804	0.999000	0.42202	1.000000	0.80357	0.973000	0.67179	1.917000	0.39996	1.071000	0.40834	0.482000	0.46254	AAG	SRCAP	-	NULL	ENSG00000080603		0.522	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1		0.00	66	0	A	NM_006662		30740303	+1			no_errors	ENST00000262518	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	G
SREK1	140890	genome.wustl.edu	37	5	65475786	65475786	+	IGR	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:65475786T>A	ENST00000380918.3	+	0	2433				SREK1_ENST00000334121.6_3'UTR|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TCATGCAGCTTTGGGACCATC	0.348																																					GBM(10;31 347 27684 38976 41583)												0																																										SO:0001628	intergenic_variant	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809		5.37:g.65475786T>A			A4FTW3|Q2M1J0|Q86X37	RNA	SNP	-	NULL	ENST00000380918.3	37	NULL	CCDS3991.1	5																																																																																			SREK1	-	-	ENSG00000153914		0.348	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	-	0.00	30	0	T	NM_001077199		65475786	+1	tier1	-	no_errors	ENST00000284041	ensembl	human	known	74_37	rna	10.00	26	3	SNP	0.998	A
SSH1	54434	genome.wustl.edu	37	12	109186396	109186396	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:109186396G>T	ENST00000326495.5	-	14	1652	c.1559C>A	c.(1558-1560)cCt>cAt	p.P520H	SSH1_ENST00000326470.5_Missense_Mutation_p.P531H|SSH1_ENST00000551165.1_Missense_Mutation_p.P520H|SSH1_ENST00000360239.3_Missense_Mutation_p.P208H	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	520					actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCAGGGGAAGGCAGAAGGGG	0.652																																																	0													42.0	48.0	46.0					12																	109186396		2202	4297	6499	SO:0001583	missense	0			BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.1559C>A	12.37:g.109186396G>T	ENSP00000315713:p.Pro520His		Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.P520H	ENST00000326495.5	37	c.1559	CCDS9121.1	12	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294603	0.23564	.	.	ENSG00000084112	ENST00000360239;ENST00000326495;ENST00000551165;ENST00000326470	T;T;T;T	0.12255	2.87;2.73;2.72;2.7	4.75	-9.26	0.00662	.	0.729507	0.13272	N	0.400450	T	0.02688	0.0081	N	0.01705	-0.755	0.09310	N	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.08055	0.001;0.002;0.0;0.003	T	0.30794	-0.9966	10	0.13853	T	0.58	3.8811	4.4576	0.11650	0.0922:0.218:0.4984:0.1914	.	531;520;520;208	Q8WYL5-5;Q8WYL5-2;Q8WYL5;Q8WYL5-4	.;.;SSH1_HUMAN;.	H	208;520;520;531	ENSP00000353374:P208H;ENSP00000315713:P520H;ENSP00000448824:P520H;ENSP00000326107:P531H	ENSP00000326107:P531H	P	-	2	0	SSH1	107710525	0.255000	0.24002	0.000000	0.03702	0.013000	0.08279	-0.041000	0.12084	-1.979000	0.00992	0.655000	0.94253	CCT	SSH1	-	NULL	ENSG00000084112		0.652	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSH1	HGNC	protein_coding	OTTHUMT00000403724.1		0.00	77	0	G	NM_018984		109186396	-1			no_errors	ENST00000326495	ensembl	human	known	74_37	missense	5.26	71	4	SNP	0.000	T
STAT3	6774	genome.wustl.edu	37	17	40483492	40483492	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:40483492G>A	ENST00000264657.5	-	11	1419	c.1107C>T	c.(1105-1107)gaC>gaT	p.D369D	STAT3_ENST00000585517.1_Silent_p.D369D|STAT3_ENST00000404395.3_Silent_p.D369D|STAT3_ENST00000588969.1_Silent_p.D369D|STAT3_ENST00000389272.3_Silent_p.D271D	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	369					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		GTACTTACTTGTCAATGCACA	0.323									Hyperimmunoglobulin E Recurrent Infection Syndrome																																								0													77.0	80.0	79.0					17																	40483492		2202	4300	6502	SO:0001819	synonymous_variant	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1107C>T	17.37:g.40483492G>A			A8K7B8|K7ENL3|O14916|Q9BW54	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.D369	ENST00000264657.5	37	c.1107	CCDS32656.1	17																																																																																			STAT3	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000168610		0.323	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	HGNC	protein_coding	OTTHUMT00000319353.3	-	0.00	48	0	G	NM_139276, NM_003150		40483492	-1	tier1	-	no_errors	ENST00000264657	ensembl	human	known	74_37	silent	18.18	45	10	SNP	1.000	A
STAT4	6775	genome.wustl.edu	37	2	192011340	192011340	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:192011340T>C	ENST00000392320.2	-	3	586	c.272A>G	c.(271-273)cAg>cGg	p.Q91R	STAT4_ENST00000409995.1_Splice_Site_p.Q91R|STAT4_ENST00000358470.4_Splice_Site_p.Q91R	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4	91					cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			CATTCTTACCTGAAGGACCTT	0.279																																																	0													70.0	68.0	69.0					2																	192011340		2201	4298	6499	SO:0001630	splice_region_variant	0				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.273+1A>G	2.37:g.192011340T>C			Q96NZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.Q91R	ENST00000392320.2	37	c.272	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178934	0.57692	.	.	ENSG00000138378	ENST00000358470;ENST00000392320;ENST00000413064;ENST00000409995	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.55	5.55	0.83447	STAT transcription factor, protein interaction (4);	0.182796	0.49305	D	0.000153	T	0.61476	0.2350	L	0.58669	1.825	0.48511	D	0.999669	D;P;P	0.71674	0.998;0.952;0.952	D;P;P	0.65874	0.939;0.698;0.698	T	0.64592	-0.6371	10	0.87932	D	0	-25.3837	11.008	0.47646	0.1389:0.0:0.0:0.8611	.	91;91;91	B4DSY7;B4DV04;Q14765	.;.;STAT4_HUMAN	R	91;91;64;91	ENSP00000351255:Q91R;ENSP00000376134:Q91R;ENSP00000403238:Q64R;ENSP00000386288:Q91R	ENSP00000351255:Q91R	Q	-	2	0	STAT4	191719585	1.000000	0.71417	1.000000	0.80357	0.279000	0.26890	4.491000	0.60326	2.326000	0.78906	0.533000	0.62120	CAG	STAT4	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	ENSG00000138378		0.279	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	-	0.00	68	0	T	NM_003151	Missense_Mutation	192011340	-1	tier1	-	no_errors	ENST00000358470	ensembl	human	known	74_37	missense	5.13	73	4	SNP	1.000	C
STRN4	29888	genome.wustl.edu	37	19	47228734	47228734	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:47228734T>C	ENST00000263280.6	-	10	1469	c.1420A>G	c.(1420-1422)Aag>Gag	p.K474E	STRN4_ENST00000539396.1_Missense_Mutation_p.K355E|STRN4_ENST00000391910.3_Missense_Mutation_p.K481E|STRN4_ENST00000594357.2_5'UTR	NM_001039877.1|NM_013403.2	NP_001034966.1|NP_037535.2	Q9NRL3	STRN4_HUMAN	striatin, calmodulin binding protein 4	474						cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000563)|all cancers(93;0.00138)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.035)		CCTCACTTCTTGGCCGTGACC	0.642																																																	0													48.0	46.0	47.0					19																	47228734		2203	4300	6503	SO:0001583	missense	0			AF212940	CCDS12690.1, CCDS42581.1	19q13.32	2013-01-10			ENSG00000090372	ENSG00000090372		"""WD repeat domain containing"""	15721	protein-coding gene	gene with protein product		614767				10748158	Standard	XM_006723171		Approved	zinedin, ZIN	uc002pfm.3	Q9NRL3		ENST00000263280.6:c.1420A>G	19.37:g.47228734T>C	ENSP00000263280:p.Lys474Glu		A0A024R0V2|B4DQH7|F8VYA6|Q8NE53	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Striatin_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K481E	ENST00000263280.6	37	c.1441	CCDS12690.1	19	.	.	.	.	.	.	.	.	.	.	T	17.93	3.509420	0.64522	.	.	ENSG00000090372	ENST00000391910;ENST00000263280;ENST00000539396	T;T;T	0.66460	-0.21;-0.17;-0.05	4.77	3.74	0.42951	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.062472	0.64402	D	0.000013	T	0.67896	0.2942	M	0.67700	2.07	0.80722	D	1	B;P	0.43392	0.384;0.805	P;B	0.45753	0.492;0.211	T	0.68424	-0.5412	10	0.62326	D	0.03	.	10.6632	0.45714	0.0:0.0:0.1614:0.8386	.	481;474	F8VYA6;Q9NRL3	.;STRN4_HUMAN	E	481;474;355	ENSP00000375777:K481E;ENSP00000263280:K474E;ENSP00000440901:K355E	ENSP00000263280:K474E	K	-	1	0	STRN4	51920574	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	5.974000	0.70465	0.672000	0.31204	0.459000	0.35465	AAG	STRN4	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000090372		0.642	STRN4-001	KNOWN	NMD_exception|basic|appris_candidate|CCDS	protein_coding	STRN4	HGNC	protein_coding	OTTHUMT00000466607.2		0.00	75	0	T			47228734	-1			no_errors	ENST00000391910	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	C
STT3A	3703	genome.wustl.edu	37	11	125484062	125484062	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:125484062C>T	ENST00000529196.1	+	15	1841	c.1635C>T	c.(1633-1635)aaC>aaT	p.N545N	STT3A_ENST00000392708.4_Silent_p.N545N|STT3A_ENST00000531491.1_Silent_p.N453N			P46977	STT3A_HUMAN	STT3A, subunit of the oligosaccharyltransferase complex (catalytic)	545					cellular protein metabolic process (GO:0044267)|co-translational protein modification (GO:0043686)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			NS(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	33	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		TGGACAATAACACATGGAATA	0.408																																																	0													216.0	202.0	207.0					11																	125484062		2201	4299	6500	SO:0001819	synonymous_variant	0			BC020965	CCDS8458.1, CCDS60998.1	11q23.3	2013-03-06	2013-03-06	2006-02-07	ENSG00000134910	ENSG00000134910	2.4.99.18		6172	protein-coding gene	gene with protein product	"""dolichyl-diphosphooligosaccharide protein glycotransferase"""	601134	"""integral membrane protein 1"", ""STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)"", ""STT3A, cataylic subunit of the oligosaccharyltransferase complex"""	ITM1		8941377, 8634329, 10234787	Standard	NM_152713		Approved	TMC, MGC9042, STT3-A	uc001qcd.2	P46977	OTTHUMG00000165852	ENST00000529196.1:c.1635C>T	11.37:g.125484062C>T			B4DJ24|E9PNQ1|Q86XU9|Q8TE35|Q8WUB4	Silent	SNP	pfam_Oligo_trans_STT3	p.N545	ENST00000529196.1	37	c.1635	CCDS8458.1	11																																																																																			STT3A	-	pfam_Oligo_trans_STT3	ENSG00000134910		0.408	STT3A-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	STT3A	HGNC	protein_coding	OTTHUMT00000386691.1	-	0.00	60	0	C	NM_152713		125484062	+1	tier1	-	no_errors	ENST00000392708	ensembl	human	known	74_37	silent	23.94	54	17	SNP	1.000	T
STT3B	201595	genome.wustl.edu	37	3	31656660	31656660	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:31656660A>G	ENST00000295770.2	+	6	1150	c.941A>G	c.(940-942)cAg>cGg	p.Q314R	STT3B_ENST00000453168.1_3'UTR	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	314					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						GTGGGATTCCAGCCAATCAGA	0.348																																																	0													103.0	97.0	99.0					3																	31656660		2203	4299	6502	SO:0001583	missense	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.941A>G	3.37:g.31656660A>G	ENSP00000295770:p.Gln314Arg		Q96JZ4|Q96KY7	Missense_Mutation	SNP	pfam_Oligo_trans_STT3	p.Q314R	ENST00000295770.2	37	c.941	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	A	25.8	4.676118	0.88445	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.83464	0.5260	M	0.89163	3.01	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.83901	0.0290	9	0.30078	T	0.28	-8.6658	15.4568	0.75321	1.0:0.0:0.0:0.0	.	314	Q8TCJ2	STT3B_HUMAN	R	314	.	ENSP00000295770:Q314R	Q	+	2	0	STT3B	31631664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.063000	0.61619	0.454000	0.30748	CAG	STT3B	-	pfam_Oligo_trans_STT3	ENSG00000163527		0.348	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	-	0.00	37	0	A	NM_178862		31656660	+1	tier1	-	no_errors	ENST00000295770	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152510430	152510430	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:152510430C>T	ENST00000367255.5	-	128	23859	c.23258G>A	c.(23257-23259)cGc>cAc	p.R7753H	SYNE1_ENST00000423061.1_Missense_Mutation_p.R7682H|SYNE1_ENST00000356820.4_Missense_Mutation_p.R2277H|SYNE1_ENST00000265368.4_Missense_Mutation_p.R7753H|SYNE1_ENST00000448038.1_Missense_Mutation_p.R7682H|SYNE1_ENST00000341594.5_Missense_Mutation_p.R7365H	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7753					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.R7753H(2)|p.R7682H(1)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAGCTCTACGCGTTCATTAAG	0.443										HNSCC(10;0.0054)																																							3	Substitution - Missense(3)	endometrium(3)											148.0	139.0	142.0					6																	152510430		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.23258G>A	6.37:g.152510430C>T	ENSP00000356224:p.Arg7753His		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R7753H	ENST00000367255.5	37	c.23258	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	34	5.298528	0.95574	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0;-1.0	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000017	D	0.86781	0.6015	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.999	D	0.86552	0.1835	10	0.62326	D	0.03	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	7753;7753;7682;7682	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	H	7753;399;7682;7753;7682;7365;2277;675	ENSP00000356224:R7753H;ENSP00000356226:R399H;ENSP00000396024:R7682H;ENSP00000265368:R7753H;ENSP00000390975:R7682H;ENSP00000341887:R7365H;ENSP00000349276:R2277H;ENSP00000356220:R675H	ENSP00000265368:R7753H	R	-	2	0	SYNE1	152552123	1.000000	0.71417	0.970000	0.41538	0.927000	0.56198	7.747000	0.85070	2.840000	0.97914	0.655000	0.94253	CGC	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.443	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	35	0	C	NM_182961		152510430	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
