#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A1BG	1	genome.wustl.edu	37	19	58863717	58863717	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:58863717C>A	ENST00000263100.3	-	4	606	c.545G>T	c.(544-546)tGc>tTc	p.C182F	A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000593960.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	182	Ig-like V-type 2.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CCGGTAGCTGCAGCTGTAGTT	0.632																																																	0													114.0	103.0	106.0					19																	58863717		2203	4300	6503	SO:0001583	missense	0				CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.545G>T	19.37:g.58863717C>A	ENSP00000263100:p.Cys182Phe		A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.C182F	ENST00000263100.3	37	c.545	CCDS12976.1	19	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435710	0.43224	.	.	ENSG00000121410	ENST00000263100;ENST00000453054	T	0.29142	1.58	4.05	4.05	0.47172	Immunoglobulin-like fold (1);	0.000000	0.49916	D	0.000133	T	0.63558	0.2521	M	0.93594	3.435	0.48975	D	0.999736	D	0.89917	1.0	D	0.91635	0.999	T	0.73519	-0.3957	10	0.87932	D	0	.	12.4371	0.55604	0.0:1.0:0.0:0.0	.	182	P04217	A1BG_HUMAN	F	182;60	ENSP00000263100:C182F	ENSP00000263100:C182F	C	-	2	0	A1BG	63555529	1.000000	0.71417	1.000000	0.80357	0.279000	0.26890	1.461000	0.35255	2.203000	0.70933	0.563000	0.77884	TGC	A1BG	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000121410		0.632	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A1BG	HGNC	protein_coding	OTTHUMT00000466930.1		0.00	33	0	C	NM_130786		58863717	-1			no_errors	ENST00000263100	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	A
ABCD2	225	genome.wustl.edu	37	12	39967550	39967550	+	Silent	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:39967550G>T	ENST00000308666.3	-	9	2106	c.1971C>A	c.(1969-1971)tcC>tcA	p.S657S		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	657	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						TAGACAGTAAGGAAATTCCAG	0.373																																																	0													125.0	112.0	116.0					12																	39967550		2203	4300	6503	SO:0001819	synonymous_variant	0			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.1971C>A	12.37:g.39967550G>T			B2RAM3|Q13210|Q2M3H9	Silent	SNP	pfam_ABC_Peroxi_TM,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.S657	ENST00000308666.3	37	c.1971	CCDS8734.1	12																																																																																			ABCD2	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000173208		0.373	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD2	HGNC	protein_coding	OTTHUMT00000403591.1	-	0.00	40	0	G	NM_005164		39967550	-1	tier1	-	no_errors	ENST00000308666	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	T
ABI3BP	25890	genome.wustl.edu	37	3	100554487	100554487	+	Intron	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:100554487C>G	ENST00000284322.5	-	18	1707				ABI3BP_ENST00000495063.1_Missense_Mutation_p.E724Q|ABI3BP_ENST00000471714.1_Missense_Mutation_p.E724Q|ABI3BP_ENST00000383691.4_Missense_Mutation_p.E29Q	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GTTACAGGCTCAATGTCTGTG	0.343																																																	0																																										SO:0001627	intron_variant	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1597+10728G>C	3.37:g.100554487C>G			B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.E29Q	ENST00000284322.5	37	c.85	CCDS46880.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.03|17.03	3.285622|3.285622	0.59867|0.59867	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000471714;ENST00000383692;ENST00000383691;ENST00000533795;ENST00000495063|ENST00000495591;ENST00000528490;ENST00000534413	T;T;T;T|.	0.59906|.	0.23;0.23;0.23;0.23|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|.	.|.	.|.	.|.	T|T	0.51584|0.51584	0.1683|0.1683	.|.	.|.	.|.	0.23156|0.23156	N|N	0.998202|0.998202	P;D;P;P|.	0.57899|.	0.943;0.981;0.943;0.943|.	B;P;B;B|.	0.49999|.	0.425;0.628;0.425;0.425|.	T|T	0.45687|0.45687	-0.9244|-0.9244	8|4	0.40728|.	T|.	0.16|.	.|.	15.8335|15.8335	0.78778|0.78778	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	29;724;724;10|.	B4DSV9;Q5JPC9;D3YTG3;D3YTD6|.	.;.;.;.|.	Q|F	724;10;29;90;724|130;55;66	ENSP00000420524:E724Q;ENSP00000373189:E29Q;ENSP00000433981:E90Q;ENSP00000433993:E724Q|.	ENSP00000373189:E29Q|.	E|L	-|-	1|3	0|2	ABI3BP|ABI3BP	102037177|102037177	0.993000|0.993000	0.37304|0.37304	0.955000|0.955000	0.39395|0.39395	0.611000|0.611000	0.37282|0.37282	2.077000|2.077000	0.41557|0.41557	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	GAG|TTG	ABI3BP	-	NULL	ENSG00000154175		0.343	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	-	0.00	21	0	C			100554487	-1	tier1	-	no_errors	ENST00000383691	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.982	G
ADCK2	90956	genome.wustl.edu	37	7	140378976	140378976	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:140378976C>T	ENST00000072869.4	+	3	1280	c.1102C>T	c.(1102-1104)Cag>Tag	p.Q368*	ADCK2_ENST00000476491.1_Nonsense_Mutation_p.Q368*	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	368	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					TTACGAAGCTCAGAATCTAGA	0.512																																																	0													150.0	131.0	138.0					7																	140378976		2203	4300	6503	SO:0001587	stop_gained	0			AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.1102C>T	7.37:g.140378976C>T	ENSP00000072869:p.Gln368*		Q96CN6|Q9Y6T5	Nonsense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.Q368*	ENST00000072869.4	37	c.1102	CCDS5861.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	37|37	6.053181|6.053181	0.97241|0.97241	.|.	.|.	ENSG00000133597|ENSG00000133597	ENST00000072869;ENST00000476491;ENST00000473512|ENST00000483369	.|.	.|.	.|.	5.14|5.14	4.25|4.25	0.50352|0.50352	.|.	0.652897|.	0.14316|.	N|.	0.327330|.	.|T	.|0.62356	.|0.2421	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.70156	.|-0.4949	.|3	0.05959|.	T|.	0.93|.	-30.4727|-30.4727	13.0972|13.0972	0.59200|0.59200	0.3489:0.6511:0.0:0.0|0.3489:0.6511:0.0:0.0	.|.	.|.	.|.	.|.	X|L	368;368;8|205	.|.	ENSP00000072869:Q368X|.	Q|S	+|+	1|2	0|0	ADCK2|ADCK2	140025445|140025445	0.935000|0.935000	0.31712|0.31712	0.990000|0.990000	0.47175|0.47175	0.862000|0.862000	0.49288|0.49288	1.677000|1.677000	0.37576|0.37576	1.382000|1.382000	0.46385|0.46385	0.484000|0.484000	0.47621|0.47621	CAG|TCA	ADCK2	-	pfam_UbiB_dom,superfamily_Kinase-like_dom	ENSG00000133597		0.512	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK2	HGNC	protein_coding	OTTHUMT00000348734.1	-	0.00	95	0	C	NM_052853		140378976	+1	tier1	-	no_errors	ENST00000072869	ensembl	human	known	74_37	nonsense	32.00	68	32	SNP	0.998	T
ADGB	79747	genome.wustl.edu	37	6	146956593	146956593	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:146956593G>A	ENST00000397944.3	+	2	233	c.157G>A	c.(157-159)Gaa>Aaa	p.E53K	ADGB_ENST00000367493.3_5'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	53					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AGAGTGGAGTGAAGCTGACAT	0.408																																																	0													143.0	127.0	132.0					6																	146956593		692	1591	2283	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.157G>A	6.37:g.146956593G>A	ENSP00000381036:p.Glu53Lys		Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.E53K	ENST00000397944.3	37	c.157		6	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294534	0.81025	.	.	ENSG00000118492	ENST00000397944;ENST00000522242	T;T	0.45668	0.89;0.89	4.68	4.68	0.58851	.	0.060159	0.64402	D	0.000004	T	0.49813	0.1579	L	0.59436	1.845	0.37988	D	0.933811	D	0.67145	0.996	P	0.60609	0.877	T	0.56044	-0.8044	10	0.72032	D	0.01	-23.4063	16.7604	0.85510	0.0:0.0:1.0:0.0	.	53	Q8N7X0	CAN7L_HUMAN	K	53;47	ENSP00000381036:E53K;ENSP00000428035:E47K	ENSP00000381036:E53K	E	+	1	0	C6orf103	146998286	1.000000	0.71417	0.975000	0.42487	0.732000	0.41865	5.155000	0.64900	2.316000	0.78162	0.650000	0.86243	GAA	ADGB	-	NULL	ENSG00000118492		0.408	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	-	0.00	68	0	G	NM_024694		146956593	+1	tier1	-	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	32.14	38	18	SNP	1.000	A
AHNAK	79026	genome.wustl.edu	37	11	62289859	62289859	+	Silent	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:62289859C>G	ENST00000378024.4	-	5	12304	c.12030G>C	c.(12028-12030)ctG>ctC	p.L4010L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4010					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TAGGGCCTTTCAGATGCAAAT	0.478																																																	0													194.0	203.0	200.0					11																	62289859		2202	4299	6501	SO:0001819	synonymous_variant	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.12030G>C	11.37:g.62289859C>G			A1A586	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L4010	ENST00000378024.4	37	c.12030	CCDS31584.1	11																																																																																			AHNAK	-	NULL	ENSG00000124942		0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	103	0	C	NM_024060		62289859	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	silent	30.16	88	38	SNP	0.030	G
AHNAK	79026	genome.wustl.edu	37	11	62290087	62290087	+	Missense_Mutation	SNP	C	C	A	rs199930235		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:62290087C>A	ENST00000378024.4	-	5	12076	c.11802G>T	c.(11800-11802)aaG>aaT	p.K3934N	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3934					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GCATTTTTATCTTAGGCATCT	0.502																																																	0													225.0	239.0	234.0					11																	62290087		2202	4299	6501	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.11802G>T	11.37:g.62290087C>A	ENSP00000367263:p.Lys3934Asn		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K3934N	ENST00000378024.4	37	c.11802	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	-	8.751	0.921233	0.17982	.	.	ENSG00000124942	ENST00000378024	T	0.02606	4.23	4.71	0.0733	0.14390	.	0.000000	0.37715	U	0.001976	T	0.14270	0.0345	M	0.89785	3.06	0.19945	N	0.999948	D	0.64830	0.994	D	0.76071	0.987	T	0.02457	-1.1156	10	0.41790	T	0.15	.	8.7849	0.34814	0.0:0.6533:0.0:0.3467	.	3934	Q09666	AHNK_HUMAN	N	3934	ENSP00000367263:K3934N	ENSP00000367263:K3934N	K	-	3	2	AHNAK	62046663	0.002000	0.14202	0.052000	0.19188	0.266000	0.26442	-0.046000	0.11983	-0.283000	0.09115	-0.302000	0.09304	AAG	AHNAK	-	NULL	ENSG00000124942		0.502	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	112	0	C	NM_024060		62290087	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	37.97	98	60	SNP	0.023	A
AHNAK	79026	genome.wustl.edu	37	11	62299163	62299163	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:62299163G>T	ENST00000378024.4	-	5	3000	c.2726C>A	c.(2725-2727)tCa>tAa	p.S909*	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	909					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTGGGTCCTGAGATGTCCAC	0.498																																																	0													165.0	176.0	172.0					11																	62299163		2202	4299	6501	SO:0001587	stop_gained	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.2726C>A	11.37:g.62299163G>T	ENSP00000367263:p.Ser909*		A1A586	Nonsense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S909*	ENST00000378024.4	37	c.2726	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	g	40	8.273837	0.98737	.	.	ENSG00000124942	ENST00000378024	.	.	.	5.19	5.19	0.71726	.	0.732597	0.11497	N	0.558085	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.3133	17.4887	0.87696	0.0:0.0:1.0:0.0	.	.	.	.	X	909	.	ENSP00000367263:S909X	S	-	2	0	AHNAK	62055739	0.591000	0.26824	0.988000	0.46212	0.378000	0.30076	3.855000	0.55957	2.430000	0.82344	0.455000	0.32223	TCA	AHNAK	-	NULL	ENSG00000124942		0.498	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	143	0	G	NM_024060		62299163	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	nonsense	27.10	113	42	SNP	1.000	T
AMOT	154796	genome.wustl.edu	37	X	112024179	112024179	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:112024179G>A	ENST00000524145.1	-	10	2482	c.2408C>T	c.(2407-2409)tCc>tTc	p.S803F	AMOT_ENST00000371959.3_Missense_Mutation_p.S803F|AMOT_ENST00000371958.1_Missense_Mutation_p.S571F|MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371962.1_Missense_Mutation_p.S571F|AMOT_ENST00000304758.1_Missense_Mutation_p.S394F			Q4VCS5	AMOT_HUMAN	angiomotin	803					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						AGTCAGGGTGGATGAGTGGGA	0.532																																																	0													155.0	140.0	145.0					X																	112024179		2203	4300	6503	SO:0001583	missense	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2408C>T	X.37:g.112024179G>A	ENSP00000429013:p.Ser803Phe		Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.S803F	ENST00000524145.1	37	c.2408	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122820	0.77436	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214;ENST00000371958	T;T;T;T;T	0.39997	1.05;2.19;2.44;2.19;1.88	5.69	3.91	0.45181	Angiomotin, C-terminal (1);	0.132843	0.56097	N	0.000021	T	0.35278	0.0926	L	0.44542	1.39	0.43296	D	0.995285	B	0.11235	0.004	B	0.12156	0.007	T	0.20338	-1.0278	10	0.62326	D	0.03	-4.3522	11.013	0.47673	0.1557:0.0:0.8443:0.0	.	803	Q4VCS5	AMOT_HUMAN	F	394;803;571;803;43;571	ENSP00000305557:S394F;ENSP00000361027:S803F;ENSP00000361030:S571F;ENSP00000429013:S803F;ENSP00000361026:S571F	ENSP00000305557:S394F	S	-	2	0	AMOT	111910835	1.000000	0.71417	0.959000	0.39883	0.980000	0.70556	4.869000	0.63028	1.160000	0.42584	0.600000	0.82982	TCC	AMOT	-	pfam_Angiomotin_C	ENSG00000126016		0.532	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	-	0.00	20	0	G	NM_133265		112024179	-1	tier1	-	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	37.14	22	13	SNP	0.995	A
APBA2	321	genome.wustl.edu	37	15	29400541	29400541	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:29400541C>T	ENST00000558402.1	+	14	2585	c.1986C>T	c.(1984-1986)atC>atT	p.I662I	APBA2_ENST00000558330.1_Silent_p.I650I|APBA2_ENST00000411764.1_Silent_p.I650I|APBA2_ENST00000561069.1_Silent_p.I662I|APBA2_ENST00000558259.1_Silent_p.I662I			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	662	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CGGTCCTTATCAAGCGGCCAG	0.607																																																	0													173.0	148.0	156.0					15																	29400541		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1986C>T	15.37:g.29400541C>T			E9PGI4|O60571|Q5XKC0	Silent	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.I662	ENST00000558402.1	37	c.1986	CCDS10022.1	15																																																																																			APBA2	-	superfamily_PDZ,pfscan_PDZ	ENSG00000034053		0.607	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	-	0.00	40	0	C	NM_005503		29400541	+1	tier1	-	no_errors	ENST00000558259	ensembl	human	known	74_37	silent	30.65	43	19	SNP	1.000	T
ARFGEF2	10564	genome.wustl.edu	37	20	47589702	47589702	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:47589702A>G	ENST00000371917.4	+	12	1546	c.1546A>G	c.(1546-1548)Att>Gtt	p.I516V		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	516	HUS; DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TGTTGTGGATATTTATGTCAA	0.358																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													113.0	106.0	108.0					20																	47589702		2203	4300	6503	SO:0001583	missense	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1546A>G	20.37:g.47589702A>G	ENSP00000360985:p.Ile516Val		Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.I516V	ENST00000371917.4	37	c.1546	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539143	0.85917	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.53857	0.6	5.5	5.5	0.81552	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72630	0.3484	M	0.80508	2.5	0.80722	D	1	D	0.60575	0.988	D	0.65323	0.934	T	0.77161	-0.2689	10	0.72032	D	0.01	.	15.6362	0.76953	1.0:0.0:0.0:0.0	.	516	Q9Y6D5	BIG2_HUMAN	V	516	ENSP00000360985:I516V	ENSP00000360985:I516V	I	+	1	0	ARFGEF2	47023109	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.090000	0.63153	0.460000	0.39030	ATT	ARFGEF2	-	superfamily_ARM-type_fold	ENSG00000124198		0.358	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	-	0.00	58	0	A	NM_006420		47589702	+1	tier1	-	no_errors	ENST00000371917	ensembl	human	known	74_37	missense	38.24	42	26	SNP	1.000	G
ARID1A	8289	genome.wustl.edu	37	1	27087879	27087879	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:27087879C>T	ENST00000324856.7	+	6	2537	c.2166C>T	c.(2164-2166)aaC>aaT	p.N722N	ARID1A_ENST00000457599.2_Silent_p.N722N|ARID1A_ENST00000374152.2_Silent_p.N339N|RN7SL501P_ENST00000578818.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	722					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.N722fs*18(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GAGCAGGCAACCAGATGCCAC	0.502			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Deletion - Frameshift(1)	ovary(1)											78.0	73.0	75.0					1																	27087879		2203	4300	6503	SO:0001819	synonymous_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2166C>T	1.37:g.27087879C>T			D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Silent	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.N722	ENST00000324856.7	37	c.2166	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.502	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	-	0.00	32	0	C	NM_139135		27087879	+1	tier1	-	no_errors	ENST00000324856	ensembl	human	known	74_37	silent	30.00	28	12	SNP	1.000	T
ATF7IP	55729	genome.wustl.edu	37	12	14589100	14589100	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:14589100G>T	ENST00000540793.1	+	3	1861	c.1706G>T	c.(1705-1707)cGt>cTt	p.R569L	ATF7IP_ENST00000261168.4_Missense_Mutation_p.R569L|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000543189.1_Missense_Mutation_p.R568L|ATF7IP_ENST00000536444.1_Missense_Mutation_p.R568L|ATF7IP_ENST00000544627.1_Missense_Mutation_p.R577L			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	569	Glu-rich.|Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						CAGTCTAAACGTCGTCGATAT	0.353																																																	0													118.0	118.0	118.0					12																	14589100		2203	4300	6503	SO:0001583	missense	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.1706G>T	12.37:g.14589100G>T	ENSP00000444589:p.Arg569Leu		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.R569L	ENST00000540793.1	37	c.1706	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943001	0.92526	.	.	ENSG00000171681	ENST00000261168;ENST00000538511;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.40225	1.46;1.04;1.46;1.46;1.46	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000003	T	0.64560	0.2609	M	0.61703	1.905	0.58432	D	0.999992	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.998;0.999;0.994;0.994;0.999;0.999	T	0.65837	-0.6071	10	0.87932	D	0	-10.7714	19.2901	0.94095	0.0:0.0:1.0:0.0	.	577;568;568;569;568;180	B4E2A2;B4DRL6;G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;.;.;MCAF1_HUMAN;.;.	L	569;8;568;568;577;569	ENSP00000261168:R569L;ENSP00000443179:R568L;ENSP00000445955:R568L;ENSP00000440440:R577L;ENSP00000444589:R569L	ENSP00000261168:R569L	R	+	2	0	ATF7IP	14480367	1.000000	0.71417	0.983000	0.44433	0.994000	0.84299	4.786000	0.62425	2.728000	0.93425	0.585000	0.79938	CGT	ATF7IP	-	NULL	ENSG00000171681		0.353	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1		0.00	21	0	G	NM_018179		14589100	+1			no_errors	ENST00000261168	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.996	T
ATG2B	55102	genome.wustl.edu	37	14	96829287	96829287	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:96829287G>C	ENST00000359933.4	-	1	920	c.27C>G	c.(25-27)atC>atG	p.I9M	GSKIP_ENST00000556095.1_5'Flank|GSKIP_ENST00000554182.1_5'Flank|GSKIP_ENST00000555181.1_5'Flank	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	9					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CCCTCTTCTTGATGGACTCCG	0.642																																																	0													51.0	54.0	53.0					14																	96829287		2087	4224	6311	SO:0001583	missense	0			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.27C>G	14.37:g.96829287G>C	ENSP00000353010:p.Ile9Met		Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.I9M	ENST00000359933.4	37	c.27	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	G	18.18	3.565808	0.65651	.	.	ENSG00000066739	ENST00000359933	T	0.56941	0.43	4.02	2.04	0.26737	.	0.000000	0.64402	U	0.000004	T	0.67335	0.2882	M	0.69248	2.105	0.41354	D	0.987384	D	0.76494	0.999	D	0.80764	0.994	T	0.68534	-0.5383	10	0.72032	D	0.01	.	11.9051	0.52705	0.0:0.0:0.6825:0.3175	.	9	Q96BY7	ATG2B_HUMAN	M	9	ENSP00000353010:I9M	ENSP00000353010:I9M	I	-	3	3	ATG2B	95899040	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	1.193000	0.32162	0.287000	0.22375	-0.500000	0.04577	ATC	ATG2B	-	NULL	ENSG00000066739		0.642	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1	-	0.00	57	0	G	NM_018036		96829287	-1	tier1	-	no_errors	ENST00000359933	ensembl	human	known	74_37	missense	29.27	58	24	SNP	1.000	C
AWAT2	158835	genome.wustl.edu	37	X	69263824	69263824	+	Silent	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:69263824C>G	ENST00000276101.3	-	3	224	c.219G>C	c.(217-219)gtG>gtC	p.V73V		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	73					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						GCCAGTGCCTCACACAGGTAA	0.612																																					NSCLC(80;1334 1436 9350 24214 26427)												0													34.0	28.0	30.0					X																	69263824		2201	4298	6499	SO:0001819	synonymous_variant	0			BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.219G>C	X.37:g.69263824C>G			Q6IEE3|Q6P437	Silent	SNP	pfam_DAGAT	p.V73	ENST00000276101.3	37	c.219	CCDS35320.1	X																																																																																			AWAT2	-	pfam_DAGAT	ENSG00000147160		0.612	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT2	HGNC	protein_coding	OTTHUMT00000358738.1	-	0.00	32	0	C	NM_001002254		69263824	-1	tier1	-	no_errors	ENST00000276101	ensembl	human	known	74_37	silent	65.12	15	28	SNP	0.464	G
AVPR2	554	genome.wustl.edu	37	X	153171021	153171021	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:153171021A>G	ENST00000358927.2	+	3	270	c.61A>G	c.(61-63)Agc>Ggc	p.S21G	AVPR2_ENST00000337474.5_Missense_Mutation_p.S21G|AVPR2_ENST00000370049.1_Missense_Mutation_p.S21G			P30518	V2R_HUMAN	arginine vasopressin receptor 2	21					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	CAGCCTGCCCAGCAACAGCAG	0.677																																																	0													6.0	8.0	7.0					X																	153171021		2110	4146	6256	SO:0001583	missense	0			Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.61A>G	X.37:g.153171021A>G	ENSP00000351805:p.Ser21Gly		C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Vprsn_rcpt_V2,prints_Vasoprsn_rcpt,prints_GPCR_Rhodpsn	p.S21G	ENST00000358927.2	37	c.61	CCDS14735.1	X	.	.	.	.	.	.	.	.	.	.	A	7.522	0.656883	0.14580	.	.	ENSG00000126895	ENST00000358927;ENST00000430697;ENST00000337474;ENST00000370049	T;T;T;T	0.75938	-0.98;-0.81;-0.98;-0.45	4.03	-0.684	0.11331	.	1.036640	0.07660	N	0.933510	T	0.41604	0.1166	N	0.01352	-0.895	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.25847	-1.0120	10	0.13470	T	0.59	-10.0096	7.0647	0.25145	0.4834:0.0:0.5166:0.0	.	21;21	P30518-2;P30518	.;V2R_HUMAN	G	21	ENSP00000351805:S21G;ENSP00000393513:S21G;ENSP00000338072:S21G;ENSP00000359066:S21G	ENSP00000338072:S21G	S	+	1	0	AVPR2	152824215	0.000000	0.05858	0.152000	0.22495	0.368000	0.29767	-0.331000	0.07914	-0.198000	0.10333	0.144000	0.16011	AGC	AVPR2	-	prints_Vprsn_rcpt_V2	ENSG00000126895		0.677	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR2	HGNC	protein_coding	OTTHUMT00000061127.2	-	0.00	27	0	A			153171021	+1	tier1	-	no_errors	ENST00000337474	ensembl	human	known	74_37	missense	6.33	74	5	SNP	0.065	G
BCL2L11	10018	genome.wustl.edu	37	2	111907693	111907693	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:111907693G>A	ENST00000393256.3	+	3	740	c.467G>A	c.(466-468)gGa>gAa	p.G156E	BCL2L11_ENST00000393253.2_Missense_Mutation_p.G66E|BCL2L11_ENST00000357757.2_Missense_Mutation_p.G156E|BCL2L11_ENST00000308659.8_Missense_Mutation_p.G96E	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	156					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CGGCGTATTGGAGACGAGTTT	0.443																																																	0													159.0	119.0	133.0					2																	111907693		2203	4300	6503	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.467G>A	2.37:g.111907693G>A	ENSP00000376943:p.Gly156Glu		A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting_BH3_dom,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.G156E	ENST00000393256.3	37	c.467	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822663	0.90873	.	.	ENSG00000153094	ENST00000308659;ENST00000357757;ENST00000393253;ENST00000393256;ENST00000452033	.	.	.	5.89	5.89	0.94794	Bcl-x interacting (1);	0.000000	0.56097	D	0.000022	T	0.67515	0.2901	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.69243	-0.5196	9	0.87932	D	0	-14.1923	15.7362	0.77846	0.0:0.0:1.0:0.0	.	66;156;96	O43521-3;O43521;O43521-2	.;B2L11_HUMAN;.	E	96;156;66;156;23	.	ENSP00000309226:G96E	G	+	2	0	BCL2L11	111624164	1.000000	0.71417	0.999000	0.59377	0.953000	0.61014	5.870000	0.69620	2.791000	0.96007	0.591000	0.81541	GGA	BCL2L11	-	pfam_Bcl-x_interacting_BH3_dom,pirsf_Bcl-2-like_11	ENSG00000153094		0.443	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	-	0.00	53	0	G			111907693	+1	tier1	-	no_errors	ENST00000393256	ensembl	human	known	74_37	missense	32.65	33	16	SNP	1.000	A
BMP2K	55589	genome.wustl.edu	37	4	79832424	79832424	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:79832424A>G	ENST00000335016.5	+	16	2889	c.2723A>G	c.(2722-2724)aAt>aGt	p.N908S	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	908					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						AAGAAGGTGAATGTACAAGAA	0.473																																																	0													60.0	55.0	56.0					4																	79832424		1934	4135	6069	SO:0001583	missense	0			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2723A>G	4.37:g.79832424A>G	ENSP00000334836:p.Asn908Ser		O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.N908S	ENST00000335016.5	37	c.2723	CCDS47083.1	4	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.208455	0.00292	.	.	ENSG00000138756	ENST00000335016	T	0.70749	-0.51	5.05	-6.31	0.02001	.	1.225120	0.05582	N	0.573142	T	0.29061	0.0722	N	0.00583	-1.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47661	-0.9100	10	0.02654	T	1	0.2158	8.8529	0.35210	0.2954:0.2954:0.4092:0.0	.	908	Q9NSY1	BMP2K_HUMAN	S	908	ENSP00000334836:N908S	ENSP00000334836:N908S	N	+	2	0	BMP2K	80051448	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-0.432000	0.06956	-0.897000	0.03910	0.397000	0.26171	AAT	BMP2K	-	NULL	ENSG00000138756		0.473	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BMP2K	HGNC	protein_coding		-	0.00	57	0	A	NM_017593		79832424	+1	tier1	-	no_errors	ENST00000335016	ensembl	human	known	74_37	missense	50.00	24	24	SNP	0.000	G
BNC2	54796	genome.wustl.edu	37	9	16437354	16437354	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:16437354A>G	ENST00000380672.4	-	6	895	c.838T>C	c.(838-840)Tca>Cca	p.S280P	BNC2_ENST00000380666.2_Missense_Mutation_p.S280P|BNC2_ENST00000545497.1_Missense_Mutation_p.S185P|BNC2_ENST00000380667.2_Missense_Mutation_p.S213P	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CTTATATCTGAGTCTGTCTTT	0.478																																																	0													154.0	147.0	149.0					9																	16437354		2203	4300	6503	SO:0001583	missense	0			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.838T>C	9.37:g.16437354A>G	ENSP00000370047:p.Ser280Pro			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S280P	ENST00000380672.4	37	c.838	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	A	15.96	2.985617	0.53934	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T	0.03831	3.79;3.79;3.79;3.79;3.79	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.18841	0.0452	L	0.59436	1.845	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.76494	0.999;0.998;0.994;0.997;0.997;0.999;0.995;0.998;0.998;0.998	D;D;D;D;D;D;D;D;D;D	0.80764	0.974;0.987;0.986;0.991;0.977;0.994;0.969;0.991;0.991;0.987	T	0.00102	-1.2063	10	0.46703	T	0.11	-9.3449	16.6406	0.85098	1.0:0.0:0.0:0.0	.	185;213;317;280;106;280;238;280;185;45	F5H586;B1APH0;Q06HC4;Q6ZN30-2;B4E3J2;F5H8G9;Q5H9S4;Q6ZN30;B4DR27;D3DRJ1	.;.;.;.;.;.;.;BNC2_HUMAN;.;.	P	280;237;317;308;213;185;106;280;280	ENSP00000370047:S280P;ENSP00000408370:S237P;ENSP00000370042:S213P;ENSP00000444640:S185P;ENSP00000370041:S280P	ENSP00000370041:S280P	S	-	1	0	BNC2	16427354	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.326000	0.78906	0.533000	0.62120	TCA	BNC2	-	NULL	ENSG00000173068		0.478	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	-	0.00	64	0	A	NM_017637		16437354	-1	tier1	-	no_errors	ENST00000380672	ensembl	human	known	74_37	missense	51.35	18	19	SNP	1.000	G
HEATR9	256957	genome.wustl.edu	37	17	34185297	34185297	+	Silent	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:34185297G>C	ENST00000311880.2	-	11	1207	c.1059C>G	c.(1057-1059)ctC>ctG	p.L353L	C17orf66_ENST00000592980.1_Silent_p.L313L	NM_152781.2	NP_689994.2	A2RTY3	HEAT9_HUMAN		353					hematopoietic progenitor cell differentiation (GO:0002244)					breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(6)|lung(11)|skin(2)|stomach(4)	38		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		CAATGGTCTTGAGCATTTGGG	0.522																																																	0													175.0	163.0	167.0					17																	34185297		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000311880.2:c.1059C>G	17.37:g.34185297G>C			B4DX21|B4DXA4|B4DXF0|Q8N4R4|Q96M46	Silent	SNP	superfamily_ARM-type_fold	p.L353	ENST00000311880.2	37	c.1059	CCDS11299.1	17																																																																																			C17orf66	-	superfamily_ARM-type_fold	ENSG00000172653		0.522	C17orf66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf66	HGNC	protein_coding	OTTHUMT00000256487.1	-	0.00	37	0	G			34185297	-1	tier1	-	no_errors	ENST00000311880	ensembl	human	known	74_37	silent	34.67	49	26	SNP	0.995	C
BZRAP1	9256	genome.wustl.edu	37	17	56400114	56400114	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:56400114C>T	ENST00000343736.4	-	9	1381	c.1218G>A	c.(1216-1218)ctG>ctA	p.L406L	BZRAP1-AS1_ENST00000579527.1_RNA|BZRAP1_ENST00000268893.6_Silent_p.L346L|BZRAP1_ENST00000355701.3_Silent_p.L406L			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	406						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GCTGGCCCCTCAGCTCCGCAT	0.652																																																	0													50.0	49.0	49.0					17																	56400114		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.1218G>A	17.37:g.56400114C>T			O75111|Q8N5W3	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.L406	ENST00000343736.4	37	c.1218	CCDS11605.1	17																																																																																			BZRAP1	-	NULL	ENSG00000005379		0.652	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	-	0.00	30	0	C	NM_004758		56400114	-1	tier1	-	no_errors	ENST00000355701	ensembl	human	known	74_37	silent	34.48	19	10	SNP	1.000	T
C3orf27	23434	genome.wustl.edu	37	3	128292319	128292320	+	Frame_Shift_Del	DEL	TC	TC	-	rs147519916		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:128292319_128292320delTC	ENST00000356020.2	-	3	1219_1220	c.253_254delGA	c.(253-255)gatfs	p.D86fs		NM_007354.2	NP_031380.1	O15544	GR6_HUMAN	chromosome 3 open reading frame 27	86										large_intestine(2)|lung(5)|prostate(1)	8				GBM - Glioblastoma multiforme(114;0.176)		GAGCTCGTCATCTCTCTCTCTC	0.599																																																	0																																										SO:0001589	frameshift_variant	0			AF008192	CCDS3050.1	3q21	2005-12-19			ENSG00000198685	ENSG00000198685			17099	protein-coding gene	gene with protein product						9307271	Standard	NR_125802		Approved	GR6	uc003ekq.3	O15544	OTTHUMG00000159688	ENST00000356020.2:c.253_254delGA	3.37:g.128292329_128292330delTC	ENSP00000348302:p.Asp86fs			Frame_Shift_Del	DEL	NULL	p.D85fs	ENST00000356020.2	37	c.254_253	CCDS3050.1	3																																																																																			C3orf27	-	NULL	ENSG00000198685		0.599	C3orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf27	HGNC	protein_coding	OTTHUMT00000356924.1		0.00	19	0	TC	NM_007354		128292320	-1	tier1		no_errors	ENST00000356020	ensembl	human	known	74_37	frame_shift_del	18.18	18	4	DEL	0.075:0.076	-
C5orf58	133874	genome.wustl.edu	37	5	169661118	169661119	+	Splice_Site	INS	-	-	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:169661118_169661119insT	ENST00000593851.1	+	2	62_63		c.e2-1		C5orf58_ENST00000517575.1_Intron|C5orf58_ENST00000521850.1_5'UTR	NM_001102609.1	NP_001096079.1	C9J3I9	CE058_HUMAN	chromosome 5 open reading frame 58											large_intestine(1)|lung(4)|urinary_tract(1)	6						AACAAAATTAGTTTTTTTACAG	0.416																																																	0										1,3541		0,1,1770						-3.0	0.0			81	0,7820		0,0,3910	no	splice-3	C5orf58	NM_001102609.1		0,1,5680	A1A1,A1R,RR		0.0,0.0282,0.0088				1,11361				SO:0001630	splice_region_variant	0			BC030767	CCDS47338.1	5q35.1	2009-09-30			ENSG00000234511	ENSG00000234511			37272	protein-coding gene	gene with protein product							Standard	NM_001102609		Approved		uc010jjn.3	C9J3I9	OTTHUMG00000163122	ENST00000593851.1:c.-21-1->T	5.37:g.169661125_169661125dupT				Splice_Site	INS	-	e1-1	ENST00000593851.1	37	c.1-1_0	CCDS47338.1	5																																																																																			C5orf58	-	-	ENSG00000234511		0.416	C5orf58-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf58	HGNC	protein_coding			0.00	37	0	-	NM_001102609	Intron	169661119	+1	tier1		no_errors	ENST00000593851	ensembl	human	known	74_37	splice_site_ins	45.45	12	10	INS	0.000:0.003	T
CACNB3	784	genome.wustl.edu	37	12	49217550	49217550	+	Silent	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:49217550C>G	ENST00000301050.2	+	3	454	c.255C>G	c.(253-255)gtC>gtG	p.V85V	CACNB3_ENST00000547392.1_Silent_p.V85V|CACNB3_ENST00000536187.2_Silent_p.V84V|CACNB3_ENST00000540990.1_Silent_p.V72V|CACNB3_ENST00000550168.1_3'UTR|CACNB3_ENST00000547230.1_Intron	NM_000725.3	NP_000716.2	P54284	CACB3_HUMAN	calcium channel, voltage-dependent, beta 3 subunit	85	SH3.				axon guidance (GO:0007411)|calcium ion transport (GO:0006816)|membrane depolarization (GO:0051899)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|membrane (GO:0016020)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(1)|large_intestine(5)|lung(4)|prostate(1)	12					Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTCTGGAGTCAACTTTGAGG	0.502																																																	0													109.0	108.0	109.0					12																	49217550		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8769.1, CCDS55821.1, CCDS55822.1, CCDS55823.1	12q13	2008-05-02				ENSG00000167535		"""Calcium channel subunits"""	1403	protein-coding gene	gene with protein product		601958		CACNLB3		8119293	Standard	NM_000725		Approved		uc010sly.2	P54284		ENST00000301050.2:c.255C>G	12.37:g.49217550C>G			A8K0Z4|B7Z4Q1|B7Z973|B7ZAK8|F5GZW7|F5H2P6|F8VSG3|Q13913	Silent	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,prints_VDCC_L_bsu,prints_VDCC_L_b3su	p.V85	ENST00000301050.2	37	c.255	CCDS8769.1	12																																																																																			CACNB3	-	superfamily_SH3_domain	ENSG00000167535		0.502	CACNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNB3	HGNC	protein_coding	OTTHUMT00000408886.1	-	0.00	63	0	C			49217550	+1	tier1	-	no_errors	ENST00000301050	ensembl	human	known	74_37	silent	32.61	31	15	SNP	1.000	G
CASD1	64921	genome.wustl.edu	37	7	94184821	94184821	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:94184821T>A	ENST00000297273.4	+	18	2432	c.2145T>A	c.(2143-2145)taT>taA	p.Y715*		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	715						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			TTTGCCAGTATCACATATGGC	0.363																																																	0													45.0	43.0	44.0					7																	94184821		2203	4300	6503	SO:0001587	stop_gained	0			AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.2145T>A	7.37:g.94184821T>A	ENSP00000297273:p.Tyr715*		B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Nonsense_Mutation	SNP	pfam_Cas1_AcylTrans_dom,superfamily_Cyclin-like	p.Y715*	ENST00000297273.4	37	c.2145	CCDS5636.1	7	.	.	.	.	.	.	.	.	.	.	T	36	5.781204	0.96929	.	.	ENSG00000127995	ENST00000297273	.	.	.	5.33	-2.82	0.05787	.	0.118710	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.4764	0.22039	0.1369:0.5029:0.0:0.3602	.	.	.	.	X	715	.	ENSP00000297273:Y715X	Y	+	3	2	CASD1	94022757	0.995000	0.38212	0.963000	0.40424	0.245000	0.25701	0.391000	0.20784	-0.294000	0.08973	-1.039000	0.02377	TAT	CASD1	-	NULL	ENSG00000127995		0.363	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASD1	HGNC	protein_coding	OTTHUMT00000255216.1	-	0.00	38	0	T	NM_022900		94184821	+1	tier1	-	no_errors	ENST00000297273	ensembl	human	known	74_37	nonsense	36.23	44	25	SNP	0.995	A
CASP14	23581	genome.wustl.edu	37	19	15164702	15164702	+	Silent	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:15164702G>T	ENST00000427043.3	+	4	644	c.336G>T	c.(334-336)ctG>ctT	p.L112L	AC004699.1_ENST00000411269.1_RNA|CASP14_ENST00000221740.1_Silent_p.L112L	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	112					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						TCGAGGCCCTGAACAACAAGA	0.562																																																	0													96.0	87.0	90.0					19																	15164702		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.336G>T	19.37:g.15164702G>T			O95823|Q3SYC9	Silent	SNP	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.L112	ENST00000427043.3	37	c.336	CCDS12323.1	19																																																																																			CASP14	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_ICE_p20	ENSG00000105141		0.562	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP14	HGNC	protein_coding	OTTHUMT00000465663.1		0.00	18	0	G	NM_012114		15164702	+1			no_errors	ENST00000221740	ensembl	human	known	74_37	silent	9.09	30	3	SNP	0.291	T
CAST	831	genome.wustl.edu	37	5	96108510	96108510	+	3'UTR	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:96108510G>C	ENST00000341926.3	+	0	2479				CAST_ENST00000508579.1_3'UTR|CAST_ENST00000511049.1_3'UTR|ERAP1_ENST00000296754.3_Intron|CAST_ENST00000359176.4_3'UTR|CAST_ENST00000325674.7_3'UTR|CAST_ENST00000395812.2_3'UTR|CAST_ENST00000395813.1_3'UTR|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000309190.5_3'UTR|CAST_ENST00000338252.3_3'UTR|CAST_ENST00000504465.1_3'UTR			P20810	ICAL_HUMAN	calpastatin						negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		AAATGAATTTGACTGGTTCAC	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.*190G>C	5.37:g.96108510G>C			B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	RNA	SNP	-	NULL	ENST00000341926.3	37	NULL		5																																																																																			CAST	-	-	ENSG00000153113		0.294	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	-	0.00	54	0	G	NM_173062		96108510	+1	tier1	-	no_errors	ENST00000348386	ensembl	human	known	74_37	rna	50.00	12	12	SNP	0.942	C
CCDC14	64770	genome.wustl.edu	37	3	123650025	123650025	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:123650025C>T	ENST00000488653.2	-	12	1936	c.1846G>A	c.(1846-1848)Gaa>Aaa	p.E616K	CCDC14_ENST00000310351.4_Missense_Mutation_p.E456K|CCDC14_ENST00000433542.2_Missense_Mutation_p.E575K|CCDC14_ENST00000489746.1_Missense_Mutation_p.E416K|CCDC14_ENST00000485727.1_Missense_Mutation_p.E416K|CCDC14_ENST00000483247.1_Intron			Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	616					substantia nigra development (GO:0021762)	centrosome (GO:0005813)				NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)	21		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		TTTTCCTTTTCAGCAGTTTCT	0.363																																																	0													72.0	71.0	71.0					3																	123650025		2203	4300	6503	SO:0001583	missense	0			AL122079	CCDS3025.2	3q21.1	2014-03-20			ENSG00000175455	ENSG00000175455			25766	protein-coding gene	gene with protein product						12477932	Standard	NM_022757		Approved	FLJ12892, DKFZp434L1050	uc010hrt.3	Q49A88	OTTHUMG00000153005	ENST00000488653.2:c.1846G>A	3.37:g.123650025C>T	ENSP00000420180:p.Glu616Lys		B7Z2T2|B8ZZ41|B8ZZ58|D3DN98|Q7Z3N3|Q86T30|Q8IWF8|Q8WUJ8|Q96K47|Q9H9A3|Q9UFH0	Missense_Mutation	SNP	NULL	p.E616K	ENST00000488653.2	37	c.1846		3	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856662	0.71834	.	.	ENSG00000175455	ENST00000488653;ENST00000310351;ENST00000485727;ENST00000489746;ENST00000433542;ENST00000409697;ENST00000419247	T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.17	3.24	0.37175	.	0.206931	0.40144	N	0.001179	T	0.43166	0.1235	M	0.61703	1.905	0.36233	D	0.852756	B;B;B;B	0.27997	0.197;0.197;0.082;0.197	B;B;B;B	0.25140	0.058;0.058;0.039;0.058	T	0.55749	-0.8092	10	0.56958	D	0.05	.	10.5703	0.45196	0.0:0.8274:0.0:0.1726	.	616;575;416;457	Q49A88;Q49A88-6;Q49A88-4;Q49A88-5	CCD14_HUMAN;.;.;.	K	616;456;416;416;575;597;257	ENSP00000420180:E616K;ENSP00000312031:E456K;ENSP00000418002:E416K;ENSP00000418403:E416K;ENSP00000395706:E575K;ENSP00000386866:E597K;ENSP00000400957:E257K	ENSP00000312031:E456K	E	-	1	0	CCDC14	125132715	0.998000	0.40836	0.999000	0.59377	0.993000	0.82548	2.933000	0.48948	1.407000	0.46875	0.563000	0.77884	GAA	CCDC14	-	NULL	ENSG00000175455		0.363	CCDC14-202	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC14	HGNC	protein_coding		-	0.00	53	0	C	NM_022757		123650025	-1	tier1	-	no_errors	ENST00000488653	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.986	T
CCDC168	643677	genome.wustl.edu	37	13	103388934	103388934	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr13:103388934C>G	ENST00000322527.2	-	1	225	c.226G>C	c.(226-228)Gag>Cag	p.E76Q		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	76																	GAGTCTAACTCAAGGAAAGCT	0.418																																																	0													240.0	188.0	204.0					13																	103388934		692	1591	2283	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.226G>C	13.37:g.103388934C>G	ENSP00000320232:p.Glu76Gln		Q8N800	Missense_Mutation	SNP	NULL	p.E76Q	ENST00000322527.2	37	c.226		13	.	.	.	.	.	.	.	.	.	.	C	8.505	0.865159	0.17250	.	.	ENSG00000175820	ENST00000322527	T	0.03772	3.81	3.7	-0.048	0.13840	.	0.837744	0.09970	N	0.732409	T	0.01558	0.0050	N	0.02011	-0.69	0.09310	N	1	B	0.24823	0.112	B	0.20184	0.028	T	0.48198	-0.9056	10	0.12103	T	0.63	.	3.2125	0.06687	0.0:0.2351:0.2159:0.549	.	76	Q8NDH2	CC168_HUMAN	Q	76	ENSP00000320232:E76Q	ENSP00000320232:E76Q	E	-	1	0	CCDC168	102186935	0.000000	0.05858	0.001000	0.08648	0.168000	0.22595	-0.397000	0.07269	-0.001000	0.14495	-0.379000	0.06801	GAG	CCDC168	-	NULL	ENSG00000175820		0.418	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		-	0.00	58	0	C	NM_001146197		103388934	-1	tier1	-	no_errors	ENST00000322527	ensembl	human	known	74_37	missense	26.23	45	16	SNP	0.001	G
CCT2	10576	genome.wustl.edu	37	12	69980553	69980553	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:69980553C>T	ENST00000299300.6	+	3	287	c.99C>T	c.(97-99)atC>atT	p.I33I	CCT2_ENST00000544368.2_Silent_p.I33I|MIR3913-2_ENST00000577744.1_RNA|CCT2_ENST00000543146.2_5'UTR	NM_006431.2	NP_006422.1	P78371	TCPB_HUMAN	chaperonin containing TCP1, subunit 2 (beta)	33					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)	p.I33I(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(1)	24	all_cancers(2;7.7e-106)|Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.72e-18)|GBM - Glioblastoma multiforme(2;2.58e-10)|Lung(24;0.000185)|OV - Ovarian serous cystadenocarcinoma(12;0.00126)|STAD - Stomach adenocarcinoma(21;0.00501)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TTGGTGCCATCGCCATTGGAG	0.338																																																	1	Substitution - coding silent(1)	endometrium(1)											135.0	149.0	145.0					12																	69980553		2203	4300	6503	SO:0001819	synonymous_variant	0			AF026293	CCDS8991.1, CCDS55843.1	12q14	2011-09-02						"""Heat Shock Proteins / Chaperonins"""	1615	protein-coding gene	gene with protein product		605139				9819444	Standard	NM_001198842		Approved	Cctb	uc001svb.1	P78371	OTTHUMG00000169383	ENST00000299300.6:c.99C>T	12.37:g.69980553C>T			A8K402|B5BTY7|B7Z243|B7Z7K4|B7ZAT2|Q14D36|Q6IAT3	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_beta	p.I33	ENST00000299300.6	37	c.99	CCDS8991.1	12																																																																																			CCT2	-	superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_beta	ENSG00000166226		0.338	CCT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT2	HGNC	protein_coding	OTTHUMT00000403818.1	-	0.00	72	0	C	NM_006431		69980553	+1	tier1	-	no_errors	ENST00000299300	ensembl	human	known	74_37	silent	33.33	30	15	SNP	0.974	T
CCT8L2	150160	genome.wustl.edu	37	22	17072518	17072518	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:17072518T>C	ENST00000359963.3	-	1	1182	c.923A>G	c.(922-924)gAc>gGc	p.D308G		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	308					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GCCATACTTGTCCGCCAGTGT	0.532																																																	0													190.0	166.0	174.0					22																	17072518		2203	4300	6503	SO:0001583	missense	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.923A>G	22.37:g.17072518T>C	ENSP00000353048:p.Asp308Gly		A4QPH3|Q9UJS3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.D308G	ENST00000359963.3	37	c.923	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	t	10.29	1.310492	0.23821	.	.	ENSG00000198445	ENST00000359963	T	0.78481	-1.18	1.98	1.98	0.26296	.	0.178508	0.26457	U	0.024274	T	0.63581	0.2523	L	0.44542	1.39	0.09310	N	1	B	0.24186	0.099	B	0.25759	0.063	T	0.42599	-0.9442	10	0.15066	T	0.55	-16.9039	5.9203	0.19078	0.0:0.0:0.0:1.0	.	308	Q96SF2	TCPQM_HUMAN	G	308	ENSP00000353048:D308G	ENSP00000353048:D308G	D	-	2	0	CCT8L2	15452518	0.139000	0.22563	0.002000	0.10522	0.006000	0.05464	3.036000	0.49767	0.922000	0.37019	0.312000	0.20444	GAC	CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000198445		0.532	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	-	0.00	60	0	T			17072518	-1	tier1	-	no_errors	ENST00000359963	ensembl	human	known	74_37	missense	24.00	57	18	SNP	0.005	C
CDCA7	83879	genome.wustl.edu	37	2	174231980	174231980	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:174231980C>T	ENST00000347703.3	+	8	1195	c.1051C>T	c.(1051-1053)Cat>Tat	p.H351Y	CDCA7_ENST00000306721.3_Missense_Mutation_p.H430Y|CDCA7_ENST00000410101.3_Missense_Mutation_p.H386Y|CDCA7_ENST00000392567.2_Missense_Mutation_p.H301Y|CDCA7_ENST00000410019.3_Missense_Mutation_p.H309Y	NM_145810.2	NP_665809.1	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7	351	Mediates transcriptional activity.				apoptotic process (GO:0006915)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.116)			AGCCAAATATCATGGCTTTGG	0.453																																																	0													165.0	151.0	156.0					2																	174231980		2203	4300	6503	SO:0001583	missense	0			BG354580	CCDS2252.1, CCDS2253.1	2q31.1	2008-02-05			ENSG00000144354	ENSG00000144354			14628	protein-coding gene	gene with protein product		609937				11598121, 12188893	Standard	NM_145810		Approved	FLJ14736, JPO1	uc002uic.1	Q9BWT1	OTTHUMG00000132296	ENST00000347703.3:c.1051C>T	2.37:g.174231980C>T	ENSP00000272789:p.His351Tyr		B4DLP8|B4DV66|Q53EW5|Q580W9|Q658K4|Q658N4|Q8NBY9|Q96BV8|Q96SP5	Missense_Mutation	SNP	pfam_Znf-4CXXC_R1	p.H430Y	ENST00000347703.3	37	c.1288	CCDS2253.1	2	.	.	.	.	.	.	.	.	.	.	C	14.50	2.554747	0.45487	.	.	ENSG00000144354	ENST00000347703;ENST00000392567;ENST00000306721;ENST00000410101;ENST00000410019	T;T;T;T;T	0.45668	0.91;0.95;0.96;0.89;0.91	5.51	5.51	0.81932	Zinc-finger domain of monoamine-oxidase A repressor R1 (1);	0.000000	0.85682	D	0.000000	T	0.43277	0.1240	N	0.11673	0.155	0.80722	D	1	D;D;D;D	0.76494	0.99;0.998;0.99;0.999	P;D;P;D	0.69824	0.876;0.963;0.904;0.966	T	0.23619	-1.0183	10	0.07482	T	0.82	-20.6051	19.4394	0.94811	0.0:1.0:0.0:0.0	.	309;386;351;430	B4DLP8;B4DV66;Q9BWT1;Q9BWT1-2	.;.;CDCA7_HUMAN;.	Y	351;301;430;386;309	ENSP00000272789:H351Y;ENSP00000376348:H301Y;ENSP00000306968:H430Y;ENSP00000386656:H386Y;ENSP00000386833:H309Y	ENSP00000306968:H430Y	H	+	1	0	CDCA7	173940226	1.000000	0.71417	0.996000	0.52242	0.963000	0.63663	7.754000	0.85163	2.581000	0.87130	0.655000	0.94253	CAT	CDCA7	-	pfam_Znf-4CXXC_R1	ENSG00000144354		0.453	CDCA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7	HGNC	protein_coding	OTTHUMT00000255400.1	-	0.00	67	0	C	NM_031942		174231980	+1	tier1	-	no_errors	ENST00000306721	ensembl	human	known	74_37	missense	48.08	27	25	SNP	1.000	T
CDH12	1010	genome.wustl.edu	37	5	21842384	21842384	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:21842384G>A	ENST00000382254.1	-	8	1786	c.700C>T	c.(700-702)Caa>Taa	p.Q234*	CDH12_ENST00000504376.2_Nonsense_Mutation_p.Q234*|CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000522262.1_Nonsense_Mutation_p.Q194*	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	234	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ATGAGTACTTGATATTGTTCT	0.393										HNSCC(59;0.17)																																							0													255.0	203.0	221.0					5																	21842384		2203	4300	6503	SO:0001587	stop_gained	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.700C>T	5.37:g.21842384G>A	ENSP00000371689:p.Gln234*		B2RBT1|B7Z2U6|Q86UD2	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q234*	ENST00000382254.1	37	c.700	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.768376	0.99259	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	.	.	.	5.34	4.44	0.53790	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	16.0773	0.80976	0.0:0.1336:0.8664:0.0	.	.	.	.	X	234;234;194	.	ENSP00000371689:Q234X	Q	-	1	0	CDH12	21878141	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.670000	0.98625	2.480000	0.83734	0.655000	0.94253	CAA	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000154162		0.393	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	70	0	G	NM_004061		21842384	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	nonsense	38.67	46	29	SNP	1.000	A
CDK13	8621	genome.wustl.edu	37	7	39991112	39991112	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:39991112C>T	ENST00000181839.4	+	1	1477	c.872C>T	c.(871-873)tCg>tTg	p.S291L	RP11-467D6.1_ENST00000569710.1_RNA|CDK13_ENST00000340829.5_Missense_Mutation_p.S291L	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	291					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						GAGCCGCCTTCGGCCTACAAG	0.677																																																	0													7.0	7.0	7.0					7																	39991112		2101	4143	6244	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.872C>T	7.37:g.39991112C>T	ENSP00000181839:p.Ser291Leu		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S291L	ENST00000181839.4	37	c.872	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536463	0.65085	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.19669	2.13;2.13	3.96	3.96	0.45880	.	.	.	.	.	T	0.14399	0.0348	L	0.27053	0.805	0.44330	D	0.99721	P;P	0.52463	0.953;0.921	B;B	0.38296	0.27;0.139	T	0.08432	-1.0722	8	.	.	.	-3.9257	15.4476	0.75243	0.0:1.0:0.0:0.0	.	291;291	Q14004-2;Q14004	.;CDK13_HUMAN	L	291	ENSP00000181839:S291L;ENSP00000340557:S291L	.	S	+	2	0	CDK13	39957637	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.718000	0.54919	1.918000	0.55548	0.456000	0.33151	TCG	CDK13	-	NULL	ENSG00000065883		0.677	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	-	0.00	9	0	C	NM_003718		39991112	+1	tier1	-	no_errors	ENST00000181839	ensembl	human	known	74_37	missense	55.56	4	5	SNP	1.000	T
CDYL	9425	genome.wustl.edu	37	6	4943930	4943930	+	Silent	SNP	C	C	T	rs372837191		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:4943930C>T	ENST00000328908.5	+	7	1565	c.1434C>T	c.(1432-1434)ttC>ttT	p.F478F	CDYL_ENST00000472453.1_3'UTR|CDYL_ENST00000397588.3_Silent_p.F424F|CDYL_ENST00000343762.5_Silent_p.F292F|CDYL_ENST00000449732.2_Silent_p.F292F			Q9Y232	CDYL1_HUMAN	chromodomain protein, Y-like	478					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|methylated histone binding (GO:0035064)|transcription corepressor activity (GO:0003714)			breast(2)|kidney(2)|large_intestine(9)|lung(13)|skin(1)|stomach(2)|urinary_tract(1)	30	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		ATACCACCTTCGGACAGAGTC	0.418																																																	0								C	,,	0,4406		0,0,2203	126.0	129.0	128.0		876,876,1272	3.6	1.0	6		128	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	CDYL	NM_001143970.1,NM_001143971.1,NM_004824.3	,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,	292/413,292/413,424/545	4943930	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF081258	CCDS4491.2, CCDS47364.1	6p25.1	2010-05-04	2003-09-12		ENSG00000153046	ENSG00000153046			1811	protein-coding gene	gene with protein product	"""CDY-like, autosomal"", ""testis-specific chromodomain Y-like protein"""	603778	"""chromodomain protein, Y chromosome-like"""			10192397	Standard	NM_001143970		Approved	DKFZP586C1622, CDYL1	uc003mwj.3	Q9Y232	OTTHUMG00000014170	ENST00000328908.5:c.1434C>T	6.37:g.4943930C>T			A8K6D6|B4DLG4|Q0VDG7|Q32NC5|Q5VX99|Q6P7T5|Q9BWZ2|Q9Y424	Silent	SNP	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.F478	ENST00000328908.5	37	c.1434		6																																																																																			CDYL	-	pfam_Crotonase_core_superfam	ENSG00000153046		0.418	CDYL-001	KNOWN	basic	protein_coding	CDYL	HGNC	protein_coding	OTTHUMT00000039736.1	-	0.00	58	0	C	NM_004824		4943930	+1	tier1	-	no_errors	ENST00000328908	ensembl	human	known	74_37	silent	39.19	45	29	SNP	1.000	T
CEP152	22995	genome.wustl.edu	37	15	49031177	49031177	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:49031177C>T	ENST00000380950.2	-	27	4589	c.4402G>A	c.(4402-4404)Gaa>Aaa	p.E1468K	CEP152_ENST00000399334.3_Missense_Mutation_p.E1412K	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1468					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CCTTCACCTTCACAAGGAACA	0.448																																																	0													115.0	110.0	112.0					15																	49031177		1903	4127	6030	SO:0001583	missense	0			AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.4402G>A	15.37:g.49031177C>T	ENSP00000370337:p.Glu1468Lys		E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NULL	p.E1468K	ENST00000380950.2	37	c.4402	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362613	0.61403	.	.	ENSG00000103995	ENST00000399334	T	0.54071	0.59	5.2	1.17	0.20885	.	0.531595	0.17205	N	0.182952	T	0.33990	0.0882	L	0.27053	0.805	0.26891	N	0.967337	B	0.11235	0.004	B	0.09377	0.004	T	0.16958	-1.0385	10	0.42905	T	0.14	-6.6823	5.9695	0.19344	0.0:0.6322:0.1411:0.2267	.	1412	O94986	CE152_HUMAN	K	1412	ENSP00000382271:E1412K	ENSP00000382271:E1412K	E	-	1	0	CEP152	46818469	0.007000	0.16637	0.102000	0.21198	0.401000	0.30781	0.294000	0.19047	0.066000	0.16515	0.557000	0.71058	GAA	CEP152	-	NULL	ENSG00000103995		0.448	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	HGNC	protein_coding	OTTHUMT00000417365.1	-	0.00	30	0	C	NM_014985		49031177	-1	tier1	-	no_errors	ENST00000380950	ensembl	human	known	74_37	missense	33.33	26	13	SNP	0.304	T
