#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ADAMTS20	80070	genome.wustl.edu	37	12	43771250	43771250	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:43771250G>A	ENST00000389420.3	-	32	4912	c.4913C>T	c.(4912-4914)cCt>cTt	p.P1638L		NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1638	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.P1638H(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AGGCACCACAGGGCATTCTTG	0.423																																																	1	Substitution - Missense(1)	large_intestine(1)											130.0	117.0	121.0					12																	43771250		2203	4300	6503	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4913C>T	12.37:g.43771250G>A	ENSP00000374071:p.Pro1638Leu		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P1638L	ENST00000389420.3	37	c.4913	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124280	0.56613	.	.	ENSG00000173157	ENST00000389420	T	0.60299	0.2	4.99	4.99	0.66335	.	0.000000	0.51477	D	0.000090	T	0.76622	0.4013	M	0.74258	2.255	0.80722	D	1	D	0.76494	0.999	D	0.72625	0.978	T	0.78770	-0.2074	10	0.66056	D	0.02	.	19.1624	0.93539	0.0:0.0:1.0:0.0	.	1638	P59510	ATS20_HUMAN	L	1638	ENSP00000374071:P1638L	ENSP00000374071:P1638L	P	-	2	0	ADAMTS20	42057517	1.000000	0.71417	0.978000	0.43139	0.150000	0.21749	6.896000	0.75665	2.709000	0.92574	0.655000	0.94253	CCT	ADAMTS20	-	NULL	ENSG00000173157		0.423	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	47	0	G	NM_025003		43771250	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	missense	12.96	47	7	SNP	0.997	A
AFG3L1P	172	genome.wustl.edu	37	16	90066363	90066363	+	IGR	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr16:90066363G>A								AFG3L1P (3332 upstream) : DBNDD1 (4909 downstream)																							CCGAGCAGCTGTGCTCCGGGT	0.672																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.90066363G>A				RNA	SNP	-	NULL		37	NULL		16																																																																																			AFG3L1P	-	-	ENSG00000223959	0	0.672					AFG3L1P	HGNC			-	0.00	34	0	G			90066363	+1	tier1	-	no_errors	ENST00000388970	ensembl	human	known	74_37	rna	41.38	17	12	SNP	0.966	A
AGAP10	728127	genome.wustl.edu	37	10	47207813	47207813	+	Splice_Site	SNP	T	T	C	rs202014361	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr10:47207813T>C	ENST00000452145.2	-	4	506	c.395A>G	c.(394-396)cAt>cGt	p.H132R	RP11-144G6.12_ENST00000605970.1_RNA|AGAP10_ENST00000413193.2_Splice_Site_p.H228R|AGAP10_ENST00000355232.3_Splice_Site_p.H157R			Q5T2P9	AGA10_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 10	132					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.H228R(20)		endometrium(5)|kidney(3)|lung(1)|prostate(2)|urinary_tract(1)	12						TTTACTTACATGGTTTGTACA	0.294																																																	20	Substitution - Missense(20)	endometrium(10)|prostate(4)|kidney(4)|urinary_tract(2)																																								SO:0001630	splice_region_variant	0			BC075841		10q11.22	2013-01-11	2008-09-22	2008-09-22	ENSG00000204172	ENSG00000204172		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	23462	protein-coding gene	gene with protein product			"""centaurin, gamma-like family, member 7"""	CTGLF7			Standard	XM_006709937		Approved	bA144G6.2		Q5T2P9	OTTHUMG00000018115	ENST00000452145.2:c.396+1A>G	10.37:g.47207813T>C				Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.H228R	ENST00000452145.2	37	c.683		10	.	.	.	.	.	.	.	.	.	.	t	0.012	-1.675265	0.00751	.	.	ENSG00000204172	ENST00000452145;ENST00000413193;ENST00000355232	D;T;D	0.87966	-2.32;2.68;-2.32	1.4	1.4	0.22301	.	0.264128	0.34555	N	0.003879	T	0.72486	0.3466	.	.	.	0.20764	N	0.999856	B	0.22003	0.063	B	0.19666	0.026	T	0.55471	-0.8136	9	0.16896	T	0.51	.	6.9024	0.24291	0.0:0.0:0.0:1.0	.	132	Q5T2P9	AGA10_HUMAN	R	132;228;157	ENSP00000392206:H132R;ENSP00000407436:H228R;ENSP00000347372:H157R	ENSP00000347372:H157R	H	-	2	0	AGAP10	46627819	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	3.704000	0.54815	0.898000	0.36418	0.163000	0.16589	CAT	AGAP10	-	NULL	ENSG00000204172		0.294	AGAP10-001	KNOWN	basic|appris_candidate	protein_coding	AGAP10	HGNC	protein_coding	OTTHUMT00000047845.2	-	0.00	93	0	T	XM_001714786.2	Missense_Mutation	47207813	-1	tier1	rs202014361	no_errors	ENST00000413193	ensembl	human	known	74_37	missense	11.69	68	9	SNP	1.000	C
AMBRA1	55626	genome.wustl.edu	37	11	46563800	46563800	+	Silent	SNP	A	A	G			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:46563800A>G	ENST00000458649.2	-	7	2185	c.1767T>C	c.(1765-1767)ccT>ccC	p.P589P	AMBRA1_ENST00000314845.3_Silent_p.P499P|AMBRA1_ENST00000528950.1_Silent_p.P589P|AMBRA1_ENST00000298834.3_Silent_p.P589P|AMBRA1_ENST00000533727.1_Silent_p.P499P|AMBRA1_ENST00000534300.1_Silent_p.P589P|AMBRA1_ENST00000426438.1_Silent_p.P589P			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	589					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGGAGTAGTTAGGTGTGGTTC	0.572																																																	0													80.0	67.0	72.0					11																	46563800		2201	4299	6500	SO:0001819	synonymous_variant	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1767T>C	11.37:g.46563800A>G			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P589	ENST00000458649.2	37	c.1767		11																																																																																			AMBRA1	-	NULL	ENSG00000110497		0.572	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	24	0	A	NM_017749		46563800	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	silent	23.26	33	10	SNP	0.627	G
AMPH	273	genome.wustl.edu	37	7	38502672	38502672	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:38502672G>A	ENST00000356264.2	-	10	1006	c.791C>T	c.(790-792)cCt>cTt	p.P264L	AMPH_ENST00000325590.5_Missense_Mutation_p.P264L|AMPH_ENST00000428293.2_Missense_Mutation_p.P264L	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	264					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						AGGCTCCTCAGGCGGTGATGG	0.557																																																	0													162.0	152.0	156.0					7																	38502672		2203	4300	6503	SO:0001583	missense	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.791C>T	7.37:g.38502672G>A	ENSP00000348602:p.Pro264Leu		A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_Amphiphysin,prints_Amphiphysin_1,prints_SH3_domain	p.P264L	ENST00000356264.2	37	c.791	CCDS5456.1	7	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140643	0.77775	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000544070	T;T;T	0.44881	0.91;0.91;0.91	6.04	6.04	0.98038	.	0.103160	0.64402	D	0.000002	T	0.66247	0.2770	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.984;0.981;0.999	T	0.64334	-0.6432	10	0.59425	D	0.04	-16.7501	20.5792	0.99380	0.0:0.0:1.0:0.0	.	264;264;20	P49418-2;P49418;Q8NFL4	.;AMPH_HUMAN;.	L	264;264;264;34;267	ENSP00000317441:P264L;ENSP00000348602:P264L;ENSP00000390734:P264L	ENSP00000317441:P264L	P	-	2	0	AMPH	38469197	1.000000	0.71417	0.348000	0.25681	0.500000	0.33767	7.960000	0.87893	2.873000	0.98535	0.561000	0.74099	CCT	AMPH	-	NULL	ENSG00000078053		0.557	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	-	0.00	58	0	G	NM_001635		38502672	-1	tier1	-	no_errors	ENST00000356264	ensembl	human	known	74_37	missense	6.59	85	6	SNP	0.992	A
ANKLE2	23141	genome.wustl.edu	37	12	133306568	133306568	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:133306568G>A	ENST00000357997.5	-	11	2269	c.2180C>T	c.(2179-2181)cCa>cTa	p.P727L	ANKLE2_ENST00000539605.1_Missense_Mutation_p.P665L|ANKLE2_ENST00000542374.1_Intron|ANKLE2_ENST00000542282.1_Missense_Mutation_p.P82L|ANKLE2_ENST00000542657.1_Missense_Mutation_p.P82L	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	727					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CGAGACAGGTGGCAGATGGGC	0.498																																																	0													91.0	95.0	94.0					12																	133306568		1949	4136	6085	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.2180C>T	12.37:g.133306568G>A	ENSP00000350686:p.Pro727Leu		A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM_dom,superfamily_LEM/LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM_dom	p.P727L	ENST00000357997.5	37	c.2180	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	G	15.28	2.785829	0.49997	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000542282;ENST00000542657;ENST00000538766	T;T;T;T;T	0.42900	1.98;1.96;0.97;0.97;0.96	5.74	3.92	0.45320	.	0.374700	0.31697	N	0.007211	T	0.35799	0.0944	L	0.44542	1.39	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.14227	-1.0480	10	0.52906	T	0.07	-13.028	12.541	0.56169	0.1351:0.0:0.8649:0.0	.	727	Q86XL3	ANKL2_HUMAN	L	665;727;82;82;82	ENSP00000446268:P665L;ENSP00000350686:P727L;ENSP00000437807:P82L;ENSP00000438551:P82L;ENSP00000445760:P82L	ENSP00000350686:P727L	P	-	2	0	ANKLE2	131816641	0.286000	0.24305	0.001000	0.08648	0.008000	0.06430	3.280000	0.51677	0.892000	0.36259	0.645000	0.84053	CCA	ANKLE2	-	NULL	ENSG00000176915		0.498	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1		0.00	27	0	G			133306568	-1			no_errors	ENST00000357997	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.749	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14184381	14184381	+	RNA	DEL	T	T	-	rs367796612		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr18:14184381delT	ENST00000581935.1	+	0	1070							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TTTTTCCCCGTAATTAGCGTA	0.313																																																	0																																												0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184381delT			Q4G1B6	RNA	DEL	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.313	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1		0.00	8	0	T			14184381	+1			no_errors	ENST00000581935	ensembl	human	known	74_37	rna	33.33	4	2	DEL	0.000	0
ARL14EP	120534	genome.wustl.edu	37	11	30358340	30358340	+	Nonstop_Mutation	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:30358340T>A	ENST00000282032.3	+	4	996	c.781T>A	c.(781-783)Taa>Aaa	p.*261K		NM_152316.1	NP_689529.1	Q8N8R7	AL14E_HUMAN	ADP-ribosylation factor-like 14 effector protein	0						cytoplasm (GO:0005737)											ACATGCTGGATAATCTGCGGT	0.358																																																	0													59.0	58.0	59.0					11																	30358340		2202	4299	6501	SO:0001578	stop_lost	0			AK096287	CCDS7869.1	11p14.1	2014-09-17	2012-07-09	2012-07-09	ENSG00000152219	ENSG00000152219			26798	protein-coding gene	gene with protein product		612295	"""chromosome 11 open reading frame 46"""	C11orf46		21458045	Standard	XM_005252792		Approved	FLJ38968, ARF7EP	uc001mso.1	Q8N8R7	OTTHUMG00000166154	ENST00000282032.3:c.781T>A	11.37:g.30358340T>A	ENSP00000282032:p.*261Lysext*15		Q5HYH9	Nonstop_Mutation	SNP	NULL	p.*261K	ENST00000282032.3	37	c.781	CCDS7869.1	11	.	.	.	.	.	.	.	.	.	.	T	20.7	4.036971	0.75617	.	.	ENSG00000152219	ENST00000282032	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	.	.	.	K	261	.	.	X	+	1	0	C11orf46	30314916	1.000000	0.71417	0.277000	0.24703	0.756000	0.42949	5.486000	0.66856	2.279000	0.76181	0.533000	0.62120	TAA	ARL14EP	-	NULL	ENSG00000152219		0.358	ARL14EP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL14EP	HGNC	protein_coding	OTTHUMT00000388129.1		0.00	28	0	T	NM_152316		30358340	+1			no_errors	ENST00000282032	ensembl	human	known	74_37	nonstop	43.33	17	13	SNP	0.924	A
ARMC4	55130	genome.wustl.edu	37	10	28196695	28196695	+	Missense_Mutation	SNP	C	C	T	rs376281682		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr10:28196695C>T	ENST00000305242.5	-	17	2599	c.2507G>A	c.(2506-2508)cGc>cAc	p.R836H	ARMC4_ENST00000545014.1_Missense_Mutation_p.R361H|ARMC4_ENST00000537576.1_Missense_Mutation_p.R528H	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	836					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TCCATCTAAGCGATCAATTAT	0.398																																																	0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	110.0	97.0	101.0		2507	2.9	1.0	10		101	0,8600		0,0,4300	no	missense	ARMC4	NM_018076.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	836/1045	28196695	1,13005	2203	4300	6503	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2507G>A	10.37:g.28196695C>T	ENSP00000306410:p.Arg836His		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.R836H	ENST00000305242.5	37	c.2507	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	C	14.15	2.449894	0.43531	2.27E-4	0.0	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	T;T;T	0.64803	-0.12;-0.12;-0.12	5.74	2.89	0.33648	Armadillo-like helical (1);Armadillo-type fold (1);	0.209827	0.49916	D	0.000123	T	0.73353	0.3576	M	0.70903	2.155	0.80722	D	1	D;B	0.69078	0.997;0.434	D;B	0.66084	0.941;0.133	T	0.72459	-0.4287	10	0.62326	D	0.03	-4.2619	9.7055	0.40214	0.0:0.7556:0.1164:0.128	.	361;836	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	H	528;836;361	ENSP00000443208:R528H;ENSP00000306410:R836H;ENSP00000441076:R361H	ENSP00000306410:R836H	R	-	2	0	ARMC4	28236701	1.000000	0.71417	0.996000	0.52242	0.908000	0.53690	1.257000	0.32932	0.366000	0.24427	-0.119000	0.15052	CGC	ARMC4	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000169126		0.398	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	-	0.00	14	0	C	NM_018076		28196695	-1	tier1	-	no_errors	ENST00000305242	ensembl	human	known	74_37	missense	43.90	23	18	SNP	1.000	T
ATAD3B	83858	genome.wustl.edu	37	1	1412670	1412670	+	Silent	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:1412670C>T	ENST00000308647.7	+	2	338	c.222C>T	c.(220-222)gcC>gcT	p.A74A	ATAD3B_ENST00000378741.3_5'UTR	NM_031921.4	NP_114127.3	Q5T9A4	ATD3B_HUMAN	ATPase family, AAA domain containing 3B	74						mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)|urinary_tract(1)	10	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		CCAAGGAGGCCCTGAATCTGG	0.612																																																	0													46.0	44.0	44.0					1																	1412670		2203	4295	6498	SO:0001819	synonymous_variant	0			AL834179	CCDS30.1	1p36.33	2010-04-21		2007-02-08	ENSG00000160072	ENSG00000160072		"""ATPases / AAA-type"""	24007	protein-coding gene	gene with protein product		612317				10574462	Standard	XM_005244806		Approved	TOB3, KIAA1273	uc001afv.3	Q5T9A4	OTTHUMG00000000577	ENST00000308647.7:c.222C>T	1.37:g.1412670C>T			A8K3H1|Q6ZRB5|Q9BUK4|Q9ULE7	Silent	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A74	ENST00000308647.7	37	c.222	CCDS30.1	1																																																																																			ATAD3B	-	pfam_DUF3523	ENSG00000160072		0.612	ATAD3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3B	HGNC	protein_coding	OTTHUMT00000001369.2	-	0.00	76	0	C	NM_031921		1412670	+1	tier1	-	no_errors	ENST00000308647	ensembl	human	known	74_37	silent	52.83	25	28	SNP	0.892	T
B3GALT2	8707	genome.wustl.edu	37	1	193149736	193149736	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:193149736A>T	ENST00000367434.4	-	2	1712	c.957T>A	c.(955-957)ttT>ttA	p.F319L	CDC73_ENST00000367435.3_Intron	NM_003783.3	NP_003774.1	O43825	B3GT2_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2	319					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)	16						GATCTCCAGAAAAAACATAAC	0.423																																																	0													79.0	78.0	78.0					1																	193149736		2203	4300	6503	SO:0001583	missense	0			Y15060	CCDS1383.1	1q31	2013-02-19			ENSG00000162630	ENSG00000162630		"""Beta 3-glycosyltransferases"""	917	protein-coding gene	gene with protein product		603018				9582303, 9417100	Standard	NM_003783		Approved	beta3Gal-T2	uc001gtc.4	O43825	OTTHUMG00000035687	ENST00000367434.4:c.957T>A	1.37:g.193149736A>T	ENSP00000356404:p.Phe319Leu		B2RAB1|Q9BZQ9	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.F319L	ENST00000367434.4	37	c.957	CCDS1383.1	1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.959148	0.34565	.	.	ENSG00000162630	ENST00000367434	D	0.85411	-1.98	5.42	0.592	0.17471	.	0.000000	0.85682	D	0.000000	T	0.73418	0.3584	L	0.31420	0.93	0.58432	D	0.99999	B	0.15141	0.012	B	0.26969	0.075	T	0.56715	-0.7933	10	0.15066	T	0.55	.	9.0674	0.36471	0.6442:0.0:0.3558:0.0	.	319	O43825	B3GT2_HUMAN	L	319	ENSP00000356404:F319L	ENSP00000356404:F319L	F	-	3	2	B3GALT2	191416359	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.075000	0.30716	0.059000	0.16252	-0.297000	0.09499	TTT	B3GALT2	-	pfam_Glyco_trans_31	ENSG00000162630		0.423	B3GALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT2	HGNC	protein_coding	OTTHUMT00000086759.1	-	0.00	49	0	A	NM_003783		193149736	-1	tier1	-	no_errors	ENST00000367434	ensembl	human	known	74_37	missense	36.84	48	28	SNP	1.000	T
BEND7	222389	genome.wustl.edu	37	10	13485245	13485245	+	Intron	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr10:13485245C>A	ENST00000396900.2	-	9	1234				BEND7_ENST00000341083.3_Intron|BEND7_ENST00000486542.1_Intron|BEND7_ENST00000378605.3_Intron|BEND7_ENST00000396898.2_Intron			Q8N7W2	BEND7_HUMAN	BEN domain containing 7							extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						TGACAGAACACCCACACTTTG	0.363																																																	0																																										SO:0001627	intron_variant	0			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1235-3748G>T	10.37:g.13485245C>A			Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	RNA	SNP	-	NULL	ENST00000396900.2	37	NULL		10																																																																																			BEND7	-	-	ENSG00000165626		0.363	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding		-	0.00	46	0	C	NM_152751		13485245	-1	tier1	-	no_errors	ENST00000480703	ensembl	human	known	74_37	rna	15.22	39	7	SNP	0.397	A
BOD1L2	284257	genome.wustl.edu	37	18	54815025	54815025	+	Missense_Mutation	SNP	G	G	T	rs11151997	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr18:54815025G>T	ENST00000585477.1	+	1	733	c.482G>T	c.(481-483)gGc>gTc	p.G161V	CTD-2526M8.3_ENST00000590942.1_lincRNA	NM_001257964.1	NP_001244893.1	Q8IYS8	BD1L2_HUMAN	biorientation of chromosomes in cell division 1-like 2	161																	GAGCCAGAAGGCCAGGACCCT	0.468													G|||	2845	0.568091	0.5893	0.5519	5008	,	,		20390	0.5794		0.5109	False		,,,				2504	0.5982																0																																										SO:0001583	missense	0			AK127964	CCDS59322.1	18q21.31	2013-10-11	2012-04-10	2012-04-10	ENSG00000228075	ENSG00000228075			28505	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member C"", ""biorientation of chromosomes in cell division 1 pseudogene"""	FAM44C, BOD1P		17938248	Standard	NM_001257964		Approved	MGC33608	uc002lgm.3	Q8IYS8	OTTHUMG00000180124	ENST00000585477.1:c.482G>T	18.37:g.54815025G>T	ENSP00000467843:p.Gly161Val		B3KXU4|Q8WW13	Missense_Mutation	SNP	NULL	p.G161V	ENST00000585477.1	37	c.482	CCDS59322.1	18	1153	0.5279304029304029	265	0.5386178861788617	189	0.5220994475138122	333	0.5821678321678322	366	0.48284960422163586	G	10.54	1.379007	0.24944	.	.	ENSG00000228075	ENST00000420277	.	.	.	2.73	-0.478	0.12093	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.26400	0.148	B	0.15052	0.012	T	0.44097	-0.9350	6	0.44086	T	0.13	.	3.8142	0.08809	0.2348:0.4547:0.3104:0.0	rs11151997;rs57011054	161	Q8IYS8	BD1L2_HUMAN	V	133	.	ENSP00000442342:G133V	G	+	2	0	AC100775.1	52966023	0.037000	0.19845	0.001000	0.08648	0.009000	0.06853	0.004000	0.13106	0.012000	0.14892	-0.291000	0.09656	GGC	BOD1L2	-	NULL	ENSG00000228075		0.468	BOD1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L2	HGNC	protein_coding	OTTHUMT00000449763.1		0.00	34	0	G	NM_001257964		54815025	+1			no_errors	ENST00000585477	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.000	T
BTN2A2	10385	genome.wustl.edu	37	6	26390424	26390424	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:26390424G>A	ENST00000356709.4	+	5	1027	c.916G>A	c.(916-918)Gaa>Aaa	p.E306K	BTN2A2_ENST00000469230.1_Missense_Mutation_p.E306K|BTN2A2_ENST00000416795.2_Missense_Mutation_p.E306K|BTN2A2_ENST00000482536.1_Missense_Mutation_p.E96K|BTN2A2_ENST00000352867.2_Missense_Mutation_p.E190K|BTN2A2_ENST00000432533.2_Missense_Mutation_p.E212K	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	306					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						TGAACAAGAGGAAAAAGAAAT	0.348																																																	0													52.0	54.0	53.0					6																	26390424		2203	4300	6503	SO:0001583	missense	0			U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.916G>A	6.37:g.26390424G>A	ENSP00000349143:p.Glu306Lys		A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like_dom	p.E306K	ENST00000356709.4	37	c.916	CCDS4606.1	6	.	.	.	.	.	.	.	.	.	.	.	5.847	0.340399	0.11069	.	.	ENSG00000124508	ENST00000469230;ENST00000490025;ENST00000356709;ENST00000352867;ENST00000482536;ENST00000432533;ENST00000416795;ENST00000495632	T;T;T;T;T;D;T	0.91180	4.06;0.44;1.29;0.93;0.47;-2.8;1.29	3.76	3.76	0.43208	.	0.304500	0.23334	N	0.049320	T	0.80423	0.4620	L	0.52266	1.64	0.21579	N	0.999639	P;P;P;P;P;P;B	0.48089	0.722;0.722;0.888;0.498;0.905;0.722;0.002	B;B;B;B;P;B;B	0.45610	0.114;0.114;0.435;0.115;0.487;0.164;0.004	T	0.72124	-0.4385	10	0.12766	T	0.61	.	11.0483	0.47872	0.0:0.0:1.0:0.0	.	96;96;212;190;306;190;306	B4DE97;E9PH07;B4DQ01;B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;.;.;.;BT2A2_HUMAN	K	306;101;306;190;96;212;306;32	ENSP00000417472:E306K;ENSP00000418965:E101K;ENSP00000349143:E306K;ENSP00000337117:E190K;ENSP00000419451:E96K;ENSP00000394241:E212K;ENSP00000399308:E306K	ENSP00000337117:E190K	E	+	1	0	BTN2A2	26498403	0.002000	0.14202	0.054000	0.19295	0.063000	0.16089	0.492000	0.22435	1.627000	0.50400	0.467000	0.42956	GAA	BTN2A2	-	NULL	ENSG00000124508		0.348	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A2	HGNC	protein_coding	OTTHUMT00000040117.1		0.00	28	0	G			26390424	+1			no_errors	ENST00000356709	ensembl	human	known	74_37	missense	21.74	18	5	SNP	0.488	A
C12orf56	115749	genome.wustl.edu	37	12	64712546	64712546	+	Missense_Mutation	SNP	A	A	T	rs10671017|rs113411861	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:64712546A>T	ENST00000543942.2	-	4	1329	c.703T>A	c.(703-705)Tcc>Acc	p.S235T	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Intron	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	235										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		TCACTTATGGAGTTGTGATCT	0.448																																																	0													128.0	105.0	112.0					12																	64712546		692	1591	2283	SO:0001583	missense	0				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.703T>A	12.37:g.64712546A>T	ENSP00000446101:p.Ser235Thr			Missense_Mutation	SNP	NULL	p.S235T	ENST00000543942.2	37	c.703		12	.	.	.	.	.	.	.	.	.	.	A	1.995	-0.430849	0.04669	.	.	ENSG00000185306	ENST00000543942;ENST00000433716	.	.	.	4.98	3.81	0.43845	.	.	.	.	.	T	0.42743	0.1216	L	0.51422	1.61	0.09310	N	1	.	.	.	.	.	.	T	0.25984	-1.0116	5	.	.	.	.	9.1303	0.36841	0.8167:0.1833:0.0:0.0	.	.	.	.	T	235;237	.	.	S	-	1	0	C12orf56	62998813	0.975000	0.34042	0.021000	0.16686	0.004000	0.04260	2.364000	0.44187	0.999000	0.39023	0.460000	0.39030	TCC	C12orf56	-	NULL	ENSG00000185306		0.448	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	HGNC	protein_coding	OTTHUMT00000401058.2		0.00	63	0	A	NM_001099676		64712546	-1			no_errors	ENST00000543942	ensembl	human	putative	74_37	missense	6.74	83	6	SNP	0.101	T
CASD1	64921	genome.wustl.edu	37	7	94174972	94174972	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:94174972C>G	ENST00000297273.4	+	12	1879	c.1592C>G	c.(1591-1593)aCt>aGt	p.T531S		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	531						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATATATGTTACTTTAGCACTA	0.313																																																	0													153.0	129.0	137.0					7																	94174972		2203	4300	6503	SO:0001583	missense	0			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.1592C>G	7.37:g.94174972C>G	ENSP00000297273:p.Thr531Ser		B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	pfam_Cas1_AcylTrans_dom,superfamily_Cyclin-like	p.T531S	ENST00000297273.4	37	c.1592	CCDS5636.1	7	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802329	0.50315	.	.	ENSG00000127995	ENST00000297273	T	0.49432	0.78	5.02	5.02	0.67125	.	0.050356	0.85682	D	0.000000	T	0.48205	0.1487	L	0.56340	1.77	0.51767	D	0.999937	B;B	0.29552	0.248;0.248	B;B	0.30179	0.112;0.112	T	0.51593	-0.8686	10	0.62326	D	0.03	.	18.7033	0.91629	0.0:1.0:0.0:0.0	.	531;531	Q8WZ77;Q96PB1	.;CASD1_HUMAN	S	531	ENSP00000297273:T531S	ENSP00000297273:T531S	T	+	2	0	CASD1	94012908	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	3.984000	0.56923	2.489000	0.83994	0.491000	0.48974	ACT	CASD1	-	pfam_Cas1_AcylTrans_dom	ENSG00000127995		0.313	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	HGNC	protein_coding	OTTHUMT00000255216.1	-	0.00	42	0	C	NM_022900		94174972	+1	tier1	-	no_errors	ENST00000297273	ensembl	human	known	74_37	missense	20.99	64	17	SNP	0.984	G
CCDC39	339829	genome.wustl.edu	37	3	180369978	180369978	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr3:180369978T>A	ENST00000442201.2	-	8	1126	c.1007A>T	c.(1006-1008)aAg>aTg	p.K336M	CCDC39_ENST00000273654.4_Missense_Mutation_p.K420M	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	336					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			AATGTCCTTCTTTATCTTGGA	0.269																																																	0													35.0	32.0	33.0					3																	180369978		1716	3877	5593	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1007A>T	3.37:g.180369978T>A	ENSP00000405708:p.Lys336Met		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.K336M	ENST00000442201.2	37	c.1007	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	T	18.95	3.730967	0.69074	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.79033	-1.23;-1.23	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	D	0.85252	0.5654	L	0.61036	1.89	0.45580	D	0.998525	D	0.89917	1.0	D	0.83275	0.996	D	0.86420	0.1754	10	0.66056	D	0.02	-21.2062	12.295	0.54840	0.0:0.0:0.0:1.0	.	336	Q9UFE4	CCD39_HUMAN	M	420;336	ENSP00000273654:K420M;ENSP00000405708:K336M	ENSP00000273654:K420M	K	-	2	0	CCDC39	181852672	1.000000	0.71417	1.000000	0.80357	0.852000	0.48524	6.539000	0.73856	1.838000	0.53458	0.528000	0.53228	AAG	CCDC39	-	NULL	ENSG00000145075		0.269	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	-	0.00	42	0	T	XM_291028		180369978	-1	tier1	-	no_errors	ENST00000442201	ensembl	human	known	74_37	missense	8.57	64	6	SNP	1.000	A
CCDC88A	55704	genome.wustl.edu	37	2	55563852	55563852	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:55563852T>A	ENST00000436346.1	-	14	2462	c.1621A>T	c.(1621-1623)Aca>Tca	p.T541S	AC012358.8_ENST00000608103.1_RNA|CCDC88A_ENST00000263630.8_Missense_Mutation_p.T541S|AC012358.8_ENST00000599352.1_RNA|CCDC88A_ENST00000413716.2_Missense_Mutation_p.T541S|CCDC88A_ENST00000336838.6_Missense_Mutation_p.T541S|AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000599475.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	541					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GTTTCTATTGTTTTTTCAAGC	0.279																																																	0													74.0	76.0	76.0					2																	55563852		2201	4296	6497	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.1621A>T	2.37:g.55563852T>A	ENSP00000410608:p.Thr541Ser		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.T541S	ENST00000436346.1	37	c.1621		2	.	.	.	.	.	.	.	.	.	.	T	11.81	1.748951	0.30955	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.16457	2.34;2.34;2.34;2.34	5.19	5.19	0.71726	.	0.133316	0.33515	U	0.004834	T	0.10895	0.0266	N	0.24115	0.695	0.80722	D	1	B;P;B	0.45902	0.057;0.868;0.155	B;B;B	0.38264	0.11;0.269;0.062	T	0.15263	-1.0443	10	0.10377	T	0.69	-12.6444	15.0407	0.71788	0.0:0.0:0.0:1.0	.	541;541;541	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	S	541	ENSP00000338728:T541S;ENSP00000263630:T541S;ENSP00000410608:T541S;ENSP00000404431:T541S	ENSP00000263630:T541S	T	-	1	0	CCDC88A	55417356	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.982000	0.56909	1.964000	0.57103	0.477000	0.44152	ACA	CCDC88A	-	pfam_Hook-related_fam	ENSG00000115355		0.279	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		-	0.00	28	0	T	NM_017571		55563852	-1	tier1	-	no_errors	ENST00000436346	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	A