SYTL2	54843	genome.wustl.edu	37	11	85428540	85428540	+	Intron	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:85428540T>C	ENST00000528231.1	-	9	1893				SYTL2_ENST00000529581.1_5'UTR|SYTL2_ENST00000525423.1_Intron|SYTL2_ENST00000359152.5_Intron|SYTL2_ENST00000389958.3_Intron|SYTL2_ENST00000524452.1_Missense_Mutation_p.E550G|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000389960.4_Missense_Mutation_p.E550G|SYTL2_ENST00000533892.1_5'UTR|SYTL2_ENST00000527523.1_Missense_Mutation_p.E502G|SYTL2_ENST00000525702.1_5'Flank|SYTL2_ENST00000528566.1_Intron|SYTL2_ENST00000354566.3_Missense_Mutation_p.E872G	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TGGTACGCATTCATTTGTAAC	0.338																																																	0													238.0	223.0	228.0					11																	85428540		2203	4299	6502	SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1615+1292A>G	11.37:g.85428540T>C			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.E872G	ENST00000528231.1	37	c.2615	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	T	14.24	2.475484	0.43942	.	.	ENSG00000137501	ENST00000389960;ENST00000354566;ENST00000530351;ENST00000527523;ENST00000524452	T;T;T;T;T	0.38722	1.57;1.63;1.12;1.48;1.57	5.65	5.65	0.86999	.	.	.	.	.	T	0.43122	0.1233	N	0.22421	0.69	0.80722	D	1	P;P;D;D	0.62365	0.675;0.675;0.991;0.991	B;B;P;P	0.56563	0.295;0.295;0.801;0.647	T	0.25502	-1.0130	8	.	.	.	.	13.4033	0.60896	0.0:0.0:0.0:1.0	.	502;550;872;872	Q9HCH5-14;Q9HCH5-6;Q9HCH5-11;Q9HCH5-8	.;.;.;.	G	550;872;291;502;550	ENSP00000374610:E550G;ENSP00000346576:E872G;ENSP00000435009:E291G;ENSP00000434010:E502G;ENSP00000435238:E550G	.	E	-	2	0	SYTL2	85106188	1.000000	0.71417	0.999000	0.59377	0.855000	0.48748	3.503000	0.53340	2.166000	0.68216	0.460000	0.39030	GAA	SYTL2	-	NULL	ENSG00000137501		0.338	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	-	0.00	67	0	T	NM_206927		85428540	-1	tier1	-	no_errors	ENST00000354566	ensembl	human	known	74_37	missense	11.94	59	8	SNP	1.000	C
TAS1R2	80834	genome.wustl.edu	37	1	19180775	19180775	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:19180775G>T	ENST00000375371.3	-	3	1210	c.1189C>A	c.(1189-1191)Cat>Aat	p.H397N	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	397					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	TGCAGGGCATGGGCCACAGCA	0.607																																																	0													91.0	81.0	84.0					1																	19180775		2203	4300	6503	SO:0001583	missense	0				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1189C>A	1.37:g.19180775G>T	ENSP00000364520:p.His397Asn		Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.H397N	ENST00000375371.3	37	c.1189	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.023770	0.35701	.	.	ENSG00000179002	ENST00000375371	D	0.84146	-1.81	4.31	3.4	0.38934	Extracellular ligand-binding receptor (1);	0.486591	0.17107	N	0.186748	D	0.90345	0.6979	M	0.77486	2.375	0.43342	D	0.995397	D	0.89917	1.0	D	0.75484	0.986	D	0.88899	0.3351	10	0.87932	D	0	.	6.4565	0.21932	0.2178:0.0:0.7822:0.0	.	397	Q8TE23	TS1R2_HUMAN	N	397	ENSP00000364520:H397N	ENSP00000364520:H397N	H	-	1	0	TAS1R2	19053362	1.000000	0.71417	0.995000	0.50966	0.141000	0.21300	2.971000	0.49248	1.032000	0.39892	0.462000	0.41574	CAT	TAS1R2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000179002		0.607	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1		0.00	18	0	G			19180775	-1			no_errors	ENST00000375371	ensembl	human	novel	74_37	missense	8.70	21	2	SNP	0.998	T
TADA1	117143	genome.wustl.edu	37	1	166831598	166831598	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:166831598T>A	ENST00000367874.4	-	5	475	c.382A>T	c.(382-384)Aag>Tag	p.K128*	TADA1_ENST00000467021.1_5'UTR	NM_053053.3	NP_444281.1	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1	128					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	11						TGGGGATCCTTTGCCACAAAT	0.418																																																	0													115.0	103.0	107.0					1																	166831598		2203	4300	6503	SO:0001587	stop_gained	0			BC015401	CCDS1255.1	1q24.1	2009-10-02	2009-10-02	2009-10-02	ENSG00000152382	ENSG00000152382			30631	protein-coding gene	gene with protein product		612763	"""transcriptional adaptor 1 (HFI1 homolog, yeast)-like"", ""transcriptional adaptor 1 (HFI1 homolog, yeast)"""	TADA1L		11564863	Standard	NM_053053		Approved	STAF42, ADA1, hADA1, HFI1	uc001gdw.3	Q96BN2	OTTHUMG00000034321	ENST00000367874.4:c.382A>T	1.37:g.166831598T>A	ENSP00000356848:p.Lys128*		A8K4J9	Nonsense_Mutation	SNP	superfamily_Histone-fold	p.K128*	ENST00000367874.4	37	c.382	CCDS1255.1	1	.	.	.	.	.	.	.	.	.	.	T	37	6.465682	0.97590	.	.	ENSG00000152382	ENST00000367874	.	.	.	6.16	6.16	0.99307	.	0.107611	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.3439	14.7581	0.69583	0.0:0.0:0.0:1.0	.	.	.	.	X	128	.	ENSP00000356848:K128X	K	-	1	0	TADA1	165098222	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	3.593000	0.54001	2.367000	0.80283	0.528000	0.53228	AAG	TADA1	-	NULL	ENSG00000152382		0.418	TADA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA1	HGNC	protein_coding	OTTHUMT00000082881.1	-	0.00	54	0	T	NM_053053		166831598	-1	tier1	-	no_errors	ENST00000367874	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	0.977	A
TBX3	6926	genome.wustl.edu	37	12	115112511	115112511	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr12:115112511G>A	ENST00000257566.3	-	7	1618	c.1229C>T	c.(1228-1230)cCc>cTc	p.P410L	TBX3_ENST00000349155.2_Missense_Mutation_p.P390L	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	410					anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P410L(1)		breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CTTGACCGCGGGGCTGCCCTT	0.701																																																	1	Substitution - Missense(1)	lung(1)											15.0	16.0	15.0					12																	115112511		2196	4281	6477	SO:0001583	missense	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1229C>T	12.37:g.115112511G>A	ENSP00000257566:p.Pro410Leu		Q8TB20|Q9UKF8	Missense_Mutation	SNP	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.P410L	ENST00000257566.3	37	c.1229	CCDS9176.1	12	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918575	0.33908	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	D;D	0.88975	-2.45;-2.44	4.99	4.99	0.66335	Transcription factor, T-box, region of unknown function (1);	4.659220	0.01760	U	0.030525	D	0.88880	0.6557	L	0.38838	1.175	0.47905	D	0.999548	B;B	0.27882	0.006;0.192	B;B	0.35413	0.02;0.202	T	0.67589	-0.5632	10	0.72032	D	0.01	.	13.769	0.63012	0.0:0.1666:0.8334:0.0	.	390;410	O15119-2;O15119	.;TBX3_HUMAN	L	390;410;410	ENSP00000257567:P390L;ENSP00000257566:P410L	ENSP00000257566:P410L	P	-	2	0	TBX3	113596894	0.989000	0.36119	0.952000	0.39060	0.208000	0.24298	4.245000	0.58734	2.310000	0.77875	0.591000	0.81541	CCC	TBX3	-	pfam_TBX	ENSG00000135111		0.701	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2		0.00	29	0	G	NM_016569, NM_005996		115112511	-1			no_errors	ENST00000257566	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.976	A
TDRD5	163589	genome.wustl.edu	37	1	179590227	179590230	+	Splice_Site	DEL	GTAA	GTAA	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	GTAA	GTAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:179590227_179590230delGTAA	ENST00000367614.1	+	6	1331		c.e6+1		TDRD5_ENST00000294848.8_Splice_Site|TDRD5_ENST00000444136.1_Splice_Site	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5						DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AGAGTATGAGGTAAGTGTTTTGCT	0.358																																																	0																																										SO:0001630	splice_region_variant	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.972+1GTAA>-	1.37:g.179590227_179590230delGTAA			A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Splice_Site	DEL	-	e5+1	ENST00000367614.1	37	c.972+1_972+1	CCDS1332.1	1																																																																																			TDRD5	-	-	ENSG00000162782		0.358	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1		0.00	60	0	GTAA	NM_173533	Intron	179590230	+1	tier1		no_errors	ENST00000444136	ensembl	human	known	74_37	splice_site_del	14.29	66	11	DEL	1.000:1.000:0.997:0.996	-
TDRD7	23424	genome.wustl.edu	37	9	100222868	100222868	+	Missense_Mutation	SNP	G	G	A	rs566332281		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:100222868G>A	ENST00000355295.4	+	7	1559	c.1264G>A	c.(1264-1266)Ggt>Agt	p.G422S	TDRD7_ENST00000422139.2_Missense_Mutation_p.G348S	NM_014290.2	NP_055105.2	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	422					germ cell development (GO:0007281)|lens fiber cell differentiation (GO:0070306)|lens morphogenesis in camera-type eye (GO:0002089)|posttranscriptional regulation of gene expression (GO:0010608)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|P granule (GO:0043186)|ribonucleoprotein granule (GO:0035770)	mRNA binding (GO:0003729)	p.G422C(1)		endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Acute lymphoblastic leukemia(62;0.158)				GCAAGCACATGGTGATAATGA	0.418													G|||	1	0.000199681	0.0	0.0014	5008	,	,		21629	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)											96.0	91.0	93.0					9																	100222868		2203	4300	6503	SO:0001583	missense	0			AB025254	CCDS6725.1	9q22.33	2013-01-23			ENSG00000196116	ENSG00000196116		"""Tudor domain containing"""	30831	protein-coding gene	gene with protein product		611258				21436445	Standard	NM_014290		Approved	PCTAIRE2BP	uc004axj.3	Q8NHU6	OTTHUMG00000020326	ENST00000355295.4:c.1264G>A	9.37:g.100222868G>A	ENSP00000347444:p.Gly422Ser		A6NCI6|B2RBX3|B4DG99|B4DXF7|E7EQD4|Q5VV27|Q96JT1|Q9UFF0|Q9Y2M3	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.G422S	ENST00000355295.4	37	c.1264	CCDS6725.1	9	.	.	.	.	.	.	.	.	.	.	G	0.197	-1.048000	0.01981	.	.	ENSG00000196116	ENST00000355295;ENST00000422139	T;T	0.10382	2.88;2.88	5.49	3.6	0.41247	.	0.903587	0.09978	N	0.731378	T	0.07098	0.0180	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.35251	-0.9796	10	0.09084	T	0.74	-7.5341	10.5474	0.45068	0.2135:0.0:0.7865:0.0	.	422	Q8NHU6	TDRD7_HUMAN	S	422;348	ENSP00000347444:G422S;ENSP00000413608:G348S	ENSP00000347444:G422S	G	+	1	0	TDRD7	99262689	0.034000	0.19679	0.065000	0.19835	0.198000	0.23893	2.334000	0.43920	1.425000	0.47237	0.655000	0.94253	GGT	TDRD7	-	NULL	ENSG00000196116		0.418	TDRD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD7	HGNC	protein_coding	OTTHUMT00000053322.1		0.00	46	0	G	NM_014290		100222868	+1			no_errors	ENST00000355295	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.000	A
TDRD9	122402	genome.wustl.edu	37	14	104462118	104462118	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr14:104462118C>T	ENST00000409874.4	+	12	1400	c.1352C>T	c.(1351-1353)tCt>tTt	p.S451F	TDRD9_ENST00000339063.5_Missense_Mutation_p.S451F	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	451	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				GCAGAGAGTTCTGTCACAGTT	0.378																																																	0													205.0	170.0	182.0					14																	104462118		2203	4300	6503	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.1352C>T	14.37:g.104462118C>T	ENSP00000387303:p.Ser451Phe		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S451F	ENST00000409874.4	37	c.1352	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309991	0.81247	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.76968	-1.06;-1.06	5.06	5.06	0.68205	Helicase, C-terminal (3);	0.000000	0.64402	D	0.000019	D	0.91811	0.7409	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94360	0.7587	10	0.87932	D	0	.	16.1956	0.82024	0.0:1.0:0.0:0.0	.	451;451	Q8NDG6-2;Q8NDG6	.;TDRD9_HUMAN	F	451	ENSP00000387303:S451F;ENSP00000343545:S451F	ENSP00000343545:S451F	S	+	2	0	TDRD9	103531871	1.000000	0.71417	0.933000	0.37362	0.993000	0.82548	6.304000	0.72800	2.333000	0.79357	0.467000	0.42956	TCT	TDRD9	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000156414		0.378	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	-	0.00	98	0	C	NM_153046		104462118	+1	tier1	-	no_errors	ENST00000409874	ensembl	human	known	74_37	missense	18.18	81	18	SNP	1.000	T