CEP250	11190	genome.wustl.edu	37	20	34090592	34090592	+	Silent	SNP	G	G	A	rs377306728		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:34090592G>A	ENST00000397527.1	+	30	5115	c.4395G>A	c.(4393-4395)ctG>ctA	p.L1465L	CEP250_ENST00000342580.4_Silent_p.L1409L	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1465	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CTCTGGACCTGAAGAAGAGGA	0.512																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	64.0	65.0	65.0		4395	-2.1	1.0	20		65	0,8600		0,0,4300	no	coding-synonymous	CEP250	NM_007186.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		1465/2443	34090592	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.4395G>A	20.37:g.34090592G>A			E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	superfamily_Prefoldin	p.L1465	ENST00000397527.1	37	c.4395	CCDS13255.1	20																																																																																			CEP250	-	NULL	ENSG00000126001		0.512	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	-	0.00	25	0	G	NM_007186		34090592	+1	tier1	-	no_errors	ENST00000397527	ensembl	human	known	74_37	silent	32.14	19	9	SNP	0.984	A
CEP250	11190	genome.wustl.edu	37	20	34092542	34092542	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:34092542G>C	ENST00000397527.1	+	30	7065	c.6345G>C	c.(6343-6345)gaG>gaC	p.E2115D	CEP250_ENST00000342580.4_Missense_Mutation_p.E2059D	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2115	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AGCTGAGGGAGACCCAGCAAA	0.507																																																	0													80.0	86.0	84.0					20																	34092542		2203	4300	6503	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6345G>C	20.37:g.34092542G>C	ENSP00000380661:p.Glu2115Asp		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.E2115D	ENST00000397527.1	37	c.6345	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905162	0.33628	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.50813	2.73;2.71;0.73	4.28	2.22	0.28083	.	0.202181	0.34676	N	0.003762	T	0.33059	0.0850	L	0.54323	1.7	0.19775	N	0.999958	P	0.39480	0.675	B	0.33454	0.164	T	0.17319	-1.0373	10	0.35671	T	0.21	.	4.2533	0.10705	0.2116:0.0:0.6111:0.1772	.	2115	Q9BV73	CP250_HUMAN	D	2115;2059;603	ENSP00000380661:E2115D;ENSP00000341541:E2059D;ENSP00000395992:E603D	ENSP00000341541:E2059D	E	+	3	2	CEP250	33555956	0.543000	0.26434	0.995000	0.50966	0.659000	0.38960	1.896000	0.39789	0.375000	0.24679	0.462000	0.41574	GAG	CEP250	-	NULL	ENSG00000126001		0.507	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	-	0.00	16	0	G	NM_007186		34092542	+1	tier1	-	no_errors	ENST00000397527	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.942	C
CEP85L	387119	genome.wustl.edu	37	6	118886706	118886706	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:118886706C>G	ENST00000368491.3	-	3	1627	c.1006G>C	c.(1006-1008)Gaa>Caa	p.E336Q	CEP85L_ENST00000419517.2_Missense_Mutation_p.E336Q|CEP85L_ENST00000360290.3_Missense_Mutation_p.E234Q|CEP85L_ENST00000472713.1_5'Flank|CEP85L_ENST00000368488.5_Missense_Mutation_p.E339Q|CEP85L_ENST00000392500.3_Missense_Mutation_p.E339Q	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	336						centrosome (GO:0005813)|cytoplasm (GO:0005737)											ATTGGTGTTTCACTTCCTTGT	0.423																																																	0													116.0	116.0	116.0					6																	118886706		2203	4300	6503	SO:0001583	missense	0			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.1006G>C	6.37:g.118886706C>G	ENSP00000357477:p.Glu336Gln		A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	NULL	p.E339Q	ENST00000368491.3	37	c.1015	CCDS43498.1	6	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065790	0.55539	.	.	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604;ENST00000392500;ENST00000360290;ENST00000419517	T;T;T;T;T;T	0.29397	2.81;2.8;2.21;1.89;1.57;1.9	6.07	6.07	0.98685	.	0.267200	0.37809	N	0.001928	T	0.34424	0.0897	L	0.42245	1.32	0.51767	D	0.999933	D;D;D;P;P	0.55800	0.973;0.973;0.973;0.934;0.934	P;P;P;P;P	0.55161	0.77;0.71;0.71;0.71;0.71	T	0.01159	-1.1433	10	0.49607	T	0.09	-15.4251	18.8399	0.92180	0.0:1.0:0.0:0.0	.	234;339;336;339;336	B4DYT2;Q5SZL2-2;G3V0H3;F8W6J2;Q5SZL2	.;.;.;.;CF204_HUMAN	Q	336;339;339;339;234;336	ENSP00000357477:E336Q;ENSP00000357474:E339Q;ENSP00000392131:E339Q;ENSP00000376288:E339Q;ENSP00000353434:E234Q;ENSP00000393317:E336Q	ENSP00000353434:E234Q	E	-	1	0	C6orf204	118993399	1.000000	0.71417	0.992000	0.48379	0.448000	0.32197	4.587000	0.60991	2.885000	0.99019	0.655000	0.94253	GAA	CEP85L	-	NULL	ENSG00000111860		0.423	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP85L	HGNC	protein_coding	OTTHUMT00000041996.2	-	0.00	19	0	C	NM_001042475		118886706	-1	tier1	-	no_errors	ENST00000368488	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	G
CGREF1	10669	genome.wustl.edu	37	2	27325006	27325006	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:27325006C>T	ENST00000260595.5	-	5	593	c.301G>A	c.(301-303)Gct>Act	p.A101T	CGREF1_ENST00000405600.1_Missense_Mutation_p.A101T|CGREF1_ENST00000402394.1_Missense_Mutation_p.A101T|CGREF1_ENST00000312734.4_Missense_Mutation_p.A101T|CGREF1_ENST00000402550.1_Missense_Mutation_p.A101T|CGREF1_ENST00000452318.2_Missense_Mutation_p.A5T|CGREF1_ENST00000404694.3_Missense_Mutation_p.A223T			Q99674	CGRE1_HUMAN	cell growth regulator with EF-hand domain 1	101	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|response to stress (GO:0006950)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			kidney(1)|lung(4)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGCCAGAGCAGCTGTCAAC	0.562																																																	0													45.0	47.0	46.0					2																	27325006		2203	4300	6503	SO:0001583	missense	0			BC034764	CCDS33162.1, CCDS33162.2, CCDS54339.1	2p23.3	2013-01-10			ENSG00000138028	ENSG00000138028		"""EF-hand domain containing"""	16962	protein-coding gene	gene with protein product		606137				8968090	Standard	NM_006569		Approved	CGR11	uc002riq.3	Q99674	OTTHUMG00000152009	ENST00000260595.5:c.301G>A	2.37:g.27325006C>T	ENSP00000260595:p.Ala101Thr		A6NHV7|B4DXY8|B5MCB7|B5MCC9|B5MCP5|E7EU99|Q8N4B7	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.A101T	ENST00000260595.5	37	c.301		2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.990617	0.74589	.	.	ENSG00000138028	ENST00000402550;ENST00000452318;ENST00000402394;ENST00000405600;ENST00000389521;ENST00000312734;ENST00000404694;ENST00000260595	T;T;T;T;T;T;T	0.60040	0.56;0.22;1.51;1.51;1.51;1.51;1.51	4.92	4.04	0.47022	EF-hand-like domain (1);	0.408437	0.28062	N	0.016759	T	0.48150	0.1484	L	0.33485	1.01	0.26175	N	0.979814	P;P;P;P;P	0.42078	0.728;0.77;0.77;0.77;0.484	B;P;B;B;B	0.46389	0.25;0.515;0.263;0.263;0.105	T	0.30679	-0.9970	10	0.21540	T	0.41	-21.6008	7.7295	0.28779	0.0:0.8128:0.0:0.1872	.	5;223;101;101;101	E7EU99;B5MCC9;B5MCP5;Q99674;B5MCB7	.;.;.;CGRE1_HUMAN;.	T	101;5;101;101;101;101;223;101	ENSP00000385103:A101T;ENSP00000395042:A5T;ENSP00000385452:A101T;ENSP00000386113:A101T;ENSP00000324025:A101T;ENSP00000385574:A223T;ENSP00000260595:A101T	ENSP00000260595:A101T	A	-	1	0	CGREF1	27178510	0.503000	0.26115	0.638000	0.29380	0.829000	0.46940	1.176000	0.31957	1.306000	0.44926	0.448000	0.29417	GCT	CGREF1	-	pfscan_EF_hand_dom	ENSG00000138028		0.562	CGREF1-201	KNOWN	basic	protein_coding	CGREF1	HGNC	protein_coding		-	0.00	29	0	C	NM_006569		27325006	-1	tier1	-	no_errors	ENST00000312734	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.722	T
CHD8	57680	genome.wustl.edu	37	14	21861740	21861740	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:21861740C>G	ENST00000557364.1	-	32	6477	c.6214G>C	c.(6214-6216)Gag>Cag	p.E2072Q	SNORD9_ENST00000362566.1_RNA|CHD8_ENST00000555962.1_5'Flank|CHD8_ENST00000430710.3_Missense_Mutation_p.E1793Q|CHD8_ENST00000399982.2_Missense_Mutation_p.E2072Q			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2072	Ser-rich.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		AAGTCCAGCTCAGAGTCCGAA	0.507																																																	0													42.0	44.0	43.0					14																	21861740		2090	4216	6306	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.6214G>C	14.37:g.21861740C>G	ENSP00000451601:p.Glu2072Gln		Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E2072Q	ENST00000557364.1	37	c.6214	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	C	14.71	2.615446	0.46631	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.89196	-2.47;-2.48;-2.48	5.11	5.11	0.69529	.	0.174169	0.49916	D	0.000124	D	0.87561	0.6208	N	0.08118	0	0.39077	D	0.960837	D	0.54772	0.968	D	0.70487	0.969	D	0.87914	0.2699	10	0.32370	T	0.25	-17.5755	15.5697	0.76323	0.0:1.0:0.0:0.0	.	1793	Q9HCK8-2	.	Q	1793;2072;1792;2072	ENSP00000406288:E1793Q;ENSP00000382863:E2072Q;ENSP00000451601:E2072Q	ENSP00000262707:E1792Q	E	-	1	0	CHD8	20931580	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.022000	0.57203	2.659000	0.90383	0.563000	0.77884	GAG	CHD8	-	NULL	ENSG00000100888		0.507	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	-	0.00	25	0	C	NM_020920		21861740	-1	tier1	-	no_errors	ENST00000399982	ensembl	human	known	74_37	missense	44.44	15	12	SNP	1.000	G
CHL1	10752	genome.wustl.edu	37	3	239555	239556	+	3'UTR	INS	-	-	T	rs397954553|rs58240971|rs562780218|rs200685563	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:239555_239556insT	ENST00000489224.1	+	0	230_231				CHL1-AS2_ENST00000444879.1_RNA|CHL1_ENST00000256509.2_Intron|CHL1_ENST00000397491.2_Intron|CHL1-AS2_ENST00000452919.1_RNA	NR_045572.1		Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		CTTTCTCTCGCTTTTTTTTTTT	0.584													|||unknown(HR)	2238	0.446885	0.3457	0.5245	5008	,	,		12086	0.5546		0.505	False		,,,				2504	0.3579																0																																										SO:0001624	3_prime_UTR_variant	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000489224.1:c.*228->T	3.37:g.239566_239566dupT			Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Frame_Shift_Ins	INS	NULL	p.F80fs	ENST00000489224.1	37	c.226_227		3																																																																																			CHL1	-	NULL	ENSG00000134121		0.584	CHL1-004	KNOWN	basic	processed_transcript	CHL1	HGNC	protein_coding	OTTHUMT00000337367.2		0.00	51	0	-	NM_006614		239556	+1	tier1		no_errors	ENST00000453040	ensembl	human	known	74_37	frame_shift_ins	9.38	58	6	INS	0.000:0.000	T
CHM	1121	genome.wustl.edu	37	X	85118100	85118101	+	3'UTR	INS	-	-	T	rs376822651|rs6623530|rs372854246	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:85118100_85118101insT	ENST00000357749.2	-	0	3525_3526				CHM_ENST00000467744.2_Splice_Site	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				GTACAGCCCCCttttttttttt	0.45																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.*1535->A	X.37:g.85118111_85118111dupT			A1L4D2|O43732	Splice_Site	INS	-	NULL	ENST00000357749.2	37	c.NULL	CCDS14454.1	X																																																																																			CHM	-	-	ENSG00000188419		0.450	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3		0.00	13	0	-	NM_000390		85118101	-1	tier1		no_errors	ENST00000467744	ensembl	human	known	74_37	splice_site_ins	13.64	19	3	INS	0.002:0.003	T
CHM	1121	genome.wustl.edu	37	X	85118101	85118101	+	3'UTR	DEL	T	T	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:85118101delT	ENST00000357749.2	-	0	3525				CHM_ENST00000467744.2_Splice_Site	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TACAGCCCCCttttttttttt	0.453																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.*1534A>-	X.37:g.85118101delT			A1L4D2|O43732	Splice_Site	DEL	-	NULL	ENST00000357749.2	37	c.NULL	CCDS14454.1	X																																																																																			CHM	-	-	ENSG00000188419		0.453	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3		0.00	14	0	T	NM_000390		85118101	-1	tier1		no_errors	ENST00000467744	ensembl	human	known	74_37	splice_site_del	18.18	18	4	DEL	0.003	-
CHRD	8646	genome.wustl.edu	37	3	184101106	184101107	+	Frame_Shift_Del	DEL	AA	AA	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	AA	AA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:184101106_184101107delAA	ENST00000204604.1	+	11	1466_1467	c.1220_1221delAA	c.(1219-1221)caafs	p.Q407fs	CHRD_ENST00000348986.3_Frame_Shift_Del_p.Q407fs|CHRD_ENST00000545352.1_Frame_Shift_Del_p.Q37fs|CHRD_ENST00000450923.1_Frame_Shift_Del_p.Q407fs|EIF2B5_ENST00000444495.1_Intron	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	407	CHRD 3. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GTAGTCCTGCAAAGTGTCCTTT	0.609																																																	0																																										SO:0001589	frameshift_variant	0			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1220_1221delAA	3.37:g.184101106_184101107delAA	ENSP00000204604:p.Gln407fs		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Frame_Shift_Del	DEL	pfam_CHRD,pfam_VWF_C,smart_VWF_C,smart_CHRD,pirsf_Chordin,pfscan_CHRD,pfscan_VWF_C	p.S408fs	ENST00000204604.1	37	c.1220_1221	CCDS3266.1	3																																																																																			CHRD	-	pfam_CHRD,smart_CHRD,pirsf_Chordin,pfscan_CHRD	ENSG00000090539		0.609	CHRD-001	KNOWN	basic|CCDS	protein_coding	CHRD	HGNC	protein_coding	OTTHUMT00000280432.1		0.00	29	0	AA	NM_003741		184101107	+1	tier1		no_errors	ENST00000204604	ensembl	human	known	74_37	frame_shift_del	59.65	23	34	DEL	1.000:0.999	-
CLHC1	130162	genome.wustl.edu	37	2	55439812	55439812	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:55439812G>C	ENST00000401408.1	-	5	841	c.496C>G	c.(496-498)Cca>Gca	p.P166A	CLHC1_ENST00000406076.1_Missense_Mutation_p.P44A|CLHC1_ENST00000494539.1_Intron|CLHC1_ENST00000406437.2_Intron|AC012358.7_ENST00000366153.2_RNA|CLHC1_ENST00000407122.1_Missense_Mutation_p.P166A	NM_152385.2	NP_689598.2	Q8NHS4	CLHC1_HUMAN	clathrin heavy chain linker domain containing 1	166																	ACAATACCTGGAATAGGTTTT	0.313																																																	0													92.0	91.0	91.0					2																	55439812		2201	4300	6501	SO:0001583	missense	0				CCDS33201.1, CCDS46287.1	2p16.1	2012-08-03	2012-08-03	2012-08-03	ENSG00000162994	ENSG00000162994			26453	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 63"""	C2orf63			Standard	NM_152385		Approved	FLJ31438	uc002ryi.2	Q8NHS4	OTTHUMG00000151918	ENST00000401408.1:c.496C>G	2.37:g.55439812G>C	ENSP00000384869:p.Pro166Ala		B2RDV1|Q53R93|Q8N403	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_Clathrin_heavy-chain-rel	p.P166A	ENST00000401408.1	37	c.496	CCDS33201.1	2	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874050	0.72180	.	.	ENSG00000162994	ENST00000407122;ENST00000401408;ENST00000406076	T;T;T	0.36340	1.37;1.37;1.26	5.0	5.0	0.66597	.	0.000000	0.64402	D	0.000002	T	0.58864	0.2152	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62201	-0.6904	10	0.72032	D	0.01	.	14.1458	0.65349	0.0:0.0:1.0:0.0	.	166	Q8NHS4	CB063_HUMAN	A	166;166;44	ENSP00000385778:P166A;ENSP00000384869:P166A;ENSP00000385512:P44A	ENSP00000384869:P166A	P	-	1	0	C2orf63	55293316	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.670000	0.61583	2.472000	0.83506	0.655000	0.94253	CCA	CLHC1	-	pirsf_Clathrin_heavy-chain-rel	ENSG00000162994		0.313	CLHC1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CLHC1	HGNC	protein_coding	OTTHUMT00000324412.4	-	0.00	38	0	G	NM_152385		55439812	-1	tier1	-	no_errors	ENST00000401408	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	C
CNOT6L	246175	genome.wustl.edu	37	4	78647324	78647324	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:78647324G>T	ENST00000504123.1	-	11	1582	c.1452C>A	c.(1450-1452)ttC>ttA	p.F484L	CNOT6L_ENST00000264903.4_Missense_Mutation_p.F484L			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	484	Nuclease domain.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						CACTCACTTTGAAATCAAAGG	0.363																																																	0													165.0	158.0	160.0					4																	78647324		1833	4076	5909	SO:0001583	missense	0			AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.1452C>A	4.37:g.78647324G>T	ENSP00000424896:p.Phe484Leu		Q9UF92	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Leu-rich_rpt,superfamily_Endo/exonuclease/phosphatase,smart_Leu-rich_rpt_typical-subtyp	p.F484L	ENST00000504123.1	37	c.1452		4	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486650	0.84854	.	.	ENSG00000138767	ENST00000504123;ENST00000264903;ENST00000512485;ENST00000505983	D;D;D;T	0.94497	-3.44;-3.44;-3.44;-0.36	5.78	4.94	0.65067	Endonuclease/exonuclease/phosphatase (2);	0.000000	0.85682	D	0.000000	D	0.97498	0.9181	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.91635	0.999;0.984	D	0.98202	1.0468	10	0.87932	D	0	-2.7016	14.5744	0.68235	0.0699:0.0:0.9301:0.0	.	457;484	Q96LI5-2;Q96LI5	.;CNO6L_HUMAN	L	484;484;491;259	ENSP00000424896:F484L;ENSP00000264903:F484L;ENSP00000425571:F491L;ENSP00000426320:F259L	ENSP00000264903:F484L	F	-	3	2	CNOT6L	78866348	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.196000	0.58407	1.451000	0.47736	0.655000	0.94253	TTC	CNOT6L	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000138767		0.363	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	CNOT6L	HGNC	protein_coding	OTTHUMT00000362515.1	-	0.00	52	0	G			78647324	-1	tier1	-	no_errors	ENST00000264903	ensembl	human	known	74_37	missense	51.43	17	18	SNP	1.000	T
CNTN5	53942	genome.wustl.edu	37	11	99942510	99942510	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:99942510G>T	ENST00000524871.1	+	12	1663	c.1373G>T	c.(1372-1374)tGt>tTt	p.C458F	CNTN5_ENST00000528682.1_Missense_Mutation_p.C458F|CNTN5_ENST00000418526.2_Missense_Mutation_p.C384F|CNTN5_ENST00000527185.1_Missense_Mutation_p.C458F|CNTN5_ENST00000279463.3_Missense_Mutation_p.C458F	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	458	Ig-like C2-type 4.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ATGTATCAGTGTTTGGCTGAA	0.348																																																	0													111.0	106.0	108.0					11																	99942510		1882	4147	6029	SO:0001583	missense	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1373G>T	11.37:g.99942510G>T	ENSP00000435637:p.Cys458Phe		A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C458F	ENST00000524871.1	37	c.1373	CCDS53696.1	11	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353061	0.82132	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.98068	0.9363	H	0.99261	4.49	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.997	D	0.99701	1.1004	10	0.87932	D	0	.	18.3469	0.90325	0.0:0.0:1.0:0.0	.	458;384;458	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	F	458;458;458;384;458	ENSP00000433575:C458F;ENSP00000436185:C458F;ENSP00000435637:C458F;ENSP00000393229:C384F;ENSP00000279463:C458F	ENSP00000279463:C458F	C	+	2	0	CNTN5	99447720	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.444000	0.97578	2.573000	0.86826	0.655000	0.94253	TGT	CNTN5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149972		0.348	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	-	0.00	19	0	G	NM_014361		99942510	+1	tier1	-	no_errors	ENST00000279463	ensembl	human	known	74_37	missense	33.33	8	4	SNP	1.000	T
COL22A1	169044	genome.wustl.edu	37	8	139603732	139603732	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:139603732G>C	ENST00000303045.6	-	64	5074	c.4628C>G	c.(4627-4629)gCc>gGc	p.A1543G	COL22A1_ENST00000341807.4_5'UTR|COL22A1_ENST00000435777.1_Missense_Mutation_p.A1523G	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1543	Collagen-like 15.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTCACCTTTGGCTCCTCGCTC	0.607										HNSCC(7;0.00092)																																							0													62.0	57.0	59.0					8																	139603732		2203	4300	6503	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.4628C>G	8.37:g.139603732G>C	ENSP00000303153:p.Ala1543Gly		B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.A1543G	ENST00000303045.6	37	c.4628	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	12.57	1.979055	0.34942	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.94376	-3.41;-3.41	5.3	3.51	0.40186	.	0.288557	0.23898	U	0.043478	D	0.88702	0.6508	L	0.31578	0.945	0.29712	N	0.839286	B;B	0.28820	0.224;0.051	B;B	0.38428	0.273;0.033	T	0.80993	-0.1134	10	0.23891	T	0.37	.	8.2266	0.31572	0.2389:0.0:0.7611:0.0	.	1523;1543	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	G	1543;1523;1236	ENSP00000303153:A1543G;ENSP00000387655:A1523G	ENSP00000303153:A1543G	A	-	2	0	COL22A1	139672914	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	2.258000	0.43249	0.815000	0.34398	-0.253000	0.11424	GCC	COL22A1	-	pfam_Collagen	ENSG00000169436		0.607	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	40	0	G	XM_291257		139603732	-1	tier1	-	no_errors	ENST00000303045	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	C
COL22A1	169044	genome.wustl.edu	37	8	139737649	139737649	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:139737649delG	ENST00000303045.6	-	24	2620	c.2174delC	c.(2173-2175)cctfs	p.P725fs	COL22A1_ENST00000435777.1_Frame_Shift_Del_p.P725fs	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	725	Collagen-like 5.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TCCCGGTCCAGGGGGGCCTGG	0.582										HNSCC(7;0.00092)																																							0													55.0	63.0	60.0					8																	139737649		2203	4300	6503	SO:0001589	frameshift_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2174delC	8.37:g.139737649delG	ENSP00000303153:p.Pro725fs		B7ZMH0|C9K0G4|Q8IVT9	Frame_Shift_Del	DEL	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P725fs	ENST00000303045.6	37	c.2174	CCDS6376.1	8																																																																																			COL22A1	-	pfam_Collagen	ENSG00000169436		0.582	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2		0.00	24	0	G	XM_291257		139737649	-1	tier1		no_errors	ENST00000303045	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	1.000	-
CPAMD8	27151	genome.wustl.edu	37	19	17038839	17038839	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:17038839C>T	ENST00000443236.1	-	25	3522	c.3491G>A	c.(3490-3492)cGa>cAa	p.R1164Q		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1117						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						GGCGGTGGCTCGCTCAGACCC	0.617																																																	0													41.0	50.0	47.0					19																	17038839		2043	4177	6220	SO:0001583	missense	0			AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3491G>A	19.37:g.17038839C>T	ENSP00000402505:p.Arg1164Gln		Q8NC09|Q9ULD7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.R1164Q	ENST00000443236.1	37	c.3491	CCDS42519.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.28|16.28	3.077474|3.077474	0.55753|0.55753	.|.	.|.	ENSG00000160111|ENSG00000160111	ENST00000443236|ENST00000291440	.|.	.|.	.|.	3.02|3.02	3.02|3.02	0.34903|0.34903	.|.	.|0.311950	.|0.27861	.|U	.|0.017554	T|T	0.70133|0.70133	0.3189|0.3189	M|M	0.87971|0.87971	2.92|2.92	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|P	.|0.47162	.|0.54	T|T	0.76984|0.76984	-0.2756|-0.2756	5|9	.|0.46703	.|T	.|0.11	.|.	13.9882|13.9882	0.64348|0.64348	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1117	.|Q8IZJ3	.|CPMD8_HUMAN	K|Q	1175|1164	.|.	.|ENSP00000291440:R1164Q	E|R	-|-	1|2	0|0	CPAMD8|CPAMD8	16899839|16899839	1.000000|1.000000	0.71417|0.71417	0.523000|0.523000	0.27875|0.27875	0.084000|0.084000	0.17831|0.17831	2.274000|2.274000	0.43390|0.43390	1.237000|1.237000	0.43756|0.43756	0.655000|0.655000	0.94253|0.94253	GAG|CGA	CPAMD8	-	NULL	ENSG00000160111		0.617	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	HGNC	protein_coding	OTTHUMT00000257531.2	-	0.00	38	0	C	NM_015692		17038839	-1	tier1	-	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	T
CPSF1	29894	genome.wustl.edu	37	8	145622125	145622125	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:145622125A>G	ENST00000349769.3	-	24	2706	c.2612T>C	c.(2611-2613)cTg>cCg	p.L871P	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	871					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTAGATAAGCAGCTCTTGGTC	0.622																																					NSCLC(133;1088 1848 27708 34777 35269)												0													51.0	42.0	45.0					8																	145622125		2203	4300	6503	SO:0001583	missense	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2612T>C	8.37:g.145622125A>G	ENSP00000339353:p.Leu871Pro		Q96AF0	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.L871P	ENST00000349769.3	37	c.2612	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	a	21.5	4.164104	0.78339	.	.	ENSG00000071894	ENST00000349769	T	0.58210	0.35	4.78	4.78	0.61160	.	0.000000	0.64402	D	0.000002	T	0.67144	0.2862	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.70425	-0.4875	10	0.87932	D	0	-16.5443	12.3175	0.54966	1.0:0.0:0.0:0.0	.	871	Q10570	CPSF1_HUMAN	P	871	ENSP00000339353:L871P	ENSP00000339353:L871P	L	-	2	0	CPSF1	145592933	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	8.392000	0.90180	2.020000	0.59435	0.392000	0.25879	CTG	CPSF1	-	NULL	ENSG00000071894		0.622	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	-	0.00	87	0	A	NM_013291		145622125	-1	tier1	-	no_errors	ENST00000349769	ensembl	human	known	74_37	missense	24.16	113	36	SNP	1.000	G
CRCP	27297	genome.wustl.edu	37	7	65617254	65617254	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:65617254C>T	ENST00000395326.3	+	6	715	c.357C>T	c.(355-357)acC>acT	p.T119T	CRCP_ENST00000492264.1_3'UTR|CRCP_ENST00000398684.2_Silent_p.T42T|CRCP_ENST00000338592.5_Silent_p.T86T|CRCP_ENST00000431089.2_Silent_p.T112T|RP5-1132H15.1_ENST00000435524.2_RNA|CRCP_ENST00000415001.2_Silent_p.T86T	NM_014478.4	NP_055293.1	O75575	RPC9_HUMAN	CGRP receptor component	119					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|neuropeptide signaling pathway (GO:0007218)|transcription from RNA polymerase III promoter (GO:0006383)	acrosomal vesicle (GO:0001669)|DNA polymerase III complex (GO:0009360)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcitonin gene-related polypeptide receptor activity (GO:0001635)|DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)			cervix(1)|kidney(1)|lung(4)	6						TTCTCCACACCGTCACCAGCA	0.507																																																	0													85.0	75.0	78.0					7																	65617254		2203	4300	6503	SO:0001819	synonymous_variant	0			AF073792	CCDS5532.1, CCDS47599.1, CCDS47600.1, CCDS55116.1	7q11.1	2009-01-14			ENSG00000241258	ENSG00000241258			17888	protein-coding gene	gene with protein product	"""calcitonin gene-related peptide-receptor component protein"""	606121				8622957, 10067875, 12482973	Standard	NM_014478		Approved	CGRP-RCP, RCP, RCP9	uc011kdw.2	O75575	OTTHUMG00000129519	ENST00000395326.3:c.357C>T	7.37:g.65617254C>T			A8MUZ4|A8MW23|B2R4H4|B4E198|Q3KRA3|Q5HYF1|Q8IXL4	Silent	SNP	pfam_RNA_pol_II_Rpb4,superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	p.T119	ENST00000395326.3	37	c.357	CCDS5532.1	7																																																																																			CRCP	-	pfam_RNA_pol_II_Rpb4,superfamily_HRDC-like,smart_RNA_pol_II_Rpb4_core	ENSG00000241258		0.507	CRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRCP	HGNC	protein_coding	OTTHUMT00000251697.2	-	0.00	21	0	C	NM_014478		65617254	+1	tier1	-	no_errors	ENST00000395326	ensembl	human	known	74_37	silent	31.82	15	7	SNP	0.001	T
CREB3L2	64764	genome.wustl.edu	37	7	137686398	137686398	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:137686398C>T	ENST00000330387.6	-	1	405	c.54G>A	c.(52-54)ctG>ctA	p.L18L	CREB3L2_ENST00000456390.1_Silent_p.L18L|CREB3L2_ENST00000468127.1_5'UTR|CREB3L2_ENST00000452463.1_Silent_p.L18L	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	18					cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)		FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						ACAGCTCGCTCAGCTTGCGGT	0.701			T	FUS	fibromyxoid sarcoma																																			Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	0													34.0	35.0	35.0					7																	137686398		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.54G>A	7.37:g.137686398C>T			Q6P454|Q6ZMR6	Silent	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.L18	ENST00000330387.6	37	c.54	CCDS34760.1	7																																																																																			CREB3L2	-	NULL	ENSG00000182158		0.701	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3L2	HGNC	protein_coding	OTTHUMT00000341462.1	-	0.00	66	0	C	NM_194071		137686398	-1	tier1	-	no_errors	ENST00000330387	ensembl	human	known	74_37	silent	25.37	50	17	SNP	1.000	T
CSMD1	64478	genome.wustl.edu	37	8	3015448	3015448	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:3015448C>T	ENST00000520002.1	-	40	6443	c.5888G>A	c.(5887-5889)cGt>cAt	p.R1963H	CSMD1_ENST00000400186.3_Missense_Mutation_p.R1963H|CSMD1_ENST00000539096.1_Missense_Mutation_p.R1962H|CSMD1_ENST00000542608.1_Missense_Mutation_p.R1962H|CSMD1_ENST00000537824.1_Missense_Mutation_p.R1962H|CSMD1_ENST00000602557.1_Missense_Mutation_p.R1963H|CSMD1_ENST00000602723.1_Missense_Mutation_p.R1963H|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1963	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATAGTTCCAACGGCGAACGGT	0.453																																																	0													55.0	53.0	54.0					8																	3015448		1959	4100	6059	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5888G>A	8.37:g.3015448C>T	ENSP00000430733:p.Arg1963His		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R1963H	ENST00000520002.1	37	c.5888		8	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829321	0.71258	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18	5.45	5.45	0.79879	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.75451	0.3851	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;0.998	T	0.77051	-0.2731	10	0.72032	D	0.01	.	18.8862	0.92379	0.0:1.0:0.0:0.0	.	1963;1963;1962;1963	E5RIG2;Q96PZ7;F5H2I8;Q96PZ7-4	.;CSMD1_HUMAN;.;.	H	1963;1963;1824;1962;1962;1962	ENSP00000383047:R1963H;ENSP00000430733:R1963H;ENSP00000441462:R1962H;ENSP00000446243:R1962H;ENSP00000441675:R1962H	ENSP00000320445:R1824H	R	-	2	0	CSMD1	3002855	1.000000	0.71417	0.266000	0.24541	0.030000	0.12068	7.311000	0.78958	2.538000	0.85594	0.655000	0.94253	CGT	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.453	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2		0.00	31	0	C	NM_033225		3015448	-1			no_errors	ENST00000520002	ensembl	human	known	74_37	missense	12.50	14	2	SNP	0.999	T
CWC27	10283	genome.wustl.edu	37	5	64081312	64081312	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:64081312C>T	ENST00000381070.3	+	5	618	c.401C>T	c.(400-402)aCa>aTa	p.T134I	CWC27_ENST00000508024.1_Missense_Mutation_p.T134I	NM_005869.2	NP_005860.2	Q6UX04	CWC27_HUMAN	CWC27 spliceosome-associated protein homolog (S. cerevisiae)	134	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				mRNA splicing, via spliceosome (GO:0000398)|protein folding (GO:0006457)	catalytic step 2 spliceosome (GO:0071013)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.?(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(5)|prostate(1)	21						TGATAGGTTACAGGGGATACA	0.303																																																	1	Unknown(1)	prostate(1)											102.0	108.0	106.0					5																	64081312		2203	4300	6503	SO:0001583	missense	0			AF039692	CCDS3982.2, CCDS75252.1	5q12.3	2010-01-26	2010-01-26	2010-01-26	ENSG00000153015	ENSG00000153015			10664	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 10"""	SDCCAG10		9610721, 19941820	Standard	XM_005248399		Approved	NY-CO-10	uc003jtn.1	Q6UX04	OTTHUMG00000074069	ENST00000381070.3:c.401C>T	5.37:g.64081312C>T	ENSP00000370460:p.Thr134Ile		O60529|O60530|Q96EM3	Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.T134I	ENST00000381070.3	37	c.401	CCDS3982.2	5	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869756	0.72065	.	.	ENSG00000153015	ENST00000381070;ENST00000508024;ENST00000538793	T;T	0.22539	1.95;1.95	5.07	5.07	0.68467	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.000000	0.85682	D	0.000000	T	0.27629	0.0679	N	0.13098	0.295	0.80722	D	1	D;D;D;D	0.63046	0.979;0.962;0.99;0.992	P;P;D;D	0.65573	0.859;0.728;0.914;0.936	T	0.07271	-1.0781	10	0.15952	T	0.53	.	18.6436	0.91404	0.0:1.0:0.0:0.0	.	134;134;134;134	Q6UX04-2;Q6UX04;F5H636;D6REK3	.;CWC27_HUMAN;.;.	I	134	ENSP00000370460:T134I;ENSP00000426802:T134I	ENSP00000370460:T134I	T	+	2	0	CWC27	64117068	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.873000	0.75541	2.636000	0.89361	0.467000	0.42956	ACA	CWC27	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	ENSG00000153015		0.303	CWC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWC27	HGNC	protein_coding	OTTHUMT00000157247.4	-	0.00	60	0	C	NM_005869		64081312	+1	tier1	-	no_errors	ENST00000381070	ensembl	human	known	74_37	missense	42.22	26	19	SNP	1.000	T
CTNNA1	1495	genome.wustl.edu	37	5	138266577	138266577	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:138266577G>A	ENST00000302763.7	+	16	2341	c.2251G>A	c.(2251-2253)Gag>Aag	p.E751K	CTNNA1_ENST00000355078.5_Missense_Mutation_p.E648K|CTNNA1_ENST00000518825.1_Missense_Mutation_p.E751K|CTNNA1_ENST00000540387.1_Missense_Mutation_p.E381K	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	751					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAAATTGCTGAGGCAGGATC	0.507																																																	0													82.0	83.0	83.0					5																	138266577		2203	4300	6503	SO:0001583	missense	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.2251G>A	5.37:g.138266577G>A	ENSP00000304669:p.Glu751Lys		Q12795|Q8N1C0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.E751K	ENST00000302763.7	37	c.2251	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.959245	0.97145	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000540387;ENST00000520520	T;T;T;T;T	0.57595	0.39;0.39;0.39;0.39;0.39	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.67599	0.2910	M	0.71581	2.175	0.80722	D	1	D;P;P	0.54964	0.969;0.902;0.908	P;P;P	0.57101	0.813;0.733;0.733	T	0.63065	-0.6720	10	0.30078	T	0.28	-27.2739	19.0128	0.92881	0.0:0.0:1.0:0.0	.	751;628;751	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	K	648;751;751;736;751;381;26	ENSP00000347190:E648K;ENSP00000304669:E751K;ENSP00000427821:E751K;ENSP00000438476:E381K;ENSP00000430076:E26K	ENSP00000304669:E751K	E	+	1	0	CTNNA1	138294476	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.635000	0.98437	2.825000	0.97269	0.655000	0.94253	GAG	CTNNA1	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	ENSG00000044115		0.507	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	-	0.00	31	0	G	NM_001903		138266577	+1	tier1	-	no_errors	ENST00000302763	ensembl	human	known	74_37	missense	14.63	35	6	SNP	1.000	A
CYLC2	1539	genome.wustl.edu	37	9	105767708	105767708	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:105767708G>T	ENST00000374798.3	+	5	865	c.795G>T	c.(793-795)aaG>aaT	p.K265N	CYLC2_ENST00000487798.1_Missense_Mutation_p.K265N	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	265	31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.K265N(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AAGATGCAAAGGAGATTAAAA	0.383																																																	1	Substitution - Missense(1)	lung(1)											115.0	109.0	111.0					9																	105767708		2203	4300	6503	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.795G>T	9.37:g.105767708G>T	ENSP00000420256:p.Lys265Asn		B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.K265N	ENST00000374798.3	37	c.795	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	G	9.432	1.085679	0.20390	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.16073	2.37;2.37	4.07	2.15	0.27550	.	0.156178	0.29822	N	0.011111	T	0.12263	0.0298	L	0.29908	0.895	0.09310	N	1	P	0.44816	0.844	B	0.42319	0.383	T	0.10543	-1.0625	10	0.62326	D	0.03	-5.5122	6.9007	0.24281	0.0:0.1946:0.6041:0.2014	.	265	Q14093	CYLC2_HUMAN	N	265	ENSP00000420256:K265N;ENSP00000417674:K265N	ENSP00000420256:K265N	K	+	3	2	CYLC2	104807529	0.001000	0.12720	0.016000	0.15963	0.016000	0.09150	-0.001000	0.12947	0.620000	0.30215	0.585000	0.79938	AAG	CYLC2	-	NULL	ENSG00000155833		0.383	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3		0.00	14	0	G	NM_001340		105767708	+1			no_errors	ENST00000374798	ensembl	human	known	74_37	missense	12.50	14	2	SNP	0.020	T
CYP1A1	1543	genome.wustl.edu	37	15	75014785	75014785	+	Silent	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:75014785G>C	ENST00000379727.3	-	2	852	c.654C>G	c.(652-654)gtC>gtG	p.V218V	CYP1A1_ENST00000395049.4_Silent_p.V218V|CYP1A1_ENST00000395048.2_Silent_p.V218V|CYP1A1_ENST00000567032.1_Silent_p.V218V|CYP1A1_ENST00000564596.1_5'UTR			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	218					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	TATTCAGGTTGACTAGGCTAA	0.502									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																																								0													94.0	98.0	96.0					15																	75014785		2197	4296	6493	SO:0001819	synonymous_variant	0	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.654C>G	15.37:g.75014785G>C			A4F3V9|A4F3W0|Q53G18	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP1,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.V218	ENST00000379727.3	37	c.654	CCDS10268.1	15																																																																																			CYP1A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000140465		0.502	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1A1	HGNC	protein_coding	OTTHUMT00000286396.1	-	0.00	70	0	G	NM_000499		75014785	-1	tier1	-	no_errors	ENST00000379727	ensembl	human	known	74_37	silent	25.64	58	20	SNP	0.033	C
CYP2W1	54905	genome.wustl.edu	37	7	1024706	1024706	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:1024706G>T	ENST00000308919.7	+	3	471	c.458G>T	c.(457-459)tGc>tTc	p.C153F	CYP2W1_ENST00000340150.6_Missense_Mutation_p.C97F	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	153					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GAGCTGAAATGCCTCTCTGGG	0.721																																																	0													30.0	36.0	34.0					7																	1024706		2198	4298	6496	SO:0001583	missense	0			AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.458G>T	7.37:g.1024706G>T	ENSP00000310149:p.Cys153Phe			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.C153F	ENST00000308919.7	37	c.458	CCDS5319.2	7	.	.	.	.	.	.	.	.	.	.	G	0.154	-1.088765	0.01873	.	.	ENSG00000073067	ENST00000308919;ENST00000340150	T;T	0.68479	-0.33;-0.33	5.09	-0.231	0.13086	.	0.647706	0.18018	N	0.154325	T	0.41373	0.1156	N	0.25245	0.725	0.21604	N	0.999626	B;B	0.11235	0.001;0.004	B;B	0.13407	0.006;0.009	T	0.17715	-1.0360	10	0.08837	T	0.75	.	4.8768	0.13660	0.3984:0.0:0.3804:0.2212	.	97;153	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	F	153;97	ENSP00000310149:C153F;ENSP00000344178:C97F	ENSP00000310149:C153F	C	+	2	0	CYP2W1	991232	0.024000	0.19004	0.028000	0.17463	0.027000	0.11550	0.341000	0.19909	0.188000	0.20168	0.491000	0.48974	TGC	CYP2W1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000073067		0.721	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2W1	HGNC	protein_coding	OTTHUMT00000157249.1	-	0.00	82	0	G	NM_017781		1024706	+1	tier1	-	no_errors	ENST00000308919	ensembl	human	known	74_37	missense	28.04	77	30	SNP	0.053	T
DAGLA	747	genome.wustl.edu	37	11	61491028	61491028	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:61491028C>T	ENST00000257215.5	+	5	648	c.532C>T	c.(532-534)Cgg>Tgg	p.R178W		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	178					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GCGTAACCTGCGGACCTACAA	0.607																																																	0													104.0	93.0	97.0					11																	61491028		2202	4299	6501	SO:0001583	missense	0			AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.532C>T	11.37:g.61491028C>T	ENSP00000257215:p.Arg178Trp		A7E233|Q6WQJ0	Missense_Mutation	SNP	pfam_Lipase_3	p.R178W	ENST00000257215.5	37	c.532	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859968	0.71834	.	.	ENSG00000134780	ENST00000257215	T	0.25912	1.77	4.69	2.6	0.31112	.	0.058396	0.64402	D	0.000005	T	0.26195	0.0639	N	0.19112	0.55	0.48395	D	0.999644	D	0.69078	0.997	P	0.53490	0.727	T	0.10941	-1.0608	10	0.87932	D	0	-28.9437	13.2044	0.59787	0.3877:0.6123:0.0:0.0	.	178	Q9Y4D2	DGLA_HUMAN	W	178	ENSP00000257215:R178W	ENSP00000257215:R178W	R	+	1	2	DAGLA	61247604	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.041000	0.49807	1.070000	0.40811	0.561000	0.74099	CGG	DAGLA	-	NULL	ENSG00000134780		0.607	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	HGNC	protein_coding	OTTHUMT00000398516.1	-	0.00	25	0	C	NM_006133		61491028	+1	tier1	-	no_errors	ENST00000257215	ensembl	human	known	74_37	missense	25.64	29	10	SNP	1.000	T
DAPK1	1612	genome.wustl.edu	37	9	90252871	90252871	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:90252871G>A	ENST00000408954.3	+	4	633	c.298G>A	c.(298-300)Gag>Aag	p.E100K	DAPK1_ENST00000472284.1_Missense_Mutation_p.E100K|DAPK1_ENST00000469640.2_Missense_Mutation_p.E100K|DAPK1_ENST00000358077.5_Missense_Mutation_p.E100K|DAPK1_ENST00000491893.1_Missense_Mutation_p.E100K	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	100	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TGCAGGTGGCGAGCTGTTTGA	0.418									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													109.0	108.0	108.0					9																	90252871		2075	4242	6317	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.298G>A	9.37:g.90252871G>A	ENSP00000386135:p.Glu100Lys		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.E100K	ENST00000408954.3	37	c.298	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.600344	0.96614	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.26	5.26	0.73747	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000165	T	0.68495	0.3007	M	0.82132	2.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.99;0.983;0.996	T	0.72221	-0.4356	10	0.87932	D	0	.	19.0661	0.93110	0.0:0.0:1.0:0.0	.	100;100;100	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	K	100	ENSP00000350785:E100K;ENSP00000417076:E100K;ENSP00000418885:E100K;ENSP00000386135:E100K;ENSP00000419026:E100K	ENSP00000350785:E100K	E	+	1	0	DAPK1	89442691	1.000000	0.71417	0.966000	0.40874	0.908000	0.53690	9.657000	0.98554	2.746000	0.94184	0.655000	0.94253	GAG	DAPK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000196730		0.418	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	-	0.00	46	0	G	NM_004938		90252871	+1	tier1	-	no_errors	ENST00000469640	ensembl	human	known	74_37	missense	61.76	13	21	SNP	1.000	A
DCAF4L2	138009	genome.wustl.edu	37	8	88886083	88886083	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:88886083G>A	ENST00000319675.3	-	1	213	c.117C>T	c.(115-117)ttC>ttT	p.F39F		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	39								p.F39F(2)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						AATAGTTGGCGAATCTGAGGA	0.522																																																	2	Substitution - coding silent(2)	large_intestine(2)											90.0	81.0	84.0					8																	88886083		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.117C>T	8.37:g.88886083G>A				Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F39	ENST00000319675.3	37	c.117	CCDS6245.1	8																																																																																			DCAF4L2	-	superfamily_WD40_repeat_dom	ENSG00000176566		0.522	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	-	0.00	107	0	G	NM_152418		88886083	-1	tier1	-	no_errors	ENST00000319675	ensembl	human	known	74_37	silent	34.78	75	40	SNP	0.000	A
DCC	1630	genome.wustl.edu	37	18	50731660	50731660	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr18:50731660C>T	ENST00000442544.2	+	10	2264	c.1648C>T	c.(1648-1650)Ccc>Tcc	p.P550S	DCC_ENST00000581580.1_Missense_Mutation_p.P205S|DCC_ENST00000412726.1_Missense_Mutation_p.P398S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	550	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TACCTGGGAACCCCCTGCCTA	0.453																																																	0													195.0	191.0	193.0					18																	50731660		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1648C>T	18.37:g.50731660C>T	ENSP00000389140:p.Pro550Ser			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P550S	ENST00000442544.2	37	c.1648	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754774	0.31046	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.61274	0.12;0.12	5.78	4.89	0.63831	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.068983	0.56097	D	0.000021	T	0.64382	0.2593	M	0.65677	2.01	0.42783	D	0.993873	P;P;P	0.37731	0.566;0.566;0.607	P;P;P	0.46208	0.507;0.507;0.507	T	0.64343	-0.6430	10	0.38643	T	0.18	.	14.1082	0.65104	0.0:0.6535:0.3465:0.0	.	398;398;550	E7EQM8;B4DYX2;P43146	.;.;DCC_HUMAN	S	550;483;398	ENSP00000389140:P550S;ENSP00000397322:P398S	ENSP00000304146:P483S	P	+	1	0	DCC	48985658	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.522000	0.35921	1.330000	0.45394	0.655000	0.94253	CCC	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.453	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	40	0	C	NM_005215		50731660	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	T
DDR1	780	genome.wustl.edu	37	6	30864803	30864803	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:30864803G>A	ENST00000324771.8	+	16	2430	c.1882G>A	c.(1882-1884)Gag>Aag	p.E628K	DDR1_ENST00000508312.1_Missense_Mutation_p.E609K|DDR1_ENST00000376568.3_Missense_Mutation_p.E628K|DDR1_ENST00000376567.2_Missense_Mutation_p.E591K|DDR1_ENST00000452441.1_Missense_Mutation_p.E628K|DDR1_ENST00000376570.4_Missense_Mutation_p.E591K|DDR1_ENST00000361741.4_Missense_Mutation_p.E295K|DDR1_ENST00000454612.2_Missense_Mutation_p.E591K|DDR1_ENST00000513240.1_Missense_Mutation_p.E628K|DDR1_ENST00000418800.2_Missense_Mutation_p.E591K|DDR1_ENST00000376569.3_Missense_Mutation_p.E591K|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000376575.3_Missense_Mutation_p.E628K			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	628	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	GCACCTGTGTGAGGTCGACAG	0.507																																																	0													213.0	195.0	201.0					6																	30864803		2203	4300	6503	SO:0001583	missense	0			X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.1882G>A	6.37:g.30864803G>A	ENSP00000318217:p.Glu628Lys		B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E628K	ENST00000324771.8	37	c.1882	CCDS34385.1	6	.	.	.	.	.	.	.	.	.	.	G	29.8	5.034403	0.93575	.	.	ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240;ENST00000417521;ENST00000361741;ENST00000451954	D;D;D;D;D;D;D;D;D;D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41;-2.41	5.29	5.29	0.74685	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93370	0.7886	.	.	.	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.997;0.999	D;D;D;D	0.83275	0.995;0.994;0.966;0.996	D	0.93148	0.6547	9	0.49607	T	0.09	.	16.4122	0.83722	0.0:0.0:1.0:0.0	.	609;360;628;628	B7Z2K0;A2ABM8;Q08345-5;Q08345	.;.;.;DDR1_HUMAN	K	628;591;591;591;628;591;628;628;609;591;628;360;295;165	ENSP00000318217:E628K;ENSP00000407699:E591K;ENSP00000406091:E591K;ENSP00000365753:E591K;ENSP00000365759:E628K;ENSP00000365754:E591K;ENSP00000365752:E628K;ENSP00000405039:E628K;ENSP00000422442:E609K;ENSP00000365751:E591K;ENSP00000427552:E628K;ENSP00000398682:E360K;ENSP00000354844:E295K	ENSP00000318217:E628K	E	+	1	0	DDR1	30972782	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.564000	0.82326	2.478000	0.83669	0.561000	0.74099	GAG	DDR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000204580		0.507	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DDR1	HGNC	protein_coding	OTTHUMT00000076494.3	-	0.00	63	0	G	NM_013994		30864803	+1	tier1	-	no_errors	ENST00000376575	ensembl	human	known	74_37	missense	38.33	37	23	SNP	1.000	A
DDX21	9188	genome.wustl.edu	37	10	70716052	70716052	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr10:70716052G>C	ENST00000354185.4	+	1	169	c.71G>C	c.(70-72)cGa>cCa	p.R24P		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	24					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GAGACACTGCGAAAGCAAACC	0.622																																																	0													84.0	74.0	77.0					10																	70716052		2203	4300	6503	SO:0001583	missense	0			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.71G>C	10.37:g.70716052G>C	ENSP00000346120:p.Arg24Pro		B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R24P	ENST00000354185.4	37	c.71	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	G	10.48	1.360682	0.24598	.	.	ENSG00000165732	ENST00000354185;ENST00000541642	T	0.43294	0.95	5.02	-0.157	0.13387	.	1.604020	0.04095	N	0.311967	T	0.24890	0.0604	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.14504	-1.0470	10	0.30078	T	0.28	0.0	4.7686	0.13144	0.2533:0.2948:0.4519:0.0	.	24	Q9NR30	DDX21_HUMAN	P	24	ENSP00000346120:R24P	ENSP00000346120:R24P	R	+	2	0	DDX21	70386058	0.095000	0.21747	0.000000	0.03702	0.124000	0.20399	0.320000	0.19540	-0.099000	0.12263	0.655000	0.94253	CGA	DDX21	-	NULL	ENSG00000165732		0.622	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	HGNC	protein_coding	OTTHUMT00000048374.1	-	0.00	18	0	G	NM_004728		70716052	+1	tier1	-	no_errors	ENST00000354185	ensembl	human	known	74_37	missense	33.33	10	5	SNP	0.001	C
DDX28	55794	genome.wustl.edu	37	16	68055590	68055590	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:68055590G>C	ENST00000332395.5	-	1	2180	c.1516C>G	c.(1516-1518)Ccc>Gcc	p.P506A	DUS2_ENST00000432752.1_5'Flank|DUS2_ENST00000358896.6_5'Flank|DUS2_ENST00000565263.1_5'Flank	NM_018380.3	NP_060850.2	Q9NUL7	DDX28_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 28	506	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	13		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0116)|Epithelial(162;0.0474)|all cancers(182;0.233)		ACATCCCAGGGATGGGTCACA	0.582																																																	0													49.0	46.0	47.0					16																	68055590		2198	4300	6498	SO:0001583	missense	0			AF329821	CCDS10858.1	16q22.1-q22.3	2008-02-05	2003-06-13		ENSG00000182810	ENSG00000182810		"""DEAD-boxes"""	17330	protein-coding gene	gene with protein product		607618	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 28"""			10493829, 11350955	Standard	NM_018380		Approved	MDDX28, FLJ11282	uc002evh.2	Q9NUL7	OTTHUMG00000137549	ENST00000332395.5:c.1516C>G	16.37:g.68055590G>C	ENSP00000332340:p.Pro506Ala			Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.P506A	ENST00000332395.5	37	c.1516	CCDS10858.1	16	.	.	.	.	.	.	.	.	.	.	G	10.16	1.274106	0.23221	.	.	ENSG00000182810	ENST00000332395	T	0.70869	-0.52	5.81	4.86	0.63082	Helicase, C-terminal (1);	0.181994	0.47852	D	0.000203	T	0.55033	0.1895	N	0.21583	0.68	0.38807	D	0.955338	B	0.18310	0.027	B	0.19148	0.024	T	0.53063	-0.8491	10	0.32370	T	0.25	-16.7896	10.4232	0.44363	0.0699:0.1339:0.7962:0.0	.	506	Q9NUL7	DDX28_HUMAN	A	506	ENSP00000332340:P506A	ENSP00000332340:P506A	P	-	1	0	DDX28	66613091	1.000000	0.71417	1.000000	0.80357	0.265000	0.26407	5.307000	0.65762	1.473000	0.48159	-0.259000	0.10710	CCC	DDX28	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000182810		0.582	DDX28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX28	HGNC	protein_coding	OTTHUMT00000268883.1	-	0.00	22	0	G	NM_018380		68055590	-1	tier1	-	no_errors	ENST00000332395	ensembl	human	known	74_37	missense	18.92	30	7	SNP	0.997	C
DENND2A	27147	genome.wustl.edu	37	7	140269453	140269453	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:140269453G>C	ENST00000275884.6	-	6	1949	c.1532C>G	c.(1531-1533)tCa>tGa	p.S511*	DENND2A_ENST00000496613.1_Nonsense_Mutation_p.S511*|DENND2A_ENST00000492720.1_Nonsense_Mutation_p.S511*|DENND2A_ENST00000537639.1_Nonsense_Mutation_p.S511*			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	511					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					ACCTTTTCCTGAGTTGCTCTC	0.527																																																	0													149.0	151.0	151.0					7																	140269453		1915	4119	6034	SO:0001587	stop_gained	0			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1532C>G	7.37:g.140269453G>C	ENSP00000275884:p.Ser511*		C9JUI3|Q1RMD5|Q86XY0	Nonsense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.S511*	ENST00000275884.6	37	c.1532	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	G	39	7.624371	0.98396	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	.	.	.	4.89	4.89	0.63831	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-9.465	18.0603	0.89374	0.0:0.0:1.0:0.0	.	.	.	.	X	511	.	ENSP00000275884:S511X	S	-	2	0	DENND2A	139915922	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.013000	0.93629	2.255000	0.74692	0.462000	0.41574	TCA	DENND2A	-	NULL	ENSG00000146966		0.527	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1	-	0.00	57	0	G	NM_015689		140269453	-1	tier1	-	no_errors	ENST00000275884	ensembl	human	known	74_37	nonsense	31.34	46	21	SNP	1.000	C
DLG1	1739	genome.wustl.edu	37	3	196812438	196812438	+	Intron	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:196812438G>C	ENST00000419354.1	-	17	2224				DLG1_ENST00000346964.2_Intron|DLG1_ENST00000452595.1_Intron|DLG1_ENST00000450955.1_Intron|DLG1_ENST00000314062.3_Intron|DLG1_ENST00000392382.2_Intron|DLG1_ENST00000448528.2_Intron|DLG1_ENST00000422288.1_Intron|DLG1_ENST00000357674.4_Intron|DLG1_ENST00000443183.1_Intron			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)						actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CAAGTGGTAAGAAACAGGCAT	0.408																																																	0													110.0	113.0	112.0					3																	196812438		2203	4300	6503	SO:0001627	intron_variant	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1937+12C>G	3.37:g.196812438G>C			A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_PDZ,superfamily_SH3_domain,smart_L27,smart_PDZ,smart_SH3_domain,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain	p.F650L	ENST00000419354.1	37	c.1950	CCDS43194.1	3																																																																																			DLG1	-	smart_SH3_domain	ENSG00000075711		0.408	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	-	0.00	30	0	G	NM_004087		196812438	-1	tier1	-	no_errors	ENST00000392381	ensembl	human	known	74_37	missense	43.86	32	25	SNP	0.001	C
DLGAP3	58512	genome.wustl.edu	37	1	35370161	35370161	+	Missense_Mutation	SNP	G	G	A	rs146229611		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:35370161G>A	ENST00000373347.1	-	3	1092	c.824C>T	c.(823-825)gCg>gTg	p.A275V	DLGAP3_ENST00000235180.4_Missense_Mutation_p.A275V|DLGAP3_ENST00000495979.1_5'Flank			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	275					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				CCTCCCACCCGCCAGGAAGCC	0.662																																																	0													75.0	77.0	76.0					1																	35370161		2203	4300	6503	SO:0001583	missense	0			AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.824C>T	1.37:g.35370161G>A	ENSP00000362444:p.Ala275Val		Q5TDD5|Q9H3X7	Missense_Mutation	SNP	pfam_GKAP	p.A275V	ENST00000373347.1	37	c.824	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863091	0.32884	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	T;T	0.24723	1.84;1.84	4.65	2.69	0.31865	.	0.443790	0.24502	N	0.037973	T	0.08537	0.0212	N	0.01505	-0.83	0.24826	N	0.992554	B	0.16802	0.019	B	0.10450	0.005	T	0.24119	-1.0169	10	0.39692	T	0.17	-1.5444	6.6443	0.22927	0.4624:0.0:0.5376:0.0	.	275	O95886	DLGP3_HUMAN	V	275	ENSP00000362444:A275V;ENSP00000235180:A275V	ENSP00000235180:A275V	A	-	2	0	DLGAP3	35142748	1.000000	0.71417	0.990000	0.47175	0.986000	0.74619	2.544000	0.45761	0.451000	0.26802	0.655000	0.94253	GCG	DLGAP3	-	NULL	ENSG00000116544		0.662	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	-	0.00	35	0	G	NM_021234		35370161	-1	tier1	-	no_errors	ENST00000235180	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	A