CCDC88B	283234	genome.wustl.edu	37	11	64109782	64109782	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:64109782C>A	ENST00000356786.5	+	9	882	c.838C>A	c.(838-840)Ctg>Atg	p.L280M	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000301897.4_5'Flank	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	280						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GAAGGCCGAGCTGCTGCTAGA	0.677																																																	0													34.0	39.0	37.0					11																	64109782		2192	4288	6480	SO:0001583	missense	0			AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.838C>A	11.37:g.64109782C>A	ENSP00000349238:p.Leu280Met		A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	pfam_Hook-related_fam	p.L280M	ENST00000356786.5	37	c.838	CCDS8072.2	11	.	.	.	.	.	.	.	.	.	.	.	10.15	1.269991	0.23221	.	.	ENSG00000168071	ENST00000377638;ENST00000356786	T	0.59502	0.26	3.74	0.356	0.16074	.	.	.	.	.	T	0.48642	0.1511	N	0.19112	0.55	0.54753	D	0.999984	P;P	0.48998	0.918;0.918	P;P	0.57776	0.765;0.827	T	0.44590	-0.9318	9	0.34782	T	0.22	.	3.2617	0.06851	0.0:0.4891:0.219:0.2919	.	280;280	B2RTU8;A6NC98	.;CC88B_HUMAN	M	280	ENSP00000349238:L280M	ENSP00000349238:L280M	L	+	1	2	CCDC88B	63866358	0.018000	0.18449	0.601000	0.28877	0.726000	0.41606	-0.521000	0.06245	0.312000	0.23038	-0.703000	0.03666	CTG	CCDC88B	-	pfam_Hook-related_fam	ENSG00000168071		0.677	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88B	HGNC	protein_coding	OTTHUMT00000104845.1	-	0.00	36	0	C	NM_032251		64109782	+1	tier1	-	no_errors	ENST00000356786	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.786	A
CCT7	10574	genome.wustl.edu	37	2	73471716	73471716	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:73471716G>T	ENST00000258091.5	+	6	632	c.491G>T	c.(490-492)aGc>aTc	p.S164I	CCT7_ENST00000398422.2_Intron|CCT7_ENST00000538797.1_Missense_Mutation_p.S36I|CCT7_ENST00000539919.1_Missense_Mutation_p.S120I|CCT7_ENST00000473786.1_3'UTR|CCT7_ENST00000537131.1_Missense_Mutation_p.S64I|CCT7_ENST00000540468.1_Missense_Mutation_p.S77I	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	164					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						ACCGCTCTGAGCTCCAAGCTG	0.483																																																	0													55.0	55.0	55.0					2																	73471716		2055	4217	6272	SO:0001583	missense	0			AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.491G>T	2.37:g.73471716G>T	ENSP00000258091:p.Ser164Ile		A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_eta	p.S164I	ENST00000258091.5	37	c.491	CCDS46336.1	2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231880	0.79688	.	.	ENSG00000135624	ENST00000540468;ENST00000539919;ENST00000258091;ENST00000537131;ENST00000538797;ENST00000409081	T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37	4.75	4.75	0.60458	.	0.130749	0.64402	D	0.000002	D	0.90363	0.6984	M	0.90369	3.11	0.54753	D	0.999986	P;P;P;P;P	0.52463	0.762;0.953;0.502;0.94;0.929	P;P;B;P;P	0.61658	0.489;0.804;0.371;0.892;0.84	D	0.92183	0.5753	10	0.87932	D	0	-11.1849	15.6389	0.76981	0.0:0.0:1.0:0.0	.	77;36;64;122;164	B7Z4Z7;B7Z1C9;F5GZK5;B8ZZC9;Q99832	.;.;.;.;TCPH_HUMAN	I	77;120;164;64;36;122	ENSP00000442058:S77I;ENSP00000437824:S120I;ENSP00000258091:S164I;ENSP00000444379:S64I;ENSP00000438462:S36I	ENSP00000258091:S164I	S	+	2	0	CCT7	73325224	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.853000	0.69496	2.632000	0.89209	0.563000	0.77884	AGC	CCT7	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_eta	ENSG00000135624		0.483	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT7	HGNC	protein_coding	OTTHUMT00000327714.2	-	0.00	39	0	G			73471716	+1	tier1	-	no_errors	ENST00000258091	ensembl	human	known	74_37	missense	33.33	44	22	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109811375	109811375	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:109811375C>T	ENST00000271332.3	+	18	6552	c.6491C>T	c.(6490-6492)aCg>aTg	p.T2164M		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2164					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ACCATCGTCACGCCCAACATT	0.647																																					NSCLC(158;1285 2011 34800 34852 42084)												0													72.0	69.0	70.0					1																	109811375		2203	4300	6503	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.6491C>T	1.37:g.109811375C>T	ENSP00000271332:p.Thr2164Met		Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.T2164M	ENST00000271332.3	37	c.6491	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	C	16.00	2.998375	0.54147	.	.	ENSG00000143126	ENST00000271332	T	0.13196	2.61	4.77	4.77	0.60923	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.32315	0.0825	M	0.76838	2.35	0.58432	D	0.999991	D	0.89917	1.0	D	0.79108	0.992	T	0.12426	-1.0548	9	0.66056	D	0.02	.	17.9851	0.89153	0.0:1.0:0.0:0.0	.	2164	Q9HCU4	CELR2_HUMAN	M	2164	ENSP00000271332:T2164M	ENSP00000271332:T2164M	T	+	2	0	CELSR2	109612898	1.000000	0.71417	0.931000	0.37212	0.258000	0.26162	7.273000	0.78527	2.502000	0.84385	0.462000	0.41574	ACG	CELSR2	-	pfam_DUF3497	ENSG00000143126		0.647	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	-	0.00	68	0	C	NM_001408		109811375	+1	tier1	-	no_errors	ENST00000271332	ensembl	human	known	74_37	missense	49.21	32	31	SNP	1.000	T
CREBBP	1387	genome.wustl.edu	37	16	3807902	3807902	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr16:3807902G>A	ENST00000262367.5	-	18	4326	c.3517C>T	c.(3517-3519)Cga>Tga	p.R1173*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.R1135*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1173	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.|Interaction with ASF1A. {ECO:0000269|PubMed:24616510}.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.R1173*(2)		NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTATAGACTCGGGATGTCTTG	0.507			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	2	Substitution - Nonsense(2)	urinary_tract(1)|haematopoietic_and_lymphoid_tissue(1)	GRCh37	CM065105	CREBBP	M							140.0	119.0	126.0					16																	3807902		2197	4300	6497	SO:0001587	stop_gained	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3517C>T	16.37:g.3807902G>A	ENSP00000262367:p.Arg1173*		D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.R1173*	ENST00000262367.5	37	c.3517	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	G	49	15.463467	0.99834	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.59	3.48	0.39840	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-26.8768	15.2905	0.73862	0.0:0.0:0.6645:0.3355	.	.	.	.	X	1173;1203;1135	.	ENSP00000262367:R1173X	R	-	1	2	CREBBP	3747903	1.000000	0.71417	0.980000	0.43619	0.993000	0.82548	3.494000	0.53273	1.338000	0.45544	0.585000	0.79938	CGA	CREBBP	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000005339		0.507	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	11	0	G	NM_004380		3807902	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	nonsense	24.00	19	6	SNP	0.997	A
CROCC	9696	genome.wustl.edu	37	1	17280821	17280821	+	Missense_Mutation	SNP	G	G	C	rs6669627	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:17280821G>C	ENST00000375541.5	+	22	3359	c.3290G>C	c.(3289-3291)cGa>cCa	p.R1097P	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CGGCAGAAACGAGATGCCCAG	0.627																																																	0													43.0	48.0	46.0					1																	17280821		2203	4300	6503	SO:0001583	missense	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.3290G>C	1.37:g.17280821G>C	ENSP00000364691:p.Arg1097Pro			Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.R1097P	ENST00000375541.5	37	c.3290	CCDS30616.1	1	18	0.008241758241758242	4	0.008130081300813009	3	0.008287292817679558	2	0.0034965034965034965	9	0.011873350923482849	G	17.39	3.377554	0.61735	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.56941	0.43	4.5	4.5	0.54988	.	.	.	.	.	T	0.65749	0.2721	M	0.77313	2.365	0.54753	D	0.999985	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.72839	-0.4171	9	0.52906	T	0.07	.	15.5037	0.75722	0.0:0.0:1.0:0.0	rs6669627	960;400;1097	A1L0S8;Q5TZA2-2;Q5TZA2	.;.;CROCC_HUMAN	P	1097;978	ENSP00000364691:R1097P	ENSP00000364691:R1097P	R	+	2	0	CROCC	17153408	0.997000	0.39634	1.000000	0.80357	0.750000	0.42670	2.928000	0.48908	2.428000	0.82296	0.561000	0.74099	CGA	CROCC	-	NULL	ENSG00000058453		0.627	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2		0.00	23	0	G	NM_014675		17280821	+1			no_errors	ENST00000375541	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	C
CTNND2	1501	genome.wustl.edu	37	5	11082930	11082930	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:11082930C>A	ENST00000304623.8	-	16	2855	c.2666G>T	c.(2665-2667)cGa>cTa	p.R889L	CTNND2_ENST00000511377.1_Missense_Mutation_p.R798L|CTNND2_ENST00000458100.2_Missense_Mutation_p.R456L|CTNND2_ENST00000503622.1_Missense_Mutation_p.R552L|CTNND2_ENST00000359640.2_Missense_Mutation_p.R831L|CTNND2_ENST00000495388.2_5'UTR	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	889					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TTTCTCTTTTCGGACAGCGGC	0.542																																																	0													81.0	74.0	76.0					5																	11082930		2203	4300	6503	SO:0001583	missense	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2666G>T	5.37:g.11082930C>A	ENSP00000307134:p.Arg889Leu		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R889L	ENST00000304623.8	37	c.2666	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.495653	0.96355	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35	4.93	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84115	0.5401	M	0.86028	2.79	0.80722	D	1	D;D;D	0.76494	0.997;0.997;0.999	D;D;D	0.85130	0.995;0.995;0.997	D	0.87025	0.2131	10	0.87932	D	0	-8.1838	18.4893	0.90841	0.0:1.0:0.0:0.0	.	552;481;889	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	L	889;831;798;456;552	ENSP00000307134:R889L;ENSP00000352661:R831L;ENSP00000426510:R798L;ENSP00000391155:R456L;ENSP00000426887:R552L	ENSP00000307134:R889L	R	-	2	0	CTNND2	11135930	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	7.731000	0.84895	2.439000	0.82584	0.563000	0.77884	CGA	CTNND2	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000169862		0.542	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1	-	0.00	23	0	C	NM_001332		11082930	-1	tier1	-	no_errors	ENST00000304623	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	A
CUL3	8452	genome.wustl.edu	37	2	225422486	225422486	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:225422486G>A	ENST00000264414.4	-	2	492	c.154C>T	c.(154-156)Ctt>Ttt	p.L52F	CUL3_ENST00000409777.1_Missense_Mutation_p.L28F|CUL3_ENST00000432260.2_5'UTR|CUL3_ENST00000409096.1_Missense_Mutation_p.L28F|CUL3_ENST00000344951.4_Intron	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	52					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		TCAAAACTAAGACCACTGTTA	0.358																																																	0													99.0	97.0	97.0					2																	225422486		2202	4296	6498	SO:0001583	missense	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.154C>T	2.37:g.225422486G>A	ENSP00000264414:p.Leu52Phe		A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.L52F	ENST00000264414.4	37	c.154	CCDS2462.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.2|21.2	4.106331|4.106331	0.77096|0.77096	.|.	.|.	ENSG00000036257|ENSG00000036257	ENST00000264414;ENST00000409096;ENST00000409777|ENST00000436172	T;T;T|.	0.75821|.	-0.97;-0.97;-0.97|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.75642|0.75642	0.3877|0.3877	M|M	0.81112|0.81112	2.525|2.525	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	T|T	0.76358|0.76358	-0.2988|-0.2988	10|5	0.42905|.	T|.	0.14|.	.|.	13.1355|13.1355	0.59407|0.59407	0.0733:0.0:0.9267:0.0|0.0733:0.0:0.9267:0.0	.|.	30;52|.	Q53S54;Q13618|.	.;CUL3_HUMAN|.	F|F	52;28;28|72	ENSP00000264414:L52F;ENSP00000387200:L28F;ENSP00000386525:L28F|.	ENSP00000264414:L52F|.	L|S	-|-	1|2	0|0	CUL3|CUL3	225130730|225130730	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.913000|7.913000	0.87471|0.87471	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	CTT|TCT	CUL3	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000036257		0.358	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	-	0.00	49	0	G			225422486	-1	tier1	-	no_errors	ENST00000264414	ensembl	human	known	74_37	missense	48.78	21	20	SNP	1.000	A
DAGLA	747	genome.wustl.edu	37	11	61502404	61502404	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:61502404C>T	ENST00000257215.5	+	10	1174	c.1058C>T	c.(1057-1059)gCc>gTc	p.A353V		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	353					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		AATGCCATTGCCATCCGGCGC	0.622																																																	0													217.0	195.0	203.0					11																	61502404		2202	4299	6501	SO:0001583	missense	0			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1058C>T	11.37:g.61502404C>T	ENSP00000257215:p.Ala353Val		A7E233|Q6WQJ0	Missense_Mutation	SNP	pfam_Lipase_3	p.A353V	ENST00000257215.5	37	c.1058	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.337283	0.95758	.	.	ENSG00000134780	ENST00000257215	T	0.29397	1.57	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.55737	0.1939	M	0.74467	2.265	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.62685	-0.6802	10	0.66056	D	0.02	-30.7933	16.7005	0.85348	0.0:1.0:0.0:0.0	.	353	Q9Y4D2	DGLA_HUMAN	V	353	ENSP00000257215:A353V	ENSP00000257215:A353V	A	+	2	0	DAGLA	61258980	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.021000	0.76425	2.245000	0.73994	0.561000	0.74099	GCC	DAGLA	-	NULL	ENSG00000134780		0.622	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1	-	0.00	62	0	C	NM_006133		61502404	+1	tier1	-	no_errors	ENST00000257215	ensembl	human	known	74_37	missense	24.00	57	18	SNP	1.000	T
DEPDC5	9681	genome.wustl.edu	37	22	32239099	32239099	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr22:32239099G>T	ENST00000382112.3	+	27	2577	c.2507G>T	c.(2506-2508)cGc>cTc	p.R836L	DEPDC5_ENST00000400248.2_Missense_Mutation_p.R836L|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R845L|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R836L|DEPDC5_ENST00000382105.2_Missense_Mutation_p.R767L|DEPDC5_ENST00000535622.1_Missense_Mutation_p.R767L|DEPDC5_ENST00000382111.2_Missense_Mutation_p.R845L|DEPDC5_ENST00000400246.1_Missense_Mutation_p.R845L	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	845					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TCCCGAAACCGCCCTGAGGAG	0.443																																																	0													90.0	84.0	86.0					22																	32239099		1965	4157	6122	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2507G>T	22.37:g.32239099G>T	ENSP00000371546:p.Arg836Leu		A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_IML1,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.R845L	ENST00000382112.3	37	c.2534	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130150	0.77549	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382105;ENST00000382112;ENST00000382111;ENST00000400248	T;T;T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02;2.02;2.02	5.68	4.67	0.58626	.	0.060343	0.64402	D	0.000002	T	0.37571	0.1008	L	0.53249	1.67	0.80722	D	1	D;D;P;P;P;P	0.67145	0.996;0.966;0.941;0.946;0.708;0.91	D;P;P;P;B;B	0.68039	0.955;0.522;0.522;0.538;0.137;0.337	T	0.06789	-1.0807	10	0.23891	T	0.37	.	13.693	0.62559	0.0737:0.0:0.9263:0.0	.	166;845;767;845;836;836	B4DSS1;B9EGN9;B4DH93;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	L	767;845;836;767;845;767;836;845;836	ENSP00000440210:R767L;ENSP00000266091:R845L;ENSP00000383108:R836L;ENSP00000383105:R845L;ENSP00000371539:R767L;ENSP00000371546:R836L;ENSP00000371545:R845L;ENSP00000383107:R836L	ENSP00000266091:R845L	R	+	2	0	DEPDC5	30569099	0.989000	0.36119	1.000000	0.80357	0.957000	0.61999	2.512000	0.45485	1.422000	0.47177	0.655000	0.94253	CGC	DEPDC5	-	NULL	ENSG00000100150		0.443	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1		0.00	53	0	G	NM_014662		32239099	+1			no_errors	ENST00000266091	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
DIO2	1734	genome.wustl.edu	37	14	80677773	80677773	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr14:80677773G>T	ENST00000557010.1	-	3	428	c.43C>A	c.(43-45)Ctg>Atg	p.L15M	DIO2_ENST00000555750.1_Missense_Mutation_p.L15M|DIO2_ENST00000422005.3_Missense_Mutation_p.L15M|DIO2_ENST00000438257.4_Missense_Mutation_p.L15M|DIO2-AS1_ENST00000553979.1_RNA|DIO2_ENST00000557125.1_Missense_Mutation_p.L15M	NM_000793.5|NM_001242502.1|NM_001242503.1	NP_000784.2|NP_001229431.1|NP_001229432.1	Q92813	IOD2_HUMAN	deiodinase, iodothyronine, type II	15					cellular nitrogen compound metabolic process (GO:0034641)|hormone biosynthetic process (GO:0042446)|selenocysteine incorporation (GO:0001514)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|thyroid hormone metabolic process (GO:0042403)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	selenium binding (GO:0008430)|thyroxine 5'-deiodinase activity (GO:0004800)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(14)|skin(1)|stomach(1)	25				BRCA - Breast invasive adenocarcinoma(234;0.0281)		AAAACTGGCAGAATTTGCAGT	0.532																																																	0													35.0	38.0	37.0					14																	80677773		2047	4175	6222	SO:0001583	missense	0			AF007144	CCDS45146.1, CCDS55934.1	14q24.2-q24.3	2014-05-02			ENSG00000211448	ENSG00000211448	1.97.1.10		2884	protein-coding gene	gene with protein product	"""thyroxine deiodinase, type II"", ""deiodonase-2"", ""deiodinase-2"""	601413				8755651, 10343107	Standard	NM_001007023		Approved	TXDI2, SelY	uc021rxb.1	Q92813	OTTHUMG00000171443	ENST00000557010.1:c.43C>A	14.37:g.80677773G>T	ENSP00000451419:p.Leu15Met		B9EGK0|G3V315|Q6B0A3|Q9HCP8|Q9P1W4|Q9UDZ1	Missense_Mutation	SNP	pfam_Iodothyronine_deiodinase	p.L15M	ENST00000557010.1	37	c.43	CCDS45146.1	14	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177315	0.38413	.	.	ENSG00000211448	ENST00000438257;ENST00000557010;ENST00000422005;ENST00000555750;ENST00000388838;ENST00000557125;ENST00000554188	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.7	4.81	0.61882	.	0.108239	0.38272	N	0.001757	T	0.58264	0.2110	M	0.84433	2.695	0.42677	D	0.993539	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;0.999;1.0	T	0.63773	-0.6561	10	0.87932	D	0	.	5.4515	0.16568	0.268:0.0:0.732:0.0	.	15;15;15;15	Q92813-2;Q92813;G3V315;A8K845	.;IOD2_HUMAN;.;.	M	15	ENSP00000405854:L15M;ENSP00000451419:L15M;ENSP00000411438:L15M;ENSP00000450980:L15M;ENSP00000451136:L15M	ENSP00000373490:L15M	L	-	1	2	DIO2	79747526	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.032000	0.57274	2.677000	0.91161	0.650000	0.86243	CTG	DIO2	-	pfam_Iodothyronine_deiodinase	ENSG00000211448		0.532	DIO2-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	DIO2	HGNC	protein_coding	OTTHUMT00000413428.2	-	0.00	24	0	G			80677773	-1	tier1	-	no_errors	ENST00000422005	ensembl	human	known	74_37	missense	30.61	34	15	SNP	1.000	T
DLGAP3	58512	genome.wustl.edu	37	1	35334318	35334318	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:35334318G>T	ENST00000373347.1	-	9	2641	c.2373C>A	c.(2371-2373)tgC>tgA	p.C791*	DLGAP3_ENST00000235180.4_Nonsense_Mutation_p.C791*			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	791					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CGTCGCGTGGGCAGGGGGATG	0.701																																																	0													38.0	38.0	38.0					1																	35334318		2203	4300	6503	SO:0001587	stop_gained	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.2373C>A	1.37:g.35334318G>T	ENSP00000362444:p.Cys791*		Q5TDD5|Q9H3X7	Nonsense_Mutation	SNP	pfam_GKAP	p.C791*	ENST00000373347.1	37	c.2373	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.162360	0.99085	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	.	.	.	5.09	3.14	0.36123	.	0.044560	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.2823	11.0265	0.47748	0.1572:0.0:0.8428:0.0	.	.	.	.	X	791	.	ENSP00000235180:C791X	C	-	3	2	DLGAP3	35106905	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.954000	0.56708	0.656000	0.30886	0.655000	0.94253	TGC	DLGAP3	-	pfam_GKAP	ENSG00000116544		0.701	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	-	0.00	31	0	G	NM_021234		35334318	-1	tier1	-	no_errors	ENST00000235180	ensembl	human	known	74_37	nonsense	36.36	7	4	SNP	1.000	T
DNAJC7	7266	genome.wustl.edu	37	17	40149135	40149135	+	Silent	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:40149135G>T	ENST00000457167.4	-	3	525	c.289C>A	c.(289-291)Cgg>Agg	p.R97R	DNAJC7_ENST00000426588.3_Silent_p.R41R|DNAJC7_ENST00000316603.7_Silent_p.R41R	NM_003315.3	NP_003306.3	Q99615	DNJC7_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 7	97					chaperone cofactor-dependent protein refolding (GO:0070389)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9		all_cancers(22;0.00273)|Breast(137;0.00104)|all_epithelial(22;0.0305)				ATACATACCCGGACAAAACTG	0.483																																					Colon(63;618 1117 8600 10857 19751)												0													108.0	102.0	104.0					17																	40149135		1958	4122	6080	SO:0001819	synonymous_variant	0			U46571	CCDS45677.1, CCDS45678.1	17q11.2	2013-01-10				ENSG00000168259		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	12392	protein-coding gene	gene with protein product		601964		TTC2		8836031, 11147971	Standard	NR_029431		Approved	TPR2	uc002hyo.3	Q99615		ENST00000457167.4:c.289C>A	17.37:g.40149135G>T			Q7Z784	Silent	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_TPR_repeat,smart_DnaJ_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R97	ENST00000457167.4	37	c.289	CCDS45677.1	17																																																																																			DNAJC7	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168259		0.483	DNAJC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC7	HGNC	protein_coding	OTTHUMT00000453366.2		0.00	46	0	G			40149135	-1			no_errors	ENST00000457167	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	T
DNM1P47	100216544	genome.wustl.edu	37	15	102304740	102304740	+	RNA	SNP	G	G	C	rs7169420		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr15:102304740G>C	ENST00000561463.1	+	0	12786									DNM1 pseudogene 47																		GAAGACACTCGTGGAGGAGTC	0.612																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304740G>C				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.612	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1		0.00	22	0	G	NG_009149		102304740	+1			no_errors	ENST00000561463	ensembl	human	known	74_37	rna	28.12	23	9	SNP	1.000	C
DYNC1H1	1778	genome.wustl.edu	37	14	102460527	102460527	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr14:102460527G>T	ENST00000360184.4	+	12	3186	c.3022G>T	c.(3022-3024)Gta>Tta	p.V1008L		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1008	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CTAGGTGGGTGTACATTACGA	0.403																																																	0													267.0	240.0	249.0					14																	102460527		2203	4300	6503	SO:0001583	missense	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.3022G>T	14.37:g.102460527G>T	ENSP00000348965:p.Val1008Leu		B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.V1008L	ENST00000360184.4	37	c.3022	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	11.37	1.617395	0.28801	.	.	ENSG00000197102	ENST00000360184	T	0.65364	-0.15	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.29620	0.0739	N	0.00471	-1.455	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.49844	-0.8896	10	0.02654	T	1	.	20.0011	0.97409	0.0:0.0:1.0:0.0	.	1008	Q14204	DYHC1_HUMAN	L	1008	ENSP00000348965:V1008L	ENSP00000348965:V1008L	V	+	1	0	DYNC1H1	101530280	1.000000	0.71417	0.975000	0.42487	0.991000	0.79684	9.826000	0.99387	2.735000	0.93741	0.557000	0.71058	GTA	DYNC1H1	-	NULL	ENSG00000197102		0.403	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	-	0.00	62	0	G	NM_001376		102460527	+1	tier1	-	no_errors	ENST00000360184	ensembl	human	known	74_37	missense	42.65	39	29	SNP	1.000	T
MUC3A	4584	genome.wustl.edu	37	7	100608573	100608573	+	Intron	SNP	G	G	C	rs10251415	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:100608573G>C	ENST00000319509.7	+	7	2107				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						AGGGTGCTGGGGGTGGCCTCC	0.617													G|||	2006	0.400559	0.2769	0.5692	5008	,	,		15156	0.5536		0.3449	False		,,,				2504	0.3476																0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2108-156G>C	7.37:g.100608573G>C			O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	SNP	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-	ENSG00000225946		0.617	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	-	0.00	17	0	G	XM_001725354		100608573	-1	tier1	rs10251415	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	35.48	20	11	SNP	0.000	C
RP11-13J8.1	0	genome.wustl.edu	37	2	201967217	201967218	+	lincRNA	DEL	AG	AG	-	rs371047928|rs368317583		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:201967217_201967218delAG	ENST00000448256.1	+	0	627_628																											aaaaaaaaaaagaaTTTGTTCT	0.46																																																	0																																												0																															2.37:g.201967217_201967218delAG				RNA	DEL	-	NULL	ENST00000448256.1	37	NULL		2																																																																																			RP11-13J8.1	-	-	ENSG00000232719		0.460	RP11-13J8.1-001	KNOWN	basic	lincRNA	ENSG00000232719	Clone_based_vega_gene	lincRNA	OTTHUMT00000347397.1		0.00	8	0	AG			201967218	+1			no_errors	ENST00000448256	ensembl	human	known	74_37	rna	33.33	4	2	DEL	0.405:0.966	0
CTB-114C7.4	0	genome.wustl.edu	37	5	169736910	169736910	+	lincRNA	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:169736910C>A	ENST00000511921.1	-	0	976																											ctgcagccagcaggccagTGG	0.587																																																	0																																												0																															5.37:g.169736910C>A				RNA	SNP	-	NULL	ENST00000511921.1	37	NULL		5																																																																																			CTB-114C7.4	-	-	ENSG00000250274		0.587	CTB-114C7.4-001	KNOWN	basic	lincRNA	ENSG00000250274	Clone_based_vega_gene	lincRNA	OTTHUMT00000371723.1	-	0.00	12	0	C			169736910	-1	tier1	-	no_errors	ENST00000511921	ensembl	human	known	74_37	rna	62.50	6	10	SNP	0.013	A
ITPR3	3710	genome.wustl.edu	37	6	33663453	33663453	+	Intron	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:33663453G>A	ENST00000374316.5	+	59	9007				SBP1_ENST00000594414.1_Missense_Mutation_p.P8S|MIR3934_ENST00000579806.1_RNA|ITPR3_ENST00000605930.1_Intron			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GTGCCAGGCGGCCTGACCAGG	0.637																																																	0													100.0	90.0	93.0					6																	33663453		2203	4300	6503	SO:0001627	intron_variant	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7948-36G>A	6.37:g.33663453G>A			Q14649|Q5TAQ2	Missense_Mutation	SNP	NULL	p.P8S	ENST00000374316.5	37	c.22	CCDS4783.1	6																																																																																			SBP1	-	NULL	ENSG00000269490		0.637	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269490	Uniprot_gn	protein_coding	OTTHUMT00000040204.2		0.00	22	0	G	NM_002224		33663453	-1			no_errors	ENST00000594414	ensembl	human	novel	74_37	missense	11.54	23	3	SNP	0.003	A
F9	2158	genome.wustl.edu	37	X	138643810	138643810	+	Silent	SNP	C	C	T	rs373107855		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chrX:138643810C>T	ENST00000218099.2	+	8	973	c.966C>T	c.(964-966)gaC>gaT	p.D322D	F9_ENST00000394090.2_Silent_p.D284D	NM_000133.3	NP_000124.1	P00740	FA9_HUMAN	coagulation factor IX	322	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|blood coagulation, intrinsic pathway (GO:0007597)|cellular protein metabolic process (GO:0044267)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|skin(1)	35	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Menadione(DB00170)	TGGAACTGGACGAACCCTTAG	0.408																																																	0								C		0,3835		0,0,0,1632,571	214.0	181.0	192.0		966	-6.8	0.0	X		192	1,6727		0,0,1,2428,1871	no	coding-synonymous	F9	NM_000133.3		0,0,1,4060,2442	TT,TC,T,CC,C		0.0149,0.0,0.0095		322/462	138643810	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	0			M11309	CCDS14666.1	Xq26.3-q27.1	2014-09-17	2008-08-01		ENSG00000101981	ENSG00000101981	3.4.21.22		3551	protein-coding gene	gene with protein product	"""Factor IX"", ""plasma thromboplastic component"", ""Christmas disease"", ""hemophilia B"""	300746					Standard	NM_000133		Approved	FIX	uc004fas.1	P00740	OTTHUMG00000022536	ENST00000218099.2:c.966C>T	X.37:g.138643810C>T			A8K9N4|F2RM36|Q5FBE1|Q5JYJ8	Silent	SNP	pfam_Peptidase_S1,pfam_GLA_domain,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Peptidase_S1,pirsf_Pept_S1A_FX,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_GLA_domain	p.D322	ENST00000218099.2	37	c.966	CCDS14666.1	X																																																																																			F9	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_FX,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000101981		0.408	F9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F9	HGNC	protein_coding	OTTHUMT00000058557.1	-	0.00	32	0	C			138643810	+1	tier1	-	no_errors	ENST00000218099	ensembl	human	known	74_37	silent	82.76	10	48	SNP	0.000	T