TEKT3	64518	genome.wustl.edu	37	17	15231347	15231347	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:15231347C>T	ENST00000395930.1	-	4	811	c.625G>A	c.(625-627)Gac>Aac	p.D209N	TEKT3_ENST00000338696.2_Missense_Mutation_p.D209N	NM_031898.2	NP_114104.1	Q9BXF9	TEKT3_HUMAN	tektin 3	209					cilium morphogenesis (GO:0060271)|regulation of fertilization (GO:0080154)|sperm motility (GO:0030317)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				endometrium(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	23				UCEC - Uterine corpus endometrioid carcinoma (92;0.0877)		TGAACTAGGTCGATTCCCATT	0.403																																																	0													233.0	184.0	200.0					17																	15231347		2203	4300	6503	SO:0001583	missense	0			AF334676	CCDS11169.1	17p12	2011-05-23			ENSG00000125409	ENSG00000125409			14293	protein-coding gene	gene with protein product		612683				11381029, 14735490	Standard	NM_031898		Approved	FLJ32828	uc002gon.3	Q9BXF9	OTTHUMG00000058965	ENST00000395930.1:c.625G>A	17.37:g.15231347C>T	ENSP00000379263:p.Asp209Asn		B2RAS7|D3DTT0|Q8N5R5|Q96M48	Missense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.D209N	ENST00000395930.1	37	c.625	CCDS11169.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339599	0.81911	.	.	ENSG00000125409	ENST00000395930;ENST00000338696;ENST00000539245	T;T;T	0.05025	3.51;3.51;3.51	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.19967	0.0480	M	0.92367	3.3	0.58432	D	0.999999	P	0.47762	0.9	B	0.43658	0.426	T	0.18871	-1.0323	10	0.87932	D	0	-6.8125	16.4988	0.84252	0.0:1.0:0.0:0.0	.	209	Q9BXF9	TEKT3_HUMAN	N	209;209;43	ENSP00000379263:D209N;ENSP00000343995:D209N;ENSP00000443280:D43N	ENSP00000343995:D209N	D	-	1	0	TEKT3	15172072	1.000000	0.71417	0.857000	0.33713	0.501000	0.33797	6.696000	0.74598	2.437000	0.82529	0.491000	0.48974	GAC	TEKT3	-	pfam_Tektin	ENSG00000125409		0.403	TEKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT3	HGNC	protein_coding	OTTHUMT00000130385.2	-	0.00	45	0	C	NM_031898		15231347	-1	tier1	-	no_errors	ENST00000338696	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.999	T
TENM3	55714	genome.wustl.edu	37	4	183522243	183522243	+	Silent	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr4:183522243G>T	ENST00000511685.1	+	4	801	c.678G>T	c.(676-678)ctG>ctT	p.L226L	TENM3_ENST00000406950.2_Silent_p.L226L			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	226	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCGCCGAGCTGCAAACCACAC	0.532																																																	0													73.0	82.0	79.0					4																	183522243		1881	4107	5988	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.678G>T	4.37:g.183522243G>T			Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.L226	ENST00000511685.1	37	c.678	CCDS47165.1	4																																																																																			TENM3	-	pfam_Ten_N	ENSG00000218336		0.532	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	66	0	G			183522243	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	silent	28.09	63	25	SNP	1.000	T
THADA	63892	genome.wustl.edu	37	2	43732856	43732856	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:43732856G>T	ENST00000405006.4	-	24	3877	c.3526C>A	c.(3526-3528)Cca>Aca	p.P1176T	THADA_ENST00000415080.2_Missense_Mutation_p.P886T|THADA_ENST00000405975.2_Missense_Mutation_p.P1176T|THADA_ENST00000330266.7_Missense_Mutation_p.P886T	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1176										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				CCTTTCTTTGGTTCAGATGCC	0.388																																																	0													90.0	83.0	85.0					2																	43732856		1839	4092	5931	SO:0001583	missense	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.3526C>A	2.37:g.43732856G>T	ENSP00000385995:p.Pro1176Thr		A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	p.P1176T	ENST00000405006.4	37	c.3526	CCDS46268.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.38|16.38	3.107875|3.107875	0.56291|0.56291	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000407351|ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006	.|T;T;T;T	.|0.45668	.|0.89;0.89;0.89;0.89	5.54|5.54	4.64|4.64	0.57946|0.57946	.|Domain of unknown function DUF2428, death-receptor-like (1);Armadillo-type fold (1);	.|0.115968	.|0.64402	.|D	.|0.000013	T|T	0.62816|0.62816	0.2459|0.2459	M|M	0.81497|0.81497	2.545|2.545	0.47183|0.47183	D|D	0.999345|0.999345	.|D;D;D;P	.|0.69078	.|0.997;0.987;0.99;0.939	.|D;P;P;P	.|0.64144	.|0.922;0.842;0.897;0.549	T|T	0.68194|0.68194	-0.5473|-0.5473	5|10	.|0.66056	.|D	.|0.02	.|.	12.6086|12.6086	0.56538|0.56538	0.084:0.0:0.916:0.0|0.084:0.0:0.916:0.0	.|.	.|886;1177;886;1176	.|Q6YHU6-2;B6ZDQ0;C9JJB1;Q6YHU6	.|.;.;.;THADA_HUMAN	K|T	489|886;1176;1177;886;1176	.|ENSP00000331105:P886T;ENSP00000386088:P1176T;ENSP00000416048:P886T;ENSP00000385995:P1176T	.|ENSP00000331105:P886T	N|P	-|-	3|1	2|0	THADA|THADA	43586360|43586360	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.919000|5.919000	0.70005|0.70005	1.508000|1.508000	0.48769|0.48769	0.650000|0.650000	0.86243|0.86243	AAC|CCA	THADA	-	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	ENSG00000115970		0.388	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	-	0.00	56	0	G	NM_022065		43732856	-1	tier1	-	no_errors	ENST00000405006	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
THBS2	7058	genome.wustl.edu	37	6	169633059	169633059	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:169633059C>T	ENST00000366787.3	-	12	1954	c.1705G>A	c.(1705-1707)Gat>Aat	p.D569N	XXyac-YX65C7_A.2_ENST00000444188.1_RNA	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	569	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CAGGACCCATCGGGGAAGCTG	0.667																																					Esophageal Squamous(91;219 1934 18562 44706)												0													34.0	35.0	35.0					6																	169633059		2180	4264	6444	SO:0001583	missense	0				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.1705G>A	6.37:g.169633059C>T	ENSP00000355751:p.Asp569Asn		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D569N	ENST00000366787.3	37	c.1705	CCDS34574.1	6	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721989	0.89298	.	.	ENSG00000186340	ENST00000366787	D	0.95554	-3.74	4.06	4.06	0.47325	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.191523	0.25148	U	0.032766	D	0.96636	0.8902	M	0.63169	1.94	0.51012	D	0.999904	D	0.89917	1.0	D	0.80764	0.994	D	0.97028	0.9748	10	0.59425	D	0.04	-30.5683	16.6818	0.85294	0.0:1.0:0.0:0.0	.	569	P35442	TSP2_HUMAN	N	569	ENSP00000355751:D569N	ENSP00000355751:D569N	D	-	1	0	THBS2	169374984	1.000000	0.71417	0.422000	0.26621	0.906000	0.53458	7.327000	0.79147	1.992000	0.58205	0.472000	0.43445	GAT	THBS2	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000186340		0.667	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	HGNC	protein_coding	OTTHUMT00000105439.1	-	0.00	75	0	C	NM_003247		169633059	-1	tier1	-	no_errors	ENST00000366787	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
TMEM134	80194	genome.wustl.edu	37	11	67232151	67232153	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	GAA	GAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:67232151_67232153delGAA	ENST00000308022.2	-	7	561_563	c.520_522delTTC	c.(520-522)ttcdel	p.F174del	CTC-1337H24.2_ENST00000602944.1_lincRNA|TMEM134_ENST00000393877.3_In_Frame_Del_p.F159del|TMEM134_ENST00000541059.1_5'UTR	NM_001078651.1|NM_025124.2	NP_001072119.1|NP_079400.1	Q9H6X4	TM134_HUMAN	transmembrane protein 134	174						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						CGCAGTAGATGAAGATCACGTGA	0.69																																																	0																																										SO:0001651	inframe_deletion	0			AK025402	CCDS8167.1, CCDS41678.1	11q13.2	2006-03-09			ENSG00000172663	ENSG00000172663			26142	protein-coding gene	gene with protein product							Standard	NM_025124		Approved	FLJ21749	uc001olq.2	Q9H6X4	OTTHUMG00000168034	ENST00000308022.2:c.520_522delTTC	11.37:g.67232151_67232153delGAA	ENSP00000312615:p.Phe174del		Q08AK4|Q6PJN3	In_Frame_Del	DEL	pfam_DUF872_TM	p.F159in_frame_del	ENST00000308022.2	37	c.477_475	CCDS8167.1	11																																																																																			TMEM134	-	pfam_DUF872_TM	ENSG00000172663		0.690	TMEM134-020	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TMEM134	HGNC	protein_coding	OTTHUMT00000398994.1		0.00	73	0	GAA	NM_025124		67232153	-1	tier1		no_errors	ENST00000393877	ensembl	human	known	74_37	in_frame_del	15.71	59	11	DEL	1.000:1.000:1.000	-
TMEM86A	144110	genome.wustl.edu	37	11	18722743	18722743	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr11:18722743T>C	ENST00000280734.2	+	2	381	c.285T>C	c.(283-285)caT>caC	p.H95H	TMEM86A_ENST00000527002.1_3'UTR	NM_153347.1	NP_699178.1	Q8N2M4	TM86A_HUMAN	transmembrane protein 86A	95						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|skin(2)	11						ACTTCGTGCATGGTCAGTGGC	0.587																																																	0													58.0	59.0	58.0					11																	18722743		2199	4293	6492	SO:0001630	splice_region_variant	0			BC035692	CCDS7844.1	11p15.1	2005-10-28				ENSG00000151117			26890	protein-coding gene	gene with protein product							Standard	NM_153347		Approved	FLJ90119	uc001moz.1	Q8N2M4		ENST00000280734.2:c.286+1T>C	11.37:g.18722743T>C			Q96AJ0	Silent	SNP	pfam_YhhN	p.H95	ENST00000280734.2	37	c.285	CCDS7844.1	11																																																																																			TMEM86A	-	pfam_YhhN	ENSG00000151117		0.587	TMEM86A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM86A	HGNC	protein_coding	OTTHUMT00000387812.1	-	0.00	69	0	T	NM_153347	Silent	18722743	+1	tier1	-	no_errors	ENST00000280734	ensembl	human	known	74_37	silent	31.03	40	18	SNP	0.987	C
TMPRSS7	344805	genome.wustl.edu	37	3	111795914	111795914	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:111795914G>A	ENST00000452346.2	+	16	2150	c.2147G>A	c.(2146-2148)tGc>tAc	p.C716Y	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.C590Y			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	716	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CAGCCAATATGCATTCCTCCC	0.488																																																	0													141.0	129.0	132.0					3																	111795914		1943	4149	6092	SO:0001583	missense	0			BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.2147G>A	3.37:g.111795914G>A	ENSP00000398236:p.Cys716Tyr		C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.C590Y	ENST00000452346.2	37	c.1769		3	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703603	0.88924	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.66995	-0.24;-0.24	6.11	6.11	0.99139	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	D	0.89508	0.6735	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.92422	0.5946	10	0.87932	D	0	.	19.5057	0.95114	0.0:0.0:1.0:0.0	.	716;590	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	Y	716;704;690;590	ENSP00000398236:C716Y;ENSP00000411645:C590Y	ENSP00000411645:C590Y	C	+	2	0	TMPRSS7	113278604	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.141000	0.94612	2.906000	0.99361	0.655000	0.94253	TGC	TMPRSS7	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000176040		0.488	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	TMPRSS7	HGNC	protein_coding	OTTHUMT00000347592.2	-	0.00	39	0	G	XM_293599		111795914	+1	tier1	-	no_errors	ENST00000419127	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