DLGAP5	9787	genome.wustl.edu	37	14	55642728	55642728	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:55642728G>A	ENST00000247191.2	-	9	1274	c.1058C>T	c.(1057-1059)tCt>tTt	p.S353F	DLGAP5_ENST00000395425.2_Missense_Mutation_p.S353F	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	353					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						TGTTGCTTGAGACTCATCACT	0.323																																																	0													127.0	121.0	123.0					14																	55642728		2203	4297	6500	SO:0001583	missense	0			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.1058C>T	14.37:g.55642728G>A	ENSP00000247191:p.Ser353Phe		A8MTM6|B4DRM8|Q86T11|Q8NG58	Missense_Mutation	SNP	pfam_GKAP	p.S353F	ENST00000247191.2	37	c.1058	CCDS9723.1	14	.	.	.	.	.	.	.	.	.	.	G	11.46	1.646526	0.29246	.	.	ENSG00000126787	ENST00000395425;ENST00000247191	T;T	0.19105	2.17;2.17	4.47	1.58	0.23477	.	6.758430	0.00166	N	0.000012	T	0.20210	0.0486	L	0.34521	1.04	0.25502	N	0.987543	P;P	0.41313	0.745;0.611	B;B	0.42245	0.381;0.295	T	0.13442	-1.0509	10	0.54805	T	0.06	.	4.2665	0.10766	0.2061:0.1915:0.6024:0.0	.	353;353	A8MTM6;Q15398	.;DLGP5_HUMAN	F	353	ENSP00000378815:S353F;ENSP00000247191:S353F	ENSP00000247191:S353F	S	-	2	0	DLGAP5	54712481	0.747000	0.28283	0.593000	0.28771	0.893000	0.52053	0.969000	0.29370	0.370000	0.24538	0.585000	0.79938	TCT	DLGAP5	-	pfam_GKAP	ENSG00000126787		0.323	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP5	HGNC	protein_coding	OTTHUMT00000276908.2	-	0.00	57	0	G	NM_014750		55642728	-1	tier1	-	no_errors	ENST00000247191	ensembl	human	known	74_37	missense	26.53	36	13	SNP	0.774	A
DNAH5	1767	genome.wustl.edu	37	5	13883156	13883156	+	Silent	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:13883156G>T	ENST00000265104.4	-	20	3135	c.3031C>A	c.(3031-3033)Cgg>Agg	p.R1011R	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1011	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ACGCTTGCCCGGAAAATGGGC	0.458									Kartagener syndrome																																								0													126.0	118.0	121.0					5																	13883156		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3031C>A	5.37:g.13883156G>T			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1011	ENST00000265104.4	37	c.3031	CCDS3882.1	5																																																																																			DNAH5	-	NULL	ENSG00000039139		0.458	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	22	0	G	NM_001369		13883156	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6519527	6519527	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:6519527G>T	ENST00000527990.2	+	1	82	c.82G>T	c.(82-84)Gtc>Ttc	p.V28F	DNHD1_ENST00000354685.3_Missense_Mutation_p.V28F|DNHD1_ENST00000254579.6_Missense_Mutation_p.V28F|DNHD1_ENST00000477562.1_Intron			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	28					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTCCATATGTGTCTTGGACAG	0.532																																																	0													196.0	193.0	194.0					11																	6519527		2201	4296	6497	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.82G>T	11.37:g.6519527G>T	ENSP00000436180:p.Val28Phe		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.V28F	ENST00000527990.2	37	c.82	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	G	12.47	1.948346	0.34377	.	.	ENSG00000179532	ENST00000254579;ENST00000354685;ENST00000527990	T;T;T	0.28069	1.63;2.54;1.63	4.14	-0.187	0.13268	.	1.131030	0.06820	N	0.792075	T	0.20455	0.0492	N	0.19112	0.55	0.09310	N	1	P;D	0.54207	0.94;0.965	B;P	0.44811	0.272;0.461	T	0.14671	-1.0464	10	0.87932	D	0	.	3.294	0.06960	0.4083:0.2092:0.3824:0.0	.	28;28	Q96M86;Q96M86-4	DNHD1_HUMAN;.	F	28	ENSP00000254579:V28F;ENSP00000346716:V28F;ENSP00000436180:V28F	ENSP00000254579:V28F	V	+	1	0	DNHD1	6476103	0.002000	0.14202	0.000000	0.03702	0.021000	0.10359	0.069000	0.14552	-0.134000	0.11516	0.563000	0.77884	GTC	DNHD1	-	NULL	ENSG00000179532		0.532	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	-	0.00	30	0	G	NM_144666		6519527	+1	tier1	-	no_errors	ENST00000254579	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.000	T
DPCR1	135656	genome.wustl.edu	37	6	30917575	30917575	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:30917575G>C	ENST00000462446.1	+	2	1362	c.1334G>C	c.(1333-1335)aGa>aCa	p.R445T	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	336						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						ACAGAAAATAGAGAAAGGACA	0.512																																																	0													174.0	217.0	204.0					6																	30917575		692	1591	2283	SO:0001583	missense	0			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1334G>C	6.37:g.30917575G>C	ENSP00000417182:p.Arg445Thr		C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	NULL	p.R445T	ENST00000462446.1	37	c.1334	CCDS4692.2	6	.	.	.	.	.	.	.	.	.	.	-	2.657	-0.280559	0.05642	.	.	ENSG00000168631	ENST00000462446	T	0.40225	1.04	1.56	-3.13	0.05266	.	.	.	.	.	T	0.05456	0.0144	N	0.14661	0.345	0.09310	N	0.999999	B	0.17038	0.02	B	0.04013	0.001	T	0.34576	-0.9823	9	0.13853	T	0.58	.	3.4968	0.07658	0.5774:0.0:0.2473:0.1752	.	445	E9PEI6	.	T	445	ENSP00000417182:R445T	ENSP00000417182:R445T	R	+	2	0	DPCR1	31025554	0.000000	0.05858	0.000000	0.03702	0.492000	0.33523	-3.566000	0.00429	-1.243000	0.02519	0.000000	0.15137	AGA	DPCR1	-	NULL	ENSG00000168631		0.512	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	HGNC	protein_coding	OTTHUMT00000076173.3	-	0.00	65	0	G	NM_080870		30917575	+1	tier1	-	no_errors	ENST00000462446	ensembl	human	novel	74_37	missense	37.84	46	28	SNP	0.000	C
DPM2	8818	genome.wustl.edu	37	9	130698040	130698040	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:130698040C>T	ENST00000314392.8	-	4	879	c.216G>A	c.(214-216)gtG>gtA	p.V72V	RP11-203J24.8_ENST00000586374.1_RNA|RP11-203J24.8_ENST00000588890.1_RNA|RP11-203J24.8_ENST00000590283.1_RNA|RP11-203J24.8_ENST00000591408.1_RNA|RP11-203J24.8_ENST00000587355.1_RNA|RP11-203J24.8_ENST00000608805.1_RNA|RP11-203J24.8_ENST00000587978.1_RNA|RP11-203J24.8_ENST00000592240.1_RNA	NM_003863.3	NP_003854.1	O94777	DPM2_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit	72					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)|regulation of protein stability (GO:0031647)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of endoplasmic reticulum membrane (GO:0030176)|perinuclear region of cytoplasm (GO:0048471)	dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|enzyme regulator activity (GO:0030234)			lung(1)	1						TCTTCAGCATCACATAGGAGA	0.567																																																	0													134.0	112.0	119.0					9																	130698040		2203	4300	6503	SO:0001819	synonymous_variant	0			AB013361	CCDS6886.1	9q34.13	2013-02-26			ENSG00000136908	ENSG00000136908			3006	protein-coding gene	gene with protein product	"""DPM synthase complex subunit"""	603564				9724629	Standard	NM_003863		Approved	MGC21559, MGC111193	uc004bsv.2	O94777	OTTHUMG00000020725	ENST00000314392.8:c.216G>A	9.37:g.130698040C>T			Q5XKK9|Q6FGH3	Silent	SNP	pfam_DPM2	p.V72	ENST00000314392.8	37	c.216	CCDS6886.1	9																																																																																			DPM2	-	pfam_DPM2	ENSG00000136908		0.567	DPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPM2	HGNC	protein_coding	OTTHUMT00000054324.1	-	0.00	48	0	C	NM_003863		130698040	-1	tier1	-	no_errors	ENST00000314392	ensembl	human	known	74_37	silent	23.81	32	10	SNP	0.985	T
DPYD	1806	genome.wustl.edu	37	1	97771847	97771847	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:97771847C>T	ENST00000370192.3	-	17	2165	c.2065G>A	c.(2065-2067)Gag>Aag	p.E689K	DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	689					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CGCACCAGCTCTGGATCCTGT	0.438																																																	0													115.0	117.0	116.0					1																	97771847		2203	4300	6503	SO:0001583	missense	0			U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2065G>A	1.37:g.97771847C>T	ENSP00000359211:p.Glu689Lys		A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	pfam_Dihydroorotate_DH_1_2,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_tRNA_hU_synthase,superfamily_Helical_ferredxn,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Dihydroorotate_DH	p.E689K	ENST00000370192.3	37	c.2065	CCDS30777.1	1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064334	0.55432	.	.	ENSG00000188641	ENST00000370192	D	0.85702	-2.02	5.9	5.9	0.94986	Aldolase-type TIM barrel (1);	0.335623	0.32372	N	0.006188	T	0.74816	0.3766	L	0.41632	1.29	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	T	0.67956	-0.5536	10	0.30854	T	0.27	-22.1022	20.2704	0.98474	0.0:1.0:0.0:0.0	.	689	Q12882	DPYD_HUMAN	K	689	ENSP00000359211:E689K	ENSP00000359211:E689K	E	-	1	0	DPYD	97544435	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.458000	0.80787	2.793000	0.96121	0.591000	0.81541	GAG	DPYD	-	pfam_Dihydroorotate_DH_1_2,pfam_tRNA_hU_synthase,tigrfam_Dihydroorotate_DH	ENSG00000188641		0.438	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYD	HGNC	protein_coding	OTTHUMT00000095698.3	-	0.00	17	0	C	NM_000110		97771847	-1	tier1	-	no_errors	ENST00000370192	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	T
DSCR3	10311	genome.wustl.edu	37	21	38610793	38610793	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr21:38610793C>G	ENST00000309117.6	-	3	556	c.319G>C	c.(319-321)Gag>Cag	p.E107Q	DSCR3_ENST00000399000.3_5'UTR|DSCR3_ENST00000288304.5_Missense_Mutation_p.E65Q|AP001432.14_ENST00000440629.1_lincRNA|DSCR3_ENST00000476950.1_Missense_Mutation_p.E107Q|DSCR3_ENST00000539844.1_Intron|DSCR3_ENST00000399001.1_Intron|DSCR3_ENST00000398998.1_Missense_Mutation_p.E59Q	NM_006052.1	NP_006043.1	O14972	DSCR3_HUMAN	Down syndrome critical region gene 3	107						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(3)|lung(3)	9						TGATACGTCTCATACAGAACT	0.453																																																	0													165.0	151.0	156.0					21																	38610793		2203	4300	6503	SO:0001583	missense	0			D87343	CCDS33553.1	21q22.2	2008-05-22			ENSG00000157538	ENSG00000157538			3044	protein-coding gene	gene with protein product		605298				9399594	Standard	NM_006052		Approved	DCRA	uc002ywf.1	O14972	OTTHUMG00000086659	ENST00000309117.6:c.319G>C	21.37:g.38610793C>G	ENSP00000311399:p.Glu107Gln		B2R6T8|B7Z6B1|D3DSH4|Q2TAY6	Missense_Mutation	SNP	pfam_VPS26,pfam_Arrestin-like_N,superfamily_Ig_E-set	p.E107Q	ENST00000309117.6	37	c.319	CCDS33553.1	21	.	.	.	.	.	.	.	.	.	.	C	33	5.219936	0.95139	.	.	ENSG00000157538	ENST00000309117;ENST00000288304;ENST00000476950;ENST00000398998	T	0.06371	3.31	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.32704	0.0838	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.989	T	0.12863	-1.0531	10	0.87932	D	0	-8.5269	19.5612	0.95373	0.0:1.0:0.0:0.0	.	107;107	B7Z6B1;O14972	.;DSCR3_HUMAN	Q	107;65;107;59	ENSP00000311399:E107Q	ENSP00000288304:E65Q	E	-	1	0	DSCR3	37532663	1.000000	0.71417	0.995000	0.50966	0.901000	0.52897	7.458000	0.80787	2.687000	0.91594	0.655000	0.94253	GAG	DSCR3	-	pfam_VPS26,pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000157538		0.453	DSCR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCR3	HGNC	protein_coding	OTTHUMT00000194807.1	-	0.00	25	0	C			38610793	-1	tier1	-	no_errors	ENST00000309117	ensembl	human	known	74_37	missense	40.00	15	10	SNP	1.000	G
DSEL	92126	genome.wustl.edu	37	18	65180887	65180887	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr18:65180887delA	ENST00000310045.7	-	2	2462	c.989delT	c.(988-990)ttafs	p.L330fs	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA|RP11-638L3.1_ENST00000583687.1_lincRNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	320					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GAAGCCAGGTAAAAGGGTGGC	0.378																																																	0													70.0	74.0	73.0					18																	65180887		2203	4300	6503	SO:0001589	frameshift_variant	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.989delT	18.37:g.65180887delA	ENSP00000310565:p.Leu330fs		Q17RH1|Q6P5Z3	Frame_Shift_Del	DEL	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.L330fs	ENST00000310045.7	37	c.989	CCDS11995.1	18																																																																																			DSEL	-	superfamily_Chondroitin_lyas	ENSG00000171451		0.378	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1		0.00	49	0	A	NM_032160		65180887	-1	tier1		no_errors	ENST00000310045	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	0.996	-
DSP	1832	genome.wustl.edu	37	6	7583820	7583820	+	Missense_Mutation	SNP	G	G	A	rs397516951		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:7583820G>A	ENST00000379802.3	+	24	6666	c.6325G>A	c.(6325-6327)Gaa>Aaa	p.E2109K	DSP_ENST00000418664.2_Missense_Mutation_p.E1510K	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2109	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		ATCTGTTTCAGAAGCCATCAA	0.448																																																	0													87.0	94.0	92.0					6																	7583820		2203	4300	6503	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6325G>A	6.37:g.7583820G>A	ENSP00000369129:p.Glu2109Lys		B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.E2109K	ENST00000379802.3	37	c.6325	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	G	24.1	4.494173	0.85069	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.72942	-0.7;-0.7	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000011	T	0.64983	0.2648	L	0.50333	1.59	0.31687	N	0.642418	P;P	0.49185	0.92;0.905	P;B	0.47346	0.544;0.292	T	0.68834	-0.5304	10	0.66056	D	0.02	.	19.0722	0.93143	0.0:0.0:1.0:0.0	.	1557;2109	Q4LE79;P15924	.;DESP_HUMAN	K	2109;1510	ENSP00000369129:E2109K;ENSP00000396591:E1510K	ENSP00000369129:E2109K	E	+	1	0	DSP	7528819	1.000000	0.71417	0.982000	0.44146	0.997000	0.91878	7.229000	0.78088	2.595000	0.87683	0.655000	0.94253	GAA	DSP	-	smart_Plectin_repeat	ENSG00000096696		0.448	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	-	0.00	33	0	G	NM_004415		7583820	+1	tier1	-	no_errors	ENST00000379802	ensembl	human	known	74_37	missense	44.44	20	16	SNP	0.999	A
DST	667	genome.wustl.edu	37	6	56535438	56535438	+	Splice_Site	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:56535438C>G	ENST00000361203.3	-	6	589		c.e6+1		DST_ENST00000370754.5_Splice_Site|DST_ENST00000312431.6_Splice_Site|DST_ENST00000370769.4_Splice_Site|DST_ENST00000421834.2_Splice_Site|DST_ENST00000370788.2_Splice_Site			Q03001	DYST_HUMAN	dystonin						axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAATTCCATACCTGTATTTAT	0.328																																																	0													40.0	36.0	37.0					6																	56535438		1815	4079	5894	SO:0001630	splice_region_variant	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.581+1G>C	6.37:g.56535438C>G			B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Splice_Site	SNP	-	e9+1	ENST00000361203.3	37	c.1115+1		6	.	.	.	.	.	.	.	.	.	.	C	23.3	4.396010	0.83011	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000421834;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000520645;ENST00000449297	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3201	0.90236	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DST	56643397	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.609000	0.82925	2.623000	0.88846	0.591000	0.81541	.	DST	-	-	ENSG00000151914		0.328	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	25	0	C	NM_001723	Intron	56535438	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	splice_site	27.50	29	11	SNP	1.000	G
E2F5	1875	genome.wustl.edu	37	8	86118428	86118428	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:86118428C>T	ENST00000416274.2	+	4	557	c.523C>T	c.(523-525)Cat>Tat	p.H175Y	E2F5_ENST00000256117.5_Missense_Mutation_p.H176Y|E2F5_ENST00000521429.1_5'UTR|E2F5_ENST00000519128.1_3'UTR|E2F5_ENST00000418930.2_Missense_Mutation_p.H175Y|E2F5_ENST00000517476.1_Missense_Mutation_p.H14Y	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	175	Dimerization. {ECO:0000255}.				gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						CTATGTAACTCATGAAGACAT	0.353																																																	0													172.0	171.0	171.0					8																	86118428		1867	4117	5984	SO:0001583	missense	0			X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.523C>T	8.37:g.86118428C>T	ENSP00000398124:p.His175Tyr		E9PBN9|Q16601|Q92756	Missense_Mutation	SNP	pfam_E2F_TDP	p.H176Y	ENST00000416274.2	37	c.526	CCDS47885.1	8	.	.	.	.	.	.	.	.	.	.	C	16.13	3.034889	0.54896	.	.	ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274;ENST00000517476;ENST00000518234	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	6.07	5.19	0.71726	.	0.047188	0.85682	N	0.000000	T	0.75496	0.3857	L	0.28400	0.85	0.80722	D	1	B;B	0.27140	0.169;0.093	B;B	0.27796	0.083;0.068	T	0.71130	-0.4682	10	0.30854	T	0.27	-17.7741	15.6787	0.77349	0.0:0.9344:0.0:0.0656	.	175;175	Q15329-2;Q15329	.;E2F5_HUMAN	Y	175;176;175;14;11	ENSP00000414312:H175Y;ENSP00000256117:H176Y;ENSP00000398124:H175Y;ENSP00000429120:H14Y;ENSP00000429669:H11Y	ENSP00000256117:H176Y	H	+	1	0	E2F5	86305680	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.818000	0.62657	1.577000	0.49804	0.655000	0.94253	CAT	E2F5	-	NULL	ENSG00000133740		0.353	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	E2F5	HGNC	protein_coding	OTTHUMT00000380274.1	-	0.00	58	0	C	NM_001951		86118428	+1	tier1	-	no_errors	ENST00000256117	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
ECE1	1889	genome.wustl.edu	37	1	21582529	21582529	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:21582529C>G	ENST00000374893.6	-	8	1005	c.931G>C	c.(931-933)Gag>Cag	p.E311Q	ECE1_ENST00000528294.1_5'UTR|ECE1_ENST00000357071.4_Missense_Mutation_p.E299Q|ECE1_ENST00000415912.2_Missense_Mutation_p.E295Q|ECE1_ENST00000436918.2_Missense_Mutation_p.E311Q|ECE1_ENST00000264205.6_Missense_Mutation_p.E308Q	NM_001397.2	NP_001388.1	P42892	ECE1_HUMAN	endothelin converting enzyme 1	311					bradykinin catabolic process (GO:0010815)|calcitonin catabolic process (GO:0010816)|ear development (GO:0043583)|embryonic digit morphogenesis (GO:0042733)|endothelin maturation (GO:0034959)|heart development (GO:0007507)|hormone catabolic process (GO:0042447)|peptide hormone processing (GO:0016486)|pharyngeal system development (GO:0060037)|positive regulation of receptor recycling (GO:0001921)|protein processing (GO:0016485)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|substance P catabolic process (GO:0010814)	early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intrinsic component of endosome membrane (GO:0031302)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)|Weibel-Palade body (GO:0033093)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide hormone binding (GO:0017046)|protein homodimerization activity (GO:0042803)			endometrium(5)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	25		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		AGTGCCGTCTCAAAGTCCAAG	0.602																																																	0													137.0	110.0	119.0					1																	21582529		2203	4300	6503	SO:0001583	missense	0			D49471	CCDS215.1, CCDS44081.1, CCDS44082.1, CCDS44083.1	1p36.1	2008-02-05			ENSG00000117298	ENSG00000117298			3146	protein-coding gene	gene with protein product		600423		ECE		7805846, 7864876, 17592116	Standard	NM_001397		Approved		uc001bei.2	P42892	OTTHUMG00000002625	ENST00000374893.6:c.931G>C	1.37:g.21582529C>G	ENSP00000364028:p.Glu311Gln		A8K3P1|B4E291|Q14217|Q17RN5|Q2Z2K8|Q58GE7|Q5THM5|Q5THM7|Q5THM8|Q9UJQ6|Q9UPF4|Q9UPM4|Q9Y501	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.E311Q	ENST00000374893.6	37	c.931	CCDS215.1	1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951593	0.92660	.	.	ENSG00000117298	ENST00000415912;ENST00000357071;ENST00000374893;ENST00000436918;ENST00000264205	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.73	5.73	0.89815	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.93271	0.7856	M	0.92026	3.265	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.995;0.999;0.999	D	0.93997	0.7272	10	0.87932	D	0	-44.4529	18.8402	0.92180	0.0:1.0:0.0:0.0	.	311;295;311;299;308	B4DKB2;Q2Z2K8;P42892;P42892-2;P42892-4	.;.;ECE1_HUMAN;.;.	Q	295;299;311;311;308	ENSP00000405088:E295Q;ENSP00000349581:E299Q;ENSP00000364028:E311Q;ENSP00000388439:E311Q;ENSP00000264205:E308Q	ENSP00000264205:E308Q	E	-	1	0	ECE1	21455116	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.379000	0.79691	2.868000	0.98415	0.555000	0.69702	GAG	ECE1	-	pfam_Peptidase_M13_N	ENSG00000117298		0.602	ECE1-002	KNOWN	basic|CCDS	protein_coding	ECE1	HGNC	protein_coding	OTTHUMT00000007470.2	-	0.00	33	0	C	NM_001397		21582529	-1	tier1	-	no_errors	ENST00000374893	ensembl	human	known	74_37	missense	27.45	37	14	SNP	1.000	G
ECI1	1632	genome.wustl.edu	37	16	2296896	2296896	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:2296896C>T	ENST00000301729.4	-	3	305	c.258G>A	c.(256-258)gaG>gaA	p.E86E	ECI1_ENST00000570258.1_Silent_p.E27E|ECI1_ENST00000562238.1_Silent_p.E86E	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	86					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)			endometrium(1)|large_intestine(2)|lung(6)	9						TCTTGTCATTCTCCAGCTTCT	0.542																																																	0													63.0	58.0	60.0					16																	2296896		2198	4300	6498	SO:0001819	synonymous_variant	0				CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.258G>A	16.37:g.2296896C>T			A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Silent	SNP	pfam_Crotonase_core_superfam	p.E86	ENST00000301729.4	37	c.258	CCDS10464.1	16																																																																																			ECI1	-	pfam_Crotonase_core_superfam	ENSG00000167969		0.542	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECI1	HGNC	protein_coding	OTTHUMT00000250768.1	-	0.00	70	0	C			2296896	-1	tier1	-	no_errors	ENST00000301729	ensembl	human	known	74_37	silent	40.58	41	28	SNP	0.999	T
EEF1DP3	196549	genome.wustl.edu	37	13	32527031	32527031	+	RNA	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr13:32527031G>A	ENST00000428783.1	+	0	731							Q658K8	EF1DL_HUMAN	eukaryotic translation elongation factor 1 delta pseudogene 3								translation elongation factor activity (GO:0003746)										CCCGGCCACTGGGCCACAGCC	0.642																																																	0													11.0	14.0	13.0					13																	32527031		692	1591	2283			0					13q13.1	2012-10-23			ENSG00000229715	ENSG00000229715			30486	pseudogene	pseudogene						12477932	Standard	NR_027062		Approved		uc001utu.3	Q658K8	OTTHUMG00000016691		13.37:g.32527031G>A			Q08AR3	RNA	SNP	-	NULL	ENST00000428783.1	37	NULL		13																																																																																			EEF1DP3	-	-	ENSG00000229715		0.642	EEF1DP3-001	KNOWN	basic	processed_transcript	EEF1DP3	HGNC	pseudogene	OTTHUMT00000044400.2	-	0.00	28	0	G	NR_027062		32527031	+1	tier1	-	no_errors	ENST00000428783	ensembl	human	known	74_37	rna	48.28	15	14	SNP	0.732	A
EFCAB13	124989	genome.wustl.edu	37	17	45451874	45451874	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:45451874C>G	ENST00000331493.2	+	12	1325	c.914C>G	c.(913-915)tCa>tGa	p.S305*	EFCAB13_ENST00000517484.1_Nonsense_Mutation_p.S209*	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	305						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										GAAATTACTTCAGACAGAAAG	0.279																																																	0													32.0	36.0	35.0					17																	45451874		2187	4249	6436	SO:0001587	stop_gained	0			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.914C>G	17.37:g.45451874C>G	ENSP00000332111:p.Ser305*		G3V128|Q49AG9	Nonsense_Mutation	SNP	NULL	p.S305*	ENST00000331493.2	37	c.914	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673861	0.88445	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	.	.	.	4.02	2.02	0.26589	.	1.797520	0.03299	N	0.188711	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.4134	5.6839	0.17792	0.0:0.7571:0.0:0.2429	.	.	.	.	X	305;209;257	.	ENSP00000332111:S305X	S	+	2	0	C17orf57	42806873	0.055000	0.20627	0.348000	0.25681	0.252000	0.25951	0.079000	0.14782	1.031000	0.39867	0.585000	0.79938	TCA	EFCAB13	-	NULL	ENSG00000178852		0.279	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFCAB13	HGNC	protein_coding	OTTHUMT00000380147.4	-	0.00	49	0	C	NM_152347		45451874	+1	tier1	-	no_errors	ENST00000331493	ensembl	human	known	74_37	nonsense	32.00	34	16	SNP	0.067	G
EHD1	10938	genome.wustl.edu	37	11	64621765	64621765	+	3'UTR	SNP	C	C	T	rs554327697		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:64621765C>T	ENST00000320631.3	-	0	1899				EHD1_ENST00000488711.1_5'UTR|EHD1_ENST00000359393.2_3'UTR	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1						blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						CTCTGCCTCCCGGCCGGGCGT	0.642													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15482	0.0		0.0	False		,,,				2504	0.0																0													5.0	7.0	6.0					11																	64621765		2048	4080	6128	SO:0001624	3_prime_UTR_variant	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.*40G>A	11.37:g.64621765C>T			O14611|Q2M3Q4|Q9UNR3	RNA	SNP	-	NULL	ENST00000320631.3	37	NULL	CCDS8084.1	11																																																																																			EHD1	-	-	ENSG00000110047		0.642	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	-	0.00	46	0	C	NM_006795		64621765	-1	tier1	-	no_errors	ENST00000488711	ensembl	human	known	74_37	rna	40.91	39	27	SNP	0.000	T
EIF4ENIF1	56478	genome.wustl.edu	37	22	31835930	31835930	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:31835930T>A	ENST00000397525.1	-	19	3117	c.2894A>T	c.(2893-2895)cAg>cTg	p.Q965L	EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.Q791L|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.Q620L|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.Q965L|EIF4ENIF1_ENST00000441289.1_5'Flank|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.Q941L	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	965						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						CAGGGGTTGCTGTAGCACATC	0.592																																																	0													102.0	84.0	90.0					22																	31835930		2203	4300	6503	SO:0001583	missense	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.2894A>T	22.37:g.31835930T>A	ENSP00000380659:p.Gln965Leu		B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	pfam_eIF4E_transporter	p.Q965L	ENST00000397525.1	37	c.2894	CCDS13898.1	22	.	.	.	.	.	.	.	.	.	.	T	20.4	3.988761	0.74589	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180	.	.	.	6.16	6.16	0.99307	.	0.099229	0.64402	D	0.000001	T	0.65698	0.2716	L	0.29908	0.895	0.80722	D	1	D;P;D;D	0.59357	0.985;0.956;0.985;0.985	D;B;P;P	0.66196	0.942;0.444;0.79;0.541	T	0.68254	-0.5457	9	0.66056	D	0.02	-12.3651	15.9872	0.80168	0.0:0.0:0.0:1.0	.	791;965;790;941	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	L	791;965;965;941;620	.	ENSP00000328103:Q965L	Q	-	2	0	EIF4ENIF1	30165930	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.078000	0.76821	2.367000	0.80283	0.528000	0.53228	CAG	EIF4ENIF1	-	NULL	ENSG00000184708		0.592	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	-	0.00	36	0	T	NM_019843		31835930	-1	tier1	-	no_errors	ENST00000330125	ensembl	human	known	74_37	missense	37.04	34	20	SNP	1.000	A
ELAVL1	1994	genome.wustl.edu	37	19	8032642	8032642	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:8032642C>G	ENST00000407627.2	-	5	592	c.463G>C	c.(463-465)Gac>Cac	p.D155H	ELAVL1_ENST00000351593.5_Missense_Mutation_p.D182H|ELAVL1_ENST00000596459.1_Missense_Mutation_p.D155H|ELAVL1_ENST00000593807.1_Intron	NM_001419.2	NP_001410.2	Q15717	ELAV1_HUMAN	ELAV like RNA binding protein 1	155	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|multicellular organismal development (GO:0007275)|positive regulation of translation (GO:0045727)|regulation of stem cell maintenance (GO:2000036)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|double-stranded RNA binding (GO:0003725)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						GACCGTTTGTCAAACCGGATA	0.463																																																	0													110.0	91.0	97.0					19																	8032642		2203	4300	6503	SO:0001583	missense	0			U38175	CCDS12193.1	19p13.2	2013-10-03	2013-10-03			ENSG00000066044		"""RNA binding motif (RRM) containing"""	3312	protein-coding gene	gene with protein product	"""embryonic lethal, abnormal vision, drosophila, homolog-like 1"", ""Hu antigen R"""	603466	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)"""	HUR		8626503, 9003489	Standard	NM_001419		Approved	HuR, Hua, MelG	uc002mjb.3	Q15717		ENST00000407627.2:c.463G>C	19.37:g.8032642C>G	ENSP00000385269:p.Asp155His		B4DVB8|Q53XN6|Q9BTT1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.D182H	ENST00000407627.2	37	c.544	CCDS12193.1	19	.	.	.	.	.	.	.	.	.	.	C	29.6	5.021009	0.93462	.	.	ENSG00000066044	ENST00000407627;ENST00000351593	T;T	0.17213	2.29;2.29	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.45518	0.1346	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.24657	-1.0154	10	0.87932	D	0	.	18.3732	0.90420	0.0:1.0:0.0:0.0	.	155	Q15717	ELAV1_HUMAN	H	155;182	ENSP00000385269:D155H;ENSP00000264073:D182H	ENSP00000264073:D182H	D	-	1	0	ELAVL1	7938642	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GAC	ELAVL1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_ELAD_HUD_SF	ENSG00000066044		0.463	ELAVL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAVL1	HGNC	protein_coding	OTTHUMT00000461494.3	-	0.00	52	0	C	NM_001419		8032642	-1	tier1	-	no_errors	ENST00000351593	ensembl	human	known	74_37	missense	45.59	37	31	SNP	1.000	G
ELAVL3	1995	genome.wustl.edu	37	19	11591457	11591457	+	5'UTR	DEL	G	G	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:11591457delG	ENST00000359227.3	-	0	391				ELAVL3_ENST00000438662.2_5'Flank|CTC-398G3.6_ENST00000585656.1_Intron|ELAVL3_ENST00000592218.1_5'UTR	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3						cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						TCCGTGTTGAGGGGGGCTCCG	0.706																																																	0													21.0	25.0	24.0					19																	11591457		2196	4295	6491	SO:0001623	5_prime_UTR_variant	0				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.-34C>-	19.37:g.11591457delG			Q16135|Q96CL8|Q96QS9	RNA	DEL	-	NULL	ENST00000359227.3	37	NULL	CCDS32912.1	19																																																																																			ELAVL3	-	-	ENSG00000196361		0.706	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	HGNC	protein_coding	OTTHUMT00000458827.2		0.00	43	0	G	NM_001420		11591457	-1	tier1		no_errors	ENST00000592218	ensembl	human	putative	74_37	rna	40.48	50	34	DEL	1.000	-
ELAVL3	1995	genome.wustl.edu	37	19	11591462	11591462	+	5'UTR	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:11591462G>T	ENST00000359227.3	-	0	386				ELAVL3_ENST00000438662.2_5'Flank|CTC-398G3.6_ENST00000585656.1_Intron|ELAVL3_ENST00000592218.1_5'UTR	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3						cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						GTTGAGGGGGGCTCCGGGGGT	0.706																																																	0													20.0	23.0	22.0					19																	11591462		2194	4293	6487	SO:0001623	5_prime_UTR_variant	0				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.-39C>A	19.37:g.11591462G>T			Q16135|Q96CL8|Q96QS9	RNA	SNP	-	NULL	ENST00000359227.3	37	NULL	CCDS32912.1	19																																																																																			ELAVL3	-	-	ENSG00000196361		0.706	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	HGNC	protein_coding	OTTHUMT00000458827.2	-	0.00	38	0	G	NM_001420		11591462	-1	tier1	-	no_errors	ENST00000592218	ensembl	human	putative	74_37	rna	46.43	45	39	SNP	1.000	T
ENG	2022	genome.wustl.edu	37	9	130578263	130578263	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:130578263G>T	ENST00000373203.4	-	14	2211	c.1811C>A	c.(1810-1812)gCc>gAc	p.A604D	RP11-228B15.4_ENST00000425991.1_RNA|ENG_ENST00000480266.1_5'Flank|ENG_ENST00000344849.3_Missense_Mutation_p.A604D|RP11-228B15.4_ENST00000439298.1_RNA	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	604			A -> D (in HHT1). {ECO:0000269|PubMed:16752392}.		artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						AGTGAGCAGGGCCCCGATGAG	0.657									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																																								0			GRCh37	CM062599	ENG	M							86.0	62.0	70.0					9																	130578263		2203	4298	6501	SO:0001583	missense	0	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.1811C>A	9.37:g.130578263G>T	ENSP00000362299:p.Ala604Asp		Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	pfam_ZP_dom	p.A604D	ENST00000373203.4	37	c.1811	CCDS48029.1	9	.	.	.	.	.	.	.	.	.	.	G	24.9	4.585540	0.86748	.	.	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345;ENST00000546301	T;T	0.54479	0.57;1.13	5.29	5.29	0.74685	.	0.070853	0.56097	D	0.000026	T	0.61311	0.2337	L	0.36672	1.1	0.48135	D	0.999595	D;D	0.71674	0.998;0.998	P;P	0.61477	0.889;0.889	T	0.64647	-0.6358	10	0.87932	D	0	-6.8413	16.0477	0.80731	0.0:0.0:1.0:0.0	.	604;604	Q5T9B9;P17813	.;EGLN_HUMAN	D	604;604;604;422	ENSP00000362299:A604D;ENSP00000341917:A604D	ENSP00000341917:A604D	A	-	2	0	ENG	129618084	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.143000	0.58051	2.482000	0.83794	0.462000	0.41574	GCC	ENG	-	NULL	ENSG00000106991		0.657	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENG	HGNC	protein_coding	OTTHUMT00000054313.1	-	0.00	46	0	G			130578263	-1	tier1	-	no_errors	ENST00000373203	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	T
AC026700.1	0	genome.wustl.edu	37	5	84823943	84823944	+	RNA	DEL	CA	CA	-	rs537929167|rs368649367	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:84823943_84823944delCA	ENST00000401134.1	-	0	8_9																											catgcacatgcacacacacaca	0.337																																																	0																																												0																															5.37:g.84823953_84823954delCA				RNA	DEL	-	NULL	ENST00000401134.1	37	NULL		5																																																																																			AC026700.1	-	-	ENSG00000215953		0.337	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	Clone_based_ensembl_gene	miRNA			0.00	50	0	CA			84823944	-1	tier1		no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	11.54	23	3	DEL	0.030:0.032	-
CDC27	996	genome.wustl.edu	37	17	45195869	45195869	+	3'UTR	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:45195869G>C	ENST00000066544.3	-	0	5000				AC002558.1_ENST00000408089.1_RNA	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						TATGTATATAGATGTAttaag	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.*2432C>G	17.37:g.45195869G>C			G3V1C4|Q16349|Q96F35	RNA	SNP	-	NULL	ENST00000066544.3	37	NULL	CCDS11509.1	17																																																																																			AC002558.1	-	-	ENSG00000221016		0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	ENSG00000221016	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000389742.2	-	0.00	44	0	G			45195869	+1	tier1	-	no_errors	ENST00000408089	ensembl	human	novel	74_37	rna	50.00	17	17	SNP	0.000	C
MGAM2	93432	genome.wustl.edu	37	7	141867247	141867247	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:141867247G>A	ENST00000477922.3	+	26	3042	c.2988G>A	c.(2986-2988)ctG>ctA	p.L996L																	endometrium(1)|lung(5)	6						TCCTCCACCTGAAAGTGATCT	0.502																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000477922.3:c.2988G>A	7.37:g.141867247G>A				Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.L996	ENST00000477922.3	37	c.2988		7																																																																																			RP11-1220K2.2	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000257743		0.502	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	Clone_based_vega_gene	protein_coding	OTTHUMT00000351325.3	-	0.00	36	0	G			141867247	+1	tier1	-	no_errors	ENST00000477922	ensembl	human	putative	74_37	silent	42.50	23	17	SNP	0.144	A
RP11-26F2.1	0	genome.wustl.edu	37	15	23128493	23128493	+	RNA	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:23128493C>T	ENST00000560053.1	-	0	273																											TCAGTCAACTCATTGTAAAAC	0.333																																																	0																																												0																															15.37:g.23128493C>T				RNA	SNP	-	NULL	ENST00000560053.1	37	NULL		15																																																																																			RP11-26F2.1	-	-	ENSG00000259480		0.333	RP11-26F2.1-002	KNOWN	basic	processed_transcript	ENSG00000259480	Clone_based_vega_gene	pseudogene	OTTHUMT00000415904.1	-	0.00	52	0	C			23128493	-1	tier1	-	no_errors	ENST00000560053	ensembl	human	known	74_37	rna	38.00	31	19	SNP	1.000	T
CCNC	892	genome.wustl.edu	37	6	100016540	100016540	+	5'UTR	SNP	G	G	A	rs532788052		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:100016540G>A	ENST00000520429.1	-	0	309				CCNC_ENST00000482541.2_5'Flank|CCNC_ENST00000518714.1_5'Flank|CCNC_ENST00000521017.1_5'Flank|CCNC_ENST00000369220.4_5'Flank|RP1-199J3.7_ENST00000607332.1_RNA|CCNC_ENST00000523985.1_5'Flank|CCNC_ENST00000520371.1_5'UTR|CCNC_ENST00000523799.1_Intron	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C						gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)							all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		CGGCGACGGCGAAAGGAAGAG	0.662													G|||	1	0.000199681	0.0	0.0	5008	,	,		12981	0.001		0.0	False		,,,				2504	0.0				GBM(57;273 1020 40094 44454 49348)												0																																										SO:0001623	5_prime_UTR_variant	0				CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.-137C>T	6.37:g.100016540G>A			B4DPZ1|Q9H543	RNA	SNP	-	NULL	ENST00000520429.1	37	NULL	CCDS34502.1	6																																																																																			RP1-199J3.7	-	-	ENSG00000272017		0.662	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000272017	Clone_based_vega_gene	protein_coding	OTTHUMT00000041613.2	-	0.00	38	0	G	NM_005190		100016540	+1	tier1	-	no_errors	ENST00000607332	ensembl	human	known	74_37	rna	28.26	33	13	SNP	0.000	A
EPB41L3	23136	genome.wustl.edu	37	18	5406961	5406961	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr18:5406961C>A	ENST00000341928.2	-	16	2504	c.2164G>T	c.(2164-2166)Gaa>Taa	p.E722*	EPB41L3_ENST00000544123.1_Nonsense_Mutation_p.E553*|EPB41L3_ENST00000342933.3_Nonsense_Mutation_p.E722*|EPB41L3_ENST00000400111.3_Nonsense_Mutation_p.E541*|EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000540638.2_Nonsense_Mutation_p.E541*|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	722	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TGAGTTTTTTCTAGCTCCTAT	0.348																																																	0													160.0	138.0	146.0					18																	5406961		2203	4300	6503	SO:0001587	stop_gained	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2164G>T	18.37:g.5406961C>A	ENSP00000343158:p.Glu722*		B7Z4I5|F5GX05|O95713|Q9BRP5	Nonsense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.E722*	ENST00000341928.2	37	c.2164	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	C	41	8.973714	0.99021	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	.	.	.	5.66	5.66	0.87406	.	0.324869	0.35436	N	0.003215	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	19.7538	0.96281	0.0:1.0:0.0:0.0	.	.	.	.	X	722;432;553;432;722;541	.	ENSP00000343158:E722X	E	-	1	0	EPB41L3	5396961	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.359000	0.66074	2.690000	0.91761	0.655000	0.94253	GAA	EPB41L3	-	pirsf_Band_41_protein,pfam_SAB_dom	ENSG00000082397		0.348	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	-	0.00	100	0	C	NM_012307		5406961	-1	tier1	-	no_errors	ENST00000341928	ensembl	human	known	74_37	nonsense	30.30	69	30	SNP	1.000	A
EPB41L3	23136	genome.wustl.edu	37	18	5488869	5488869	+	Intron	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr18:5488869C>T	ENST00000341928.2	-	2	524				EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000342933.3_Intron|EPB41L3_ENST00000400111.3_Intron|EPB41L3_ENST00000540638.2_Intron	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						acattttcatctgcctgggGC	0.453																																																	0																																										SO:0001627	intron_variant	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.183+130G>A	18.37:g.5488869C>T			B7Z4I5|F5GX05|O95713|Q9BRP5	RNA	SNP	-	NULL	ENST00000341928.2	37	NULL	CCDS11838.1	18																																																																																			EPB41L3	-	-	ENSG00000082397		0.453	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	-	0.00	16	0	C	NM_012307		5488869	-1	tier1	-	no_errors	ENST00000581454	ensembl	human	known	74_37	rna	36.36	7	4	SNP	0.011	T
EPHA10	284656	genome.wustl.edu	37	1	38201051	38201051	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:38201051C>T	ENST00000373048.4	-	6	1368	c.1369G>A	c.(1369-1371)Gag>Aag	p.E457K	Y_RNA_ENST00000363551.1_RNA|EPHA10_ENST00000446149.2_5'UTR|EPHA10_ENST00000427468.2_Missense_Mutation_p.E457K|EPHA10_ENST00000330210.7_5'UTR|EPHA10_ENST00000540011.1_5'UTR	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	457	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)			NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				ATCTCATCCTCCTCCCAGGGC	0.672																																																	0													22.0	23.0	23.0					1																	38201051		1968	4165	6133	SO:0001583	missense	0			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.1369G>A	1.37:g.38201051C>T	ENSP00000362139:p.Glu457Lys		A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.E457K	ENST00000373048.4	37	c.1369	CCDS41305.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538283	0.85917	.	.	ENSG00000183317	ENST00000427468;ENST00000373048	T;T	0.53423	0.62;0.62	4.14	4.14	0.48551	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.35739	N	0.003015	T	0.38026	0.1025	L	0.36672	1.1	0.80722	D	1	B	0.22003	0.063	B	0.18871	0.023	T	0.37798	-0.9690	10	0.87932	D	0	.	12.0986	0.53769	0.0:1.0:0.0:0.0	.	457	Q5JZY3	EPHAA_HUMAN	K	457	ENSP00000397746:E457K;ENSP00000362139:E457K	ENSP00000362139:E457K	E	-	1	0	EPHA10	37973638	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	2.421000	0.44688	2.324000	0.78689	0.561000	0.74099	GAG	EPHA10	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000183317		0.672	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	HGNC	protein_coding	OTTHUMT00000012497.2	-	0.00	42	0	C	NM_173641		38201051	-1	tier1	-	no_errors	ENST00000427468	ensembl	human	known	74_37	missense	32.61	31	15	SNP	1.000	T
EWSR1	2130	genome.wustl.edu	37	22	29678390	29678390	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:29678390G>C	ENST00000397938.2	+	6	744	c.425G>C	c.(424-426)gGa>gCa	p.G142A	EWSR1_ENST00000332050.6_Missense_Mutation_p.G142A|EWSR1_ENST00000406548.1_Missense_Mutation_p.G142A|EWSR1_ENST00000331029.7_Missense_Mutation_p.G142A|EWSR1_ENST00000332035.6_Intron|EWSR1_ENST00000414183.2_Missense_Mutation_p.G148A|EWSR1_ENST00000333395.6_Missense_Mutation_p.G142A	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	142	31 X approximate tandem repeats.|EAD (Gln/Pro/Thr-rich).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						CCGCAGGATGGAAACAAGCCC	0.423			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																			Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	0													40.0	33.0	36.0					22																	29678390		2203	4300	6503	SO:0001583	missense	0				CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.425G>C	22.37:g.29678390G>C	ENSP00000381031:p.Gly142Ala		B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfam_RRM_dom,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.G148A	ENST00000397938.2	37	c.443	CCDS13851.1	22	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595874	0.46318	.	.	ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000436425;ENST00000447973;ENST00000406548;ENST00000437155;ENST00000415761;ENST00000331029;ENST00000414183;ENST00000333395	D;D;D;D;D	0.98345	-4.24;-3.64;-3.63;-4.88;-3.88	4.99	4.99	0.66335	.	0.204722	0.31134	U	0.008190	D	0.98611	0.9535	M	0.69358	2.11	0.49798	D	0.999829	D;D;D;D	0.76494	0.996;0.999;0.996;0.998	D;D;D;D	0.83275	0.91;0.996;0.91;0.959	D	0.98660	1.0683	10	0.27082	T	0.32	.	18.2114	0.89871	0.0:0.0:1.0:0.0	.	142;148;142;142	Q96FE8;Q96MX4;Q01844;Q9BWA2	.;.;EWS_HUMAN;.	A	142;142;149;148;142;143;67;142;148;142	ENSP00000330896:G142A;ENSP00000381031:G142A;ENSP00000385726:G142A;ENSP00000330516:G142A;ENSP00000400142:G148A	ENSP00000330516:G142A	G	+	2	0	EWSR1	28008390	1.000000	0.71417	1.000000	0.80357	0.519000	0.34347	5.178000	0.65037	2.454000	0.82982	0.557000	0.71058	GGA	EWSR1	-	NULL	ENSG00000182944		0.423	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EWSR1	HGNC	protein_coding	OTTHUMT00000321345.1	-	0.00	56	0	G	NM_005243		29678390	+1	tier1	-	no_errors	ENST00000414183	ensembl	human	known	74_37	missense	27.45	37	14	SNP	1.000	C
FAM183B	340286	genome.wustl.edu	37	7	38725305	38725305	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:38725305C>T	ENST00000409072.3	-	2	1235	c.301G>A	c.(301-303)Gac>Aac	p.D101N				Q6ZVS7	F183B_HUMAN	family with sequence similarity 183, member B	101										endometrium(1)|lung(7)	8						CGTTCTGGGTCGACCAAGGCT	0.522																																																	0													173.0	174.0	174.0					7																	38725305		1988	4162	6150	SO:0001583	missense	0			AK124132, BC045803		7p14.1	2008-08-11			ENSG00000164556	ENSG00000164556			34511	protein-coding gene	gene with protein product							Standard	NR_028347		Approved	LOC340286	uc011kbd.2	Q6ZVS7	OTTHUMG00000153653	ENST00000409072.3:c.301G>A	7.37:g.38725305C>T	ENSP00000386657:p.Asp101Asn		A4D1Y1	Missense_Mutation	SNP	NULL	p.D101N	ENST00000409072.3	37	c.301		7	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.872355	0.00542	.	.	ENSG00000164556	ENST00000409072	.	.	.	0.962	-0.263	0.12954	.	0.824441	0.10942	N	0.617119	T	0.09642	0.0237	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33497	-0.9866	6	0.06099	T	0.92	.	2.8796	0.05642	0.0:0.3828:0.0:0.6172	.	.	.	.	N	101	.	ENSP00000386657:D101N	D	-	1	0	FAM183B	38691830	0.008000	0.16893	0.004000	0.12327	0.003000	0.03518	-0.039000	0.12124	-0.116000	0.11893	-0.471000	0.05019	GAC	FAM183B	-	NULL	ENSG00000164556		0.522	FAM183B-001	NOVEL	basic|appris_principal	protein_coding	FAM183B	HGNC	protein_coding	OTTHUMT00000331972.1	-	0.00	57	0	C	NM_001105282		38725305	-1	tier1	-	no_errors	ENST00000409072	ensembl	human	novel	74_37	missense	28.38	53	21	SNP	0.027	T
FAM230A	653203	genome.wustl.edu	37	22	20708800	20708800	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:20708800G>A	ENST00000434783.3	+	8	716	c.532G>A	c.(532-534)Gag>Aag	p.E178K	USP41_ENST00000486536.2_Intron|USP41_ENST00000454608.2_Intron					family with sequence similarity 230, member A																		CATCGCTAACGAGGATGCCGC	0.617																																																	0																																										SO:0001583	missense	0			JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.532G>A	22.37:g.20708800G>A	ENSP00000463576:p.Glu178Lys			Missense_Mutation	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.E178K	ENST00000434783.3	37	c.532		22																																																																																			FAM230A	-	superfamily_Kinase-like_dom	ENSG00000188280		0.617	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	-	0.00	91	0	G			20708800	+1	tier1	-	no_errors	ENST00000434783	ensembl	human	known	74_37	missense	40.16	73	49	SNP	0.000	A
FAM46B	115572	genome.wustl.edu	37	1	27333125	27333125	+	Silent	SNP	G	G	A	rs143879440		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:27333125G>A	ENST00000289166.5	-	2	753	c.588C>T	c.(586-588)agC>agT	p.S196S		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	196										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		CGTTCTTGCCGCTCTTGTTGG	0.532																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	136.0	130.0	132.0		588	-2.5	0.9	1	dbSNP_134	132	0,8600		0,0,4300	no	coding-synonymous	FAM46B	NM_052943.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		196/426	27333125	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.588C>T	1.37:g.27333125G>A				Silent	SNP	pfam_DUF1693	p.S196	ENST00000289166.5	37	c.588	CCDS294.2	1																																																																																			FAM46B	-	pfam_DUF1693	ENSG00000158246		0.532	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46B	HGNC	protein_coding	OTTHUMT00000012347.2		0.00	22	0	G	NM_052943		27333125	-1			no_errors	ENST00000289166	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.741	A
FAM90A27P	646508	genome.wustl.edu	37	19	53787529	53787529	+	RNA	SNP	C	C	G	rs556817022	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:53787529C>G	ENST00000599085.1	+	0	423					NR_046365.1		A6NNH2	F90AR_HUMAN	family with sequence similarity 90, member A27, pseudogene								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)										CCATGGTGCTCTCCAGCCTGC	0.602																																																	0																																												0					19q13.42	2014-03-18			ENSG00000189348	ENSG00000189348			43617	pseudogene	pseudogene							Standard	NR_046365		Approved		uc031rmv.1	A6NNH2	OTTHUMG00000182909		19.37:g.53787529C>G				RNA	SNP	-	NULL	ENST00000599085.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	C	6.643	0.487201	0.12641	.	.	ENSG00000189348	ENST00000338885	.	.	.	1.93	1.93	0.25924	.	1.957620	0.02652	N	0.106545	T	0.40791	0.1131	.	.	.	0.20403	N	0.999902	.	.	.	.	.	.	T	0.43196	-0.9406	5	0.49607	T	0.09	.	7.3623	0.26754	0.0:1.0:0.0:0.0	.	.	.	.	V	238	.	ENSP00000341223:L238V	L	+	1	0	AC092070.1	58479341	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	1.475000	0.35409	1.394000	0.46624	0.462000	0.41574	CTC	FAM90A27P	-	-	ENSG00000189348		0.602	FAM90A27P-002	KNOWN	basic	processed_transcript	FAM90A27P	HGNC	pseudogene	OTTHUMT00000464290.1	-	0.00	36	0	C	NR_046365		53787529	+1	tier1	-	no_errors	ENST00000599085	ensembl	human	known	74_37	rna	34.55	36	19	SNP	0.001	G
FER1L6	654463	genome.wustl.edu	37	8	125033904	125033904	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:125033904G>A	ENST00000522917.1	+	17	2334	c.2128G>A	c.(2128-2130)Gat>Aat	p.D710N	FER1L6_ENST00000399018.1_Missense_Mutation_p.D710N|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	710						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CTTTCTTGTTGATGAGGTAAC	0.413																																																	0													82.0	78.0	79.0					8																	125033904		1878	4107	5985	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2128G>A	8.37:g.125033904G>A	ENSP00000428280:p.Asp710Asn			Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.D710N	ENST00000522917.1	37	c.2128	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582689	0.86748	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81579	-1.51;-1.51	5.77	5.77	0.91146	.	0.316602	0.26485	U	0.024101	D	0.88518	0.6458	M	0.77820	2.39	0.54753	D	0.999981	D	0.71674	0.998	P	0.61722	0.893	D	0.85941	0.1458	10	0.27785	T	0.31	.	18.7507	0.91814	0.0:0.0:1.0:0.0	.	710	Q2WGJ9	FR1L6_HUMAN	N	710	ENSP00000428280:D710N;ENSP00000381982:D710N	ENSP00000381982:D710N	D	+	1	0	FER1L6	125103085	1.000000	0.71417	0.997000	0.53966	0.564000	0.35744	8.011000	0.88624	2.727000	0.93392	0.591000	0.81541	GAT	FER1L6	-	NULL	ENSG00000214814		0.413	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	-	0.00	31	0	G	NM_001039112		125033904	+1	tier1	-	no_errors	ENST00000399018	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	A
FLNA	2316	genome.wustl.edu	37	X	153589759	153589759	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:153589759C>A	ENST00000369850.3	-	21	3360	c.3124G>T	c.(3124-3126)Gag>Tag	p.E1042*	FLNA_ENST00000344736.4_Nonsense_Mutation_p.E1042*|FLNA_ENST00000360319.4_Nonsense_Mutation_p.E1042*|FLNA_ENST00000422373.1_Nonsense_Mutation_p.E1042*	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1042					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACCTCCACCTCATAGGGCCCT	0.657																																																	0													57.0	60.0	59.0					X																	153589759		2092	4186	6278	SO:0001587	stop_gained	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3124G>T	X.37:g.153589759C>A	ENSP00000358866:p.Glu1042*		E9KL45|Q5HY53|Q5HY55|Q8NF52	Nonsense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E1042*	ENST00000369850.3	37	c.3124	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	44	10.653819	0.99445	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	.	.	.	5.51	4.62	0.57501	.	0.144833	0.45126	D	0.000386	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	15.3065	0.73995	0.0:0.8632:0.1368:0.0	.	.	.	.	X	1042;1015;1042;1042;1042	.	ENSP00000358863:E1042X	E	-	1	0	FLNA	153242953	0.001000	0.12720	0.895000	0.35142	0.978000	0.69477	-0.013000	0.12678	1.053000	0.40415	0.523000	0.50628	GAG	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.657	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	-	0.00	37	0	C			153589759	-1	tier1	-	no_errors	ENST00000369850	ensembl	human	known	74_37	nonsense	18.84	56	13	SNP	0.952	A
FOLH1	2346	genome.wustl.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H|FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																																	1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.R281H	ENST00000256999.2	37	c.842	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	FOLH1	-	NULL	ENSG00000086205		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	44	0	C	NM_004476		49204779	-1	tier1	rs116795343	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.843	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000343844.4_5'UTR	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																																	0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	39	0	A	NM_004476		49204790	-1	tier1	rs76509850	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	18.42	31	7	SNP	1.000	G
FREM3	166752	genome.wustl.edu	37	4	144614357	144614358	+	Splice_Site	INS	-	-	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:144614357_144614358insA	ENST00000329798.5	-	2	5185		c.e2-2			NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3						cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CAATGTCAGCTAAAAAAAAAGC	0.337																																																	0																																										SO:0001630	splice_region_variant	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.5186-2->T	4.37:g.144614366_144614366dupA				Splice_Site	INS	-	e2-2	ENST00000329798.5	37	c.5186-3_5186-2	CCDS54808.1	4																																																																																			FREM3	-	-	ENSG00000183090		0.337	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1		0.00	42	0	-	XM_094074	Intron	144614358	-1	tier1		no_errors	ENST00000329798	ensembl	human	putative	74_37	splice_site_ins	13.33	13	2	INS	1.000:0.000	A
FUT3	2525	genome.wustl.edu	37	19	5844652	5844652	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:5844652G>T	ENST00000303225.6	-	3	833	c.199C>A	c.(199-201)Cta>Ata	p.L67I	FUT3_ENST00000593144.1_5'Flank|FUT3_ENST00000458379.2_Missense_Mutation_p.L67I|AC024592.9_ENST00000589276.1_RNA|FUT3_ENST00000589620.1_Missense_Mutation_p.L67I|FUT3_ENST00000589918.1_Missense_Mutation_p.L67I	NM_000149.3	NP_000140	P21217	FUT3_HUMAN	fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group)	67					cell-cell recognition (GO:0009988)|fucosylation (GO:0036065)|macromolecule glycosylation (GO:0043413)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(1)	14						CATGTCCGTAGCAGGATCAGG	0.647																																					Esophageal Squamous(82;745 1728 24593 44831)												0													48.0	49.0	49.0					19																	5844652		2203	4300	6503	SO:0001583	missense	0				CCDS12153.1	19p13.3	2014-07-19	2006-01-12		ENSG00000171124	ENSG00000171124	2.4.1.65	"""CD molecules"", ""Blood group antigens"", ""Fucosyltransferases"""	4014	protein-coding gene	gene with protein product		111100	"""fucosyltransferase 3 (galactoside 3(4)-L-fucosyltransferase, Lewis blood group included)"""	LE		1977660, 1740457	Standard	NM_000149		Approved	CD174	uc002mdk.2	P21217	OTTHUMG00000180614	ENST00000303225.6:c.199C>A	19.37:g.5844652G>T	ENSP00000305603:p.Leu67Ile		B5U7U9|B5U7V0|Q32NE7|Q99448|Q99449	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.L67I	ENST00000303225.6	37	c.199	CCDS12153.1	19	.	.	.	.	.	.	.	.	.	.	G	14.94	2.683909	0.47991	.	.	ENSG00000171124	ENST00000303225;ENST00000458379	T;T	0.27557	1.66;1.66	2.33	2.33	0.28932	.	0.000000	0.46145	D	0.000319	T	0.41488	0.1161	L	0.51853	1.615	0.32133	N	0.586525	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.91635	0.998;0.998;0.999;0.998	T	0.43294	-0.9400	10	0.28530	T	0.3	.	6.7649	0.23560	0.0:0.0:0.721:0.279	.	67;67;67;67	B3W6H0;A8K737;B3GVC1;P21217	.;.;.;FUT3_HUMAN	I	67	ENSP00000305603:L67I;ENSP00000416443:L67I	ENSP00000305603:L67I	L	-	1	2	FUT3	5795652	0.996000	0.38824	0.491000	0.27477	0.089000	0.18198	1.098000	0.31000	1.225000	0.43566	0.205000	0.17691	CTA	FUT3	-	pfam_Glyco_trans_10	ENSG00000171124		0.647	FUT3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FUT3	HGNC	protein_coding	OTTHUMT00000452204.1		0.00	16	0	G	NM_000149		5844652	-1			no_errors	ENST00000303225	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