FAM230B	642633	genome.wustl.edu	37	22	21538350	21538350	+	RNA	SNP	G	G	C	rs376591786		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr22:21538350G>C	ENST00000451257.1	+	0	1336									family with sequence similarity 230, member B (non-protein coding)																		GCATCGCCAAGGAGGACGCCG	0.746																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538350G>C				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.746	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	-	0.00	39	0	G	NR_108107		21538350	+1	tier1	-	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	14.81	23	4	SNP	0.000	C
FLT1	2321	genome.wustl.edu	37	13	28959159	28959159	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr13:28959159G>T	ENST00000282397.4	-	14	2230	c.1979C>A	c.(1978-1980)gCa>gAa	p.A660E	FLT1_ENST00000541932.1_Missense_Mutation_p.A660E	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	660					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGGTATGGTGCTTCCTGATC	0.428																																																	0													194.0	173.0	180.0					13																	28959159		2203	4300	6503	SO:0001583	missense	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.1979C>A	13.37:g.28959159G>T	ENSP00000282397:p.Ala660Glu		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.A660E	ENST00000282397.4	37	c.1979	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661331	0.88154	.	.	ENSG00000102755	ENST00000282397;ENST00000541932	T;T	0.43294	0.95;2.49	5.59	5.59	0.84812	Immunoglobulin-like fold (1);	0.125321	0.52532	D	0.000065	T	0.65790	0.2725	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.94	T	0.62238	-0.6896	10	0.24483	T	0.36	.	17.7786	0.88517	0.0:0.0:1.0:0.0	.	660;660	P17948-3;P17948	.;VGFR1_HUMAN	E	660	ENSP00000282397:A660E;ENSP00000437631:A660E	ENSP00000282397:A660E	A	-	2	0	FLT1	27857159	1.000000	0.71417	0.962000	0.40283	0.906000	0.53458	8.119000	0.89579	2.630000	0.89119	0.563000	0.77884	GCA	FLT1	-	NULL	ENSG00000102755		0.428	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	-	0.00	58	0	G			28959159	-1	tier1	-	no_errors	ENST00000282397	ensembl	human	known	74_37	missense	8.06	57	5	SNP	0.999	T
GANAB	23193	genome.wustl.edu	37	11	62397743	62397743	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:62397743C>A	ENST00000356638.3	-	13	1535	c.1519G>T	c.(1519-1521)Gct>Tct	p.A507S	GANAB_ENST00000534422.1_5'Flank|GANAB_ENST00000534779.1_Missense_Mutation_p.A415S|GANAB_ENST00000540933.1_Missense_Mutation_p.A410S|GANAB_ENST00000346178.4_Missense_Mutation_p.A529S	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	507					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	GGGTAACCAGCTGAGCCTGGG	0.537																																					Melanoma(23;1005 1074 15747 18937)												0													76.0	66.0	69.0					11																	62397743		2202	4299	6501	SO:0001583	missense	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.1519G>T	11.37:g.62397743C>A	ENSP00000349053:p.Ala507Ser		A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom	p.A529S	ENST00000356638.3	37	c.1585	CCDS8026.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.650|2.650	-0.282232|-0.282232	0.05642|0.05642	.|.	.|.	ENSG00000089597|ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933|ENST00000540002	D;D;D;D|.	0.92595|.	-3.07;-3.07;-3.07;-3.07|.	5.2|5.2	5.2|5.2	0.72013|0.72013	Glycoside hydrolase, superfamily (1);|.	0.055010|.	0.64402|.	D|.	0.000001|.	T|T	0.38026|0.38026	0.1025|0.1025	N|N	0.02334|0.02334	-0.595|-0.595	0.46298|0.46298	D|D	0.998976|0.998976	B;B;B;B|.	0.10296|.	0.003;0.003;0.003;0.002|.	B;B;B;B|.	0.15052|.	0.012;0.012;0.012;0.007|.	T|T	0.53034|0.53034	-0.8495|-0.8495	10|6	0.02654|0.62326	T|D	1|0.03	-17.561|-17.561	16.2695|16.2695	0.82607|0.82607	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	393;415;507;529|.	B4DIW2;E9PKU7;Q14697;Q14697-2|.	.;.;GANAB_HUMAN;.|.	S|I	529;507;415;410|92	ENSP00000340466:A529S;ENSP00000349053:A507S;ENSP00000435306:A415S;ENSP00000442962:A410S|.	ENSP00000340466:A529S|ENSP00000439113:S92I	A|S	-|-	1|2	0|0	GANAB|GANAB	62154319|62154319	0.981000|0.981000	0.34729|0.34729	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	2.354000|2.354000	0.44098|0.44098	2.706000|2.706000	0.92434|0.92434	0.561000|0.561000	0.74099|0.74099	GCT|AGC	GANAB	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000089597		0.537	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	-	0.00	41	0	C	NM_198334		62397743	-1	tier1	-	no_errors	ENST00000346178	ensembl	human	known	74_37	missense	17.11	63	13	SNP	0.998	A
GPR98	84059	genome.wustl.edu	37	5	89981640	89981640	+	Silent	SNP	G	G	T	rs190981860	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:89981640G>T	ENST00000405460.2	+	29	6414	c.6318G>T	c.(6316-6318)gcG>gcT	p.A2106A		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2106					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.A2106A(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAACTATTGCGCAACTAATTA	0.413																																																	1	Substitution - coding silent(1)	central_nervous_system(1)											108.0	96.0	100.0					5																	89981640		1906	4125	6031	SO:0001819	synonymous_variant	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.6318G>T	5.37:g.89981640G>T			O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.A2106	ENST00000405460.2	37	c.6318	CCDS47246.1	5																																																																																			GPR98	-	NULL	ENSG00000164199		0.413	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2		0.00	29	0	G	NM_032119		89981640	+1			no_errors	ENST00000405460	ensembl	human	known	74_37	silent	9.09	20	2	SNP	0.815	T
GRID2IP	392862	genome.wustl.edu	37	7	6541473	6541473	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:6541473A>G	ENST00000457091.2	-	20	3337	c.3338T>C	c.(3337-3339)aTa>aCa	p.I1113T	GRID2IP_ENST00000435185.1_Missense_Mutation_p.I929T|GRID2IP_ENST00000452113.1_Missense_Mutation_p.I922T	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	1113	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGCATCCTGTATCTCGCTGAT	0.592																																																	0													58.0	57.0	57.0					7																	6541473		692	1591	2283	SO:0001583	missense	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.3338T>C	7.37:g.6541473A>G	ENSP00000397351:p.Ile1113Thr			Missense_Mutation	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.I1113T	ENST00000457091.2	37	c.3338	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	A	16.87	3.243350	0.58995	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.18174	2.23;2.23;2.23	4.85	4.85	0.62838	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	U	0.000000	T	0.39517	0.1081	M	0.78801	2.425	0.58432	D	0.999997	D	0.61697	0.99	D	0.64042	0.921	T	0.25882	-1.0119	10	0.54805	T	0.06	.	12.7266	0.57174	1.0:0.0:0.0:0.0	.	1113	A4D2P6	GRD2I_HUMAN	T	922;929;1113	ENSP00000397887:I922T;ENSP00000408364:I929T;ENSP00000397351:I1113T	ENSP00000408364:I929T	I	-	2	0	GRID2IP	6507998	1.000000	0.71417	0.989000	0.46669	0.791000	0.44710	6.636000	0.74299	2.165000	0.68154	0.533000	0.62120	ATA	GRID2IP	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000215045		0.592	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1		0.00	39	0	A	XM_294249		6541473	-1			no_errors	ENST00000457091	ensembl	human	putative	74_37	missense	9.30	39	4	SNP	0.986	G
GRIK4	2900	genome.wustl.edu	37	11	120831733	120831733	+	Missense_Mutation	SNP	G	G	A	rs139636929		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:120831733G>A	ENST00000527524.2	+	17	2277	c.1990G>A	c.(1990-1992)Gcc>Acc	p.A664T	GRIK4_ENST00000438375.2_Missense_Mutation_p.A664T	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	664					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		TGACCAGACCGCCATTGAATA	0.532													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20033	0.0		0.0	False		,,,				2504	0.0																0								G	THR/ALA	6,4400	11.4+/-27.6	0,6,2197	118.0	99.0	105.0		1990	3.7	1.0	11	dbSNP_134	105	0,8598		0,0,4299	yes	missense	GRIK4	NM_014619.2	58	0,6,6496	AA,AG,GG		0.0,0.1362,0.0461	benign	664/957	120831733	6,12998	2203	4299	6502	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1990G>A	11.37:g.120831733G>A	ENSP00000435648:p.Ala664Thr		A8K9L1	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A664T	ENST00000527524.2	37	c.1990	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	14.42	2.528608	0.44969	0.001362	0.0	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.11277	2.79;2.79	5.51	3.66	0.41972	Ionotropic glutamate receptor (2);	0.270482	0.42172	N	0.000747	T	0.05456	0.0144	N	0.05012	-0.13	0.35910	D	0.831013	B;B	0.16603	0.018;0.018	B;B	0.20955	0.032;0.032	T	0.26018	-1.0115	10	0.45353	T	0.12	.	8.4365	0.32791	0.3017:0.0:0.6983:0.0	.	664;664	A6H8K8;Q16099	.;GRIK4_HUMAN	T	664	ENSP00000435648:A664T;ENSP00000404063:A664T	ENSP00000404063:A664T	A	+	1	0	GRIK4	120336943	0.906000	0.30813	0.987000	0.45799	0.999000	0.98932	1.455000	0.35190	0.707000	0.31934	0.655000	0.94253	GCC	GRIK4	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000149403		0.532	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	-	0.00	53	0	G	NM_014619		120831733	+1	tier1	rs139636929	no_errors	ENST00000527524	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.628	A
GUSBP2	387036	genome.wustl.edu	37	6	26856948	26856948	+	RNA	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:26856948C>A	ENST00000463434.1	-	0	122									glucuronidase, beta pseudogene 2																		GGTTACTGCACTTGACGGAGA	0.542																																																	0																																												0					6p21	2011-06-09	2011-06-09	2011-06-09	ENSG00000241549	ENSG00000241549			18792	pseudogene	pseudogene			"""spinal muscular atrophy candidate gene 3-like 2"", ""glucuronidase, beta-like 1"""	SMAC3L2, GUSBL1			Standard	NR_003504		Approved	bA239L20.5, bA239L20.1, SMA3-L, bGLU-Lp, SMAC3L	uc003nim.2		OTTHUMG00000014462		6.37:g.26856948C>A				RNA	SNP	-	NULL	ENST00000463434.1	37	NULL		6																																																																																			GUSBP2	-	-	ENSG00000241549		0.542	GUSBP2-003	KNOWN	basic	processed_transcript	GUSBP2	HGNC	pseudogene	OTTHUMT00000314060.1	-	0.00	106	0	C			26856948	-1	tier1	-	no_errors	ENST00000463434	ensembl	human	known	74_37	rna	23.31	102	31	SNP	0.501	A
GTPBP2	54676	genome.wustl.edu	37	6	43588707	43588707	+	3'UTR	SNP	G	G	A	rs530455578		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:43588707G>A	ENST00000307126.5	-	0	2452				GTPBP2_ENST00000476510.1_5'UTR	NM_019096.3	NP_061969.3			GTP binding protein 2											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			CCTATAAGCCGGGAGGGGATG	0.582													g|||	1	0.000199681	0.0	0.0	5008	,	,		18827	0.0		0.001	False		,,,				2504	0.0				GBM(116;405 1620 28302 32150 44768)												0																																										SO:0001624	3_prime_UTR_variant	0			AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.*644C>T	6.37:g.43588707G>A				RNA	SNP	-	NULL	ENST00000307126.5	37	NULL	CCDS4903.1	6																																																																																			GTPBP2	-	-	ENSG00000172432		0.582	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP2	HGNC	protein_coding	OTTHUMT00000040679.1	-	0.00	22	0	G			43588707	-1	tier1	-	no_errors	ENST00000476510	ensembl	human	known	74_37	rna	39.29	17	11	SNP	0.154	A
HDAC4	9759	genome.wustl.edu	37	2	240016733	240016733	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:240016733G>T	ENST00000345617.3	-	17	3029	c.2238C>A	c.(2236-2238)ttC>ttA	p.F746L	HDAC4_ENST00000541256.1_Missense_Mutation_p.F720L|HDAC4_ENST00000543185.1_Missense_Mutation_p.F330L	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	746	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGAGCCGGACGAACACGGAGG	0.612																																																	0													77.0	85.0	82.0					2																	240016733		2203	4300	6503	SO:0001583	missense	0			AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.2238C>A	2.37:g.240016733G>T	ENSP00000264606:p.Phe746Leu		Q9UND6	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pfam_Arb2_domain,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.F746L	ENST00000345617.3	37	c.2238	CCDS2529.1	2	.	.	.	.	.	.	.	.	.	.	G	8.926	0.962203	0.18583	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65364	0.22;-0.15;0.73	4.46	-8.93	0.00771	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.65207	0.2669	L	0.48935	1.535	0.40990	D	0.984848	D;B;B;B;B;B	0.54601	0.967;0.222;0.013;0.014;0.016;0.2	P;B;B;B;B;B	0.58577	0.841;0.094;0.016;0.005;0.037;0.146	T	0.79305	-0.1858	10	0.56958	D	0.05	.	20.7024	0.99706	0.2754:0.0:0.7246:0.0	.	746;629;720;720;714;746	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	L	746;634;330;720;629	ENSP00000264606:F746L;ENSP00000440481:F330L;ENSP00000443057:F720L	ENSP00000264606:F746L	F	-	3	2	HDAC4	239681670	0.411000	0.25384	0.125000	0.21846	0.040000	0.13550	-0.171000	0.09883	-2.355000	0.00614	-0.768000	0.03414	TTC	HDAC4	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000068024		0.612	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC4	HGNC	protein_coding	OTTHUMT00000257174.2	-	0.00	45	0	G	NM_006037		240016733	-1	tier1	-	no_errors	ENST00000345617	ensembl	human	known	74_37	missense	9.84	54	6	SNP	0.191	T
HID1	283987	genome.wustl.edu	37	17	72958339	72958339	+	Missense_Mutation	SNP	C	C	A	rs141799560		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:72958339C>A	ENST00000425042.2	-	5	678	c.601G>T	c.(601-603)Gat>Tat	p.D201Y	HID1_ENST00000532900.1_5'Flank	NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	201					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											CGGTTCATATCGTGGATGTAG	0.647																																																	0													46.0	48.0	48.0					17																	72958339		2203	4300	6503	SO:0001583	missense	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.601G>T	17.37:g.72958339C>A	ENSP00000413520:p.Asp201Tyr		Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	pfam_Dymeclin	p.D201Y	ENST00000425042.2	37	c.601	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	C	18.48	3.633855	0.67130	.	.	ENSG00000167861	ENST00000425042;ENST00000530857	.	.	.	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.75961	0.3921	M	0.79343	2.45	0.80722	D	1	B;P	0.36599	0.183;0.56	B;P	0.45998	0.275;0.5	T	0.78894	-0.2024	9	0.52906	T	0.07	.	17.5269	0.87803	0.0:1.0:0.0:0.0	.	200;201	Q8IV36-2;Q8IV36	.;CQ028_HUMAN	Y	201;93	.	ENSP00000413520:D201Y	D	-	1	0	C17orf28	70469934	1.000000	0.71417	0.999000	0.59377	0.438000	0.31896	7.811000	0.86092	2.150000	0.67090	0.313000	0.20887	GAT	HID1	-	NULL	ENSG00000167861		0.647	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HID1	HGNC	protein_coding	OTTHUMT00000390011.2	-	0.00	33	0	C	NM_030630		72958339	-1	tier1	-	no_errors	ENST00000425042	ensembl	human	known	74_37	missense	61.29	12	19	SNP	1.000	A
HMGN5	79366	genome.wustl.edu	37	X	80371790	80371790	+	Silent	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chrX:80371790G>T	ENST00000358130.2	-	6	508	c.180C>A	c.(178-180)gcC>gcA	p.A60A	HMGN5_ENST00000491275.1_5'UTR	NM_030763.2	NP_110390.1	P82970	HMGN5_HUMAN	high mobility group nucleosome binding domain 5	60					chromatin modification (GO:0016568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.A60A(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	10						CAACTGCTTGGGCACTTGTAT	0.328																																																	2	Substitution - coding silent(2)	endometrium(2)											148.0	113.0	125.0					X																	80371790		2203	4297	6500	SO:0001819	synonymous_variant	0			AF250329	CCDS14448.1	Xq13.3	2011-07-01	2011-04-05	2009-09-15	ENSG00000198157	ENSG00000198157		"""High-mobility group / Canonical"""	8013	protein-coding gene	gene with protein product		300385	"""nucleosomal binding protein 1"", ""high-mobility group nucleosome binding domain 5"""	NSBP1		11161810, 19748358	Standard	NM_030763		Approved		uc004eee.1	P82970	OTTHUMG00000021911	ENST00000358130.2:c.180C>A	X.37:g.80371790G>T			Q5JSL1	Silent	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.A60	ENST00000358130.2	37	c.180	CCDS14448.1	X																																																																																			HMGN5	-	pfam_HMGN_fam,smart_HMGN_fam	ENSG00000198157		0.328	HMGN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN5	HGNC	protein_coding	OTTHUMT00000057354.1	-	0.00	22	0	G	NM_030763		80371790	-1	tier1	-	no_errors	ENST00000358130	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.020	T
IL12RB2	3595	genome.wustl.edu	37	1	67855810	67855810	+	Splice_Site	DEL	A	A	-			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:67855810delA	ENST00000262345.1	+	15	2685	c.2045delA	c.(2044-2046)gag>gg	p.E683fs	IL12RB2_ENST00000371000.1_Intron|IL12RB2_ENST00000465396.1_3'UTR|IL12RB2_ENST00000544434.1_Splice_Site_p.E597fs|IL12RB2_ENST00000541374.1_Intron	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	683					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CCCATTGCAGAGGTAAGGTAC	0.473																																																	0													92.0	80.0	84.0					1																	67855810		2203	4300	6503	SO:0001630	splice_region_variant	0			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.2046+1A>-	1.37:g.67855810delA			B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E682fs	ENST00000262345.1	37	c.2045	CCDS638.1	1																																																																																			IL12RB2	-	NULL	ENSG00000081985		0.473	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2		0.00	39	0	A	NM_001559	Frame_Shift_Del	67855810	+1	tier1		no_errors	ENST00000262345	ensembl	human	known	74_37	frame_shift_del	10.42	43	5	DEL	1.000	-
KCTD21	283219	genome.wustl.edu	37	11	77885236	77885236	+	Missense_Mutation	SNP	G	G	A	rs370613583		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:77885236G>A	ENST00000340067.3	-	2	643	c.365C>T	c.(364-366)aCg>aTg	p.T122M	KCTD21-AS1_ENST00000523626.2_RNA|KCTD21-AS1_ENST00000528468.1_RNA|KCTD21-AS1_ENST00000530261.1_RNA|KCTD21-AS1_ENST00000600795.1_RNA	NM_001029859.1	NP_001025030.1	Q4G0X4	KCD21_HUMAN	potassium channel tetramerization domain containing 21	122					protein homooligomerization (GO:0051260)			p.T122M(1)		breast(1)|endometrium(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(2)	11	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			GAAGTGGACCGTCTGCACACG	0.577																																																	1	Substitution - Missense(1)	endometrium(1)											140.0	110.0	120.0					11																	77885236		2200	4292	6492	SO:0001583	missense	0			AK095233	CCDS31645.1	11q14.1	2013-06-20	2013-06-20			ENSG00000188997			27452	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 21"""			21472142	Standard	XM_005273925		Approved	KCASH2	uc001ozb.3	Q4G0X4		ENST00000340067.3:c.365C>T	11.37:g.77885236G>A	ENSP00000339340:p.Thr122Met		B4DTR0	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.T122M	ENST00000340067.3	37	c.365	CCDS31645.1	11	.	.	.	.	.	.	.	.	.	.	G	10.57	1.388055	0.25118	.	.	ENSG00000188997	ENST00000340067;ENST00000526208;ENST00000525447	T;T;T	0.54071	0.59;0.62;0.64	6.03	3.99	0.46301	.	0.108319	0.40728	N	0.001028	T	0.29223	0.0727	N	0.08118	0	0.26372	N	0.976876	B	0.06786	0.001	B	0.04013	0.001	T	0.12528	-1.0544	10	0.33940	T	0.23	.	8.6303	0.33915	0.1426:0.0:0.7232:0.1343	.	122	Q4G0X4	KCD21_HUMAN	M	122	ENSP00000339340:T122M;ENSP00000431789:T122M;ENSP00000434174:T122M	ENSP00000339340:T122M	T	-	2	0	KCTD21	77562884	1.000000	0.71417	0.930000	0.37139	0.955000	0.61496	3.267000	0.51577	1.558000	0.49541	0.655000	0.94253	ACG	KCTD21	-	NULL	ENSG00000188997		0.577	KCTD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD21	HGNC	protein_coding	OTTHUMT00000390057.1	-	0.00	28	0	G	NM_001029859		77885236	-1	tier1	-	no_errors	ENST00000340067	ensembl	human	known	74_37	missense	20.00	36	9	SNP	0.446	A
KIF3A	11127	genome.wustl.edu	37	5	132035914	132035914	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:132035914C>A	ENST00000378746.4	-	15	2138	c.1920G>T	c.(1918-1920)gaG>gaT	p.E640D	KIF3A_ENST00000378735.1_Missense_Mutation_p.E643D|AC004237.1_ENST00000431165.1_RNA|KIF3A_ENST00000487055.1_5'Flank|KIF3A_ENST00000403231.1_Missense_Mutation_p.E667D	NM_007054.5	NP_008985.3	Q9Y496	KIF3A_HUMAN	kinesin family member 3A	640					anterior/posterior pattern specification (GO:0009952)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|dorsal/ventral neural tube patterning (GO:0021904)|epidermal stem cell homeostasis (GO:0036334)|epidermis development (GO:0008544)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|inner ear receptor stereocilium organization (GO:0060122)|kidney development (GO:0001822)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|organelle organization (GO:0006996)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of receptor-mediated endocytosis (GO:0048260)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|spectrin binding (GO:0030507)			endometrium(1)|kidney(4)|large_intestine(8)|lung(3)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	25		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TTACATCTTTCTCCTTTTTAT	0.299																																																	0													87.0	77.0	80.0					5																	132035914		2202	4300	6502	SO:0001583	missense	0			AF041853	CCDS34235.1, CCDS75295.1, CCDS75296.1	5q31	2012-08-01			ENSG00000131437	ENSG00000131437		"""Kinesins"""	6319	protein-coding gene	gene with protein product	"""kinesin family protein 3A"""	604683				1054846	Standard	XM_005271868		Approved	FLA10, KLP-20	uc003kxo.3	Q9Y496	OTTHUMG00000059725	ENST00000378746.4:c.1920G>T	5.37:g.132035914C>A	ENSP00000368020:p.Glu640Asp		A8MSW9|Q59EN1|Q86XE9|Q9Y6V4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E643D	ENST00000378746.4	37	c.1929	CCDS34235.1	5	.	.	.	.	.	.	.	.	.	.	C	8.785	0.929220	0.18131	.	.	ENSG00000131437	ENST00000378746;ENST00000378735;ENST00000541316;ENST00000450441;ENST00000403231	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	5.92	3.11	0.35812	.	0.000000	0.85682	D	0.000000	T	0.13670	0.0331	N	0.24115	0.695	0.58432	D	0.999994	P;P;P;P	0.52842	0.956;0.956;0.956;0.956	P;P;P;P	0.62184	0.899;0.899;0.899;0.899	T	0.14615	-1.0466	10	0.13108	T	0.6	.	9.8773	0.41211	0.0:0.605:0.0:0.395	.	667;667;640;666	E9PES4;B4DHG8;Q9Y496;Q2UVF2	.;.;KIF3A_HUMAN;.	D	640;643;667;126;667	ENSP00000368020:E640D;ENSP00000368009:E643D;ENSP00000405619:E126D;ENSP00000385808:E667D	ENSP00000368009:E643D	E	-	3	2	KIF3A	132063813	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.215000	0.32431	0.799000	0.34018	-0.137000	0.14449	GAG	KIF3A	-	NULL	ENSG00000131437		0.299	KIF3A-001	KNOWN	basic|CCDS	protein_coding	KIF3A	HGNC	protein_coding	OTTHUMT00000132788.3	-	0.00	11	0	C	NM_007054		132035914	-1	tier1	-	no_errors	ENST00000378735	ensembl	human	known	74_37	missense	45.00	11	9	SNP	1.000	A
KPNB1	3837	genome.wustl.edu	37	17	45750492	45750492	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:45750492G>T	ENST00000290158.4	+	13	2063	c.1656G>T	c.(1654-1656)ttG>ttT	p.L552F	KPNB1_ENST00000535458.2_Missense_Mutation_p.L407F|KPNB1_ENST00000540627.1_Missense_Mutation_p.L407F|KPNB1_ENST00000537679.1_Missense_Mutation_p.L336F	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	552					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L552F(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						AAACGACTTTGGTCATCATGG	0.463																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	119.0	121.0					17																	45750492		2203	4300	6503	SO:0001583	missense	0			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1656G>T	17.37:g.45750492G>T	ENSP00000290158:p.Leu552Phe		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.L552F	ENST00000290158.4	37	c.1656	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085870	0.36758	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.52	-2.18	0.07037	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.52805	0.1757	L	0.50333	1.59	0.38797	D	0.955109	P;P	0.46784	0.884;0.776	B;B	0.40782	0.34;0.198	T	0.60301	-0.7290	9	0.56958	D	0.05	-16.5928	7.3697	0.26794	0.4933:0.1129:0.3938:0.0	.	336;552	F5H4R7;Q14974	.;IMB1_HUMAN	F	407;552;407;336	ENSP00000438253:L407F;ENSP00000290158:L552F;ENSP00000438964:L407F;ENSP00000445006:L336F	ENSP00000290158:L552F	L	+	3	2	KPNB1	43105491	1.000000	0.71417	0.930000	0.37139	0.990000	0.78478	1.490000	0.35573	-0.010000	0.14271	0.655000	0.94253	TTG	KPNB1	-	superfamily_ARM-type_fold	ENSG00000108424		0.463	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	-	0.00	52	0	G	NM_002265		45750492	+1	tier1	-	no_errors	ENST00000290158	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.952	T
LAMA2	3908	genome.wustl.edu	37	6	129785573	129785573	+	Silent	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:129785573G>T	ENST00000421865.2	+	50	7180	c.7131G>T	c.(7129-7131)ctG>ctT	p.L2377L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2377	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)	p.L2377L(1)		NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTGCTCTTCTGATGTATCTTG	0.423																																																	1	Substitution - coding silent(1)	breast(1)											257.0	212.0	227.0					6																	129785573		2203	4300	6503	SO:0001819	synonymous_variant	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7131G>T	6.37:g.129785573G>T			Q14736|Q5VUM2|Q93022	Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.L2377	ENST00000421865.2	37	c.7131	CCDS5138.1	6																																																																																			LAMA2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000196569		0.423	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	44	0	G			129785573	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	silent	6.90	54	4	SNP	1.000	T
LINC00623	728855	genome.wustl.edu	37	1	149581062	149581063	+	RNA	INS	-	-	A	rs200727473		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:149581062_149581063insA	ENST00000598569.1	+	0	539_540																											TTTGTAAAAAGAAAAAAAAAAA	0.272																																																	0																																												0																															1.37:g.149581073_149581073dupA				RNA	INS	-	NULL	ENST00000598569.1	37	NULL		1																																																																																			RP11-353N4.6	-	-	ENSG00000269501		0.272	RP11-353N4.6-002	KNOWN	basic	processed_transcript	LINC00623	Clone_based_vega_gene	pseudogene	OTTHUMT00000462966.1		0.00	29	0	0			149581063	+1			no_errors	ENST00000598569	ensembl	human	known	74_37	rna	13.95	37	6	INS	0.000:0.000	A
ZEB1	6935	genome.wustl.edu	37	10	31652033	31652033	+	Intron	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr10:31652033T>A	ENST00000320985.10	+	1	168				RP11-192P3.5_ENST00000607134.1_RNA|ZEB1_ENST00000559858.1_Intron|RP11-192P3.5_ENST00000359888.2_RNA|ZEB1_ENST00000446923.2_Intron|ZEB1_ENST00000542815.3_Intron|ZEB1_ENST00000560721.2_Intron|ZEB1_ENST00000361642.5_Intron			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1						cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				CCGGCAGCTCTGGGTGGAGAA	0.607																																					Ovarian(40;423 959 14296 36701 49589)												0																																										SO:0001627	intron_variant	0			AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.58+43812T>A	10.37:g.31652033T>A			B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	RNA	SNP	-	NULL	ENST00000320985.10	37	NULL	CCDS7169.1	10	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023379	0.54683	.	.	ENSG00000196960	ENST00000359888	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	241	.	ENSP00000352954:R241X	R	-	1	2	AL117340.1	31692039	0.209000	0.23505	0.105000	0.21289	0.106000	0.19336	0.567000	0.23608	0.077000	0.16863	0.076000	0.15429	AGA	RP11-192P3.5	-	-	ENSG00000196960		0.607	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100505502	Clone_based_vega_gene	protein_coding	OTTHUMT00000419083.2	-	0.00	77	0	T	NM_030751		31652033	-1	tier1	-	no_errors	ENST00000359888	ensembl	human	known	74_37	rna	15.69	85	16	SNP	0.109	A