TNFAIP3	7128	genome.wustl.edu	37	6	138196886	138196886	+	Missense_Mutation	SNP	G	G	T	rs375378882		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:138196886G>T	ENST00000237289.4	+	4	614	c.548G>T	c.(547-549)cGa>cTa	p.R183L		NM_001270507.1|NM_001270508.1|NM_006290.3	NP_001257436.1|NP_001257437.1|NP_006281.1	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	183	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				apoptotic process (GO:0006915)|B-1 B cell homeostasis (GO:0001922)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of B cell activation (GO:0050869)|negative regulation of bone resorption (GO:0045779)|negative regulation of CD40 signaling pathway (GO:2000349)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 3 signaling pathway (GO:0034140)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of protein catabolic process (GO:0045732)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked deubiquitination (GO:0070536)|protein oligomerization (GO:0051259)|regulation of defense response to virus by host (GO:0050691)|regulation of germinal center formation (GO:0002634)|regulation of vascular wound healing (GO:0061043)|response to molecule of bacterial origin (GO:0002237)|tolerance induction to lipopolysaccharide (GO:0072573)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|protease binding (GO:0002020)|protein self-association (GO:0043621)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.0?(25)		breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(196)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	225	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		CCCATGGCCCGAAGTGGACTT	0.443			"""D, N, F"""		"""marginal zone B-cell lymphomas, Hodgkin's lymphoma, primary mediastinal B cell lymphoma"""																																GBM(130;153 1739 22295 28918 47987)			Rec	yes		6	6q23	7128	"""tumor necrosis factor, alpha-induced protein 3"""		L	25	Whole gene deletion(25)	haematopoietic_and_lymphoid_tissue(25)											121.0	119.0	119.0					6																	138196886		2203	4300	6503	SO:0001583	missense	0			M59465	CCDS5187.1	6q23-q25	2013-01-21			ENSG00000118503	ENSG00000118503		"""OTU domain containing"""	11896	protein-coding gene	gene with protein product		191163				2118515	Standard	NM_006290		Approved	A20, OTUD7C	uc031spw.1	P21580	OTTHUMG00000015664	ENST00000237289.4:c.548G>T	6.37:g.138196886G>T	ENSP00000237289:p.Arg183Leu		B2R767|E1P588|Q2HIX9|Q5VXQ7|Q9NSR6	Missense_Mutation	SNP	pfam_Znf_A20,pfam_OTU,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.R183L	ENST00000237289.4	37	c.548	CCDS5187.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.47|10.47	1.357874|1.357874	0.24598|0.24598	.|.	.|.	ENSG00000118503|ENSG00000118503	ENST00000539356|ENST00000237289;ENST00000535574;ENST00000535332;ENST00000544646	.|T	.|0.24350	.|1.86	6.08|6.08	3.22|3.22	0.36961|0.36961	.|Ovarian tumour, otubain (2);	.|0.623617	.|0.16890	.|N	.|0.195345	.|T	.|0.09113	.|0.0225	L|L	0.48642|0.48642	1.525|1.525	0.44207|0.44207	D|D	0.997033|0.997033	.|B	.|0.17667	.|0.023	.|B	.|0.17098	.|0.017	.|T	.|0.05733	.|-1.0867	.|10	0.22706|0.45353	T|T	0.39|0.12	-8.1519|-8.1519	5.4205|5.4205	0.16398|0.16398	0.2273:0.0:0.6337:0.1389|0.2273:0.0:0.6337:0.1389	.|.	.|183	.|P21580	.|TNAP3_HUMAN	X|L	183|183	.|ENSP00000237289:R183L	ENSP00000439665:E183X|ENSP00000237289:R183L	E|R	+|+	1|2	0|0	TNFAIP3|TNFAIP3	138238579|138238579	0.780000|0.780000	0.28664|0.28664	0.251000|0.251000	0.24312|0.24312	0.210000|0.210000	0.24377|0.24377	0.998000|0.998000	0.29744|0.29744	0.384000|0.384000	0.24942|0.24942	-0.345000|-0.345000	0.07892|0.07892	GAA|CGA	TNFAIP3	-	pfam_OTU,pfscan_OTU	ENSG00000118503		0.443	TNFAIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP3	HGNC	protein_coding	OTTHUMT00000042414.1		0.00	48	0	G			138196886	+1			no_errors	ENST00000237289	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.715	T
TNFSF12	8742	genome.wustl.edu	37	17	7460431	7460431	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:7460431G>T	ENST00000293825.6	+	7	777	c.514G>T	c.(514-516)Ggg>Tgg	p.G172W	TNFSF12_ENST00000557233.1_Intron|TNFSF12_ENST00000462811.1_3'UTR|TNFSF13_ENST00000396542.1_5'Flank|TNFSF12-TNFSF13_ENST00000293826.4_Intron|TNFSF13_ENST00000380535.4_5'Flank|TNFSF13_ENST00000338784.4_5'Flank|TNFSF13_ENST00000483039.1_5'Flank|TNFSF13_ENST00000349228.4_5'Flank|TNFSF13_ENST00000396545.4_5'Flank	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	172					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)	p.G172R(1)		central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				CTTTGATGAGGGGAAGGCTGT	0.622																																																	1	Substitution - Missense(1)	large_intestine(1)											99.0	71.0	80.0					17																	7460431		2203	4300	6503	SO:0001583	missense	0			AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.514G>T	17.37:g.7460431G>T	ENSP00000293825:p.Gly172Trp		Q8IZK7|Q8WUZ7	Missense_Mutation	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom	p.G172W	ENST00000293825.6	37	c.514	CCDS11109.1	17	.	.	.	.	.	.	.	.	.	.	G	18.19	3.568015	0.65651	.	.	ENSG00000239697	ENST00000293825	D	0.94723	-3.5	4.5	3.51	0.40186	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	.	.	.	.	D	0.95153	0.8429	L	0.40543	1.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94871	0.8030	9	0.72032	D	0.01	.	12.0545	0.53527	0.0879:0.0:0.9121:0.0	.	172	O43508	TNF12_HUMAN	W	172	ENSP00000293825:G172W	ENSP00000293825:G172W	G	+	1	0	TNFSF12	7401155	1.000000	0.71417	0.820000	0.32676	0.987000	0.75469	4.433000	0.59929	1.022000	0.39626	0.561000	0.74099	GGG	TNFSF12	-	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom	ENSG00000239697		0.622	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF12	HGNC	protein_coding	OTTHUMT00000226951.2		0.00	37	0	G	NM_003809		7460431	+1			no_errors	ENST00000293825	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.986	T
TNRC18	84629	genome.wustl.edu	37	7	5401604	5401604	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:5401604G>A	ENST00000430969.1	-	13	4804	c.4456C>T	c.(4456-4458)Cgg>Tgg	p.R1486W	TNRC18_ENST00000399537.4_Missense_Mutation_p.R1486W	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1486							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TCGGCCAGCCGCATCCGGAAG	0.667																																																	0													20.0	23.0	22.0					7																	5401604		2076	4206	6282	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4456C>T	7.37:g.5401604G>A	ENSP00000395538:p.Arg1486Trp		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R1486W	ENST00000430969.1	37	c.4456	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	G	19.92	3.917049	0.73098	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.26223	2.16;2.16;1.75	5.52	2.4	0.29515	.	0.000000	0.40469	N	0.001093	T	0.49660	0.1570	M	0.77103	2.36	0.39721	D	0.971474	D	0.89917	1.0	D	0.76071	0.987	T	0.61063	-0.7138	10	0.87932	D	0	.	13.4634	0.61239	0.0:0.0:0.4916:0.5084	.	1486	O15417	TNC18_HUMAN	W	1486;1486;541;19	ENSP00000382452:R1486W;ENSP00000395538:R1486W;ENSP00000395990:R19W	ENSP00000382452:R1486W	R	-	1	2	TNRC18	5368130	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.532000	0.36029	1.314000	0.45095	0.561000	0.74099	CGG	TNRC18	-	NULL	ENSG00000182095		0.667	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding			0.00	62	0	G			5401604	-1			no_errors	ENST00000399537	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	A
TOP2A	7153	genome.wustl.edu	37	17	38546372	38546372	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:38546372G>A	ENST00000423485.1	-	34	4470	c.4312C>T	c.(4312-4314)Cca>Tca	p.P1438S	Y_RNA_ENST00000410949.1_RNA	NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	1438					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	GTTCCTTTTGGGGCAGCCCTT	0.478																																																	0													63.0	57.0	59.0					17																	38546372		1868	4110	5978	SO:0001583	missense	0				CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.4312C>T	17.37:g.38546372G>A	ENSP00000411532:p.Pro1438Ser		B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	pfam_Topo_IIA_A/C,pfam_Topo_IIA_bsu_dom2,pfam_DTHCT,pfam_HATPase_ATP-bd,superfamily_Topo_IIA_like_dom,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_Topo_IIA,smart_Topo_IIA_A/C,prints_TopoII_euk,prints_Topo_IIA,prints_Transcrpt_fac_NFYB/HAP3	p.P1438S	ENST00000423485.1	37	c.4312	CCDS45672.1	17	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677472	0.29783	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.72835	-0.69	5.46	5.46	0.80206	DTHCT (1);	0.210997	0.50627	D	0.000119	T	0.70622	0.3245	M	0.74881	2.28	0.44789	D	0.997797	P	0.34462	0.454	B	0.38156	0.266	T	0.65932	-0.6048	10	0.14656	T	0.56	.	13.9851	0.64328	0.0:0.1516:0.8484:0.0	.	1438	P11388	TOP2A_HUMAN	S	1438;1518;1461;1475	ENSP00000411532:P1438S	ENSP00000269577:P1518S	P	-	1	0	TOP2A	35799898	0.995000	0.38212	0.589000	0.28718	0.018000	0.09664	2.638000	0.46562	2.708000	0.92522	0.591000	0.81541	CCA	TOP2A	-	pfam_DTHCT	ENSG00000131747		0.478	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP2A	HGNC	protein_coding	OTTHUMT00000338035.1	-	0.00	73	0	G			38546372	-1	tier1	-	no_errors	ENST00000423485	ensembl	human	known	74_37	missense	9.33	68	7	SNP	0.956	A
TNS4	84951	genome.wustl.edu	37	17	38652298	38652298	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:38652298T>A	ENST00000254051.6	-	2	538	c.380A>T	c.(379-381)cAg>cTg	p.Q127L		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	127					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			CAGCTCAGCCTGGGAGCCCCC	0.572																																																	0													77.0	80.0	79.0					17																	38652298		2203	4300	6503	SO:0001583	missense	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.380A>T	17.37:g.38652298T>A	ENSP00000254051:p.Gln127Leu		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	pfam_PTB,pfam_SH2,smart_SH2,smart_PTB/PI_dom,pfscan_SH2	p.Q127L	ENST00000254051.6	37	c.380	CCDS11368.1	17	.	.	.	.	.	.	.	.	.	.	T	7.310	0.614724	0.14129	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.19250	2.16	4.77	-5.29	0.02747	.	4.216810	0.00357	N	0.000026	T	0.10465	0.0256	N	0.14661	0.345	0.09310	N	1	B	0.24186	0.099	B	0.22601	0.04	T	0.12293	-1.0553	10	0.27082	T	0.32	9.225	3.2491	0.06807	0.1122:0.3898:0.113:0.385	.	127	Q8IZW8	TENS4_HUMAN	L	127	ENSP00000254051:Q127L	ENSP00000254051:Q127L	Q	-	2	0	TNS4	35905824	0.000000	0.05858	0.012000	0.15200	0.003000	0.03518	-1.415000	0.02469	-1.408000	0.02040	-2.548000	0.00178	CAG	TNS4	-	NULL	ENSG00000131746		0.572	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	-	0.00	46	0	T	NM_032865		38652298	-1	tier1	-	no_errors	ENST00000254051	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.001	A
TOPAZ1	375337	genome.wustl.edu	37	3	44285525	44285525	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr3:44285525G>T	ENST00000309765.4	+	2	1695	c.1527G>T	c.(1525-1527)aaG>aaT	p.K509N		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	509						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										GTTGGAAAAAGGCTTCCTTGC	0.408																																																	0													122.0	102.0	108.0					3																	44285525		692	1591	2283	SO:0001583	missense	0			AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.1527G>T	3.37:g.44285525G>T	ENSP00000310303:p.Lys509Asn			Missense_Mutation	SNP	NULL	p.K509N	ENST00000309765.4	37	c.1527	CCDS46809.1	3	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434835	0.43224	.	.	ENSG00000173769	ENST00000309765	T	0.12255	2.7	5.55	0.326	0.15908	.	0.355474	0.27981	N	0.017068	T	0.14960	0.0361	L	0.32530	0.975	0.09310	N	1	D	0.61080	0.989	P	0.55923	0.787	T	0.06679	-1.0813	10	0.56958	D	0.05	-7.8913	5.147	0.14991	0.3625:0.0:0.5075:0.1301	.	509	Q8N9V7	CC077_HUMAN	N	509	ENSP00000310303:K509N	ENSP00000310303:K509N	K	+	3	2	C3orf77	44260529	0.021000	0.18746	0.734000	0.30879	0.990000	0.78478	0.108000	0.15396	0.317000	0.23160	0.650000	0.86243	AAG	TOPAZ1	-	NULL	ENSG00000173769		0.408	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPAZ1	HGNC	protein_coding	OTTHUMT00000343247.1	-	0.00	38	0	G	NM_001145030		44285525	+1	tier1	-	no_errors	ENST00000309765	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7578263	7578263	+	Nonsense_Mutation	SNP	G	G	A	rs397516435		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:7578263G>A	ENST00000269305.4	-	6	775	c.586C>T	c.(586-588)Cga>Tga	p.R196*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R196*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R196*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R196*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R196*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R196*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	196	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R196*(167)|p.R64*(14)|p.R103*(14)|p.0?(8)|p.R196fs*51(7)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.R196R(2)|p.I195fs*50(1)|p.R64fs*>27(1)|p.R103fs*51(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I195fs*12(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTTCCACTCGGATAAGATGC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	232	Substitution - Nonsense(195)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Complex - deletion inframe(5)|Unknown(5)|Substitution - coding silent(2)|Complex - frameshift(1)	large_intestine(54)|breast(29)|upper_aerodigestive_tract(22)|lung(22)|haematopoietic_and_lymphoid_tissue(17)|skin(17)|biliary_tract(11)|central_nervous_system(11)|oesophagus(11)|ovary(11)|stomach(8)|urinary_tract(7)|bone(4)|liver(3)|pancreas(3)|eye(1)|kidney(1)	GRCh37	CM941329	TP53	M							102.0	91.0	94.0					17																	7578263		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.586C>T	17.37:g.7578263G>A	ENSP00000269305:p.Arg196*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R196*	ENST00000269305.4	37	c.586	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409843	0.42715	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.9531	12.3046	0.54895	0.0827:0.0:0.9173:0.0	.	.	.	.	X	196;196;196;196;196;196;185;103;64;103;64	.	ENSP00000269305:R196X	R	-	1	2	TP53	7518988	1.000000	0.71417	0.997000	0.53966	0.023000	0.10783	2.166000	0.42406	1.427000	0.47276	-0.140000	0.14226	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	58	0	G	NM_000546		7578263	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	22.81	43	13	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	26	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	T