GART	2618	genome.wustl.edu	37	21	34903861	34903861	+	Missense_Mutation	SNP	C	C	G	rs142038738		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr21:34903861C>G	ENST00000381831.3	-	6	794	c.531G>C	c.(529-531)gaG>gaC	p.E177D	GART_ENST00000381839.3_Missense_Mutation_p.E177D|GART_ENST00000381815.4_Missense_Mutation_p.E177D|GART_ENST00000497313.1_5'UTR|GART_ENST00000361093.5_Missense_Mutation_p.E177D	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	177	ATP-grasp.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CAAAGGCTTTCTCCTGATTGT	0.328																																																	0													100.0	101.0	101.0					21																	34903861		2203	4300	6503	SO:0001583	missense	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.531G>C	21.37:g.34903861C>G	ENSP00000371253:p.Glu177Asp		A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Missense_Mutation	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C_dom,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth_N_dom,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.E177D	ENST00000381831.3	37	c.531	CCDS13627.1	21	.	.	.	.	.	.	.	.	.	.	C	5.106	0.205160	0.09704	.	.	ENSG00000159131	ENST00000381815;ENST00000381831;ENST00000381839;ENST00000361093;ENST00000430874;ENST00000426819	T;T;T;T;T;T	0.44482	1.53;1.53;1.53;1.54;0.94;0.92	6.07	-3.18	0.05186	ATP-grasp fold (1);ATP-grasp fold, subdomain 1 (1);Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain (1);	0.172604	0.64402	N	0.000009	T	0.09818	0.0241	N	0.01003	-1.06	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09618	-1.0666	10	0.33141	T	0.24	-6.3852	0.8613	0.01194	0.4025:0.2436:0.1422:0.2117	.	177	P22102	PUR2_HUMAN	D	177	ENSP00000371236:E177D;ENSP00000371253:E177D;ENSP00000371261:E177D;ENSP00000354388:E177D;ENSP00000413040:E177D;ENSP00000398631:E177D	ENSP00000354388:E177D	E	-	3	2	GART	33825731	0.902000	0.30710	0.936000	0.37596	0.897000	0.52465	0.030000	0.13688	-0.809000	0.04381	0.650000	0.86243	GAG	GART	-	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth	ENSG00000159131		0.328	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3	-	0.00	8	0	C	NM_000819		34903861	-1	tier1	-	no_errors	ENST00000381815	ensembl	human	known	74_37	missense	30.77	9	4	SNP	0.979	G
GCFC2	6936	genome.wustl.edu	37	2	75929334	75929334	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:75929334C>T	ENST00000321027.3	-	3	743	c.610G>A	c.(610-612)Gag>Aag	p.E204K	GCFC2_ENST00000409857.3_Intron|GCFC2_ENST00000541687.1_Missense_Mutation_p.E204K|GCFC2_ENST00000470503.1_Missense_Mutation_p.E204K	NM_001201334.1|NM_003203.4	NP_001188263.1|NP_003194.3	P16383	GCFC2_HUMAN	GC-rich sequence DNA-binding factor 2	204					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)										CTTGATTCCTCAGCCATCCTT	0.353																																																	0													166.0	156.0	159.0					2																	75929334		2203	4300	6503	SO:0001583	missense	0			AB026911	CCDS1961.1, CCDS62943.1	2p12	2014-01-17	2011-11-24	2011-11-24	ENSG00000005436	ENSG00000005436			1317	protein-coding gene	gene with protein product	"""GC binding factor"""	189901	"""transcription factor 9 (binds GC-rich sequences)"", ""chromosome 2 open reading frame 3"""	TCF9, C2orf3		1370479, 2556218, 17309879, 24304693	Standard	NM_003203		Approved	DNABF, GCF	uc002sno.3	P16383	OTTHUMG00000129989	ENST00000321027.3:c.610G>A	2.37:g.75929334C>T	ENSP00000318690:p.Glu204Lys		A4UHQ8|O95032|Q53TY0|Q6P2F2	Missense_Mutation	SNP	pfam_GCFC_dom	p.E204K	ENST00000321027.3	37	c.610	CCDS1961.1	2	.	.	.	.	.	.	.	.	.	.	C	14.28	2.487168	0.44249	.	.	ENSG00000005436	ENST00000321027;ENST00000541687	T;T	0.38077	2.3;1.16	4.85	3.97	0.46021	.	0.470389	0.22051	N	0.065308	T	0.32406	0.0828	M	0.71581	2.175	0.43761	D	0.996275	P;B	0.36144	0.539;0.079	B;B	0.26202	0.067;0.021	T	0.13548	-1.0505	10	0.29301	T	0.29	-7.5985	11.5532	0.50733	0.0:0.9095:0.0:0.0905	.	204;204	A4UHQ8;P16383	.;GCF_HUMAN	K	204	ENSP00000318690:E204K;ENSP00000437767:E204K	ENSP00000318690:E204K	E	-	1	0	C2orf3	75782842	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	4.121000	0.57904	1.358000	0.45922	0.591000	0.81541	GAG	GCFC2	-	NULL	ENSG00000005436		0.353	GCFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC2	HGNC	protein_coding	OTTHUMT00000252255.2	-	0.00	53	0	C	NM_003203		75929334	-1	tier1	-	no_errors	ENST00000321027	ensembl	human	known	74_37	missense	30.16	44	19	SNP	1.000	T
GGTA1P	2681	genome.wustl.edu	37	9	124241446	124241446	+	RNA	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:124241446G>A	ENST00000495328.1	-	0	274							Q4G0N0	GGTA1_HUMAN	glycoprotein, alpha-galactosyltransferase 1 pseudogene						glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|protein galactosylation at cell surface (GO:0033580)	anchored component of external side of plasma membrane (GO:0031362)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|transferase activity, transferring hexosyl groups (GO:0016758)										AGAGTTTAGGGCGATCCACCC	0.532																																																	0																																												0					9q33.2	2011-05-04	2010-03-19	2011-05-04	ENSG00000204136	ENSG00000204136			4253	pseudogene	pseudogene		104175	"""glycoprotein, alpha-galactosyltransferase 1"""	GLYT2, GGTA, GGTA1		1559713, 2108966	Standard	NR_003191		Approved		uc004bll.1	Q4G0N0	OTTHUMG00000020592		9.37:g.124241446G>A			A2JVH9	RNA	SNP	-	NULL	ENST00000495328.1	37	NULL		9																																																																																			GGTA1P	-	-	ENSG00000204136		0.532	GGTA1P-003	KNOWN	basic	processed_transcript	GGTA1P	HGNC	pseudogene	OTTHUMT00000337174.1	-	0.00	20	0	G	NR_003191		124241446	-1	tier1	-	no_errors	ENST00000373793	ensembl	human	known	74_37	rna	28.57	15	6	SNP	0.002	A
GLIS1	148979	genome.wustl.edu	37	1	53980335	53980335	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:53980335G>C	ENST00000312233.2	-	7	1887	c.1321C>G	c.(1321-1323)Ctg>Gtg	p.L441V		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						AGAGGGGACAGATGGTGGTGG	0.667																																																	0													99.0	101.0	100.0					1																	53980335		2203	4300	6503	SO:0001583	missense	0			AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1321C>G	1.37:g.53980335G>C	ENSP00000309653:p.Leu441Val			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L441V	ENST00000312233.2	37	c.1321	CCDS582.1	1	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342905	0.41498	.	.	ENSG00000174332	ENST00000312233	T	0.12039	2.72	4.97	4.03	0.46877	.	0.170789	0.28161	N	0.016376	T	0.12178	0.0296	L	0.32530	0.975	0.29966	N	0.81893	D	0.57257	0.979	P	0.46718	0.525	T	0.05225	-1.0898	10	0.30854	T	0.27	.	7.9569	0.30049	0.0841:0.0:0.7543:0.1616	.	441	Q8NBF1	GLIS1_HUMAN	V	441	ENSP00000309653:L441V	ENSP00000309653:L441V	L	-	1	2	GLIS1	53752923	1.000000	0.71417	0.992000	0.48379	0.921000	0.55340	3.161000	0.50747	1.367000	0.46095	0.563000	0.77884	CTG	GLIS1	-	NULL	ENSG00000174332		0.667	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	HGNC	protein_coding	OTTHUMT00000022109.1	-	0.00	51	0	G	NM_147193		53980335	-1	tier1	-	no_errors	ENST00000312233	ensembl	human	known	74_37	missense	29.63	38	16	SNP	0.994	C
GLRA2	2742	genome.wustl.edu	37	X	14627271	14627271	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:14627271A>T	ENST00000218075.4	+	7	1404	c.874A>T	c.(874-876)Acc>Tcc	p.T292S	GLRA2_ENST00000443437.2_Missense_Mutation_p.T203S|GLRA2_ENST00000355020.4_Missense_Mutation_p.T292S	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	292					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	ACTGGGCATCACCACAGTCTT	0.478																																																	0													85.0	83.0	84.0					X																	14627271		2203	4300	6503	SO:0001583	missense	0				CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.874A>T	X.37:g.14627271A>T	ENSP00000218075:p.Thr292Ser		A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A2,prints_Neur_channel,tigrfam_Neur_channel	p.T292S	ENST00000218075.4	37	c.874	CCDS14160.1	X	.	.	.	.	.	.	.	.	.	.	A	26.6	4.752181	0.89753	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020	D;D;D	0.86769	-2.17;-2.17;-2.17	5.4	5.4	0.78164	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.92825	0.7718	M	0.74467	2.265	0.80722	D	1	D;D;D	0.89917	0.987;0.979;1.0	D;D;D	0.78314	0.946;0.973;0.991	D	0.93642	0.6965	10	0.87932	D	0	.	14.5375	0.67971	1.0:0.0:0.0:0.0	.	276;292;292	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	S	203;292;292	ENSP00000387756:T203S;ENSP00000218075:T292S;ENSP00000347123:T292S	ENSP00000218075:T292S	T	+	1	0	GLRA2	14537192	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	9.248000	0.95456	1.813000	0.52934	0.486000	0.48141	ACC	GLRA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000101958		0.478	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA2	HGNC	protein_coding	OTTHUMT00000055829.1	-	0.00	14	0	A			14627271	+1	tier1	-	no_errors	ENST00000218075	ensembl	human	known	74_37	missense	66.67	10	20	SNP	1.000	T
GPATCH3	63906	genome.wustl.edu	37	1	27216261	27216261	+	IGR	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:27216261G>A	ENST00000361720.5	-	0	2123				GPN2_ENST00000374135.4_Silent_p.F109F|GPN2_ENST00000461282.1_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3								nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		CTGGGCAGTCGAAGAGGAAGT	0.662																																																	0													60.0	62.0	61.0					1																	27216261		2203	4300	6503	SO:0001628	intergenic_variant	0			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229		1.37:g.27216261G>A			Q5JYH2|Q8NDJ2|Q9H9Z3	Silent	SNP	pfam_Uncharacterised_ATP-bd,superfamily_P-loop_NTPase	p.F109	ENST00000361720.5	37	c.327	CCDS290.1	1																																																																																			GPN2	-	pfam_Uncharacterised_ATP-bd,superfamily_P-loop_NTPase	ENSG00000142751		0.662	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPN2	HGNC	protein_coding	OTTHUMT00000012181.1	-	0.00	107	0	G	NM_022078		27216261	-1	tier1	-	no_errors	ENST00000374135	ensembl	human	known	74_37	silent	36.30	86	49	SNP	1.000	A
GRAP2	9402	genome.wustl.edu	37	22	40365485	40365485	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:40365485C>A	ENST00000344138.4	+	7	1024	c.761C>A	c.(760-762)gCg>gAg	p.A254E	GRAP2_ENST00000544756.1_Missense_Mutation_p.A182E|GRAP2_ENST00000399090.2_Missense_Mutation_p.A141E|GRAP2_ENST00000540310.1_Missense_Mutation_p.A188E|GRAP2_ENST00000543252.1_Missense_Mutation_p.A214E|GRAP2_ENST00000407075.3_Missense_Mutation_p.A254E	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	254					cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GAAATGAATGCGGCCCTCATG	0.572																																																	0													122.0	101.0	108.0					22																	40365485		2203	4300	6503	SO:0001583	missense	0			AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.761C>A	22.37:g.40365485C>A	ENSP00000339186:p.Ala254Glu		B7Z8I3|O43726|Q9NRB7	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.A254E	ENST00000344138.4	37	c.761	CCDS13999.1	22	.	.	.	.	.	.	.	.	.	.	C	11.20	1.568007	0.28003	.	.	ENSG00000100351	ENST00000344138;ENST00000543252;ENST00000544006;ENST00000540310;ENST00000544756;ENST00000399090;ENST00000407075	T;T;T;T;T;T	0.74842	-0.36;-0.88;1.48;0.91;0.66;-0.36	5.69	5.69	0.88448	.	0.603639	0.17228	N	0.182044	T	0.73179	0.3554	L	0.29908	0.895	0.09310	N	0.999994	D;B;P;D;B	0.55800	0.965;0.36;0.925;0.973;0.36	P;B;B;P;B	0.51355	0.629;0.096;0.446;0.667;0.096	T	0.65249	-0.6214	10	0.26408	T	0.33	-9.9602	17.985	0.89153	0.0:1.0:0.0:0.0	.	141;254;188;228;254	B7Z8I3;Q6FI14;F5H548;B7Z8F8;O75791	.;.;.;.;GRAP2_HUMAN	E	254;214;228;188;182;141;254	ENSP00000339186:A254E;ENSP00000446350:A214E;ENSP00000444734:A188E;ENSP00000442195:A182E;ENSP00000382040:A141E;ENSP00000385607:A254E	ENSP00000339186:A254E	A	+	2	0	GRAP2	38695431	0.150000	0.22732	0.023000	0.16930	0.037000	0.13140	4.664000	0.61540	2.676000	0.91093	0.655000	0.94253	GCG	GRAP2	-	NULL	ENSG00000100351		0.572	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	HGNC	protein_coding	OTTHUMT00000321295.1		0.00	29	0	C	NM_004810		40365485	+1			no_errors	ENST00000344138	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.070	A
GRAMD4	23151	genome.wustl.edu	37	22	47054198	47054198	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:47054198A>G	ENST00000406902.1	+	4	611	c.398A>G	c.(397-399)aAg>aGg	p.K133R	GRAMD4_ENST00000361034.3_Missense_Mutation_p.K133R			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	133					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		GAGGTGCTGAAGGCCAGGTAC	0.697																																																	0													43.0	42.0	42.0					22																	47054198		2199	4298	6497	SO:0001583	missense	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.398A>G	22.37:g.47054198A>G	ENSP00000385689:p.Lys133Arg		A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.K133R	ENST00000406902.1	37	c.398	CCDS33672.1	22	.	.	.	.	.	.	.	.	.	.	a	13.22	2.171252	0.38315	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.46451	0.87;0.87	4.58	2.35	0.29111	.	0.167176	0.35838	N	0.002954	T	0.26629	0.0651	L	0.31926	0.97	0.41410	D	0.987736	B	0.06786	0.001	B	0.09377	0.004	T	0.06023	-1.0850	10	0.25751	T	0.34	-26.8948	6.4206	0.21742	0.7694:0.0:0.2306:0.0	.	133	Q6IC98	GRAM4_HUMAN	R	133	ENSP00000385689:K133R;ENSP00000354313:K133R	ENSP00000354313:K133R	K	+	2	0	GRAMD4	45432862	0.978000	0.34361	1.000000	0.80357	0.985000	0.73830	0.669000	0.25142	0.709000	0.31976	0.451000	0.29950	AAG	GRAMD4	-	NULL	ENSG00000075240		0.697	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1		0.00	25	0	A	NM_015124		47054198	+1			no_errors	ENST00000361034	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.997	G
GRM4	2914	genome.wustl.edu	37	6	34003781	34003781	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:34003781G>C	ENST00000538487.2	-	9	2549	c.2106C>G	c.(2104-2106)atC>atG	p.I702M	GRM4_ENST00000609222.1_Missense_Mutation_p.I569M|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000535756.1_Missense_Mutation_p.I569M|GRM4_ENST00000374177.3_Missense_Mutation_p.I586M|GRM4_ENST00000374181.4_Missense_Mutation_p.I702M|GRM4_ENST00000455714.2_Missense_Mutation_p.I562M|GRM4_ENST00000544773.2_Missense_Mutation_p.I533M	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	702					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						GGCTGAAGGTGATGGCCAGCT	0.632																																																	0													95.0	105.0	102.0					6																	34003781		2203	4300	6503	SO:0001583	missense	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.2106C>G	6.37:g.34003781G>C	ENSP00000440556:p.Ile702Met		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.I702M	ENST00000538487.2	37	c.2106	CCDS4787.1	6	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973586	0.53720	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.89485	-2.52;-2.52;-2.52;-2.52;-2.52;-2.52;-2.52	4.63	1.87	0.25490	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.91264	0.7246	M	0.84326	2.69	0.53005	D	0.99996	P;P;D;D;P	0.76494	0.951;0.76;0.999;0.998;0.863	P;P;D;D;P	0.83275	0.685;0.686;0.996;0.948;0.507	D	0.90027	0.4132	10	0.87932	D	0	.	7.4338	0.27143	0.1452:0.0:0.7202:0.1346	.	655;533;562;702;569	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	M	702;586;394;569;533;702;562	ENSP00000363296:I702M;ENSP00000363292:I586M;ENSP00000445533:I394M;ENSP00000437925:I569M;ENSP00000437730:I533M;ENSP00000440556:I702M;ENSP00000398456:I562M	ENSP00000363292:I586M	I	-	3	3	GRM4	34111759	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.891000	0.56227	0.187000	0.20147	0.462000	0.41574	ATC	GRM4	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000124493		0.632	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000040213.2	-	0.00	28	0	G			34003781	-1	tier1	-	no_errors	ENST00000374181	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	C
GRIK2	2898	genome.wustl.edu	37	6	102337692	102337692	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:102337692C>T	ENST00000421544.1	+	11	2192	c.1702C>T	c.(1702-1704)Ctg>Ttg	p.L568L	GRIK2_ENST00000369138.1_Silent_p.L568L|GRIK2_ENST00000369134.4_Silent_p.L519L|GRIK2_ENST00000369137.3_Intron|GRIK2_ENST00000413795.1_Silent_p.L568L|GRIK2_ENST00000318991.6_Silent_p.L568L	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	568					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GATGTATATTCTGCTGGCTTA	0.433																																																	0													190.0	190.0	190.0					6																	102337692		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1702C>T	6.37:g.102337692C>T			A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L568	ENST00000421544.1	37	c.1702	CCDS5048.1	6																																																																																			GRIK2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	ENSG00000164418		0.433	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	-	0.00	11	0	C			102337692	+1	tier1	-	no_errors	ENST00000421544	ensembl	human	known	74_37	silent	31.03	20	9	SNP	1.000	T
HAS2	3037	genome.wustl.edu	37	8	122626754	122626754	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:122626754G>A	ENST00000303924.4	-	4	1791	c.1254C>T	c.(1252-1254)ctC>ctT	p.L418L		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	418					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			ATGATTTTATGAGACCTACTA	0.418																																																	0													146.0	141.0	142.0					8																	122626754		2203	4300	6503	SO:0001819	synonymous_variant	0			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1254C>T	8.37:g.122626754G>A			Q32MM3	Silent	SNP	pfam_Chitin_synth_fng	p.L418	ENST00000303924.4	37	c.1254	CCDS6335.1	8																																																																																			HAS2	-	NULL	ENSG00000170961		0.418	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	HGNC	protein_coding	OTTHUMT00000381150.2	-	0.00	21	0	G	NM_005328		122626754	-1	tier1	-	no_errors	ENST00000303924	ensembl	human	known	74_37	silent	20.00	24	6	SNP	1.000	A
HAS2	3037	genome.wustl.edu	37	8	122626768	122626768	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:122626768G>A	ENST00000303924.4	-	4	1777	c.1240C>T	c.(1240-1242)Cag>Tag	p.Q414*		NM_005328.2	NP_005319.1	Q92819	HYAS2_HUMAN	hyaluronan synthase 2	414					atrioventricular canal development (GO:0036302)|bone morphogenesis (GO:0060349)|cellular response to fluid shear stress (GO:0071498)|cellular response to interleukin-1 (GO:0071347)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|cellular response to tumor necrosis factor (GO:0071356)|endocardial cushion to mesenchymal transition (GO:0090500)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|hyaluronan biosynthetic process (GO:0030213)|kidney development (GO:0001822)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of urine volume (GO:0035810)|renal water absorption (GO:0070295)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	hyaluronan synthase activity (GO:0050501)		HAS2/PLAG1(10)	breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(19)|ovary(5)|skin(1)	38	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			CCTACTAGCTGGACAGTTAAC	0.403																																																	0													143.0	138.0	140.0					8																	122626768		2203	4300	6503	SO:0001587	stop_gained	0			U54804	CCDS6335.1	8q24.12	2013-02-22			ENSG00000170961	ENSG00000170961	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4819	protein-coding gene	gene with protein product		601636				9169154	Standard	NM_005328		Approved		uc003yph.2	Q92819	OTTHUMG00000164953	ENST00000303924.4:c.1240C>T	8.37:g.122626768G>A	ENSP00000306991:p.Gln414*		Q32MM3	Nonsense_Mutation	SNP	pfam_Chitin_synth_fng	p.Q414*	ENST00000303924.4	37	c.1240	CCDS6335.1	8	.	.	.	.	.	.	.	.	.	.	G	42	9.239819	0.99110	.	.	ENSG00000170961	ENST00000303924	.	.	.	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-6.4373	20.5792	0.99380	0.0:0.0:1.0:0.0	.	.	.	.	X	414	.	ENSP00000306991:Q414X	Q	-	1	0	HAS2	122695949	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.990000	0.88215	2.873000	0.98535	0.561000	0.74099	CAG	HAS2	-	NULL	ENSG00000170961		0.403	HAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAS2	HGNC	protein_coding	OTTHUMT00000381150.2	-	0.00	24	0	G	NM_005328		122626768	-1	tier1	-	no_errors	ENST00000303924	ensembl	human	known	74_37	nonsense	26.67	22	8	SNP	1.000	A
HEATR1	55127	genome.wustl.edu	37	1	236740143	236740143	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:236740143C>T	ENST00000366582.3	-	21	2976	c.2862G>A	c.(2860-2862)ctG>ctA	p.L954L	HEATR1_ENST00000366581.2_Silent_p.L954L	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	954					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GATCTATTATCAGATAAAACG	0.443																																																	0													90.0	93.0	92.0					1																	236740143		2203	4300	6503	SO:0001819	synonymous_variant	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.2862G>A	1.37:g.236740143C>T			Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.L954	ENST00000366582.3	37	c.2862	CCDS31066.1	1																																																																																			HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.443	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1		0.00	32	0	C	XM_375853		236740143	-1			no_errors	ENST00000366582	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.061	T
HHIP	64399	genome.wustl.edu	37	4	145640083	145640083	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:145640083C>T	ENST00000296575.3	+	11	2390	c.1735C>T	c.(1735-1737)Ctc>Ttc	p.L579F		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	579					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		CAATGGAAAACTCTACAAAAT	0.289																																																	0													101.0	104.0	103.0					4																	145640083		2203	4300	6503	SO:0001583	missense	0			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1735C>T	4.37:g.145640083C>T	ENSP00000296575:p.Leu579Phe		Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	pfam_Folate_rcpt-like,superfamily_Quinoprot_gluc/sorb_DH,smart_EG-like_dom,pfscan_EG-like_dom	p.L579F	ENST00000296575.3	37	c.1735	CCDS3762.1	4	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206270	0.58343	.	.	ENSG00000164161	ENST00000296575	T	0.07327	3.2	5.73	5.73	0.89815	Six-bladed beta-propeller, TolB-like (1);	0.203728	0.44285	D	0.000471	T	0.10078	0.0247	L	0.55990	1.75	0.80722	D	1	P	0.39576	0.679	B	0.32864	0.154	T	0.01844	-1.1262	10	0.72032	D	0.01	-6.1187	14.7064	0.69194	0.1449:0.8551:0.0:0.0	.	579	Q96QV1	HHIP_HUMAN	F	579	ENSP00000296575:L579F	ENSP00000296575:L579F	L	+	1	0	HHIP	145859533	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.241000	0.58707	2.703000	0.92315	0.557000	0.71058	CTC	HHIP	-	NULL	ENSG00000164161		0.289	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIP	HGNC	protein_coding	OTTHUMT00000364887.2	-	0.00	50	0	C			145640083	+1	tier1	-	no_errors	ENST00000296575	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12121877	12121877	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:12121877G>A	ENST00000379388.2	+	4	2181	c.1849G>A	c.(1849-1851)Gag>Aag	p.E617K		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	617					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CTCCAGGTTGGAGACTAATGA	0.507																																																	0													69.0	67.0	68.0					6																	12121877		1951	4171	6122	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1849G>A	6.37:g.12121877G>A	ENSP00000368698:p.Glu617Lys		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E617K	ENST00000379388.2	37	c.1849	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078067	0.76528	.	.	ENSG00000095951	ENST00000379388	T	0.11604	2.76	5.92	5.04	0.67666	.	0.000000	0.33401	N	0.004945	T	0.10508	0.0257	M	0.76574	2.34	0.80722	D	1	P	0.49635	0.926	B	0.43225	0.412	T	0.04053	-1.0981	9	.	.	.	-22.5597	16.9555	0.86258	0.0:0.1278:0.8722:0.0	.	617	P15822	ZEP1_HUMAN	K	617	ENSP00000368698:E617K	.	E	+	1	0	HIVEP1	12229863	1.000000	0.71417	0.519000	0.27824	0.027000	0.11550	8.006000	0.88564	1.481000	0.48307	0.655000	0.94253	GAG	HIVEP1	-	NULL	ENSG00000095951		0.507	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2	-	0.00	29	0	G	NM_002114		12121877	+1	tier1	-	no_errors	ENST00000379388	ensembl	human	known	74_37	missense	25.53	35	12	SNP	0.997	A
HMGXB4	10042	genome.wustl.edu	37	22	35684359	35684359	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:35684359G>A	ENST00000216106.5	+	9	1725	c.1597G>A	c.(1597-1599)Gag>Aag	p.E533K	HMGXB4_ENST00000444518.2_Missense_Mutation_p.E424K	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	533					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCTGTTGGGAGAGTCCCTAAG	0.493																																																	0													131.0	106.0	114.0					22																	35684359		2203	4300	6503	SO:0001583	missense	0			AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1597G>A	22.37:g.35684359G>A	ENSP00000216106:p.Glu533Lys		O75672|O75673|Q9UMT5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E533K	ENST00000216106.5	37	c.1597	CCDS33641.1	22	.	.	.	.	.	.	.	.	.	.	G	35	5.463534	0.96257	.	.	ENSG00000100281	ENST00000444518;ENST00000216106	T;T	0.35048	1.33;1.38	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.61986	0.2391	M	0.75777	2.31	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.67015	-0.5777	10	0.87932	D	0	-24.4388	18.4568	0.90724	0.0:0.0:1.0:0.0	.	533	Q9UGU5	HMGX4_HUMAN	K	424;533	ENSP00000398302:E424K;ENSP00000216106:E533K	ENSP00000216106:E533K	E	+	1	0	HMGXB4	34014359	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.567000	0.98161	2.351000	0.79841	0.563000	0.77884	GAG	HMGXB4	-	NULL	ENSG00000100281		0.493	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HMGXB4	HGNC	protein_coding	OTTHUMT00000318104.2	-	0.00	13	0	G	NM_005487		35684359	+1	tier1	-	no_errors	ENST00000216106	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	A
HOXA3	3200	genome.wustl.edu	37	7	27147685	27147685	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:27147685C>T	ENST00000396352.4	-	3	1380	c.1181G>A	c.(1180-1182)gGc>gAc	p.G394D	HOXA-AS2_ENST00000518088.1_RNA|HOXA3_ENST00000317201.2_Missense_Mutation_p.G394D|HOXA3_ENST00000521401.1_5'Flank	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3	394					angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						GTCCATGGCGCCCGAGGCAGC	0.711																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)												0													30.0	33.0	32.0					7																	27147685		2202	4300	6502	SO:0001583	missense	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.1181G>A	7.37:g.27147685C>T	ENSP00000379640:p.Gly394Asp		A4D181	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G394D	ENST00000396352.4	37	c.1181	CCDS5404.1	7	.	.	.	.	.	.	.	.	.	.	C	11.88	1.771820	0.31320	.	.	ENSG00000105997	ENST00000396352;ENST00000317201;ENST00000396350	D;D	0.85702	-2.02;-2.02	5.6	3.79	0.43588	.	0.112881	0.64402	D	0.000013	T	0.80849	0.4702	L	0.38175	1.15	0.30100	N	0.807552	B	0.18013	0.025	B	0.34301	0.179	T	0.76666	-0.2875	10	0.66056	D	0.02	.	9.9192	0.41453	0.0:0.1547:0.5872:0.2581	.	394	O43365	HXA3_HUMAN	D	394;394;236	ENSP00000379640:G394D;ENSP00000324884:G394D	ENSP00000324884:G394D	G	-	2	0	HOXA3	27114210	1.000000	0.71417	0.475000	0.27278	0.801000	0.45260	4.095000	0.57728	0.715000	0.32103	-0.229000	0.12294	GGC	HOXA3	-	NULL	ENSG00000105997		0.711	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA3	HGNC	protein_coding	OTTHUMT00000358708.2		0.00	16	0	C			27147685	-1			no_errors	ENST00000317201	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.988	T
HOXC4	3221	genome.wustl.edu	37	12	54447759	54447759	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:54447759C>A	ENST00000430889.2	+	1	99	c.53C>A	c.(52-54)cCt>cAt	p.P18H	HOXC4_ENST00000303406.4_Missense_Mutation_p.P18H|HOXC4_ENST00000609810.1_Missense_Mutation_p.P18H	NM_153633.2	NP_705897.1	P09017	HXC4_HUMAN	homeobox C4	18					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	13						CCGAAATTTCCTCCATGCGAA	0.438																																																	0													112.0	111.0	112.0					12																	54447759		2203	4300	6503	SO:0001583	missense	0				CCDS8873.1	12q13.13	2011-06-20	2005-12-22		ENSG00000198353	ENSG00000198353		"""Homeoboxes / ANTP class : HOXL subclass"""	5126	protein-coding gene	gene with protein product		142974	"""homeo box C4"""	HOX3, HOX3E		1973146, 1358459	Standard	NM_014620		Approved		uc001sex.3	P09017	OTTHUMG00000160036	ENST00000430889.2:c.53C>A	12.37:g.54447759C>A	ENSP00000399808:p.Pro18His			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.P18H	ENST00000430889.2	37	c.53	CCDS8873.1	12	.	.	.	.	.	.	.	.	.	.	C	18.75	3.691386	0.68271	.	.	ENSG00000198353	ENST00000303406;ENST00000430889	T;T	0.69435	-0.4;-0.4	3.41	3.41	0.39046	.	0.204002	0.42053	D	0.000771	D	0.84875	0.5569	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89109	0.3495	10	0.87932	D	0	.	14.7795	0.69754	0.0:1.0:0.0:0.0	.	18	P09017	HXC4_HUMAN	H	18	ENSP00000305973:P18H;ENSP00000399808:P18H	ENSP00000305973:P18H	P	+	2	0	HOXC4	52734026	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.240000	0.78192	2.187000	0.69744	0.462000	0.41574	CCT	HOXC4	-	NULL	ENSG00000273266		0.438	HOXC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC4	Uniprot_gn	protein_coding	OTTHUMT00000358963.1	-	0.00	61	0	C			54447759	+1	tier1	-	no_errors	ENST00000430889	ensembl	human	known	74_37	missense	37.04	34	20	SNP	1.000	A
HSDL1	83693	genome.wustl.edu	37	16	84163981	84163981	+	Silent	SNP	G	G	T	rs141648024	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:84163981G>T	ENST00000219439.4	-	4	452	c.276C>A	c.(274-276)ctC>ctA	p.L92L	HSDL1_ENST00000434463.3_Silent_p.L92L	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	92						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						GGATTATATTGAGACCTCGGC	0.448																																																	0													110.0	113.0	112.0					16																	84163981		2200	4300	6500	SO:0001819	synonymous_variant	0			AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.276C>A	16.37:g.84163981G>T			B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L92	ENST00000219439.4	37	c.276	CCDS10942.1	16																																																																																			HSDL1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000103160		0.448	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSDL1	HGNC	protein_coding	OTTHUMT00000269076.3	-	0.00	42	0	G	NM_031463		84163981	-1	tier1	-	no_errors	ENST00000219439	ensembl	human	known	74_37	silent	30.23	30	13	SNP	0.977	T
IFI27	3429	genome.wustl.edu	37	14	94582247	94582247	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:94582247C>T	ENST00000555744.1	+	4	430	c.242C>T	c.(241-243)tCg>tTg	p.S81L	IFI27_ENST00000557098.1_Missense_Mutation_p.S36L|IFI27_ENST00000444961.1_Missense_Mutation_p.S84L|IFI27_ENST00000448882.1_Missense_Mutation_p.S84L|IFI27_ENST00000557634.1_Missense_Mutation_p.S71L|IFI27_ENST00000298902.5_Missense_Mutation_p.S81L			P40305	IFI27_HUMAN	interferon, alpha-inducible protein 27	81					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)				breast(1)|lung(3)	4				Epithelial(152;0.112)|all cancers(159;0.187)|COAD - Colon adenocarcinoma(157;0.206)		GGAGTTGCCTCGGGCAGCCTT	0.637																																					GBM(128;797 1667 20895 29868 47129)												0													33.0	28.0	30.0					14																	94582247		2203	4299	6502	SO:0001583	missense	0			X67325	CCDS32148.1	14q32.12	2012-10-02			ENSG00000165949	ENSG00000165949			5397	protein-coding gene	gene with protein product		600009				8358738	Standard	NM_005532		Approved	P27, FAM14D	uc021sba.1	P40305	OTTHUMG00000171303	ENST00000555744.1:c.242C>T	14.37:g.94582247C>T	ENSP00000451956:p.Ser81Leu		Q53YA6|Q6IEC1|Q96BK3	Missense_Mutation	SNP	pfam_IFI6/IFI27	p.S84L	ENST00000555744.1	37	c.251	CCDS32148.1	14	.	.	.	.	.	.	.	.	.	.	C	9.807	1.182170	0.21787	.	.	ENSG00000165949	ENST00000444961;ENST00000448882;ENST00000557098;ENST00000556544;ENST00000298902;ENST00000557634;ENST00000555744	T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43	3.52	2.63	0.31362	.	0.325812	0.31821	N	0.007015	T	0.26991	0.0661	L	0.57536	1.79	0.09310	N	1	B	0.26845	0.161	B	0.25614	0.062	T	0.27297	-1.0078	10	0.87932	D	0	.	6.8921	0.24234	0.0:0.8733:0.0:0.1267	.	81	P40305	IFI27_HUMAN	L	84;84;36;81;81;71;81	ENSP00000413536:S84L;ENSP00000410901:S84L;ENSP00000450753:S36L;ENSP00000451875:S81L;ENSP00000298902:S81L;ENSP00000452560:S71L;ENSP00000451956:S81L	ENSP00000298902:S81L	S	+	2	0	IFI27	93652000	0.068000	0.21057	0.002000	0.10522	0.001000	0.01503	3.405000	0.52630	1.055000	0.40461	-0.253000	0.11424	TCG	IFI27	-	pfam_IFI6/IFI27	ENSG00000165949		0.637	IFI27-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IFI27	HGNC	protein_coding	OTTHUMT00000412889.1	-	0.00	79	0	C	NM_005532		94582247	+1	tier1	-	no_errors	ENST00000444961	ensembl	human	known	74_37	missense	26.32	84	30	SNP	0.022	T
IFITM1	8519	genome.wustl.edu	37	11	314322	314322	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:314322G>T	ENST00000408968.3	+	1	470	c.152G>T	c.(151-153)tGt>tTt	p.C51F	IFITM1_ENST00000528780.1_Missense_Mutation_p.C51F|IFITM1_ENST00000328221.5_Missense_Mutation_p.C51F	NM_003641.3	NP_003632	P13164	IFM1_HUMAN	interferon induced transmembrane protein 1	51					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of immune response (GO:0050776)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			large_intestine(1)|lung(3)	4		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		AACTGGTGCTGTCTGGGCTTC	0.602																																																	0													134.0	140.0	138.0					11																	314322		2059	4208	6267	SO:0001583	missense	0			J04164	CCDS41584.1	11p15.5	2012-03-15	2012-03-13		ENSG00000185885	ENSG00000185885		"""CD molecules"""	5412	protein-coding gene	gene with protein product	"""interferon-induced transmembrane protein 1"""	604456	"""interferon induced transmembrane protein 1 (9-27)"""	IFI17		7559564	Standard	NM_003641		Approved	9-27, CD225	uc001loy.4	P13164		ENST00000408968.3:c.152G>T	11.37:g.314322G>T	ENSP00000386187:p.Cys51Phe		Q15322|Q53XZ0	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.C51F	ENST00000408968.3	37	c.152	CCDS41584.1	11	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709977	0.48517	.	.	ENSG00000185885	ENST00000528780;ENST00000328221;ENST00000408968;ENST00000452428	D;D;D	0.87887	-2.31;-2.31;-2.31	3.14	3.14	0.36123	.	0.000000	0.64402	U	0.000001	D	0.93766	0.8007	M	0.92923	3.36	0.54753	D	0.999988	D	0.71674	0.998	D	0.72338	0.977	D	0.94071	0.7335	10	0.87932	D	0	.	9.9145	0.41425	0.0:0.0:1.0:0.0	.	51	P13164	IFM1_HUMAN	F	51;51;51;54	ENSP00000437057:C51F;ENSP00000330825:C51F;ENSP00000386187:C51F	ENSP00000330825:C51F	C	+	2	0	IFITM1	304322	1.000000	0.71417	0.992000	0.48379	0.332000	0.28634	6.065000	0.71176	1.771000	0.52183	0.205000	0.17691	TGT	IFITM1	-	pfam_CD225/Dispanin_fam	ENSG00000185885		0.602	IFITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFITM1	HGNC	protein_coding	OTTHUMT00000383595.1	-	0.00	75	0	G	NM_003641		314322	+1	tier1	-	no_errors	ENST00000328221	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
IGF2R	3482	genome.wustl.edu	37	6	160501186	160501186	+	Silent	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:160501186C>G	ENST00000356956.1	+	39	5860	c.5712C>G	c.(5710-5712)gtC>gtG	p.V1904V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1904	Fibronectin type-II. {ECO:0000255|PROSITE-ProRule:PRU00479}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCCCCTGTGTCTTCCCCTTCA	0.537																																																	0													152.0	139.0	144.0					6																	160501186		2203	4300	6503	SO:0001819	synonymous_variant	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5712C>G	6.37:g.160501186C>G			Q7Z7G9|Q96PT5	Silent	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.V1904	ENST00000356956.1	37	c.5712	CCDS5273.1	6																																																																																			IGF2R	-	pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	ENSG00000197081		0.537	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	-	0.00	29	0	C	NM_000876		160501186	+1	tier1	-	no_errors	ENST00000356956	ensembl	human	known	74_37	silent	41.38	17	12	SNP	1.000	G
IGHMBP2	3508	genome.wustl.edu	37	11	68707045	68707045	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:68707045G>C	ENST00000255078.3	+	15	2939	c.2828G>C	c.(2827-2829)aGa>aCa	p.R943T	RP11-757G1.5_ENST00000542410.1_RNA	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	943					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCCCGGCAGAGAATCAGCCGG	0.642																																																	0													32.0	37.0	35.0					11																	68707045		2200	4294	6494	SO:0001583	missense	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.2828G>C	11.37:g.68707045G>C	ENSP00000255078:p.Arg943Thr		A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.R943T	ENST00000255078.3	37	c.2828	CCDS8187.1	11	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195569	0.58126	.	.	ENSG00000132740	ENST00000255078	T	0.41400	1.0	4.54	2.62	0.31277	Zinc finger, AN1-type (1);	0.112530	0.64402	N	0.000014	T	0.42449	0.1203	L	0.53249	1.67	0.80722	D	1	D	0.53619	0.961	P	0.49637	0.617	T	0.20009	-1.0288	10	0.26408	T	0.33	-7.5391	9.7631	0.40543	0.1798:0.0:0.8202:0.0	.	943	P38935	SMBP2_HUMAN	T	943	ENSP00000255078:R943T	ENSP00000255078:R943T	R	+	2	0	IGHMBP2	68463621	1.000000	0.71417	0.966000	0.40874	0.760000	0.43138	4.093000	0.57714	0.885000	0.36088	0.491000	0.48974	AGA	IGHMBP2	-	NULL	ENSG00000132740		0.642	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	-	0.00	62	0	G	NM_002180		68707045	+1	tier1	-	no_errors	ENST00000255078	ensembl	human	known	74_37	missense	32.32	67	32	SNP	0.999	C
IGLL1	3543	genome.wustl.edu	37	22	23917210	23917210	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:23917210G>C	ENST00000330377.2	-	2	383	c.266C>G	c.(265-267)tCc>tGc	p.S89C	AP000345.2_ENST00000454863.1_RNA|AP000345.2_ENST00000458318.1_RNA|IGLL1_ENST00000249053.3_Intron	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	89					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						GTTATGCTTGGATTGAAACCC	0.612																																																	0													67.0	62.0	64.0					22																	23917210		2203	4300	6503	SO:0001583	missense	0			X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.266C>G	22.37:g.23917210G>C	ENSP00000329312:p.Ser89Cys		Q0P681	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	p.S89C	ENST00000330377.2	37	c.266	CCDS13809.1	22	.	.	.	.	.	.	.	.	.	.	-	7.094	0.572755	0.13623	.	.	ENSG00000128322	ENST00000330377;ENST00000438703	T;T	0.01099	6.59;5.34	1.58	1.58	0.23477	.	.	.	.	.	T	0.01454	0.0047	L	0.48642	1.525	0.09310	N	1	B	0.18166	0.026	B	0.14023	0.01	T	0.40794	-0.9544	9	0.56958	D	0.05	.	7.441	0.27183	0.0:0.0:1.0:0.0	.	89	P15814	IGLL1_HUMAN	C	89;90	ENSP00000329312:S89C;ENSP00000403391:S90C	ENSP00000329312:S89C	S	-	2	0	IGLL1	22247210	0.001000	0.12720	0.050000	0.19076	0.000000	0.00434	0.745000	0.26259	0.929000	0.37192	0.000000	0.15137	TCC	IGLL1	-	NULL	ENSG00000128322		0.612	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGLL1	HGNC	protein_coding	OTTHUMT00000319569.1	-	0.00	66	0	G	NM_020070		23917210	-1	tier1	-	no_errors	ENST00000330377	ensembl	human	known	74_37	missense	28.07	40	16	SNP	0.004	C
INTS7	25896	genome.wustl.edu	37	1	212125924	212125924	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:212125924G>A	ENST00000366994.3	-	17	2407	c.2303C>T	c.(2302-2304)cCt>cTt	p.P768L	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366992.3_Missense_Mutation_p.P768L|INTS7_ENST00000366993.3_Intron|INTS7_ENST00000440600.2_Missense_Mutation_p.P719L	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	768					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		ATAAGAAACAGGGGTATATTT	0.363																																																	0													127.0	123.0	125.0					1																	212125924		2203	4300	6503	SO:0001583	missense	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.2303C>T	1.37:g.212125924G>A	ENSP00000355961:p.Pro768Leu		B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.P719L	ENST00000366994.3	37	c.2156	CCDS1501.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.372764	0.82573	.	.	ENSG00000143493	ENST00000366994;ENST00000366992;ENST00000440600	T;T;T	0.56275	0.84;0.47;0.84	5.58	5.58	0.84498	.	0.094375	0.85682	D	0.000000	T	0.68742	0.3034	L	0.48362	1.52	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.68930	-0.5279	10	0.59425	D	0.04	-33.4925	19.582	0.95471	0.0:0.0:1.0:0.0	.	719;768;768	B4DLZ6;Q9NVH2-3;Q9NVH2	.;.;INT7_HUMAN	L	768;768;719	ENSP00000355961:P768L;ENSP00000355959:P768L;ENSP00000388908:P719L	ENSP00000355959:P768L	P	-	2	0	INTS7	210192547	1.000000	0.71417	0.992000	0.48379	0.945000	0.59286	9.040000	0.93783	2.638000	0.89438	0.557000	0.71058	CCT	INTS7	-	NULL	ENSG00000143493		0.363	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1	-	0.00	45	0	G	NM_015434		212125924	-1	tier1	-	no_errors	ENST00000440600	ensembl	human	known	74_37	missense	31.43	24	11	SNP	1.000	A
ISPD	729920	genome.wustl.edu	37	7	16445718	16445718	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:16445718G>C	ENST00000407010.2	-	2	501	c.502C>G	c.(502-504)Ctt>Gtt	p.L168V	ISPD_ENST00000399310.3_Missense_Mutation_p.L168V	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	168					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						ACAACTTTAAGAAGGACACCT	0.413										Multiple Myeloma(15;0.18)																																							0													93.0	85.0	88.0					7																	16445718		1903	4113	6016	SO:0001583	missense	0			AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.502C>G	7.37:g.16445718G>C	ENSP00000385478:p.Leu168Val		A8MU35|H9KVB2	Missense_Mutation	SNP	pfam_IspD	p.L168V	ENST00000407010.2	37	c.502		7	.	.	.	.	.	.	.	.	.	.	G	6.458	0.452595	0.12283	.	.	ENSG00000214960	ENST00000407010;ENST00000399310	D;D	0.85773	-2.03;-2.03	5.88	2.93	0.34026	4-diphosphocytidyl-2C-methyl-D-erythritol synthase (1);	0.885835	0.09540	U	0.788345	T	0.79713	0.4493	L	0.34521	1.04	0.09310	N	1	P	0.47034	0.889	P	0.45167	0.472	T	0.65438	-0.6168	10	0.30078	T	0.28	-7.1321	8.9464	0.35762	0.2503:0.1164:0.6333:0.0	.	168	A4D126	ISPD_HUMAN	V	168	ENSP00000385478:L168V;ENSP00000382249:L168V	ENSP00000382249:L168V	L	-	1	0	ISPD	16412243	0.000000	0.05858	0.407000	0.26434	0.199000	0.23934	0.635000	0.24629	0.824000	0.34613	-0.140000	0.14226	CTT	ISPD	-	pfam_IspD	ENSG00000214960		0.413	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ISPD	HGNC	protein_coding	OTTHUMT00000326252.4	-	0.00	44	0	G	NM_001101426		16445718	-1	tier1	-	no_errors	ENST00000407010	ensembl	human	known	74_37	missense	38.64	27	17	SNP	0.000	C
CCDC175	729665	genome.wustl.edu	37	14	59970584	59970584	+	IGR	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:59970584C>T	ENST00000537690.2	-	0	2616				JKAMP_ENST00000425728.2_Missense_Mutation_p.L238F|JKAMP_ENST00000356057.5_Missense_Mutation_p.L252F|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000554271.1_Missense_Mutation_p.L258F|JKAMP_ENST00000261247.9_Missense_Mutation_p.L244F	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175									p.L252I(1)									CTGCTATGATCTTCTGGTCAG	0.323																																																	1	Substitution - Missense(1)	large_intestine(1)											96.0	91.0	92.0					14																	59970584		1806	4076	5882	SO:0001628	intergenic_variant	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221			14.37:g.59970584C>T			G3V5J7	Missense_Mutation	SNP	pfam_DUF766	p.L252F	ENST00000537690.2	37	c.754	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702332	0.68501	.	.	ENSG00000050130	ENST00000261247;ENST00000425728;ENST00000554271;ENST00000356057	.	.	.	5.62	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.79341	0.4429	M	0.81112	2.525	0.58432	D	0.999998	D;D;D;D;D	0.76494	0.999;0.998;0.998;0.998;0.998	D;D;D;D;D	0.72982	0.979;0.965;0.965;0.965;0.965	T	0.82705	-0.0325	9	0.87932	D	0	-7.2	14.5802	0.68282	0.0:0.93:0.0:0.07	.	259;258;238;252;244	Q9P055;G3V2M4;Q9P055-3;Q9P055-5;Q9P055-4	JKAMP_HUMAN;.;.;.;.	F	244;238;258;252	.	ENSP00000261247:L244F	L	+	1	0	JKAMP	59040337	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.373000	0.59537	1.384000	0.46424	0.655000	0.94253	CTT	JKAMP	-	pfam_DUF766	ENSG00000050130		0.323	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	JKAMP	HGNC	protein_coding	OTTHUMT00000471273.1		0.00	36	0	C	NM_001164399		59970584	+1			no_errors	ENST00000356057	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
KRT17	3872	genome.wustl.edu	37	17	39777080	39777080	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:39777080G>A	ENST00000311208.8	-	6	1079	c.1012C>T	c.(1012-1014)Cag>Tag	p.Q338*	JUP_ENST00000540235.1_Nonsense_Mutation_p.Q497*	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	338	Coil 2.|Peptide epitope S4; induces T-cell and keratinocyte proliferation and IFN-gamma production.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				TGGGACAGCTGCACGCAGTAG	0.602																																					Pancreas(92;1242 2086 39193 50508)												0													55.0	56.0	56.0					17																	39777080		2203	4300	6503	SO:0001587	stop_gained	0			X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.1012C>T	17.37:g.39777080G>A	ENSP00000308452:p.Gln338*		A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Nonsense_Mutation	SNP	pfam_IF,pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo,pfscan_Armadillo,prints_Keratin_I,prints_Beta-catenin	p.Q497*	ENST00000311208.8	37	c.1489	CCDS11402.1	17	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752318	0.89753	.	.	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	.	.	.	4.02	4.02	0.46733	.	0.000000	0.44688	D	0.000424	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.3517	0.55153	0.0:0.309:0.691:0.0	.	.	.	.	X	338;497	.	ENSP00000441751:Q497X	Q	-	1	0	JUP;KRT17	37030606	0.993000	0.37304	1.000000	0.80357	0.994000	0.84299	1.734000	0.38166	2.246000	0.74042	0.561000	0.74099	CAG	JUP	-	pfam_IF,prints_Keratin_I	ENSG00000173801		0.602	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257460.1	-	0.00	61	0	G	NM_000422		39777080	-1	tier1	-	no_errors	ENST00000540235	ensembl	human	known	74_37	nonsense	38.10	51	32	SNP	0.995	A
KALRN	8997	genome.wustl.edu	37	3	123813618	123813618	+	5'UTR	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:123813618C>G	ENST00000240874.3	+	0	91				KALRN_ENST00000460856.1_5'UTR|KALRN_ENST00000360013.3_5'UTR|KALRN_ENST00000477496.1_3'UTR	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase						apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCGGCCTCCTCGAGTCAGCGG	0.607																																																	0													93.0	88.0	89.0					3																	123813618		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.-67C>G	3.37:g.123813618C>G			A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	RNA	SNP	-	NULL	ENST00000240874.3	37	NULL	CCDS3027.1	3																																																																																			KALRN	-	-	ENSG00000160145		0.607	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258843.4	-	0.00	46	0	C	NM_003947		123813618	+1	tier1	-	no_errors	ENST00000477496	ensembl	human	known	74_37	rna	34.72	47	25	SNP	0.287	G
KCNQ3	3786	genome.wustl.edu	37	8	133187730	133187730	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:133187730C>G	ENST00000388996.4	-	5	1323	c.903G>C	c.(901-903)gaG>gaC	p.E301D	KCNQ3_ENST00000519445.1_Missense_Mutation_p.E301D|KCNQ3_ENST00000521134.1_Missense_Mutation_p.E181D	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	301					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CTGCATAGGTCTCAAACTCCT	0.507																																																	0													177.0	156.0	163.0					8																	133187730		2203	4300	6503	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.903G>C	8.37:g.133187730C>G	ENSP00000373648:p.Glu301Asp		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.E301D	ENST00000388996.4	37	c.903	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	C	8.246	0.807892	0.16467	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.97303	-4.33;-4.33;-4.33	5.51	2.72	0.32119	Ion transport (1);	0.050828	0.85682	D	0.000000	D	0.90469	0.7015	N	0.17278	0.47	0.39635	D	0.970238	B;B	0.14805	0.011;0.011	B;B	0.19946	0.027;0.027	T	0.81245	-0.1020	10	0.08381	T	0.77	-29.1908	7.3143	0.26491	0.0:0.6666:0.1231:0.2103	.	301;301	E7ET42;O43525	.;KCNQ3_HUMAN	D	301;181;301;290;180	ENSP00000373648:E301D;ENSP00000429799:E181D;ENSP00000428790:E301D	ENSP00000373648:E301D	E	-	3	2	KCNQ3	133256912	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.839000	0.27586	0.367000	0.24454	0.655000	0.94253	GAG	KCNQ3	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl	ENSG00000184156		0.507	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	-	0.00	69	0	C	NM_004519		133187730	-1	tier1	-	no_errors	ENST00000388996	ensembl	human	known	74_37	missense	24.68	58	19	SNP	0.999	G
KDM4A	9682	genome.wustl.edu	37	1	44169066	44169066	+	Intron	DEL	T	T	-	rs570960378	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:44169066delT	ENST00000372396.3	+	20	2975				KDM4A-AS1_ENST00000439057.1_RNA|KDM4A-AS1_ENST00000453015.1_RNA|KDM4A-AS1_ENST00000434346.1_RNA|KDM4A-AS1_ENST00000398804.3_RNA|KDM4A-AS1_ENST00000418149.1_RNA	NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A						cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						TATAGCTGGATTTTTTTTTTT	0.433													|||unknown(LONG_INSERTION)	1432	0.285942	0.2776	0.3112	5008	,	,		18094	0.2817		0.2863	False		,,,				2504	0.2832																0																																										SO:0001627	intron_variant	0			AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.2842-222T>-	1.37:g.44169066delT			Q5VVB1	RNA	DEL	-	NULL	ENST00000372396.3	37	NULL	CCDS491.1	1																																																																																			KDM4A-AS1	-	-	ENSG00000236200		0.433	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A-AS1	HGNC	protein_coding	OTTHUMT00000019960.1		0.00	12	0	T	NM_014663		44169066	-1	tier1		no_errors	ENST00000453015	ensembl	human	known	74_37	rna	29.41	12	5	DEL	0.000	-
KDM4C	23081	genome.wustl.edu	37	9	7013942	7013942	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:7013942A>T	ENST00000381309.3	+	14	2688	c.2123A>T	c.(2122-2124)gAa>gTa	p.E708V	KDM4C_ENST00000536108.1_Missense_Mutation_p.E527V|KDM4C_ENST00000428870.2_Missense_Mutation_p.E395V|KDM4C_ENST00000535193.1_Missense_Mutation_p.E730V|KDM4C_ENST00000543771.1_Missense_Mutation_p.E708V|KDM4C_ENST00000442236.2_Missense_Mutation_p.E453V|KDM4C_ENST00000381306.3_Missense_Mutation_p.E708V	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	708					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GCCTTCCTTGAAGAGGATGGA	0.408																																																	0													144.0	140.0	141.0					9																	7013942		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2123A>T	9.37:g.7013942A>T	ENSP00000370710:p.Glu708Val		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.E708V	ENST00000381309.3	37	c.2123	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	A	16.60	3.169602	0.57584	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870;ENST00000420847	T;T;T;T;T;T;T;T	0.21031	2.11;2.12;2.33;2.24;2.56;2.03;3.31;2.6	5.31	4.17	0.49024	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);	0.163882	0.53938	D	0.000048	T	0.35653	0.0939	L	0.58810	1.83	0.40416	D	0.979799	D;D;D;P;D	0.71674	0.998;0.958;0.989;0.937;0.995	P;P;P;B;P	0.59115	0.852;0.483;0.843;0.405;0.845	T	0.12502	-1.0545	10	0.59425	D	0.04	.	11.1212	0.48291	0.9273:0.0:0.0727:0.0	.	453;708;730;708;708	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	V	730;708;708;708;453;527;395;52	ENSP00000442382:E730V;ENSP00000445427:E708V;ENSP00000370710:E708V;ENSP00000370707:E708V;ENSP00000409353:E453V;ENSP00000440656:E527V;ENSP00000405739:E395V;ENSP00000400127:E52V	ENSP00000370707:E708V	E	+	2	0	KDM4C	7003942	1.000000	0.71417	0.998000	0.56505	0.404000	0.30871	6.825000	0.75293	0.962000	0.38057	0.477000	0.44152	GAA	KDM4C	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	ENSG00000107077		0.408	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	-	0.00	39	0	A	NM_015061		7013942	+1	tier1	-	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	35.48	20	11	SNP	1.000	T
KIAA0430	9665	genome.wustl.edu	37	16	15692750	15692750	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:15692750C>A	ENST00000396368.3	-	26	5151	c.4945G>T	c.(4945-4947)Gat>Tat	p.D1649Y	KIAA0430_ENST00000548025.1_Missense_Mutation_p.D1646Y|KIAA0430_ENST00000344181.3_Missense_Mutation_p.D1337Y|KIAA0430_ENST00000551742.1_Missense_Mutation_p.D1649Y|KIAA0430_ENST00000540441.2_Missense_Mutation_p.D1484Y|KIAA0430_ENST00000602337.1_Missense_Mutation_p.D1646Y	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1649					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						TGAATGAGATCAGCAGATTGG	0.572																																																	0													65.0	72.0	70.0					16																	15692750		1992	4170	6162	SO:0001583	missense	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4945G>T	16.37:g.15692750C>A	ENSP00000379654:p.Asp1649Tyr		A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.D1649Y	ENST00000396368.3	37	c.4945	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611602	0.87258	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.38	5.38	0.77491	.	0.050694	0.85682	D	0.000000	T	0.64918	0.2642	L	0.32530	0.975	0.41024	D	0.985107	D;D;D;P	0.64830	0.965;0.994;0.994;0.941	P;P;P;P	0.60236	0.73;0.871;0.871;0.541	T	0.62393	-0.6864	9	0.38643	T	0.18	.	19.3333	0.94303	0.0:1.0:0.0:0.0	.	1648;1646;1645;1648	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	Y	1649;1484;1589;1337;1646;1649;1515	.	ENSP00000315718:D1589Y	D	-	1	0	KIAA0430	15600251	1.000000	0.71417	0.572000	0.28498	0.742000	0.42306	6.776000	0.75023	2.793000	0.96121	0.655000	0.94253	GAT	KIAA0430	-	NULL	ENSG00000166783		0.572	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	-	0.00	82	0	C	NM_014647		15692750	-1	tier1	-	no_errors	ENST00000396368	ensembl	human	known	74_37	missense	26.03	53	19	SNP	1.000	A
KIAA2018	205717	genome.wustl.edu	37	3	113376936	113376936	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:113376936G>T	ENST00000478658.1	-	5	3610	c.3593C>A	c.(3592-3594)tCt>tAt	p.S1198Y	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.S1198Y			Q68DE3	K2018_HUMAN	KIAA2018	1198						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.S1198Y(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TGAACCCTGAGAATTAAATTC	0.413																																																	1	Substitution - Missense(1)	large_intestine(1)											105.0	93.0	97.0					3																	113376936		1847	4099	5946	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3593C>A	3.37:g.113376936G>T	ENSP00000420721:p.Ser1198Tyr		Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S1198Y	ENST00000478658.1	37	c.3593	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194493	0.38806	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15603	2.41;2.41	5.43	4.54	0.55810	.	0.934494	0.09100	N	0.848698	T	0.21841	0.0526	L	0.29908	0.895	0.38313	D	0.943308	P	0.49447	0.924	P	0.46585	0.521	T	0.11012	-1.0605	10	0.87932	D	0	-7.9104	16.0571	0.80814	0.0:0.1345:0.8655:0.0	.	1198	Q68DE3	K2018_HUMAN	Y	1198	ENSP00000320794:S1198Y;ENSP00000420721:S1198Y	ENSP00000320794:S1198Y	S	-	2	0	KIAA2018	114859626	1.000000	0.71417	0.985000	0.45067	0.664000	0.39144	4.829000	0.62737	1.268000	0.44264	0.561000	0.74099	TCT	KIAA2018	-	NULL	ENSG00000176542		0.413	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	-	0.00	84	0	G	NM_001009899		113376936	-1	tier1	-	no_errors	ENST00000316407	ensembl	human	known	74_37	missense	39.24	48	31	SNP	0.998	T