LOC643733	643733	genome.wustl.edu	37	11	104779414	104779415	+	RNA	INS	-	-	CA	rs111659193|rs369096286|rs67326622|rs58526794	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:104779414_104779415insCA	ENST00000532510.1	-	0	17_18																											ATTTTTTGCATcacacacacac	0.351																																																	0																																												0																															11.37:g.104779423_104779424dupCA				RNA	INS	-	NULL	ENST00000532510.1	37	NULL		11																																																																																			RP11-693N9.2	-	-	ENSG00000235505		0.351	RP11-693N9.2-004	KNOWN	basic	processed_transcript	LOC643733	Clone_based_vega_gene	pseudogene	OTTHUMT00000387738.1		0.00	10	0	-			104779415	-1	tier1		no_errors	ENST00000530264	ensembl	human	known	74_37	rna	12.50	21	3	INS	0.000:0.000	CA
LOC645166	645166	genome.wustl.edu	37	2	91824935	91824935	+	RNA	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:91824935C>A	ENST00000609777.1	-	0	199																											GAGGTCATTGCAgaaggagag	0.517																																																	0																																												0																															2.37:g.91824935C>A				RNA	SNP	-	NULL	ENST00000609777.1	37	NULL		2																																																																																			AC027612.6	-	-	ENSG00000143429		0.517	AC027612.6-002	KNOWN	basic	processed_transcript	LOC654342	Clone_based_vega_gene	pseudogene	OTTHUMT00000471986.1	-	0.00	104	0	C			91824935	-1	tier1	-	no_errors	ENST00000608018	ensembl	human	known	74_37	rna	10.49	145	17	SNP	0.000	A
LPAL2	80350	genome.wustl.edu	37	6	160887988	160887988	+	RNA	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:160887988C>T	ENST00000335388.5	-	0	2041					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		CTTGGCGTGGCGTCCCAGTAA	0.483																																																	0																																												0			U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160887988C>T			E1P5B4	RNA	SNP	-	NULL	ENST00000335388.5	37	NULL		6																																																																																			LPAL2	-	-	ENSG00000213071		0.483	LPAL2-003	KNOWN	basic	processed_transcript	LPAL2	HGNC	pseudogene	OTTHUMT00000042950.1	-	0.00	78	0	C	NM_024492		160887988	-1	tier1	-	no_errors	ENST00000435757	ensembl	human	known	74_37	rna	15.79	63	12	SNP	0.001	T
LRGUK	136332	genome.wustl.edu	37	7	133833054	133833054	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:133833054A>C	ENST00000285928.2	+	5	721	c.652A>C	c.(652-654)Act>Cct	p.T218P		NM_144648.1	NP_653249.1	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain containing	218						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)			breast(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	49						TCATGCTCTCACTAAACTAAT	0.289																																																	0													64.0	64.0	64.0					7																	133833054		2202	4298	6500	SO:0001583	missense	0			AK057348	CCDS5830.1	7q33	2006-10-27			ENSG00000155530	ENSG00000155530			21964	protein-coding gene	gene with protein product							Standard	NM_144648		Approved	FLJ32786	uc003vrm.1	Q96M69	OTTHUMG00000155320	ENST00000285928.2:c.652A>C	7.37:g.133833054A>C	ENSP00000285928:p.Thr218Pro		Q2M3I1	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like	p.T218P	ENST00000285928.2	37	c.652	CCDS5830.1	7	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682750	0.47991	.	.	ENSG00000155530	ENST00000285928	T	0.26957	1.7	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.54029	0.1833	M	0.84773	2.715	0.48511	D	0.999663	D	0.69078	0.997	D	0.65010	0.931	T	0.61004	-0.7150	10	0.66056	D	0.02	-20.1702	15.1689	0.72854	1.0:0.0:0.0:0.0	.	218	Q96M69	LRGUK_HUMAN	P	218	ENSP00000285928:T218P	ENSP00000285928:T218P	T	+	1	0	LRGUK	133483594	0.994000	0.37717	1.000000	0.80357	0.099000	0.18886	7.071000	0.76770	2.227000	0.72691	0.454000	0.30748	ACT	LRGUK	-	NULL	ENSG00000155530		0.289	LRGUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRGUK	HGNC	protein_coding	OTTHUMT00000339442.1	-	0.00	17	0	A	NM_144648		133833054	+1	tier1	-	no_errors	ENST00000285928	ensembl	human	known	74_37	missense	33.33	12	6	SNP	1.000	C
LRIT3	345193	genome.wustl.edu	37	4	110789009	110789009	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr4:110789009G>T	ENST00000594814.1	+	3	802	c.802G>T	c.(802-804)Ggc>Tgc	p.G268C	LRIT3_ENST00000327908.3_Missense_Mutation_p.G85C|LRIT3_ENST00000409621.2_Missense_Mutation_p.G85C|LRIT3_ENST00000379920.3_Missense_Mutation_p.G223C	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	268	Ig-like.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		GTCTGCTCTGGGCAGTAATGT	0.493																																																	0													116.0	106.0	109.0					4																	110789009		2203	4300	6503	SO:0001583	missense	0			AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.802G>T	4.37:g.110789009G>T	ENSP00000469759:p.Gly268Cys		C9J1C2|Q6ZTG1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G268C	ENST00000594814.1	37	c.802	CCDS3688.3	4	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903105	0.92035	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	D;D;D	0.81499	-1.5;-1.5;-1.5	5.88	5.88	0.94601	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94873	0.8343	H	0.99074	4.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96522	0.9386	10	0.87932	D	0	.	20.2228	0.98330	0.0:0.0:1.0:0.0	.	223;85	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	C	85;223;85	ENSP00000328222:G85C;ENSP00000369252:G223C;ENSP00000386734:G85C	ENSP00000328222:G85C	G	+	1	0	LRIT3	111008458	1.000000	0.71417	0.977000	0.42913	0.953000	0.61014	9.476000	0.97823	2.789000	0.95967	0.655000	0.94253	GGC	LRIT3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000183423		0.493	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT3	HGNC	protein_coding	OTTHUMT00000335270.2	-	0.00	32	0	G	NM_198506		110789009	+1	tier1	-	no_errors	ENST00000594814	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170030640	170030640	+	Silent	SNP	G	G	A	rs370876114		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:170030640G>A	ENST00000263816.3	-	56	11088	c.10803C>T	c.(10801-10803)tgC>tgT	p.C3601C		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3601	LDL-receptor class A 28. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.C3601C(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTTTGTTGGCGCACTGCCATT	0.478																																																	1	Substitution - coding silent(1)	breast(1)						A		0,4406		0,0,2203	97.0	81.0	86.0		10803	-4.9	0.9	2		86	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	LRP2	NM_004525.2		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		3601/4656	170030640	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.10803C>T	2.37:g.170030640G>A			O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.C3601	ENST00000263816.3	37	c.10803	CCDS2232.1	2																																																																																			LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.478	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	44	0	G	NM_004525		170030640	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	silent	28.42	68	27	SNP	0.975	A
LRRC7	57554	genome.wustl.edu	37	1	70504428	70504428	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:70504428T>A	ENST00000035383.5	+	19	2837	c.2807T>A	c.(2806-2808)aTg>aAg	p.M936K	LRRC7_ENST00000415775.2_Missense_Mutation_p.M220K|LRRC7_ENST00000310961.5_Missense_Mutation_p.M941K	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	936						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCCCCCCTAATGAAAGATATC	0.363																																																	0													56.0	57.0	56.0					1																	70504428		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2807T>A	1.37:g.70504428T>A	ENSP00000035383:p.Met936Lys		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.M936K	ENST00000035383.5	37	c.2807	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.209417	0.39003	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000415775;ENST00000370957	T;T;T	0.37058	1.22;1.3;2.39	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.36220	0.0959	L	0.32530	0.975	0.58432	D	0.999999	D;D;D	0.58970	0.977;0.984;0.973	P;D;D	0.69479	0.735;0.964;0.921	T	0.10154	-1.0642	10	0.28530	T	0.3	.	15.0844	0.72138	0.0:0.0:0.0:1.0	.	220;936;936	F8WE45;Q96NW7-2;Q96NW7	.;.;LRRC7_HUMAN	K	941;936;220;759	ENSP00000309245:M941K;ENSP00000035383:M936K;ENSP00000394867:M220K	ENSP00000035383:M936K	M	+	2	0	LRRC7	70277016	1.000000	0.71417	0.997000	0.53966	0.102000	0.19082	7.477000	0.81069	2.169000	0.68431	0.383000	0.25322	ATG	LRRC7	-	NULL	ENSG00000033122		0.363	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	20	0	T	NM_020794		70504428	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	A
LRTM2	654429	genome.wustl.edu	37	12	1944589	1944590	+	3'UTR	DEL	AC	AC	-	rs372477361		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:1944589_1944590delAC	ENST00000543818.1	+	0	2657_2658				LRTM2_ENST00000299194.1_3'UTR|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585708.1_Intron|LRTM2_ENST00000535041.1_3'UTR|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000588077.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2							integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			AAGAATTAATacacacacacac	0.525																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.*703AC>-	12.37:g.1944599_1944600delAC			A7E2U6	RNA	DEL	-	NULL	ENST00000543818.1	37	NULL	CCDS31726.1	12																																																																																			LRTM2	-	-	ENSG00000166159		0.525	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1		0.00	8	0	AC			1944590	+1	tier1		no_errors	ENST00000543730	ensembl	human	putative	74_37	rna	33.33	4	2	DEL	0.001:0.002	-
LYPLA1	10434	genome.wustl.edu	37	8	54965225	54965225	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr8:54965225G>A	ENST00000316963.3	-	7	645	c.452C>T	c.(451-453)tCc>tTc	p.S151F	LYPLA1_ENST00000519926.1_5'Flank|LYPLA1_ENST00000522007.1_Intron|LYPLA1_ENST00000343231.6_Missense_Mutation_p.S135F	NM_001279360.1|NM_006330.2	NP_001266289.1|NP_006321.1	O75608	LYPA1_HUMAN	lysophospholipase I	151					fatty acid metabolic process (GO:0006631)|negative regulation of Golgi to plasma membrane protein transport (GO:0042997)|nitric oxide metabolic process (GO:0046209)|protein depalmitoylation (GO:0002084)|regulation of nitric-oxide synthase activity (GO:0050999)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	lysophospholipase activity (GO:0004622)|palmitoyl-(protein) hydrolase activity (GO:0008474)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)	6		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;8.48e-07)|Epithelial(17;9.29e-05)|all cancers(17;0.000689)			CTGTGGAAAGGAAGCCCGAAG	0.418																																																	0													66.0	60.0	62.0					8																	54965225		2203	4300	6503	SO:0001583	missense	0			AF081281	CCDS6157.1, CCDS64899.1, CCDS75738.1, CCDS75739.1	8q11.23-q12.1	2008-05-15			ENSG00000120992	ENSG00000120992	3.1.1.5		6737	protein-coding gene	gene with protein product		605599				10064899	Standard	NM_006330		Approved	LPL1	uc003xry.3	O75608	OTTHUMG00000164313	ENST00000316963.3:c.452C>T	8.37:g.54965225G>A	ENSP00000320043:p.Ser151Phe		O43202|Q9UQF9	Missense_Mutation	SNP	pfam_PLipase/COase/thioEstase,pfam_AB_hydrolase_3	p.S151F	ENST00000316963.3	37	c.452	CCDS6157.1	8	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598495	0.66332	.	.	ENSG00000120992	ENST00000316963;ENST00000343231;ENST00000521171;ENST00000518546;ENST00000521352	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	4.88	4.88	0.63580	Phospholipase/carboxylesterase/thioesterase (1);	0.000000	0.85682	D	0.000000	T	0.40145	0.1105	L	0.55990	1.75	0.80722	D	1	P;P	0.43392	0.805;0.668	P;P	0.50970	0.655;0.507	T	0.26608	-1.0098	10	0.66056	D	0.02	-3.5077	18.0108	0.89222	0.0:0.0:1.0:0.0	.	135;151	O75608-2;O75608	.;LYPA1_HUMAN	F	151;135;60;135;87	ENSP00000320043:S151F;ENSP00000344477:S135F;ENSP00000428729:S135F;ENSP00000428306:S87F	ENSP00000320043:S151F	S	-	2	0	LYPLA1	55127778	1.000000	0.71417	0.627000	0.29227	0.493000	0.33554	9.472000	0.97709	2.414000	0.81942	0.650000	0.86243	TCC	LYPLA1	-	pfam_PLipase/COase/thioEstase	ENSG00000120992		0.418	LYPLA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPLA1	HGNC	protein_coding	OTTHUMT00000378238.1	-	0.00	16	0	G			54965225	-1	tier1	-	no_errors	ENST00000316963	ensembl	human	known	74_37	missense	28.12	23	9	SNP	0.998	A
LZTR1	8216	genome.wustl.edu	37	22	21348483	21348483	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr22:21348483C>T	ENST00000215739.8	+	14	1899	c.1540C>T	c.(1540-1542)Cgg>Tgg	p.R514W	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Missense_Mutation_p.R495W	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	514	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CGTGGCCATCCGGGAGGCCGA	0.701																																																	0													9.0	11.0	11.0					22																	21348483		2186	4280	6466	SO:0001583	missense	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.1540C>T	22.37:g.21348483C>T	ENSP00000215739:p.Arg514Trp		Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R514W	ENST00000215739.8	37	c.1540	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560223	0.86335	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.68624	-0.34;-0.34	5.34	5.34	0.76211	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.105597	0.64402	D	0.000004	T	0.78848	0.4348	L	0.54323	1.7	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.981;0.96;0.981;0.997	T	0.80221	-0.1472	10	0.66056	D	0.02	-6.6561	16.536	0.84373	0.0:1.0:0.0:0.0	.	495;473;514;473	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	W	473;514;495	ENSP00000215739:R514W;ENSP00000374006:R495W	ENSP00000215739:R514W	R	+	1	2	LZTR1	19678483	1.000000	0.71417	0.979000	0.43373	0.894000	0.52154	3.864000	0.56024	2.494000	0.84150	0.462000	0.41574	CGG	LZTR1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000099949		0.701	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1	-	0.00	58	0	C	NM_006767		21348483	+1	tier1	-	no_errors	ENST00000215739	ensembl	human	known	74_37	missense	28.57	30	12	SNP	1.000	T
MAP6	4135	genome.wustl.edu	37	11	75299016	75299016	+	Silent	SNP	C	C	T	rs569375606	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:75299016C>T	ENST00000304771.3	-	4	2280	c.1530G>A	c.(1528-1530)acG>acA	p.T510T	CTD-2530H12.4_ENST00000527803.1_RNA|MAP6_ENST00000526740.1_Silent_p.T181T|MAP6_ENST00000526689.1_5'Flank	NM_033063.1	NP_149052.1	Q96JE9	MAP6_HUMAN	microtubule-associated protein 6	510	Pro-rich.				dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)		p.T510T(1)		central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	19	Ovarian(111;0.11)					GCTCAGGGACCGTGTGATCTT	0.512													C|||	2	0.000399361	0.0	0.0	5008	,	,		21113	0.002		0.0	False		,,,				2504	0.0				Esophageal Squamous(181;1115 2007 8647 17065 22697)												1	Substitution - coding silent(1)	lung(1)											169.0	160.0	163.0					11																	75299016		2200	4293	6493	SO:0001819	synonymous_variant	0			AK123340	CCDS31641.1, CCDS44686.1	11q13.5	2005-10-11			ENSG00000171533	ENSG00000171533			6868	protein-coding gene	gene with protein product		601783				10516426, 12231625	Standard	NM_207577		Approved	KIAA1878, STOP, FLJ41346	uc001owu.3	Q96JE9	OTTHUMG00000165343	ENST00000304771.3:c.1530G>A	11.37:g.75299016C>T			A7E2A1|Q6P3T0|Q6ZWB8	Silent	SNP	pfam_MAP6/FAM154	p.T510	ENST00000304771.3	37	c.1530	CCDS31641.1	11																																																																																			MAP6	-	NULL	ENSG00000171533		0.512	MAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP6	HGNC	protein_coding	OTTHUMT00000383527.1	-	0.00	86	0	C	NM_033063		75299016	-1	tier1	-	no_errors	ENST00000304771	ensembl	human	known	74_37	silent	7.95	139	12	SNP	0.007	T
MARK4	57787	genome.wustl.edu	37	19	45801428	45801428	+	Intron	SNP	G	G	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr19:45801428G>C	ENST00000262891.4	+	15	2208				MARK4_ENST00000300843.4_Missense_Mutation_p.Q635H	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4						microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		CTAAACGGCAGAACTCTAACC	0.612																																																	0													167.0	131.0	143.0					19																	45801428		2203	4300	6503	SO:0001627	intron_variant	0			AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1877+216G>C	19.37:g.45801428G>C			Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_UBA/Ts_N,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q635H	ENST00000262891.4	37	c.1905	CCDS56097.1	19	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835294	0.50951	.	.	ENSG00000007047	ENST00000300843	T	0.71579	-0.58	4.83	3.79	0.43588	.	.	.	.	.	T	0.68201	0.2975	N	0.08118	0	0.26655	N	0.972012	D	0.64830	0.994	D	0.75484	0.986	T	0.60821	-0.7187	9	0.52906	T	0.07	.	10.6789	0.45802	0.0952:0.0:0.9048:0.0	.	635	Q96L34-2	.	H	635	ENSP00000300843:Q635H	ENSP00000300843:Q635H	Q	+	3	2	MARK4	50493268	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.713000	0.68415	1.027000	0.39758	0.454000	0.30748	CAG	MARK4	-	NULL	ENSG00000007047		0.612	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK4	HGNC	protein_coding	OTTHUMT00000457537.1	-	0.00	67	0	G	NM_031417		45801428	+1	tier1	-	no_errors	ENST00000300843	ensembl	human	known	74_37	missense	27.42	45	17	SNP	1.000	C
MBNL1	4154	genome.wustl.edu	37	3	152016909	152016909	+	Intron	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr3:152016909C>T	ENST00000282486.6	+	2	1053				MBNL1_ENST00000498502.1_5'Flank|MBNL1_ENST00000485910.1_5'Flank|MBNL1_ENST00000355460.2_Intron|MBNL1_ENST00000485509.1_5'Flank|MBNL1_ENST00000282488.7_Intron|MBNL1_ENST00000492948.1_5'Flank|MBNL1_ENST00000357472.3_5'Flank|MBNL1_ENST00000463374.1_5'Flank|MBNL1_ENST00000324196.5_5'Flank|MBNL1_ENST00000493459.1_Intron|MBNL1_ENST00000545754.1_5'Flank|MBNL1_ENST00000461436.1_Intron|MBNL1_ENST00000324210.5_Intron			Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1						alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ACAACCCACACTATTGGCTTT	0.428																																																	0																																										SO:0001627	intron_variant	0			Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000282486.6:c.-789-285C>T	3.37:g.152016909C>T			E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	RNA	SNP	-	NULL	ENST00000282486.6	37	NULL	CCDS3165.1	3																																																																																			MBNL1	-	-	ENSG00000152601		0.428	MBNL1-201	KNOWN	basic|CCDS	protein_coding	MBNL1	HGNC	protein_coding		-	0.00	21	0	C	NM_021038		152016909	+1	tier1	-	no_errors	ENST00000466565	ensembl	human	putative	74_37	rna	12.90	54	8	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	47351393	47351393	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr14:47351393A>T	ENST00000399232.2	-	11	2427	c.2063T>A	c.(2062-2064)aTt>aAt	p.I688N	MDGA2_ENST00000399222.3_5'Flank|MDGA2_ENST00000426342.1_Missense_Mutation_p.I459N|MDGA2_ENST00000357362.3_Missense_Mutation_p.I459N|MDGA2_ENST00000439988.3_Missense_Mutation_p.I757N	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	688	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ATTTATTTTAATCTCCTGCTC	0.373																																																	0													62.0	59.0	60.0					14																	47351393		1821	4081	5902	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2063T>A	14.37:g.47351393A>T	ENSP00000382178:p.Ile688Asn		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.I757N	ENST00000399232.2	37	c.2270		14	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107326	0.77096	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.4	5.4	0.78164	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.52532	U	0.000079	T	0.65790	0.2725	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.99	T	0.68652	-0.5352	10	0.66056	D	0.02	.	14.2454	0.65986	1.0:0.0:0.0:0.0	.	459;688	F6W3S7;Q7Z553	.;MDGA2_HUMAN	N	688;459;757;459	ENSP00000400011:I688N;ENSP00000405456:I459N;ENSP00000382178:I757N;ENSP00000349925:I459N	ENSP00000349925:I459N	I	-	2	0	MDGA2	46421143	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.935000	0.92923	2.059000	0.61396	0.383000	0.25322	ATT	MDGA2	-	superfamily_Fibronectin_type3	ENSG00000272781		0.373	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	41	0	A	NM_182830		47351393	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	30.36	39	17	SNP	1.000	T
MGARP	84709	genome.wustl.edu	37	4	140188162	140188162	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr4:140188162G>T	ENST00000398955.1	-	4	493	c.314C>A	c.(313-315)gCa>gAa	p.A105E		NM_032623.3	NP_116012.2	Q8TDB4	HUMMR_HUMAN	mitochondria-localized glutamic acid-rich protein	105					anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cellular response to gonadotropin-releasing hormone (GO:0097211)|cellular response to hypoxia (GO:0071456)|cellular response to steroid hormone stimulus (GO:0071383)|positive regulation of mitochondrion organization (GO:0010822)|protein targeting to mitochondrion (GO:0006626)|retrograde axon cargo transport (GO:0008090)	integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)											TTCTGAACTTGCTTTCTCAGT	0.428																																																	0													162.0	152.0	155.0					4																	140188162		1896	4121	6017	SO:0001583	missense	0			AF484960	CCDS43269.1	4q31.1	2014-02-19	2014-02-19	2012-04-17	ENSG00000137463	ENSG00000137463			29969	protein-coding gene	gene with protein product	"""ovary-specific acidic protein"", ""corneal endothelium-specific protein 1"", ""hypoxia up-regulated mitochondrial movement regulator"""		"""chromosome 4 open reading frame 49"""	C4orf49			Standard	NM_032623		Approved	OSAP, CESP-1, HUMMR	uc003ihr.1	Q8TDB4	OTTHUMG00000161325	ENST00000398955.1:c.314C>A	4.37:g.140188162G>T	ENSP00000381928:p.Ala105Glu		Q9BZC3	Missense_Mutation	SNP	NULL	p.A105E	ENST00000398955.1	37	c.314	CCDS43269.1	4	.	.	.	.	.	.	.	.	.	.	G	9.648	1.140734	0.21205	.	.	ENSG00000137463	ENST00000398955	T	0.57595	0.39	5.43	2.63	0.31362	.	0.589319	0.16282	N	0.221312	T	0.44329	0.1288	L	0.54323	1.7	0.20074	N	0.999933	B	0.14012	0.009	B	0.14578	0.011	T	0.37314	-0.9711	10	0.46703	T	0.11	-12.7643	6.712	0.23282	0.0843:0.0:0.6068:0.3089	.	105	Q8TDB4	CD049_HUMAN	E	105	ENSP00000381928:A105E	ENSP00000381928:A105E	A	-	2	0	C4orf49	140407612	0.003000	0.15002	0.001000	0.08648	0.132000	0.20833	0.481000	0.22260	0.205000	0.20568	0.467000	0.42956	GCA	MGARP	-	NULL	ENSG00000137463		0.428	MGARP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGARP	HGNC	protein_coding	OTTHUMT00000364536.1	-	0.00	74	0	G	NM_032623		140188162	-1	tier1	-	no_errors	ENST00000398955	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.010	T
MICU2	221154	genome.wustl.edu	37	13	22113447	22113447	+	Missense_Mutation	SNP	C	C	T	rs140786216		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr13:22113447C>T	ENST00000382374.4	-	4	525	c.460G>A	c.(460-462)Gat>Aat	p.D154N		NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	154					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TTACCTTTATCGCCAAGGTCT	0.318																																																	0													58.0	58.0	58.0					13																	22113447		2203	4300	6503	SO:0001583	missense	0			AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.460G>A	13.37:g.22113447C>T	ENSP00000371811:p.Asp154Asn		Q8N0T6|Q8NAX8	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.D154N	ENST00000382374.4	37	c.460	CCDS9297.1	13	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955253	0.73902	.	.	ENSG00000165487	ENST00000382374	T	0.80123	-1.34	4.02	4.02	0.46733	.	0.000000	0.85682	D	0.000000	D	0.82370	0.5022	L	0.31476	0.935	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	T	0.80299	-0.1441	10	0.30854	T	0.27	-11.7735	13.3443	0.60564	0.0:1.0:0.0:0.0	.	154	Q8IYU8	EFHA1_HUMAN	N	154	ENSP00000371811:D154N	ENSP00000371811:D154N	D	-	1	0	EFHA1	21011447	0.991000	0.36638	0.995000	0.50966	0.964000	0.63967	3.774000	0.55341	2.243000	0.73865	0.491000	0.48974	GAT	MICU2	-	NULL	ENSG00000165487		0.318	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICU2	HGNC	protein_coding	OTTHUMT00000144355.1	-	0.00	26	0	C	NM_152726		22113447	-1	tier1	-	no_errors	ENST00000382374	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	T
MORC2	22880	genome.wustl.edu	37	22	31324086	31324086	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr22:31324086C>T	ENST00000397641.3	-	25	3358	c.2950G>A	c.(2950-2952)Gag>Aag	p.E984K	MORC2_ENST00000215862.4_Missense_Mutation_p.E922K|MORC2-AS1_ENST00000432624.2_RNA|MORC2-AS1_ENST00000422995.2_RNA|MORC2-AS1_ENST00000441558.1_RNA|MORC2-AS1_ENST00000609557.1_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	984						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						AGCTTCCTCTCGGAGGTGCGC	0.597																																																	0													63.0	56.0	59.0					22																	31324086		2203	4300	6503	SO:0001583	missense	0			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2950G>A	22.37:g.31324086C>T	ENSP00000380763:p.Glu984Lys		B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Carb-bd_dom,pfscan_Znf_CW	p.E984K	ENST00000397641.3	37	c.2950		22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.621256|4.621256	0.87460|0.87460	.|.	.|.	ENSG00000133422|ENSG00000133422	ENST00000397641;ENST00000429468;ENST00000215862|ENST00000445980	T;T|.	0.15139|.	2.46;2.45|.	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.048924|.	0.85682|.	D|.	0.000000|.	T|T	0.56108|0.56108	0.1963|0.1963	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.56398|.	0.797|.	T|T	0.50491|0.50491	-0.8822|-0.8822	10|5	0.42905|.	T|.	0.14|.	.|.	19.2808|19.2808	0.94052|0.94052	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	984|.	Q9Y6X9|.	MORC2_HUMAN|.	K|Q	984;44;922|145	ENSP00000380763:E984K;ENSP00000215862:E922K|.	ENSP00000215862:E922K|.	E|R	-|-	1|2	0|0	MORC2|MORC2	29654086|29654086	1.000000|1.000000	0.71417|0.71417	0.905000|0.905000	0.35620|0.35620	0.581000|0.581000	0.36288|0.36288	7.487000|7.487000	0.81328|0.81328	2.557000|2.557000	0.86248|0.86248	0.561000|0.561000	0.74099|0.74099	GAG|CGA	MORC2	-	NULL	ENSG00000133422		0.597	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2	HGNC	protein_coding	OTTHUMT00000321710.2	-	0.00	77	0	C	NM_014941		31324086	-1	tier1	-	no_errors	ENST00000397641	ensembl	human	known	74_37	missense	23.94	54	17	SNP	1.000	T
MOV10	4343	genome.wustl.edu	37	1	113237086	113237086	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:113237086G>A	ENST00000413052.2	+	9	1697	c.1307G>A	c.(1306-1308)cGc>cAc	p.R436H	MOV10_ENST00000369644.1_Missense_Mutation_p.R380H|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000357443.2_Missense_Mutation_p.R436H|MOV10_ENST00000468624.1_3'UTR|MOV10_ENST00000369645.1_Missense_Mutation_p.R436H	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	436					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CTCCTGAGCCGCTTTGTGGAT	0.597																																																	0													57.0	60.0	59.0					1																	113237086		2203	4300	6503	SO:0001583	missense	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.1307G>A	1.37:g.113237086G>A	ENSP00000399797:p.Arg436His		Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R436H	ENST00000413052.2	37	c.1307	CCDS853.1	1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.762695	0.49574	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000285733;ENST00000369644;ENST00000357443;ENST00000369648	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	5.09	4.17	0.49024	.	0.461885	0.18895	N	0.128186	D	0.90072	0.6899	L	0.38838	1.175	0.80722	D	1	B;D;P	0.76494	0.146;0.999;0.53	B;P;B	0.62382	0.018;0.901;0.074	D	0.90021	0.4128	10	0.56958	D	0.05	-16.0533	9.0708	0.36491	0.1576:0.0:0.8424:0.0	.	380;436;436	Q5JR04;Q9H8T8;Q9HCE1	.;.;MOV10_HUMAN	H	436;436;436;380;436;374	ENSP00000399797:R436H;ENSP00000358659:R436H;ENSP00000358658:R380H;ENSP00000350028:R436H	ENSP00000285733:R436H	R	+	2	0	MOV10	113038609	0.222000	0.23652	1.000000	0.80357	0.993000	0.82548	2.055000	0.41345	2.371000	0.80710	0.561000	0.74099	CGC	MOV10	-	NULL	ENSG00000155363		0.597	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	-	0.00	66	0	G	NM_020963		113237086	+1	tier1	-	no_errors	ENST00000357443	ensembl	human	known	74_37	missense	59.62	21	31	SNP	0.969	A