TP53BP2	7159	genome.wustl.edu	37	1	223986289	223986289	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:223986289G>A	ENST00000343537.7	-	12	1867	c.1576C>T	c.(1576-1578)Cca>Tca	p.P526S	TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391879.2_Intron|TP53BP2_ENST00000391878.2_Missense_Mutation_p.P397S	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	520					cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		TCTGAAGGTGGCTGATTAGTT	0.428																																																	0													89.0	91.0	90.0					1																	223986289		2203	4300	6503	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.1576C>T	1.37:g.223986289G>A	ENSP00000341957:p.Pro526Ser		B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.P526S	ENST00000343537.7	37	c.1576	CCDS44319.1	1	.	.	.	.	.	.	.	.	.	.	G	9.297	1.052117	0.19827	.	.	ENSG00000143514	ENST00000391878;ENST00000343537	T;T	0.45668	0.89;1.06	5.55	-6.3	0.02007	.	0.833908	0.11202	N	0.588737	T	0.15869	0.0382	N	0.05510	-0.035	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28964	-1.0027	10	0.17369	T	0.5	.	7.3698	0.26794	0.1488:0.1193:0.6137:0.1182	.	526;520	B4DG66;Q13625	.;ASPP2_HUMAN	S	397;526	ENSP00000375750:P397S;ENSP00000341957:P526S	ENSP00000341957:P526S	P	-	1	0	TP53BP2	222052912	0.991000	0.36638	0.000000	0.03702	0.782000	0.44232	0.746000	0.26275	-0.785000	0.04522	-0.258000	0.10820	CCA	TP53BP2	-	NULL	ENSG00000143514		0.428	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	-	0.00	75	0	G	NM_001031685, NM_005426		223986289	-1	tier1	-	no_errors	ENST00000343537	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.000	A
TRERF1	55809	genome.wustl.edu	37	6	42196257	42196257	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:42196257delC	ENST00000372922.4	-	18	3991	c.3429delG	c.(3427-3429)gggfs	p.G1143fs	TRERF1_ENST00000354325.2_Frame_Shift_Del_p.G1060fs|TRERF1_ENST00000372917.4_Frame_Shift_Del_p.G1072fs|TRERF1_ENST00000340840.2_Frame_Shift_Del_p.G1072fs|TRERF1_ENST00000541110.1_Frame_Shift_Del_p.G1163fs	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1143	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GGGGCAGCAGCCCCGGCGCCC	0.607																																																	0													138.0	156.0	150.0					6																	42196257		2203	4300	6503	SO:0001589	frameshift_variant	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3429delG	6.37:g.42196257delC	ENSP00000362013:p.Gly1143fs		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Frame_Shift_Del	DEL	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.L1164fs	ENST00000372922.4	37	c.3489	CCDS4867.1	6																																																																																			TRERF1	-	NULL	ENSG00000124496		0.607	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2		0.00	28	0	C	NM_033502		42196257	-1	tier1		no_errors	ENST00000541110	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.971	-
TRIM31	11074	genome.wustl.edu	37	6	30080455	30080455	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:30080455A>G	ENST00000376734.3	-	2	253	c.128T>C	c.(127-129)aTt>aCt	p.I43T	TRIM31_ENST00000485864.1_5'Flank|TRIM31_ENST00000540829.1_Missense_Mutation_p.I43T|TRIM31-AS1_ENST00000440874.1_RNA	NM_007028.3	NP_008959.3	Q9BZY9	TRI31_HUMAN	tripartite motif containing 31	43					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral release from host cell (GO:1902186)	mitochondrion (GO:0005739)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(2)	15						TGTTTCCCCAATCTGAGTGAT	0.488																																																	0													113.0	116.0	115.0					6																	30080455		1511	2709	4220	SO:0001583	missense	0			AF230386	CCDS34374.1	6p21.3	2013-01-09	2011-01-25		ENSG00000204616	ENSG00000204616		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16289	protein-coding gene	gene with protein product		609316	"""tripartite motif-containing 31"""			11331580	Standard	XM_006714977		Approved	RNF, HCGI, C6orf13, HCG1	uc003npg.1	Q9BZY9	OTTHUMG00000031064	ENST00000376734.3:c.128T>C	6.37:g.30080455A>G	ENSP00000365924:p.Ile43Thr		A6NLX6|A9R9Q4|Q53H52|Q5RI37|Q5SRJ7|Q5SRJ8|Q5SS28|Q96AK4|Q96AP8|Q99579|Q9BZY8	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,prints_Znf_B-box_chordata,pfscan_Znf_B-box,pfscan_Znf_RING	p.I43T	ENST00000376734.3	37	c.128	CCDS34374.1	6	.	.	.	.	.	.	.	.	.	.	A	7.239	0.600817	0.13939	.	.	ENSG00000204616	ENST00000376734;ENST00000376728;ENST00000540829	T;T	0.08370	3.1;3.1	3.74	-7.47	0.01365	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	2.509480	0.02378	N	0.078564	T	0.01222	0.0040	N	0.21508	0.67	0.09310	N	1	B	0.17852	0.024	B	0.13407	0.009	T	0.39921	-0.9590	10	0.27082	T	0.32	.	3.3406	0.07116	0.5001:0.1433:0.2671:0.0894	.	43	Q9BZY9	TRI31_HUMAN	T	43	ENSP00000365924:I43T;ENSP00000444311:I43T	ENSP00000365918:I43T	I	-	2	0	TRIM31	30188434	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.478000	0.00227	-1.522000	0.01769	-0.264000	0.10439	ATT	TRIM31	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000204616		0.488	TRIM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM31	HGNC	protein_coding	OTTHUMT00000076081.2	-	0.00	41	0	A			30080455	-1	tier1	-	no_errors	ENST00000376734	ensembl	human	known	74_37	missense	38.10	38	24	SNP	0.000	G
TRIP13	9319	genome.wustl.edu	37	5	901487	901487	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr5:901487T>A	ENST00000166345.3	+	5	832	c.476T>A	c.(475-477)tTt>tAt	p.F159Y		NM_004237.3	NP_004228.1	Q15645	PCH2_HUMAN	thyroid hormone receptor interactor 13	159					double-strand break repair (GO:0006302)|female meiosis I (GO:0007144)|male meiosis I (GO:0007141)|oocyte maturation (GO:0001556)|oogenesis (GO:0048477)|reciprocal meiotic recombination (GO:0007131)|regulation of RNA biosynthetic process (GO:2001141)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	18			Epithelial(17;0.00147)|OV - Ovarian serous cystadenocarcinoma(19;0.00271)|all cancers(22;0.00622)|Lung(60;0.165)			ACTTTACTGTTTTCAGACAAG	0.443																																																	0													115.0	109.0	111.0					5																	901487		2203	4300	6503	SO:0001583	missense	0			L40384	CCDS3858.1	5p15	2010-04-21			ENSG00000071539	ENSG00000071539		"""ATPases / AAA-type"""	12307	protein-coding gene	gene with protein product	"""thyroid receptor interacting protein 13"""	604507				7776974	Standard	NM_004237		Approved	16E1BP	uc003jbr.3	Q15645	OTTHUMG00000090349	ENST00000166345.3:c.476T>A	5.37:g.901487T>A	ENSP00000166345:p.Phe159Tyr		C9K0T3|D3DTC0|O15324	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_ClpA/B	p.F159Y	ENST00000166345.3	37	c.476	CCDS3858.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.19|16.19	3.053209|3.053209	0.55218|0.55218	.|.	.|.	ENSG00000071539|ENSG00000071539	ENST00000513435|ENST00000166345;ENST00000354240	D|D	0.94931|0.94828	-3.56|-3.53	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.93344|0.93344	0.7878|0.7878	L|L	0.46567|0.46567	1.45|1.45	0.80722|0.80722	D|D	1|1	.|D	.|0.54207	.|0.965	.|P	.|0.47645	.|0.553	D|D	0.92907|0.92907	0.6344|0.6344	8|10	0.40728|0.40728	T|T	0.16|0.16	-9.1067|-9.1067	15.5928|15.5928	0.76550|0.76550	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|159	.|Q15645	.|PCH2_HUMAN	I|Y	155|159	ENSP00000427528:F155I|ENSP00000166345:F159Y	ENSP00000427528:F155I|ENSP00000166345:F159Y	F|F	+|+	1|2	0|0	TRIP13|TRIP13	954487|954487	1.000000|1.000000	0.71417|0.71417	0.973000|0.973000	0.42090|0.42090	0.119000|0.119000	0.20118|0.20118	7.405000|7.405000	0.80007|0.80007	2.163000|2.163000	0.67991|0.67991	0.402000|0.402000	0.26972|0.26972	TTT|TTT	TRIP13	-	superfamily_P-loop_NTPase	ENSG00000071539		0.443	TRIP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP13	HGNC	protein_coding	OTTHUMT00000206721.2	-	0.00	54	0	T	NM_004237		901487	+1	tier1	-	no_errors	ENST00000166345	ensembl	human	known	74_37	missense	5.71	65	4	SNP	1.000	A
TRNAU1AP	54952	genome.wustl.edu	37	1	28904175	28904177	+	3'UTR	DEL	ATG	ATG	-			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	ATG	ATG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:28904175_28904177delATG	ENST00000373830.3	+	0	917_919				SNHG12_ENST00000488745.1_RNA|SNHG12_ENST00000483436.1_RNA|SNHG12_ENST00000384581.1_RNA|SNHG12_ENST00000531126.1_RNA|SNHG12_ENST00000475441.1_RNA|SNORD99_ENST00000408612.1_RNA|SNHG12_ENST00000384584.1_RNA	NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1						selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						GCCAGGTTGCATGATGTGAGGGA	0.424																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653	ENST00000373830.3:c.*29ATG>-	1.37:g.28904178_28904180delATG			Q86SU7	RNA	DEL	-	NULL	ENST00000373830.3	37	NULL	CCDS324.1	1																																																																																			TRNAU1AP	-	-	ENSG00000180098		0.424	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRNAU1AP	HGNC	protein_coding	OTTHUMT00000010346.1		0.00	19	0	ATG	NM_017846		28904177	+1	tier1		no_errors	ENST00000480930	ensembl	human	known	74_37	rna	26.67	11	4	DEL	0.000:0.001:0.001	-
TRPC5	7224	genome.wustl.edu	37	X	111078237	111078237	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chrX:111078237G>T	ENST00000262839.2	-	7	2726	c.1808C>A	c.(1807-1809)aCc>aAc	p.T603N		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	603					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TCCAAACATGGTAGCTCCTAC	0.428																																																	0													343.0	301.0	315.0					X																	111078237		2203	4300	6503	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1808C>A	X.37:g.111078237G>T	ENSP00000262839:p.Thr603Asn		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.T603N	ENST00000262839.2	37	c.1808	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	G	26.6	4.755363	0.89843	.	.	ENSG00000072315	ENST00000262839	D	0.98550	-4.99	5.56	5.56	0.83823	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98068	0.9363	M	0.71581	2.175	0.80722	D	1	B;B	0.28783	0.151;0.222	B;B	0.40444	0.232;0.329	D	0.97998	1.0358	10	0.62326	D	0.03	-4.1036	18.5256	0.90971	0.0:0.0:1.0:0.0	.	604;603	Q59G51;Q9UL62	.;TRPC5_HUMAN	N	603	ENSP00000262839:T603N	ENSP00000262839:T603N	T	-	2	0	TRPC5	110964893	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	5.790000	0.69038	2.318000	0.78349	0.544000	0.68410	ACC	TRPC5	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000072315		0.428	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	-	0.00	32	0	G	NM_012471		111078237	-1	tier1	-	no_errors	ENST00000262839	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
TSGA13	114960	genome.wustl.edu	37	7	130353927	130353927	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:130353927G>A	ENST00000456951.1	-	9	1606	c.755C>T	c.(754-756)gCg>gTg	p.A252V	TSGA13_ENST00000356588.3_Missense_Mutation_p.A252V|COPG2_ENST00000445977.2_5'Flank			Q96PP4	TSG13_HUMAN	testis specific, 13	252										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					CTCCCCGGGCGCGGTTCTGGT	0.592																																																	0													101.0	104.0	103.0					7																	130353927		2203	4300	6503	SO:0001583	missense	0			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.755C>T	7.37:g.130353927G>A	ENSP00000406047:p.Ala252Val		B3KSC9	Missense_Mutation	SNP	NULL	p.A252V	ENST00000456951.1	37	c.755	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	G	7.436	0.639631	0.14386	.	.	ENSG00000213265	ENST00000456951;ENST00000356588	.	.	.	5.51	-3.55	0.04639	.	1.069840	0.07322	N	0.877778	T	0.18299	0.0439	N	0.08118	0	0.09310	N	1	B	0.22983	0.078	B	0.13407	0.009	T	0.35699	-0.9778	9	0.02654	T	1	0.0064	11.9008	0.52682	0.7462:0.0:0.2538:0.0	.	252	Q96PP4	TSG13_HUMAN	V	252	.	ENSP00000348996:A252V	A	-	2	0	TSGA13	130004467	0.030000	0.19436	0.000000	0.03702	0.116000	0.19942	-0.018000	0.12568	-0.915000	0.03823	-0.291000	0.09656	GCG	TSGA13	-	NULL	ENSG00000213265		0.592	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	HGNC	protein_coding	OTTHUMT00000337997.1	-	0.00	64	0	G	NM_052933		130353927	-1	tier1	-	no_errors	ENST00000356588	ensembl	human	known	74_37	missense	8.47	53	5	SNP	0.008	A
TSNARE1	203062	genome.wustl.edu	37	8	143310866	143310868	+	In_Frame_Del	DEL	GAT	GAT	-	rs142964918|rs577569567		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	GAT	GAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr8:143310866_143310868delGAT	ENST00000307180.3	-	13	1636_1638	c.1519_1521delATC	c.(1519-1521)atcdel	p.I507del	TSNARE1_ENST00000524325.1_In_Frame_Del_p.I506del|TSNARE1_ENST00000520166.1_In_Frame_Del_p.I507del	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	507	Poly-Ile.				intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CAGAGGTGGCGATGATGATGATG	0.512																																																	0																																										SO:0001651	inframe_deletion	0					8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.1519_1521delATC	8.37:g.143310875_143310877delGAT	ENSP00000303437:p.Ile507del		B7ZLB0|Q14D03	In_Frame_Del	DEL	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.I507in_frame_del	ENST00000307180.3	37	c.1521_1519	CCDS6384.1	8																																																																																			TSNARE1	-	NULL	ENSG00000171045		0.512	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSNARE1	HGNC	protein_coding			0.00	33	0	GAT	NM_145003		143310868	-1	tier1		no_errors	ENST00000307180	ensembl	human	known	74_37	in_frame_del	9.30	39	4	DEL	0.000:0.000:0.002	-