KIDINS220	57498	genome.wustl.edu	37	2	8930037	8930037	+	Missense_Mutation	SNP	A	A	C	rs369544460		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:8930037A>C	ENST00000256707.3	-	14	1775	c.1594T>G	c.(1594-1596)Ttc>Gtc	p.F532V	KIDINS220_ENST00000418530.1_Missense_Mutation_p.F490V|KIDINS220_ENST00000473731.1_Missense_Mutation_p.F532V|KIDINS220_ENST00000319688.5_Missense_Mutation_p.F533V|KIDINS220_ENST00000427284.1_Missense_Mutation_p.F532V	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	532	KAP NTPase.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AGAGCCAAGAAGCTCAGTGAC	0.353																																																	0													78.0	73.0	75.0					2																	8930037		1821	4092	5913	SO:0001583	missense	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.1594T>G	2.37:g.8930037A>C	ENSP00000256707:p.Phe532Val		A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Missense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.F532V	ENST00000256707.3	37	c.1594	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	A	13.76	2.333446	0.41297	.	.	ENSG00000134313	ENST00000496383;ENST00000541927;ENST00000256707;ENST00000427284;ENST00000418530;ENST00000473731;ENST00000489024;ENST00000319688	T;T;T;T;T;T;T	0.64438	0.96;-0.1;-0.06;-0.02;-0.06;-0.07;-0.06	5.2	4.15	0.48705	KAP P-loop (1);	0.360824	0.29892	N	0.010933	T	0.44201	0.1282	N	0.19112	0.55	0.37280	D	0.907819	B;B;B;B	0.09022	0.002;0.001;0.0;0.0	B;B;B;B	0.12156	0.007;0.005;0.003;0.002	T	0.40664	-0.9551	10	0.45353	T	0.12	.	7.8202	0.29284	0.8236:0.0:0.1764:0.0	.	533;533;490;532	B4DK94;E9PH70;Q9ULH0-2;Q9ULH0	.;.;.;KDIS_HUMAN	V	279;216;532;532;490;532;533;533	ENSP00000420364:F279V;ENSP00000256707:F532V;ENSP00000411849:F532V;ENSP00000414923:F490V;ENSP00000418974:F532V;ENSP00000419964:F533V;ENSP00000319947:F533V	ENSP00000256707:F532V	F	-	1	0	KIDINS220	8847488	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	2.749000	0.47492	0.953000	0.37825	0.482000	0.46254	TTC	KIDINS220	-	pfam_KAP_NTPase	ENSG00000134313		0.353	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	-	0.00	36	0	A	NM_020738		8930037	-1	tier1	-	no_errors	ENST00000256707	ensembl	human	known	74_37	missense	35.29	22	12	SNP	1.000	C
KIF7	374654	genome.wustl.edu	37	15	90171751	90171751	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:90171751C>T	ENST00000394412.3	-	19	4007	c.3931G>A	c.(3931-3933)Gag>Aag	p.E1311K	KIF7_ENST00000558928.1_Intron	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1311					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			AGGCCTGCCTCACCCACAGGA	0.667																																																	0													32.0	39.0	37.0					15																	90171751		2200	4297	6497	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3931G>A	15.37:g.90171751C>T	ENSP00000377934:p.Glu1311Lys		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1311K	ENST00000394412.3	37	c.3931	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	C	13.37	2.217625	0.39201	.	.	ENSG00000166813	ENST00000394412	T	0.70516	-0.49	5.29	5.29	0.74685	.	0.508177	0.21198	N	0.078505	T	0.56877	0.2015	L	0.27053	0.805	0.09310	N	1	P;P	0.38922	0.493;0.651	B;B	0.30401	0.079;0.115	T	0.51236	-0.8731	10	0.25751	T	0.34	.	18.9395	0.92600	0.0:1.0:0.0:0.0	.	797;1311	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	K	1311	ENSP00000377934:E1311K	ENSP00000377934:E1311K	E	-	1	0	KIF7	87972755	0.037000	0.19845	0.060000	0.19600	0.028000	0.11728	1.588000	0.36633	2.484000	0.83849	0.462000	0.41574	GAG	KIF7	-	NULL	ENSG00000166813		0.667	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	-	0.00	27	0	C	NM_198525		90171751	-1	tier1	-	no_errors	ENST00000394412	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.019	T
KIF7	374654	genome.wustl.edu	37	15	90171829	90171829	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:90171829C>T	ENST00000394412.3	-	19	3929	c.3853G>A	c.(3853-3855)Gag>Aag	p.E1285K	KIF7_ENST00000558928.1_Intron	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1285					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			CCCTGCTCCTCACCACACAGG	0.701																																																	0													40.0	45.0	44.0					15																	90171829		2199	4299	6498	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3853G>A	15.37:g.90171829C>T	ENSP00000377934:p.Glu1285Lys		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1285K	ENST00000394412.3	37	c.3853	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196698	0.58126	.	.	ENSG00000166813	ENST00000394412	T	0.72942	-0.7	5.59	4.68	0.58851	.	0.245798	0.39341	N	0.001382	T	0.55513	0.1925	N	0.24115	0.695	0.44207	D	0.997035	P;P	0.39480	0.675;0.546	B;B	0.34536	0.185;0.073	T	0.58951	-0.7545	10	0.46703	T	0.11	.	14.2095	0.65755	0.0:0.928:0.0:0.072	.	771;1285	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	K	1285	ENSP00000377934:E1285K	ENSP00000377934:E1285K	E	-	1	0	KIF7	87972833	1.000000	0.71417	0.726000	0.30738	0.028000	0.11728	3.920000	0.56446	1.367000	0.46095	0.462000	0.41574	GAG	KIF7	-	NULL	ENSG00000166813		0.701	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	-	0.00	16	0	C	NM_198525		90171829	-1	tier1	-	no_errors	ENST00000394412	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.995	T
KIF7	374654	genome.wustl.edu	37	15	90185619	90185619	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:90185619G>T	ENST00000394412.3	-	11	2285	c.2209C>A	c.(2209-2211)Ctg>Atg	p.L737M		NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	737	Sufficient for interaction with NPHP1.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TGGCGGTTCAGGGCCTGAGCT	0.657																																																	0													11.0	11.0	11.0					15																	90185619		2194	4293	6487	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.2209C>A	15.37:g.90185619G>T	ENSP00000377934:p.Leu737Met		Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L737M	ENST00000394412.3	37	c.2209	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	g	13.39	2.222101	0.39300	.	.	ENSG00000166813	ENST00000394412	T	0.45668	0.89	4.87	0.241	0.15494	.	0.163209	0.47455	D	0.000233	T	0.20007	0.0481	N	0.13235	0.315	0.27180	N	0.960683	P;B	0.42973	0.796;0.217	B;B	0.39660	0.306;0.033	T	0.15578	-1.0432	10	0.27785	T	0.31	.	5.6298	0.17504	0.2566:0.0:0.5164:0.227	.	223;737	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	M	737	ENSP00000377934:L737M	ENSP00000377934:L737M	L	-	1	2	KIF7	87986623	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	1.222000	0.32515	0.117000	0.18138	0.306000	0.20318	CTG	KIF7	-	NULL	ENSG00000166813		0.657	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1		0.00	39	0	G	NM_198525		90185619	-1			no_errors	ENST00000394412	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.997	T
KIFC1	3833	genome.wustl.edu	37	6	33374170	33374170	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:33374170C>T	ENST00000428849.2	+	8	2184	c.1734C>T	c.(1732-1734)ctC>ctT	p.L578L		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	578	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GCTTAGCCCTCGGCCCCGGGG	0.647																																																	0													52.0	61.0	58.0					6																	33374170		2203	4300	6503	SO:0001819	synonymous_variant	0			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1734C>T	6.37:g.33374170C>T			O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L578	ENST00000428849.2	37	c.1734	CCDS34430.1	6																																																																																			KIFC1	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000237649		0.647	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	-	0.00	55	0	C	NM_002263		33374170	+1	tier1	-	no_errors	ENST00000428849	ensembl	human	known	74_37	silent	37.04	33	20	SNP	0.000	T
KNTC1	9735	genome.wustl.edu	37	12	123030788	123030788	+	Silent	SNP	G	G	A	rs7968222	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:123030788G>A	ENST00000333479.7	+	9	912	c.735G>A	c.(733-735)aaG>aaA	p.K245K	KNTC1_ENST00000450485.2_Silent_p.K208K	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	245			K -> N (in dbSNP:rs7968222).		mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGACAGTTAAGAACCTTATTG	0.308																																																	0													52.0	50.0	50.0					12																	123030788		1812	4073	5885	SO:0001819	synonymous_variant	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.735G>A	12.37:g.123030788G>A			A7E2C4|B3KSG2	Silent	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.K245	ENST00000333479.7	37	c.735	CCDS45002.1	12																																																																																			KNTC1	-	superfamily_WD40_repeat_dom	ENSG00000184445		0.308	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	-	0.00	56	0	G			123030788	+1	tier1	-	no_errors	ENST00000333479	ensembl	human	known	74_37	silent	27.12	43	16	SNP	1.000	A
KRT33A	3883	genome.wustl.edu	37	17	39505616	39505616	+	Nonsense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:39505616G>C	ENST00000007735.3	-	2	457	c.413C>G	c.(412-414)tCa>tGa	p.S138*		NM_004138.3	NP_004129.2	O76009	KT33A_HUMAN	keratin 33A	138	Coil 1B.|Rod.					extracellular space (GO:0005615)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.S138L(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	21		Breast(137;0.000496)				GAAGTCATCTGAGGCCAGCTT	0.502																																																	1	Substitution - Missense(1)	urinary_tract(1)											111.0	102.0	105.0					17																	39505616		2203	4300	6503	SO:0001587	stop_gained	0			Y16788	CCDS11388.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000006059	ENSG00000006059		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6450	protein-coding gene	gene with protein product	"""hard keratin type I 3I"""	602761	"""keratin, hair, acidic, 3A"""	KRTHA3A		7565656, 16831889	Standard	NM_004138		Approved	Ha-3I, Krt1-3	uc002hwk.2	O76009	OTTHUMG00000133432	ENST00000007735.3:c.413C>G	17.37:g.39505616G>C	ENSP00000007735:p.Ser138*		B2RA87|Q6NTB9|Q6ZZB9	Nonsense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.S138*	ENST00000007735.3	37	c.413	CCDS11388.1	17	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917076	0.92249	.	.	ENSG00000006059	ENST00000007735	.	.	.	5.03	5.03	0.67393	.	0.811364	0.10899	N	0.621819	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.8727	0.88815	0.0:0.0:1.0:0.0	.	.	.	.	X	138	.	ENSP00000007735:S138X	S	-	2	0	KRT33A	36759142	0.996000	0.38824	0.094000	0.20943	0.892000	0.51952	7.543000	0.82106	2.760000	0.94817	0.655000	0.94253	TCA	KRT33A	-	pfam_IF,prints_Keratin_I	ENSG00000006059		0.502	KRT33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT33A	HGNC	protein_coding	OTTHUMT00000257295.1	-	0.00	94	0	G	NM_004138		39505616	-1	tier1	-	no_errors	ENST00000007735	ensembl	human	known	74_37	nonsense	28.71	72	29	SNP	0.587	C
LCMT1	51451	genome.wustl.edu	37	16	25186294	25186294	+	Silent	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:25186294G>T	ENST00000399069.3	+	10	1076	c.921G>T	c.(919-921)ctG>ctT	p.L307L	LCMT1_ENST00000380966.4_Silent_p.L252L|LCMT1_ENST00000572869.1_3'UTR	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	307				EL -> DV (in Ref. 1; AAF18267). {ECO:0000305}.	C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)								GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	AAATGGAGCTGCTGGAGCAGC	0.443																																					Colon(200;565 2072 24396 47922 50898)												0													61.0	62.0	62.0					16																	25186294		1875	4105	5980	SO:0001819	synonymous_variant	0			AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.921G>T	16.37:g.25186294G>T			A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Silent	SNP	pfam_LCM_MeTrfase,pirsf_Leu_CO_MeTrfase_LCMT1	p.L307	ENST00000399069.3	37	c.921	CCDS45445.1	16																																																																																			LCMT1	-	pirsf_Leu_CO_MeTrfase_LCMT1	ENSG00000205629		0.443	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT1	HGNC	protein_coding	OTTHUMT00000435747.4	-	0.00	22	0	G	NM_016309		25186294	+1	tier1	-	no_errors	ENST00000399069	ensembl	human	known	74_37	silent	34.38	21	11	SNP	0.691	T
LILRA6	79168	genome.wustl.edu	37	19	54744236	54744236	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:54744236G>A	ENST00000396365.2	-	6	1211	c.1172C>T	c.(1171-1173)gCg>gTg	p.A391V	LILRA6_ENST00000391735.3_3'UTR|LILRA6_ENST00000419410.2_Missense_Mutation_p.A391V|LILRA6_ENST00000245621.5_Missense_Mutation_p.A391V|LILRA6_ENST00000440558.2_Intron|LILRB3_ENST00000407860.2_Intron|LILRA6_ENST00000270464.5_Intron	NM_024318.2	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6	391	Ig-like C2-type 2.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)		p.A391V(1)		central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(20)|ovary(3)|skin(2)|urinary_tract(2)	38	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTAGGTCCCCGCGTGGGCTGA	0.592																																																	1	Substitution - Missense(1)	endometrium(1)											68.0	96.0	87.0					19																	54744236		2203	4296	6499	SO:0001583	missense	0			AF041262	CCDS42610.1	19q13.4	2013-01-11	2005-05-17	2005-05-17	ENSG00000244482	ENSG00000244482		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15495	protein-coding gene	gene with protein product			"""leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 6"""	LILRB6		10941842	Standard	NM_024318		Approved	ILT8, CD85b		Q6PI73	OTTHUMG00000066635	ENST00000396365.2:c.1172C>T	19.37:g.54744236G>A	ENSP00000379651:p.Ala391Val			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A391V	ENST00000396365.2	37	c.1172	CCDS42610.1	19	.	.	.	.	.	.	.	.	.	.	G	9.149	1.015702	0.19355	.	.	ENSG00000244482	ENST00000419410;ENST00000421123;ENST00000396365;ENST00000245621	T;T;T	0.03242	4.0;4.0;4.0	2.39	-4.78	0.03209	Immunoglobulin subtype (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.213430	0.06219	N	0.686499	T	0.05318	0.0141	M	0.75085	2.285	0.09310	N	1	B;B;B	0.31817	0.241;0.271;0.341	B;B;B	0.28139	0.025;0.05;0.086	T	0.07947	-1.0746	10	0.46703	T	0.11	.	5.9955	0.19491	0.0:0.3583:0.4208:0.221	.	391;391;391	C9JFH3;Q6PI73;D3YTC4	.;LIRA6_HUMAN;.	V	391	ENSP00000411227:A391V;ENSP00000379651:A391V;ENSP00000245621:A391V	ENSP00000245621:A391V	A	-	2	0	LILRA6	59436048	0.000000	0.05858	0.000000	0.03702	0.329000	0.28539	-2.324000	0.01116	-2.421000	0.00563	0.195000	0.17529	GCG	LILRA6	-	smart_Ig_sub,smart_Ig_sub2	ENSG00000244482		0.592	LILRA6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	LILRA6	HGNC	protein_coding	OTTHUMT00000313725.1	-	0.00	99	0	G	NM_024318		54744236	-1	tier1	-	no_errors	ENST00000419410	ensembl	human	known	74_37	missense	29.81	73	31	SNP	0.000	A
LINC00283	100874057	genome.wustl.edu	37	13	103396902	103396902	+	RNA	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr13:103396902C>G	ENST00000430111.1	+	0	1275									long intergenic non-protein coding RNA 283																		AAAACAGTTTCTCTAAAGTGT	0.383																																																	0													132.0	112.0	118.0					13																	103396902		692	1591	2283			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103396902C>G				RNA	SNP	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.383	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	-	0.00	45	0	C			103396902	+1	tier1	-	no_errors	ENST00000430111	ensembl	human	known	74_37	rna	47.83	24	22	SNP	0.000	G
LINC00283	100874057	genome.wustl.edu	37	13	103397430	103397430	+	RNA	SNP	C	C	G	rs373154448		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr13:103397430C>G	ENST00000430111.1	+	0	1803									long intergenic non-protein coding RNA 283																		TGTATTGGCTCTGCAGGCTGA	0.403																																																	0								C	GLN/GLU	0,1384		0,0,692	162.0	126.0	137.0		5617	1.8	0.0	13		137	1,3181		0,1,1590	no	missense	CCDC168	NM_001146197.1	29	0,1,2282	GG,GC,CC		0.0314,0.0,0.0219		1873/7082	103397430	1,4565	692	1591	2283			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103397430C>G				RNA	SNP	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.403	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	-	0.00	33	0	C			103397430	+1	tier1	-	no_errors	ENST00000430111	ensembl	human	known	74_37	rna	23.53	26	8	SNP	0.038	G
LMX1B	4010	genome.wustl.edu	37	9	129377800	129377800	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:129377800G>T	ENST00000373474.4	+	2	285	c.278G>T	c.(277-279)aGc>aTc	p.S93I	LMX1B_ENST00000561065.1_Missense_Mutation_p.S70I|RP11-123K19.1_ENST00000451449.2_RNA|LMX1B_ENST00000526117.1_Missense_Mutation_p.S93I|LMX1B_ENST00000425646.2_Missense_Mutation_p.S70I|LMX1B_ENST00000355497.5_Missense_Mutation_p.S93I|RP11-123K19.1_ENST00000425370.1_RNA			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	93	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						CTCACCACCAGCTGCTACTTC	0.622									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)												0													89.0	76.0	80.0					9																	129377800		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.278G>T	9.37:g.129377800G>T	ENSP00000362573:p.Ser93Ile		F8W7W6|O75463|Q5JU95|Q6ISC9	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.S93I	ENST00000373474.4	37	c.278	CCDS55342.1	9	.	.	.	.	.	.	.	.	.	.	G	30	5.052471	0.93793	.	.	ENSG00000136944	ENST00000526117;ENST00000373474;ENST00000355497;ENST00000425646	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	4.71	4.71	0.59529	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.91771	0.7397	M	0.76170	2.325	0.80722	D	1	D;P;D	0.54964	0.96;0.833;0.969	P;P;P	0.58130	0.833;0.521;0.595	D	0.93050	0.6465	10	0.87932	D	0	.	16.2213	0.82258	0.0:0.0:1.0:0.0	.	70;70;93	B7ZLH2;O60663;F8VYP0	.;LMX1B_HUMAN;.	I	93;93;93;70	ENSP00000436930:S93I;ENSP00000362573:S93I;ENSP00000347684:S93I;ENSP00000390923:S70I	ENSP00000347684:S93I	S	+	2	0	LMX1B	128417621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.261000	0.43276	2.180000	0.69256	0.561000	0.74099	AGC	LMX1B	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000136944		0.622	LMX1B-002	KNOWN	basic|CCDS	protein_coding	LMX1B	HGNC	protein_coding	OTTHUMT00000054123.2		0.00	36	0	G			129377800	+1			no_errors	ENST00000355497	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	T
CADM3	57863	genome.wustl.edu	37	1	159166613	159166613	+	Intron	DEL	T	T	-	rs533935187		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:159166613delT	ENST00000368125.4	+	7	939				CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Intron	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTCCCAGTTATTTTTTTTTTT	0.527											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.783-68T>-	1.37:g.159166613delT		1799	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	DEL	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.527	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1		0.00	16	0	T	NM_021189		159166613	-1	tier1		no_errors	ENST00000415675	ensembl	human	known	74_37	rna	15.62	27	5	DEL	0.000	-
LOC101927542	101927542	genome.wustl.edu	37	1	83912348	83912348	+	lincRNA	SNP	C	C	T	rs370704857		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:83912348C>T	ENST00000446227.1	+	0	613																											AGACTGGCAACATTCTAAAGG	0.373																																																	0																																												0																															1.37:g.83912348C>T				RNA	SNP	-	NULL	ENST00000446227.1	37	NULL		1																																																																																			RP11-413G15.1	-	-	ENSG00000231364		0.373	RP11-413G15.1-001	KNOWN	basic	lincRNA	LOC101927542	Clone_based_vega_gene	lincRNA	OTTHUMT00000026942.1		0.00	19	0	C			83912348	+1			no_errors	ENST00000446227	ensembl	human	known	74_37	rna	15.79	16	3	SNP	0.005	T
LRRN2	10446	genome.wustl.edu	37	1	204587876	204587876	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:204587876C>G	ENST00000367175.1	-	1	3457	c.1245G>C	c.(1243-1245)gaG>gaC	p.E415D	LRRN2_ENST00000367177.3_Missense_Mutation_p.E415D|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Missense_Mutation_p.E415D|RP11-430C7.4_ENST00000453895.1_RNA			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	415	LRRCT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GGTCCGTCATCTCCCGGAAGG	0.667																																																	0													38.0	38.0	38.0					1																	204587876		2203	4300	6503	SO:0001583	missense	0			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1245G>C	1.37:g.204587876C>G	ENSP00000356143:p.Glu415Asp		B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.E415D	ENST00000367175.1	37	c.1245	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	C	9.674	1.147392	0.21288	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.60424	0.19;0.19;0.19	5.56	4.59	0.56863	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.43747	D	0.000540	T	0.33411	0.0862	N	0.12961	0.28	0.45930	D	0.998765	B	0.28584	0.216	B	0.25506	0.061	T	0.17410	-1.0370	10	0.07990	T	0.79	.	10.0018	0.41933	0.0:0.783:0.1408:0.0762	.	415	O75325	LRRN2_HUMAN	D	415	ENSP00000356144:E415D;ENSP00000356145:E415D;ENSP00000356143:E415D	ENSP00000356143:E415D	E	-	3	2	LRRN2	202854499	0.996000	0.38824	1.000000	0.80357	0.992000	0.81027	0.443000	0.21644	2.620000	0.88729	0.460000	0.39030	GAG	LRRN2	-	smart_Cys-rich_flank_reg_C	ENSG00000170382		0.667	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	-	0.00	33	0	C	NM_006338		204587876	-1	tier1	-	no_errors	ENST00000367175	ensembl	human	known	74_37	missense	30.77	36	16	SNP	1.000	G
LRRTM3	347731	genome.wustl.edu	37	10	68857428	68857428	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr10:68857428C>T	ENST00000361320.4	+	3	2198	c.1620C>T	c.(1618-1620)ctC>ctT	p.L540L	LRRTM3_ENST00000485868.1_3'UTR|CTNNA3_ENST00000373744.4_Intron|CTNNA3_ENST00000433211.2_Intron	NM_178011.3	NP_821079.3	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	540					positive regulation of beta-amyloid formation (GO:1902004)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	41						ATGAACTTCTCTCCCATAAGT	0.453																																																	0													168.0	149.0	155.0					10																	68857428		2203	4300	6503	SO:0001819	synonymous_variant	0			BX640611	CCDS7270.1	10q22.1	2007-01-22				ENSG00000198739			19410	protein-coding gene	gene with protein product		610869				12676565	Standard	XR_247527		Approved		uc001jmz.1	Q86VH5		ENST00000361320.4:c.1620C>T	10.37:g.68857428C>T			A8K2A3|Q2NKX7|Q6N0A3	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.L540	ENST00000361320.4	37	c.1620	CCDS7270.1	10																																																																																			LRRTM3	-	NULL	ENSG00000198739		0.453	LRRTM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM3	HGNC	protein_coding	OTTHUMT00000048277.2	-	0.00	67	0	C	NM_178011		68857428	+1	tier1	-	no_errors	ENST00000361320	ensembl	human	known	74_37	silent	26.76	52	19	SNP	1.000	T
LSM10	84967	genome.wustl.edu	37	1	36859680	36859680	+	Silent	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:36859680C>G	ENST00000315732.2	-	2	200	c.51G>C	c.(49-51)ctG>ctC	p.L17L	LSM10_ENST00000476041.1_5'UTR	NM_032881.1	NP_116270.1	Q969L4	LSM10_HUMAN	LSM10, U7 small nuclear RNA associated	17					gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U7 snRNP (GO:0005683)	histone pre-mRNA DCP binding (GO:0071208)			upper_aerodigestive_tract(1)|urinary_tract(1)	2		Myeloproliferative disorder(586;0.0393)				GTAGGATGATCAGGCTGTTCT	0.582																																																	0													71.0	65.0	67.0					1																	36859680		2203	4300	6503	SO:0001819	synonymous_variant	0			AF394685	CCDS408.1	1p34.3	2008-02-05			ENSG00000181817	ENSG00000181817			17562	protein-coding gene	gene with protein product						11574479	Standard	NM_032881		Approved	MGC15749	uc001cao.1	Q969L4	OTTHUMG00000008140	ENST00000315732.2:c.51G>C	1.37:g.36859680C>G				Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.L17	ENST00000315732.2	37	c.51	CCDS408.1	1																																																																																			LSM10	-	superfamily_LSM_dom	ENSG00000181817		0.582	LSM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSM10	HGNC	protein_coding	OTTHUMT00000022294.1	-	0.00	60	0	C	NM_032881		36859680	-1	tier1	-	no_errors	ENST00000315732	ensembl	human	known	74_37	silent	27.27	40	15	SNP	1.000	G
LTB4R	1241	genome.wustl.edu	37	14	24785316	24785316	+	Silent	SNP	C	C	G	rs375670032		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:24785316C>G	ENST00000396789.4	+	2	2184	c.459C>G	c.(457-459)ctC>ctG	p.L153L	LTB4R_ENST00000396782.2_Silent_p.L153L|LTB4R_ENST00000345363.3_Silent_p.L153L	NM_181657.3	NP_858043.1	Q15722	LT4R1_HUMAN	leukotriene B4 receptor	153					cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|muscle contraction (GO:0006936)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(265;0.018)		CACCCGTCCTCGCGTACCGCA	0.637																																																	0													60.0	60.0	60.0					14																	24785316		2203	4300	6503	SO:0001819	synonymous_variant	0			X98356	CCDS9626.1	14q11.2-q12	2012-08-10			ENSG00000213903	ENSG00000213903		"""GPCR / Class A : Leukotriene receptors"""	6713	protein-coding gene	gene with protein product		601531		P2RY7, GPR16, CMKRL1		8921391, 8702478	Standard	NM_181657		Approved	BLTR, P2Y7, LTB4R1	uc001wos.3	Q15722	OTTHUMG00000029346	ENST00000396789.4:c.459C>G	14.37:g.24785316C>G			Q13305|Q53XV5|Q92641|Q9BSU5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Leukotriene_B4_typ-1_rcpt,prints_Leukotriene_B4_rcpt,prints_GPCR_Rhodpsn	p.L153	ENST00000396789.4	37	c.459	CCDS9626.1	14																																																																																			LTB4R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000213903		0.637	LTB4R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LTB4R	HGNC	protein_coding	OTTHUMT00000073198.4	-	0.00	22	0	C			24785316	+1	tier1	-	no_errors	ENST00000345363	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.000	G
LYSMD1	388695	genome.wustl.edu	37	1	151134280	151134280	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:151134280C>T	ENST00000368908.5	-	2	1137	c.477G>A	c.(475-477)aaG>aaA	p.K159K	LYSMD1_ENST00000440902.2_Silent_p.K111K	NM_212551.4	NP_997716.1	Q96S90	LYSM1_HUMAN	LysM, putative peptidoglycan-binding, domain containing 1	159										endometrium(2)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AATCAAGCTTCTTAAGGAAAT	0.512																																																	0													153.0	153.0	153.0					1																	151134280		2203	4300	6503	SO:0001819	synonymous_variant	0			BX647911	CCDS986.1, CCDS44218.1	1q21.2	2008-02-05			ENSG00000163155	ENSG00000163155			32070	protein-coding gene	gene with protein product						12477932	Standard	NM_212551		Approved	SB145, MGC35223, RP11-68I18.5	uc001ewy.3	Q96S90	OTTHUMG00000012260	ENST00000368908.5:c.477G>A	1.37:g.151134280C>T			B4DQA1|Q69YX9	Silent	SNP	pfam_LysM_dom,smart_LysM_dom	p.K159	ENST00000368908.5	37	c.477	CCDS986.1	1																																																																																			LYSMD1	-	NULL	ENSG00000163155		0.512	LYSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYSMD1	HGNC	protein_coding	OTTHUMT00000034070.3	-	0.00	83	0	C	NM_212551		151134280	-1	tier1	-	no_errors	ENST00000368908	ensembl	human	known	74_37	silent	39.00	60	39	SNP	1.000	T
MAP7D2	256714	genome.wustl.edu	37	X	20030483	20030483	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:20030483G>A	ENST00000379651.3	-	14	1951	c.1933C>T	c.(1933-1935)Cag>Tag	p.Q645*	MAP7D2_ENST00000452324.3_Nonsense_Mutation_p.Q593*|MAP7D2_ENST00000379643.5_Nonsense_Mutation_p.Q686*|MAP7D2_ENST00000443379.3_Nonsense_Mutation_p.Q600*|MAP7D2_ENST00000543767.1_Nonsense_Mutation_p.Q530*	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	645					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						TCCATAGACTGAACTTCTTCA	0.398																																																	0													149.0	145.0	147.0					X																	20030483		2203	4300	6503	SO:0001587	stop_gained	0			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.1933C>T	X.37:g.20030483G>A	ENSP00000368972:p.Gln645*		B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Nonsense_Mutation	SNP	pfam_MAP7	p.Q686*	ENST00000379651.3	37	c.2056	CCDS14195.1	X	.	.	.	.	.	.	.	.	.	.	G	38	7.112271	0.98070	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000544957;ENST00000452324	.	.	.	5.54	4.65	0.58169	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-22.4837	14.7694	0.69665	0.0:0.0:0.8546:0.1454	.	.	.	.	X	645;686;530;600;328;593	.	ENSP00000368964:Q686X	Q	-	1	0	MAP7D2	19940404	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.523000	0.67099	1.063000	0.40649	0.525000	0.51046	CAG	MAP7D2	-	NULL	ENSG00000184368		0.398	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP7D2	HGNC	protein_coding	OTTHUMT00000056001.1	-	0.00	30	0	G	NM_152780		20030483	-1	tier1	-	no_errors	ENST00000379643	ensembl	human	known	74_37	nonsense	68.18	7	15	SNP	1.000	A
MAGEC2	51438	genome.wustl.edu	37	X	141290896	141290896	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:141290896G>A	ENST00000247452.3	-	3	1225	c.878C>T	c.(877-879)tCt>tTt	p.S293F		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	293	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					ATATGGAGGAGAACTGTGGGG	0.507										HNSCC(46;0.14)																																							0													83.0	83.0	83.0					X																	141290896		2203	4300	6503	SO:0001583	missense	0			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.878C>T	X.37:g.141290896G>A	ENSP00000354660:p.Ser293Phe		Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S293F	ENST00000247452.3	37	c.878	CCDS14678.1	X	.	.	.	.	.	.	.	.	.	.	-	10.86	1.469594	0.26423	.	.	ENSG00000046774	ENST00000247452	T	0.05382	3.45	0.988	-0.414	0.12359	.	0.651748	0.13406	U	0.390244	T	0.08358	0.0208	L	0.29908	0.895	0.09310	N	1	P	0.35908	0.527	P	0.50192	0.634	T	0.38067	-0.9678	10	0.87932	D	0	.	3.6472	0.08189	0.0:0.0:0.4491:0.5509	.	293	Q9UBF1	MAGC2_HUMAN	F	293	ENSP00000354660:S293F	ENSP00000354660:S293F	S	-	2	0	MAGEC2	141118562	0.469000	0.25846	0.011000	0.14972	0.121000	0.20230	0.783000	0.26802	-0.176000	0.10707	0.284000	0.19432	TCT	MAGEC2	-	pfam_MAGE,pfscan_MAGE	ENSG00000046774		0.507	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEC2	HGNC	protein_coding	OTTHUMT00000058611.1	-	0.00	21	0	G	NM_016249		141290896	-1	tier1	-	no_errors	ENST00000247452	ensembl	human	known	74_37	missense	29.03	44	18	SNP	0.011	A
MARCH6	10299	genome.wustl.edu	37	5	10403651	10403651	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:10403651G>C	ENST00000274140.5	+	15	1462	c.1330G>C	c.(1330-1332)Gag>Cag	p.E444Q	MARCH6_ENST00000503788.1_Missense_Mutation_p.E339Q|MARCH6_ENST00000449913.2_Missense_Mutation_p.E396Q|MARCH6_ENST00000510792.1_Missense_Mutation_p.E142Q	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	444					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						ACTACTGAGAGAGGTAAGTCC	0.428																																																	0													140.0	124.0	129.0					5																	10403651		2203	4300	6503	SO:0001583	missense	0			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1330G>C	5.37:g.10403651G>C	ENSP00000274140:p.Glu444Gln		A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.E444Q	ENST00000274140.5	37	c.1330	CCDS34135.1	5	.	.	.	.	.	.	.	.	.	.	G	25.8	4.678524	0.88542	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.68815	0.3042	M	0.83852	2.665	0.80722	D	1	D;D;D;D	0.89917	0.99;1.0;1.0;1.0	D;D;D;D	0.85130	0.953;0.997;0.997;0.992	T	0.68047	-0.5512	10	0.37606	T	0.19	-20.9075	19.4918	0.95052	0.0:0.0:1.0:0.0	.	339;396;24;444	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	Q	396;339;444;142	ENSP00000414643:E396Q;ENSP00000425930:E339Q;ENSP00000274140:E444Q;ENSP00000424512:E142Q	ENSP00000274140:E444Q	E	+	1	0	MARCH6	10456651	1.000000	0.71417	1.000000	0.80357	0.549000	0.35272	9.505000	0.97989	2.616000	0.88540	0.557000	0.71058	GAG	MARCH6	-	NULL	ENSG00000145495		0.428	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	-	0.00	49	0	G	NM_005885		10403651	+1	tier1	-	no_errors	ENST00000274140	ensembl	human	known	74_37	missense	32.31	44	21	SNP	1.000	C
MARK1	4139	genome.wustl.edu	37	1	220791681	220791681	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:220791681G>A	ENST00000366917.4	+	8	848	c.582G>A	c.(580-582)atG>atA	p.M194I	MARK1_ENST00000366918.4_Missense_Mutation_p.M172I|MARK1_ENST00000402574.1_Missense_Mutation_p.M59I					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		ATGGTGATATGAATATTAAAA	0.328																																																	0													42.0	47.0	45.0					1																	220791681		2203	4300	6503	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.582G>A	1.37:g.220791681G>A	ENSP00000355884:p.Met194Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.M194I	ENST00000366917.4	37	c.582	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889733	0.91889	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.24350	1.86;1.86;1.86	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042980	0.85682	D	0.000000	T	0.39091	0.1065	N	0.21324	0.655	0.80722	D	1	P;P;D;D	0.64830	0.944;0.931;0.994;0.993	P;P;P;D	0.68765	0.892;0.692;0.899;0.96	T	0.33599	-0.9862	10	0.72032	D	0.01	.	18.9969	0.92817	0.0:0.0:1.0:0.0	.	194;59;194;172	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	I	59;172;194	ENSP00000386017:M59I;ENSP00000355885:M172I;ENSP00000355884:M194I	ENSP00000355884:M194I	M	+	3	0	MARK1	218858304	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.807000	0.99171	2.488000	0.83962	0.650000	0.86243	ATG	MARK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000116141		0.328	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	-	0.00	51	0	G			220791681	+1	tier1	-	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	28.00	36	14	SNP	1.000	A
MARVELD3	91862	genome.wustl.edu	37	16	71668213	71668213	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:71668213A>G	ENST00000268485.3	+	3	757	c.713A>G	c.(712-714)tAt>tGt	p.Y238C	MARVELD3_ENST00000567501.1_Silent_p.L51L|MARVELD3_ENST00000299952.4_Intron|MARVELD3_ENST00000565261.1_Intron	NM_052858.4	NP_443090.4	Q96A59	MALD3_HUMAN	MARVEL domain containing 3	238	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|tight junction (GO:0005923)				NS(1)|endometrium(3)|large_intestine(5)|lung(6)|skin(2)	17		Ovarian(137;0.125)				ATTTACTACTATCAGTTCGGA	0.557																																																	0													108.0	110.0	110.0					16																	71668213		2198	4300	6498	SO:0001583	missense	0			BC013376	CCDS10904.1, CCDS32478.1, CCDS59270.1	16q22.2	2008-02-05	2004-07-12	2004-07-14	ENSG00000140832	ENSG00000140832			30525	protein-coding gene	gene with protein product		614094	"""MARVEL (membrane-associating) domain containing 3"""	MRVLDC3			Standard	NM_001017967		Approved		uc002fat.4	Q96A59	OTTHUMG00000137591	ENST00000268485.3:c.713A>G	16.37:g.71668213A>G	ENSP00000268485:p.Tyr238Cys		A8K820|H3BQM5|Q96MJ4	Missense_Mutation	SNP	NULL	p.Y238C	ENST00000268485.3	37	c.713	CCDS10904.1	16	.	.	.	.	.	.	.	.	.	.	A	22.9	4.343854	0.82022	.	.	ENSG00000140832	ENST00000268485	T	0.59772	0.24	5.91	5.91	0.95273	Marvel (1);	.	.	.	.	T	0.75982	0.3924	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78097	-0.2337	9	0.59425	D	0.04	.	15.5295	0.75942	1.0:0.0:0.0:0.0	.	238	Q96A59	MALD3_HUMAN	C	238	ENSP00000268485:Y238C	ENSP00000268485:Y238C	Y	+	2	0	MARVELD3	70225714	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.120000	0.89581	2.254000	0.74563	0.533000	0.62120	TAT	MARVELD3	-	NULL	ENSG00000140832		0.557	MARVELD3-002	KNOWN	basic|CCDS	protein_coding	MARVELD3	HGNC	protein_coding	OTTHUMT00000268991.2	-	0.00	23	0	A	NM_052858		71668213	+1	tier1	-	no_errors	ENST00000268485	ensembl	human	known	74_37	missense	50.00	14	14	SNP	1.000	G
MATN2	4147	genome.wustl.edu	37	8	99033468	99033468	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:99033468G>A	ENST00000520016.1	+	12	1979	c.1855G>A	c.(1855-1857)Gaa>Aaa	p.E619K	MATN2_ENST00000521689.1_Missense_Mutation_p.E619K|MATN2_ENST00000522025.2_Missense_Mutation_p.E335K|MATN2_ENST00000524308.1_Missense_Mutation_p.E578K|MATN2_ENST00000254898.5_Missense_Mutation_p.E619K			O00339	MATN2_HUMAN	matrilin 2	619	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.E619K(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CCATGGCTGCGAACACATTTG	0.433																																																	2	Substitution - Missense(2)	large_intestine(2)											117.0	112.0	114.0					8																	99033468		1899	4120	6019	SO:0001583	missense	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1855G>A	8.37:g.99033468G>A	ENSP00000430487:p.Glu619Lys		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.E619K	ENST00000520016.1	37	c.1855	CCDS55264.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.31|19.31	3.803944|3.803944	0.70682|0.70682	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016|ENST00000518154	D;D;D;D;D|.	0.96830|.	-4.14;-4.14;-4.14;-4.14;-4.14|.	5.7|5.7	5.7|5.7	0.88788|0.88788	Epidermal growth factor-like (1);|.	0.000000|.	0.64402|.	D|.	0.000009|.	T|T	0.79511|0.79511	0.4458|0.4458	M|M	0.82630|0.82630	2.6|2.6	0.54753|0.54753	D|D	0.999989|0.999989	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.83275|.	0.991;0.994;0.996;0.994|.	T|T	0.80301|0.80301	-0.1440|-0.1440	10|5	0.72032|.	D|.	0.01|.	-26.7817|-26.7817	18.0216|18.0216	0.89257|0.89257	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	578;619;619;619|.	C9JH87;E9PF03;O00339-2;O00339|.	.;.;.;MATN2_HUMAN|.	K|Q	619;619;578;578;335;619|401	ENSP00000429977:E619K;ENSP00000254898:E619K;ENSP00000430221:E578K;ENSP00000429010:E335K;ENSP00000430487:E619K|.	ENSP00000254898:E619K|.	E|R	+|+	1|2	0|0	MATN2|MATN2	99102644|99102644	1.000000|1.000000	0.71417|0.71417	0.131000|0.131000	0.22000|0.22000	0.026000|0.026000	0.11368|0.11368	4.443000|4.443000	0.59994|0.59994	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GAA|CGA	MATN2	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000132561		0.433	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	-	0.00	48	0	G			99033468	+1	tier1	-	no_errors	ENST00000254898	ensembl	human	known	74_37	missense	27.91	31	12	SNP	1.000	A
MCHR2	84539	genome.wustl.edu	37	6	100395746	100395746	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:100395746C>T	ENST00000281806.2	-	3	598	c.284G>A	c.(283-285)cGa>cAa	p.R95Q	MCHR2_ENST00000369212.2_Missense_Mutation_p.R95Q	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CTCTCCCCCTCGGGCCCATTG	0.488																																																	0													99.0	102.0	101.0					6																	100395746		2203	4300	6503	SO:0001583	missense	0			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.284G>A	6.37:g.100395746C>T	ENSP00000281806:p.Arg95Gln		B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MCH2_receptor,prints_GPCR_Rhodpsn,prints_MCH_rcpt	p.R95Q	ENST00000281806.2	37	c.284	CCDS5044.1	6	.	.	.	.	.	.	.	.	.	.	C	9.769	1.172093	0.21704	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	T;T;T	0.71698	-0.59;-0.59;-0.59	4.57	0.0436	0.14222	GPCR, rhodopsin-like superfamily (1);	0.365474	0.20851	N	0.084534	T	0.24890	0.0604	N	0.11341	0.13	0.19300	N	0.999977	B	0.06786	0.001	B	0.13407	0.009	T	0.28170	-1.0052	10	0.35671	T	0.21	.	8.1229	0.30982	0.0:0.5776:0.0:0.4224	.	95	Q969V1	MCHR2_HUMAN	Q	95	ENSP00000403490:R95Q;ENSP00000281806:R95Q;ENSP00000358214:R95Q	ENSP00000281806:R95Q	R	-	2	0	MCHR2	100502467	0.000000	0.05858	0.328000	0.25416	0.920000	0.55202	-0.295000	0.08298	-0.392000	0.07751	0.650000	0.86243	CGA	MCHR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MCH2_receptor	ENSG00000152034		0.488	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MCHR2	HGNC	protein_coding	OTTHUMT00000041620.2	-	0.00	34	0	C	NM_032503		100395746	-1	tier1	-	no_errors	ENST00000281806	ensembl	human	known	74_37	missense	40.00	23	16	SNP	0.388	T
MCPH1	79648	genome.wustl.edu	37	8	6289088	6289088	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:6289088C>G	ENST00000344683.5	+	4	378	c.302C>G	c.(301-303)tCa>tGa	p.S101*	MCPH1_ENST00000519480.1_Nonsense_Mutation_p.S101*|MCPH1_ENST00000522905.1_Nonsense_Mutation_p.S101*	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	101					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GAACACTTATCAAGCCTAATT	0.289																																					Colon(95;1448 1467 8277 34473 35819)												0													102.0	99.0	100.0					8																	6289088		1819	4084	5903	SO:0001587	stop_gained	0			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.302C>G	8.37:g.6289088C>G	ENSP00000342924:p.Ser101*		B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Nonsense_Mutation	SNP	pfam_Microcephalin,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom,prints_BRCA1	p.S101*	ENST00000344683.5	37	c.302	CCDS43689.1	8	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099434	0.76983	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	.	.	.	5.23	5.23	0.72850	.	0.282774	0.33691	N	0.004641	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-7.5517	16.6455	0.85176	0.0:1.0:0.0:0.0	.	.	.	.	X	101	.	ENSP00000342924:S101X	S	+	2	0	MCPH1	6276496	0.003000	0.15002	0.009000	0.14445	0.022000	0.10575	1.578000	0.36525	2.600000	0.87896	0.655000	0.94253	TCA	MCPH1	-	NULL	ENSG00000147316		0.289	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCPH1	HGNC	protein_coding	OTTHUMT00000374532.2		0.00	13	0	C	NM_024596		6289088	+1			no_errors	ENST00000344683	ensembl	human	known	74_37	nonsense	58.33	5	7	SNP	0.032	G
MED13	9969	genome.wustl.edu	37	17	60032879	60032880	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:60032879_60032880insA	ENST00000397786.2	-	26	5907_5908	c.5831_5832insT	c.(5830-5832)atgfs	p.M1944fs		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	1944					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						GAGATGTCTGCATATTTAGAGT	0.347																																																	0																																										SO:0001589	frameshift_variant	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.5832dupT	17.37:g.60032880_60032880dupA	ENSP00000380888:p.Met1944fs		B2RU05|O60334	Frame_Shift_Ins	INS	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.M1944fs	ENST00000397786.2	37	c.5832_5831	CCDS42366.1	17																																																																																			MED13	-	pfam_Mediator_Med13	ENSG00000108510		0.347	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1		0.00	44	0	-	NM_005121		60032880	-1	tier1		no_errors	ENST00000397786	ensembl	human	known	74_37	frame_shift_ins	44.83	32	26	INS	1.000:1.000	A
METTL25	84190	genome.wustl.edu	37	12	82780586	82780586	+	Missense_Mutation	SNP	G	G	C	rs558856672		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:82780586G>C	ENST00000248306.3	+	2	333	c.264G>C	c.(262-264)atG>atC	p.M88I	METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	88							methyltransferase activity (GO:0008168)										TTTTAGGTATGACTGATTTTC	0.318																																																	0													65.0	67.0	66.0					12																	82780586		2203	4299	6502	SO:0001583	missense	0			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.264G>C	12.37:g.82780586G>C	ENSP00000248306:p.Met88Ile		Q9H5Y3	Missense_Mutation	SNP	NULL	p.M88I	ENST00000248306.3	37	c.264	CCDS9024.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.026|0.026	-1.374140|-1.374140	0.01214|0.01214	.|.	.|.	ENSG00000127720|ENSG00000127720	ENST00000248306;ENST00000548200|ENST00000550058	T|.	0.28454|.	1.61|.	5.39|5.39	3.14|3.14	0.36123|0.36123	.|.	1.208660|.	0.05641|.	N|.	0.583410|.	T|.	0.08537|.	0.0212|.	N|N	0.01048|0.01048	-1.04|-1.04	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|.	0.32188|.	-0.9916|.	10|.	0.17832|.	T|.	0.49|.	-0.1365|-0.1365	4.9705|4.9705	0.14113|0.14113	0.0:0.1043:0.2273:0.6684|0.0:0.1043:0.2273:0.6684	.|.	88|.	Q8N6Q8|.	CL026_HUMAN|.	I|S	88|47	ENSP00000248306:M88I|.	ENSP00000248306:M88I|.	M|X	+|+	3|2	0|2	C12orf26|C12orf26	81304717|81304717	0.007000|0.007000	0.16637|0.16637	0.009000|0.009000	0.14445|0.14445	0.167000|0.167000	0.22549|0.22549	0.787000|0.787000	0.26858|0.26858	0.561000|0.561000	0.29186|0.29186	0.650000|0.650000	0.86243|0.86243	ATG|TGA	METTL25	-	NULL	ENSG00000127720		0.318	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL25	HGNC	protein_coding	OTTHUMT00000408192.1	-	0.00	27	0	G	NM_032230		82780586	+1	tier1	-	no_errors	ENST00000248306	ensembl	human	known	74_37	missense	41.38	17	12	SNP	0.009	C
METTL2B	55798	genome.wustl.edu	37	7	128141942	128141942	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:128141942G>T	ENST00000262432.8	+	9	1146	c.1109G>T	c.(1108-1110)tGc>tTc	p.C370F	METTL2B_ENST00000480046.1_Missense_Mutation_p.C305F	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	370					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TGCAAATACTGCAAGCCCCTT	0.502																																																	0													151.0	156.0	154.0					7																	128141942		2203	4300	6503	SO:0001583	missense	0			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.1109G>T	7.37:g.128141942G>T	ENSP00000262432:p.Cys370Phe		B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase	p.C370F	ENST00000262432.8	37	c.1109	CCDS5803.2	7	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724237	0.30593	.	.	ENSG00000165055	ENST00000262432;ENST00000480046	T;T	0.11063	2.81;2.81	3.44	3.44	0.39384	.	0.481200	0.23338	N	0.049267	T	0.06005	0.0156	N	0.11560	0.145	0.24214	N	0.995466	B;B	0.18968	0.032;0.019	B;B	0.20184	0.028;0.009	T	0.26710	-1.0095	10	0.87932	D	0	-3.8494	8.2244	0.31560	0.0:0.0:0.7618:0.2382	.	305;370	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	F	370;305	ENSP00000262432:C370F;ENSP00000418402:C305F	ENSP00000262432:C370F	C	+	2	0	METTL2B	127929178	1.000000	0.71417	0.946000	0.38457	0.849000	0.48306	3.169000	0.50809	1.903000	0.55091	0.195000	0.17529	TGC	METTL2B	-	pirsf_MeTrfase	ENSG00000165055		0.502	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000289817.1	-	0.00	55	0	G	NM_018396		128141942	+1	tier1	-	no_errors	ENST00000262432	ensembl	human	known	74_37	missense	8.16	44	4	SNP	0.943	T
MIR509-1	574514	genome.wustl.edu	37	X	146340315	146340315	+	RNA	SNP	T	T	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:146340315T>G	ENST00000385265.1	-	0	94				MIR509-2_ENST00000390724.1_RNA|MIR509-3_ENST00000390725.1_RNA	NR_030236.1|NR_030586.1				microRNA 509-1																		GTACCAATCATTTTTAATTAT	0.458																																																	0													60.0	56.0	57.0					X																	146340315		1568	3572	5140			0					Xq27.3	2011-09-12	2007-10-23	2008-12-18	ENSG00000208000	ENSG00000208000		"""ncRNAs / Micro RNAs"""	32146	non-coding RNA	RNA, micro		300875	"""microRNA 509"""	MIRN509, MIRN509-1			Standard	NR_030236		Approved	hsa-mir-509, hsa-mir-509-1	uc022cfy.1				X.37:g.146340315T>G				RNA	SNP	-	NULL	ENST00000385265.1	37	NULL		X																																																																																			MIR509-2	-	-	ENSG00000212013		0.458	MIR509-1-201	KNOWN	basic	miRNA	MIR509-2	HGNC	miRNA		-	0.00	43	0	T	NR_030236		146340315	-1	tier1	-	no_errors	ENST00000390724	ensembl	human	known	74_37	rna	30.95	87	39	SNP	0.000	G
MTA3	57504	genome.wustl.edu	37	2	42931360	42931360	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:42931360C>G	ENST00000405094.1	+	12	1052	c.1052C>G	c.(1051-1053)tCc>tGc	p.S351C	MTA3_ENST00000406652.1_Missense_Mutation_p.S294C|MTA3_ENST00000472767.1_3'UTR|MTA3_ENST00000405592.1_Missense_Mutation_p.S294C|MTA3_ENST00000407270.3_Missense_Mutation_p.S351C|MTA3_ENST00000406911.1_Missense_Mutation_p.S350C			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	351						intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						AACCAAATATCCACTAGTAAT	0.418																																																	0													74.0	72.0	72.0					2																	42931360		1895	4110	6005	SO:0001583	missense	0			AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.1052C>G	2.37:g.42931360C>G	ENSP00000385823:p.Ser351Cys		Q9NSP2|Q9ULF4	Missense_Mutation	SNP	pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.S351C	ENST00000405094.1	37	c.1052		2	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344845	0.61073	.	.	ENSG00000057935	ENST00000405592;ENST00000406652;ENST00000407270;ENST00000282366;ENST00000406911;ENST00000405094	T;T;T;T;T	0.49139	0.79;0.79;0.81;0.8;0.8	5.75	3.88	0.44766	.	0.112616	0.64402	D	0.000006	T	0.63510	0.2517	M	0.70595	2.14	0.09310	N	1	D;D;D	0.67145	0.996;0.995;0.991	P;D;P	0.63703	0.827;0.917;0.76	T	0.57400	-0.7818	10	0.39692	T	0.17	-12.9852	13.9164	0.63899	0.3962:0.6038:0.0:0.0	.	350;351;294	E7EQY4;Q9BTC8-2;D6W5A2	.;.;.	C	294;294;351;351;350;351	ENSP00000383973:S294C;ENSP00000384249:S294C;ENSP00000385045:S351C;ENSP00000385241:S350C;ENSP00000385823:S351C	ENSP00000282366:S351C	S	+	2	0	MTA3	42784864	1.000000	0.71417	0.861000	0.33841	0.993000	0.82548	3.175000	0.50855	1.408000	0.46895	0.563000	0.77884	TCC	MTA3	-	NULL	ENSG00000057935		0.418	MTA3-017	KNOWN	basic	protein_coding	MTA3	HGNC	protein_coding	OTTHUMT00000318159.1	-	0.00	40	0	C	NM_020744		42931360	+1	tier1	-	no_errors	ENST00000405094	ensembl	human	known	74_37	missense	34.09	29	15	SNP	0.009	G
MTMR4	9110	genome.wustl.edu	37	17	56581711	56581711	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:56581711A>T	ENST00000323456.5	-	13	1562	c.1438T>A	c.(1438-1440)Ttg>Atg	p.L480M	MTMR4_ENST00000579925.1_Missense_Mutation_p.L480M	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	480	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGCTTAAGCAACTGATGAACA	0.512																																																	0													88.0	87.0	88.0					17																	56581711		2203	4300	6503	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.1438T>A	17.37:g.56581711A>T	ENSP00000325285:p.Leu480Met		D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.L480M	ENST00000323456.5	37	c.1438	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	A	19.19	3.779750	0.70107	.	.	ENSG00000108389	ENST00000323456	D	0.94723	-3.5	5.1	-1.45	0.08828	Myotubularin phosphatase domain (1);	0.071434	0.56097	D	0.000024	D	0.95636	0.8581	M	0.71296	2.17	0.58432	D	0.99999	D	0.89917	1.0	D	0.72338	0.977	D	0.93281	0.6660	10	0.42905	T	0.14	.	11.5733	0.50848	0.2927:0.0:0.7073:0.0	.	480	Q9NYA4	MTMR4_HUMAN	M	480	ENSP00000325285:L480M	ENSP00000325285:L480M	L	-	1	2	MTMR4	53936710	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	2.353000	0.44089	-0.162000	0.10964	0.383000	0.25322	TTG	MTMR4	-	NULL	ENSG00000108389		0.512	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1		0.00	36	0	A	NM_004687		56581711	-1			no_errors	ENST00000323456	ensembl	human	known	74_37	missense	18.92	30	7	SNP	1.000	T
MTOR	2475	genome.wustl.edu	37	1	11288958	11288958	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:11288958C>T	ENST00000361445.4	-	19	2873	c.2797G>A	c.(2797-2799)Gaa>Aaa	p.E933K	RNU6-291P_ENST00000384720.1_RNA	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	933					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	ACCAGCATTTCACTAGTGCTA	0.488																																																	0													165.0	137.0	147.0					1																	11288958		2203	4300	6503	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2797G>A	1.37:g.11288958C>T	ENSP00000354558:p.Glu933Lys		Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_Rapamycin-bd_dom,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_Rapamycin-bd_dom,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E933K	ENST00000361445.4	37	c.2797	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675124	0.88445	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.08634	3.07	5.19	5.19	0.71726	Domain of unknown function DUF3385,  target of rapamycin protein (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	M	0.81802	2.56	0.80722	D	1	P	0.47841	0.901	P	0.49361	0.608	T	0.01146	-1.1437	10	0.44086	T	0.13	-16.1765	19.0565	0.93067	0.0:1.0:0.0:0.0	.	933	P42345	MTOR_HUMAN	K	933	ENSP00000354558:E933K	ENSP00000354558:E933K	E	-	1	0	MTOR	11211545	1.000000	0.71417	0.995000	0.50966	0.943000	0.58893	7.204000	0.77872	2.584000	0.87258	0.591000	0.81541	GAA	MTOR	-	pfam_DUF3385_TOR,superfamily_ARM-type_fold	ENSG00000198793		0.488	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	-	0.00	67	0	C	NM_004958		11288958	-1	tier1	-	no_errors	ENST00000361445	ensembl	human	known	74_37	missense	27.38	61	23	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9073176	9073176	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:9073176G>T	ENST00000397910.4	-	3	14473	c.14270C>A	c.(14269-14271)cCt>cAt	p.P4757H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4759	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P4757L(2)|p.P4757R(2)|p.P390R(1)|p.P390L(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACAGAAGAAGGTAAGGTTGT	0.488																																																	6	Substitution - Missense(6)	large_intestine(3)|endometrium(3)											111.0	106.0	108.0					19																	9073176		2090	4211	6301	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14270C>A	19.37:g.9073176G>T	ENSP00000381008:p.Pro4757His		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P4757H	ENST00000397910.4	37	c.14270	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	2.899	-0.228034	0.06022	.	.	ENSG00000181143	ENST00000397910	T	0.25579	1.79	1.48	1.48	0.22813	.	.	.	.	.	T	0.19327	0.0464	L	0.29908	0.895	.	.	.	D	0.61697	0.99	P	0.45310	0.476	T	0.23797	-1.0178	8	0.87932	D	0	.	6.3871	0.21566	0.0:0.0:1.0:0.0	.	4757	B5ME49	.	H	4757	ENSP00000381008:P4757H	ENSP00000381008:P4757H	P	-	2	0	MUC16	8934176	0.001000	0.12720	0.003000	0.11579	0.030000	0.12068	0.512000	0.22755	1.120000	0.41904	0.306000	0.20318	CCT	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	52	0	G	NM_024690		9073176	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	32.81	43	21	SNP	0.003	T
MYH10	4628	genome.wustl.edu	37	17	8393817	8393817	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:8393817C>T	ENST00000269243.4	-	33	4770	c.4632G>A	c.(4630-4632)atG>atA	p.M1544I	MYH10_ENST00000379980.4_Missense_Mutation_p.M1560I|MYH10_ENST00000360416.3_Missense_Mutation_p.M1575I|MYH10_ENST00000396239.1_Missense_Mutation_p.M1565I	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1544					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						GCTGGGTCCTCATTTCCTCCA	0.557																																																	0													117.0	106.0	110.0					17																	8393817		2203	4300	6503	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4632G>A	17.37:g.8393817C>T	ENSP00000269243:p.Met1544Ile		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M1565I	ENST00000269243.4	37	c.4695	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	21.6	4.169189	0.78339	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98	4.77	4.77	0.60923	Myosin tail (1);	0.000000	0.85682	D	0.000000	T	0.71082	0.3298	L	0.48986	1.54	0.80722	D	1	B;B;B	0.23185	0.081;0.006;0.081	B;B;B	0.33121	0.158;0.044;0.158	T	0.64964	-0.6283	10	0.09338	T	0.73	.	18.3251	0.90251	0.0:1.0:0.0:0.0	.	1553;1575;1544	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	I	1544;1575;1565;1560	ENSP00000269243:M1544I;ENSP00000353590:M1575I;ENSP00000379539:M1565I;ENSP00000369315:M1560I	ENSP00000269243:M1544I	M	-	3	0	MYH10	8334542	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.603000	0.82811	2.629000	0.89072	0.655000	0.94253	ATG	MYH10	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000133026		0.557	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	-	0.00	32	0	C			8393817	-1	tier1	-	no_errors	ENST00000396239	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	T