MTMR14	64419	genome.wustl.edu	37	3	9731787	9731787	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr3:9731787T>A	ENST00000296003.4	+	17	1695	c.1573T>A	c.(1573-1575)Ttc>Atc	p.F525I	MTMR14_ENST00000353332.5_Missense_Mutation_p.F525I|MTMR14_ENST00000351233.5_Intron|MTMR14_ENST00000420925.1_Intron	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	525					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					TGATAACTTTTTCAGGATGGG	0.567																																																	0													36.0	39.0	38.0					3																	9731787		1869	4093	5962	SO:0001583	missense	0			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.1573T>A	3.37:g.9731787T>A	ENSP00000296003:p.Phe525Ile		Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	NULL	p.F525I	ENST00000296003.4	37	c.1573	CCDS43043.1	3	.	.	.	.	.	.	.	.	.	.	T	14.26	2.481395	0.44147	.	.	ENSG00000163719	ENST00000353332;ENST00000296003	T	0.23950	1.88	5.65	5.65	0.86999	.	0.367041	0.31734	N	0.007152	T	0.22781	0.0550	L	0.54323	1.7	0.80722	D	1	B;B	0.28933	0.228;0.146	B;B	0.30855	0.121;0.024	T	0.07290	-1.0780	10	0.18276	T	0.48	-7.8488	8.0316	0.30467	0.0:0.1555:0.0:0.8445	.	525;525	Q8NCE2-2;Q8NCE2	.;MTMRE_HUMAN	I	525	ENSP00000296003:F525I	ENSP00000296003:F525I	F	+	1	0	MTMR14	9706787	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.563000	0.36364	2.146000	0.66826	0.533000	0.62120	TTC	MTMR14	-	NULL	ENSG00000163719		0.567	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1	-	0.00	41	0	T	NM_022485		9731787	+1	tier1	-	no_errors	ENST00000296003	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.995	A
MUC4	4585	genome.wustl.edu	37	3	195508324	195508324	+	Missense_Mutation	SNP	C	C	T	rs425562	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr3:195508324C>T	ENST00000463781.3	-	2	10586	c.10127G>A	c.(10126-10128)cGt>cAt	p.R3376H	MUC4_ENST00000475231.1_Missense_Mutation_p.R3376H|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGACGGGTGGTGTC	0.582																																																	0													38.0	33.0	34.0					3																	195508324		686	1584	2270	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10127G>A	3.37:g.195508324C>T	ENSP00000417498:p.Arg3376His		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.R3376H	ENST00000463781.3	37	c.10127	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	10.98	1.503472	0.26949	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35048	1.39;1.33	0.743	-1.49	0.08718	.	.	.	.	.	T	0.11537	0.0281	N	0.08118	0	0.09310	N	1	P	0.35793	0.521	B	0.13407	0.009	T	0.13899	-1.0492	8	.	.	.	.	3.5529	0.07853	0.2457:0.2612:0.4931:0.0	.	3248	E7ESK3	.	H	3376	ENSP00000417498:R3376H;ENSP00000420243:R3376H	.	R	-	2	0	MUC4	196993103	0.000000	0.05858	0.009000	0.14445	0.005000	0.04900	-1.306000	0.02735	-2.031000	0.00928	-1.986000	0.00452	CGT	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	258	0	C	NM_018406		195508324	-1	tier1	rs425562	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	5.29	497	28	SNP	0.006	T
MYBPC1	4604	genome.wustl.edu	37	12	102021559	102021559	+	Intron	SNP	G	G	T	rs373356488		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:102021559G>T	ENST00000550270.1	+	4	103				MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000545503.2_Intron|MYBPC1_ENST00000536007.1_Intron|MYBPC1_ENST00000441232.1_Intron|MYBPC1_ENST00000360610.2_Intron|MYBPC1_ENST00000361685.2_Missense_Mutation_p.R52L|MYBPC1_ENST00000547405.1_Intron|MYBPC1_ENST00000549145.1_Intron|MYBPC1_ENST00000361466.2_Missense_Mutation_p.R52L|MYBPC1_ENST00000551300.1_5'UTR|MYBPC1_ENST00000541119.1_Intron|MYBPC1_ENST00000553190.1_Intron|MYBPC1_ENST00000392934.3_Intron|MYBPC1_ENST00000547509.1_Intron|MYBPC1_ENST00000452455.2_Intron			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type						cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)	p.R52L(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TTGGGTAGTCGGGCCCTGGAG	0.478																																																	1	Substitution - Missense(1)	lung(1)						G	LEU/ARG,LEU/ARG,,	0,4406		0,0,2203	147.0	130.0	136.0		155,155,,	4.7	1.0	12		136	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron,intron	MYBPC1	NM_002465.2,NM_206819.1,NM_206820.1,NM_206821.1	102,102,,	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	benign,benign,,	52/1172,52/1149,,	102021559	1,13005	2203	4300	6503	SO:0001627	intron_variant	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.104-1653G>T	12.37:g.102021559G>T			B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R52L	ENST00000550270.1	37	c.155	CCDS9085.1	12	.	.	.	.	.	.	.	.	.	.	G	16.37	3.103744	0.56291	0.0	1.16E-4	ENSG00000196091	ENST00000361685;ENST00000540770;ENST00000361466	T;T	0.58506	0.35;0.33	5.62	4.72	0.59763	.	0.466114	0.16415	N	0.215403	T	0.35219	0.0924	N	0.14661	0.345	0.80722	D	1	B;B	0.34290	0.447;0.312	B;B	0.32583	0.148;0.148	T	0.21245	-1.0251	10	0.38643	T	0.18	.	5.3629	0.16098	0.2738:0.0:0.7262:0.0	.	52;52	G3XAE8;Q00872-2	.;.	L	52	ENSP00000354845:R52L;ENSP00000354849:R52L	ENSP00000354849:R52L	R	+	2	0	MYBPC1	100545690	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.502000	0.45398	2.634000	0.89283	0.655000	0.94253	CGG	MYBPC1	-	NULL	ENSG00000196091		0.478	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	-	0.00	47	0	G			102021559	+1	tier1	-	no_errors	ENST00000361466	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	T
MYBPC2	4606	genome.wustl.edu	37	19	50951588	50951588	+	Nonsense_Mutation	SNP	G	G	A	rs34373957		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr19:50951588G>A	ENST00000357701.5	+	13	1464	c.1413G>A	c.(1411-1413)tgG>tgA	p.W471*		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	471	Ig-like C2-type 4.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CGGGCAAGTGGTATAAGAATG	0.577																																																	0								G	stop/TRP	1,4099		0,1,2049	151.0	155.0	154.0		1413	3.7	1.0	19	dbSNP_126	154	0,8412		0,0,4206	no	stop-gained	MYBPC2	NM_004533.3		0,1,6255	AA,AG,GG		0.0,0.0244,0.0080		471/1142	50951588	1,12511	2050	4206	6256	SO:0001587	stop_gained	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1413G>A	19.37:g.50951588G>A	ENSP00000350332:p.Trp471*		A1L4G9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W471*	ENST00000357701.5	37	c.1413	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	g	37	6.632201	0.97722	2.44E-4	0.0	ENSG00000086967	ENST00000357701	.	.	.	3.7	3.7	0.42460	.	0.000000	0.35970	U	0.002862	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1811	0.72960	0.0:0.0:1.0:0.0	.	.	.	.	X	471	.	ENSP00000350332:W471X	W	+	3	0	MYBPC2	55643400	1.000000	0.71417	0.996000	0.52242	0.853000	0.48598	8.924000	0.92827	2.039000	0.60335	0.473000	0.43528	TGG	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000086967		0.577	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	-	0.00	40	0	G	NM_004533		50951588	+1	tier1	-	no_errors	ENST00000357701	ensembl	human	known	74_37	nonsense	8.06	57	5	SNP	1.000	A
NFE2L3	9603	genome.wustl.edu	37	7	26224292	26224292	+	Missense_Mutation	SNP	A	A	G	rs143091809		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:26224292A>G	ENST00000056233.3	+	4	1233	c.974A>G	c.(973-975)aAt>aGt	p.N325S		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	325					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TGTCCCAACAATACATTTAGA	0.418																																																	0													109.0	98.0	102.0					7																	26224292		2203	4300	6503	SO:0001583	missense	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.974A>G	7.37:g.26224292A>G	ENSP00000056233:p.Asn325Ser		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP,pfam_bZIP_Maf,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.N325S	ENST00000056233.3	37	c.974	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	A	5.103	0.204557	0.09704	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.29142	1.58	3.89	-2.88	0.05682	.	1.311320	0.04767	N	0.427464	T	0.25494	0.0620	L	0.60455	1.87	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.20974	-1.0259	10	0.31617	T	0.26	-0.9675	2.998	0.06004	0.2501:0.2377:0.3955:0.1167	.	325	Q9Y4A8	NF2L3_HUMAN	S	325;31	ENSP00000056233:N325S	ENSP00000056233:N325S	N	+	2	0	NFE2L3	26190817	0.004000	0.15560	0.432000	0.26747	0.756000	0.42949	0.061000	0.14366	-0.551000	0.06175	0.383000	0.25322	AAT	NFE2L3	-	NULL	ENSG00000050344		0.418	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	-	0.00	39	0	A			26224292	+1	tier1	rs143091809	no_errors	ENST00000056233	ensembl	human	known	74_37	missense	10.91	49	6	SNP	0.000	G
NFE2L3	9603	genome.wustl.edu	37	7	26224313	26224313	+	Missense_Mutation	SNP	C	C	T	rs147199325		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:26224313C>T	ENST00000056233.3	+	4	1254	c.995C>T	c.(994-996)aCa>aTa	p.T332I		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	332					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						AGAGATCCAACAGCAAGGACT	0.408																																																	0													108.0	96.0	100.0					7																	26224313		2203	4300	6503	SO:0001583	missense	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.995C>T	7.37:g.26224313C>T	ENSP00000056233:p.Thr332Ile		Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP,pfam_bZIP_Maf,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.T332I	ENST00000056233.3	37	c.995	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	c	0.830	-0.745584	0.03065	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.31247	1.5	4.63	-5.14	0.02875	.	1.593220	0.03300	N	0.188821	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20107	-1.0285	10	0.38643	T	0.18	1.2662	4.7543	0.13075	0.1048:0.4831:0.2352:0.177	.	332	Q9Y4A8	NF2L3_HUMAN	I	332;38	ENSP00000056233:T332I	ENSP00000056233:T332I	T	+	2	0	NFE2L3	26190838	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.396000	0.07278	-0.575000	0.05982	-1.912000	0.00520	ACA	NFE2L3	-	NULL	ENSG00000050344		0.408	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	-	0.00	30	0	C			26224313	+1	tier1	rs147199325	no_errors	ENST00000056233	ensembl	human	known	74_37	missense	12.90	54	8	SNP	0.000	T
NFE2L3	9603	genome.wustl.edu	37	7	26224323	26224323	+	Silent	SNP	T	T	C	rs113074870		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:26224323T>C	ENST00000056233.3	+	4	1264	c.1005T>C	c.(1003-1005)acT>acC	p.T335T		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	335					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						CAGCAAGGACTTCACAGTCAC	0.418																																																	0													108.0	96.0	100.0					7																	26224323		2203	4300	6503	SO:0001819	synonymous_variant	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1005T>C	7.37:g.26224323T>C			Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Silent	SNP	pfam_bZIP,pfam_bZIP_Maf,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.T335	ENST00000056233.3	37	c.1005	CCDS5396.1	7																																																																																			NFE2L3	-	NULL	ENSG00000050344		0.418	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	-	0.00	28	0	T			26224323	+1	tier1	rs113074870	no_errors	ENST00000056233	ensembl	human	known	74_37	silent	16.95	49	10	SNP	0.002	C
NOS3	4846	genome.wustl.edu	37	7	150695460	150695460	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:150695460G>A	ENST00000484524.1	+	5	598	c.598G>A	c.(598-600)Gac>Aac	p.D200N	NOS3_ENST00000461406.1_5'UTR|NOS3_ENST00000467517.1_Missense_Mutation_p.D200N|NOS3_ENST00000297494.3_Missense_Mutation_p.D200N	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CGATGCCCGGGACTGCAGGTC	0.612																																																	0													52.0	43.0	46.0					7																	150695460		2193	4283	6476	SO:0001583	missense	0				CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.598G>A	7.37:g.150695460G>A	ENSP00000420215:p.Asp200Asn		Q495E5	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.D200N	ENST00000484524.1	37	c.598	CCDS55182.1	7	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623016	0.46840	.	.	ENSG00000164867	ENST00000297494;ENST00000484524;ENST00000467517	T;T;T	0.22743	1.94;1.94;1.94	4.82	4.82	0.62117	Nitric oxide synthase, oxygenase domain (3);	0.000000	0.64402	D	0.000012	T	0.22742	0.0549	L	0.55103	1.725	0.46336	D	0.998995	B;B;B;B	0.27559	0.101;0.101;0.016;0.181	B;B;B;B	0.30716	0.119;0.119;0.028;0.069	T	0.03922	-1.0992	10	0.16420	T	0.52	-14.6635	15.7812	0.78260	0.0:0.0:1.0:0.0	.	200;200;200;200	A0S0A6;E9PFR2;A0S0A8;P29474	.;.;.;NOS3_HUMAN	N	200	ENSP00000297494:D200N;ENSP00000420215:D200N;ENSP00000420551:D200N	ENSP00000297494:D200N	D	+	1	0	NOS3	150326393	1.000000	0.71417	0.997000	0.53966	0.839000	0.47603	7.876000	0.87215	2.383000	0.81215	0.573000	0.79308	GAC	NOS3	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000164867		0.612	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS3	HGNC	protein_coding	OTTHUMT00000351550.1	-	0.00	32	0	G	NM_000603		150695460	+1	tier1	-	no_errors	ENST00000297494	ensembl	human	known	74_37	missense	41.03	23	16	SNP	1.000	A
NPIPB11	728888	genome.wustl.edu	37	16	29394470	29394470	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr16:29394470G>A	ENST00000524087.1	-	8	1857	c.1783C>T	c.(1783-1785)Cgg>Tgg	p.R595W	SNX29P2_ENST00000398878.3_lincRNA			E5RHQ5	NPB11_HUMAN	nuclear pore complex interacting protein family, member B11	595	Pro-rich.					integral component of membrane (GO:0016021)											ATTATCATCCGCTGAGGGTGG	0.547																																																	0																																										SO:0001583	missense	0					16p11.2	2013-06-11			ENSG00000254206	ENSG00000254206			37453	protein-coding gene	gene with protein product							Standard	XM_006721110		Approved			E5RHQ5	OTTHUMG00000170467	ENST00000524087.1:c.1783C>T	16.37:g.29394470G>A	ENSP00000430853:p.Arg595Trp			Missense_Mutation	SNP	NULL	p.R595W	ENST00000524087.1	37	c.1783		16	.	.	.	.	.	.	.	.	.	.	G	4.790	0.146895	0.09134	.	.	ENSG00000254206	ENST00000524087	T	0.26518	1.73	.	.	.	.	.	.	.	.	T	0.12902	0.0313	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.27400	-1.0075	5	0.72032	D	0.01	.	.	.	.	.	.	.	.	W	595	ENSP00000430853:R595W	ENSP00000430853:R595W	R	-	1	2	RP11-231C14.2	29301971	0.046000	0.20272	0.042000	0.18584	0.042000	0.13812	0.075000	0.14686	0.073000	0.16731	0.074000	0.15403	CGG	NPIPB11	-	NULL	ENSG00000254206		0.547	NPIPB11-001	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal	protein_coding	NPIPB11	HGNC	protein_coding	OTTHUMT00000374094.1	-	0.00	47	0	G	XM_002343430		29394470	-1	tier1	-	no_errors	ENST00000524087	ensembl	human	putative	74_37	missense	35.05	63	34	SNP	0.042	A
NSMAF	8439	genome.wustl.edu	37	8	59510074	59510074	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr8:59510074G>A	ENST00000038176.3	-	21	1876	c.1664C>T	c.(1663-1665)aCg>aTg	p.T555M	NSMAF_ENST00000427130.2_Missense_Mutation_p.T586M	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	555	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				CAAGATTTGCGTAAGCATGGC	0.448																																																	0													175.0	150.0	158.0					8																	59510074		2203	4300	6503	SO:0001583	missense	0			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1664C>T	8.37:g.59510074G>A	ENSP00000038176:p.Thr555Met		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,pfam_GRAM,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_GRAM,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T586M	ENST00000038176.3	37	c.1757	CCDS6173.1	8	.	.	.	.	.	.	.	.	.	.	G	28.4	4.918173	0.92249	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.80738	-1.41;-1.41	6.03	6.03	0.97812	BEACH domain (4);	0.000000	0.85682	D	0.000000	D	0.90477	0.7017	M	0.82323	2.585	0.58432	D	0.999998	D;D	0.89917	1.0;0.989	D;P	0.65773	0.938;0.79	D	0.89555	0.3802	9	.	.	.	.	20.5752	0.99366	0.0:0.0:1.0:0.0	.	586;555	Q92636-2;Q92636	.;FAN_HUMAN	M	555;586	ENSP00000038176:T555M;ENSP00000411012:T586M	.	T	-	2	0	NSMAF	59672628	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	9.471000	0.97696	2.868000	0.98415	0.557000	0.71058	ACG	NSMAF	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000035681		0.448	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	HGNC	protein_coding	OTTHUMT00000378384.1	-	0.00	40	0	G	NM_003580		59510074	-1	tier1	-	no_errors	ENST00000427130	ensembl	human	known	74_37	missense	44.07	33	26	SNP	1.000	A
OGDH	4967	genome.wustl.edu	37	7	44736644	44736644	+	Missense_Mutation	SNP	G	G	A	rs139641350		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:44736644G>A	ENST00000222673.5	+	15	2074	c.2032G>A	c.(2032-2034)Gtg>Atg	p.V678M	OGDH_ENST00000449767.1_Missense_Mutation_p.V674M|OGDH_ENST00000444676.1_Missense_Mutation_p.V693M|OGDH_ENST00000439616.2_Missense_Mutation_p.V528M|OGDH_ENST00000543843.1_Missense_Mutation_p.V629M|OGDH_ENST00000447398.1_Missense_Mutation_p.V689M	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	678					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CGGCCAGGACGTGGAGCGGGG	0.557																																																	0								G	MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	98.0	78.0	85.0		2020,2032	5.1	1.0	7	dbSNP_134	85	0,8600		0,0,4300	no	missense,missense	OGDH	NM_001165036.1,NM_002541.3	21,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	674/1020,678/1024	44736644	1,13005	2203	4300	6503	SO:0001583	missense	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.2032G>A	7.37:g.44736644G>A	ENSP00000222673:p.Val678Met		B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.V678M	ENST00000222673.5	37	c.2032	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	27.9	4.869070	0.91587	2.27E-4	0.0	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.92595	-3.07;-3.07;-3.07;-3.07;-3.07;-3.07	5.13	5.13	0.70059	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.97607	0.9216	H	0.96633	3.855	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.98786	1.0734	10	0.87932	D	0	-25.9355	18.3765	0.90437	0.0:0.0:1.0:0.0	.	473;528;674;689;580;678	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	M	528;674;689;693;678;629	ENSP00000398576:V528M;ENSP00000392878:V674M;ENSP00000388183:V689M;ENSP00000414662:V693M;ENSP00000222673:V678M;ENSP00000443821:V629M	ENSP00000222673:V678M	V	+	1	0	OGDH	44703169	1.000000	0.71417	0.963000	0.40424	0.985000	0.73830	9.548000	0.98103	2.642000	0.89623	0.650000	0.86243	GTG	OGDH	-	pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.557	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	-	0.00	59	0	G			44736644	+1	tier1	rs139641350	no_errors	ENST00000222673	ensembl	human	known	74_37	missense	32.26	63	30	SNP	1.000	A
OLFML2B	25903	genome.wustl.edu	37	1	161954722	161954722	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:161954722T>C	ENST00000294794.3	-	7	1946	c.1523A>G	c.(1522-1524)aAc>aGc	p.N508S	OLFML2B_ENST00000367940.2_Missense_Mutation_p.N509S|OLFML2B_ENST00000367938.1_5'UTR	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	508	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			CCCATATGTGTTCTGGGTGGT	0.552																																																	0													189.0	167.0	174.0					1																	161954722		2203	4300	6503	SO:0001583	missense	0			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.1523A>G	1.37:g.161954722T>C	ENSP00000294794:p.Asn508Ser		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_NA-bd_OB-fold,smart_Olfac-like,pfscan_Olfac-like	p.N508S	ENST00000294794.3	37	c.1523	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096715	0.76870	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	D;D	0.88509	-2.39;-2.39	4.31	4.31	0.51392	Olfactomedin-like (3);	.	.	.	.	D	0.83440	0.5255	N	0.20401	0.57	0.41391	D	0.987618	P;B	0.50156	0.932;0.34	P;B	0.58520	0.84;0.349	D	0.84887	0.0834	8	0.46703	T	0.11	.	11.4874	0.50361	0.0:0.0:0.0:1.0	.	509;508	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	S	508;509	ENSP00000294794:N508S;ENSP00000356917:N509S	ENSP00000294794:N508S	N	-	2	0	OLFML2B	160221346	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.722000	0.84778	1.812000	0.52913	0.459000	0.35465	AAC	OLFML2B	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000162745		0.552	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OLFML2B	HGNC	protein_coding	OTTHUMT00000060552.2	-	0.00	79	0	T	NM_015441		161954722	-1	tier1	-	no_errors	ENST00000294794	ensembl	human	known	74_37	missense	32.61	62	30	SNP	1.000	C
OR10A6	390093	genome.wustl.edu	37	11	7949463	7949463	+	Silent	SNP	G	G	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:7949463G>C	ENST00000309838.2	-	1	746	c.747C>G	c.(745-747)acC>acG	p.T249T		NM_001004461.1	NP_001004461.1	Q8NH74	O10A6_HUMAN	olfactory receptor, family 10, subfamily A, member 6	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CATAGAATAGGGTCACAGATG	0.463																																																	0													130.0	117.0	121.0					11																	7949463		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065515	CCDS31420.1	11p15.4	2012-08-09			ENSG00000175393	ENSG00000175393		"""GPCR / Class A : Olfactory receptors"""	15132	protein-coding gene	gene with protein product							Standard	NM_001004461		Approved		uc010rbh.2	Q8NH74	OTTHUMG00000165671	ENST00000309838.2:c.747C>G	11.37:g.7949463G>C			Q6IF59	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T249	ENST00000309838.2	37	c.747	CCDS31420.1	11																																																																																			OR10A6	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000175393		0.463	OR10A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A6	HGNC	protein_coding	OTTHUMT00000385703.1	-	0.00	54	0	G	NM_001004461		7949463	-1	tier1	-	no_errors	ENST00000309838	ensembl	human	known	74_37	silent	22.22	42	12	SNP	0.284	C
OR10Z1	128368	genome.wustl.edu	37	1	158576618	158576618	+	Silent	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:158576618C>A	ENST00000361284.1	+	1	390	c.390C>A	c.(388-390)ctC>ctA	p.L130L		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					GTGCTCCACTCCACTATGCCA	0.507																																																	0													95.0	96.0	95.0					1																	158576618		2203	4300	6503	SO:0001819	synonymous_variant	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.390C>A	1.37:g.158576618C>A			Q5VYL0|Q6IFR7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L130	ENST00000361284.1	37	c.390	CCDS30901.1	1																																																																																			OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000198967		0.507	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	0.00	43	0	C	NM_001004478		158576618	+1	tier1	-	no_errors	ENST00000361284	ensembl	human	known	74_37	silent	34.21	50	26	SNP	0.925	A
OR1J1	347168	genome.wustl.edu	37	9	125240137	125240137	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr9:125240137C>A	ENST00000259357.2	-	1	98	c.69G>T	c.(67-69)caG>caT	p.Q23H	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						ACACGGCCTGCTGCTCTGGCC	0.582																																																	0													116.0	112.0	114.0					9																	125240137		2203	4300	6503	SO:0001583	missense	0			AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.69G>T	9.37:g.125240137C>A	ENSP00000259357:p.Gln23His		A3KFL8|Q6IF10|Q96R88	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q23H	ENST00000259357.2	37	c.69	CCDS35120.1	9	.	.	.	.	.	.	.	.	.	.	C	2.086	-0.409540	0.04799	.	.	ENSG00000136834	ENST00000259357	T	0.02974	4.09	4.37	1.52	0.23074	.	0.000000	0.53938	D	0.000041	T	0.01905	0.0060	L	0.31120	0.905	0.09310	N	0.999998	B	0.20671	0.047	B	0.20577	0.03	T	0.46938	-0.9155	10	0.16420	T	0.52	.	3.1355	0.06437	0.2814:0.4322:0.0:0.2863	.	23	Q8NGS3	OR1J1_HUMAN	H	23	ENSP00000259357:Q23H	ENSP00000259357:Q23H	Q	-	3	2	OR1J1	124279958	0.000000	0.05858	0.609000	0.28983	0.190000	0.23558	-1.432000	0.02430	0.610000	0.30035	0.531000	0.56144	CAG	OR1J1	-	NULL	ENSG00000136834		0.582	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1J1	HGNC	protein_coding	OTTHUMT00000053931.1	-	0.00	66	0	C			125240137	-1	tier1	-	no_errors	ENST00000259357	ensembl	human	known	74_37	missense	32.00	68	32	SNP	0.070	A
OR5AU1	390445	genome.wustl.edu	37	14	21623754	21623754	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr14:21623754G>A	ENST00000304418.3	-	1	468	c.431C>T	c.(430-432)tCt>tTt	p.S144F		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	144						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GCCAAAATAAGAGATCACTTT	0.512																																																	0													86.0	80.0	82.0					14																	21623754		2203	4300	6503	SO:0001583	missense	0			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.431C>T	14.37:g.21623754G>A	ENSP00000302057:p.Ser144Phe		B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S144F	ENST00000304418.3	37	c.431	CCDS32042.1	14	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554100	0.27739	.	.	ENSG00000169327	ENST00000304418	T	0.00745	5.75	4.22	4.22	0.49857	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04634	0.0126	M	0.82823	2.61	0.20926	N	0.999829	D	0.76494	0.999	D	0.67900	0.954	T	0.08046	-1.0741	9	0.87932	D	0	.	14.1451	0.65347	0.0:0.0:1.0:0.0	.	144	Q8NGC0	O5AU1_HUMAN	F	144	ENSP00000302057:S144F	ENSP00000302057:S144F	S	-	2	0	OR5AU1	20693594	0.937000	0.31787	0.089000	0.20774	0.149000	0.21700	3.884000	0.56175	2.189000	0.69895	0.313000	0.20887	TCT	OR5AU1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000169327		0.512	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AU1	HGNC	protein_coding	OTTHUMT00000410213.1		0.00	33	0	G			21623754	-1			no_errors	ENST00000304418	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.099	A
PARP8	79668	genome.wustl.edu	37	5	50093011	50093011	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:50093011G>T	ENST00000281631.5	+	14	1677	c.1519G>T	c.(1519-1521)Gaa>Taa	p.E507*	PARP8_ENST00000514067.2_Nonsense_Mutation_p.E507*|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000514342.2_Nonsense_Mutation_p.E260*|PARP8_ENST00000505554.1_Nonsense_Mutation_p.E486*|PARP8_ENST00000505697.2_Nonsense_Mutation_p.E507*|PARP8_ENST00000503750.2_Nonsense_Mutation_p.E507*	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	507						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TGTATTAAATGAATATTGTGT	0.358																																																	0													129.0	116.0	120.0					5																	50093011		2203	4300	6503	SO:0001587	stop_gained	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1519G>T	5.37:g.50093011G>T	ENSP00000281631:p.Glu507*		Q3KRB7|Q6DHZ1|Q9H754	Nonsense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.E507*	ENST00000281631.5	37	c.1519	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.836549	0.98516	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.4488	19.6213	0.95656	0.0:0.0:1.0:0.0	.	.	.	.	X	507;507;260;507;507;486;260;260	.	.	E	+	1	0	PARP8	50128768	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	9.655000	0.98512	2.650000	0.89964	0.591000	0.81541	GAA	PARP8	-	NULL	ENSG00000151883		0.358	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	-	0.00	50	0	G	NM_024615		50093011	+1	tier1	-	no_errors	ENST00000281631	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