TTC39B	158219	genome.wustl.edu	37	9	15307094	15307094	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr9:15307094C>T	ENST00000512701.2	-	1	264	c.228G>A	c.(226-228)ctG>ctA	p.L76L	TTC39B_ENST00000380850.4_Silent_p.L76L|TTC39B_ENST00000541445.1_Silent_p.L10L|TTC39B_ENST00000355694.2_Silent_p.L10L|TTC39B_ENST00000297615.5_Silent_p.L76L			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	76										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						CGTCCGCTTCCAGCTCCGCTC	0.647																																																	0													28.0	23.0	25.0					9																	15307094		2202	4299	6501	SO:0001819	synonymous_variant	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.228G>A	9.37:g.15307094C>T			A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Silent	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.L76	ENST00000512701.2	37	c.228	CCDS6477.2	9																																																																																			TTC39B	-	NULL	ENSG00000155158		0.647	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	-	0.00	64	0	C	NM_152574		15307094	-1	tier1	-	no_errors	ENST00000512701	ensembl	human	known	74_37	silent	25.00	30	10	SNP	0.994	T
TTN	7273	genome.wustl.edu	37	2	179418788	179418788	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:179418788G>A	ENST00000591111.1	-	283	84351	c.84127C>T	c.(84127-84129)Cta>Tta	p.L28043L	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342175.6_Silent_p.L20811L|TTN_ENST00000359218.5_Silent_p.L20744L|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Silent_p.L29684L|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Silent_p.L27116L|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000460472.2_Silent_p.L20619L|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28043	Fibronectin type-III 104. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCTCTTTTAGTACTTTAAAC	0.433																																																	0													198.0	194.0	195.0					2																	179418788		1885	4112	5997	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.84127C>T	2.37:g.179418788G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L27116	ENST00000591111.1	37	c.81346		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	20	0	G	NM_133378		179418788	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	50.00	14	14	SNP	0.001	A
TTN	7273	genome.wustl.edu	37	2	179519218	179519218	+	Intron	SNP	T	T	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:179519218T>C	ENST00000591111.1	-	156	34747				TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Silent_p.K12750K|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCACCGGTACTTTCTTTTCTG	0.463																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34522+253A>G	2.37:g.179519218T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K12750	ENST00000591111.1	37	c.38250		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	40	0	T	NM_133378		179519218	-1	tier1	-	no_errors	ENST00000589042	ensembl	human	putative	74_37	silent	56.10	18	23	SNP	0.905	C
TXNRD2	10587	genome.wustl.edu	37	22	19870861	19870861	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr22:19870861C>A	ENST00000400521.1	-	12	1079	c.1073G>T	c.(1072-1074)gGt>gTt	p.G358V	TXNRD2_ENST00000542719.1_Missense_Mutation_p.G328V|TXNRD2_ENST00000535882.1_Missense_Mutation_p.G357V|TXNRD2_ENST00000400519.1_Missense_Mutation_p.G357V|TXNRD2_ENST00000400518.1_Missense_Mutation_p.G328V	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	358					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					CACCACGTCACCAATGGCGTA	0.647																																																	0													88.0	100.0	96.0					22																	19870861		2062	4208	6270	SO:0001583	missense	0			AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.1073G>T	22.37:g.19870861C>A	ENSP00000383365:p.Gly358Val		O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_GIDA-rel,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,tigrfam_Thioredoxin/glutathione_Rdtase	p.G357V	ENST00000400521.1	37	c.1070	CCDS42981.1	22	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130106	0.56721	.	.	ENSG00000184470	ENST00000400518;ENST00000538798;ENST00000400521;ENST00000400525;ENST00000540474;ENST00000400519;ENST00000535882;ENST00000542719	D;D;D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98;-2.98;-2.98	5.07	5.07	0.68467	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98147	0.9388	H	0.99454	4.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99823	1.1048	10	0.87932	D	0	-20.8911	18.8357	0.92162	0.0:1.0:0.0:0.0	.	358;357	Q9NNW7;D3YTF9	TRXR2_HUMAN;.	V	328;358;358;335;262;357;357;328	ENSP00000383362:G328V;ENSP00000383365:G358V;ENSP00000383369:G335V;ENSP00000383363:G357V;ENSP00000439314:G357V;ENSP00000439570:G328V	ENSP00000383362:G328V	G	-	2	0	TXNRD2	18250861	1.000000	0.71417	0.859000	0.33776	0.028000	0.11728	6.596000	0.74113	2.515000	0.84797	0.563000	0.77884	GGT	TXNRD2	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Thioredoxin/glutathione_Rdtase	ENSG00000184470		0.647	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	TXNRD2	HGNC	protein_coding	OTTHUMT00000314903.3	-	0.00	52	0	C	NM_006440		19870861	-1	tier1	-	no_errors	ENST00000535882	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	A
UBE3A	7337	genome.wustl.edu	37	15	25584312	25584312	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:25584312G>A	ENST00000397954.2	-	11	2599	c.2600C>T	c.(2599-2601)aCg>aTg	p.T867M	UBE3A_ENST00000438097.1_Missense_Mutation_p.T844M|UBE3A_ENST00000428984.2_Missense_Mutation_p.T844M|SNHG14_ENST00000554726.1_RNA|SNHG14_ENST00000452731.1_RNA|UBE3A_ENST00000566215.1_Missense_Mutation_p.T844M|UBE3A_ENST00000232165.3_Missense_Mutation_p.T864M			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	867	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		TTTGGCATACGTGATGGCCTT	0.284																																																	0													90.0	82.0	85.0					15																	25584312		2203	4300	6503	SO:0001583	missense	0			AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.2600C>T	15.37:g.25584312G>A	ENSP00000381045:p.Thr867Met		A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	p.T867M	ENST00000397954.2	37	c.2600	CCDS45192.1	15	.	.	.	.	.	.	.	.	.	.	G	27.6	4.842550	0.91197	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.38	5.38	0.77491	HECT (4);	0.100303	0.64402	D	0.000002	T	0.72637	0.3485	M	0.69523	2.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.70227	0.955;0.968	T	0.75309	-0.3363	10	0.72032	D	0.01	.	19.1347	0.93422	0.0:0.0:1.0:0.0	.	864;867	Q05086-3;Q05086	.;UBE3A_HUMAN	M	864;864;867;844;844	ENSP00000232165:T864M;ENSP00000381045:T867M;ENSP00000411258:T844M;ENSP00000401265:T844M	ENSP00000232165:T864M	T	-	2	0	UBE3A	23135405	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.522000	0.85027	0.460000	0.39030	ACG	UBE3A	-	pfam_HECT,superfamily_HECT,smart_HECT,pirsf_Ubiquitin-protein_ligase_E6-AP,pfscan_HECT	ENSG00000114062		0.284	UBE3A-003	KNOWN	basic|CCDS	protein_coding	UBE3A	HGNC	protein_coding	OTTHUMT00000434203.1	-	0.00	58	0	G	NM_000462		25584312	-1	tier1	-	no_errors	ENST00000397954	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
TYRO3	7301	genome.wustl.edu	37	15	41859736	41859736	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr15:41859736G>C	ENST00000263798.3	+	7	1185		c.e7+1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AAGGGTCTAGGTAAGGGATGC	0.617																																																	0													61.0	58.0	59.0					15																	41859736		2203	4300	6503	SO:0001630	splice_region_variant	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.961+1G>C	15.37:g.41859736G>C			O14953|Q86VR3	Splice_Site	SNP	-	e7+1	ENST00000263798.3	37	c.961+1	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876992	0.72180	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5246	0.67878	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39647028	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.264000	0.78432	2.417000	0.82017	0.655000	0.94253	.	TYRO3	-	-	ENSG00000092445		0.617	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2		0.00	32	0	G		Intron	41859736	+1			no_errors	ENST00000263798	ensembl	human	known	74_37	splice_site	5.41	35	2	SNP	1.000	C
UBR4	23352	genome.wustl.edu	37	1	19482038	19482038	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:19482038G>A	ENST00000375254.3	-	43	6224	c.6197C>T	c.(6196-6198)tCg>tTg	p.S2066L	UBR4_ENST00000375267.2_Missense_Mutation_p.S2066L|UBR4_ENST00000375226.2_Missense_Mutation_p.S2066L|UBR4_ENST00000375217.2_Missense_Mutation_p.S2066L	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2066					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		GTACCCAGCCGAAGACATTAT	0.438																																																	0													101.0	91.0	94.0					1																	19482038		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.6197C>T	1.37:g.19482038G>A	ENSP00000364403:p.Ser2066Leu		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.S2066L	ENST00000375254.3	37	c.6197	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.329448	0.95733	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000001	T	0.48021	0.1477	M	0.83312	2.635	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.85130	0.997;0.885	T	0.52873	-0.8517	10	0.87932	D	0	.	18.7937	0.91985	0.0:0.0:1.0:0.0	.	2066;2066	Q5T4S7-5;Q5T4S7	.;UBR4_HUMAN	L	2066;2066;2066;2066;776;1282	ENSP00000364403:S2066L;ENSP00000364416:S2066L;ENSP00000364365:S2066L;ENSP00000364374:S2066L	ENSP00000364365:S2066L	S	-	2	0	UBR4	19354625	1.000000	0.71417	0.978000	0.43139	0.972000	0.66771	9.025000	0.93694	2.670000	0.90874	0.650000	0.86243	TCG	UBR4	-	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold	ENSG00000127481		0.438	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	34	0	G	NM_020765		19482038	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	A
UHRF1BP1	54887	genome.wustl.edu	37	6	34802096	34802096	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:34802096G>A	ENST00000192788.5	+	5	612	c.441G>A	c.(439-441)ttG>ttA	p.L147L	UHRF1BP1_ENST00000452449.2_Silent_p.L147L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	147							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						CTTTTGAATTGTGGCAGCTCC	0.517																																																	0													70.0	68.0	68.0					6																	34802096		1988	4148	6136	SO:0001819	synonymous_variant	0			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.441G>A	6.37:g.34802096G>A			Q9NXE0	Silent	SNP	NULL	p.L147	ENST00000192788.5	37	c.441	CCDS43455.1	6																																																																																			UHRF1BP1	-	NULL	ENSG00000065060		0.517	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	-	0.00	40	0	G	NM_017754		34802096	+1	tier1	-	no_errors	ENST00000192788	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	A
USP39	10713	genome.wustl.edu	37	2	85875088	85875088	+	Silent	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:85875088G>A	ENST00000323701.6	+	12	1609	c.1599G>A	c.(1597-1599)caG>caA	p.Q533Q	USP39_ENST00000409470.1_Silent_p.Q533Q|USP39_ENST00000450066.2_Silent_p.Q430Q|USP39_ENST00000409766.3_Missense_Mutation_p.R488K|USP39_ENST00000459775.1_3'UTR|USP39_ENST00000409025.1_Intron	NM_006590.3	NP_006581.2	Q53GS9	SNUT2_HUMAN	ubiquitin specific peptidase 39	533	USP.				cell cycle (GO:0007049)|cell division (GO:0051301)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|ubiquitin-dependent protein catabolic process (GO:0006511)	spliceosomal complex (GO:0005681)	ubiquitinyl hydrolase activity (GO:0036459)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	19						AAGACCTCCAGGTGACTGACA	0.498																																																	0													103.0	95.0	98.0					2																	85875088		2203	4300	6503	SO:0001819	synonymous_variant	0			AF132955	CCDS33234.1, CCDS58716.1, CCDS58717.1, CCDS74534.1	2p11.2	2009-01-06	2005-08-08		ENSG00000168883	ENSG00000168883		"""Ubiquitin-specific peptidases"""	20071	protein-coding gene	gene with protein product	"""snRNP assembly defective 1 homolog (S.cerevisiae)"", ""small nuclear ribonucleoprotein 65kDa (U4/U6.U5)"""	611594	"""ubiquitin specific protease 39"""			12838346	Standard	NM_006590		Approved	SAD1, CGI-21, SNRNP65	uc002sqg.4	Q53GS9	OTTHUMG00000153090	ENST00000323701.6:c.1599G>A	2.37:g.85875088G>A			A8K086|B3KM40|B4DHT4|D6W5L4|G5E9H0|Q6NX47|Q96RK9|Q9BV89|Q9H381|Q9P050|Q9Y310	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R488K	ENST00000323701.6	37	c.1463	CCDS33234.1	2	.	.	.	.	.	.	.	.	.	.	G	18.56	3.650781	0.67472	.	.	ENSG00000168883	ENST00000409766	T	0.17054	2.3	5.93	2.14	0.27477	.	.	.	.	.	T	0.14874	0.0359	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05194	-1.0900	8	0.87932	D	0	-26.9996	9.4033	0.38447	0.2996:0.0:0.7004:0.0	.	488	G5E9H0	.	K	488	ENSP00000386803:R488K	ENSP00000386803:R488K	R	+	2	0	USP39	85728599	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.621000	0.46418	0.415000	0.25817	-0.140000	0.14226	AGG	USP39	-	pfscan_Peptidase_C19/C67	ENSG00000168883		0.498	USP39-009	NOVEL	basic|appris_principal|CCDS	protein_coding	USP39	HGNC	protein_coding	OTTHUMT00000329892.1	-	0.00	43	0	G	NM_006590		85875088	+1	tier1	-	no_errors	ENST00000409766	ensembl	human	novel	74_37	missense	32.76	39	19	SNP	1.000	A