MYH7	4625	genome.wustl.edu	37	14	23886443	23886443	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:23886443C>G	ENST00000355349.3	-	32	4600	c.4438G>C	c.(4438-4440)Gag>Cag	p.E1480Q	MIR208B_ENST00000401172.1_RNA|CTD-2201G16.1_ENST00000557368.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1480					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTGAAGAGCTCTGTGCTGAGG	0.587																																																	0													106.0	109.0	108.0					14																	23886443		2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4438G>C	14.37:g.23886443C>G	ENSP00000347507:p.Glu1480Gln		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1480Q	ENST00000355349.3	37	c.4438	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.109195	0.94292	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.84516	-1.86	5.27	5.27	0.74061	Myosin tail (1);	.	.	.	.	D	0.94997	0.8381	H	0.95645	3.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95845	0.8869	9	0.66056	D	0.02	.	19.0892	0.93219	0.0:1.0:0.0:0.0	.	1480	P12883	MYH7_HUMAN	Q	1480;1485	ENSP00000347507:E1480Q	ENSP00000347507:E1480Q	E	-	1	0	MYH7	22956283	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	7.314000	0.78988	2.746000	0.94184	0.591000	0.81541	GAG	MYH7	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000092054		0.587	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	-	0.00	35	0	C	NM_000257		23886443	-1	tier1	-	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	22.50	31	9	SNP	1.000	G
MYLIP	29116	genome.wustl.edu	37	6	16129565	16129565	+	Silent	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:16129565T>C	ENST00000356840.3	+	1	210	c.12T>C	c.(10-12)taT>taC	p.Y4Y	MYLIP_ENST00000349606.4_5'UTR	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	4	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			TGCTGTGTTATGTGACGAGGC	0.682																																																	0													31.0	30.0	31.0					6																	16129565		2186	4275	6461	SO:0001819	synonymous_variant	0			AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.12T>C	6.37:g.16129565T>C			Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Silent	SNP	pfam_FERM_N,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,pfscan_Znf_RING,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.Y4	ENST00000356840.3	37	c.12	CCDS4536.1	6																																																																																			MYLIP	-	smart_Band_41_domain,pfscan_FERM_domain	ENSG00000007944		0.682	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLIP	HGNC	protein_coding	OTTHUMT00000043864.1	-	0.00	57	0	T	NM_013262		16129565	+1	tier1	-	no_errors	ENST00000356840	ensembl	human	known	74_37	silent	38.60	35	22	SNP	1.000	C
MYO15A	51168	genome.wustl.edu	37	17	18023041	18023041	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:18023041C>T	ENST00000205890.5	+	2	1265	c.927C>T	c.(925-927)taC>taT	p.Y309Y		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	309					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.Y309Y(1)		breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCTACGGCTACGACGATTACG	0.607																																																	1	Substitution - coding silent(1)	large_intestine(1)											45.0	52.0	50.0					17																	18023041		1914	4110	6024	SO:0001819	synonymous_variant	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.927C>T	17.37:g.18023041C>T			B4DFC7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.Y309	ENST00000205890.5	37	c.927	CCDS42271.1	17																																																																																			MYO15A	-	NULL	ENSG00000091536		0.607	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	-	0.00	94	0	C	NM_016239		18023041	+1	tier1	-	no_errors	ENST00000205890	ensembl	human	known	74_37	silent	50.00	33	33	SNP	0.089	T
MYOT	9499	genome.wustl.edu	37	5	137211532	137211532	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:137211532C>T	ENST00000239926.4	+	3	745	c.371C>T	c.(370-372)tCa>tTa	p.S124L	MYOT_ENST00000509812.1_3'UTR|RP11-381K20.2_ENST00000514616.1_RNA|MYOT_ENST00000421631.2_5'UTR|MYOT_ENST00000515645.1_Missense_Mutation_p.S9L	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	124	Necessary for interaction with ACTN1.				muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)			cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			CAACAGTCCTCAGCTGGCCAA	0.368																																																	0													94.0	93.0	93.0					5																	137211532		2203	4300	6503	SO:0001583	missense	0			AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.371C>T	5.37:g.137211532C>T	ENSP00000239926:p.Ser124Leu		A0A4R6|B4DT79	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S124L	ENST00000239926.4	37	c.371	CCDS4194.1	5	.	.	.	.	.	.	.	.	.	.	C	11.21	1.572798	0.28092	.	.	ENSG00000120729	ENST00000239926;ENST00000515645	T;T	0.68331	-0.28;-0.32	5.62	3.83	0.44106	.	0.314300	0.22934	N	0.053865	T	0.47040	0.1424	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26780	-1.0093	10	0.28530	T	0.3	.	8.0402	0.30517	0.3629:0.5623:0.0:0.0748	.	124	Q9UBF9	MYOTI_HUMAN	L	124;9	ENSP00000239926:S124L;ENSP00000426281:S9L	ENSP00000239926:S124L	S	+	2	0	MYOT	137239431	0.109000	0.22037	0.978000	0.43139	0.729000	0.41735	2.015000	0.40961	1.365000	0.46057	0.655000	0.94253	TCA	MYOT	-	NULL	ENSG00000120729		0.368	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOT	HGNC	protein_coding	OTTHUMT00000251219.2	-	0.00	22	0	C	NM_006790		137211532	+1	tier1	-	no_errors	ENST00000239926	ensembl	human	known	74_37	missense	28.00	18	7	SNP	0.045	T
MYPN	84665	genome.wustl.edu	37	10	69961659	69961659	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr10:69961659G>A	ENST00000358913.5	+	18	4055	c.3567G>A	c.(3565-3567)gtG>gtA	p.V1189V	MYPN_ENST00000540630.1_Silent_p.V1189V|MYPN_ENST00000354393.2_Silent_p.V914V	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	1189	Ig-like 5.|Interaction with ACTN.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						GCCACCCCGTGAGACTGGAGT	0.527																																																	0													128.0	115.0	120.0					10																	69961659		2203	4300	6503	SO:0001819	synonymous_variant	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.3567G>A	10.37:g.69961659G>A			Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.V1189	ENST00000358913.5	37	c.3567	CCDS7275.1	10																																																																																			MYPN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000138347		0.527	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	-	0.00	19	0	G	NM_032578		69961659	+1	tier1	-	no_errors	ENST00000358913	ensembl	human	known	74_37	silent	30.43	16	7	SNP	0.993	A
NBAS	51594	genome.wustl.edu	37	2	15651430	15651430	+	Missense_Mutation	SNP	G	G	A	rs149760582		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:15651430G>A	ENST00000281513.5	-	10	816	c.791C>T	c.(790-792)tCa>tTa	p.S264L	NBAS_ENST00000441750.1_Missense_Mutation_p.S264L	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	264					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						AGAAGCTTTTGACATGCCTAC	0.378																																																	0								G	LEU/SER	0,4406		0,0,2203	108.0	109.0	109.0		791	4.7	0.0	2	dbSNP_134	109	1,8599	1.2+/-3.3	0,1,4299	no	missense	NBAS	NM_015909.2	145	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	264/2372	15651430	1,13005	2203	4300	6503	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.791C>T	2.37:g.15651430G>A	ENSP00000281513:p.Ser264Leu		O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.S264L	ENST00000281513.5	37	c.791	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219823	0.58560	0.0	1.16E-4	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.55588	0.51;0.51	5.62	4.72	0.59763	Quinoprotein amine dehydrogenase, beta chain-like (1);	0.060167	0.64402	D	0.000002	T	0.69079	0.3071	M	0.72894	2.215	0.09310	N	0.999997	D	0.76494	0.999	P	0.61874	0.895	T	0.65455	-0.6164	10	0.87932	D	0	.	15.5903	0.76523	0.0:0.1386:0.8614:0.0	.	264	A2RRP1	NBAS_HUMAN	L	264	ENSP00000413201:S264L;ENSP00000281513:S264L	ENSP00000281513:S264L	S	-	2	0	NBAS	15568881	1.000000	0.71417	0.004000	0.12327	0.932000	0.56968	5.704000	0.68347	1.474000	0.48178	0.467000	0.42956	TCA	NBAS	-	superfamily_Quino_amine_DH_bsu	ENSG00000151779		0.378	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	-	0.00	24	0	G	NM_015909		15651430	-1	tier1	rs149760582	no_errors	ENST00000281513	ensembl	human	known	74_37	missense	28.57	10	4	SNP	0.388	A
NBPF20	100288142	genome.wustl.edu	37	1	148344692	148344692	+	Missense_Mutation	SNP	G	G	C	rs374322358		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:148344692G>C	ENST00000369202.1	-	3	423	c.226C>G	c.(226-228)Cag>Gag	p.Q76E	NBPF20_ENST00000414710.2_Missense_Mutation_p.Q76E			Q3BBV1	NBPFK_HUMAN	neuroblastoma breakpoint family, member 20	76						cytoplasm (GO:0005737)				breast(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	27						TCCTTGAACTGTCGCTCATTC	0.532																																																	0								G		0,3298		0,0,1649	72.0	77.0	76.0			0.5	0.0	1		76	1,7363		0,1,3681	no	intergenic				0,1,5330	CC,CG,GG		0.0136,0.0,0.0094			148344692	1,10661	1649	3682	5331	SO:0001583	missense	0				CCDS72856.1	1q21.2	2014-01-16			ENSG00000203832			"""neuroblastoma breakpoint family"""	32000	protein-coding gene	gene with protein product		614007				16079250	Standard	NM_001278267		Approved			Q3BBV1	OTTHUMG00000042439	ENST00000369202.1:c.226C>G	1.37:g.148344692G>C	ENSP00000358203:p.Gln76Glu			Missense_Mutation	SNP	pfam_NBPF_dom	p.Q76E	ENST00000369202.1	37	c.226		1	.	.	.	.	.	.	.	.	.	.	.	0.929	-0.713275	0.03206	0.0	1.36E-4	ENSG00000203832	ENST00000369202;ENST00000369188;ENST00000414710	T;T;T	0.04234	4.0;4.08;3.67	0.521	0.521	0.17046	.	.	.	.	.	T	0.04363	0.0120	.	.	.	0.20821	N	0.999842	B;P	0.49783	0.259;0.928	B;P	0.53912	0.01;0.737	T	0.39820	-0.9595	6	0.40728	T	0.16	.	.	.	.	.	76;76	Q6P3W6;F5H1Q5	NBPFA_HUMAN;.	E	76	ENSP00000358203:Q76E;ENSP00000358189:Q76E;ENSP00000389520:Q76E	ENSP00000358189:Q76E	Q	-	1	0	NBPF20	146711316	0.000000	0.05858	0.047000	0.18901	0.012000	0.07955	0.086000	0.14935	0.529000	0.28599	0.184000	0.17185	CAG	NBPF20	-	NULL	ENSG00000203832		0.532	NBPF20-001	KNOWN	basic|appris_principal	protein_coding	NBPF20	HGNC	protein_coding	OTTHUMT00000100689.2	-	0.00	148	0	G			148344692	-1	tier1	-	no_errors	ENST00000369202	ensembl	human	known	74_37	missense	16.99	171	35	SNP	0.059	C
NDUFS8	4728	genome.wustl.edu	37	11	67800424	67800424	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:67800424G>T	ENST00000313468.5	+	4	251	c.144G>T	c.(142-144)atG>atT	p.M48I	MIR4691_ENST00000583764.1_RNA|NDUFS8_ENST00000528492.1_Intron|RP5-901A4.1_ENST00000532296.1_RNA	NM_002496.3	NP_002487.1	O00217	NDUS8_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)	48					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|lung(5)|skin(1)	8						AGATGGACATGAAGTCAGTGA	0.637																																					Colon(116;1205 2770 20054)												0													96.0	88.0	91.0					11																	67800424		2200	4294	6494	SO:0001583	missense	0			U65579	CCDS8176.1	11q13.2	2011-07-04	2002-08-29		ENSG00000110717	ENSG00000110717	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7715	protein-coding gene	gene with protein product	"""complex I 23kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial"""	602141	"""NADH dehydrogenase (ubiquinone) Fe-S protein 8 (23kD) (NADH-coenzyme Q reductase)"""			9666055, 9116042	Standard	NM_002496		Approved	TYKY, CI-23k	uc001onc.3	O00217	OTTHUMG00000167331	ENST00000313468.5:c.144G>T	11.37:g.67800424G>T	ENSP00000315774:p.Met48Ile		B2RB86|Q0VDA8	Nonsense_Mutation	SNP	NULL	p.E67*	ENST00000313468.5	37	c.199	CCDS8176.1	11	.	.	.	.	.	.	.	.	.	.	G	21.2	4.107574	0.77096	.	.	ENSG00000110717	ENST00000313468;ENST00000453471;ENST00000526339;ENST00000525419;ENST00000525628	D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15	5.19	5.19	0.71726	.	0.176942	0.64402	D	0.000017	D	0.92407	0.7590	M	0.71036	2.16	0.80722	D	1	P;B;B	0.35174	0.488;0.064;0.032	B;B;B	0.36092	0.217;0.019;0.003	D	0.90941	0.4797	10	0.22109	T	0.4	.	17.3053	0.87192	0.0:0.0:1.0:0.0	.	48;48;48	B4DYI3;E9PPW7;O00217	.;.;NDUS8_HUMAN	I	48;48;48;30;48	ENSP00000315774:M48I;ENSP00000403972:M48I;ENSP00000436287:M48I;ENSP00000433521:M30I;ENSP00000432968:M48I	ENSP00000315774:M48I	M	+	3	0	NDUFS8	67557000	1.000000	0.71417	1.000000	0.80357	0.132000	0.20833	9.678000	0.98647	2.417000	0.82017	0.655000	0.94253	ATG	NDUFS8	-	NULL	ENSG00000110717		0.637	NDUFS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFS8	HGNC	protein_coding	OTTHUMT00000394193.1	-	0.00	50	0	G	NM_002496		67800424	+1	tier1	-	no_errors	ENST00000531228	ensembl	human	known	74_37	nonsense	35.80	52	29	SNP	1.000	T
NEK1	4750	genome.wustl.edu	37	4	170523765	170523765	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:170523765C>A	ENST00000439128.2	-	2	657	c.17G>T	c.(16-18)aGa>aTa	p.R6I	NEK1_ENST00000511633.1_Missense_Mutation_p.R6I|NEK1_ENST00000507142.1_Missense_Mutation_p.R6I|NEK1_ENST00000512193.1_Missense_Mutation_p.R6I|NEK1_ENST00000510533.1_Missense_Mutation_p.R6I	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	6	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		CTTCTGTAGTCTAACATACTT	0.308																																																	0													130.0	126.0	127.0					4																	170523765		1805	4069	5874	SO:0001583	missense	0			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.17G>T	4.37:g.170523765C>A	ENSP00000408020:p.Arg6Ile		G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R6I	ENST00000439128.2	37	c.17	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	C	13.68	2.310346	0.40895	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02	5.28	3.27	0.37495	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.181664	0.38217	N	0.001779	T	0.10637	0.0260	N	0.00633	-1.31	0.46241	D	0.998941	B;D;B;D;B	0.55800	0.087;0.973;0.087;0.973;0.107	B;P;B;P;B	0.59825	0.074;0.864;0.096;0.864;0.155	T	0.27297	-1.0078	10	0.23891	T	0.37	.	6.205	0.20598	0.0:0.6532:0.0:0.3468	.	6;6;6;6;6	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	I	6	ENSP00000408020:R6I;ENSP00000423332:R6I;ENSP00000427653:R6I;ENSP00000424757:R6I;ENSP00000424938:R6I	ENSP00000408020:R6I	R	-	2	0	NEK1	170760340	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	1.956000	0.40382	1.211000	0.43351	0.591000	0.81541	AGA	NEK1	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000137601		0.308	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3		0.00	36	0	C			170523765	-1			no_errors	ENST00000507142	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.513	A
NFATC2	4773	genome.wustl.edu	37	20	50048903	50048903	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:50048903G>A	ENST00000396009.3	-	9	2642	c.2423C>T	c.(2422-2424)tCg>tTg	p.S808L	NFATC2_ENST00000610033.1_Missense_Mutation_p.S589L|NFATC2_ENST00000609507.1_Missense_Mutation_p.S589L|NFATC2_ENST00000371564.3_Missense_Mutation_p.S808L|NFATC2_ENST00000414705.1_Missense_Mutation_p.S788L|NFATC2_ENST00000609943.1_Missense_Mutation_p.S788L	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	808					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S808L(2)	EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GATCACAGGCGAGGCCTGCTG	0.647																																																	2	Substitution - Missense(2)	lung(2)											47.0	50.0	49.0					20																	50048903		2203	4300	6503	SO:0001583	missense	0			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2423C>T	20.37:g.50048903G>A	ENSP00000379330:p.Ser808Leu		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.S808L	ENST00000396009.3	37	c.2423	CCDS13437.1	20	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780159	0.49891	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.18960	2.19;2.18;2.21	5.45	5.45	0.79879	.	0.135690	0.50627	D	0.000108	T	0.15003	0.0362	L	0.36672	1.1	0.48901	D	0.999727	P;P;D;P	0.54601	0.931;0.913;0.967;0.931	B;B;B;B	0.34489	0.081;0.17;0.173;0.184	T	0.12400	-1.0549	10	0.11794	T	0.64	-4.4372	19.296	0.94122	0.0:0.0:1.0:0.0	.	788;788;808;808	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	L	808;808;788	ENSP00000360619:S808L;ENSP00000379330:S808L;ENSP00000396471:S788L	ENSP00000360619:S808L	S	-	2	0	NFATC2	49482310	1.000000	0.71417	0.903000	0.35520	0.152000	0.21847	9.452000	0.97615	2.563000	0.86464	0.650000	0.86243	TCG	NFATC2	-	NULL	ENSG00000101096		0.647	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2	-	0.00	53	0	G	NM_012340		50048903	-1	tier1	-	no_errors	ENST00000396009	ensembl	human	known	74_37	missense	33.00	67	33	SNP	0.998	A
NFE2L1	4779	genome.wustl.edu	37	17	46134843	46134843	+	Silent	SNP	C	C	T	rs374254839		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:46134843C>T	ENST00000362042.3	+	5	1567	c.951C>T	c.(949-951)ctC>ctT	p.L317L	NFE2L1_ENST00000536222.1_Silent_p.L161L|NFE2L1_ENST00000357480.5_Silent_p.L287L|RP5-890E16.4_ENST00000583349.1_RNA|NFE2L1_ENST00000585291.1_Silent_p.L287L|NFE2L1_ENST00000583378.1_Silent_p.L118L|NFE2L1_ENST00000582155.1_Silent_p.L129L|NFE2L1_ENST00000361665.3_Silent_p.L306L	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	317					anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GGCAAGATCTCATGTCCATCA	0.478																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	123.0	104.0	110.0		951	3.7	1.0	17		110	0,8600		0,0,4300	no	coding-synonymous	NFE2L1	NM_003204.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		317/773	46134843	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.951C>T	17.37:g.46134843C>T			D3DTU3|D3DTU5|Q12877|Q96FN6	Silent	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.L317	ENST00000362042.3	37	c.951	CCDS11524.1	17																																																																																			NFE2L1	-	NULL	ENSG00000082641		0.478	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	HGNC	protein_coding	OTTHUMT00000443019.1	-	0.00	42	0	C	NM_003204		46134843	+1	tier1	-	no_errors	ENST00000362042	ensembl	human	known	74_37	silent	38.64	27	17	SNP	1.000	T
NFYC	4802	genome.wustl.edu	37	1	41218824	41218824	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:41218824G>T	ENST00000308733.5	+	4	299	c.293G>T	c.(292-294)aGa>aTa	p.R98I	NFYC_ENST00000372654.1_Splice_Site_p.R98I|NFYC_ENST00000372651.1_Splice_Site_p.R98I|NFYC_ENST00000447388.3_Splice_Site_p.R98I|NFYC_ENST00000427410.2_Splice_Site_p.R60I|NFYC_ENST00000372653.1_Splice_Site_p.R98I|NFYC_ENST00000372652.1_Splice_Site_p.R98I|NFYC_ENST00000425457.2_Splice_Site_p.R98I|MIR30E_ENST00000362104.1_RNA|NFYC_ENST00000456393.2_Splice_Site_p.R98I|NFYC_ENST00000440226.3_Splice_Site_p.R98I			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	98					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)	p.R98I(1)		NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			TTGTTACAGAGAAATGATATC	0.398																																																	1	Substitution - Missense(1)	large_intestine(1)											97.0	89.0	92.0					1																	41218824		2203	4300	6503	SO:0001630	splice_region_variant	0			U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.292-1G>T	1.37:g.41218824G>T			B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold	p.R98I	ENST00000308733.5	37	c.293		1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606724	0.87157	.	.	ENSG00000066136	ENST00000427410;ENST00000447388;ENST00000425457;ENST00000453631;ENST00000456393;ENST00000372654;ENST00000372653;ENST00000372669;ENST00000372652;ENST00000372651;ENST00000440226;ENST00000525290;ENST00000530965;ENST00000308733	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.43688	1.51;1.51;1.51;0.94;1.51;1.51;1.51;1.51;0.94;1.51;1.51;0.94;0.94;0.94	5.4	5.4	0.78164	Histone-fold (2);Transcription factor CBF/NF-Y/archaeal histone (1);	0.000000	0.85682	D	0.000000	T	0.75228	0.3821	H	0.95504	3.68	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.994;0.999;0.996;0.997;0.994;0.994;0.999	D;D;D;D;D;D;D	0.87578	0.975;0.998;0.985;0.994;0.975;0.975;0.987	T	0.82494	-0.0429	10	0.87932	D	0	.	16.7079	0.85377	0.0:0.0:1.0:0.0	.	60;98;98;98;98;98;98	B4DW63;Q13952;Q5T6K9;Q13952-3;F8VWM3;Q13952-2;B4DUS6	.;NFYC_HUMAN;.;.;.;.;.	I	60;98;98;98;98;98;98;98;98;98;98;98;74;98	ENSP00000408315:R60I;ENSP00000404427:R98I;ENSP00000396620:R98I;ENSP00000397647:R98I;ENSP00000408867:R98I;ENSP00000361738:R98I;ENSP00000361737:R98I;ENSP00000361754:R98I;ENSP00000361736:R98I;ENSP00000361734:R98I;ENSP00000414299:R98I;ENSP00000436710:R98I;ENSP00000433413:R74I;ENSP00000312617:R98I	ENSP00000312617:R98I	R	+	2	0	NFYC	40991411	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.170000	0.94795	2.818000	0.97014	0.655000	0.94253	AGA	NFYC	-	pfam_CBFA_NFYB_domain,pfam_Histone_core_D,superfamily_Histone-fold	ENSG00000066136		0.398	NFYC-007	KNOWN	basic	protein_coding	NFYC	HGNC	protein_coding	OTTHUMT00000020802.1		0.00	35	0	G	NM_014223	Missense_Mutation	41218824	+1			no_errors	ENST00000308733	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
NIPA2	81614	genome.wustl.edu	37	15	23034295	23034295	+	5'UTR	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:23034295G>A	ENST00000337451.3	-	0	113				NIPA2_ENST00000359727.4_5'UTR|NIPA2_ENST00000539711.2_5'UTR|NIPA2_ENST00000398014.2_5'UTR|NIPA2_ENST00000398013.3_5'UTR|NIPA2_ENST00000559571.1_5'UTR	NM_030922.6	NP_112184.4	Q8N8Q9	NIPA2_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 2							early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(4)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;1.48e-06)|Epithelial(43;1.44e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000353)		ATTCGGGGCTGAAGCCGTTCG	0.706																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AY732242	CCDS73693.1, CCDS73694.1	15q11.2	2008-02-05			ENSG00000140157	ENSG00000140157			17044	protein-coding gene	gene with protein product		608146				14508708	Standard	NM_001008860		Approved		uc001yuz.3	Q8N8Q9	OTTHUMG00000129101	ENST00000337451.3:c.-500C>T	15.37:g.23034295G>A			F8W7Y8|Q96F03|Q9BVS2	RNA	SNP	-	NULL	ENST00000337451.3	37	NULL	CCDS10010.1	15																																																																																			NIPA2	-	-	ENSG00000140157		0.706	NIPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPA2	HGNC	protein_coding	OTTHUMT00000251137.1	-	0.00	16	0	G	NM_030922		23034295	-1	tier1	-	no_errors	ENST00000559571	ensembl	human	known	74_37	rna	21.74	18	5	SNP	0.198	A
NLRP5	126206	genome.wustl.edu	37	19	56538599	56538599	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:56538599G>C	ENST00000390649.3	+	7	1000	c.1000G>C	c.(1000-1002)Gag>Cag	p.E334Q		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	334	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		CAGTGTCACAGAGTTCATCTC	0.557																																																	0													38.0	39.0	39.0					19																	56538599		2061	4211	6272	SO:0001583	missense	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1000G>C	19.37:g.56538599G>C	ENSP00000375063:p.Glu334Gln		A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E334Q	ENST00000390649.3	37	c.1000	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	G	3.347	-0.133413	0.06711	.	.	ENSG00000171487	ENST00000390649	T	0.79653	-1.29	3.35	1.08	0.20341	NACHT nucleoside triphosphatase (1);	0.214319	0.23704	N	0.045392	T	0.66396	0.2785	L	0.33753	1.03	0.09310	N	1	P	0.38223	0.623	B	0.42882	0.401	T	0.55780	-0.8087	10	0.08381	T	0.77	.	4.5488	0.12098	0.129:0.229:0.642:0.0	.	334	P59047	NALP5_HUMAN	Q	334	ENSP00000375063:E334Q	ENSP00000375063:E334Q	E	+	1	0	NLRP5	61230411	0.971000	0.33674	0.002000	0.10522	0.002000	0.02628	2.314000	0.43743	0.375000	0.24679	0.655000	0.94253	GAG	NLRP5	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000171487		0.557	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	-	0.00	32	0	G	NM_153447		56538599	+1	tier1	-	no_errors	ENST00000390649	ensembl	human	known	74_37	missense	44.44	15	12	SNP	0.003	C
NQO2	4835	genome.wustl.edu	37	6	3006787	3006787	+	Start_Codon_SNP	SNP	A	A	G	rs138748428		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:3006787A>G	ENST00000338130.2	+	5	713	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	NQO2_ENST00000380441.1_Start_Codon_SNP_p.M1V|NQO2_ENST00000380455.4_Start_Codon_SNP_p.M1V|NQO2_ENST00000380454.4_Start_Codon_SNP_p.M1V|NQO2_ENST00000606474.1_Start_Codon_SNP_p.M1V|NQO2_ENST00000380430.1_Start_Codon_SNP_p.M1V			P16083	NQO2_HUMAN	NAD(P)H dehydrogenase, quinone 2	1					memory (GO:0007613)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	dihydronicotinamide riboside quinone reductase activity (GO:0001512)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADPH dehydrogenase (quinone) activity (GO:0008753)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Dabigatran etexilate(DB06695)|Flavin adenine dinucleotide(DB03147)|Melatonin(DB01065)|Menadione(DB00170)|Primaquine(DB01087)	TTCTTACGCTATGGCAGGTAA	0.453																																																	0								A	VAL/MET	2,4404	4.2+/-10.8	0,2,2201	122.0	101.0	108.0		1	2.3	0.7	6	dbSNP_134	108	0,8596		0,0,4298	no	missense	NQO2	NM_000904.3	21	0,2,6499	GG,GA,AA		0.0,0.0454,0.0154	benign	1/232	3006787	2,13000	2203	4298	6501	SO:0001582	initiator_codon_variant	0			U07736	CCDS4481.1, CCDS75388.1	6p25.2	2012-09-20	2001-11-30	2001-12-07	ENSG00000124588	ENSG00000124588	1.6.5.2		7856	protein-coding gene	gene with protein product		160998	"""NAD(P)H menadione oxidoreductase 2, dioxin-inducible"""	NMOR2		1691923	Standard	XM_005249152		Approved	QR2, DHQV, DIA6	uc003mus.2	P16083	OTTHUMG00000014130	ENST00000338130.2:c.1A>G	6.37:g.3006787A>G	ENSP00000337773:p.Met1Val		B2R492|Q5TD04	Missense_Mutation	SNP	pfam_Flavodoxin_fold,pfam_FMN_Rdtase-like	p.M1V	ENST00000338130.2	37	c.1	CCDS4481.1	6	.	.	.	.	.	.	.	.	.	.	A	1.752	-0.488981	0.04352	4.54E-4	0.0	ENSG00000124588	ENST00000426637;ENST00000380472;ENST00000538898;ENST00000397717;ENST00000338130;ENST00000380441;ENST00000380455;ENST00000380454;ENST00000380430	T;T;T;T;T;T;T;T	0.20332	2.08;2.33;2.33;3.0;2.95;3.0;2.95;3.0	3.44	2.28	0.28536	.	0.835684	0.10754	N	0.637998	T	0.06872	0.0175	.	.	.	0.80722	D	1	B;B	0.14438	0.006;0.01	B;B	0.12837	0.008;0.002	T	0.11275	-1.0594	9	0.72032	D	0.01	0.1279	5.4307	0.16452	0.8713:0.0:0.1287:0.0	.	1;48	P16083;Q59EN2	NQO2_HUMAN;.	V	1;1;48;1;1;1;1;1;1	ENSP00000406951:M1V;ENSP00000369839:M1V;ENSP00000380829:M1V;ENSP00000337773:M1V;ENSP00000369806:M1V;ENSP00000369822:M1V;ENSP00000369821:M1V;ENSP00000369795:M1V	ENSP00000337773:M1V	M	+	1	0	NQO2	2951786	0.958000	0.32768	0.664000	0.29753	0.006000	0.05464	2.787000	0.47798	0.696000	0.31696	-0.250000	0.11733	ATG	NQO2	-	NULL	ENSG00000124588		0.453	NQO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NQO2	HGNC	protein_coding	OTTHUMT00000039651.1	-	0.00	49	0	A		Missense_Mutation	3006787	+1	tier1	rs138748428	no_errors	ENST00000338130	ensembl	human	known	74_37	missense	39.39	40	26	SNP	0.693	G
NSMAF	8439	genome.wustl.edu	37	8	59515783	59515783	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:59515783G>A	ENST00000038176.3	-	13	1243	c.1031C>T	c.(1030-1032)tCc>tTc	p.S344F	NSMAF_ENST00000427130.2_Missense_Mutation_p.S375F|NSMAF_ENST00000519858.1_5'UTR	NM_003580.3	NP_003571.2	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation associated factor	344	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				ceramide metabolic process (GO:0006672)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)|sphingomyelin phosphodiesterase activator activity (GO:0016230)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	38		all_lung(136;0.174)|Lung NSC(129;0.2)				TTCTGAGCTGGAATAATCATG	0.443																																																	0													156.0	150.0	152.0					8																	59515783		2203	4300	6503	SO:0001583	missense	0			X96586	CCDS6173.1, CCDS47864.1	8q12-q13	2013-01-10			ENSG00000035681	ENSG00000035681		"""WD repeat domain containing"""	8017	protein-coding gene	gene with protein product		603043				8808629, 10640829	Standard	NM_003580		Approved	FAN	uc011lee.2	Q92636	OTTHUMG00000164352	ENST00000038176.3:c.1031C>T	8.37:g.59515783G>A	ENSP00000038176:p.Ser344Phe		B4DFB0|E9PCH0|Q8IW26	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,pfam_GRAM,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_GRAM,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S375F	ENST00000038176.3	37	c.1124	CCDS6173.1	8	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750099	0.49257	.	.	ENSG00000035681	ENST00000038176;ENST00000427130	T;T	0.80909	-1.43;-1.43	5.93	-3.86	0.04230	BEACH domain (4);	1.057390	0.07159	N	0.850319	T	0.74129	0.3676	M	0.76170	2.325	0.21579	N	0.999632	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.004;0.006;0.006	T	0.58364	-0.7649	9	.	.	.	.	3.649	0.08196	0.1648:0.1356:0.4952:0.2044	.	375;344;344	Q92636-2;A8K9G4;Q92636	.;.;FAN_HUMAN	F	344;375	ENSP00000038176:S344F;ENSP00000411012:S375F	.	S	-	2	0	NSMAF	59678337	0.751000	0.28327	0.006000	0.13384	0.839000	0.47603	0.009000	0.13219	-0.330000	0.08514	0.655000	0.94253	TCC	NSMAF	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000035681		0.443	NSMAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMAF	HGNC	protein_coding	OTTHUMT00000378384.1	-	0.00	45	0	G	NM_003580		59515783	-1	tier1	-	no_errors	ENST00000427130	ensembl	human	known	74_37	missense	33.33	34	17	SNP	0.013	A
NUTM1	256646	genome.wustl.edu	37	15	34648143	34648143	+	Missense_Mutation	SNP	C	C	T	rs540031927		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:34648143C>T	ENST00000333756.4	+	7	2005	c.1850C>T	c.(1849-1851)tCa>tTa	p.S617L	NUTM1_ENST00000438749.3_Missense_Mutation_p.S635L|NUTM1_ENST00000537011.1_Missense_Mutation_p.S645L	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	617						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GATAGGACTTCAGAGGCTCTG	0.582																																																	0													23.0	23.0	23.0					15																	34648143		2195	4288	6483	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.1850C>T	15.37:g.34648143C>T	ENSP00000329448:p.Ser617Leu		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.S617L	ENST00000333756.4	37	c.1850	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	C	12.87	2.068221	0.36470	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.08546	3.08;3.08;3.08	5.63	4.61	0.57282	.	0.700115	0.12703	N	0.446152	T	0.07908	0.0198	L	0.43152	1.355	0.09310	N	1	B;B;B	0.14805	0.006;0.011;0.006	B;B;B	0.11329	0.005;0.006;0.003	T	0.16070	-1.0415	10	0.33141	T	0.24	.	6.4471	0.21882	0.0:0.8488:0.0:0.1512	.	635;645;617	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	L	645;635;617	ENSP00000444896:S645L;ENSP00000407031:S635L;ENSP00000329448:S617L	ENSP00000329448:S617L	S	+	2	0	C15orf55	32435435	0.001000	0.12720	0.010000	0.14722	0.141000	0.21300	1.354000	0.34056	2.651000	0.90000	0.655000	0.94253	TCA	NUTM1	-	NULL	ENSG00000184507		0.582	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	HGNC	protein_coding	OTTHUMT00000418026.1	-	0.00	39	0	C	NM_175741		34648143	+1	tier1	-	no_errors	ENST00000333756	ensembl	human	known	74_37	missense	37.50	25	15	SNP	0.005	T
OGFR	11054	genome.wustl.edu	37	20	61444660	61444660	+	Missense_Mutation	SNP	C	C	A	rs61743079		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:61444660C>A	ENST00000290291.6	+	7	1718	c.1693C>A	c.(1693-1695)Cgc>Agc	p.R565S	OGFR_ENST00000370461.1_Missense_Mutation_p.R513S	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	565	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CCCAGGCCCCCGCCCGGCAGG	0.741																																																	0													3.0	6.0	5.0					20																	61444660		1281	3014	4295	SO:0001583	missense	0			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1693C>A	20.37:g.61444660C>A	ENSP00000290291:p.Arg565Ser		O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.R565S	ENST00000290291.6	37	c.1693	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	A	0.130	-1.114132	0.01799	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.54866	0.55;0.55	1.46	-2.91	0.05631	.	.	.	.	.	T	0.23649	0.0572	N	0.14661	0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.19031	-1.0318	9	0.11182	T	0.66	.	0.4172	0.00450	0.232:0.1649:0.1659:0.4372	rs61743079	565;548;565	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	S	565;545;400;513	ENSP00000290291:R565S;ENSP00000359491:R513S	ENSP00000290291:R565S	R	+	1	0	OGFR	60915105	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-0.466000	0.06672	-1.870000	0.01139	-1.293000	0.01348	CGC	OGFR	-	pfam_OGF_rcpt_rpt	ENSG00000060491		0.741	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1		0.00	19	0	C			61444660	+1			no_errors	ENST00000290291	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	A
OLFM1	10439	genome.wustl.edu	37	9	138011671	138011671	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:138011671G>A	ENST00000371793.3	+	6	1356	c.1105G>A	c.(1105-1107)Gcc>Acc	p.A369T	OLFM1_ENST00000252854.4_Missense_Mutation_p.A351T|OLFM1_ENST00000371796.3_Missense_Mutation_p.A342T	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	369	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		GGCCGTGTACGCCACCAACCA	0.627																																																	0													77.0	60.0	66.0					9																	138011671		2203	4300	6503	SO:0001583	missense	0			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.1105G>A	9.37:g.138011671G>A	ENSP00000360858:p.Ala369Thr		Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Missense_Mutation	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	p.A369T	ENST00000371793.3	37	c.1105		9	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325467	0.60743	.	.	ENSG00000130558	ENST00000252854;ENST00000371796;ENST00000371793	D;D;D	0.91237	-2.81;-2.81;-2.81	5.07	4.14	0.48551	Olfactomedin-like (3);Quinonprotein alcohol dehydrogenase-like (1);	0.053005	0.85682	D	0.000000	D	0.88976	0.6584	L	0.39566	1.225	0.58432	D	0.999993	D;P	0.57899	0.981;0.499	P;B	0.50049	0.629;0.217	D	0.86184	0.1608	10	0.23302	T	0.38	.	15.1732	0.72891	0.0:0.142:0.858:0.0	.	369;351	Q99784;Q6IMJ8	NOE1_HUMAN;.	T	351;342;369	ENSP00000252854:A351T;ENSP00000360861:A342T;ENSP00000360858:A369T	ENSP00000252854:A351T	A	+	1	0	OLFM1	137151492	1.000000	0.71417	0.998000	0.56505	0.852000	0.48524	7.578000	0.82498	1.079000	0.41038	0.561000	0.74099	GCC	OLFM1	-	pfam_Olfac-like,superfamily_Quinonprotein_ADH-like_supfam,smart_Olfac-like,pfscan_Olfac-like	ENSG00000130558		0.627	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	OLFM1	HGNC	protein_coding	OTTHUMT00000054974.1	-	0.00	17	0	G	NM_014279		138011671	+1	tier1	-	no_errors	ENST00000371793	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	A
OPA1	4976	genome.wustl.edu	37	3	193409881	193409881	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:193409881G>C	ENST00000392438.3	+	28	3082	c.2848G>C	c.(2848-2850)Gat>Cat	p.D950H	OPA1_ENST00000361908.3_Missense_Mutation_p.D987H|OPA1_ENST00000361828.2_Missense_Mutation_p.D968H|OPA1_ENST00000361510.2_Missense_Mutation_p.D1005H|OPA1_ENST00000361150.2_Missense_Mutation_p.D951H|OPA1_ENST00000361715.2_Missense_Mutation_p.D969H	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	950					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AGAAAAACTTGATGCTTTCAT	0.274																																																	0			GRCh37	CD070499	OPA1	D							18.0	19.0	18.0					3																	193409881		2165	4259	6424	SO:0001583	missense	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2848G>C	3.37:g.193409881G>C	ENSP00000376233:p.Asp950His		D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.D1005H	ENST00000392438.3	37	c.3013	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879276	0.72294	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150	D;D;D;D;D;D	0.95171	-3.21;-3.21;-3.22;-3.22;-3.22;-3.63	5.13	5.13	0.70059	.	0.103125	0.64402	D	0.000003	D	0.91727	0.7384	N	0.12182	0.205	0.47476	D	0.999431	B;B;B;B;P;B;P;B	0.47409	0.019;0.41;0.019;0.019;0.8;0.019;0.895;0.019	B;B;B;B;B;B;P;B	0.49708	0.019;0.135;0.025;0.031;0.259;0.04;0.62;0.04	D	0.93665	0.6985	10	0.87932	D	0	-21.0852	17.5551	0.87888	0.0:0.0:1.0:0.0	.	914;950;932;951;968;987;969;1005	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	H	987;950;1005;969;968;951	ENSP00000354681:D987H;ENSP00000376233:D950H;ENSP00000355324:D1005H;ENSP00000355311:D969H;ENSP00000354429:D968H;ENSP00000354781:D951H	ENSP00000354781:D951H	D	+	1	0	OPA1	194892575	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.678000	0.84035	2.373000	0.80994	0.650000	0.86243	GAT	OPA1	-	NULL	ENSG00000198836		0.274	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2	-	0.00	65	0	G	NM_130837		193409881	+1	tier1	-	no_errors	ENST00000361510	ensembl	human	known	74_37	missense	55.13	35	43	SNP	1.000	C
OR2AK2	391191	genome.wustl.edu	37	1	248129321	248129321	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:248129321C>G	ENST00000366480.3	+	1	787	c.688C>G	c.(688-690)Ctg>Gtg	p.L230V	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	230						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCTAGCCATTCTGGCTTCCTA	0.473																																					Melanoma(45;390 1181 23848 28461 41504)												0													100.0	87.0	91.0					1																	248129321		2203	4300	6503	SO:0001583	missense	0			BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.688C>G	1.37:g.248129321C>G	ENSP00000355436:p.Leu230Val		B2RND1|Q6IF05	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L230V	ENST00000366480.3	37	c.688	CCDS31102.1	1	.	.	.	.	.	.	.	.	.	.	.	2.153	-0.394024	0.04899	.	.	ENSG00000187080	ENST00000366480	T	0.00051	8.81	3.04	-6.09	0.02145	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.21240	0.645	0.09310	N	1	B	0.31485	0.325	B	0.39465	0.3	T	0.36939	-0.9727	9	0.02654	T	1	.	3.369	0.07213	0.477:0.2281:0.2095:0.0855	.	230	Q8NG84	O2AK2_HUMAN	V	230	ENSP00000355436:L230V	ENSP00000355436:L230V	L	+	1	2	OR2AK2	246195944	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-7.304000	0.00039	-1.544000	0.01721	0.462000	0.41574	CTG	OR2AK2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000187080		0.473	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AK2	HGNC	protein_coding	OTTHUMT00000096858.2	-	0.00	60	0	C	NM_001004491		248129321	+1	tier1	-	no_errors	ENST00000366480	ensembl	human	known	74_37	missense	37.93	54	33	SNP	0.000	G
OR4C6	219432	genome.wustl.edu	37	11	55432918	55432918	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:55432918C>T	ENST00000314259.3	+	1	305	c.276C>T	c.(274-276)ctC>ctT	p.L92L		NM_001004704.1	NP_001004704.1	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C, member 6	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L92L(2)|p.L92P(1)		breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|lung(49)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	71						CCATCTCTCTCAAAGGCTGCC	0.502																																																	3	Substitution - coding silent(2)|Substitution - Missense(1)	lung(2)|cervix(1)											140.0	126.0	131.0					11																	55432918		2200	4296	6496	SO:0001819	synonymous_variant	0			CR593785	CCDS31506.1	11q11	2012-08-09			ENSG00000181903	ENSG00000181903		"""GPCR / Class A : Olfactory receptors"""	14743	protein-coding gene	gene with protein product							Standard	NM_001004704		Approved		uc010rik.2	Q8NH72	OTTHUMG00000166800	ENST00000314259.3:c.276C>T	11.37:g.55432918C>T			B2RP11|Q6IFD2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L92	ENST00000314259.3	37	c.276	CCDS31506.1	11																																																																																			OR4C6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181903		0.502	OR4C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C6	HGNC	protein_coding	OTTHUMT00000391504.1	-	0.00	22	0	C	NM_001004704		55432918	+1	tier1	-	no_errors	ENST00000314259	ensembl	human	known	74_37	silent	20.83	19	5	SNP	0.000	T
OR4N2	390429	genome.wustl.edu	37	14	20295898	20295898	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:20295898C>T	ENST00000315947.1	+	1	291	c.291C>T	c.(289-291)tgC>tgT	p.C97C	OR4N2_ENST00000568211.1_Silent_p.C97C	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ACAGAGGCTGCATCACTCAGC	0.537																																																	0													124.0	140.0	135.0					14																	20295898		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.291C>T	14.37:g.20295898C>T			Q6IEY9|Q6IFA2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C97	ENST00000315947.1	37	c.291	CCDS32022.1	14																																																																																			OR4N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000176294		0.537	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	-	0.00	144	0	C			20295898	+1	tier1	-	no_errors	ENST00000315947	ensembl	human	known	74_37	silent	20.90	140	37	SNP	1.000	T
OR4K1	79544	genome.wustl.edu	37	14	20404053	20404053	+	Silent	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:20404053T>C	ENST00000285600.4	+	1	287	c.228T>C	c.(226-228)ttT>ttC	p.F76F		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AGTCTAACTTTGCCACCCCCA	0.383																																																	0													213.0	224.0	220.0					14																	20404053		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.228T>C	14.37:g.20404053T>C			B9EKV9|Q8NGD6|Q96R73	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F76	ENST00000285600.4	37	c.228	CCDS32025.1	14																																																																																			OR4K1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000155249		0.383	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K1	HGNC	protein_coding	OTTHUMT00000409881.1	-	0.00	96	0	T			20404053	+1	tier1	-	no_errors	ENST00000285600	ensembl	human	known	74_37	silent	20.69	69	18	SNP	0.870	C
OXR1	55074	genome.wustl.edu	37	8	107758054	107758054	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:107758054A>G	ENST00000442977.2	+	15	2552	c.2453A>G	c.(2452-2454)aAa>aGa	p.K818R	OXR1_ENST00000517566.2_Missense_Mutation_p.K817R|OXR1_ENST00000449762.2_Missense_Mutation_p.K160R|OXR1_ENST00000445937.1_Missense_Mutation_p.K790R|OXR1_ENST00000312046.6_Missense_Mutation_p.K783R|OXR1_ENST00000452423.2_Missense_Mutation_p.K238R|OXR1_ENST00000531443.1_Missense_Mutation_p.K790R|OXR1_ENST00000521592.1_Missense_Mutation_p.K63R|OXR1_ENST00000297447.6_Missense_Mutation_p.K187R	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	818	TLD.				adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			TTTTTTATCAAAGGAGACATG	0.294																																																	0													78.0	82.0	81.0					8																	107758054		2203	4299	6502	SO:0001583	missense	0			AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2453A>G	8.37:g.107758054A>G	ENSP00000405424:p.Lys818Arg		A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	pfam_TLDc,pfam_LysM_dom,pfam_GRAM,smart_LysM_dom,smart_TLDc	p.K818R	ENST00000442977.2	37	c.2453	CCDS56548.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.3|28.3	4.904171|4.904171	0.92035|0.92035	.|.	.|.	ENSG00000164830|ENSG00000164830	ENST00000519415|ENST00000445937;ENST00000531443;ENST00000517566;ENST00000452423;ENST00000442977;ENST00000312046;ENST00000449762;ENST00000297447;ENST00000521592	T|T;T;T;T;T;T;T;T;T	0.41758|0.42131	0.99|0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.62|5.62	5.62|5.62	0.85841|0.85841	.|TLDc (2);	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.56046|0.56046	0.1959|0.1959	L|L	0.45422|0.45422	1.42|1.42	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.997;1.0;0.998;1.0	.|D;D;D;D;D;D	.|0.97110	.|0.999;1.0;0.995;0.999;0.996;0.999	T|T	0.50162|0.50162	-0.8860|-0.8860	8|10	0.72032|0.26408	D|T	0.01|0.33	-26.143|-26.143	15.8264|15.8264	0.78709|0.78709	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|783;818;817;160;187;790	.|Q8N573-2;Q8N573;D3HIS6;B7Z8N5;Q8N573-4;Q8N573-5	.|.;OXR1_HUMAN;.;.;.;.	E|R	462|790;790;817;238;818;783;160;187;63	ENSP00000430701:K462E|ENSP00000402918:K790R;ENSP00000431966:K790R;ENSP00000429205:K817R;ENSP00000395032:K238R;ENSP00000405424:K818R;ENSP00000311026:K783R;ENSP00000408659:K160R;ENSP00000297447:K187R;ENSP00000435104:K63R	ENSP00000430701:K462E|ENSP00000297447:K187R	K|K	+|+	1|2	0|0	OXR1|OXR1	107827230|107827230	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.315000|9.315000	0.96313|0.96313	2.135000|2.135000	0.66039|0.66039	0.533000|0.533000	0.62120|0.62120	AAG|AAA	OXR1	-	pfam_TLDc,smart_TLDc	ENSG00000164830		0.294	OXR1-201	KNOWN	basic|CCDS	protein_coding	OXR1	HGNC	protein_coding		-	0.00	81	0	A	NM_181354		107758054	+1	tier1	-	no_errors	ENST00000442977	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	G
PABPC4	8761	genome.wustl.edu	37	1	40034566	40034567	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:40034566_40034567delAT	ENST00000372857.3	-	6	1575_1576	c.783_784delAT	c.(781-786)atatttfs	p.F262fs	SNORA55_ENST00000364587.1_RNA|PABPC4_ENST00000529216.1_5'UTR|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372862.3_Frame_Shift_Del_p.F262fs|PABPC4_ENST00000372858.3_Frame_Shift_Del_p.F262fs|PABPC4_ENST00000372856.3_Frame_Shift_Del_p.F262fs	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	262	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CGGCCTACAAATATGATTTTAC	0.381																																																	0																																										SO:0001589	frameshift_variant	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.783_784delAT	1.37:g.40034568_40034569delAT	ENSP00000361948:p.Phe262fs		B1ANQ8|Q4VC03|Q6P0N3	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.F262fs	ENST00000372857.3	37	c.784_783	CCDS438.1	1																																																																																			PABPC4	-	smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000090621		0.381	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1		0.00	42	0	AT	NM_001135653		40034567	-1	tier1		no_errors	ENST00000372858	ensembl	human	known	74_37	frame_shift_del	31.82	30	14	DEL	1.000:0.999	-
PAPD5	64282	genome.wustl.edu	37	16	50261884	50261884	+	Silent	SNP	T	T	C	rs373965165		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:50261884T>C	ENST00000561678.1	+	10	1634	c.1560T>C	c.(1558-1560)acT>acC	p.T520T	PAPD5_ENST00000436909.3_Silent_p.T630T|PAPD5_ENST00000357464.3_Silent_p.T551T|PAPD5_ENST00000573002.1_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5	504	Ser-rich.				histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		CCCAAACCACTAACACATCCA	0.438																																																	0													88.0	86.0	86.0					16																	50261884		1925	4138	6063	SO:0001819	synonymous_variant	0			AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.1560T>C	16.37:g.50261884T>C			B4DV38|Q9NW67|Q9Y6C0	Silent	SNP	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.T630	ENST00000561678.1	37	c.1890		16																																																																																			PAPD5	-	NULL	ENSG00000121274		0.438	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1	-	0.00	47	0	T	NM_022447		50261884	+1	tier1	-	no_errors	ENST00000436909	ensembl	human	known	74_37	silent	36.49	47	27	SNP	0.002	C
PARL	55486	genome.wustl.edu	37	3	183602518	183602518	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:183602518G>A	ENST00000317096.4	-	1	177	c.117C>T	c.(115-117)ctC>ctT	p.L39L	MIR4448_ENST00000584360.1_RNA|PARL_ENST00000435888.1_Silent_p.L39L|PARL_ENST00000311101.5_Silent_p.L39L|RP11-315J22.5_ENST00000445165.1_RNA	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	39					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			ACCTGCGTCCGAGGAGCTGCG	0.716											OREG0015941	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													7.0	8.0	8.0					3																	183602518		2128	4189	6317	SO:0001819	synonymous_variant	0			AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.117C>T	3.37:g.183602518G>A		1985	Q96CQ4|Q9BTJ6|Q9P1E3	Silent	SNP	pfam_Peptidase_S54_rhomboid_dom	p.L39	ENST00000317096.4	37	c.117	CCDS3248.1	3																																																																																			PARL	-	NULL	ENSG00000175193		0.716	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARL	HGNC	protein_coding	OTTHUMT00000346465.1	-	0.00	95	0	G	NM_018622		183602518	-1	tier1	-	no_errors	ENST00000317096	ensembl	human	known	74_37	silent	51.48	82	87	SNP	0.748	A
PAX7	5081	genome.wustl.edu	37	1	19018262	19018262	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:19018262G>A	ENST00000375375.3	+	5	1199	c.601G>A	c.(601-603)Gag>Aag	p.E201K	PAX7_ENST00000420770.2_Missense_Mutation_p.E201K|PAX7_ENST00000400661.3_Missense_Mutation_p.E199K	NM_002584.2|NM_013945.2	NP_002575.1|NP_039236.1	P23759	PAX7_HUMAN	paired box 7	201	Sufficient to mediate interaction with PAXBP1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|cartilage development (GO:0051216)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system development (GO:0048706)|muscle tissue morphogenesis (GO:0060415)|negative regulation of apoptotic process (GO:0043066)|neuron fate commitment (GO:0048663)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell fate commitment (GO:0010453)|regulation of protein binding (GO:0043393)|skeletal muscle satellite cell commitment (GO:0014813)|skeletal muscle tissue regeneration (GO:0043403)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX7/FOXO1(197)	breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)	31		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		CCGGCTGGACGAGGGCTCGGA	0.642			T	FOXO1A	alveolar rhabdomyosarcoma																																			Dom	yes		1	1p36.2-p36.12	5081	paired box gene 7		M	0													22.0	17.0	19.0					1																	19018262		2192	4291	6483	SO:0001583	missense	0			X96743	CCDS186.1, CCDS44074.1, CCDS44075.1	1p36.13	2011-06-20	2007-07-12		ENSG00000009709	ENSG00000009709		"""Paired boxes"", ""Homeoboxes / PRD class"""	8621	protein-coding gene	gene with protein product		167410	"""paired box gene 7"""			7981748, 8431641	Standard	NM_001135254		Approved	Hup1	uc001bay.3	P23759	OTTHUMG00000002433	ENST00000375375.3:c.601G>A	1.37:g.19018262G>A	ENSP00000364524:p.Glu201Lys		E9PFV9|Q0VA99|Q2PJS5	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,pfam_Pax7,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,prints_Paired_dom,pfscan_Homeobox_dom,pfscan_Paired_dom	p.E201K	ENST00000375375.3	37	c.601	CCDS186.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057558	0.76074	.	.	ENSG00000009709	ENST00000375375;ENST00000420770;ENST00000400661	D;D;D	0.95103	-3.61;-3.59;-3.61	4.98	4.98	0.66077	.	0.062950	0.64402	D	0.000006	D	0.93281	0.7859	M	0.77103	2.36	0.80722	D	1	B;P;P	0.52577	0.417;0.954;0.944	B;B;B	0.37267	0.054;0.245;0.222	D	0.94409	0.7630	10	0.66056	D	0.02	.	16.8192	0.85741	0.0:0.0:1.0:0.0	.	201;199;201	E9PFV9;P23759-2;P23759	.;.;PAX7_HUMAN	K	201;201;199	ENSP00000364524:E201K;ENSP00000403389:E201K;ENSP00000383502:E199K	ENSP00000364524:E201K	E	+	1	0	PAX7	18890849	1.000000	0.71417	0.991000	0.47740	0.772000	0.43724	9.823000	0.99369	2.313000	0.78055	0.655000	0.94253	GAG	PAX7	-	NULL	ENSG00000009709		0.642	PAX7-001	KNOWN	basic|CCDS	protein_coding	PAX7	HGNC	protein_coding	OTTHUMT00000006928.1	-	0.00	17	0	G	NM_002584		19018262	+1	tier1	-	no_errors	ENST00000375375	ensembl	human	known	74_37	missense	33.33	16	8	SNP	1.000	A
PCDHB14	56122	genome.wustl.edu	37	5	140603611	140603611	+	Missense_Mutation	SNP	C	C	G	rs201192118		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:140603611C>G	ENST00000239449.4	+	1	534	c.534C>G	c.(532-534)ttC>ttG	p.F178L	PCDHB14_ENST00000515856.2_Missense_Mutation_p.F25L	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	178	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATTCTCACTTCTACATTAAAA	0.418																																					Ovarian(141;50 1831 27899 33809 37648)												0													76.0	78.0	77.0					5																	140603611		2203	4300	6503	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.534C>G	5.37:g.140603611C>G	ENSP00000239449:p.Phe178Leu		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F178L	ENST00000239449.4	37	c.534	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	13.57	2.276512	0.40294	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.70749	-0.51;-0.51	5.02	4.15	0.48705	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.84915	0.5578	H	0.99565	4.63	0.27786	N	0.942971	P	0.41546	0.754	B	0.44163	0.443	T	0.82259	-0.0546	9	0.87932	D	0	.	9.7384	0.40401	0.0:0.8392:0.0:0.1608	.	178	Q9Y5E9	PCDBE_HUMAN	L	25;178	ENSP00000444518:F25L;ENSP00000239449:F178L	ENSP00000239449:F178L	F	+	3	2	PCDHB14	140583795	0.003000	0.15002	0.997000	0.53966	0.895000	0.52256	-0.002000	0.12924	1.251000	0.43983	0.650000	0.86243	TTC	PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120327		0.418	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	-	0.00	26	0	C	NM_018934		140603611	+1	tier1	-	no_errors	ENST00000239449	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.883	G
PCDHB14	56122	genome.wustl.edu	37	5	140603882	140603882	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:140603882C>G	ENST00000239449.4	+	1	805	c.805C>G	c.(805-807)Ctg>Gtg	p.L269V	PCDHB14_ENST00000515856.2_Missense_Mutation_p.L116V	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	269	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTAAGGATCTGGATGCAGG	0.423																																					Ovarian(141;50 1831 27899 33809 37648)												0													53.0	56.0	55.0					5																	140603882		2203	4300	6503	SO:0001583	missense	0			AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.805C>G	5.37:g.140603882C>G	ENSP00000239449:p.Leu269Val		B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L269V	ENST00000239449.4	37	c.805	CCDS4256.1	5	.	.	.	.	.	.	.	.	.	.	-	6.361	0.434746	0.12045	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.61627	0.09;0.09	4.75	-2.99	0.05497	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.48502	0.1503	L	0.61218	1.895	0.09310	N	0.999993	B	0.16166	0.016	B	0.32928	0.155	T	0.51276	-0.8726	9	0.38643	T	0.18	.	0.4585	0.00512	0.3425:0.2145:0.1173:0.3257	.	269	Q9Y5E9	PCDBE_HUMAN	V	116;269	ENSP00000444518:L116V;ENSP00000239449:L269V	ENSP00000239449:L269V	L	+	1	2	PCDHB14	140584066	0.000000	0.05858	0.578000	0.28575	0.627000	0.37826	-4.079000	0.00299	-0.644000	0.05465	-0.290000	0.09829	CTG	PCDHB14	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120327		0.423	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	-	0.00	28	0	C	NM_018934		140603882	+1	tier1	-	no_errors	ENST00000239449	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.314	G
PDPR	55066	genome.wustl.edu	37	16	70187389	70187389	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:70187389G>A	ENST00000288050.4	+	18	3105	c.2148G>A	c.(2146-2148)gaG>gaA	p.E716E	PDPR_ENST00000542659.1_Silent_p.E61E|RP11-296I10.3_ENST00000566989.1_RNA|PDPR_ENST00000562100.1_Intron|PDPR_ENST00000567046.1_Silent_p.E74E|PDPR_ENST00000398122.3_Silent_p.E616E|PDPR_ENST00000568530.1_Silent_p.E716E	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	716					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		TCCGAATTGAGAAGTTTTTTG	0.463																																																	0													103.0	105.0	104.0					16																	70187389		1926	4138	6064	SO:0001819	synonymous_variant	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.2148G>A	16.37:g.70187389G>A			A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.E716	ENST00000288050.4	37	c.2148	CCDS45520.1	16																																																																																			PDPR	-	pfam_GCV_T_N	ENSG00000090857		0.463	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	-	0.00	59	0	G	NM_017990		70187389	+1	tier1	-	no_errors	ENST00000288050	ensembl	human	known	74_37	silent	28.33	43	17	SNP	1.000	A
PEX2	5828	genome.wustl.edu	37	8	77912372	77912372	+	5'UTR	DEL	A	A	-	rs545258753	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:77912372delA	ENST00000357039.4	-	0	90				PEX2_ENST00000419564.2_Intron|PEX2_ENST00000520203.1_5'UTR|PEX2_ENST00000520103.1_Intron|PEX2_ENST00000522527.1_5'UTR	NM_000318.2|NM_001079867.1|NM_001172087.1	NP_000309|NP_001073336.1|NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2						bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						GAAGTGGCTGAAAAAAAAAAG	0.532																																																	0																																										SO:0001623	5_prime_UTR_variant	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000357039.4:c.-306T>-	8.37:g.77912372delA			Q567S6|Q9BW41	RNA	DEL	-	NULL	ENST00000357039.4	37	NULL	CCDS6221.1	8																																																																																			PEX2	-	-	ENSG00000164751		0.532	PEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1		0.00	20	0	A	NM_000318		77912372	-1	tier1		no_errors	ENST00000520203	ensembl	human	known	74_37	rna	10.71	25	3	DEL	0.004	-