PBX3	5090	genome.wustl.edu	37	9	128697755	128697755	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr9:128697755delA	ENST00000373489.5	+	5	728	c.712delA	c.(712-714)aaafs	p.K238fs	PBX3_ENST00000447726.2_Frame_Shift_Del_p.K163fs|PBX3_ENST00000373483.2_Frame_Shift_Del_p.K57fs|PBX3_ENST00000538998.1_3'UTR|PBX3_ENST00000342287.5_Frame_Shift_Del_p.K238fs|PBX3_ENST00000373487.4_Frame_Shift_Del_p.K238fs	NM_006195.5	NP_006186.1	P40426	PBX3_HUMAN	pre-B-cell leukemia homeobox 3	238					adult locomotory behavior (GO:0008344)|anterior compartment pattern formation (GO:0007387)|dorsal spinal cord development (GO:0021516)|neuron development (GO:0048666)|posterior compartment specification (GO:0007388)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)|upper_aerodigestive_tract(2)	24						TCATAGACGGAAAAGGCGTAA	0.393																																																	0													92.0	85.0	87.0					9																	128697755		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS6865.1, CCDS48021.1	9q33.3	2011-06-20	2007-01-30		ENSG00000167081	ENSG00000167081		"""Homeoboxes / TALE class"""	8634	protein-coding gene	gene with protein product		176312	"""pre-B-cell leukemia transcription factor 3"""			1682799	Standard	NM_006195		Approved		uc004bqb.3	P40426	OTTHUMG00000020684	ENST00000373489.5:c.712delA	9.37:g.128697755delA	ENSP00000362588:p.Lys238fs		E9PB27|Q5JSA0|Q5JSA1|Q5VXL3|Q96PF9|Q96PG0	Frame_Shift_Del	DEL	pfam_PBX,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R239fs	ENST00000373489.5	37	c.712	CCDS6865.1	9																																																																																			PBX3	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000167081		0.393	PBX3-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PBX3	HGNC	protein_coding	OTTHUMT00000417765.1		0.00	23	0	A			128697755	+1	tier1		no_errors	ENST00000373489	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	1.000	-
PDLIM5	10611	genome.wustl.edu	37	4	95503830	95503830	+	Intron	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr4:95503830T>C	ENST00000317968.4	+	6	846				PDLIM5_ENST00000538141.1_Intron|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000514743.1_Intron|PDLIM5_ENST00000542407.1_Intron|PDLIM5_ENST00000380180.3_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5						regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TTCTCTACTCTATCGCATCTT	0.358																																																	0													202.0	176.0	184.0					4																	95503830		1845	4104	5949	SO:0001627	intron_variant	0			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.711-2886T>C	4.37:g.95503830T>C			A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	RNA	SNP	-	NULL	ENST00000317968.4	37	NULL	CCDS3641.1	4																																																																																			PDLIM5	-	-	ENSG00000163110		0.358	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	HGNC	protein_coding	OTTHUMT00000253586.1	-	0.00	26	0	T			95503830	+1	tier1	-	no_errors	ENST00000514830	ensembl	human	known	74_37	rna	41.94	18	13	SNP	0.000	C
PIK3C2A	5286	genome.wustl.edu	37	11	17190418	17190418	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:17190418C>A	ENST00000265970.7	-	1	870	c.871G>T	c.(871-873)Gaa>Taa	p.E291*	PIK3C2A_ENST00000540361.1_Intron|PIK3C2A_ENST00000531428.1_Intron	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	291					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TTTTTCTCTTCCTCATGGTCT	0.398																																																	0													169.0	163.0	165.0					11																	17190418		2200	4293	6493	SO:0001587	stop_gained	0			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.871G>T	11.37:g.17190418C>A	ENSP00000265970:p.Glu291*		B0LPH2|B4E2G4|Q14CQ9	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.E291*	ENST00000265970.7	37	c.871	CCDS7824.1	11	.	.	.	.	.	.	.	.	.	.	C	19.78	3.891510	0.72524	.	.	ENSG00000011405	ENST00000265970;ENST00000544896	.	.	.	5.3	5.3	0.74995	.	0.620727	0.16623	N	0.206389	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-19.9778	14.5589	0.68120	0.0:0.8539:0.1461:0.0	.	.	.	.	X	291	.	ENSP00000265970:E291X	E	-	1	0	PIK3C2A	17146994	0.758000	0.28405	0.953000	0.39169	0.700000	0.40528	2.551000	0.45820	2.467000	0.83353	0.563000	0.77884	GAA	PIK3C2A	-	NULL	ENSG00000011405		0.398	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1		0.00	34	0	C	NM_002645		17190418	-1			no_errors	ENST00000265970	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	0.996	A
PLTP	5360	genome.wustl.edu	37	20	44538215	44538215	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr20:44538215G>T	ENST00000477313.1	-	4	1019	c.425C>A	c.(424-426)tCc>tAc	p.S142Y	PLTP_ENST00000542937.1_Missense_Mutation_p.S162Y|PLTP_ENST00000420868.2_Intron|PLTP_ENST00000354050.4_Intron|PLTP_ENST00000372420.1_Missense_Mutation_p.S54Y|PLTP_ENST00000372431.3_Missense_Mutation_p.S142Y			P55058	PLTP_HUMAN	phospholipid transfer protein	142					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|sperm motility (GO:0030317)|vitamin E biosynthetic process (GO:0010189)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)			endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)	21		Myeloproliferative disorder(115;0.0122)				GGAGACATTGGACACTTTCAT	0.617																																																	0													75.0	72.0	73.0					20																	44538215		2203	4300	6503	SO:0001583	missense	0			L26232	CCDS13386.1, CCDS13387.1, CCDS56196.1, CCDS56197.1	20q13.12	2011-08-16			ENSG00000100979	ENSG00000100979		"""BPI fold containing"""	9093	protein-coding gene	gene with protein product	"""BPI fold containing family E"""	172425					Standard	NM_006227		Approved	BPIFE	uc002xqn.2	P55058	OTTHUMG00000033047	ENST00000477313.1:c.425C>A	20.37:g.44538215G>T	ENSP00000417138:p.Ser142Tyr		A8K006|B4DDD5|B4DRB4|E1P5N8|E7EV16|Q8WTT1|Q9BR07|Q9BSH8	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.S162Y	ENST00000477313.1	37	c.485	CCDS13386.1	20	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424249	0.62733	.	.	ENSG00000100979	ENST00000372420;ENST00000372431;ENST00000477313;ENST00000542937	T;T;T;T	0.06608	3.28;3.28;3.28;3.28	4.97	4.02	0.46733	Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.362430	0.32093	N	0.006591	T	0.20129	0.0484	M	0.68593	2.085	0.47214	D	0.999358	D;D;D;D	0.63046	0.986;0.986;0.986;0.992	P;P;P;P	0.62885	0.857;0.908;0.908;0.908	T	0.00726	-1.1592	10	0.87932	D	0	-17.6368	13.5352	0.61643	0.0753:0.0:0.9247:0.0	.	54;142;142;162	B4DDD5;Q53H91;P55058;B3KUE5	.;.;PLTP_HUMAN;.	Y	54;142;142;162	ENSP00000361497:S54Y;ENSP00000361508:S142Y;ENSP00000417138:S142Y;ENSP00000440296:S162Y	ENSP00000361497:S54Y	S	-	2	0	PLTP	43971622	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	4.137000	0.58010	1.329000	0.45376	0.462000	0.41574	TCC	PLTP	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000100979		0.617	PLTP-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLTP	HGNC	protein_coding	OTTHUMT00000354633.1		0.00	17	0	G	NM_006227		44538215	-1			no_errors	ENST00000542937	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
POP5	51367	genome.wustl.edu	37	12	121017030	121017031	+	3'UTR	DEL	TG	TG	-			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:121017030_121017031delTG	ENST00000357500.4	-	0	617_618				POP5_ENST00000542776.1_5'UTR|POP5_ENST00000341039.2_3'UTR	NM_015918.3	NP_057002.2	Q969H6	POP5_HUMAN	processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae)						tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	all_neural(191;0.077)|Medulloblastoma(191;0.0922)					TTTGGAAAACTGTGGAAGATGC	0.485																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ306296	CCDS9202.1, CCDS9203.1	12q24.31	2012-05-21			ENSG00000167272	ENSG00000167272			17689	protein-coding gene	gene with protein product		609992				11413139	Standard	NM_198202		Approved		uc001tys.3	Q969H6	OTTHUMG00000169023	ENST00000357500.4:c.*91CA>-	12.37:g.121017032_121017033delTG			A6NL80|Q53FS5|Q9Y2Q6	RNA	DEL	-	NULL	ENST00000357500.4	37	NULL	CCDS9202.1	12																																																																																			POP5	-	-	ENSG00000167272		0.485	POP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP5	HGNC	protein_coding	OTTHUMT00000401993.1		0.00	17	0	TG	NM_015918		121017031	-1	tier1		no_errors	ENST00000542776	ensembl	human	known	74_37	rna	18.52	22	5	DEL	0.000:0.000	-
PRCP	5547	genome.wustl.edu	37	11	82611294	82611294	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr11:82611294G>A	ENST00000313010.3	-	1	345	c.151C>T	c.(151-153)Ctc>Ttc	p.L51F	PRCP_ENST00000535099.1_Intron|PRCP_ENST00000393399.2_Missense_Mutation_p.L51F|C11orf82_ENST00000525388.1_5'Flank|C11orf82_ENST00000528759.1_5'Flank|C11orf82_ENST00000525361.1_5'Flank|C11orf82_ENST00000430323.2_5'Flank|C11orf82_ENST00000524921.1_5'Flank|C11orf82_ENST00000533655.1_5'Flank	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	51					angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TGGAAGTAGAGAACCGAATAG	0.652																																																	0													69.0	79.0	75.0					11																	82611294		2203	4300	6503	SO:0001583	missense	0			BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.151C>T	11.37:g.82611294G>A	ENSP00000317362:p.Leu51Phe		A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	pfam_Peptidase_S28	p.L51F	ENST00000313010.3	37	c.151	CCDS8262.1	11	.	.	.	.	.	.	.	.	.	.	G	13.75	2.331021	0.41297	.	.	ENSG00000137509	ENST00000313010;ENST00000393399	T;T	0.15017	2.53;2.46	3.92	3.01	0.34805	.	0.760259	0.12543	N	0.459778	T	0.07863	0.0197	N	0.08118	0	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.001;0.004	T	0.21075	-1.0256	9	.	.	.	0.6475	7.5979	0.28058	0.1158:0.0:0.8842:0.0	.	51;51	P42785;A8MU24	PCP_HUMAN;.	F	51	ENSP00000317362:L51F;ENSP00000377055:L51F	.	L	-	1	0	PRCP	82288942	0.989000	0.36119	0.654000	0.29608	0.882000	0.50991	1.557000	0.36299	1.246000	0.43901	0.563000	0.77884	CTC	PRCP	-	NULL	ENSG00000137509		0.652	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCP	HGNC	protein_coding	OTTHUMT00000391792.1	-	0.00	69	0	G	NM_005040		82611294	-1	tier1	-	no_errors	ENST00000393399	ensembl	human	known	74_37	missense	14.94	131	23	SNP	0.764	A
PRKCH	5583	genome.wustl.edu	37	14	61788845	61788845	+	Missense_Mutation	SNP	A	A	G	rs371540089		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr14:61788845A>G	ENST00000332981.5	+	1	411	c.26A>G	c.(25-27)aAt>aGt	p.N9S	PRKCH_ENST00000555082.1_5'Flank|RP11-902B17.1_ENST00000500036.2_RNA	NM_006255.3	NP_006246.2	P24723	KPCL_HUMAN	protein kinase C, eta	9					blood coagulation (GO:0007596)|negative regulation of glial cell apoptotic process (GO:0034351)|platelet activation (GO:0030168)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein kinase C signaling (GO:0070528)|protein phosphorylation (GO:0006468)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25				OV - Ovarian serous cystadenocarcinoma(108;0.045)|BRCA - Breast invasive adenocarcinoma(234;0.0906)|KIRC - Kidney renal clear cell carcinoma(182;0.182)		ATGAAGTTCAATGGCTATTTG	0.692																																					Melanoma(135;863 1779 8064 14443 26348)												0								A	SER/ASN	2,4402		0,2,2200	19.0	18.0	18.0		26	3.6	1.0	14		18	0,8590		0,0,4295	no	missense	PRKCH	NM_006255.3	46	0,2,6495	GG,GA,AA		0.0,0.0454,0.0154	benign	9/684	61788845	2,12992	2202	4295	6497	SO:0001583	missense	0			M55284	CCDS9752.1	14q23.1	2009-07-10			ENSG00000027075	ENSG00000027075	2.7.11.1		9403	protein-coding gene	gene with protein product		605437		PRKCL		1986216, 1545821	Standard	NM_006255		Approved	PKC-L, PKCL	uc001xfn.3	P24723	OTTHUMG00000152341	ENST00000332981.5:c.26A>G	14.37:g.61788845A>G	ENSP00000329127:p.Asn9Ser		B4DJN5|Q16246|Q8NE03	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.N9S	ENST00000332981.5	37	c.26	CCDS9752.1	14	.	.	.	.	.	.	.	.	.	.	A	11.14	1.551772	0.27739	4.54E-4	0.0	ENSG00000027075	ENST00000557294;ENST00000332981	T;T	0.08546	3.08;3.08	4.76	3.62	0.41486	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000008	T	0.07954	0.0199	L	0.43152	1.355	0.80722	D	1	B	0.15719	0.014	B	0.17722	0.019	T	0.21211	-1.0252	10	0.29301	T	0.29	.	9.051	0.36376	0.8443:0.0:0.1557:0.0	.	9	P24723	KPCL_HUMAN	S	9	ENSP00000452129:N9S;ENSP00000329127:N9S	ENSP00000329127:N9S	N	+	2	0	PRKCH	60858598	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	3.004000	0.49513	0.682000	0.31407	0.533000	0.62120	AAT	PRKCH	-	superfamily_C2_dom,pirsf_Prot_kin_PKC_delta	ENSG00000027075		0.692	PRKCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCH	HGNC	protein_coding	OTTHUMT00000276974.2	-	0.00	26	0	A	NM_006255		61788845	+1	tier1	-	no_errors	ENST00000332981	ensembl	human	known	74_37	missense	47.22	19	17	SNP	1.000	G
PTPRO	5800	genome.wustl.edu	37	12	15710404	15710404	+	Silent	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:15710404T>C	ENST00000281171.4	+	16	2904	c.2574T>C	c.(2572-2574)ggT>ggC	p.G858G	PTPRO_ENST00000544244.1_Silent_p.G47G|PTPRO_ENST00000542557.1_Silent_p.G47G|PTPRO_ENST00000348962.2_Silent_p.G858G|PTPRO_ENST00000442921.2_Silent_p.G47G|PTPRO_ENST00000445537.2_Silent_p.G47G	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	858					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				GTGGAGCTGGTACATTTGTCA	0.388																																																	0													213.0	198.0	203.0					12																	15710404		2203	4300	6503	SO:0001819	synonymous_variant	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.2574T>C	12.37:g.15710404T>C			A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.G858	ENST00000281171.4	37	c.2574	CCDS8675.1	12																																																																																			PTPRO	-	NULL	ENSG00000151490		0.388	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1	-	0.00	42	0	T			15710404	+1	tier1	-	no_errors	ENST00000281171	ensembl	human	known	74_37	silent	31.43	48	22	SNP	0.983	C
QSOX1	5768	genome.wustl.edu	37	1	180165983	180165983	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:180165983G>T	ENST00000367602.3	+	12	2129	c.2055G>T	c.(2053-2055)caG>caT	p.Q685H	QSOX1_ENST00000367600.5_Intron			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	685					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTGAGGGCCAGCTGGAGGCCC	0.672																																																	0													40.0	53.0	49.0					1																	180165983		2198	4297	6495	SO:0001583	missense	0			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.2055G>T	1.37:g.180165983G>T	ENSP00000356574:p.Gln685His		Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	pfam_ERV/ALR_sulphydryl_oxidase,pfam_Thioredoxin_domain,superfamily_ERV/ALR_sulphydryl_oxidase,superfamily_Thioredoxin-like_fold	p.Q685H	ENST00000367602.3	37	c.2055	CCDS1337.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.86|12.86	2.064427|2.064427	0.36470|0.36470	.|.	.|.	ENSG00000116260|ENSG00000116260	ENST00000367602|ENST00000443059	T|.	0.04654|.	3.58|.	4.92|4.92	3.0|3.0	0.34707|0.34707	.|.	1.188210|.	0.05574|.	N|.	0.571666|.	T|T	0.30854|0.30854	0.0778|0.0778	N|N	0.08118|0.08118	0|0	0.51767|0.51767	D|D	0.999936|0.999936	B|.	0.22909|.	0.077|.	B|.	0.11329|.	0.006|.	T|T	0.04650|0.04650	-1.0936|-1.0936	10|5	0.52906|.	T|.	0.07|.	-13.1524|-13.1524	7.1229|7.1229	0.25454|0.25454	0.2071:0.0:0.7928:0.0|0.2071:0.0:0.7928:0.0	.|.	685|.	O00391|.	QSOX1_HUMAN|.	H|I	685|56	ENSP00000356574:Q685H|.	ENSP00000356574:Q685H|.	Q|S	+|+	3|2	2|0	QSOX1|QSOX1	178432606|178432606	0.029000|0.029000	0.19370|0.19370	0.380000|0.380000	0.26093|0.26093	0.114000|0.114000	0.19823|0.19823	-0.390000|-0.390000	0.07332|0.07332	1.024000|1.024000	0.39682|0.39682	0.400000|0.400000	0.26472|0.26472	CAG|AGC	QSOX1	-	NULL	ENSG00000116260		0.672	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	HGNC	protein_coding	OTTHUMT00000085289.1	-	0.00	90	0	G	NM_002826		180165983	+1	tier1	-	no_errors	ENST00000367602	ensembl	human	known	74_37	missense	6.67	98	7	SNP	0.535	T
RABGAP1	23637	genome.wustl.edu	37	9	125827753	125827753	+	Intron	DEL	A	A	-	rs3214358		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr9:125827753delA	ENST00000373647.4	+	14	2042				RABGAP1_ENST00000493854.1_Intron|RABGAP1_ENST00000373643.5_Intron	NM_012197.3	NP_036329.3	Q9Y3P9	RBGP1_HUMAN	RAB GTPase activating protein 1						cell cycle (GO:0007049)|positive regulation of GTPase activity (GO:0043547)|regulation of GTP catabolic process (GO:0033124)	centrosome (GO:0005813)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)	DNA binding (GO:0003677)|GTPase activator activity (GO:0005096)|Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)|tubulin binding (GO:0015631)			breast(3)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|prostate(4)|stomach(3)|upper_aerodigestive_tract(1)	41						ATTTCATGTCAAAAAAAAAAA	0.343																																																	0													36.0	38.0	37.0					9																	125827753		2203	4300	6503	SO:0001627	intron_variant	0			AJ011679	CCDS6848.2	9q34.11	2013-07-09			ENSG00000011454	ENSG00000011454			17155	protein-coding gene	gene with protein product	"""rab6 GTPase activating protein (GAP and centrosome-associated)"", ""TBC1 domain family, member 11"""	615882				10202141	Standard	NM_012197		Approved	GAPCenA, TBC1D11	uc011lzh.2	Q9Y3P9	OTTHUMG00000020633	ENST00000373647.4:c.1908+13A>-	9.37:g.125827753delA			B9A6L2|Q05CW2|Q6ZMY1|Q9HA28|Q9P0E2|Q9UG67	Frame_Shift_Del	DEL	pfam_Kinesin-like,pfam_Rab-GTPase-TBC_dom,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.K576fs	ENST00000373647.4	37	c.1717	CCDS6848.2	9																																																																																			RABGAP1	-	pfscan_Rab-GTPase-TBC_dom	ENSG00000011454		0.343	RABGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1	HGNC	protein_coding	OTTHUMT00000053976.3		0.00	17	0	A	NM_012197		125827753	+1	tier1		no_errors	ENST00000456584	ensembl	human	known	74_37	frame_shift_del	16.67	15	3	DEL	0.000	-
RNY5	6090	genome.wustl.edu	37	7	148638612	148638612	+	RNA	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:148638612T>C	ENST00000516501.1	+	0	33					NR_001571.2				RNA, Ro-associated Y5																		tattgttaagttgatttaaca	0.393																																																	0													181.0	163.0	168.0					7																	148638612		692	1591	2283			0			U64824		7q36	2013-05-03	2008-03-26		ENSG00000252310			"""Y RNAs (Ro-associated)"""	10248	non-coding RNA	RNA, Y		601824	"""RNA, Y5 small cytoplasmic (associated with Ro protein)"""			7520568	Standard	NR_001571		Approved		uc010slc.1				7.37:g.148638612T>C				RNA	SNP	-	NULL	ENST00000516501.1	37	NULL		7																																																																																			RNY5	-	-	ENSG00000252310		0.393	RNY5-201	KNOWN	basic	misc_RNA	RNY5	HGNC	misc_RNA		-	0.00	29	0	T	NR_001571		148638612	+1	tier1	-	no_errors	ENST00000516501	ensembl	human	known	74_37	rna	35.14	24	13	SNP	0.011	C
RPAP1	26015	genome.wustl.edu	37	15	41829177	41829177	+	Silent	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr15:41829177C>T	ENST00000304330.4	-	2	263	c.147G>A	c.(145-147)ccG>ccA	p.P49P	RPAP1_ENST00000561603.1_Silent_p.P49P	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	49						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGTCCTGGAGCGGAGGCCGGT	0.582																																																	0													172.0	155.0	161.0					15																	41829177		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.147G>A	15.37:g.41829177C>T			Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.P49	ENST00000304330.4	37	c.147	CCDS10079.1	15																																																																																			RPAP1	-	NULL	ENSG00000103932		0.582	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	-	0.00	20	0	C	NM_015540		41829177	-1	tier1	-	no_errors	ENST00000304330	ensembl	human	known	74_37	silent	16.67	25	5	SNP	0.000	T
RTN1	6252	genome.wustl.edu	37	14	60193708	60193708	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr14:60193708G>A	ENST00000267484.5	-	3	2029	c.1694C>T	c.(1693-1695)gCg>gTg	p.A565V		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	565					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.A565E(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CTTTGTGGCCGCAGGACTTTG	0.617																																																	1	Substitution - Missense(1)	lung(1)											23.0	25.0	24.0					14																	60193708		2203	4300	6503	SO:0001583	missense	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1694C>T	14.37:g.60193708G>A	ENSP00000267484:p.Ala565Val		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.A565V	ENST00000267484.5	37	c.1694	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	G	4.575	0.106728	0.08780	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000433623	T	0.22336	1.96	4.76	-9.36	0.00629	.	3.925960	0.00531	N	0.000202	T	0.08758	0.0217	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.15665	-1.0429	10	0.27785	T	0.31	.	3.1537	0.06497	0.4605:0.0842:0.2864:0.1689	.	565	Q16799	RTN1_HUMAN	V	145;565;491	ENSP00000267484:A565V	ENSP00000267484:A565V	A	-	2	0	RTN1	59263461	0.022000	0.18835	0.000000	0.03702	0.003000	0.03518	0.394000	0.20834	-1.933000	0.01052	-1.595000	0.00837	GCG	RTN1	-	NULL	ENSG00000139970		0.617	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	-	0.00	58	0	G			60193708	-1	tier1	-	no_errors	ENST00000267484	ensembl	human	known	74_37	missense	43.84	41	32	SNP	0.000	A
RUNX1T1	862	genome.wustl.edu	37	8	92972475	92972475	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr8:92972475G>A	ENST00000523629.1	-	12	2264	c.1810C>T	c.(1810-1812)Cgc>Tgc	p.R604C	RUNX1T1_ENST00000422361.2_Missense_Mutation_p.R567C|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.R567C|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.R615C|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.R567C|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.R577C|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.R577C|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.R604C	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	604					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CACGTCTAGCGAGGGGTTGTC	0.542																																																	0													69.0	45.0	53.0					8																	92972475		2203	4300	6503	SO:0001583	missense	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1810C>T	8.37:g.92972475G>A	ENSP00000428543:p.Arg604Cys		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.R615C	ENST00000523629.1	37	c.1843	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500011	0.64298	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.38722	1.14;1.18;1.14;1.2;1.2;1.2;1.12;1.18	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.59528	0.2200	L	0.43923	1.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.986	D;D;D;D	0.71414	0.973;0.973;0.973;0.963	T	0.59974	-0.7353	10	0.87932	D	0	.	19.8956	0.96956	0.0:0.0:1.0:0.0	.	615;567;604;577	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	C	604;577;604;567;567;567;615;577	ENSP00000428543:R604C;ENSP00000379520:R577C;ENSP00000265814:R604C;ENSP00000353504:R567C;ENSP00000390137:R567C;ENSP00000428742:R567C;ENSP00000402257:R615C;ENSP00000430728:R577C	ENSP00000265814:R604C	R	-	1	0	RUNX1T1	93041651	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.823000	0.92018	2.708000	0.92522	0.563000	0.77884	CGC	RUNX1T1	-	NULL	ENSG00000079102		0.542	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	-	0.00	93	0	G	NM_004349, NM_175635		92972475	-1	tier1	-	no_errors	ENST00000436581	ensembl	human	known	74_37	missense	15.15	84	15	SNP	1.000	A
SCN11A	11280	genome.wustl.edu	37	3	38962700	38962700	+	Silent	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr3:38962700C>A	ENST00000302328.3	-	6	957	c.759G>T	c.(757-759)ctG>ctT	p.L253L	SCN11A_ENST00000456224.3_Silent_p.L253L|SCN11A_ENST00000450244.1_Silent_p.L253L|SCN11A_ENST00000444237.2_Silent_p.L253L	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	253					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCACGTTGACCAGCTTCTTCA	0.542																																																	0													138.0	133.0	134.0					3																	38962700		2203	4300	6503	SO:0001819	synonymous_variant	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.759G>T	3.37:g.38962700C>A			A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.L253	ENST00000302328.3	37	c.759	CCDS33737.1	3																																																																																			SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.542	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	-	0.00	18	0	C	NM_014139		38962700	-1	tier1	-	no_errors	ENST00000302328	ensembl	human	known	74_37	silent	21.05	15	4	SNP	0.000	A
SIN3A	25942	genome.wustl.edu	37	15	75668064	75668064	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr15:75668064T>C	ENST00000394947.3	-	20	3847	c.3533A>G	c.(3532-3534)tAt>tGt	p.Y1178C	SIN3A_ENST00000360439.4_Missense_Mutation_p.Y1178C|SIN3A_ENST00000394949.4_Missense_Mutation_p.Y1178C	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						TTTGATCACATACACCATCTT	0.468																																																	0													246.0	196.0	213.0					15																	75668064		2197	4294	6491	SO:0001583	missense	0			AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.3533A>G	15.37:g.75668064T>C	ENSP00000378402:p.Tyr1178Cys			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.Y1178C	ENST00000394947.3	37	c.3533	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373453	0.82573	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.62498	0.02;0.02;0.02	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.77116	0.4083	M	0.70275	2.135	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.80236	-0.1466	10	0.87932	D	0	-14.0574	14.2605	0.66083	0.0:0.0:0.0:1.0	.	1178	Q96ST3	SIN3A_HUMAN	C	1178	ENSP00000378402:Y1178C;ENSP00000378403:Y1178C;ENSP00000353622:Y1178C	ENSP00000353622:Y1178C	Y	-	2	0	SIN3A	73455117	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.966000	0.63715	1.980000	0.57719	0.533000	0.62120	TAT	SIN3A	-	NULL	ENSG00000169375		0.468	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	-	0.00	34	0	T	NM_015477		75668064	-1	tier1	-	no_errors	ENST00000360439	ensembl	human	known	74_37	missense	15.38	44	8	SNP	1.000	C
SIRT1	23411	genome.wustl.edu	37	10	69644841	69644841	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr10:69644841A>G	ENST00000212015.6	+	1	415	c.362A>G	c.(361-363)tAc>tGc	p.Y121C	SIRT1_ENST00000432464.1_5'Flank	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	121	Interaction with CLOCK. {ECO:0000250|UniProtKB:Q923E4}.|Interaction with HIST1H1E.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						GACAACTTGTacgacgaagac	0.716																																																	0													3.0	4.0	4.0					10																	69644841		1725	3545	5270	SO:0001583	missense	0			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.362A>G	10.37:g.69644841A>G	ENSP00000212015:p.Tyr121Cys		Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.Y121C	ENST00000212015.6	37	c.362	CCDS7273.1	10	.	.	.	.	.	.	.	.	.	.	a	9.886	1.203024	0.22121	.	.	ENSG00000096717	ENST00000212015	T	0.33654	1.4	3.34	2.18	0.27775	.	2.324550	0.02346	U	0.075351	T	0.28532	0.0706	L	0.29908	0.895	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12528	-1.0544	10	0.36615	T	0.2	8.1065	5.2062	0.15293	0.7318:0.0:0.2682:0.0	.	121	Q96EB6	SIRT1_HUMAN	C	121	ENSP00000212015:Y121C	ENSP00000212015:Y121C	Y	+	2	0	SIRT1	69314847	0.698000	0.27777	0.729000	0.30791	0.479000	0.33129	0.461000	0.21940	0.305000	0.22832	0.454000	0.30748	TAC	SIRT1	-	NULL	ENSG00000096717		0.716	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT1	HGNC	protein_coding	OTTHUMT00000048296.1		0.00	9	0	A			69644841	+1			no_errors	ENST00000212015	ensembl	human	known	74_37	missense	50.00	3	3	SNP	0.984	G
SLC6A10P	386757	genome.wustl.edu	37	16	32890602	32890602	+	RNA	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr16:32890602C>A	ENST00000330048.5	-	0	3196					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		CTCACCCCACCACGGGTACAC	0.592																																																	0																																												0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890602C>A				RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.592	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	-	0.00	109	0	C			32890602	-1	tier1	-	no_errors	ENST00000330048	ensembl	human	known	74_37	rna	18.75	104	24	SNP	1.000	A