USP42	84132	genome.wustl.edu	37	7	6180592	6180592	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:6180592C>G	ENST00000306177.5	+	7	930	c.772C>G	c.(772-774)Ctt>Gtt	p.L258V		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	258	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TGATCCATATCTTGATATAAC	0.249																																																	0													60.0	61.0	61.0					7																	6180592		1784	4028	5812	SO:0001583	missense	0			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.772C>G	7.37:g.6180592C>G	ENSP00000301962:p.Leu258Val		A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.L258V	ENST00000306177.5	37	c.772	CCDS47535.1	7	.	.	.	.	.	.	.	.	.	.	C	14.79	2.640590	0.47153	.	.	ENSG00000106346	ENST00000306177;ENST00000465073;ENST00000426246	T;T;T	0.03330	3.97;3.97;3.97	5.85	5.85	0.93711	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.56097	D	0.000021	T	0.19366	0.0465	M	0.80028	2.48	0.38657	D	0.951994	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.999	T	0.00156	-1.1978	10	0.87932	D	0	.	14.3302	0.66550	0.0:0.9296:0.0:0.0704	.	221;258;258;258	A4D2N7;Q9H9J4-2;Q9H9J4;A4D2N6	.;.;UBP42_HUMAN;.	V	258;191;104	ENSP00000301962:L258V;ENSP00000430568:L191V;ENSP00000408217:L104V	ENSP00000301962:L258V	L	+	1	0	USP42	6147118	0.998000	0.40836	0.986000	0.45419	0.102000	0.19082	2.925000	0.48884	2.773000	0.95371	0.655000	0.94253	CTT	USP42	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000106346		0.249	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	USP42	HGNC	protein_coding	OTTHUMT00000324262.3		0.00	19	0	C	XM_166526		6180592	+1			no_errors	ENST00000306177	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	G
VGLL2	245806	genome.wustl.edu	37	6	117589477	117589477	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr6:117589477A>G	ENST00000326274.5	+	2	404	c.214A>G	c.(214-216)Aaa>Gaa	p.K72E	VGLL2_ENST00000352536.3_Missense_Mutation_p.K72E	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	72					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		CAGCCCAGAGAAAGAGCGCCC	0.567																																																	0													106.0	123.0	117.0					6																	117589477		2203	4300	6503	SO:0001583	missense	0			AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.214A>G	6.37:g.117589477A>G	ENSP00000320957:p.Lys72Glu		Q8WWX1	Missense_Mutation	SNP	pfam_Vg_Tdu	p.K72E	ENST00000326274.5	37	c.214	CCDS5115.1	6	.	.	.	.	.	.	.	.	.	.	A	19.72	3.881063	0.72294	.	.	ENSG00000170162	ENST00000352536;ENST00000326274	T	0.53640	0.61	5.33	5.33	0.75918	.	0.187540	0.46758	D	0.000266	T	0.39145	0.1067	L	0.27053	0.805	0.58432	D	0.999994	D;D	0.58268	0.974;0.982	P;P	0.54499	0.754;0.734	T	0.40979	-0.9534	10	0.62326	D	0.03	-3.3777	15.4577	0.75327	1.0:0.0:0.0:0.0	.	72;72	Q8N8G2-2;Q8N8G2	.;VGLL2_HUMAN	E	72	ENSP00000320957:K72E	ENSP00000320957:K72E	K	+	1	0	VGLL2	117696170	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	6.727000	0.74764	2.241000	0.73720	0.533000	0.62120	AAA	VGLL2	-	NULL	ENSG00000170162		0.567	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VGLL2	HGNC	protein_coding	OTTHUMT00000041975.2	-	0.00	87	0	A	NM_153453		117589477	+1	tier1	-	no_errors	ENST00000326274	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	G
VSTM1	284415	genome.wustl.edu	37	19	54544290	54544290	+	Silent	SNP	G	G	A	rs140870757		TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:54544290G>A	ENST00000338372.2	-	9	811	c.636C>T	c.(634-636)agC>agT	p.S212S	VSTM1_ENST00000376626.1_Silent_p.S181S|VSTM1_ENST00000425006.2_3'UTR|VSTM1_ENST00000366170.2_Silent_p.S124S	NM_198481.3	NP_940883.2	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	212					immune system process (GO:0002376)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)		p.S212S(1)		breast(1)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)		CAGACAGGGCGCTGGTGCTTA	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		12187	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	large_intestine(1)						G		2,4404	4.2+/-10.8	0,2,2201	52.0	48.0	50.0		636	-5.3	0.0	19	dbSNP_134	50	10,8590	7.7+/-29.5	0,10,4290	no	coding-synonymous	VSTM1	NM_198481.3		0,12,6491	AA,AG,GG		0.1163,0.0454,0.0923		212/237	54544290	12,12994	2203	4300	6503	SO:0001819	synonymous_variant	0			AY358542	CCDS12872.1, CCDS74441.1, CCDS74442.1	19q13.42	2013-01-11			ENSG00000189068	ENSG00000189068		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29455	protein-coding gene	gene with protein product						12975309	Standard	NM_198481		Approved	UNQ3033	uc002qcw.4	Q6UX27	OTTHUMG00000064906	ENST00000338372.2:c.636C>T	19.37:g.54544290G>A			B6A8C6|D2DJS3|D2DJS4|Q496B6|Q496B7	Silent	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.S212	ENST00000338372.2	37	c.636	CCDS12872.1	19																																																																																			VSTM1	-	NULL	ENSG00000189068		0.517	VSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM1	HGNC	protein_coding	OTTHUMT00000139358.3		0.00	52	0	G	NM_198481		54544290	-1			no_errors	ENST00000338372	ensembl	human	known	74_37	silent	10.42	42	5	SNP	0.000	A
YWHAG	7532	genome.wustl.edu	37	7	75959049	75959049	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:75959049C>A	ENST00000307630.3	-	2	811	c.589G>T	c.(589-591)Gcc>Tcc	p.A197S		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	197					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						GCGGTCTTGGCCAAGTGGCAC	0.592																																																	0													172.0	151.0	158.0					7																	75959049		2203	4300	6503	SO:0001583	missense	0			AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.589G>T	7.37:g.75959049C>A	ENSP00000306330:p.Ala197Ser		O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Missense_Mutation	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.A197S	ENST00000307630.3	37	c.589	CCDS5584.1	7	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833390	0.91036	.	.	ENSG00000170027	ENST00000307630;ENST00000536755;ENST00000453207	T	0.53423	0.62	5.56	5.56	0.83823	14-3-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.76543	0.4002	M	0.91406	3.205	0.80722	D	1	D	0.69078	0.997	D	0.87578	0.998	T	0.81066	-0.1101	10	0.87932	D	0	-19.9205	18.7066	0.91641	0.0:1.0:0.0:0.0	.	197	P61981	1433G_HUMAN	S	197;175;157	ENSP00000306330:A197S	ENSP00000306330:A197S	A	-	1	0	YWHAG	75796985	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.616000	0.83018	2.899000	0.99337	0.655000	0.94253	GCC	YWHAG	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	ENSG00000170027		0.592	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAG	HGNC	protein_coding	OTTHUMT00000253002.1	-	0.00	26	0	C	NM_012479		75959049	-1	tier1	-	no_errors	ENST00000307630	ensembl	human	known	74_37	missense	32.14	19	9	SNP	1.000	A
ZAN	7455	genome.wustl.edu	37	7	100369492	100369492	+	RNA	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:100369492G>A	ENST00000348028.3	+	0	5439				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000542585.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GTCACCAGGTGGTGCCTCCCC	0.647																																																	0													56.0	61.0	59.0					7																	100369492		2140	4241	6381			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100369492G>A			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.V1758	ENST00000348028.3	37	c.5274		7																																																																																			ZAN	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000146839		0.647	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	-	0.00	68	0	G	NM_003386		100369492	+1	tier1	-	no_errors	ENST00000546292	ensembl	human	known	74_37	silent	30.00	48	21	SNP	1.000	A
ZC3H15	55854	genome.wustl.edu	37	2	187359986	187359986	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr2:187359986G>T	ENST00000337859.6	+	2	329	c.102G>T	c.(100-102)aaG>aaT	p.K34N	ZC3H15_ENST00000468120.1_3'UTR|ZC3H15_ENST00000544130.1_5'UTR|AC018867.1_ENST00000396985.1_5'Flank	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	34					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			TGAAGAATAAGAAAGGAGCAA	0.323																																																	0													67.0	63.0	64.0					2																	187359986		1831	4082	5913	SO:0001583	missense	0				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.102G>T	2.37:g.187359986G>T	ENSP00000338788:p.Lys34Asn		B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.K34N	ENST00000337859.6	37	c.102	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293731	0.80914	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	T	0.65178	-0.14	5.91	3.13	0.36017	.	0.000000	0.85682	D	0.000000	T	0.76579	0.4007	M	0.87456	2.885	0.80722	D	1	D	0.59767	0.986	P	0.62435	0.902	T	0.76410	-0.2969	10	0.87932	D	0	-9.8668	8.2451	0.31684	0.1915:0.1137:0.6948:0.0	.	34	Q8WU90	ZC3HF_HUMAN	N	34	ENSP00000338788:K34N	ENSP00000338788:K34N	K	+	3	2	ZC3H15	187068231	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.419000	0.44671	0.398000	0.25338	-0.136000	0.14681	AAG	ZC3H15	-	NULL	ENSG00000065548		0.323	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	-	0.00	42	0	G	NM_018471		187359986	+1	tier1	-	no_errors	ENST00000337859	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
ZC3HC1	51530	genome.wustl.edu	37	7	129680892	129680892	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr7:129680892G>T	ENST00000358303.4	-	3	392	c.308C>A	c.(307-309)gCa>gAa	p.A103E	ZC3HC1_ENST00000311873.5_Missense_Mutation_p.A82E|ZC3HC1_ENST00000360708.5_Missense_Mutation_p.A103E|ZC3HC1_ENST00000481503.1_Missense_Mutation_p.A103E	NM_016478.3	NP_057562.3	Q86WB0	NIPA_HUMAN	zinc finger, C3HC-type containing 1	103					mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein ubiquitination (GO:0016567)	nuclear membrane (GO:0031965)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(6)|large_intestine(10)|lung(2)|prostate(1)|urinary_tract(1)	22	Melanoma(18;0.0435)					GCCATATTTTGCACAGACGAG	0.413																																					Melanoma(115;540 1606 16325 28853 48167)												0													186.0	185.0	185.0					7																	129680892		2203	4300	6503	SO:0001583	missense	0			AF151050	CCDS34753.1, CCDS64767.1, CCDS75659.1	7q32.2	2013-01-17			ENSG00000091732	ENSG00000091732		"""Zinc fingers, C3HC-type"""	29913	protein-coding gene	gene with protein product	"""nuclear interaction partner of ALK"""					11042152	Standard	XM_005250403		Approved	NIPA	uc003vpi.3	Q86WB0	OTTHUMG00000157648	ENST00000358303.4:c.308C>A	7.37:g.129680892G>T	ENSP00000351052:p.Ala103Glu		A6NH66|Q75MF3|Q75MF4|Q8N330|Q96F75|Q9HA34|Q9NVX4|Q9P0R0	Missense_Mutation	SNP	pfam_Znf_C3HC-like,pfam_NIPA/Rsm1	p.A103E	ENST00000358303.4	37	c.308	CCDS34753.1	7	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851332	0.91355	.	.	ENSG00000091732	ENST00000358303;ENST00000360708;ENST00000311873;ENST00000481503;ENST00000480193	T;T;T;T	0.81163	-0.72;-1.36;-0.77;-1.46	5.9	5.02	0.67125	Zinc finger, C3HC-like (1);	0.000000	0.85682	D	0.000000	D	0.89849	0.6834	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91242	0.5022	10	0.87932	D	0	-16.7531	13.9123	0.63876	0.0736:0.0:0.9264:0.0	.	103	Q86WB0	NIPA_HUMAN	E	103;103;82;103;103	ENSP00000351052:A103E;ENSP00000353933:A103E;ENSP00000309301:A82E;ENSP00000418533:A103E	ENSP00000309301:A82E	A	-	2	0	ZC3HC1	129468128	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.932000	0.92897	1.497000	0.48584	0.563000	0.77884	GCA	ZC3HC1	-	pfam_Znf_C3HC-like	ENSG00000091732		0.413	ZC3HC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HC1	HGNC	protein_coding	OTTHUMT00000349316.1	-	0.00	69	0	G	NM_016478		129680892	-1	tier1	-	no_errors	ENST00000358303	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
ZEB1	6935	genome.wustl.edu	37	10	31810442	31810442	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr10:31810442C>T	ENST00000320985.10	+	7	2289	c.2179C>T	c.(2179-2181)Caa>Taa	p.Q727*	ZEB1_ENST00000542815.3_Nonsense_Mutation_p.Q660*|ZEB1_ENST00000559858.1_3'UTR|ZEB1_ENST00000560721.2_Nonsense_Mutation_p.Q707*|ZEB1_ENST00000361642.5_Nonsense_Mutation_p.Q728*|ZEB1_ENST00000446923.2_Nonsense_Mutation_p.Q711*			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	727					cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.Q727K(1)		NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				TGAGGGTGCACAAGAAGAGCC	0.433																																					Ovarian(40;423 959 14296 36701 49589)												1	Substitution - Missense(1)	large_intestine(1)											91.0	85.0	87.0					10																	31810442		2203	4300	6503	SO:0001587	stop_gained	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.2179C>T	10.37:g.31810442C>T	ENSP00000319248:p.Gln727*		B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Nonsense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.Q728*	ENST00000320985.10	37	c.2182	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986042	0.93044	.	.	ENSG00000148516	ENST00000542879;ENST00000537225;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	.	.	.	5.19	5.19	0.71726	.	0.320500	0.26867	N	0.022098	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	-5.6872	14.6715	0.68948	0.0:0.855:0.145:0.0	.	.	.	.	X	509;727;728;727;660;727;707;586;618;711	.	ENSP00000319248:Q727X	Q	+	1	0	ZEB1	31850448	0.311000	0.24536	0.918000	0.36340	0.998000	0.95712	1.919000	0.40015	2.575000	0.86900	0.650000	0.86243	CAA	ZEB1	-	NULL	ENSG00000148516		0.433	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZEB1	HGNC	protein_coding	OTTHUMT00000419083.2		0.00	26	0	C	NM_030751		31810442	+1			no_errors	ENST00000361642	ensembl	human	known	74_37	nonsense	7.50	37	3	SNP	0.986	T