PHACTR3	116154	genome.wustl.edu	37	20	58342365	58342365	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:58342365G>A	ENST00000371015.1	+	5	1133	c.666G>A	c.(664-666)gaG>gaA	p.E222E	PHACTR3_ENST00000395636.2_Silent_p.E181E|PHACTR3_ENST00000355648.4_Silent_p.E181E|PHACTR3_ENST00000395639.4_Intron|PHACTR3_ENST00000359926.3_Silent_p.E219E|PHACTR3_ENST00000361300.4_Intron|PHACTR3_ENST00000541461.1_Silent_p.E181E	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	222	Pro-rich.					nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			GACCTCTGGAGAGATCCGTGG	0.617																																																	0													37.0	36.0	36.0					20																	58342365		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.666G>A	20.37:g.58342365G>A			B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Silent	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.E222	ENST00000371015.1	37	c.666	CCDS13480.1	20																																																																																			PHACTR3	-	NULL	ENSG00000087495		0.617	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHACTR3	HGNC	protein_coding	OTTHUMT00000079923.3	-	0.00	30	0	G	NM_080672		58342365	+1	tier1	-	no_errors	ENST00000371015	ensembl	human	known	74_37	silent	29.03	22	9	SNP	1.000	A
PHC3	80012	genome.wustl.edu	37	3	169820479	169820479	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:169820479G>C	ENST00000494943.1	-	14	2653	c.2585C>G	c.(2584-2586)tCt>tGt	p.S862C	PHC3_ENST00000495893.2_Missense_Mutation_p.S874C|PHC3_ENST00000467570.1_Intron			Q8NDX5	PHC3_HUMAN	polyhomeotic homolog 3 (Drosophila)	862					multicellular organismal development (GO:0007275)	actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|upper_aerodigestive_tract(2)	26	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			TTCTTCTGCAGATGGATAAGT	0.443																																																	0													84.0	81.0	82.0					3																	169820479		1898	4124	6022	SO:0001583	missense	0				CCDS46952.1	3q26.32	2014-01-28	2006-09-12		ENSG00000173889	ENSG00000173889		"""Sterile alpha motif (SAM) domain containing"""	15682	protein-coding gene	gene with protein product	"""early development regulator 3"", ""polyhomeotic like 3"""		"""polyhomeotic like 3 (Drosophila)"""			12167701, 12384788	Standard	NM_024947		Approved	EDR3, FLJ12967, FLJ12729, HPH3	uc003fgl.2	Q8NDX5	OTTHUMG00000158777	ENST00000494943.1:c.2585C>G	3.37:g.169820479G>C	ENSP00000420271:p.Ser862Cys		A2RRP9|Q5HYF0|Q6NSG2|Q8NFT7|Q8NFZ1|Q8TBM2|Q9H971|Q9H9I4	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.S874C	ENST00000494943.1	37	c.2621		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.51|16.51	3.142443|3.142443	0.57044|0.57044	.|.	.|.	ENSG00000173889|ENSG00000173889	ENST00000484068|ENST00000494943;ENST00000495893	.|T;T	.|0.37058	.|1.25;1.22	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	.|0.088687	.|0.49916	.|D	.|0.000136	T|T	0.46229|0.46229	0.1382|0.1382	N|N	0.25647|0.25647	0.755|0.755	0.80722|0.80722	D|D	1|1	.|D;D	.|0.67145	.|0.993;0.996	.|D;D	.|0.74023	.|0.941;0.982	T|T	0.46091|0.46091	-0.9216|-0.9216	5|10	.|0.72032	.|D	.|0.01	-13.6302|-13.6302	13.8619|13.8619	0.63566|0.63566	0.0:0.0:0.8473:0.1527|0.0:0.0:0.8473:0.1527	.|.	.|862;874	.|Q8NDX5;Q8NDX5-7	.|PHC3_HUMAN;.	V|C	40|862;874	.|ENSP00000420271:S862C;ENSP00000420294:S874C	.|ENSP00000420271:S862C	L|S	-|-	1|2	2|0	PHC3|PHC3	171303173|171303173	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.166000|4.166000	0.58203|0.58203	2.538000|2.538000	0.85594|0.85594	0.650000|0.650000	0.86243|0.86243	CTG|TCT	PHC3	-	NULL	ENSG00000173889		0.443	PHC3-004	KNOWN	basic	protein_coding	PHC3	HGNC	protein_coding	OTTHUMT00000352182.3	-	0.00	27	0	G	NM_024947		169820479	-1	tier1	-	no_errors	ENST00000495893	ensembl	human	known	74_37	missense	51.35	18	19	SNP	1.000	C
PI4KAP2	375133	genome.wustl.edu	37	22	21846329	21846329	+	RNA	DEL	C	C	-	rs367705001|rs554599392		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:21846329delC	ENST00000450651.1	-	0	263							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						GCCAGCGGGGCGGGGGGGCCT	0.672																																																	0																																												0					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21846329delC			Q6ICJ0|Q6ZT68|Q8WUK7	RNA	DEL	-	NULL	ENST00000450651.1	37	NULL		22																																																																																			PI4KAP2	-	-	ENSG00000183506		0.672	PI4KAP2-005	KNOWN	basic	processed_transcript	PI4KAP2	HGNC	pseudogene	OTTHUMT00000334908.1		0.00	10	0	C			21846329	-1			no_errors	ENST00000450651	ensembl	human	known	74_37	rna	33.33	4	2	DEL	0.993	0
PIK3CA	5290	genome.wustl.edu	37	3	178948136	178948136	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:178948136G>A	ENST00000263967.3	+	20	3065	c.2908G>A	c.(2908-2910)Gaa>Aaa	p.E970K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	970	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E970K(4)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGGAGCCCAAGAATGCACAAA	0.338		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Substitution - Missense(4)	haematopoietic_and_lymphoid_tissue(2)|breast(2)											74.0	73.0	73.0					3																	178948136		1810	4078	5888	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2908G>A	3.37:g.178948136G>A	ENSP00000263967:p.Glu970Lys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E970K	ENST00000263967.3	37	c.2908	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857176	0.32791	.	.	ENSG00000121879	ENST00000263967	D	0.83163	-1.69	4.99	4.99	0.66335	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.790110	0.11564	N	0.551400	T	0.73202	0.3557	N	0.20304	0.555	0.80722	D	1	P	0.45428	0.858	B	0.41764	0.366	T	0.70099	-0.4965	10	0.02654	T	1	-19.3479	18.6208	0.91321	0.0:0.0:1.0:0.0	.	970	P42336	PK3CA_HUMAN	K	970	ENSP00000263967:E970K	ENSP00000263967:E970K	E	+	1	0	PIK3CA	180430830	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.311000	0.96282	2.459000	0.83118	0.585000	0.79938	GAA	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.338	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	-	0.00	29	0	G			178948136	+1	tier1	-	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	45.45	18	15	SNP	1.000	A
PIK3R5	23533	genome.wustl.edu	37	17	8791843	8791843	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:8791843A>T	ENST00000447110.1	-	10	1385	c.1261T>A	c.(1261-1263)Ttc>Atc	p.F421I	PIK3R5_ENST00000584803.1_Missense_Mutation_p.F421I|PIK3R5_ENST00000581552.1_Missense_Mutation_p.F421I	NM_001142633.2|NM_001251851.1|NM_001251852.1|NM_001251853.1|NM_001251855.1	NP_001136105.1|NP_001238780.1|NP_001238781.1|NP_001238782.1|NP_001238784.1	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	421					blood coagulation (GO:0007596)|cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|G-protein beta/gamma-subunit complex binding (GO:0031683)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(14)|prostate(3)|skin(4)|urinary_tract(1)	34						ATCCTGATGAACTTCTGCCCA	0.652																																					NSCLC(18;589 615 7696 20311 50332)												0													16.0	18.0	18.0					17																	8791843		2201	4298	6499	SO:0001583	missense	0			AF128881	CCDS11147.1, CCDS73986.1	17p13.1	2011-10-13	2008-02-04		ENSG00000141506	ENSG00000141506			30035	protein-coding gene	gene with protein product		611317				12507995	Standard	NM_014308		Approved	P101-PI3K, p101	uc002glt.3	Q8WYR1	OTTHUMG00000108197	ENST00000447110.1:c.1261T>A	17.37:g.8791843A>T	ENSP00000392812:p.Phe421Ile		B0LPH4|D3DTS3|Q5G936|Q5G938|Q5G939|Q8IZ23|Q9Y2Y2	Missense_Mutation	SNP	pfam_PI3K_1B_gamma_p101_su	p.F421I	ENST00000447110.1	37	c.1261	CCDS11147.1	17	.	.	.	.	.	.	.	.	.	.	A	13.47	2.246931	0.39697	.	.	ENSG00000141506	ENST00000269300;ENST00000447110	T	0.75938	-0.98	5.51	2.14	0.27477	.	0.373867	0.31268	N	0.007954	T	0.46132	0.1377	N	0.08118	0	0.29272	N	0.87061	B	0.17667	0.023	B	0.21151	0.033	T	0.20571	-1.0271	10	0.17832	T	0.49	-21.3479	3.1663	0.06536	0.5065:0.0:0.315:0.1785	.	421	Q8WYR1	PI3R5_HUMAN	I	421	ENSP00000392812:F421I	ENSP00000269300:F421I	F	-	1	0	PIK3R5	8732568	0.994000	0.37717	1.000000	0.80357	0.989000	0.77384	0.741000	0.26202	0.933000	0.37291	0.528000	0.53228	TTC	PIK3R5	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000141506		0.652	PIK3R5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIK3R5	HGNC	protein_coding	OTTHUMT00000227003.2	-	0.00	47	0	A	NM_014308		8791843	-1	tier1	-	no_errors	ENST00000447110	ensembl	human	known	74_37	missense	35.19	35	19	SNP	1.000	T
PIR	8544	genome.wustl.edu	37	X	15403203	15403203	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:15403203G>C	ENST00000380421.3	-	10	1256	c.796C>G	c.(796-798)Caa>Gaa	p.Q266E	FIGF_ENST00000297904.3_5'Flank|PIR_ENST00000380420.5_Missense_Mutation_p.Q266E	NM_001018109.2|NM_003662.3	NP_001018119.1|NP_003653.1	O00625	PIR_HUMAN	pirin (iron-binding nuclear protein)	266					monocyte differentiation (GO:0030224)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|quercetin 2,3-dioxygenase activity (GO:0008127)|transcription cofactor activity (GO:0003712)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9	Hepatocellular(33;0.183)					AGAATAGCTTGAGAAATCTCT	0.408																																					Ovarian(180;1587 2015 10555 34192 51653)												0													102.0	92.0	96.0					X																	15403203		2202	4300	6502	SO:0001583	missense	0			Y07868	CCDS14167.1	Xp22.31	2008-02-05			ENSG00000087842	ENSG00000087842			30048	protein-coding gene	gene with protein product		300931				9079676	Standard	NM_003662		Approved		uc004cwv.3	O00625	OTTHUMG00000021176	ENST00000380421.3:c.796C>G	X.37:g.15403203G>C	ENSP00000369786:p.Gln266Glu		Q5U0G0|Q6FHD2	Missense_Mutation	SNP	pfam_Pirin_C_dom,pfam_Pirin_N_dom,superfamily_RmlC_Cupin,pirsf_Pirin	p.Q266E	ENST00000380421.3	37	c.796	CCDS14167.1	X	.	.	.	.	.	.	.	.	.	.	G	11.06	1.529060	0.27387	.	.	ENSG00000087842	ENST00000380420;ENST00000380421	T;T	0.43688	0.94;0.94	5.28	0.269	0.15631	Cupin, RmlC-type (1);Pirin, C-terminal (1);	0.320500	0.33477	N	0.004866	T	0.28532	0.0706	L	0.46567	1.45	0.38690	D	0.952747	B	0.02656	0.0	B	0.06405	0.002	T	0.06303	-1.0834	10	0.46703	T	0.11	0.0554	3.015	0.06057	0.1422:0.2304:0.4328:0.1946	.	266	O00625	PIR_HUMAN	E	266	ENSP00000369785:Q266E;ENSP00000369786:Q266E	ENSP00000369785:Q266E	Q	-	1	0	PIR	15313124	0.958000	0.32768	0.951000	0.38953	0.933000	0.57130	0.652000	0.24888	-0.329000	0.08527	-0.297000	0.09499	CAA	PIR	-	pfam_Pirin_C_dom,superfamily_RmlC_Cupin,pirsf_Pirin	ENSG00000087842		0.408	PIR-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIR	HGNC	protein_coding	OTTHUMT00000055863.1	-	0.00	16	0	G	NM_003662		15403203	-1	tier1	-	no_errors	ENST00000380420	ensembl	human	known	74_37	missense	73.91	6	17	SNP	0.898	C
PKDCC	91461	genome.wustl.edu	37	2	42281407	42281407	+	Missense_Mutation	SNP	G	G	A	rs201349790		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:42281407G>A	ENST00000294964.5	+	3	1174	c.994G>A	c.(994-996)Gag>Aag	p.E332K		NM_138370.2	NP_612379.2			protein kinase domain containing, cytoplasmic											breast(2)|kidney(1)|lung(5)	8						GGGCTGGTGCGAGGGCATGAA	0.622																																																	0													45.0	37.0	40.0					2																	42281407		2202	4300	6502	SO:0001583	missense	0				CCDS33186.2	2p21	2014-01-28	2012-12-07		ENSG00000162878	ENSG00000162878			25123	protein-coding gene	gene with protein product	"""vertebrate lonesome kinase"""	614150	"""protein kinase domain containing, cytoplasmic homolog (mouse)"""			19097194, 19465597	Standard	NM_138370		Approved	SgK493, Vlk	uc002rsg.3	Q504Y2	OTTHUMG00000152303	ENST00000294964.5:c.994G>A	2.37:g.42281407G>A	ENSP00000294964:p.Glu332Lys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.E332K	ENST00000294964.5	37	c.994	CCDS33186.2	2	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313050	0.40895	.	.	ENSG00000162878	ENST00000294964	.	.	.	5.29	4.39	0.52855	Protein kinase, catalytic domain (1);	0.225081	0.47093	D	0.000260	T	0.29389	0.0732	N	0.08118	0	0.40462	D	0.980254	B	0.26602	0.154	B	0.13407	0.009	T	0.14476	-1.0471	9	0.27785	T	0.31	-11.4195	11.9104	0.52735	0.0:0.3846:0.6154:0.0	.	332	Q504Y2	PKDCC_HUMAN	K	332	.	ENSP00000294964:E332K	E	+	1	0	PKDCC	42134911	0.997000	0.39634	0.997000	0.53966	0.953000	0.61014	3.063000	0.49978	2.478000	0.83669	0.561000	0.74099	GAG	PKDCC	-	pfscan_Prot_kinase_dom	ENSG00000162878		0.622	PKDCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKDCC	HGNC	protein_coding	OTTHUMT00000325745.3	-	0.00	27	0	G			42281407	+1	tier1	rs201349790	no_errors	ENST00000294964	ensembl	human	known	74_37	missense	56.52	10	13	SNP	0.999	A
PKM	5315	genome.wustl.edu	37	15	72502159	72502159	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:72502159G>A	ENST00000335181.5	-	5	523	c.420C>T	c.(418-420)ctC>ctT	p.L140L	PKM_ENST00000565184.1_Silent_p.L140L|PKM_ENST00000319622.6_Silent_p.L140L|PKM_ENST00000568883.1_Intron|PKM_ENST00000565154.1_Silent_p.L140L|PKM_ENST00000568459.1_Silent_p.L140L|PKM_ENST00000449901.2_Silent_p.L125L|PKM_ENST00000389093.3_Silent_p.L140L	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle	140					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	GCGTGATTTTGAGAGTGGCTC	0.522																																																	0													209.0	177.0	188.0					15																	72502159		2199	4297	6496	SO:0001819	synonymous_variant	0			M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.420C>T	15.37:g.72502159G>A			A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Silent	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.L140	ENST00000335181.5	37	c.420	CCDS32284.1	15																																																																																			PKM	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase-like_dom,superfamily_Pyrv_Knase-like_insert_dom,tigrfam_Pyr_Knase	ENSG00000067225		0.522	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKM	HGNC	protein_coding	OTTHUMT00000420056.1	-	0.00	46	0	G			72502159	-1	tier1	-	no_errors	ENST00000319622	ensembl	human	known	74_37	silent	43.08	37	28	SNP	0.601	A
PLEKHG5	57449	genome.wustl.edu	37	1	6530391	6530391	+	Missense_Mutation	SNP	C	C	G	rs200641225		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:6530391C>G	ENST00000400915.3	-	17	1939	c.1873G>C	c.(1873-1875)Gac>Cac	p.D625H	PLEKHG5_ENST00000377748.1_Missense_Mutation_p.D646H|PLEKHG5_ENST00000544978.1_Missense_Mutation_p.D569H|PLEKHG5_ENST00000377725.1_Missense_Mutation_p.D569H|PLEKHG5_ENST00000400913.1_Missense_Mutation_p.D569H|PLEKHG5_ENST00000535355.1_Missense_Mutation_p.D638H|PLEKHG5_ENST00000377728.3_Missense_Mutation_p.D569H|PLEKHG5_ENST00000537245.1_Missense_Mutation_p.D648H|PLEKHG5_ENST00000340850.5_Missense_Mutation_p.D569H|PLEKHG5_ENST00000377737.2_Missense_Mutation_p.D569H|PLEKHG5_ENST00000377740.3_Missense_Mutation_p.D646H|PLEKHG5_ENST00000377732.1_Missense_Mutation_p.D606H	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	625					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		GCTGTCAAGTCCAGGTGCAGA	0.622																																																	0													93.0	87.0	89.0					1																	6530391		2203	4300	6503	SO:0001583	missense	0			AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.1873G>C	1.37:g.6530391C>G	ENSP00000383706:p.Asp625His		B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D648H	ENST00000400915.3	37	c.1942	CCDS41241.1	1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134304	0.77662	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377740;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	T;T;T;T;T;T;T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56;1.56	5.33	4.41	0.53225	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.57740	0.2074	M	0.84948	2.725	0.80722	D	1	P;D;D;D;D	0.89917	0.864;1.0;1.0;1.0;1.0	P;D;D;D;D	0.97110	0.88;0.999;0.989;1.0;0.999	T	0.63924	-0.6527	10	0.87932	D	0	-41.8034	12.1574	0.54085	0.0:0.916:0.0:0.084	.	638;569;646;646;625	F5GZ21;O94827-4;Q5SY18;O94827-2;O94827	.;.;.;.;PKHG5_HUMAN	H	646;569;569;625;646;606;569;569;638;569;475;648;569	ENSP00000366977:D646H;ENSP00000344570:D569H;ENSP00000383704:D569H;ENSP00000383706:D625H;ENSP00000366969:D646H;ENSP00000366961:D606H;ENSP00000366957:D569H;ENSP00000366954:D569H;ENSP00000441445:D638H;ENSP00000366966:D569H;ENSP00000439625:D648H;ENSP00000437710:D569H	ENSP00000344570:D569H	D	-	1	0	PLEKHG5	6452978	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	5.507000	0.66999	2.490000	0.84030	0.462000	0.41574	GAC	PLEKHG5	-	NULL	ENSG00000171680		0.622	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	HGNC	protein_coding	OTTHUMT00000002631.1	-	0.00	41	0	C	NM_020631		6530391	-1	tier1	-	no_errors	ENST00000537245	ensembl	human	known	74_37	missense	38.98	36	23	SNP	1.000	G
PLA2G2A	5320	genome.wustl.edu	37	1	20305040	20305040	+	Intron	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:20305040T>C	ENST00000375111.3	-	4	312				PLA2G2A_ENST00000496748.1_5'UTR|PLA2G2A_ENST00000400520.3_Intron	NM_000300.3|NM_001161727.1	NP_000291.1|NP_001155199.1	P14555	PA2GA_HUMAN	phospholipase A2, group IIA (platelets, synovial fluid)						defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of epithelial cell proliferation (GO:0050680)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidic acid metabolic process (GO:0046473)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|small molecule metabolic process (GO:0044281)|somatic stem cell maintenance (GO:0035019)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|phospholipid binding (GO:0005543)			central_nervous_system(1)|lung(6)|prostate(1)|stomach(1)	9		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Diclofenac(DB00586)|Ginkgo biloba(DB01381)|Indomethacin(DB00328)|Suramin(DB04786)	TTGGGAGTTGTCTGGTGATGG	0.532																																																	0													52.0	54.0	53.0					1																	20305040		2203	4300	6503	SO:0001627	intron_variant	0			BC005919	CCDS201.1	1p35	2008-09-19			ENSG00000188257	ENSG00000188257	3.1.1.4		9031	protein-coding gene	gene with protein product		172411		PLA2B, PLA2L		8838795	Standard	NM_000300		Approved		uc010odb.2	P14555	OTTHUMG00000002699	ENST00000375111.3:c.41-23A>G	1.37:g.20305040T>C			A8K5I7|Q6DN24|Q6IBD9|Q9UCD2	RNA	SNP	-	NULL	ENST00000375111.3	37	NULL	CCDS201.1	1																																																																																			PLA2G2A	-	-	ENSG00000188257		0.532	PLA2G2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2A	HGNC	protein_coding	OTTHUMT00000007675.1	-	0.00	63	0	T	NM_000300		20305040	-1	tier1	-	no_errors	ENST00000496748	ensembl	human	known	74_37	rna	34.12	55	29	SNP	0.000	C
PLK3	1263	genome.wustl.edu	37	1	45269890	45269890	+	Silent	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:45269890G>C	ENST00000372201.4	+	11	1553	c.1314G>C	c.(1312-1314)ctG>ctC	p.L438L	PLK3_ENST00000465443.1_3'UTR	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	438					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					TTTGTGCTCTGAGAAATTGTA	0.547																																																	0													140.0	130.0	133.0					1																	45269890		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1314G>C	1.37:g.45269890G>C			Q15767|Q5JR99|Q96CV1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.L438	ENST00000372201.4	37	c.1314	CCDS515.1	1																																																																																			PLK3	-	NULL	ENSG00000173846		0.547	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	HGNC	protein_coding	OTTHUMT00000023429.1	-	0.00	29	0	G	NM_004073		45269890	+1	tier1	-	no_errors	ENST00000372201	ensembl	human	known	74_37	silent	31.43	24	11	SNP	0.988	C
PNN	5411	genome.wustl.edu	37	14	39651779	39651779	+	3'UTR	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:39651779C>T	ENST00000216832.4	+	0	2933				PNN_ENST00000557680.1_3'UTR	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein						cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		ATGGGAGCGTCATTCTTTTGT	0.363																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.*712C>T	14.37:g.39651779C>T			B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	RNA	SNP	-	NULL	ENST00000216832.4	37	NULL	CCDS9671.1	14																																																																																			PNN	-	-	ENSG00000100941		0.363	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNN	HGNC	protein_coding	OTTHUMT00000276776.2	-	0.00	8	0	C	NM_002687		39651779	+1	tier1	-	no_errors	ENST00000557680	ensembl	human	known	74_37	rna	38.46	8	5	SNP	0.219	T
PNPLA3	80339	genome.wustl.edu	37	22	44330533	44330533	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:44330533C>T	ENST00000216180.3	+	5	917	c.744C>T	c.(742-744)ttC>ttT	p.F248F	PNPLA3_ENST00000423180.2_Silent_p.F244F	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	248					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CATTCAGGTTCTTGGAAGAGA	0.483																																																	0													242.0	210.0	221.0					22																	44330533		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.744C>T	22.37:g.44330533C>T			B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Silent	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.F248	ENST00000216180.3	37	c.744	CCDS14054.1	22																																																																																			PNPLA3	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000100344		0.483	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNPLA3	HGNC	protein_coding	OTTHUMT00000318891.1	-	0.00	90	0	C	NM_025225		44330533	+1	tier1	-	no_errors	ENST00000216180	ensembl	human	known	74_37	silent	29.63	57	24	SNP	1.000	T
PPP1R37	284352	genome.wustl.edu	37	19	45649660	45649660	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:45649660C>T	ENST00000221462.4	+	12	2370	c.2006C>T	c.(2005-2007)tCc>tTc	p.S669F	PPP1R37_ENST00000421905.1_Missense_Mutation_p.S665F	NM_019121.1	NP_061994.1	O75864	PPR37_HUMAN	protein phosphatase 1, regulatory subunit 37	669					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CTGAGCTGCTCCAAGAACGAG	0.652																																																	0																																										SO:0001583	missense	0			BC035704	CCDS56096.1	19q13.32	2012-04-17	2011-10-11	2011-10-11	ENSG00000104866	ENSG00000104866		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	27607	protein-coding gene	gene with protein product			"""leucine rich repeat containing 68"""	LRRC68		12477932	Standard	NM_019121		Approved		uc021uvs.1	O75864	OTTHUMG00000168143	ENST00000221462.4:c.2006C>T	19.37:g.45649660C>T	ENSP00000221462:p.Ser669Phe		B5MDA4|Q8IWK3|Q8TF16	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.S669F	ENST00000221462.4	37	c.2006	CCDS56096.1	19	.	.	.	.	.	.	.	.	.	.	c	16.65	3.182225	0.57800	.	.	ENSG00000104866	ENST00000421905;ENST00000221462	T;T	0.67698	-0.28;0.01	5.27	5.27	0.74061	.	0.690535	0.13636	N	0.373338	T	0.59838	0.2223	N	0.19112	0.55	0.38064	D	0.936176	D	0.55385	0.971	P	0.47299	0.543	T	0.66559	-0.5893	10	0.72032	D	0.01	-17.1184	14.3723	0.66849	0.0:1.0:0.0:0.0	.	669	B5MDA4	.	F	665;669	ENSP00000390861:S665F;ENSP00000221462:S669F	ENSP00000221462:S669F	S	+	2	0	LRRC68	50341500	1.000000	0.71417	0.803000	0.32268	0.903000	0.53119	3.034000	0.49751	2.468000	0.83385	0.457000	0.33378	TCC	PPP1R37	-	NULL	ENSG00000104866		0.652	PPP1R37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R37	HGNC	protein_coding	OTTHUMT00000398356.2	-	0.00	54	0	C	NM_173634		45649660	+1	tier1	-	no_errors	ENST00000221462	ensembl	human	known	74_37	missense	24.24	50	16	SNP	0.969	T
PRIM1	5557	genome.wustl.edu	37	12	57140622	57140622	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:57140622G>C	ENST00000338193.6	-	4	421	c.385C>G	c.(385-387)Cct>Gct	p.P129A	PRIM1_ENST00000552408.1_5'Flank	NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	129					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						CAGCACTTAGGACATATGTCT	0.463																																																	0													170.0	157.0	161.0					12																	57140622		2108	4225	6333	SO:0001583	missense	0			BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.385C>G	12.37:g.57140622G>C	ENSP00000350491:p.Pro129Ala			Missense_Mutation	SNP	pfam_DNA_primase_S,tigrfam_DNA_primase_ssu_euk/arc	p.P129A	ENST00000338193.6	37	c.385	CCDS44926.1	12	.	.	.	.	.	.	.	.	.	.	G	2.647	-0.282739	0.05642	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000550770	T;T	0.41065	1.01;1.01	4.53	2.22	0.28083	.	0.235140	0.44902	D	0.000408	T	0.27169	0.0666	L	0.40543	1.245	0.31284	N	0.690211	B;B	0.14438	0.01;0.001	B;B	0.18561	0.022;0.01	T	0.26950	-1.0088	10	0.09843	T	0.71	-5.4146	7.0641	0.25141	0.722:0.0:0.278:0.0	.	129;129	F8VSB2;P49642	.;PRI1_HUMAN	A	129;129;132	ENSP00000350491:P129A;ENSP00000450185:P132A	ENSP00000350491:P129A	P	-	1	0	PRIM1	55426889	1.000000	0.71417	0.818000	0.32626	0.952000	0.60782	2.671000	0.46842	0.514000	0.28300	-0.312000	0.09012	CCT	PRIM1	-	pfam_DNA_primase_S,tigrfam_DNA_primase_ssu_euk/arc	ENSG00000198056		0.463	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIM1	HGNC	protein_coding	OTTHUMT00000406956.1	-	0.00	82	0	G	NM_000946		57140622	-1	tier1	-	no_errors	ENST00000338193	ensembl	human	known	74_37	missense	44.83	48	39	SNP	0.923	C
PRM2	5620	genome.wustl.edu	37	16	11370120	11370120	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:11370120C>T	ENST00000241808.4	-	1	217	c.108G>A	c.(106-108)ctG>ctA	p.L36L	PRM3_ENST00000327157.2_5'Flank|SNORA48_ENST00000390926.1_RNA|RMI2_ENST00000572173.1_Intron|PRM2_ENST00000435245.2_Silent_p.L36L	NM_002762.2	NP_002753.2	P04554	PRM2_HUMAN	protamine 2	36					cell differentiation (GO:0030154)|chromosome condensation (GO:0030261)|DNA packaging (GO:0006323)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.0?(1)		central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)	7						GCTCCGGGCTCAGCCCTTGCT	0.632																																																	1	Whole gene deletion(1)	haematopoietic_and_lymphoid_tissue(1)											85.0	92.0	90.0					16																	11370120		2173	4275	6448	SO:0001819	synonymous_variant	0				CCDS42118.1, CCDS66944.1	16p13.13	2013-10-17			ENSG00000122304	ENSG00000122304			9448	protein-coding gene	gene with protein product	"""cancer/testis antigen family 94, member 2"""	182890				16632464	Standard	NM_001286356		Approved	CT94.2	uc002dau.1	P04554	OTTHUMG00000172317	ENST00000241808.4:c.108G>A	16.37:g.11370120C>T			Q6ZMM0	Silent	SNP	pfam_Protamine_P2	p.L36	ENST00000241808.4	37	c.108	CCDS42118.1	16																																																																																			PRM2	-	pfam_Protamine_P2	ENSG00000122304		0.632	PRM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRM2	HGNC	protein_coding	OTTHUMT00000417808.1	-	0.00	68	0	C			11370120	-1	tier1	-	no_errors	ENST00000241808	ensembl	human	known	74_37	silent	33.70	61	31	SNP	0.002	T
PRMT7	54496	genome.wustl.edu	37	16	68371375	68371376	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:68371375_68371376insT	ENST00000339507.5	+	7	1235_1236	c.405_406insT	c.(406-408)tgcfs	p.C136fs	PRMT7_ENST00000348497.4_Intron|PRMT7_ENST00000564441.1_3'UTR|PRMT7_ENST00000441236.1_Frame_Shift_Ins_p.C86fs|PRMT7_ENST00000449359.3_Frame_Shift_Ins_p.C86fs			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	136	SAM-dependent MTase PRMT-type 1. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		GTGACATGCCATGCCGTGCCAA	0.485																																																	0																																										SO:0001589	frameshift_variant	0			AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.406dupT	16.37:g.68371376_68371376dupT	ENSP00000343103:p.Cys136fs		B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Frame_Shift_Ins	INS	pfam_Ribosomal-L11_MeTrfase_PrmA,pirsf_Arg_MeTrfase_PRMT7	p.C135fs	ENST00000339507.5	37	c.405_406	CCDS10866.1	16																																																																																			PRMT7	-	pirsf_Arg_MeTrfase_PRMT7	ENSG00000132600		0.485	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT7	HGNC	protein_coding	OTTHUMT00000268892.3		0.00	58	0	-	NM_019023		68371376	+1	tier1		no_errors	ENST00000339507	ensembl	human	known	74_37	frame_shift_ins	34.09	29	15	INS	0.724:0.757	T
PRPF8	10594	genome.wustl.edu	37	17	1561597	1561597	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:1561597G>C	ENST00000572621.1	-	33	5720	c.5455C>G	c.(5455-5457)Ctc>Gtc	p.L1819V	PRPF8_ENST00000304992.6_Missense_Mutation_p.L1819V			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1819	Involved in interaction with pre-mRNA 5' splice site.|RNase H homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		ATTATCTTGAGGAACAGCTGC	0.517																																																	0													154.0	142.0	146.0					17																	1561597		2203	4300	6503	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.5455C>G	17.37:g.1561597G>C	ENSP00000460348:p.Leu1819Val		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.L1819V	ENST00000572621.1	37	c.5455	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	g	22.6	4.313842	0.81358	.	.	ENSG00000174231	ENST00000304992;ENST00000540177	D	0.86562	-2.14	6.03	6.03	0.97812	PRP8 domain IV core (1);	0.000000	0.85682	D	0.000000	D	0.94301	0.8169	M	0.89904	3.07	0.80722	D	1	D	0.69078	0.997	D	0.87578	0.998	D	0.94350	0.7578	10	0.56958	D	0.05	-3.1367	13.7134	0.62682	0.0699:0.0:0.9301:0.0	.	1819	Q6P2Q9	PRP8_HUMAN	V	1819;344	ENSP00000304350:L1819V	ENSP00000304350:L1819V	L	-	1	0	PRPF8	1508347	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.768000	0.68858	2.861000	0.98227	0.655000	0.94253	CTC	PRPF8	-	pfam_PRP8_domainIV	ENSG00000174231		0.517	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	-	0.00	94	0	G			1561597	-1	tier1	-	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	26.95	102	38	SNP	1.000	C
PRR23B	389151	genome.wustl.edu	37	3	138739278	138739278	+	Missense_Mutation	SNP	C	C	T	rs370987581		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:138739278C>T	ENST00000329447.5	-	1	490	c.226G>A	c.(226-228)Gtc>Atc	p.V76I	MRPS22_ENST00000495075.1_Intron	NM_001013650.2	NP_001013672.1	Q6ZRT6	PR23B_HUMAN	proline rich 23B	76										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACCAGGTCGACGTCGTCCAGG	0.687																																																	0								C	ILE/VAL	1,4405		0,1,2202	27.0	24.0	25.0		226	1.2	0.0	3		25	0,8596		0,0,4298	no	missense	PRR23B	NM_001013650.2	29	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	76/266	138739278	1,13001	2203	4298	6501	SO:0001583	missense	0			BC137146	CCDS33868.1	3q22.3	2014-06-03			ENSG00000184814	ENSG00000184814			33764	protein-coding gene	gene with protein product							Standard	NM_001013650		Approved	FLJ46116	uc003esy.1	Q6ZRT6	OTTHUMG00000160633	ENST00000329447.5:c.226G>A	3.37:g.138739278C>T	ENSP00000328768:p.Val76Ile		B2RNV9	Missense_Mutation	SNP	pfam_UPF0572	p.V76I	ENST00000329447.5	37	c.226	CCDS33868.1	3	.	.	.	.	.	.	.	.	.	.	C	8.898	0.955566	0.18507	2.27E-4	0.0	ENSG00000184814	ENST00000329447	.	.	.	3.15	1.2	0.21068	.	1.871900	0.03015	N	0.149909	T	0.30448	0.0765	L	0.51422	1.61	0.09310	N	1	P	0.43938	0.822	B	0.37198	0.243	T	0.20009	-1.0288	9	0.37606	T	0.19	.	3.958	0.09398	0.231:0.6376:0.0:0.1314	.	76	Q6ZRT6	PR23B_HUMAN	I	76	.	ENSP00000328768:V76I	V	-	1	0	PRR23B	140221968	0.008000	0.16893	0.012000	0.15200	0.233000	0.25261	0.284000	0.18864	0.293000	0.22520	0.491000	0.48974	GTC	PRR23B	-	pfam_UPF0572	ENSG00000184814		0.687	PRR23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23B	HGNC	protein_coding	OTTHUMT00000361501.1	-	0.00	32	0	C	NM_001013650		138739278	-1	tier1	-	no_errors	ENST00000329447	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.015	T
PRRC2A	7916	genome.wustl.edu	37	6	31600709	31600709	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:31600709G>C	ENST00000376033.2	+	16	4493	c.4259G>C	c.(4258-4260)gGa>gCa	p.G1420A	PRRC2A_ENST00000376007.4_Missense_Mutation_p.G1420A	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1420	4 X 57 AA type A repeats.|Poly-Gly.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GGGGGTCCTGGAGGAAGGACC	0.612																																																	0													22.0	26.0	25.0					6																	31600709		1507	2707	4214	SO:0001583	missense	0			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.4259G>C	6.37:g.31600709G>C	ENSP00000365201:p.Gly1420Ala		B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.G1420A	ENST00000376033.2	37	c.4259	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	G	8.548	0.874769	0.17395	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.10005	2.92;2.92	5.08	5.08	0.68730	.	0.115278	0.39615	N	0.001314	T	0.06462	0.0166	N	0.19112	0.55	0.48395	D	0.999646	D	0.54397	0.966	P	0.46144	0.505	T	0.19516	-1.0303	10	0.87932	D	0	-7.1531	17.3946	0.87441	0.0:0.0:1.0:0.0	.	1420	P48634	PRC2A_HUMAN	A	1414;1403;1420;1420;645	ENSP00000365175:G1420A;ENSP00000365201:G1420A	ENSP00000365175:G1420A	G	+	2	0	PRRC2A	31708688	1.000000	0.71417	0.996000	0.52242	0.262000	0.26303	4.457000	0.60088	2.633000	0.89246	0.561000	0.74099	GGA	PRRC2A	-	NULL	ENSG00000204469		0.612	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	-	0.00	35	0	G	NM_080686		31600709	+1	tier1	-	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	50.00	17	17	SNP	1.000	C
PSMC4	5704	genome.wustl.edu	37	19	40478056	40478056	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:40478056G>A	ENST00000157812.2	+	2	238	c.40G>A	c.(40-42)Gag>Aag	p.E14K	PSMC4_ENST00000455878.2_Missense_Mutation_p.E14K	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	14					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CGTCTAGGATGAGATCCCAGC	0.562																																					Colon(105;1478 1543 4034 6132 38638)												0													99.0	98.0	98.0					19																	40478056		2203	4300	6503	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.40G>A	19.37:g.40478056G>A	ENSP00000157812:p.Glu14Lys		Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.E14K	ENST00000157812.2	37	c.40	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	G	17.94	3.512381	0.64522	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95001	-3.38;-3.58	4.9	4.9	0.64082	.	0.278640	0.38663	N	0.001613	D	0.86973	0.6062	N	0.12182	0.205	0.80722	D	1	B;B	0.14012	0.009;0.006	B;B	0.14023	0.01;0.006	T	0.82311	-0.0520	10	0.08179	T	0.78	-3.934	15.617	0.76775	0.0:0.0:1.0:0.0	.	14;14	P43686-2;P43686	.;PRS6B_HUMAN	K	14	ENSP00000157812:E14K;ENSP00000413869:E14K	ENSP00000157812:E14K	E	+	1	0	PSMC4	45169896	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.965000	0.87945	2.544000	0.85801	0.561000	0.74099	GAG	PSMC4	-	NULL	ENSG00000013275		0.562	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	-	0.00	18	0	G	NM_006503		40478056	+1	tier1	-	no_errors	ENST00000157812	ensembl	human	known	74_37	missense	25.64	29	10	SNP	1.000	A
PTENP1	11191	genome.wustl.edu	37	9	33676330	33676330	+	RNA	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:33676330T>C	ENST00000532280.1	-	0	1167					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		TTGGTCAAGATCTTCACAAAA	0.378																																																	0																																												0			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33676330T>C				RNA	SNP	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-	ENSG00000237984		0.378	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1	-	0.00	73	0	T	NR_023917		33676330	-1	tier1	-	no_errors	ENST00000532280	ensembl	human	known	74_37	rna	58.62	24	34	SNP	1.000	C
PTPN11	5781	genome.wustl.edu	37	12	112924299	112924299	+	Silent	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:112924299C>A	ENST00000351677.2	+	11	1443	c.1245C>A	c.(1243-1245)gtC>gtA	p.V415V	PTPN11_ENST00000392597.1_Silent_p.V415V	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	419	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.		T -> M (in NS1). {ECO:0000269|PubMed:15384080}.		abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						AGAGAACGGTCTGGCAATACC	0.537			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0													56.0	56.0	56.0					12																	112924299		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1245C>A	12.37:g.112924299C>A			A8K1D9|Q96HD7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.V415	ENST00000351677.2	37	c.1245	CCDS9163.1	12																																																																																			PTPN11	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000179295		0.537	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	HGNC	protein_coding	OTTHUMT00000259496.2	-	0.00	34	0	C			112924299	+1	tier1	-	no_errors	ENST00000351677	ensembl	human	known	74_37	silent	38.89	22	14	SNP	0.984	A
PTPN13	5783	genome.wustl.edu	37	4	87686556	87686556	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:87686556G>A	ENST00000411767.2	+	26	4221	c.4158G>A	c.(4156-4158)gtG>gtA	p.V1386V	PTPN13_ENST00000511467.1_Silent_p.V1391V|PTPN13_ENST00000316707.6_Silent_p.V1195V|PTPN13_ENST00000436978.1_Silent_p.V1391V|PTPN13_ENST00000427191.2_Silent_p.V1367V			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1386	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		AGGGAGGTGTGAATACGAGTG	0.363																																																	0													73.0	67.0	69.0					4																	87686556		1823	4093	5916	SO:0001819	synonymous_variant	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4158G>A	4.37:g.87686556G>A			B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.V1391	ENST00000411767.2	37	c.4173	CCDS47094.1	4																																																																																			PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000163629		0.363	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	-	0.00	54	0	G			87686556	+1	tier1	-	no_errors	ENST00000436978	ensembl	human	known	74_37	silent	64.29	15	27	SNP	1.000	A
PTPRQ	374462	genome.wustl.edu	37	12	80900352	80900352	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:80900352G>A	ENST00000266688.5	+	21	2448	c.2448G>A	c.(2446-2448)ctG>ctA	p.L816L				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	862	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						CTTTAGTACTGAAGAAATATA	0.363																																																	0													99.0	89.0	92.0					12																	80900352		692	1589	2281	SO:0001819	synonymous_variant	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.2448G>A	12.37:g.80900352G>A				Silent	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.L816	ENST00000266688.5	37	c.2448		12																																																																																			PTPRQ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.363	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		-	0.00	41	0	G	NM_001145026		80900352	+1	tier1	-	no_errors	ENST00000266688	ensembl	human	known	74_37	silent	26.09	17	6	SNP	1.000	A
PTPRU	10076	genome.wustl.edu	37	1	29631863	29631863	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:29631863G>A	ENST00000345512.3	+	19	2902		c.e19-1		PTPRU_ENST00000428026.2_Splice_Site|PTPRU_ENST00000460170.2_Splice_Site|PTPRU_ENST00000356870.3_Splice_Site|PTPRU_ENST00000415600.2_Splice_Site|PTPRU_ENST00000373779.3_Splice_Site|PTPRU_ENST00000323874.8_Splice_Site	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U						canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		TGTGTTTACAGATGATCGGCA	0.572																																																	0													107.0	95.0	99.0					1																	29631863		2203	4300	6503	SO:0001630	splice_region_variant	0			U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2774-1G>A	1.37:g.29631863G>A			A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Splice_Site	SNP	-	e19-1	ENST00000345512.3	37	c.2774-1	CCDS334.1	1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.446400	0.84101	.	.	ENSG00000060656	ENST00000345512;ENST00000373779;ENST00000356870;ENST00000323874;ENST00000428026;ENST00000460170	.	.	.	4.06	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4948	0.84237	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRU	29504450	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.504000	0.97986	2.556000	0.86216	0.563000	0.77884	.	PTPRU	-	-	ENSG00000060656		0.572	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	HGNC	protein_coding	OTTHUMT00000010447.1	-	0.00	25	0	G		Intron	29631863	+1	tier1	-	no_errors	ENST00000345512	ensembl	human	known	74_37	splice_site	44.44	15	12	SNP	1.000	A
PXN	5829	genome.wustl.edu	37	12	120651990	120651990	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:120651990G>A	ENST00000228307.7	-	10	1450	c.1309C>T	c.(1309-1311)Cac>Tac	p.H437Y	PXN_ENST00000267257.7_Missense_Mutation_p.H451Y|PXN-AS1_ENST00000539446.1_RNA|PXN_ENST00000424649.2_Missense_Mutation_p.H403Y|PXN_ENST00000538144.1_5'UTR|PXN_ENST00000397506.3_Missense_Mutation_p.H249Y|PXN_ENST00000458477.2_Missense_Mutation_p.H270Y|PXN-AS1_ENST00000535200.1_RNA|PXN_ENST00000536957.1_Missense_Mutation_p.H435Y|PXN-AS1_ENST00000542265.1_RNA	NM_001080855.2	NP_001074324.1	P49023	PAXI_HUMAN	paxillin	437	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				activation of MAPK activity (GO:0000187)|branching morphogenesis of an epithelial tube (GO:0048754)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cellular component movement (GO:0006928)|cellular response to reactive oxygen species (GO:0034614)|cytoskeleton organization (GO:0007010)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|growth hormone receptor signaling pathway (GO:0060396)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|muscle contraction (GO:0006936)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of cell shape (GO:0008360)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	beta-catenin binding (GO:0008013)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGTTCAGGGTGCCACGTCCGG	0.597																																																	0													30.0	33.0	32.0					12																	120651990		1905	3921	5826	SO:0001583	missense	0			U14588	CCDS44996.1, CCDS44997.1, CCDS44998.1, CCDS58281.1	12q24	2006-01-23			ENSG00000089159	ENSG00000089159			9718	protein-coding gene	gene with protein product		602505				7534286	Standard	NM_001080855		Approved		uc001txv.3	P49023	OTTHUMG00000169169	ENST00000228307.7:c.1309C>T	12.37:g.120651990G>A	ENSP00000228307:p.His437Tyr		B2RAI3|B7ZMB4|O14970|O14971|O60360|Q5HYA4	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM,prints_Paxillin	p.H451Y	ENST00000228307.7	37	c.1351	CCDS44997.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.387554	0.95988	.	.	ENSG00000089159	ENST00000458477;ENST00000228307;ENST00000424649;ENST00000536957;ENST00000267257;ENST00000397506;ENST00000331257;ENST00000541856	D;D;D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99;-3.99;-3.99	5.63	5.63	0.86233	Zinc finger, LIM-type (5);	.	.	.	.	D	0.99171	0.9713	H	0.99600	4.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98696	1.0698	9	0.87932	D	0	.	19.6972	0.96030	0.0:0.0:1.0:0.0	.	403;451;249;437	P49023-2;P49023-3;E7EMK8;P49023	.;.;.;PAXI_HUMAN	Y	270;437;403;435;451;249;65;162	ENSP00000395536:H270Y;ENSP00000228307:H437Y;ENSP00000391283:H403Y;ENSP00000443887:H435Y;ENSP00000267257:H451Y;ENSP00000380643:H249Y	ENSP00000228307:H437Y	H	-	1	0	PXN	119136373	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.677000	0.98645	2.663000	0.90544	0.650000	0.86243	CAC	PXN	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000089159		0.597	PXN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PXN	HGNC	protein_coding	OTTHUMT00000402679.4	-	0.00	42	0	G	NM_002859		120651990	-1	tier1	-	no_errors	ENST00000267257	ensembl	human	known	74_37	missense	46.15	27	24	SNP	1.000	A
PYGM	5837	genome.wustl.edu	37	11	64527313	64527313	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:64527313C>G	ENST00000164139.3	-	1	456	c.58G>C	c.(58-60)Gcc>Ccc	p.A20P	PYGM_ENST00000377432.3_Missense_Mutation_p.A20P	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	20					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCCACGCCGGCCAGGCCACGC	0.577																																																	0													163.0	152.0	155.0					11																	64527313		2201	4297	6498	SO:0001583	missense	0				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.58G>C	11.37:g.64527313C>G	ENSP00000164139:p.Ala20Pro		A0AVK1|A6NDY6	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.A20P	ENST00000164139.3	37	c.58	CCDS8079.1	11	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797519	0.70567	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.94138	-3.2;-3.36	5.41	4.49	0.54785	.	0.104769	0.42548	N	0.000697	D	0.92609	0.7652	M	0.79475	2.455	0.80722	D	1	B;B	0.15473	0.0;0.013	B;B	0.17433	0.0;0.018	D	0.89917	0.4056	10	0.41790	T	0.15	-21.0153	14.0059	0.64463	0.0:0.8474:0.1526:0.0	.	20;20	A6NDY6;P11217	.;PYGM_HUMAN	P	20	ENSP00000366650:A20P;ENSP00000164139:A20P	ENSP00000164139:A20P	A	-	1	0	PYGM	64283889	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	5.870000	0.69620	1.288000	0.44600	0.655000	0.94253	GCC	PYGM	-	pirsf_Glyco_trans_35	ENSG00000068976		0.577	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	HGNC	protein_coding	OTTHUMT00000143254.2	-	0.00	52	0	C	NM_005609		64527313	-1	tier1	-	no_errors	ENST00000164139	ensembl	human	known	74_37	missense	30.38	55	24	SNP	1.000	G
RBM24	221662	genome.wustl.edu	37	6	17292448	17292449	+	3'UTR	INS	-	-	AAA	rs376476676|rs552369365		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:17292448_17292449insAAA	ENST00000379052.5	+	0	1045_1046				RBM24_ENST00000425446.2_3'UTR|RBM24_ENST00000318204.5_3'UTR|RBM24_ENST00000508508.1_3'UTR	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24						cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			TTAACAGCTTTAAAAAAAAAAA	0.342																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.*99->AAA	6.37:g.17292455_17292457dupAAA			E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	RNA	INS	-	NULL	ENST00000379052.5	37	NULL	CCDS47378.1	6																																																																																			RBM24	-	-	ENSG00000112183		0.342	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2		0.00	10	0	-	NM_153020		17292449	+1	tier1		no_errors	ENST00000504055	ensembl	human	known	74_37	rna	33.33	6	3	INS	0.997:0.915	AAA
RFX5	5993	genome.wustl.edu	37	1	151314765	151314765	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:151314765C>T	ENST00000290524.4	-	11	1926	c.1748G>A	c.(1747-1749)gGa>gAa	p.G583E	RFX5_ENST00000452513.2_Missense_Mutation_p.G543E|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000368870.2_Missense_Mutation_p.G583E|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452671.2_Missense_Mutation_p.G583E	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	583					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTCTACCTCTCCCTTTGCCAA	0.463																																																	0													138.0	127.0	131.0					1																	151314765		2203	4300	6503	SO:0001583	missense	0				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1748G>A	1.37:g.151314765C>T	ENSP00000290524:p.Gly583Glu		B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.G583E	ENST00000290524.4	37	c.1748	CCDS994.1	1	.	.	.	.	.	.	.	.	.	.	C	1.665	-0.510466	0.04231	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513;ENST00000392746	T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57	5.37	0.0108	0.14084	.	0.714139	0.14029	N	0.346292	T	0.03871	0.0109	N	0.05510	-0.035	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.42699	-0.9436	10	0.26408	T	0.33	-2.598	4.8746	0.13650	0.0:0.4959:0.147:0.3571	.	543;583	B7Z848;P48382	.;RFX5_HUMAN	E	583;583;583;543;583	ENSP00000290524:G583E;ENSP00000357864:G583E;ENSP00000389130:G583E;ENSP00000398388:G543E;ENSP00000376502:G583E	ENSP00000290524:G583E	G	-	2	0	RFX5	149581389	0.001000	0.12720	0.447000	0.26932	0.485000	0.33311	-0.359000	0.07632	0.086000	0.17137	-0.218000	0.12543	GGA	RFX5	-	NULL	ENSG00000143390		0.463	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	HGNC	protein_coding	OTTHUMT00000034892.6	-	0.00	22	0	C	NM_000449		151314765	-1	tier1	-	no_errors	ENST00000290524	ensembl	human	known	74_37	missense	37.93	18	11	SNP	0.013	T
RGS11	8786	genome.wustl.edu	37	16	320792	320792	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:320792G>A	ENST00000397770.3	-	14	1035	c.1018C>T	c.(1018-1020)Cga>Tga	p.R340*	ARHGDIG_ENST00000464609.1_Intron|RGS11_ENST00000316163.5_Nonsense_Mutation_p.R319*|RGS11_ENST00000359740.5_Nonsense_Mutation_p.R329*			O94810	RGS11_HUMAN	regulator of G-protein signaling 11	340	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GCTCCATATCGAAGCTCCTCA	0.667																																																	0													27.0	23.0	25.0					16																	320792		2202	4298	6500	SO:0001587	stop_gained	0			AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.1018C>T	16.37:g.320792G>A	ENSP00000380876:p.Arg340*		O75883|Q4TT71|Q4TT72	Nonsense_Mutation	SNP	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.R340*	ENST00000397770.3	37	c.1018	CCDS42088.1	16	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022218	0.54683	.	.	ENSG00000076344	ENST00000397770;ENST00000316163;ENST00000359740	.	.	.	5.0	4.03	0.46877	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-11.2657	13.7565	0.62940	0.0:0.0:0.8449:0.1551	.	.	.	.	X	340;319;329	.	ENSP00000319069:R319X	R	-	1	2	RGS11	260793	1.000000	0.71417	0.922000	0.36590	0.162000	0.22319	2.819000	0.48049	1.071000	0.40834	0.462000	0.41574	CGA	RGS11	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	ENSG00000076344		0.667	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS11	HGNC	protein_coding	OTTHUMT00000139325.2	-	0.00	307	0	G			320792	-1	tier1	-	no_errors	ENST00000397770	ensembl	human	known	74_37	nonsense	36.49	221	127	SNP	0.996	A
RNF185	91445	genome.wustl.edu	37	22	31592935	31592935	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:31592935C>G	ENST00000326132.6	+	5	481	c.322C>G	c.(322-324)Cct>Gct	p.P108A	RNF185_ENST00000426256.2_Missense_Mutation_p.P46A|RNF185_ENST00000266252.7_Intron	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	108					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						GAAGACCCCTCCTCGTCCTCA	0.463																																																	0													56.0	60.0	59.0					22																	31592935		2203	4300	6503	SO:0001583	missense	0				CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.322C>G	22.37:g.31592935C>G	ENSP00000320508:p.Pro108Ala		A8K5C1|A9X3T8|Q8N900	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P108A	ENST00000326132.6	37	c.322	CCDS13890.1	22	.	.	.	.	.	.	.	.	.	.	C	26.5	4.741149	0.89573	.	.	ENSG00000138942	ENST00000426256;ENST00000326132;ENST00000436825	D	0.95447	-3.71	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.97845	0.9292	M	0.83852	2.665	0.80722	D	1	D;D	0.76494	0.999;0.98	D;D	0.80764	0.994;0.956	D	0.98025	1.0373	10	0.59425	D	0.04	.	18.8912	0.92406	0.0:1.0:0.0:0.0	.	46;108	B4DMD6;Q96GF1	.;RN185_HUMAN	A	46;108;108	ENSP00000320508:P108A	ENSP00000320508:P108A	P	+	1	0	RNF185	29922935	1.000000	0.71417	0.998000	0.56505	0.930000	0.56654	7.445000	0.80570	2.716000	0.92895	0.555000	0.69702	CCT	RNF185	-	NULL	ENSG00000138942		0.463	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF185	HGNC	protein_coding	OTTHUMT00000321927.2	-	0.00	50	0	C	NM_152267		31592935	+1	tier1	-	no_errors	ENST00000326132	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	G
RPF1	80135	genome.wustl.edu	37	1	84961569	84961569	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:84961569G>C	ENST00000370654.5	+	7	719	c.704G>C	c.(703-705)aGa>aCa	p.R235T	GNG5_ENST00000487806.1_5'Flank	NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	235	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						TTCTAGAGAAGAGGCAAGGAC	0.348																																																	0													57.0	56.0	57.0					1																	84961569		2203	4300	6503	SO:0001583	missense	0			AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.704G>C	1.37:g.84961569G>C	ENSP00000359688:p.Arg235Thr		Q5VSK7|Q6AHX1|Q8WXZ8	Missense_Mutation	SNP	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.R235T	ENST00000370654.5	37	c.704	CCDS695.1	1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344305	0.41498	.	.	ENSG00000117133	ENST00000370654	T	0.21932	1.98	5.72	4.71	0.59529	Brix domain (3);Anticodon-binding (1);	0.146535	0.64402	D	0.000015	T	0.05090	0.0136	L	0.35593	1.075	0.44660	D	0.997644	B	0.16603	0.018	B	0.19666	0.026	T	0.33189	-0.9878	10	0.13853	T	0.58	-19.821	3.7314	0.08495	0.3328:0.0:0.6672:0.0	.	235	Q9H9Y2	RPF1_HUMAN	T	235	ENSP00000359688:R235T	ENSP00000359688:R235T	R	+	2	0	RPF1	84734157	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	3.395000	0.52558	2.717000	0.92951	0.655000	0.94253	AGA	RPF1	-	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	ENSG00000117133		0.348	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF1	HGNC	protein_coding	OTTHUMT00000027238.1	-	0.00	19	0	G	NM_025065		84961569	+1	tier1	-	no_errors	ENST00000370654	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	C
RPL10L	140801	genome.wustl.edu	37	14	47120593	47120593	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:47120593C>G	ENST00000298283.3	-	1	435	c.347G>C	c.(346-348)cGa>cCa	p.R116P		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	116					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						AAAGGCACCTCGCATACCTGT	0.547																																																	0													59.0	59.0	59.0					14																	47120593		2203	4300	6503	SO:0001583	missense	0			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.347G>C	14.37:g.47120593C>G	ENSP00000298283:p.Arg116Pro		Q8IUD1	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.R116P	ENST00000298283.3	37	c.347	CCDS32071.1	14	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225880	0.79576	.	.	ENSG00000165496	ENST00000298283	T	0.79454	-1.27	4.32	4.32	0.51571	Ribosomal protein L10e/L16 (2);Ribosomal protein L10e, conserved site (1);	0.060898	0.64402	D	0.000003	D	0.89276	0.6669	H	0.99847	4.84	0.80722	D	1	B	0.09022	0.002	B	0.28638	0.092	D	0.90167	0.4232	10	0.87932	D	0	-12.4334	15.1202	0.72438	0.0:1.0:0.0:0.0	.	116	Q96L21	RL10L_HUMAN	P	116	ENSP00000298283:R116P	ENSP00000298283:R116P	R	-	2	0	RPL10L	46190343	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	6.929000	0.75852	2.688000	0.91661	0.655000	0.94253	CGA	RPL10L	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000165496		0.547	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	HGNC	protein_coding	OTTHUMT00000349819.1	-	0.00	72	0	C			47120593	-1	tier1	-	no_errors	ENST00000298283	ensembl	human	known	74_37	missense	26.79	41	15	SNP	1.000	G
RPRM	56475	genome.wustl.edu	37	2	154334906	154334906	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:154334906C>T	ENST00000325926.3	-	1	416	c.174G>A	c.(172-174)caG>caA	p.Q58Q	AC012501.2_ENST00000424322.1_RNA	NM_019845.2	NP_062819.1	Q9NS64	RPRM_HUMAN	reprimo, TP53 dependent G2 arrest mediator candidate	58					cell cycle arrest (GO:0007050)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				large_intestine(2)|lung(1)|prostate(1)	4						TGACCGCGATCTGCACCACGC	0.627																																																	0													129.0	90.0	104.0					2																	154334906		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074808	CCDS2198.1	2q24.1	2011-01-26	2005-12-01		ENSG00000177519	ENSG00000177519			24201	protein-coding gene	gene with protein product	"""candidate mediator of the p53 dependent G2 arrest"", ""REPRIMO"""	612171	"""reprimo, TP53 dependant G2 arrest mediator candidate"""			10930422	Standard	NM_019845		Approved	FLJ90327, REPRIMO	uc002tyq.1	Q9NS64	OTTHUMG00000131905	ENST00000325926.3:c.174G>A	2.37:g.154334906C>T			B2R4V1	Silent	SNP	NULL	p.Q58	ENST00000325926.3	37	c.174	CCDS2198.1	2																																																																																			RPRM	-	NULL	ENSG00000177519		0.627	RPRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRM	HGNC	protein_coding	OTTHUMT00000254856.1	-	0.00	25	0	C	NM_019845		154334906	-1	tier1	-	no_errors	ENST00000325926	ensembl	human	known	74_37	silent	31.82	30	14	SNP	1.000	T