SLCO1B1	10599	genome.wustl.edu	37	12	21349897	21349897	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:21349897C>T	ENST00000256958.2	+	8	841	c.745C>T	c.(745-747)Cct>Tct	p.P249S		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	249					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	CAGGATAACTCCTACTGATTC	0.358																																																	0													189.0	178.0	181.0					12																	21349897		2203	4300	6503	SO:0001583	missense	0				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.745C>T	12.37:g.21349897C>T	ENSP00000256958:p.Pro249Ser		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.P249S	ENST00000256958.2	37	c.745	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	C	13.21	2.169167	0.38315	.	.	ENSG00000134538	ENST00000256958	T	0.38560	1.13	3.24	3.24	0.37175	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.378221	0.27976	N	0.017087	T	0.57344	0.2047	M	0.74881	2.28	0.47214	D	0.999359	P	0.52061	0.95	P	0.57283	0.817	T	0.63567	-0.6608	10	0.59425	D	0.04	.	12.7505	0.57306	0.0:1.0:0.0:0.0	.	249	Q9Y6L6	SO1B1_HUMAN	S	249	ENSP00000256958:P249S	ENSP00000256958:P249S	P	+	1	0	SLCO1B1	21241164	0.938000	0.31826	0.994000	0.49952	0.117000	0.20001	4.029000	0.57253	1.797000	0.52628	0.491000	0.48974	CCT	SLCO1B1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000134538		0.358	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	HGNC	protein_coding	OTTHUMT00000402070.1	-	0.00	78	0	C	NM_006446		21349897	+1	tier1	-	no_errors	ENST00000256958	ensembl	human	known	74_37	missense	40.38	62	42	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18840639	18840639	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr16:18840639T>A	ENST00000446231.2	-	54	9984	c.9572A>T	c.(9571-9573)cAg>cTg	p.Q3191L	SMG1_ENST00000389467.3_Missense_Mutation_p.Q3191L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3191					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTGAACCCGCTGCAGGCTTGT	0.413																																																	0													45.0	42.0	43.0					16																	18840639		1879	4108	5987	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9572A>T	16.37:g.18840639T>A	ENSP00000402515:p.Gln3191Leu		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q3191L	ENST00000446231.2	37	c.9572	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	T	18.48	3.633991	0.67130	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01203	5.18;5.18	5.71	5.71	0.89125	.	0.097264	0.45867	N	0.000332	T	0.01222	0.0040	N	0.20986	0.625	0.50632	D	0.999882	P	0.43477	0.808	B	0.37144	0.242	T	0.77694	-0.2492	10	0.36615	T	0.2	.	16.0341	0.80608	0.0:0.0:0.0:1.0	.	3191	Q96Q15	SMG1_HUMAN	L	3191	ENSP00000402515:Q3191L;ENSP00000374118:Q3191L	ENSP00000374118:Q3191L	Q	-	2	0	SMG1	18748140	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.008000	0.88588	2.178000	0.69098	0.472000	0.43445	CAG	SMG1	-	NULL	ENSG00000157106		0.413	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1		0.00	14	0	T	NM_015092		18840639	-1			no_errors	ENST00000389467	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
SMYD4	114826	genome.wustl.edu	37	17	1703986	1703986	+	Silent	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:1703986G>T	ENST00000305513.7	-	5	869	c.702C>A	c.(700-702)tcC>tcA	p.S234S		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	234	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						ATAAGCCGATGGATGATGAGG	0.507																																																	0													175.0	168.0	171.0					17																	1703986		2203	4300	6503	SO:0001819	synonymous_variant	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.702C>A	17.37:g.1703986G>T			Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.S234	ENST00000305513.7	37	c.702	CCDS11013.1	17																																																																																			SMYD4	-	NULL	ENSG00000186532		0.507	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4		0.00	34	0	G	XM_056082		1703986	-1			no_errors	ENST00000305513	ensembl	human	known	74_37	silent	7.41	25	2	SNP	0.667	T
SP140L	93349	genome.wustl.edu	37	2	231223688	231223688	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:231223688G>A	ENST00000415673.2	+	4	366	c.280G>A	c.(280-282)Gat>Aat	p.D94N	SP140_ENST00000486687.2_3'UTR|SP140L_ENST00000243810.6_Missense_Mutation_p.D94N|SP140L_ENST00000444636.1_Missense_Mutation_p.D94N|SP140L_ENST00000458341.1_Missense_Mutation_p.D7N|SP140L_ENST00000396563.4_Missense_Mutation_p.D94N	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	94	HSR. {ECO:0000255|PROSITE- ProRule:PRU00747}.					nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						GGATTCTGAAGATTCTTGTAG	0.343																																																	0													95.0	103.0	100.0					2																	231223688		2202	4300	6502	SO:0001583	missense	0			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.280G>A	2.37:g.231223688G>A	ENSP00000397911:p.Asp94Asn		Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.D94N	ENST00000415673.2	37	c.280	CCDS46538.1	2	.	.	.	.	.	.	.	.	.	.	G	16.88	3.244062	0.59103	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563;ENST00000458341	D;D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47;-3.47	2.96	2.96	0.34315	.	.	.	.	.	D	0.95674	0.8593	M	0.64997	1.995	0.21675	N	0.999599	D;D	0.76494	0.999;0.996	D;P	0.74348	0.983;0.824	D	0.88392	0.3009	9	0.33141	T	0.24	.	9.6203	0.39716	0.0:0.0:1.0:0.0	.	7;94	Q9H930-3;Q9H930-4	.;.	N	94;94;94;94;7	ENSP00000395195:D94N;ENSP00000397911:D94N;ENSP00000243810:D94N;ENSP00000379811:D94N;ENSP00000395223:D7N	ENSP00000243810:D94N	D	+	1	0	SP140L	230931932	0.921000	0.31238	0.340000	0.25575	0.920000	0.55202	2.147000	0.42226	1.949000	0.56562	0.491000	0.48974	GAT	SP140L	-	pfam_Sp100	ENSG00000185404		0.343	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SP140L	HGNC	protein_coding	OTTHUMT00000374538.1	-	0.00	40	0	G	NM_138402		231223688	+1	tier1	-	no_errors	ENST00000415673	ensembl	human	known	74_37	missense	42.31	15	11	SNP	0.460	A
SPAM1	6677	genome.wustl.edu	37	7	123594116	123594116	+	Silent	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr7:123594116C>T	ENST00000439500.1	+	4	1105	c.492C>T	c.(490-492)taC>taT	p.Y164Y	SPAM1_ENST00000223028.7_Silent_p.Y164Y|SPAM1_ENST00000340011.5_Silent_p.Y164Y|SPAM1_ENST00000402183.2_Silent_p.Y164Y|SPAM1_ENST00000460182.1_Silent_p.Y164Y	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	164					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)			breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						AAGATGTTTACAAGAATAGGT	0.393																																																	0													65.0	67.0	67.0					7																	123594116		2203	4300	6503	SO:0001819	synonymous_variant	0			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.492C>T	7.37:g.123594116C>T			Q8TC30	Silent	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.Y164	ENST00000439500.1	37	c.492	CCDS5791.1	7																																																																																			SPAM1	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase	ENSG00000106304		0.393	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	HGNC	protein_coding	OTTHUMT00000348309.1	-	0.00	14	0	C			123594116	+1	tier1	-	no_errors	ENST00000340011	ensembl	human	known	74_37	silent	40.91	13	9	SNP	0.879	T
SPATA16	83893	genome.wustl.edu	37	3	172643275	172643275	+	Silent	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr3:172643275T>C	ENST00000351008.3	-	7	1272	c.1089A>G	c.(1087-1089)caA>caG	p.Q363Q		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	363					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TGTGGAGTGCTTGAAGATCTG	0.378																																																	0													81.0	79.0	80.0					3																	172643275		2203	4300	6503	SO:0001819	synonymous_variant	0			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.1089A>G	3.37:g.172643275T>C			Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Silent	SNP	NULL	p.Q363	ENST00000351008.3	37	c.1089	CCDS3221.1	3																																																																																			SPATA16	-	NULL	ENSG00000144962		0.378	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA16	HGNC	protein_coding	OTTHUMT00000346322.1	-	0.00	55	0	T	NM_031955		172643275	-1	tier1	-	no_errors	ENST00000351008	ensembl	human	known	74_37	silent	23.58	81	25	SNP	0.958	C
SPATA31A6	389730	genome.wustl.edu	37	9	43627428	43627428	+	Missense_Mutation	SNP	G	G	A	rs11261835	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr9:43627428G>A	ENST00000332857.6	-	4	1287	c.1259C>T	c.(1258-1260)cCc>cTc	p.P420L	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	420					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.P420L(1)									GTGCAGAGAGGGGAGGCCCCA	0.498													G|||	2290	0.457268	0.3593	0.4424	5008	,	,		13778	0.6508		0.4891	False		,,,				2504	0.3681																1	Substitution - Missense(1)	kidney(1)											4.0	6.0	5.0					9																	43627428		577	1492	2069	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1259C>T	9.37:g.43627428G>A	ENSP00000329825:p.Pro420Leu			Missense_Mutation	SNP	NULL	p.P420L	ENST00000332857.6	37	c.1259	CCDS47973.1	9	1071	0.49038461538461536	187	0.3800813008130081	164	0.4530386740331492	357	0.6241258741258742	363	0.4788918205804749	G	16.62	3.174501	0.57692	.	.	ENSG00000185775	ENST00000332857	T	0.64618	-0.11	2.56	2.56	0.30785	.	0.000000	0.52532	D	0.000070	T	0.00012	0.0000	M	0.62154	1.92	0.26385	P	0.9766778	D	0.89917	1.0	D	0.97110	1.0	T	0.49986	-0.8880	9	0.87932	D	0	-6.7679	8.8215	0.35030	0.0:0.0:1.0:0.0	rs11261835	420	Q5VVP1	F75A6_HUMAN	L	420	ENSP00000329825:P420L	ENSP00000329825:P420L	P	-	2	0	FAM75A6	43567424	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.801000	0.47908	1.746000	0.51805	0.449000	0.29647	CCC	SPATA31A6	-	NULL	ENSG00000185775		0.498	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	HGNC	protein_coding	OTTHUMT00000036987.1		0.00	47	0	G	NM_001145196		43627428	-1			no_errors	ENST00000332857	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	A
SPTBN1	6711	genome.wustl.edu	37	2	54858121	54858121	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:54858121G>T	ENST00000356805.4	+	16	3218	c.2937G>T	c.(2935-2937)gaG>gaT	p.E979D	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E966D	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	979					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGGTCATCGAGTCCACCCAGG	0.582																																																	0													60.0	59.0	59.0					2																	54858121		2203	4300	6503	SO:0001583	missense	0				CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.2937G>T	2.37:g.54858121G>T	ENSP00000349259:p.Glu979Asp		B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.E979D	ENST00000356805.4	37	c.2937	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870367	0.72065	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.70631	-0.5;1.33	5.28	-3.04	0.05412	.	0.000000	0.85682	D	0.000000	T	0.66036	0.2749	M	0.64676	1.99	0.41058	D	0.985351	B;B	0.29232	0.105;0.238	B;B	0.36244	0.14;0.22	T	0.60611	-0.7229	10	0.59425	D	0.04	.	11.8564	0.52439	0.6467:0.0:0.3533:0.0	.	966;979	Q01082-3;Q01082	.;SPTB2_HUMAN	D	979;966	ENSP00000349259:E979D;ENSP00000334156:E966D	ENSP00000334156:E966D	E	+	3	2	SPTBN1	54711625	1.000000	0.71417	0.970000	0.41538	0.996000	0.88848	0.733000	0.26087	-0.565000	0.06061	0.655000	0.94253	GAG	SPTBN1	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000115306		0.582	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	HGNC	protein_coding	OTTHUMT00000258115.3		0.00	21	0	G			54858121	+1			no_errors	ENST00000356805	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.998	T
SRCAP	10847	genome.wustl.edu	37	16	30745119	30745119	+	Splice_Site	SNP	G	G	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr16:30745119G>C	ENST00000262518.4	+	29	6879	c.6494G>C	c.(6493-6495)aGg>aCg	p.R2165T	SRCAP_ENST00000395059.2_Splice_Site_p.R2103T|SRCAP_ENST00000344771.4_Splice_Site_p.R2007T	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2165	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CACATATATAGGTATTGCCTA	0.502																																																	0													105.0	106.0	106.0					16																	30745119		2197	4300	6497	SO:0001630	splice_region_variant	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6494+1G>C	16.37:g.30745119G>C			B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.R2165T	ENST00000262518.4	37	c.6494	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728267	0.30593	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.96041	-3.89;-3.89;-3.89	5.09	4.13	0.48395	Helicase, C-terminal (1);	0.000000	0.53938	D	0.000050	D	0.97554	0.9199	M	0.90425	3.115	0.41493	D	0.988231	D;D	0.76494	0.999;0.995	P;P	0.59948	0.866;0.617	D	0.98419	1.0576	10	0.87932	D	0	-11.9834	13.9616	0.64182	0.0:0.0:0.8469:0.1531	.	2103;2165	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	T	2165;2103;2007	ENSP00000262518:R2165T;ENSP00000378499:R2103T;ENSP00000343042:R2007T	ENSP00000262518:R2165T	R	+	2	0	SRCAP	30652620	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	9.578000	0.98200	1.348000	0.45733	0.563000	0.77884	AGG	SRCAP	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000080603		0.502	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	-	0.00	33	0	G	NM_006662	Missense_Mutation	30745119	+1	tier1	-	no_errors	ENST00000262518	ensembl	human	known	74_37	missense	40.74	32	22	SNP	1.000	C
SSTR2	6752	genome.wustl.edu	37	17	71165533	71165533	+	Silent	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:71165533G>T	ENST00000357585.2	+	2	444	c.75G>T	c.(73-75)gtG>gtT	p.V25V	RP11-143K11.5_ENST00000580671.1_RNA|SSTR2_ENST00000315332.2_Silent_p.V25V	NM_001050.2	NP_001041.1	P30874	SSR2_HUMAN	somatostatin receptor 2	25					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|digestion (GO:0007586)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|peristalsis (GO:0030432)|regulation of muscle contraction (GO:0006937)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|somatostatin receptor activity (GO:0004994)			endometrium(2)|large_intestine(5)|lung(2)|prostate(2)	11			LUSC - Lung squamous cell carcinoma(166;0.197)		Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	ATGGCTCTGTGGTGTCAACCA	0.478																																																	0													171.0	122.0	138.0					17																	71165533		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11691.1	17q24	2012-08-08				ENSG00000180616		"""GPCR / Class A : Somatostatin receptors"""	11331	protein-coding gene	gene with protein product		182452				8449518	Standard	NM_001050		Approved		uc002jje.3	P30874		ENST00000357585.2:c.75G>T	17.37:g.71165533G>T			A8K3Y0|B2R9P7|Q4VBP0|Q96GE0|Q96TF2|Q9BWH1	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Somatstn_rcpt_2,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Neuropept_B/W_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt,prints_Somatstn_rcpt_5	p.V25	ENST00000357585.2	37	c.75	CCDS11691.1	17																																																																																			SSTR2	-	prints_Somatstn_rcpt_2	ENSG00000180616		0.478	SSTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR2	HGNC	protein_coding	OTTHUMT00000441633.1	-	0.00	45	0	G			71165533	+1	tier1	-	no_errors	ENST00000357585	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.008	T
SUMO3	6612	genome.wustl.edu	37	21	46226696	46226696	+	3'UTR	SNP	T	T	G			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr21:46226696T>G	ENST00000397898.3	-	0	614				SUMO3_ENST00000411651.2_3'UTR|SUMO3_ENST00000332859.6_3'UTR|AL773604.8_ENST00000417820.1_RNA|SUMO3_ENST00000479153.1_5'UTR					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		AGTTACAGATTCATCCCTGCA	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000397898.3:c.*124A>C	21.37:g.46226696T>G				RNA	SNP	-	NULL	ENST00000397898.3	37	NULL		21																																																																																			SUMO3	-	-	ENSG00000184900		0.388	SUMO3-002	NOVEL	basic|exp_conf	protein_coding	SUMO3	HGNC	protein_coding	OTTHUMT00000206561.1	-	0.00	14	0	T			46226696	-1	tier1	-	no_errors	ENST00000479153	ensembl	human	known	74_37	rna	50.00	7	7	SNP	0.000	G
SYTL4	94121	genome.wustl.edu	37	X	99956215	99956215	+	Splice_Site	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chrX:99956215C>T	ENST00000372989.1	-	6	768		c.e6+1		SYTL4_ENST00000372981.1_Splice_Site|SYTL4_ENST00000276141.6_Splice_Site|SYTL4_ENST00000454200.2_Splice_Site|SYTL4_ENST00000455616.1_Splice_Site|SYTL4_ENST00000263033.5_Splice_Site	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGGTCCAGTACCTGCAGGTTT	0.473																																																	0													102.0	88.0	93.0					X																	99956215		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.436+1G>A	X.37:g.99956215C>T			Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Splice_Site	SNP	-	e3+1	ENST00000372989.1	37	c.436+1	CCDS14472.1	X	.	.	.	.	.	.	.	.	.	.	c	22.1	4.240372	0.79912	.	.	ENSG00000102362	ENST00000372989;ENST00000455616;ENST00000454200;ENST00000276141;ENST00000263033;ENST00000372981	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9948	0.89179	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYTL4	99842871	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.832000	0.62759	2.372000	0.80975	0.597000	0.82753	.	SYTL4	-	-	ENSG00000102362		0.473	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL4	HGNC	protein_coding	OTTHUMT00000057488.1		0.00	17	0	C	NM_080737	Intron	99956215	-1			no_errors	ENST00000454200	ensembl	human	known	74_37	splice_site	12.12	29	4	SNP	1.000	T
TAS2R43	259289	genome.wustl.edu	37	12	11244634	11244634	+	Silent	SNP	G	G	A	rs200893955		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:11244634G>A	ENST00000531678.1	-	1	278	c.195C>T	c.(193-195)aaC>aaT	p.N65N	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	65					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTGAATACCAGTTTAATAATA	0.408																																																	0													52.0	46.0	48.0					12																	11244634		1928	3963	5891	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.195C>T	12.37:g.11244634G>A			P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.N65	ENST00000531678.1	37	c.195	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.408	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	-	0.00	27	0	G	NM_176884		11244634	-1	tier1	rs200893955	no_errors	ENST00000531678	ensembl	human	known	74_37	silent	13.79	50	8	SNP	0.001	A
TAS2R43	259289	genome.wustl.edu	37	12	11244646	11244646	+	Silent	SNP	T	T	C	rs201583586		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:11244646T>C	ENST00000531678.1	-	1	266	c.183A>G	c.(181-183)gtA>gtG	p.V61V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	61					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTAATAATAATACCCAGAGCA	0.393																																																	0													52.0	47.0	49.0					12																	11244646		1950	3985	5935	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.183A>G	12.37:g.11244646T>C			P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.V61	ENST00000531678.1	37	c.183	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.393	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1		0.00	20	0	T	NM_176884		11244646	-1			no_errors	ENST00000531678	ensembl	human	known	74_37	silent	13.11	53	8	SNP	0.001	C
TBC1D22A	25771	genome.wustl.edu	37	22	47308003	47308003	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr22:47308003C>T	ENST00000337137.4	+	8	1100	c.934C>T	c.(934-936)Cgc>Tgc	p.R312C	TBC1D22A_ENST00000355704.3_Missense_Mutation_p.R234C|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.R265C|TBC1D22A_ENST00000380995.1_Missense_Mutation_p.R265C|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.R253C	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	312	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		ATGGGCGATCCGCCACCCAGC	0.383																																																	0													197.0	173.0	181.0					22																	47308003		2203	4300	6503	SO:0001583	missense	0			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.934C>T	22.37:g.47308003C>T	ENSP00000336724:p.Arg312Cys		B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R312C	ENST00000337137.4	37	c.934	CCDS14078.1	22	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269133	0.80469	.	.	ENSG00000054611	ENST00000337137;ENST00000380995;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T;T	0.04654	3.58;3.58;3.58;3.58;3.58	5.56	5.56	0.83823	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.36468	0.0968	H	0.97077	3.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.983;1.0;1.0;0.983	T	0.56147	-0.8027	10	0.87932	D	0	.	18.1129	0.89541	0.0:1.0:0.0:0.0	.	312;234;253;312	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	C	312;265;253;234;265	ENSP00000336724:R312C;ENSP00000370383:R265C;ENSP00000384036:R253C;ENSP00000347932:R234C;ENSP00000385634:R265C	ENSP00000336724:R312C	R	+	1	0	TBC1D22A	45686667	1.000000	0.71417	0.971000	0.41717	0.479000	0.33129	5.253000	0.65452	2.599000	0.87857	0.655000	0.94253	CGC	TBC1D22A	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000054611		0.383	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22A	HGNC	protein_coding	OTTHUMT00000317600.3		0.00	29	0	C	NM_014346		47308003	+1			no_errors	ENST00000337137	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
TLN1	7094	genome.wustl.edu	37	9	35703897	35703897	+	Splice_Site	SNP	C	C	T	rs367857218		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr9:35703897C>T	ENST00000314888.9	-	47	6585	c.6232G>A	c.(6232-6234)Gtg>Atg	p.V2078M	TLN1_ENST00000540444.1_Splice_Site_p.V1972M|TLN1_ENST00000464379.1_5'UTR	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2078					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ATTAGTACCACCTGTGTGGGA	0.542																																																	0													141.0	129.0	133.0					9																	35703897		2203	4300	6503	SO:0001630	splice_region_variant	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6232-1G>A	9.37:g.35703897C>T			A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.V2078M	ENST00000314888.9	37	c.6232	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901643	0.72754	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.13657	2.57;2.57	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.39172	0.1068	M	0.87758	2.905	0.80722	D	1	D	0.65815	0.995	P	0.56278	0.795	T	0.49560	-0.8927	10	0.72032	D	0.01	-14.9733	18.2524	0.90007	0.0:1.0:0.0:0.0	.	2078	Q9Y490	TLN1_HUMAN	M	2078;1972	ENSP00000316029:V2078M;ENSP00000442981:V1972M	ENSP00000316029:V2078M	V	-	1	0	TLN1	35693897	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	6.069000	0.71209	2.317000	0.78254	0.561000	0.74099	GTG	TLN1	-	superfamily_Vinculin/catenin	ENSG00000137076		0.542	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	-	0.00	33	0	C	NM_006289	Missense_Mutation	35703897	-1	tier1	-	no_errors	ENST00000314888	ensembl	human	known	74_37	missense	32.14	38	18	SNP	1.000	T
TEX10	54881	genome.wustl.edu	37	9	103065971	103065971	+	Silent	SNP	G	G	A	rs191855673		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr9:103065971G>A	ENST00000374902.4	-	14	2795	c.2619C>T	c.(2617-2619)ctC>ctT	p.L873L	TEX10_ENST00000477648.1_5'UTR|TEX10_ENST00000535814.1_Silent_p.L857L	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	873						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TATGAGTCCTGAGGGGTGCAT	0.527																																																	0													175.0	168.0	171.0					9																	103065971		2203	4300	6503	SO:0001819	synonymous_variant	0			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.2619C>T	9.37:g.103065971G>A			B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Silent	SNP	pfam_IPI1/TEX10,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L873	ENST00000374902.4	37	c.2619	CCDS6748.1	9																																																																																			TEX10	-	NULL	ENSG00000136891		0.527	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	-	0.00	19	0	G	NM_017746		103065971	-1	tier1	-	no_errors	ENST00000374902	ensembl	human	known	74_37	silent	21.62	29	8	SNP	0.896	A
TMEM181	57583	genome.wustl.edu	37	6	159005076	159005076	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:159005076G>A	ENST00000367090.3	+	4	681	c.670G>A	c.(670-672)Gaa>Aaa	p.E224K		NM_020823.1	NP_065874.1	Q9P2C4	TM181_HUMAN	transmembrane protein 181	224					pathogenesis (GO:0009405)	integral component of membrane (GO:0016021)	toxic substance binding (GO:0015643)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|skin(1)	22		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;8.15e-18)|BRCA - Breast invasive adenocarcinoma(81;1.38e-05)		TCAATCAAAAGGTATGGAGCT	0.343																																																	0													132.0	120.0	124.0					6																	159005076		1889	4107	5996	SO:0001630	splice_region_variant	0			AB037844	CCDS43520.1	6q25.3	2012-08-10	2006-10-19	2006-10-19	ENSG00000146433	ENSG00000146433			20958	protein-coding gene	gene with protein product		613209	"""G protein-coupled receptor 178"", ""KIAA1423"""	KIAA1423, GPR178		16452613	Standard	NM_020823		Approved		uc003qrm.4	Q9P2C4	OTTHUMG00000015913	ENST00000367090.3:c.670+1G>A	6.37:g.159005076G>A			Q5VTU1	Missense_Mutation	SNP	NULL	p.E224K	ENST00000367090.3	37	c.670	CCDS43520.1	6	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872198	0.51695	.	.	ENSG00000146433	ENST00000314630;ENST00000367090	.	.	.	5.62	5.62	0.85841	.	0.392170	0.28403	N	0.015477	T	0.41994	0.1183	L	0.36672	1.1	0.80722	D	1	B;B	0.17465	0.012;0.022	B;B	0.15484	0.013;0.013	T	0.30794	-0.9966	9	0.42905	T	0.14	.	17.1838	0.86861	0.0:0.0:1.0:0.0	.	224;135	Q9P2C4;Q8N4V6	TM181_HUMAN;.	K	131;224	.	ENSP00000323755:E131K	E	+	1	0	TMEM181	158925064	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	5.605000	0.67634	2.648000	0.89879	0.650000	0.86243	GAA	TMEM181	-	NULL	ENSG00000146433		0.343	TMEM181-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM181	HGNC	protein_coding	OTTHUMT00000042873.1	-	0.00	31	0	G	NM_020823	Missense_Mutation	159005076	+1	tier1	-	no_errors	ENST00000367090	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	A
SCTR	6344	genome.wustl.edu	37	2	120194908	120194908	+	IGR	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:120194908C>T	ENST00000019103.5	-	0	1865				TMEM37_ENST00000409826.1_Silent_p.L167L|TMEM37_ENST00000465296.1_3'UTR|TMEM37_ENST00000306406.4_Silent_p.L155L	NM_002980.2	NP_002971.2	P47872	SCTR_HUMAN	secretin receptor						digestion (GO:0007586)|excretion (GO:0007588)|G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic microtubule (GO:0005881)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	secretin receptor activity (GO:0015055)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)	19					Secretin(DB00021)	AAGTCACACTCATCGGCTTCA	0.557																																																	0													204.0	213.0	210.0					2																	120194908		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS2127.1	2q14.1	2012-08-10			ENSG00000080293	ENSG00000080293		"""GPCR / Class B : Glucagon receptors"""	10608	protein-coding gene	gene with protein product		182098				1646711	Standard	NM_002980		Approved		uc002tma.3	P47872	OTTHUMG00000131407		2.37:g.120194908C>T			Q12961|Q13213|Q53T00	Silent	SNP	NULL	p.L155	ENST00000019103.5	37	c.465	CCDS2127.1	2																																																																																			TMEM37	-	NULL	ENSG00000171227		0.557	SCTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM37	HGNC	protein_coding	OTTHUMT00000254198.2	-	0.00	47	0	C			120194908	+1	tier1	-	no_errors	ENST00000306406	ensembl	human	known	74_37	silent	28.92	59	24	SNP	0.553	T
TNFRSF1A	7132	genome.wustl.edu	37	12	6440106	6440106	+	Intron	SNP	C	C	T	rs200381667		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr12:6440106C>T	ENST00000162749.2	-	6	851				TNFRSF1A_ENST00000437813.3_5'Flank|TNFRSF1A_ENST00000540022.1_Intron	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						AAAGAAGAGACGGCACTGGTG	0.458																																																	0													50.0	47.0	48.0					12																	6440106		2203	4300	6503	SO:0001627	intron_variant	0			M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.552-14G>A	12.37:g.6440106C>T			A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	RNA	SNP	-	NULL	ENST00000162749.2	37	NULL	CCDS8542.1	12																																																																																			TNFRSF1A	-	-	ENSG00000067182		0.458	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1A	HGNC	protein_coding	OTTHUMT00000399038.1	-	0.00	10	0	C	NM_001065		6440106	-1	tier1	rs200381667	no_errors	ENST00000535038	ensembl	human	putative	74_37	rna	19.23	21	5	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7579321	7579322	+	Frame_Shift_Del	DEL	CA	CA	-	rs587780067		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:7579321_7579322delCA	ENST00000269305.4	-	4	554_555	c.365_366delTG	c.(364-366)gtgfs	p.V122fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.V122fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.V122fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.V122fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	122	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> L (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.V122fs*26(5)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.V122fs*46(1)|p.Y107fs*44(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGTGCAAGTCACAGACTTGGC	0.554		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	23	Deletion - Frameshift(13)|Whole gene deletion(8)|Deletion - In frame(2)	upper_aerodigestive_tract(4)|large_intestine(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|lung(2)|breast(2)|stomach(1)|liver(1)|ovary(1)	GRCh37	CM065494	TP53	M																																				SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.365_366delTG	17.37:g.7579323_7579324delCA	ENSP00000269305:p.Val122fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V122fs	ENST00000269305.4	37	c.366_365	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.554	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	63	0	CA	NM_000546		7579322	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	58.00	21	29	DEL	0.949:0.997	-