ZNF114	163071	genome.wustl.edu	37	19	48789377	48789377	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:48789377G>T	ENST00000595607.1	+	6	990	c.496G>T	c.(496-498)Gat>Tat	p.D166Y	ZNF114_ENST00000600687.1_Missense_Mutation_p.D166Y|ZNF114_ENST00000597695.1_Missense_Mutation_p.D132Y|ZNF114_ENST00000315849.1_Missense_Mutation_p.D166Y			Q8NC26	ZN114_HUMAN	zinc finger protein 114	166					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		TGTCTTAAACGATAGTCAAAA	0.423																																																	0													71.0	66.0	67.0					19																	48789377		2203	4300	6503	SO:0001583	missense	0			BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.496G>T	19.37:g.48789377G>T	ENSP00000469998:p.Asp166Tyr		A8K6B0|Q08AQ6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D166Y	ENST00000595607.1	37	c.496	CCDS12713.1	19	.	.	.	.	.	.	.	.	.	.	G	10.16	1.274898	0.23307	.	.	ENSG00000178150	ENST00000315849	T	0.05925	3.37	2.01	0.971	0.19698	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	P	0.51449	0.945	B	0.39027	0.288	T	0.42849	-0.9427	9	0.62326	D	0.03	.	5.1232	0.14871	0.83:0.0:0.17:0.0	.	166	Q8NC26	ZN114_HUMAN	Y	166	ENSP00000318898:D166Y	ENSP00000318898:D166Y	D	+	1	0	ZNF114	53481189	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.673000	0.25203	0.260000	0.21731	-0.474000	0.04947	GAT	ZNF114	-	NULL	ENSG00000178150		0.423	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF114	HGNC	protein_coding	OTTHUMT00000465601.1		0.00	18	0	G	NM_153608		48789377	+1			no_errors	ENST00000315849	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.001	T
ZNF18	7566	genome.wustl.edu	37	17	11895864	11895864	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr17:11895864C>T	ENST00000322748.3	-	4	887	c.283G>A	c.(283-285)Ggg>Agg	p.G95R	ZNF18_ENST00000454073.3_Missense_Mutation_p.G95R|ZNF18_ENST00000580306.2_Missense_Mutation_p.G95R	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	95	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		TGGATCTCCCCAGGCAGGATG	0.547																																																	0													97.0	86.0	90.0					17																	11895864		2203	4300	6503	SO:0001583	missense	0			X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.283G>A	17.37:g.11895864C>T	ENSP00000315664:p.Gly95Arg		Q5QHQ3|Q8IYC4|Q8NAH6	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.G95R	ENST00000322748.3	37	c.283	CCDS32568.1	17	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602388	0.46423	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	T;T	0.04015	3.73;3.73	5.39	5.39	0.77823	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.136669	0.33875	N	0.004480	T	0.08582	0.0213	L	0.28054	0.825	0.39336	D	0.965492	B;P	0.36577	0.451;0.558	B;P	0.47402	0.246;0.546	T	0.21621	-1.0240	10	0.87932	D	0	-33.4085	14.6804	0.69012	0.0:1.0:0.0:0.0	.	95;95	P17022-2;P17022	.;ZNF18_HUMAN	R	95	ENSP00000391376:G95R;ENSP00000315664:G95R	ENSP00000315664:G95R	G	-	1	0	ZNF18	11836589	0.003000	0.15002	0.961000	0.40146	0.990000	0.78478	1.576000	0.36504	2.531000	0.85337	0.655000	0.94253	GGG	ZNF18	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000154957		0.547	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF18	HGNC	protein_coding	OTTHUMT00000441450.2	-	0.00	51	0	C	XM_085596		11895864	-1	tier1	-	no_errors	ENST00000322748	ensembl	human	known	74_37	missense	23.44	49	15	SNP	0.959	T
ZNF724P	440519	genome.wustl.edu	37	19	23405581	23405581	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:23405581A>G	ENST00000418100.1	-	4	1583	c.1466T>C	c.(1465-1467)cTa>cCa	p.L489P				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						GTGTGAGGATAGGTTAAAAGC	0.388																																																	0																																										SO:0001583	missense	0					19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.1466T>C	19.37:g.23405581A>G	ENSP00000413411:p.Leu489Pro			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L489P	ENST00000418100.1	37	c.1466		19	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.761199	0.00657	.	.	ENSG00000196081	ENST00000418100	T	0.08896	3.04	1.08	-1.37	0.09056	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.03178	0.0093	.	.	.	0.09310	N	1	P	0.43024	0.798	B	0.25291	0.059	T	0.37663	-0.9696	8	0.40728	T	0.16	.	2.4088	0.04419	0.325:0.2255:0.0:0.4495	.	489	A8MTY0	ZN724_HUMAN	P	489	ENSP00000413411:L489P	ENSP00000413411:L489P	L	-	2	0	ZNF724P	23197421	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-5.634000	0.00108	-0.617000	0.05664	-0.686000	0.03744	CTA	ZNF724P	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196081		0.388	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	ZNF724P	HGNC	protein_coding	OTTHUMT00000465743.1	-	0.00	58	0	A			23405581	-1	tier1	-	no_errors	ENST00000418100	ensembl	human	novel	74_37	missense	11.76	30	4	SNP	0.000	G
ZNF613	79898	genome.wustl.edu	37	19	52448197	52448197	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:52448197G>A	ENST00000293471.6	+	6	1740	c.1061G>A	c.(1060-1062)cGc>cAc	p.R354H	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.R318H	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	354					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		AAAGCATTCCGCTGGAAATCA	0.458																																																	0													97.0	97.0	97.0					19																	52448197		2203	4300	6503	SO:0001583	missense	0			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1061G>A	19.37:g.52448197G>A	ENSP00000293471:p.Arg354His		Q96SS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R354H	ENST00000293471.6	37	c.1061	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905323	0.52333	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.07567	3.18;3.18	3.26	2.21	0.28008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	1.950270	0.02940	N	0.140304	T	0.10981	0.0268	L	0.53249	1.67	0.22926	N	0.998558	B	0.25351	0.124	B	0.23419	0.046	T	0.32428	-0.9907	10	0.54805	T	0.06	.	4.6272	0.12484	0.1284:0.2282:0.6434:0.0	.	354	Q6PF04	ZN613_HUMAN	H	354;318;28	ENSP00000293471:R354H;ENSP00000375671:R318H	ENSP00000293471:R354H	R	+	2	0	ZNF613	57140009	0.000000	0.05858	0.793000	0.32043	0.922000	0.55478	-2.036000	0.01421	0.708000	0.31955	0.655000	0.94253	CGC	ZNF613	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000176024		0.458	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2		0.00	54	0	G	NM_024840		52448197	+1			no_errors	ENST00000293471	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.895	A
ZNF471	57573	genome.wustl.edu	37	19	57036330	57036330	+	Silent	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:57036330C>T	ENST00000308031.5	+	5	1027	c.894C>T	c.(892-894)gcC>gcT	p.A298A	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Missense_Mutation_p.P158L	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	298					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		GCAGAAAAGCCTTCAGACAGC	0.403																																					Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)												0													110.0	119.0	116.0					19																	57036330		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.894C>T	19.37:g.57036330C>T			B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.P158L	ENST00000308031.5	37	c.473	CCDS12945.1	19																																																																																			ZNF471	-	NULL	ENSG00000196263		0.403	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF471	HGNC	protein_coding	OTTHUMT00000458405.1	-	0.00	47	0	C	NM_020813		57036330	+1	tier1	-	no_errors	ENST00000591537	ensembl	human	putative	74_37	missense	28.33	43	17	SNP	0.814	T
ZNF470	388566	genome.wustl.edu	37	19	57089220	57089220	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr19:57089220C>A	ENST00000330619.8	+	6	2109	c.1423C>A	c.(1423-1425)Cat>Aat	p.H475N	ZNF470_ENST00000601902.1_Intron|ZNF470_ENST00000391709.3_Missense_Mutation_p.H475N	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	475					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		TCAGAGAGTTCATACTGGAGA	0.433																																																	0													72.0	78.0	76.0					19																	57089220		2203	4300	6503	SO:0001583	missense	0			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.1423C>A	19.37:g.57089220C>A	ENSP00000333223:p.His475Asn		A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H475N	ENST00000330619.8	37	c.1423	CCDS33122.1	19	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349180	0.82132	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.67345	-0.26;-0.26	4.37	4.37	0.52481	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85017	0.5601	M	0.91090	3.175	0.38905	D	0.957405	D	0.89917	1.0	D	0.85130	0.997	D	0.89629	0.3854	9	0.72032	D	0.01	.	15.8406	0.78842	0.0:1.0:0.0:0.0	.	475	Q6ECI4	ZN470_HUMAN	N	475	ENSP00000375590:H475N;ENSP00000333223:H475N	ENSP00000333223:H475N	H	+	1	0	ZNF470	61781032	0.995000	0.38212	0.974000	0.42286	0.993000	0.82548	3.660000	0.54496	2.272000	0.75746	0.650000	0.86243	CAT	ZNF470	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197016		0.433	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF470	HGNC	protein_coding	OTTHUMT00000459707.2	-	0.00	45	0	C	NM_001001668		57089220	+1	tier1	-	no_errors	ENST00000330619	ensembl	human	known	74_37	missense	22.81	44	13	SNP	1.000	A
ZNF785	146540	genome.wustl.edu	37	16	30596833	30596833	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr16:30596833C>T	ENST00000395216.2	-	1	259	c.100G>A	c.(100-102)Gtg>Atg	p.V34M	ZNF785_ENST00000470110.1_Missense_Mutation_p.V34M|RP11-146F11.5_ENST00000563540.1_RNA|AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	34	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						TACACGGCCACGTCCGCGAAG	0.751																																																	0													14.0	16.0	15.0					16																	30596833		2191	4287	6478	SO:0001583	missense	0			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.100G>A	16.37:g.30596833C>T	ENSP00000378642:p.Val34Met		O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V34M	ENST00000395216.2	37	c.100	CCDS10685.1	16	.	.	.	.	.	.	.	.	.	.	c	15.15	2.749038	0.49257	.	.	ENSG00000197162	ENST00000470110;ENST00000395216	T;T	0.10382	2.88;2.88	4.19	2.16	0.27623	Krueppel-associated box (4);	.	.	.	.	T	0.15869	0.0382	M	0.90198	3.095	0.21473	N	0.999679	P;P	0.38767	0.646;0.593	B;B	0.32533	0.147;0.064	T	0.19549	-1.0302	9	0.62326	D	0.03	.	5.5143	0.16898	0.0:0.6854:0.2032:0.1114	.	34;34	A8K8V0;A8K8V0-2	ZN785_HUMAN;.	M	34	ENSP00000420340:V34M;ENSP00000378642:V34M	ENSP00000378642:V34M	V	-	1	0	ZNF785	30504334	0.008000	0.16893	0.032000	0.17829	0.165000	0.22458	0.911000	0.28584	0.393000	0.25203	0.586000	0.80456	GTG	ZNF785	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197162		0.751	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF785	HGNC	protein_coding	OTTHUMT00000255529.2		0.00	50	0	C	NM_152458		30596833	-1			no_errors	ENST00000395216	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.864	T
ZRANB2	9406	genome.wustl.edu	37	1	71536538	71536538	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NV-01A-11D-A37C-09	TCGA-L5-A8NV-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a5818360-5a6d-4513-9b7b-07a0fd43189a	6b659589-badb-4cff-9ca1-e9c1c2c1c86f	g.chr1:71536538A>G	ENST00000370920.3	-	7	956	c.655T>C	c.(655-657)Tcc>Ccc	p.S219P	ZRANB2_ENST00000254821.6_Missense_Mutation_p.S219P	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2	219	Arg/Ser-rich.|Required for nuclear targeting.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						CTTGAGGGGGAGGATGAGCGT	0.388																																																	0													251.0	239.0	243.0					1																	71536538		2203	4300	6503	SO:0001583	missense	0			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.655T>C	1.37:g.71536538A>G	ENSP00000359958:p.Ser219Pro		D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	Missense_Mutation	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pirsf_UCP037956_Znf_RanB2,pfscan_Znf_RanBP2	p.S219P	ENST00000370920.3	37	c.655	CCDS659.1	1	.	.	.	.	.	.	.	.	.	.	A	16.83	3.231354	0.58777	.	.	ENSG00000132485	ENST00000370920;ENST00000254821	T;T	0.67865	-0.29;-0.27	6.06	6.06	0.98353	.	0.200429	0.56097	D	0.000033	T	0.66723	0.2818	L	0.32530	0.975	0.80722	D	1	D;D	0.57899	0.967;0.981	D;D	0.68621	0.91;0.959	T	0.66905	-0.5805	10	0.36615	T	0.2	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	219;219	O95218;O95218-2	ZRAB2_HUMAN;.	P	219	ENSP00000359958:S219P;ENSP00000254821:S219P	ENSP00000254821:S219P	S	-	1	0	ZRANB2	71309126	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.323000	0.78572	0.528000	0.53228	TCC	ZRANB2	-	pirsf_UCP037956_Znf_RanB2	ENSG00000132485		0.388	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	-	0.00	71	0	A	NM_203350		71536538	-1	tier1	-	no_errors	ENST00000370920	ensembl	human	known	74_37	missense	8.11	68	6	SNP	1.000	G