TP53BP2	7159	genome.wustl.edu	37	1	223983606	223983606	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr1:223983606G>T	ENST00000343537.7	-	13	2926	c.2635C>A	c.(2635-2637)Cca>Aca	p.P879T	TP53BP2_ENST00000391879.2_Missense_Mutation_p.P112T|TP53BP2_ENST00000498843.1_5'UTR|TP53BP2_ENST00000391878.2_Missense_Mutation_p.P750T	NM_001031685.2	NP_001026855.2	Q13625	ASPP2_HUMAN	tumor protein p53 binding protein 2	873	Mediates interaction with APC2.|Pro-rich.				cell cycle (GO:0007049)|central nervous system development (GO:0007417)|embryo development ending in birth or egg hatching (GO:0009792)|heart development (GO:0007507)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)|positive regulation of signal transduction (GO:0009967)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(131;0.0958)		GATGGGTATGGTGGGGGTGGG	0.562																																																	0													68.0	75.0	73.0					1																	223983606		2203	4300	6503	SO:0001583	missense	0			U09582	CCDS1538.1, CCDS44319.1	1q41	2014-06-24	2014-06-24		ENSG00000143514	ENSG00000143514		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	12000	protein-coding gene	gene with protein product		602143	"""tumor protein p53-binding protein, 2"""			8668206, 8016121	Standard	NM_005426		Approved	PPP1R13A, ASPP2, 53BP2	uc010pvb.2	Q13625	OTTHUMG00000037379	ENST00000343537.7:c.2635C>A	1.37:g.223983606G>T	ENSP00000341957:p.Pro879Thr		B4DG66|Q12892|Q86X75|Q96KQ3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.P879T	ENST00000343537.7	37	c.2635	CCDS44319.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.66|17.66	3.443479|3.443479	0.63067|0.63067	.|.	.|.	ENSG00000143514|ENSG00000143514	ENST00000391878;ENST00000343537;ENST00000391879|ENST00000494100	T;T;T|.	0.43294|.	2.19;0.95;2.19|.	5.37|5.37	5.37|5.37	0.77165|0.77165	Src homology-3 domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77075|0.77075	0.4077|0.4077	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.997;0.997|.	T|T	0.76710|0.76710	-0.2859|-0.2859	10|5	0.59425|.	D|.	0.04|.	.|.	19.1101|19.1101	0.93313|0.93313	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	879;873|.	B4DG66;Q13625|.	.;ASPP2_HUMAN|.	T|N	750;879;112|212	ENSP00000375750:P750T;ENSP00000341957:P879T;ENSP00000375751:P112T|.	ENSP00000341957:P879T|.	P|T	-|-	1|2	0|0	TP53BP2|TP53BP2	222050229|222050229	1.000000|1.000000	0.71417|0.71417	0.156000|0.156000	0.22583|0.22583	0.322000|0.322000	0.28314|0.28314	9.230000|9.230000	0.95299|0.95299	2.531000|2.531000	0.85337|0.85337	0.563000|0.563000	0.77884|0.77884	CCA|ACC	TP53BP2	-	superfamily_SH3_domain	ENSG00000143514		0.562	TP53BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53BP2	HGNC	protein_coding	OTTHUMT00000090985.3	-	0.00	41	0	G	NM_001031685, NM_005426		223983606	-1	tier1	-	no_errors	ENST00000343537	ensembl	human	known	74_37	missense	17.44	71	15	SNP	1.000	T
TPTE	7179	genome.wustl.edu	37	21	10933879	10933879	+	Missense_Mutation	SNP	C	C	T	rs149228869		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr21:10933879C>T	ENST00000361285.4	-	17	1329	c.1000G>A	c.(1000-1002)Gta>Ata	p.V334I	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Missense_Mutation_p.V296I|TPTE_ENST00000298232.7_Missense_Mutation_p.V316I	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	334	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGAATCGCTACGATGTTTTCA	0.313																																																	0								C	ILE/VAL,ILE/VAL,ILE/VAL	4,4402		0,4,2199	244.0	243.0	243.0		946,886,1000	0.1	0.0	21	dbSNP_134	243	0,8600		0,0,4300	no	missense,missense,missense	TPTE	NM_199259.2,NM_199260.2,NM_199261.2	29,29,29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	benign,benign,benign	316/534,296/514,334/552	10933879	4,13002	2203	4300	6503	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1000G>A	21.37:g.10933879C>T	ENSP00000355208:p.Val334Ile		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.V334I	ENST00000361285.4	37	c.1000	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.795271	0.00617	9.08E-4	0.0	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.88975	-2.45;-2.45;-2.45	1.97	0.0501	0.14292	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.112978	0.56097	N	0.000029	T	0.69260	0.3091	N	0.05124	-0.11	0.26216	N	0.979237	B;B;B	0.18013	0.02;0.02;0.025	B;B;B	0.20955	0.019;0.009;0.032	T	0.56450	-0.7977	10	0.10902	T	0.67	-10.4341	4.9844	0.14182	0.0:0.5035:0.0:0.4965	.	296;316;334	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	I	316;334;296	ENSP00000298232:V316I;ENSP00000355208:V334I;ENSP00000344441:V296I	ENSP00000298232:V316I	V	-	1	0	TPTE	9955750	0.093000	0.21703	0.006000	0.13384	0.155000	0.21991	0.193000	0.17116	0.000000	0.14550	-1.111000	0.02071	GTA	TPTE	-	pfam_Dual-sp_phosphatase_cat-dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000166157		0.313	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	-	0.00	204	0	C			10933879	-1	tier1	rs149228869	no_errors	ENST00000361285	ensembl	human	known	74_37	missense	21.08	146	39	SNP	0.995	T
TRERF1	55809	genome.wustl.edu	37	6	42236785	42236785	+	Missense_Mutation	SNP	G	G	A	rs201248674		TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr6:42236785G>A	ENST00000372922.4	-	5	1106	c.544C>T	c.(544-546)Cgc>Tgc	p.R182C	TRERF1_ENST00000340840.2_Missense_Mutation_p.R182C|TRERF1_ENST00000541110.1_Missense_Mutation_p.R182C|TRERF1_ENST00000354325.2_Missense_Mutation_p.R182C|TRERF1_ENST00000372917.4_Missense_Mutation_p.R182C	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	182					cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			AGCAGCTGGCGGAGAGCACTG	0.602																																																	0								G	CYS/ARG	0,4406		0,0,2203	64.0	69.0	68.0		544	5.4	1.0	6		68	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TRERF1	NM_033502.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	182/1201	42236785	1,13005	2203	4300	6503	SO:0001583	missense	0			AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.544C>T	6.37:g.42236785G>A	ENSP00000362013:p.Arg182Cys		Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.R182C	ENST00000372922.4	37	c.544	CCDS4867.1	6	.	.	.	.	.	.	.	.	.	.	G	12.22	1.872877	0.33069	0.0	1.16E-4	ENSG00000124496	ENST00000541110;ENST00000372917;ENST00000372922;ENST00000340840;ENST00000354325	T;T;T;T;T	0.21031	2.39;2.03;2.28;2.03;2.04	5.39	5.39	0.77823	.	0.000000	0.56097	D	0.000029	T	0.25531	0.0621	L	0.34521	1.04	0.58432	D	0.999996	D;P;P;D;D	0.89917	0.979;0.751;0.751;1.0;1.0	P;B;B;D;D	0.79108	0.705;0.103;0.103;0.992;0.992	T	0.02132	-1.1208	10	0.87932	D	0	-21.8625	13.2384	0.59983	0.0:0.0:0.7333:0.2667	.	182;182;182;21;21	Q96PN7-4;Q05GC8;Q96PN7;Q96PN7-2;Q96PN7-3	.;.;TREF1_HUMAN;.;.	C	182	ENSP00000439689:R182C;ENSP00000362008:R182C;ENSP00000362013:R182C;ENSP00000339438:R182C;ENSP00000346285:R182C	ENSP00000339438:R182C	R	-	1	0	TRERF1	42344763	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.779000	0.38624	2.537000	0.85549	0.462000	0.41574	CGC	TRERF1	-	NULL	ENSG00000124496		0.602	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRERF1	HGNC	protein_coding	OTTHUMT00000040551.2	-	0.00	9	0	G	NM_033502		42236785	-1	tier1	rs201248674	no_errors	ENST00000541110	ensembl	human	known	74_37	missense	58.33	10	14	SNP	1.000	A
TRIM23	373	genome.wustl.edu	37	5	64905171	64905171	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:64905171G>A	ENST00000231524.9	-	6	1314	c.943C>T	c.(943-945)Cgt>Tgt	p.R315C	TRIM23_ENST00000381018.3_Missense_Mutation_p.R315C|TRIM23_ENST00000508808.1_5'UTR|TRIM23_ENST00000274327.7_Missense_Mutation_p.R315C	NM_001656.3	NP_001647.1	P36406	TRI23_HUMAN	tripartite motif containing 23	315					GTP catabolic process (GO:0006184)|positive regulation of catalytic activity (GO:0043085)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	enzyme activator activity (GO:0008047)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	28		Lung NSC(167;3.24e-06)|Prostate(74;0.0138)|Breast(144;0.0433)|Ovarian(174;0.0545)|Colorectal(97;0.234)		Lung(70;0.00473)		AATTTTTCACGAACATGAGCA	0.413																																																	0													123.0	113.0	117.0					5																	64905171		2203	4300	6503	SO:0001583	missense	0			L04510	CCDS3986.1, CCDS3987.1, CCDS43322.1	5q12.3	2013-01-09	2011-01-25	2004-06-04	ENSG00000113595	ENSG00000113595		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	660	protein-coding gene	gene with protein product		601747	"""ADP-ribosylation factor domain protein 1, 64kDa"", ""tripartite motif-containing 23"""	ARFD1		8473324	Standard	NM_001656		Approved	ARD1, RNF46	uc003jty.3	P36406	OTTHUMG00000097802	ENST00000231524.9:c.943C>T	5.37:g.64905171G>A	ENSP00000231524:p.Arg315Cys		Q9BZY4|Q9BZY5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_Znf_B-box,superfamily_P-loop_NTPase,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Rab_type,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_Znf_C2H2,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R315C	ENST00000231524.9	37	c.943	CCDS3987.1	5	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910118	0.72983	.	.	ENSG00000113595	ENST00000231524;ENST00000381018;ENST00000274327	T;T;T	0.75704	-0.88;-0.87;-0.96	5.39	5.39	0.77823	B-box, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83686	0.5308	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.996;1.0;0.998	D	0.84811	0.0790	10	0.87932	D	0	.	13.5537	0.61747	0.0:0.0:0.7415:0.2585	.	315;315;315	P36406;P36406-2;P36406-3	TRI23_HUMAN;.;.	C	315	ENSP00000231524:R315C;ENSP00000370406:R315C;ENSP00000274327:R315C	ENSP00000231524:R315C	R	-	1	0	TRIM23	64940927	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.922000	0.40045	2.685000	0.91497	0.655000	0.94253	CGT	TRIM23	-	smart_Bbox_C	ENSG00000113595		0.413	TRIM23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM23	HGNC	protein_coding	OTTHUMT00000215058.2	-	0.00	29	0	G	NM_001656		64905171	-1	tier1	-	no_errors	ENST00000231524	ensembl	human	known	74_37	missense	45.00	11	9	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179606443	179606443	+	Silent	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:179606443C>T	ENST00000591111.1	-	46	10790	c.10566G>A	c.(10564-10566)ctG>ctA	p.L3522L	TTN-AS1_ENST00000582847.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Silent_p.L3476L|TTN_ENST00000359218.5_Silent_p.L3601L|TTN_ENST00000342175.6_Silent_p.L3668L|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Silent_p.L3839L|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13859	Ig-like 21.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGTTACAGACAGTGTAGCCA	0.408																																																	0													100.0	98.0	99.0					2																	179606443		1906	4121	6027	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10566G>A	2.37:g.179606443C>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L3668	ENST00000591111.1	37	c.11004		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	27	0	C	NM_133378		179606443	-1	tier1	-	no_errors	ENST00000342175	ensembl	human	known	74_37	silent	9.43	48	5	SNP	0.984	T
TVP23C	201158	genome.wustl.edu	37	17	15441469	15441469	+	Intron	SNP	C	C	T	rs568909748	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr17:15441469C>T	ENST00000225576.3	-	5	558				TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000438826.3_Splice_Site|TVP23C_ENST00000583206.1_5'Flank|TVP23C_ENST00000428082.2_Splice_Site|TVP23C-CDRT4_ENST00000522212.2_Intron|TVP23C_ENST00000584811.1_Splice_Site	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)							integral component of membrane (GO:0016021)											TCCAGTGTTCCGCAAAAGACA	0.393													c|||	3	0.000599042	0.0015	0.0	5008	,	,		17476	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.462+7629G>A	17.37:g.15441469C>T			Q3LIC7	Splice_Site	SNP	-	e5-2	ENST00000225576.3	37	c.162-2	CCDS11170.1	17	.	.	.	.	.	.	.	.	.	.	c	13.58	2.280351	0.40294	.	.	ENSG00000175106	ENST00000438826	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0583	0.25111	0.0:0.1033:0.0:0.8967	.	.	.	.	.	-1	.	.	.	-	.	.	FAM18B2	15382194	1.000000	0.71417	0.996000	0.52242	0.698000	0.40448	1.919000	0.40015	0.852000	0.35287	-0.352000	0.07741	.	TVP23C	-	-	ENSG00000175106		0.393	TVP23C-001	KNOWN	basic|CCDS	protein_coding	TVP23C	HGNC	protein_coding	OTTHUMT00000130705.2	-	0.00	45	0	C	NM_145301		15441469	-1	tier1	-	no_errors	ENST00000523573	ensembl	human	known	74_37	splice_site	9.62	47	5	SNP	0.998	T
U2AF2	11338	genome.wustl.edu	37	19	56171899	56171901	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr19:56171899_56171901delAGA	ENST00000308924.4	+	4	288_290	c.248_250delAGA	c.(247-252)gagaag>gag	p.K87del	U2AF2_ENST00000450554.2_In_Frame_Del_p.K87del|CTD-2537I9.12_ENST00000589456.1_RNA|U2AF2_ENST00000590551.1_5'Flank|CTD-2537I9.12_ENST00000585940.1_RNA			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	87	Required for interaction with PRPF19. {ECO:0000269|PubMed:21536736}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CCCCGCCACGAGAAGAAGAAGAA	0.645																																																	0																																										SO:0001651	inframe_deletion	0			BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.248_250delAGA	19.37:g.56171908_56171910delAGA	ENSP00000307863:p.Lys87del		Q96HC5	In_Frame_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_U2AF_lg	p.K87in_frame_del	ENST00000308924.4	37	c.248_250	CCDS12933.1	19																																																																																			U2AF2	-	tigrfam_U2AF_lg	ENSG00000063244		0.645	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	U2AF2	HGNC	protein_coding	OTTHUMT00000453599.1		0.00	20	0	AGA	NM_007279		56171901	+1	tier1		no_errors	ENST00000308924	ensembl	human	known	74_37	in_frame_del	6.67	28	2	DEL	1.000:1.000:1.000	-
UNC80	285175	genome.wustl.edu	37	2	210806065	210806065	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr2:210806065T>C	ENST00000439458.1	+	43	6649	c.6569T>C	c.(6568-6570)cTc>cCc	p.L2190P	UNC80_ENST00000272845.6_Missense_Mutation_p.L2185P	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2190					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ATGCTTTTCCTCAACGTTTTT	0.547																																																	0													181.0	163.0	169.0					2																	210806065		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.6569T>C	2.37:g.210806065T>C	ENSP00000391088:p.Leu2190Pro		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.L2190P	ENST00000439458.1	37	c.6569	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	T	22.9	4.345199	0.82022	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.48201	0.82;0.82	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.63058	0.2479	L	0.49778	1.585	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.66622	-0.5877	10	0.87932	D	0	-17.2631	14.8202	0.70068	0.0:0.0:0.0:1.0	.	2190	Q8N2C7	UNC80_HUMAN	P	2190;2185	ENSP00000391088:L2190P;ENSP00000272845:L2185P	ENSP00000272845:L2185P	L	+	2	0	UNC80	210514310	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.805000	0.86005	1.913000	0.55393	0.459000	0.35465	CTC	UNC80	-	NULL	ENSG00000144406		0.547	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		-	0.00	68	0	T	NM_182587		210806065	+1	tier1	-	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	11.76	75	10	SNP	1.000	C
VPREB3	29802	genome.wustl.edu	37	22	24095297	24095297	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr22:24095297G>T	ENST00000248948.3	-	2	242	c.138C>A	c.(136-138)caC>caA	p.H46Q	VPREB3_ENST00000398465.3_Missense_Mutation_p.H30Q|ZNF70_ENST00000341976.3_5'Flank	NM_013378.2	NP_037510.1	Q9UKI3	VPRE3_HUMAN	pre-B lymphocyte 3	46	Ig-like.					endoplasmic reticulum (GO:0005783)				large_intestine(1)|lung(1)|skin(1)	3		Medulloblastoma(6;7.87e-06)|all_neural(6;0.00334)				TGATGGTGACGTGCTGGGGGC	0.627																																																	0													83.0	63.0	70.0					22																	24095297		2203	4300	6503	SO:0001583	missense	0				CCDS13813.1	22q11.23	2013-01-11	2008-09-12		ENSG00000128218	ENSG00000128218		"""Immunoglobulin superfamily / V-set domain containing"""	12710	protein-coding gene	gene with protein product		605017				10702669, 14670953	Standard	NM_013378		Approved	8HS20	uc002zxt.3	Q9UKI3	OTTHUMG00000150738	ENST00000248948.3:c.138C>A	22.37:g.24095297G>T	ENSP00000248948:p.His46Gln		B2R587	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.H46Q	ENST00000248948.3	37	c.138	CCDS13813.1	22	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360882	0.24684	.	.	ENSG00000128218	ENST00000398465;ENST00000248948	T;T	0.64991	-0.13;-0.13	4.94	-9.88	0.00467	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.627207	0.14234	N	0.332496	T	0.44371	0.1290	L	0.55743	1.74	0.09310	N	1	B	0.23937	0.094	B	0.19391	0.025	T	0.18999	-1.0319	10	0.59425	D	0.04	.	5.2454	0.15494	0.386:0.421:0.1088:0.0843	.	46	Q9UKI3	VPRE3_HUMAN	Q	30;46	ENSP00000381483:H30Q;ENSP00000248948:H46Q	ENSP00000248948:H46Q	H	-	3	2	VPREB3	22425297	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-2.633000	0.00869	-2.775000	0.00363	0.460000	0.39030	CAC	VPREB3	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000128218		0.627	VPREB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPREB3	HGNC	protein_coding	OTTHUMT00000319879.2		0.00	23	0	G	NM_013378		24095297	-1			no_errors	ENST00000248948	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	T
VPS4B	9525	genome.wustl.edu	37	18	61077552	61077552	+	Silent	SNP	T	T	C			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr18:61077552T>C	ENST00000238497.5	-	3	470	c.267A>G	c.(265-267)gaA>gaG	p.E89E	VPS4B_ENST00000591519.1_Silent_p.E89E	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	89					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						TCGGCTGTCCTTCTTTCACTG	0.353																																																	0													217.0	200.0	206.0					18																	61077552		2203	4300	6503	SO:0001819	synonymous_variant	0			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.267A>G	18.37:g.61077552T>C			Q69HW4|Q9GZS7	Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.E89	ENST00000238497.5	37	c.267	CCDS11983.1	18																																																																																			VPS4B	-	NULL	ENSG00000119541		0.353	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	HGNC	protein_coding	OTTHUMT00000256198.2	-	0.00	37	0	T	NM_004869		61077552	-1	tier1	-	no_errors	ENST00000238497	ensembl	human	known	74_37	silent	46.77	33	29	SNP	0.999	C
ZDHHC11	79844	genome.wustl.edu	37	5	796437	796437	+	3'UTR	SNP	T	T	A	rs140929317	byFrequency	TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:796437T>A	ENST00000283441.8	-	0	1888				ZDHHC11_ENST00000503758.2_5'UTR|ZDHHC11_ENST00000424784.2_3'UTR	NM_024786.2	NP_079062.1	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCAGCCCATCTTCCTGGAGAT	0.562																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000283441.8:c.*266A>T	5.37:g.796437T>A			Q6UWR9	RNA	SNP	-	NULL	ENST00000283441.8	37	NULL	CCDS3857.1	5	.	.	.	.	.	.	.	.	.	.	a	0.165	-1.076978	0.01903	.	.	ENSG00000215247	ENST00000436502	.	.	.	0.624	-1.25	0.09405	.	.	.	.	.	T	0.14056	0.0340	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.19910	-1.0291	5	0.09338	T	0.73	.	1.23	0.01941	0.2378:0.1728:0.4163:0.173	.	.	.	.	D	52	.	ENSP00000404970:E52D	E	-	3	2	AC026740.1	849437	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.240000	0.00544	-4.277000	0.00059	-3.342000	0.00043	GAA	ZDHHC11	-	-	ENSG00000188818		0.562	ZDHHC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11	HGNC	protein_coding	OTTHUMT00000206681.3	-	0.00	20	0	T	NM_024786		796437	-1	tier1	rs140929317	no_errors	ENST00000503758	ensembl	human	known	74_37	rna	18.60	35	8	SNP	0.000	A
ZFHX4	79776	genome.wustl.edu	37	8	77767606	77767606	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr8:77767606G>T	ENST00000521891.2	+	10	8897	c.8449G>T	c.(8449-8451)Gac>Tac	p.D2817Y	ZFHX4_ENST00000455469.2_Missense_Mutation_p.D2772Y|ZFHX4_ENST00000050961.6_Missense_Mutation_p.D2772Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D2791Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2772					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CACCACCGGAGACGAGGGAAA	0.468										HNSCC(33;0.089)																																							0													51.0	52.0	51.0					8																	77767606		1959	4154	6113	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8449G>T	8.37:g.77767606G>T	ENSP00000430497:p.Asp2817Tyr		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.D2817Y	ENST00000521891.2	37	c.8449	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480011	0.26598	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.61158	0.13;0.19;0.16;0.15	4.98	4.98	0.66077	.	0.000000	0.45867	U	0.000325	T	0.73148	0.3550	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.75682	-0.3233	10	0.87932	D	0	.	18.4359	0.90646	0.0:0.0:1.0:0.0	.	2772;2772;2817	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Y	2817;2801;2772;2772;2791	ENSP00000430497:D2817Y;ENSP00000399605:D2772Y;ENSP00000050961:D2772Y;ENSP00000430848:D2791Y	ENSP00000050961:D2772Y	D	+	1	0	ZFHX4	77930161	1.000000	0.71417	0.112000	0.21494	0.218000	0.24690	9.657000	0.98554	2.588000	0.87417	0.561000	0.74099	GAC	ZFHX4	-	NULL	ENSG00000091656		0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	23	0	G	NM_024721		77767606	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
ZFHX4	79776	genome.wustl.edu	37	8	77767663	77767663	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr8:77767663G>T	ENST00000521891.2	+	10	8954	c.8506G>T	c.(8506-8508)Gct>Tct	p.A2836S	ZFHX4_ENST00000455469.2_Missense_Mutation_p.A2791S|ZFHX4_ENST00000050961.6_Missense_Mutation_p.A2791S|ZFHX4_ENST00000518282.1_Missense_Mutation_p.A2810S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2791					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.A2820S(2)		NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TGTGAAACCGGCTTTGTCTCC	0.493										HNSCC(33;0.089)																																							2	Substitution - Missense(2)	lung(2)											63.0	65.0	64.0					8																	77767663		1934	4138	6072	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8506G>T	8.37:g.77767663G>T	ENSP00000430497:p.Ala2836Ser		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.A2836S	ENST00000521891.2	37	c.8506	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.306177	0.01353	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.42900	0.96;1.0;0.97;0.96	5.25	3.36	0.38483	.	0.336651	0.20910	U	0.083500	T	0.15609	0.0376	N	0.04508	-0.205	0.09310	N	1	B;B;B	0.19583	0.022;0.037;0.022	B;B;B	0.25987	0.029;0.065;0.054	T	0.34976	-0.9807	10	0.02654	T	1	.	4.2083	0.10498	0.0798:0.1327:0.5201:0.2674	.	2791;2791;2836	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	S	2836;2820;2791;2791;2810	ENSP00000430497:A2836S;ENSP00000399605:A2791S;ENSP00000050961:A2791S;ENSP00000430848:A2810S	ENSP00000050961:A2791S	A	+	1	0	ZFHX4	77930218	0.864000	0.29904	0.199000	0.23439	0.007000	0.05969	2.966000	0.49208	0.713000	0.32060	-0.367000	0.07326	GCT	ZFHX4	-	NULL	ENSG00000091656		0.493	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2		0.00	21	0	G	NM_024721		77767663	+1			no_errors	ENST00000521891	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.000	T
ZNF565	147929	genome.wustl.edu	37	19	36674504	36674504	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr19:36674504C>T	ENST00000355114.5	-	5	1210	c.484G>A	c.(484-486)Gaa>Aaa	p.E162K	ZNF565_ENST00000304116.5_Missense_Mutation_p.E122K|ZNF565_ENST00000392173.2_Missense_Mutation_p.E122K			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			AACTGGCCTTCGCATTCCCAG	0.458																																																	0													213.0	191.0	199.0					19																	36674504		2203	4300	6503	SO:0001583	missense	0			AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.484G>A	19.37:g.36674504C>T	ENSP00000347234:p.Glu162Lys		B3KQ35|Q6NUS2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E122K	ENST00000355114.5	37	c.364		19	.	.	.	.	.	.	.	.	.	.	c	0.008	-1.908826	0.00508	.	.	ENSG00000196357	ENST00000392173;ENST00000304116;ENST00000355114	T;T;T	0.06371	3.31;3.31;3.33	4.63	1.1	0.20463	.	0.911015	0.09155	N	0.840983	T	0.02047	0.0064	N	0.01656	-0.775	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42849	-0.9427	10	0.02654	T	1	.	8.8083	0.34952	0.0:0.2106:0.0:0.7894	.	122	Q8N9K5	ZN565_HUMAN	K	122;122;162	ENSP00000376013:E122K;ENSP00000306869:E122K;ENSP00000347234:E162K	ENSP00000306869:E122K	E	-	1	0	ZNF565	41366344	0.000000	0.05858	0.156000	0.22583	0.058000	0.15608	0.316000	0.19469	0.300000	0.22699	-1.015000	0.02457	GAA	ZNF565	-	NULL	ENSG00000196357		0.458	ZNF565-003	PUTATIVE	basic	protein_coding	ZNF565	HGNC	protein_coding	OTTHUMT00000451697.1	-	0.00	21	0	C	NM_152477		36674504	-1	tier1	-	no_errors	ENST00000304116	ensembl	human	known	74_37	missense	36.67	19	11	SNP	0.025	T
ZNF540	163255	genome.wustl.edu	37	19	38092021	38092021	+	Intron	SNP	C	C	A			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr19:38092021C>A	ENST00000592533.1	+	4	564				ZNF540_ENST00000343599.5_Intron|ZNF540_ENST00000587220.1_3'UTR|ZNF540_ENST00000316433.4_Intron|ZNF540_ENST00000586792.1_Intron|ZNF540_ENST00000589117.1_Intron	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTTGAGAGTTCATCAGGCAGA	0.547																																																	0													71.0	58.0	63.0					19																	38092021		2195	4293	6488	SO:0001627	intron_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.232+15C>A	19.37:g.38092021C>A			A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	RNA	SNP	-	NULL	ENST00000592533.1	37	NULL	CCDS12506.1	19																																																																																			ZNF540	-	-	ENSG00000171817		0.547	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	23	0	C	NM_152606		38092021	+1	tier1	-	no_errors	ENST00000587220	ensembl	human	known	74_37	rna	25.00	18	6	SNP	0.000	A
ZNF608	57507	genome.wustl.edu	37	5	123983771	123983771	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49K-01A-11D-A247-09	TCGA-LN-A49K-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7fef6fc4-1732-4cb8-958c-1bc52248920b	14e2990d-4d88-4fde-ba19-cfec88030c98	g.chr5:123983771G>T	ENST00000306315.5	-	4	2741	c.2306C>A	c.(2305-2307)cCc>cAc	p.P769H	ZNF608_ENST00000504926.1_Missense_Mutation_p.P342H	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	769							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGTGAGGGAGGGCAGTCCGGG	0.562																																																	0													112.0	110.0	110.0					5																	123983771		2203	4300	6503	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.2306C>A	5.37:g.123983771G>T	ENSP00000307746:p.Pro769His		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.P769H	ENST00000306315.5	37	c.2306	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515647	0.64634	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.46451	0.88;0.87	5.89	5.89	0.94794	.	0.058641	0.64402	D	0.000001	T	0.61974	0.2390	L	0.51422	1.61	0.54753	D	0.999986	D	0.89917	1.0	D	0.73380	0.98	T	0.61063	-0.7138	10	0.72032	D	0.01	-19.5839	20.2454	0.98397	0.0:0.0:1.0:0.0	.	769	Q9ULD9	ZN608_HUMAN	H	342;769	ENSP00000427657:P342H;ENSP00000307746:P769H	ENSP00000307746:P769H	P	-	2	0	ZNF608	124011670	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.350000	0.79385	2.791000	0.96007	0.643000	0.83706	CCC	ZNF608	-	NULL	ENSG00000168916		0.562	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	-	0.00	43	0	G	XM_114432		123983771	-1	tier1	-	no_errors	ENST00000306315	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