RPS6KA6	27330	genome.wustl.edu	37	X	83361419	83361419	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:83361419C>A	ENST00000262752.2	-	15	1326	c.1319G>T	c.(1318-1320)tGc>tTc	p.C440F	RPS6KA6_ENST00000495332.1_5'UTR|RPS6KA6_ENST00000543399.1_Missense_Mutation_p.C440F	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	440	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						GCATCGCTTGCAAACAGAGTA	0.338																																																	0													121.0	89.0	100.0					X																	83361419		2203	4299	6502	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.1319G>T	X.37:g.83361419C>A	ENSP00000262752:p.Cys440Phe		B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	p.C440F	ENST00000262752.2	37	c.1319	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424748	0.83667	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.39229	1.09;1.09	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.57036	0.2026	L	0.58510	1.815	0.80722	D	1	D;D	0.55172	0.97;0.97	P;P	0.55713	0.782;0.741	T	0.60984	-0.7154	10	0.87932	D	0	.	18.2848	0.90111	0.0:1.0:0.0:0.0	.	440;440	B7ZL90;Q9UK32	.;KS6A6_HUMAN	F	440	ENSP00000262752:C440F;ENSP00000440830:C440F	ENSP00000262752:C440F	C	-	2	0	RPS6KA6	83248075	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	7.597000	0.82733	2.257000	0.74773	0.422000	0.28245	TGC	RPS6KA6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom	ENSG00000072133		0.338	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	-	0.00	18	0	C	NM_014496		83361419	-1	tier1	-	no_errors	ENST00000262752	ensembl	human	known	74_37	missense	47.50	21	19	SNP	1.000	A
RSF1	51773	genome.wustl.edu	37	11	77383154	77383154	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:77383154C>T	ENST00000308488.6	-	15	3986	c.3684G>A	c.(3682-3684)aaG>aaA	p.K1228K	RSF1_ENST00000360355.2_Silent_p.K1197K|RSF1_ENST00000480887.1_Silent_p.K976K			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1228	Arg-rich.				CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			GTCGCAAACTCTTCTGGGAAC	0.418																																																	0													220.0	209.0	213.0					11																	77383154		2200	4292	6492	SO:0001819	synonymous_variant	0			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3684G>A	11.37:g.77383154C>T			Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K1228	ENST00000308488.6	37	c.3684	CCDS8253.1	11																																																																																			RSF1	-	NULL	ENSG00000048649		0.418	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RSF1	HGNC	protein_coding	OTTHUMT00000318075.2	-	0.00	54	0	C	NM_016578		77383154	-1	tier1	-	no_errors	ENST00000308488	ensembl	human	known	74_37	silent	54.05	17	20	SNP	0.961	T
RTBDN	83546	genome.wustl.edu	37	19	12940696	12940696	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:12940696G>C	ENST00000458671.2	-	2	250	c.98C>G	c.(97-99)cCa>cGa	p.P33R	RTBDN_ENST00000393233.2_5'UTR|RTBDN_ENST00000589272.1_Missense_Mutation_p.P65R|CTD-2265O21.3_ENST00000588469.1_RNA|RTBDN_ENST00000592204.1_Missense_Mutation_p.P43R|RTBDN_ENST00000322912.5_Missense_Mutation_p.P65R	NM_001080997.2	NP_001074466.1	Q9BSG5	RTBDN_HUMAN	retbindin	33						extracellular region (GO:0005576)				kidney(1)|large_intestine(5)|liver(1)|lung(4)|prostate(1)	12						GGCTTGGAGTGGGCGGCTCCC	0.637																																																	0													62.0	49.0	53.0					19																	12940696		2203	4300	6503	SO:0001583	missense	0			AY028917	CCDS12283.1, CCDS45994.1, CCDS59355.1, CCDS59356.1	19p13	2006-03-22				ENSG00000132026			30310	protein-coding gene	gene with protein product		609553				12107411	Standard	NM_001080997		Approved	FLJ36353	uc002mvj.4	Q9BSG5		ENST00000458671.2:c.98C>G	19.37:g.12940696G>C	ENSP00000416375:p.Pro33Arg		F1T0I8|Q9BWT5	Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.P65R	ENST00000458671.2	37	c.194	CCDS45994.1	19	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881497	0.33255	.	.	ENSG00000132026	ENST00000322912;ENST00000458671	T;T	0.76709	-1.04;-1.04	3.74	1.56	0.23342	Folate receptor-like (1);	0.579476	0.15514	N	0.258381	T	0.77498	0.4139	M	0.65975	2.015	0.19300	N	0.99997	P;D;D	0.59357	0.926;0.971;0.985	P;P;P	0.53224	0.45;0.58;0.721	T	0.64664	-0.6354	10	0.33141	T	0.24	-46.0112	4.3658	0.11223	0.1182:0.0:0.6584:0.2234	.	65;33;43	Q9BSG5-2;Q9BSG5;F1T0I8	.;RTBDN_HUMAN;.	R	65;33	ENSP00000326253:P65R;ENSP00000416375:P33R	ENSP00000326253:P65R	P	-	2	0	RTBDN	12801696	0.001000	0.12720	0.084000	0.20598	0.804000	0.45430	-0.105000	0.10907	0.545000	0.28902	0.561000	0.74099	CCA	RTBDN	-	pfam_Folate_rcpt-like	ENSG00000132026		0.637	RTBDN-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RTBDN	HGNC	protein_coding	OTTHUMT00000451513.1	-	0.00	61	0	G	NM_031429		12940696	-1	tier1	-	no_errors	ENST00000322912	ensembl	human	known	74_37	missense	31.40	59	27	SNP	0.085	C
RUNDC3B	154661	genome.wustl.edu	37	7	87436700	87436700	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:87436700G>A	ENST00000338056.3	+	10	1431	c.1020G>A	c.(1018-1020)aaG>aaA	p.K340K	RUNDC3B_ENST00000493037.1_Intron|RUNDC3B_ENST00000394654.3_Silent_p.K323K	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	340										breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					CTGTGCTAAAGAATAATGATT	0.433																																																	0													145.0	133.0	137.0					7																	87436700		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.1020G>A	7.37:g.87436700G>A			B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Silent	SNP	pfam_Run,smart_Run,pfscan_Run	p.K340	ENST00000338056.3	37	c.1020	CCDS5609.1	7																																																																																			RUNDC3B	-	NULL	ENSG00000105784		0.433	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	HGNC	protein_coding	OTTHUMT00000253679.1	-	0.00	50	0	G	NM_138290		87436700	+1	tier1	-	no_errors	ENST00000338056	ensembl	human	known	74_37	silent	32.08	36	17	SNP	1.000	A
RUNX1T1	862	genome.wustl.edu	37	8	93074912	93074912	+	Intron	SNP	G	G	A	rs560780392	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:93074912G>A	ENST00000523629.1	-	2	543				RUNX1T1_ENST00000265814.3_Intron|RUNX1T1_ENST00000436581.2_Intron|RUNX1T1_ENST00000360348.2_Intron|RUNX1T1_ENST00000396218.1_5'UTR|RUNX1T1_ENST00000520724.1_Intron|RUNX1T1_ENST00000522163.1_5'UTR|RUNX1T1_ENST00000518844.1_Intron	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)						fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			CGGCATCGCCGGAGGCAGGGT	0.627													G|||	2	0.000399361	0.0	0.0	5008	,	,		14415	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001627	intron_variant	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.88+13280C>T	8.37:g.93074912G>A			B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	NULL	p.S38	ENST00000523629.1	37	c.114	CCDS6256.1	8																																																																																			RUNX1T1	-	NULL	ENSG00000079102		0.627	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	-	0.00	30	0	G	NM_004349, NM_175635		93074912	-1	tier1	-	no_errors	ENST00000517493	ensembl	human	known	74_37	silent	35.29	22	12	SNP	1.000	A
RYR1	6261	genome.wustl.edu	37	19	39062663	39062663	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:39062663C>G	ENST00000359596.3	+	95	13751	c.13751C>G	c.(13750-13752)tCa>tGa	p.S4584*	RYR1_ENST00000360985.3_Nonsense_Mutation_p.S4579*|RYR1_ENST00000355481.4_Nonsense_Mutation_p.S4579*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4584					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TTTCAGGTCTCAGACTCTCCA	0.592																																																	0													64.0	62.0	63.0					19																	39062663		2203	4300	6503	SO:0001587	stop_gained	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.13751C>G	19.37:g.39062663C>G	ENSP00000352608:p.Ser4584*		Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.S4584*	ENST00000359596.3	37	c.13751	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	55	23.627827	0.99956	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	5.76	4.73	0.59995	.	0.000000	0.64402	U	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.1464	0.59463	0.0:0.9221:0.0:0.0779	.	.	.	.	X	4584;4579;4579	.	ENSP00000347667:S4579X	S	+	2	0	RYR1	43754503	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	4.875000	0.63072	2.724000	0.93272	0.561000	0.74099	TCA	RYR1	-	pfam_Ryanrecept_TM4-6	ENSG00000196218		0.592	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	-	0.00	41	0	C			39062663	+1	tier1	-	no_errors	ENST00000359596	ensembl	human	known	74_37	nonsense	35.71	36	20	SNP	1.000	G
SACS	26278	genome.wustl.edu	37	13	23913508	23913508	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr13:23913508T>C	ENST00000382292.3	-	9	4780	c.4507A>G	c.(4507-4509)Atg>Gtg	p.M1503V	SACS_ENST00000402364.1_Missense_Mutation_p.M753V|SACS_ENST00000382298.3_Missense_Mutation_p.M1503V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1503					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTTATGTCCATATTTCTTCTC	0.378																																																	0													60.0	56.0	57.0					13																	23913508		2203	4300	6503	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.4507A>G	13.37:g.23913508T>C	ENSP00000371729:p.Met1503Val		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.M1503V	ENST00000382292.3	37	c.4507	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	T	8.815	0.936249	0.18206	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87334	-2.24;-2.24;-2.24	5.96	5.96	0.96718	ATPase-like, ATP-binding domain (2);	0.178665	0.64402	D	0.000009	T	0.76256	0.3962	N	0.08118	0	0.25968	N	0.982537	B	0.12630	0.006	B	0.11329	0.006	T	0.62338	-0.6875	10	0.27082	T	0.32	.	16.4343	0.83869	0.0:0.0:0.0:1.0	.	1503	Q9NZJ4	SACS_HUMAN	V	1503;753;1503	ENSP00000371729:M1503V;ENSP00000385844:M753V;ENSP00000371735:M1503V	ENSP00000371729:M1503V	M	-	1	0	SACS	22811508	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.926000	0.40084	2.285000	0.76669	0.528000	0.53228	ATG	SACS	-	superfamily_HATPase_ATP-bd	ENSG00000151835		0.378	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	38	0	T	NM_014363		23913508	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	47.83	12	11	SNP	1.000	C
SLC46A1	113235	genome.wustl.edu	37	17	26723220	26723220	+	3'UTR	SNP	G	G	T	rs544071937		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:26723220G>T	ENST00000440501.1	-	0	4927				SLC46A1_ENST00000584729.1_5'UTR|SARM1_ENST00000457710.3_Missense_Mutation_p.R663L|SLC46A1_ENST00000321666.5_3'UTR|SARM1_ENST00000379061.4_3'UTR	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1						cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	AAGATCATCCGCTTCCTGCAG	0.607																																																	0													84.0	76.0	79.0					17																	26723220		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.*3452C>A	17.37:g.26723220G>T			Q1HE20|Q86T92|Q8TEG3|Q96FL0	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_ARM-type_fold,superfamily_TIR_dom,superfamily_SAM/pointed,smart_SAM,smart_TIR_dom,pfscan_SAM	p.R663L	ENST00000440501.1	37	c.1988		17	.	.	.	.	.	.	.	.	.	.	G	31	5.089491	0.94149	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	4.84	3.88	0.44766	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.000000	0.85682	D	0.000000	T	0.60222	0.2252	.	.	.	0.80722	D	1	D	0.63880	0.993	P	0.47603	0.551	T	0.65829	-0.6073	8	0.87932	D	0	-22.0242	13.0329	0.58854	0.0784:0.0:0.9216:0.0	.	697	Q6SZW1	SARM1_HUMAN	L	695;663	.	ENSP00000003834:R663L	R	+	2	0	SARM1	23747347	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.962000	0.87912	1.028000	0.39785	0.561000	0.74099	CGC	SARM1	-	smart_TIR_dom	ENSG00000004139		0.607	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	SARM1	HGNC	protein_coding			0.00	13	0	G	NM_080669		26723220	+1			no_errors	ENST00000457710	ensembl	human	novel	74_37	missense	8.33	22	2	SNP	1.000	T
SCAPER	49855	genome.wustl.edu	37	15	77057706	77057706	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:77057706C>G	ENST00000563290.1	-	13	1680	c.1585G>C	c.(1585-1587)Gaa>Caa	p.E529Q	SCAPER_ENST00000538941.2_Missense_Mutation_p.E283Q|SCAPER_ENST00000324767.7_Missense_Mutation_p.E529Q			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	529	Glu-rich.					endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GAAAGTTTTTCATGCATGTGA	0.418																																																	0													88.0	80.0	83.0					15																	77057706		1846	4095	5941	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1585G>C	15.37:g.77057706C>G	ENSP00000454973:p.Glu529Gln		F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.E529Q	ENST00000563290.1	37	c.1585	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504793	0.85176	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.27256	1.71;1.68	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.43545	0.1252	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;0.992;0.972	D;P;D	0.91635	0.999;0.85;0.926	T	0.22068	-1.0227	10	0.52906	T	0.07	.	19.6939	0.96016	0.0:1.0:0.0:0.0	.	529;550;283	Q6NSF1;Q9BY12-2;F5H7X8	.;.;.	Q	529;283;551	ENSP00000326924:E529Q;ENSP00000442190:E283Q	ENSP00000303560:E551Q	E	-	1	0	SCAPER	74844761	1.000000	0.71417	0.988000	0.46212	0.973000	0.67179	7.487000	0.81328	2.660000	0.90430	0.455000	0.32223	GAA	SCAPER	-	NULL	ENSG00000140386		0.418	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	-	0.00	28	0	C	NM_020843		77057706	-1	tier1	-	no_errors	ENST00000324767	ensembl	human	known	74_37	missense	40.00	21	14	SNP	1.000	G
SCAPER	49855	genome.wustl.edu	37	15	77067388	77067388	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:77067388C>T	ENST00000563290.1	-	9	938	c.843G>A	c.(841-843)gtG>gtA	p.V281V	SCAPER_ENST00000562890.1_5'UTR|SCAPER_ENST00000538941.2_Silent_p.V35V|SCAPER_ENST00000324767.7_Silent_p.V281V			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	281						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CTTTTGGCATCACTGCTGTTG	0.398																																																	0													140.0	138.0	138.0					15																	77067388		1912	4113	6025	SO:0001819	synonymous_variant	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.843G>A	15.37:g.77067388C>T			F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Silent	SNP	smart_Znf_U1	p.V281	ENST00000563290.1	37	c.843	CCDS53962.1	15																																																																																			SCAPER	-	NULL	ENSG00000140386		0.398	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	-	0.00	42	0	C	NM_020843		77067388	-1	tier1	-	no_errors	ENST00000324767	ensembl	human	known	74_37	silent	37.74	33	20	SNP	0.230	T
KPNA4	3840	genome.wustl.edu	37	3	160232848	160232848	+	Intron	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:160232848C>T	ENST00000334256.4	-	12	1338				SCARNA7_ENST00000458797.1_RNA	NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)						cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			ACTCCAATATCAGCATCACCA	0.413																																																	0													172.0	153.0	159.0					3																	160232848		876	1991	2867	SO:0001627	intron_variant	0			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.1032+391G>A	3.37:g.160232848C>T			A8K4S6|D3DNM2|O00190	RNA	SNP	-	NULL	ENST00000334256.4	37	NULL	CCDS3191.1	3																																																																																			SCARNA7	-	-	ENSG00000238741		0.413	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARNA7	HGNC	protein_coding	OTTHUMT00000352960.1	-	0.00	25	0	C	NM_002268		160232848	-1	tier1	-	no_errors	ENST00000458797	ensembl	human	known	74_37	rna	20.00	28	7	SNP	1.000	T
SCEL	8796	genome.wustl.edu	37	13	78191993	78191993	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr13:78191993C>T	ENST00000349847.3	+	26	1651	c.1567C>T	c.(1567-1569)Cag>Tag	p.Q523*	SCEL_ENST00000377246.3_Nonsense_Mutation_p.Q503*|SCEL_ENST00000535157.1_Nonsense_Mutation_p.Q481*	NM_144777.2	NP_659001.2	O95171	SCEL_HUMAN	sciellin	523	16 X approximate tandem repeats.				embryo development (GO:0009790)|epidermis development (GO:0008544)|keratinocyte differentiation (GO:0030216)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(18)|ovary(5)|prostate(1)|stomach(1)|urinary_tract(1)	40		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		CAGAAACAATCAGAGGTATAT	0.333																																																	0													82.0	88.0	86.0					13																	78191993		2202	4300	6502	SO:0001587	stop_gained	0			AF045941	CCDS9458.1, CCDS9459.1, CCDS53877.1	13q22	2008-07-18			ENSG00000136155	ENSG00000136155			10573	protein-coding gene	gene with protein product		604112				9813070	Standard	NM_003843		Approved	FLJ21667, MGC22531	uc001vki.3	O95171	OTTHUMG00000017107	ENST00000349847.3:c.1567C>T	13.37:g.78191993C>T	ENSP00000302579:p.Gln523*		B7Z797|F5H651|Q53H61|Q5W0S8|Q5W0S9|Q86X00	Nonsense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.Q523*	ENST00000349847.3	37	c.1567	CCDS9459.1	13	.	.	.	.	.	.	.	.	.	.	C	33	5.284254	0.95517	.	.	ENSG00000136155	ENST00000535157;ENST00000377246;ENST00000349847	.	.	.	5.93	5.04	0.67666	.	0.000000	0.53938	D	0.000050	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8752	12.2762	0.54737	0.0:0.8301:0.1699:0.0	.	.	.	.	X	481;503;523	.	ENSP00000302579:Q523X	Q	+	1	0	SCEL	77089994	0.995000	0.38212	0.985000	0.45067	0.795000	0.44927	1.970000	0.40520	2.826000	0.97356	0.655000	0.94253	CAG	SCEL	-	NULL	ENSG00000136155		0.333	SCEL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCEL	HGNC	protein_coding	OTTHUMT00000045339.2	-	0.00	22	0	C	NM_144777		78191993	+1	tier1	-	no_errors	ENST00000349847	ensembl	human	known	74_37	nonsense	41.94	18	13	SNP	0.972	T
KIAA0100	9703	genome.wustl.edu	37	17	26938832	26938832	+	IGR	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:26938832G>C	ENST00000528896.2	-	0	7407				SPAG5-AS1_ENST00000424210.1_RNA|RP11-192H23.4_ENST00000534850.1_Intron|RP11-192H23.4_ENST00000577790.1_Intron|SPAG5-AS1_ENST00000554154.1_RNA|SGK494_ENST00000301037.5_Intron|RP11-192H23.6_ENST00000579019.2_RNA|SGK494_ENST00000469832.3_5'Flank|SPAG5-AS1_ENST00000414744.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100							extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCACAGGTGAGAAGTAATTCT	0.433																																																	0													129.0	131.0	130.0					17																	26938832		2203	4300	6503	SO:0001628	intergenic_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587		17.37:g.26938832G>C			A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	RNA	SNP	-	NULL	ENST00000528896.2	37	NULL	CCDS32595.1	17																																																																																			SGK494	-	-	ENSG00000167524		0.433	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK494	Clone_based_vega_gene	protein_coding	OTTHUMT00000390571.3	-	0.00	39	0	G	NM_014680		26938832	-1	tier1	-	no_errors	ENST00000526073	ensembl	human	known	74_37	rna	30.95	29	13	SNP	0.016	C
SLC16A4	9122	genome.wustl.edu	37	1	110931944	110931944	+	Start_Codon_SNP	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:110931944A>G	ENST00000369779.4	-	2	251	c.2T>C	c.(1-3)aTg>aCg	p.M1T	SLC16A4_ENST00000437429.2_5'UTR|SLC16A4_ENST00000541986.1_5'UTR|SLC16A4_ENST00000472422.2_Start_Codon_SNP_p.M1T|SLC16A4_ENST00000369781.4_Start_Codon_SNP_p.M1T|LAMTOR5-AS1_ENST00000590413.1_RNA|SLC16A4_ENST00000497687.1_5'UTR	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	1					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	CCTCTTCAGCATGATGCCTCT	0.388																																																	0													154.0	147.0	150.0					1																	110931944		2203	4300	6503	SO:0001582	initiator_codon_variant	0			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.2T>C	1.37:g.110931944A>G	ENSP00000358794:p.Met1Thr		A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M1T	ENST00000369779.4	37	c.2	CCDS823.1	1	.	.	.	.	.	.	.	.	.	.	A	13.25	2.181490	0.38511	.	.	ENSG00000168679	ENST00000369779;ENST00000472422;ENST00000369781	T;T;T	0.15603	2.57;2.41;2.8	4.85	3.69	0.42338	.	0.511751	0.21792	N	0.069052	T	0.06050	0.0157	.	.	.	0.80722	D	1	B;B;B	0.32160	0.264;0.358;0.172	B;B;B	0.26517	0.033;0.07;0.015	T	0.10520	-1.0626	9	0.87932	D	0	.	8.4872	0.33078	0.9075:0.0:0.0925:0.0	.	1;1;1	G3V175;Q8WU09;O15374	.;.;MOT5_HUMAN	T	1	ENSP00000358794:M1T;ENSP00000432495:M1T;ENSP00000358796:M1T	ENSP00000358794:M1T	M	-	2	0	SLC16A4	110733467	1.000000	0.71417	0.925000	0.36789	0.308000	0.27856	1.836000	0.39191	0.667000	0.31107	0.374000	0.22700	ATG	SLC16A4	-	NULL	ENSG00000168679		0.388	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A4	HGNC	protein_coding	OTTHUMT00000031115.3	-	0.00	31	0	A	NM_004696	Missense_Mutation	110931944	-1	tier1	-	no_errors	ENST00000369779	ensembl	human	known	74_37	missense	29.17	17	7	SNP	1.000	G
SLC16A7	9194	genome.wustl.edu	37	12	60173438	60173438	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:60173438C>T	ENST00000261187.4	+	5	1579	c.1415C>T	c.(1414-1416)tCa>tTa	p.S472L	SLC16A7_ENST00000543448.1_Missense_Mutation_p.S373L|SLC16A7_ENST00000547379.1_Missense_Mutation_p.S472L|SLC16A7_ENST00000552432.1_Missense_Mutation_p.S472L|SLC16A7_ENST00000552024.1_Missense_Mutation_p.S472L	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	472					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	AGTGTAACCTCAGAAAGAGAA	0.328																																																	0													69.0	68.0	68.0					12																	60173438		2203	4298	6501	SO:0001583	missense	0			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.1415C>T	12.37:g.60173438C>T	ENSP00000261187:p.Ser472Leu		Q8NEM3|Q9UPB3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.S472L	ENST00000261187.4	37	c.1415	CCDS8961.1	12	.	.	.	.	.	.	.	.	.	.	C	16.24	3.067896	0.55539	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000261187;ENST00000543448	T;T;T;T;T	0.18657	2.33;2.33;2.33;2.33;2.2	5.22	5.22	0.72569	.	2.110390	0.02163	N	0.058977	T	0.34366	0.0895	M	0.68952	2.095	0.43417	D	0.995566	B	0.12630	0.006	B	0.08055	0.003	T	0.41574	-0.9501	9	.	.	.	.	19.1201	0.93360	0.0:1.0:0.0:0.0	.	472	O60669	MOT2_HUMAN	L	472;472;472;472;373	ENSP00000449547:S472L;ENSP00000448071:S472L;ENSP00000448742:S472L;ENSP00000261187:S472L;ENSP00000443731:S373L	.	S	+	2	0	SLC16A7	58459705	1.000000	0.71417	0.964000	0.40570	0.787000	0.44495	5.239000	0.65371	2.592000	0.87571	0.591000	0.81541	TCA	SLC16A7	-	NULL	ENSG00000118596		0.328	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A7	HGNC	protein_coding	OTTHUMT00000406587.1	-	0.00	40	0	C	NM_004731		60173438	+1	tier1	-	no_errors	ENST00000261187	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
SLC18A1	6570	genome.wustl.edu	37	8	20036783	20036783	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:20036783G>T	ENST00000276373.5	-	3	603	c.337C>A	c.(337-339)Cca>Aca	p.P113T	SLC18A1_ENST00000440926.1_Missense_Mutation_p.P113T|SLC18A1_ENST00000437980.1_Missense_Mutation_p.P113T|SLC18A1_ENST00000519026.1_Missense_Mutation_p.P113T|SLC18A1_ENST00000381608.4_Missense_Mutation_p.P113T|SLC18A1_ENST00000265808.7_Missense_Mutation_p.P113T	NM_003053.3	NP_003044.1	P54219	VMAT1_HUMAN	solute carrier family 18 (vesicular monoamine transporter), member 1	113					monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29				Colorectal(74;0.0747)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	TCAGTGGCTGGAGGTGGGATG	0.493																																																	0													150.0	113.0	125.0					8																	20036783		2203	4300	6503	SO:0001583	missense	0				CCDS6013.1, CCDS47814.1, CCDS47815.1	8p21.3	2013-07-18	2013-07-18		ENSG00000036565	ENSG00000036565		"""Solute carriers"""	10934	protein-coding gene	gene with protein product		193002		VMAT1, VAT1			Standard	NM_003053		Approved	CGAT	uc003wzm.3	P54219	OTTHUMG00000097017	ENST00000276373.5:c.337C>A	8.37:g.20036783G>T	ENSP00000276373:p.Pro113Thr		E9PDJ5|Q9BRE4	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Multidrug-R	p.P113T	ENST00000276373.5	37	c.337	CCDS6013.1	8	.	.	.	.	.	.	.	.	.	.	G	8.170	0.791509	0.16258	.	.	ENSG00000036565	ENST00000265808;ENST00000276373;ENST00000440926;ENST00000437980;ENST00000519026;ENST00000381608;ENST00000522513	T;T;T;T;T;T;T	0.04360	3.93;3.95;3.95;3.93;3.93;3.93;3.64	5.95	5.08	0.68730	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.414501	0.27092	N	0.020970	T	0.03178	0.0093	N	0.11201	0.11	0.20196	N	0.99992	B;B;B	0.29136	0.001;0.234;0.155	B;B;B	0.33254	0.01;0.119;0.16	T	0.48163	-0.9059	10	0.15066	T	0.55	-0.391	10.1203	0.42616	0.0:0.149:0.6964:0.1547	.	113;113;113	E9PB33;E9PDJ5;P54219	.;.;VMAT1_HUMAN	T	113	ENSP00000265808:P113T;ENSP00000276373:P113T;ENSP00000387549:P113T;ENSP00000413361:P113T;ENSP00000429664:P113T;ENSP00000371021:P113T;ENSP00000428999:P113T	ENSP00000265808:P113T	P	-	1	0	SLC18A1	20081063	0.737000	0.28175	0.669000	0.29828	0.009000	0.06853	1.961000	0.40432	1.524000	0.49035	-0.150000	0.13652	CCA	SLC18A1	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000036565		0.493	SLC18A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A1	HGNC	protein_coding	OTTHUMT00000214106.1	-	0.00	87	0	G			20036783	-1	tier1	-	no_errors	ENST00000276373	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.188	T
SLC1A6	6511	genome.wustl.edu	37	19	15083545	15083545	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:15083545G>A	ENST00000221742.3	-	1	185	c.178C>T	c.(178-180)Ctg>Ttg	p.L60L	SLC1A6_ENST00000544886.2_Silent_p.L60L|SLC1A6_ENST00000430939.2_Missense_Mutation_p.S64F|SLC1A6_ENST00000598504.1_Silent_p.L60L|SLC1A6_ENST00000600144.1_Silent_p.L60L	NM_005071.1	NP_005062.1	P48664	EAA4_HUMAN	solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6	60					aspartate transport (GO:0015810)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(8)|liver(1)|lung(12)|ovary(3)|pancreas(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42						ACCGTCAGCAGAATGAAGGCG	0.632																																																	0													29.0	29.0	29.0					19																	15083545		2202	4299	6501	SO:0001819	synonymous_variant	0				CCDS12321.1, CCDS62578.1	19p13.12	2013-07-15			ENSG00000105143	ENSG00000105143		"""Solute carriers"""	10944	protein-coding gene	gene with protein product		600637				7791878	Standard	NM_005071		Approved	EAAT4	uc002naa.2	P48664	OTTHUMG00000183351	ENST00000221742.3:c.178C>T	19.37:g.15083545G>A			Q8N753	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.S64F	ENST00000221742.3	37	c.191	CCDS12321.1	19	.	.	.	.	.	.	.	.	.	.	G	10.44	1.349519	0.24426	.	.	ENSG00000105143	ENST00000430939	T	0.74421	-0.84	4.46	2.27	0.28462	.	.	.	.	.	T	0.64929	0.2643	.	.	.	0.80722	D	1	B	0.25486	0.127	B	0.27887	0.084	T	0.61327	-0.7085	8	0.87932	D	0	-13.4289	6.4885	0.22103	0.2315:0.0:0.7685:0.0	.	64	E7EV13	.	F	64	ENSP00000409386:S64F	ENSP00000409386:S64F	S	-	2	0	SLC1A6	14944545	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	3.839000	0.55835	0.476000	0.27440	0.313000	0.20887	TCT	SLC1A6	-	NULL	ENSG00000105143		0.632	SLC1A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC1A6	HGNC	protein_coding	OTTHUMT00000466283.1	-	0.00	32	0	G	NM_005071		15083545	-1	tier1	-	no_errors	ENST00000430939	ensembl	human	putative	74_37	missense	17.86	23	5	SNP	1.000	A
SLC24A1	9187	genome.wustl.edu	37	15	65943238	65943238	+	Silent	SNP	C	C	T	rs368057501		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:65943238C>T	ENST00000261892.6	+	7	3038	c.2751C>T	c.(2749-2751)atC>atT	p.I917I	SLC24A1_ENST00000546330.1_Silent_p.I899I|SLC24A1_ENST00000339868.6_Silent_p.I899I|SLC24A1_ENST00000399033.4_Silent_p.I917I|SLC24A1_ENST00000537259.1_Silent_p.I899I|SLC24A1_ENST00000449142.2_3'UTR|SLC24A1_ENST00000544319.2_Silent_p.I803I	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	917					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						TTCTGCCCATCGTGTTCCCAC	0.572																																																	0								C		0,4326		0,0,2163	66.0	70.0	68.0		2751	-1.0	1.0	15		68	1,8501		0,1,4250	no	coding-synonymous	SLC24A1	NM_004727.2		0,1,6413	TT,TC,CC		0.0118,0.0,0.0078		917/1100	65943238	1,12827	2163	4251	6414	SO:0001819	synonymous_variant	0			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.2751C>T	15.37:g.65943238C>T			O43485|O75184|Q17RM9	Silent	SNP	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K/Na/Ca-exchanger	p.I917	ENST00000261892.6	37	c.2751	CCDS45284.1	15																																																																																			SLC24A1	-	tigrfam_K/Na/Ca-exchanger	ENSG00000074621		0.572	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	HGNC	protein_coding	OTTHUMT00000397304.1	-	0.00	39	0	C	NM_004727		65943238	+1	tier1	-	no_errors	ENST00000261892	ensembl	human	known	74_37	silent	22.22	35	10	SNP	0.878	T
SLC29A4	222962	genome.wustl.edu	37	7	5336607	5336607	+	Silent	SNP	G	G	A	rs138555653		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:5336607G>A	ENST00000396872.3	+	7	821	c.660G>A	c.(658-660)acG>acA	p.T220T	SLC29A4_ENST00000297195.4_Silent_p.T220T|SLC29A4_ENST00000406453.3_Silent_p.T206T			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	220					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	GCATCCTCACGAAGCTGCTGC	0.687																																																	0													18.0	18.0	18.0					7																	5336607		2182	4251	6433	SO:0001819	synonymous_variant	0			AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.660G>A	7.37:g.5336607G>A			Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	p.T220	ENST00000396872.3	37	c.660	CCDS5340.1	7																																																																																			SLC29A4	-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	ENSG00000164638		0.687	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A4	HGNC	protein_coding	OTTHUMT00000060118.6	-	0.00	58	0	G	NM_153247		5336607	+1	tier1	-	no_errors	ENST00000297195	ensembl	human	known	74_37	silent	7.69	72	6	SNP	1.000	A
SLC44A2	57153	genome.wustl.edu	37	19	10747198	10747198	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:10747198C>T	ENST00000335757.5	+	15	1809	c.1433C>T	c.(1432-1434)gCc>gTc	p.A478V	SLC44A2_ENST00000586078.1_Missense_Mutation_p.A478V|SLC44A2_ENST00000407327.4_Missense_Mutation_p.A476V			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	478					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	TACTACTGGGCCCTGCGCAAG	0.657																																																	0													48.0	50.0	49.0					19																	10747198		2203	4299	6502	SO:0001583	missense	0			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1433C>T	19.37:g.10747198C>T	ENSP00000336888:p.Ala478Val		B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.A478V	ENST00000335757.5	37	c.1433	CCDS12245.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.890220	0.97068	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.25414	1.8;1.8	5.8	5.8	0.92144	.	0.047152	0.85682	D	0.000000	T	0.60766	0.2294	M	0.89658	3.05	0.80722	D	1	D;P;D	0.71674	0.998;0.941;0.998	D;P;D	0.74348	0.983;0.854;0.975	T	0.67852	-0.5563	10	0.87932	D	0	-35.2271	18.8323	0.92145	0.0:1.0:0.0:0.0	.	478;478;476	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	V	476;478;478	ENSP00000385135:A476V;ENSP00000336888:A478V	ENSP00000336888:A478V	A	+	2	0	SLC44A2	10608198	1.000000	0.71417	0.983000	0.44433	0.995000	0.86356	7.744000	0.85034	2.755000	0.94549	0.655000	0.94253	GCC	SLC44A2	-	pfam_Choline_transptr-like	ENSG00000129353		0.657	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1	-	0.00	45	0	C			10747198	+1	tier1	-	no_errors	ENST00000335757	ensembl	human	known	74_37	missense	43.24	21	16	SNP	1.000	T
SLC7A13	157724	genome.wustl.edu	37	8	87229753	87229753	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:87229753C>T	ENST00000297524.3	-	3	1228	c.1125G>A	c.(1123-1125)atG>atA	p.M375I	SLC7A13_ENST00000520624.1_5'Flank|SLC7A13_ENST00000419776.2_Missense_Mutation_p.M366I	NM_138817.2	NP_620172.2	Q8TCU3	S7A13_HUMAN	solute carrier family 7 (anionic amino acid transporter), member 13	375						integral component of membrane (GO:0016021)	amino acid transmembrane transporter activity (GO:0015171)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	45						GTATTCCTATCATTAATAATA	0.303																																																	0													30.0	35.0	34.0					8																	87229753		2195	4291	6486	SO:0001583	missense	0			AJ417661	CCDS34917.1	8q21.3	2013-07-15	2011-07-12		ENSG00000164893	ENSG00000164893		"""Solute carriers"""	23092	protein-coding gene	gene with protein product						11907033, 11943479	Standard	XM_005250804		Approved	AGT-1, XAT2	uc003ydq.1	Q8TCU3	OTTHUMG00000163663	ENST00000297524.3:c.1125G>A	8.37:g.87229753C>T	ENSP00000297524:p.Met375Ile		Q05C37|Q08AH9|Q96N84	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.M375I	ENST00000297524.3	37	c.1125	CCDS34917.1	8	.	.	.	.	.	.	.	.	.	.	C	0.788	-0.759860	0.03019	.	.	ENSG00000164893	ENST00000297524;ENST00000419776	D;D	0.89270	-2.49;-2.49	5.03	-0.497	0.12023	.	1.034570	0.07624	N	0.927552	T	0.68933	0.3055	N	0.03917	-0.325	0.09310	N	1	B;B	0.22080	0.012;0.064	B;B	0.19391	0.01;0.025	T	0.59836	-0.7379	10	0.02654	T	1	.	5.1423	0.14965	0.1342:0.4246:0.0:0.4413	.	366;375	Q8TCU3-2;Q8TCU3	.;S7A13_HUMAN	I	375;366	ENSP00000297524:M375I;ENSP00000410982:M366I	ENSP00000297524:M375I	M	-	3	0	SLC7A13	87298869	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	-0.260000	0.08708	-0.204000	0.10235	-0.145000	0.13849	ATG	SLC7A13	-	pirsf_AA/rel_permease1	ENSG00000164893		0.303	SLC7A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A13	HGNC	protein_coding	OTTHUMT00000374704.1	-	0.00	53	0	C	NM_138817		87229753	-1	tier1	-	no_errors	ENST00000297524	ensembl	human	known	74_37	missense	43.33	17	13	SNP	0.000	T
SMC2	10592	genome.wustl.edu	37	9	106901433	106901433	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:106901433C>T	ENST00000286398.7	+	25	3719	c.3431C>T	c.(3430-3432)tCa>tTa	p.S1144L	SMC2_ENST00000374787.3_Missense_Mutation_p.S1144L|SMC2_ENST00000374793.3_Missense_Mutation_p.S1144L	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	1144					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						ATTGTGGTGTCACTAAAAGAA	0.318																																																	0													70.0	69.0	70.0					9																	106901433		2203	4300	6503	SO:0001583	missense	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.3431C>T	9.37:g.106901433C>T	ENSP00000286398:p.Ser1144Leu		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.S1144L	ENST00000286398.7	37	c.3431	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958188	0.92726	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000374787	T;T;T	0.09538	2.97;2.97;2.97	5.43	5.43	0.79202	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.47764	0.1463	H	0.95294	3.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62172	-0.6910	10	0.87932	D	0	-6.6075	17.9908	0.89168	0.0:1.0:0.0:0.0	.	1144	O95347	SMC2_HUMAN	L	1144	ENSP00000286398:S1144L;ENSP00000363925:S1144L;ENSP00000363919:S1144L	ENSP00000286398:S1144L	S	+	2	0	SMC2	105941254	1.000000	0.71417	0.993000	0.49108	0.875000	0.50365	7.565000	0.82337	2.826000	0.97356	0.655000	0.94253	TCA	SMC2	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000136824		0.318	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1		0.00	16	0	C			106901433	+1			no_errors	ENST00000286398	ensembl	human	known	74_37	missense	39.13	14	9	SNP	1.000	T
SNAPC4	6621	genome.wustl.edu	37	9	139282959	139282959	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:139282959C>T	ENST00000298532.2	-	10	1428	c.1060G>A	c.(1060-1062)Gac>Aac	p.D354N		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa											biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		AGCATGCGGTCCTCCTCCTCT	0.627																																																	0													123.0	95.0	105.0					9																	139282959		2203	4300	6503	SO:0001583	missense	0			AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.1060G>A	9.37:g.139282959C>T	ENSP00000298532:p.Asp354Asn			Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.D354N	ENST00000298532.2	37	c.1060	CCDS6998.1	9	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838133	0.91117	.	.	ENSG00000165684	ENST00000298532	T	0.28895	1.59	5.21	5.21	0.72293	SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (2);MYB-like (1);	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	M	0.89353	3.025	0.43879	D	0.996493	D	0.89917	1.0	D	0.97110	1.0	T	0.71361	-0.4616	10	0.72032	D	0.01	-38.1495	17.7432	0.88412	0.0:1.0:0.0:0.0	.	354	Q5SXM2	SNPC4_HUMAN	N	354	ENSP00000298532:D354N	ENSP00000298532:D354N	D	-	1	0	SNAPC4	138402780	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.763000	0.62257	2.438000	0.82558	0.561000	0.74099	GAC	SNAPC4	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	ENSG00000165684		0.627	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC4	HGNC	protein_coding	OTTHUMT00000055071.1	-	0.00	28	0	C	NM_003086		139282959	-1	tier1	-	no_errors	ENST00000298532	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	T
SNF8	11267	genome.wustl.edu	37	17	47007863	47007863	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:47007863C>G	ENST00000502492.1	-	8	1133	c.751G>C	c.(751-753)Gag>Cag	p.E251Q	AC091133.1_ENST00000435491.1_RNA|SNF8_ENST00000290330.3_Missense_Mutation_p.E250Q|SNF8_ENST00000514089.1_5'UTR			Q96H20	SNF8_HUMAN	SNF8, ESCRT-II complex subunit	251					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|lung(1)	3						CTGGCCTCCTCAGCTGTAATC	0.592																																																	0													26.0	25.0	25.0					17																	47007863		2203	4300	6503	SO:0001583	missense	0			AF156102	CCDS11541.1	17q21.32	2013-06-05	2013-06-05		ENSG00000159210	ENSG00000159210			17028	protein-coding gene	gene with protein product		610904	"""SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)"""			10419521, 15329733	Standard	NM_007241		Approved	EAP30, VPS22, Dot3	uc002ioj.3	Q96H20	OTTHUMG00000160569	ENST00000502492.1:c.751G>C	17.37:g.47007863C>G	ENSP00000421380:p.Glu251Gln		Q8IXY3|Q9UN50	Missense_Mutation	SNP	pfam_EAP30,pirsf_ESCRT-2_cplx_Snf8	p.E251Q	ENST00000502492.1	37	c.751	CCDS11541.1	17	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414837	0.83449	.	.	ENSG00000159210	ENST00000502492;ENST00000290330	.	.	.	5.87	5.87	0.94306	.	0.096709	0.64402	D	0.000001	T	0.54208	0.1844	N	0.19112	0.55	0.80722	D	1	B;B	0.28850	0.225;0.144	B;B	0.31946	0.138;0.065	T	0.54964	-0.8214	9	0.87932	D	0	-21.2329	20.1777	0.98189	0.0:1.0:0.0:0.0	.	250;251	Q96H20-2;Q96H20	.;SNF8_HUMAN	Q	251;250	.	ENSP00000290330:E250Q	E	-	1	0	SNF8	44362862	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	7.592000	0.82676	2.941000	0.99782	0.655000	0.94253	GAG	SNF8	-	NULL	ENSG00000159210		0.592	SNF8-001	KNOWN	basic|CCDS	protein_coding	SNF8	HGNC	protein_coding	OTTHUMT00000361172.1	-	0.00	43	0	C	NM_007241		47007863	-1	tier1	-	no_errors	ENST00000502492	ensembl	human	known	74_37	missense	33.93	37	19	SNP	1.000	G
SRP54	6729	genome.wustl.edu	37	14	35480717	35480717	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:35480717A>G	ENST00000556994.1	+	9	885	c.488A>G	c.(487-489)tAt>tGt	p.Y163C	SRP54_ENST00000555557.1_Missense_Mutation_p.Y99C|SRP54_ENST00000546080.1_Missense_Mutation_p.Y114C|SRP54_ENST00000216774.6_Missense_Mutation_p.Y163C			P61011	SRP54_HUMAN	signal recognition particle 54kDa	163	G-domain.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|protein targeting to ER (GO:0045047)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|SRP-dependent cotranslational protein targeting to membrane, signal sequence recognition (GO:0006617)|SRP-dependent cotranslational protein targeting to membrane, translocation (GO:0006616)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|drug binding (GO:0008144)|endoplasmic reticulum signal peptide binding (GO:0030942)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;2.48e-05)|Lung(238;3.13e-05)|Epithelial(34;0.0314)|all cancers(34;0.0797)|BRCA - Breast invasive adenocarcinoma(188;0.243)	GBM - Glioblastoma multiforme(112;0.0396)		TTATATAGCTATACAGAAATG	0.294																																																	0													67.0	72.0	71.0					14																	35480717		2202	4295	6497	SO:0001583	missense	0			X86373	CCDS9652.1, CCDS53893.1	14q13.2	2014-06-02	2002-08-29		ENSG00000100883	ENSG00000100883			11301	protein-coding gene	gene with protein product		604857	"""signal recognition particle 54kD"""			8722571	Standard	NM_003136		Approved		uc001wso.3	P61011	OTTHUMG00000140214	ENST00000556994.1:c.488A>G	14.37:g.35480717A>G	ENSP00000451818:p.Tyr163Cys		B2R759|B4DUW6|P13624	Missense_Mutation	SNP	pfam_SRP54_GTPase_dom,pfam_Signal_recog_particle_SRP54_M,pfam_Signal_recog_particl_SRP54_hlx,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP54_M,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	p.Y163C	ENST00000556994.1	37	c.488	CCDS9652.1	14	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293376	0.80914	.	.	ENSG00000100883	ENST00000556994;ENST00000216774;ENST00000546080;ENST00000555557	.	.	.	5.67	5.67	0.87782	ATPase, AAA+ type, core (1);Signal recognition particle, SRP54 subunit, GTPase (2);	0.000000	0.85682	D	0.000000	T	0.80215	0.4582	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.80683	-0.1273	9	0.38643	T	0.18	-19.4471	15.8921	0.79305	1.0:0.0:0.0:0.0	.	114;163	B4DUW6;P61011	.;SRP54_HUMAN	C	163;163;114;99	.	ENSP00000216774:Y163C	Y	+	2	0	SRP54	34550468	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.108000	0.94275	2.162000	0.67917	0.482000	0.46254	TAT	SRP54	-	pfam_SRP54_GTPase_dom,pfam_CobW/HypB/UreG_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_SRP54_GTPase_dom,tigrfam_SRP54_euk	ENSG00000100883		0.294	SRP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP54	HGNC	protein_coding	OTTHUMT00000276643.2	-	0.00	39	0	A	NM_003136		35480717	+1	tier1	-	no_errors	ENST00000216774	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	G
SNHG23	100507242	genome.wustl.edu	37	14	101421716	101421716	+	lincRNA	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr14:101421716G>A	ENST00000556637.1	+	0	399				SNORD113_ENST00000363280.1_RNA|SNORD114-6_ENST00000364393.1_RNA|SNORD114-3_ENST00000364969.1_RNA|SNORD114-4_ENST00000363962.1_RNA|SNORD114-5_ENST00000362928.1_RNA																							CTGGATTGATGATGACCACTG	0.398																																																	0													98.0	92.0	94.0					14																	101421716		876	1991	2867			0																															14.37:g.101421716G>A				RNA	SNP	-	NULL	ENST00000556637.1	37	NULL		14																																																																																			SNORD114-5	-	-	ENSG00000199798		0.398	AL132709.5-004	KNOWN	basic	lincRNA	SNORD114-5	HGNC	lincRNA	OTTHUMT00000414510.1	-	0.00	48	0	G			101421716	+1	tier1	-	no_errors	ENST00000362928	ensembl	human	known	74_37	rna	41.30	27	19	SNP	0.050	A
STPG1	90529	genome.wustl.edu	37	1	24710447	24710447	+	Missense_Mutation	SNP	G	G	A	rs138455088		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:24710447G>A	ENST00000374409.1	-	4	490	c.236C>T	c.(235-237)cCg>cTg	p.P79L	STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000003583.8_Missense_Mutation_p.P32L|STPG1_ENST00000440416.1_Missense_Mutation_p.P32L|STPG1_ENST00000337248.4_Missense_Mutation_p.P79L	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	79					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTTGGACACCGGTGACTGGTG	0.428													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22707	0.0		0.0	False		,,,				2504	0.0																0								G	LEU/PRO,LEU/PRO,,LEU/PRO	1,4405	2.1+/-5.4	0,1,2202	195.0	181.0	186.0		236,236,,95	4.2	0.9	1	dbSNP_134	186	0,8600		0,0,4300	no	missense,missense,utr-5,missense	C1orf201	NM_001199012.1,NM_001199013.1,NM_001199014.1,NM_178122.4	98,98,,98	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,,benign	79/335,79/335,,32/288	24710447	1,13005	2203	4300	6503	SO:0001583	missense	0			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.236C>T	1.37:g.24710447G>A	ENSP00000363530:p.Pro79Leu		Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Missense_Mutation	SNP	NULL	p.P79L	ENST00000374409.1	37	c.236	CCDS55581.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.49|15.49	2.848114|2.848114	0.51164|0.51164	2.27E-4|2.27E-4	0.0|0.0	ENSG00000001460|ENSG00000001460	ENST00000374409;ENST00000440416;ENST00000003583;ENST00000337248;ENST00000437986|ENST00000435187	.|.	.|.	.|.	6.03|6.03	4.15|4.15	0.48705|0.48705	.|.	0.153066|.	0.44688|.	N|.	0.000433|.	T|T	0.58075|0.58075	0.2097|0.2097	L|L	0.50919|0.50919	1.6|1.6	0.47659|0.47659	D|D	0.999485|0.999485	B;B|.	0.33212|.	0.402;0.189|.	B;B|.	0.32342|.	0.144;0.046|.	T|T	0.53373|0.53373	-0.8448|-0.8448	9|5	0.02654|.	T|.	1|.	-6.3934|-6.3934	9.5785|9.5785	0.39472|0.39472	0.1623:0.0:0.8377:0.0|0.1623:0.0:0.8377:0.0	.|.	79;32|.	Q5TH74;Q5TH74-3|.	CA201_HUMAN;.|.	L|W	79;32;32;79;79|56	.|.	ENSP00000003583:P32L|.	P|R	-|-	2|1	0|2	C1orf201|C1orf201	24583034|24583034	0.992000|0.992000	0.36948|0.36948	0.859000|0.859000	0.33776|0.33776	0.952000|0.952000	0.60782|0.60782	1.862000|1.862000	0.39448|0.39448	0.867000|0.867000	0.35654|0.35654	0.655000|0.655000	0.94253|0.94253	CCG|CGG	STPG1	-	NULL	ENSG00000001460		0.428	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STPG1	HGNC	protein_coding	OTTHUMT00000009172.1	-	0.00	51	0	G	NM_178122		24710447	-1	tier1	rs138455088	no_errors	ENST00000337248	ensembl	human	known	74_37	missense	43.48	26	20	SNP	0.931	A
STRADA	92335	genome.wustl.edu	37	17	61780982	61780982	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:61780982C>G	ENST00000336174.6	-	13	1385	c.1273G>C	c.(1273-1275)Gag>Cag	p.E425Q	STRADA_ENST00000375840.4_Missense_Mutation_p.E367Q|STRADA_ENST00000245865.5_3'UTR|STRADA_ENST00000447001.3_3'UTR|STRADA_ENST00000392950.4_3'UTR|LIMD2_ENST00000578402.1_5'Flank|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000580039.1_5'Flank	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	425					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						TCGTCCACCTCCAGCTCTTCC	0.577																																																	0													64.0	58.0	60.0					17																	61780982		2203	4300	6503	SO:0001583	missense	0			AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.1273G>C	17.37:g.61780982C>G	ENSP00000336655:p.Glu425Gln		B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E425Q	ENST00000336174.6	37	c.1273	CCDS32703.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969039	0.74131	.	.	ENSG00000125695	ENST00000336174;ENST00000375840	T;T	0.56444	0.48;0.46	4.99	4.99	0.66335	.	0.204775	0.51477	D	0.000090	T	0.41858	0.1177	N	0.19112	0.55	0.80722	D	1	B;B;B	0.32245	0.089;0.255;0.361	B;B;B	0.33042	0.047;0.157;0.092	T	0.34204	-0.9838	10	0.38643	T	0.18	.	18.475	0.90790	0.0:1.0:0.0:0.0	.	367;388;425	Q5JPI2;Q7RTN6-3;Q7RTN6	.;.;STRAA_HUMAN	Q	425;367	ENSP00000336655:E425Q;ENSP00000365000:E367Q	ENSP00000336655:E425Q	E	-	1	0	STRADA	59134714	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.254000	0.78329	2.592000	0.87571	0.555000	0.69702	GAG	STRADA	-	NULL	ENSG00000266173		0.577	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADA	HGNC	protein_coding	OTTHUMT00000443894.1	-	0.00	30	0	C			61780982	-1	tier1	-	no_errors	ENST00000336174	ensembl	human	known	74_37	missense	50.00	28	28	SNP	1.000	G
SUV420H2	84787	genome.wustl.edu	37	19	55853307	55853307	+	Start_Codon_SNP	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:55853307G>A	ENST00000255613.3	+	2	251	c.3G>A	c.(1-3)atG>atA	p.M1I	AC020922.1_ENST00000539076.1_5'UTR|SUV420H2_ENST00000402499.4_3'UTR	NM_032701.3	NP_116090.2	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2 (Drosophila)	1					histone H4-K20 trimethylation (GO:0034773)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	4	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		AGGGCACCATGGGGCCCGACA	0.652																																																	0													82.0	74.0	77.0					19																	55853307		2203	4300	6503	SO:0001582	initiator_codon_variant	0			BC005842	CCDS12922.1	19q13.42	2011-07-01			ENSG00000133247	ENSG00000133247		"""Chromatin-modifying enzymes / K-methyltransferases"""	28405	protein-coding gene	gene with protein product		613198				12477932	Standard	NM_032701		Approved	MGC2705, KMT5C	uc002qkj.4	Q86Y97	OTTHUMG00000150483	ENST00000255613.3:c.3G>A	19.37:g.55853307G>A	ENSP00000255613:p.Met1Ile		Q8WZ10|Q9BRZ6	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.M1I	ENST00000255613.3	37	c.3	CCDS12922.1	19	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015707	0.54468	.	.	ENSG00000133247	ENST00000255613;ENST00000402499	.	.	.	3.35	3.35	0.38373	.	0.000000	0.43579	D	0.000558	T	0.74612	0.3739	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.77928	-0.2404	8	0.54805	T	0.06	-6.8996	14.6575	0.68844	0.0:0.0:1.0:0.0	.	1	Q86Y97	SV422_HUMAN	I	1	.	ENSP00000255613:M1I	M	+	3	0	SUV420H2	60545119	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	3.699000	0.54778	2.154000	0.67381	0.563000	0.77884	ATG	SUV420H2	-	NULL	ENSG00000133247		0.652	SUV420H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H2	HGNC	protein_coding	OTTHUMT00000318309.2	-	0.00	61	0	G	NM_032701	Missense_Mutation	55853307	+1	tier1	-	no_errors	ENST00000255613	ensembl	human	known	74_37	missense	37.63	58	35	SNP	1.000	A
SV2C	22987	genome.wustl.edu	37	5	75427799	75427799	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:75427799C>G	ENST00000502798.2	+	2	666	c.224C>G	c.(223-225)tCa>tGa	p.S75*	SV2C_ENST00000322285.7_Nonsense_Mutation_p.S75*	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	75					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		GACGAAGGCTCAAGTGAAGCC	0.507																																																	0													80.0	83.0	82.0					5																	75427799		2095	4244	6339	SO:0001587	stop_gained	0			AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.224C>G	5.37:g.75427799C>G	ENSP00000423541:p.Ser75*		Q496K1|Q9UPU8	Nonsense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.S75*	ENST00000502798.2	37	c.224	CCDS43331.1	5	.	.	.	.	.	.	.	.	.	.	C	40	8.049863	0.98629	.	.	ENSG00000122012	ENST00000502798;ENST00000322285	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-24.0566	19.9694	0.97278	0.0:1.0:0.0:0.0	.	.	.	.	X	75	.	ENSP00000316983:S75X	S	+	2	0	SV2C	75463555	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	5.920000	0.70017	2.719000	0.93026	0.655000	0.94253	TCA	SV2C	-	superfamily_MFS_dom_general_subst_transpt,tigrfam_SV2	ENSG00000122012		0.507	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2C	HGNC	protein_coding	OTTHUMT00000368700.4	-	0.00	29	0	C			75427799	+1	tier1	-	no_errors	ENST00000502798	ensembl	human	known	74_37	nonsense	60.00	6	9	SNP	1.000	G
SYNJ1	8867	genome.wustl.edu	37	21	34011322	34011322	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr21:34011322T>A	ENST00000322229.7	-	30	3810	c.3811A>T	c.(3811-3813)Atg>Ttg	p.M1271L	SYNJ1_ENST00000357345.3_Missense_Mutation_p.M1255L|SYNJ1_ENST00000382491.3_Missense_Mutation_p.M1224L|SYNJ1_ENST00000382499.2_Missense_Mutation_p.M1310L|SYNJ1_ENST00000433931.2_Missense_Mutation_p.M1310L			O43426	SYNJ1_HUMAN	synaptojanin 1	1271	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						GACTGAGGCATAGGTGCTGCC	0.567																																																	0													149.0	159.0	156.0					21																	34011322		2203	4300	6503	SO:0001583	missense	0			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.3811A>T	21.37:g.34011322T>A	ENSP00000322234:p.Met1271Leu		O43425|O94984|Q4KMR1	Missense_Mutation	SNP	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.M1310L	ENST00000322229.7	37	c.3928	CCDS54484.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.887|9.887	1.203213|1.203213	0.22121|0.22121	.|.	.|.	ENSG00000159082|ENSG00000159082	ENST00000382491;ENST00000357345;ENST00000382499;ENST00000433931;ENST00000322229|ENST00000438952	D;D;D;D;D|.	0.92805|.	-2.26;-3.11;-3.09;-2.26;-2.25|.	5.13|5.13	-10.3|-10.3	0.00346|0.00346	.|.	1.165590|.	0.05998|.	N|.	0.647150|.	T|T	0.21468|0.21468	0.0517|0.0517	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B|.	0.01281|.	0.0;0.0;0.0;0.0;0.0|.	T|T	0.12066|0.12066	-1.0562|-1.0562	10|5	0.27082|.	T|.	0.32|.	.|.	6.8826|6.8826	0.24181|0.24181	0.1969:0.1722:0.5361:0.0948|0.1969:0.1722:0.5361:0.0948	.|.	1224;1310;1271;1271;1255|.	B9EGN3;C9JFZ1;O43426-2;O43426;O43426-4|.	.;.;.;SYNJ1_HUMAN;.|.	L|F	1224;1255;1310;1310;1271|146	ENSP00000371931:M1224L;ENSP00000349903:M1255L;ENSP00000371939:M1310L;ENSP00000409667:M1310L;ENSP00000322234:M1271L|.	ENSP00000322234:M1271L|.	M|Y	-|-	1|2	0|0	SYNJ1|SYNJ1	32933193|32933193	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.735000|0.735000	0.41995|0.41995	-1.363000|-1.363000	0.02592|0.02592	-3.263000|-3.263000	0.00201|0.00201	0.533000|0.533000	0.62120|0.62120	ATG|TAT	SYNJ1	-	NULL	ENSG00000159082		0.567	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding		-	0.00	82	0	T			34011322	-1	tier1	-	no_errors	ENST00000433931	ensembl	human	known	74_37	missense	26.72	85	31	SNP	0.000	A
SYNRG	11276	genome.wustl.edu	37	17	35900600	35900600	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:35900600C>T	ENST00000339208.6	-	16	3388	c.3248G>A	c.(3247-3249)cGt>cAt	p.R1083H	SYNRG_ENST00000345615.4_Missense_Mutation_p.R1005H|SYNRG_ENST00000591288.1_Missense_Mutation_p.R877H|SYNRG_ENST00000585472.1_Missense_Mutation_p.R1004H|SYNRG_ENST00000346661.4_Missense_Mutation_p.R1083H|SYNRG_ENST00000502449.2_Missense_Mutation_p.R960H|SYNRG_ENST00000394378.2_Missense_Mutation_p.R1005H	NM_001163544.1|NM_001163545.1|NM_007247.4	NP_001157016.1|NP_001157017.1|NP_009178.3	Q9UMZ2	SYNRG_HUMAN	synergin, gamma	1083					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)	AP-1 adaptor complex (GO:0030121)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						AGGAGAAGAACGGCTTATTTC	0.488																																																	0													108.0	111.0	110.0					17																	35900600		2203	4300	6503	SO:0001583	missense	0			AF169548	CCDS11321.1, CCDS11322.1, CCDS11322.2, CCDS54113.1, CCDS54114.1, CCDS59284.1, CCDS59285.1	17q12	2014-04-16	2009-07-20	2009-07-20	ENSG00000006114	ENSG00000275066			557	protein-coding gene	gene with protein product	"""gamma-synergin"", ""adaptor-related protein complex 1 gamma subunit-binding protein 1"""	607291	"""AP1 gamma subunit binding protein 1"""	AP1GBP1		10477754	Standard	XM_005256980		Approved	SYNG, MGC104959	uc010wdf.2	Q9UMZ2	OTTHUMG00000188473	ENST00000339208.6:c.3248G>A	17.37:g.35900600C>T	ENSP00000343610:p.Arg1083His		A8MWU4|B7ZKZ2|B7ZKZ3|Q17RI2|Q5BKU5|Q6ZT17	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EPS15_homology	p.R1083H	ENST00000339208.6	37	c.3248	CCDS11321.1	17	.	.	.	.	.	.	.	.	.	.	C	13.96	2.394064	0.42410	.	.	ENSG00000006114	ENST00000346661;ENST00000339208;ENST00000345615;ENST00000502449;ENST00000394378	T;T	0.53206	1.2;0.63	5.3	3.32	0.38043	.	0.122597	0.56097	N	0.000029	T	0.33990	0.0882	L	0.41710	1.295	0.49213	D	0.999769	B;B;B;B;B;B	0.34161	0.159;0.439;0.439;0.305;0.092;0.092	B;B;B;B;B;B	0.31016	0.036;0.123;0.123;0.07;0.02;0.02	T	0.16600	-1.0397	10	0.45353	T	0.12	-4.2135	7.8607	0.29507	0.0:0.7521:0.0:0.2479	.	877;1005;1005;1005;1083;1083	B7ZKZ2;Q9UMZ2-3;A8MWU4;Q9UMZ2-4;Q9UMZ2-5;Q9UMZ2	.;.;.;.;.;SYNRG_HUMAN	H	1083;877;1083;1005;1005	ENSP00000005279:R1083H;ENSP00000377903:R1005H	ENSP00000343610:R877H	R	-	2	0	SYNRG	32974713	0.997000	0.39634	0.998000	0.56505	0.968000	0.65278	3.198000	0.51035	1.235000	0.43724	0.563000	0.77884	CGT	SYNRG	-	NULL	ENSG00000006114		0.488	SYNRG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNRG	HGNC	protein_coding	OTTHUMT00000256811.2	-	0.00	73	0	C	NM_007247		35900600	-1	tier1	-	no_errors	ENST00000339208	ensembl	human	known	74_37	missense	38.60	35	22	SNP	0.997	T
TAF6L	10629	genome.wustl.edu	37	11	62554015	62554015	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:62554015G>A	ENST00000294168.3	+	11	1317	c.1116G>A	c.(1114-1116)atG>atA	p.M372I	TMEM179B_ENST00000333449.4_5'Flank|TMEM179B_ENST00000533861.1_5'Flank|TMEM223_ENST00000527073.1_Intron|RP11-727F15.12_ENST00000601484.1_RNA	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	372					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						TGCTGAAGATGAAGGCCCAGG	0.572											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													19.0	19.0	19.0					11																	62554015		2201	4298	6499	SO:0001583	missense	0			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.1116G>A	11.37:g.62554015G>A	ENSP00000294168:p.Met372Ile	1062	B2RAT0|Q96HA6	Missense_Mutation	SNP	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.M372I	ENST00000294168.3	37	c.1116	CCDS8035.1	11	.	.	.	.	.	.	.	.	.	.	G	17.02	3.280692	0.59758	.	.	ENSG00000162227	ENST00000294168	T	0.44881	0.91	5.24	4.32	0.51571	.	0.044972	0.85682	D	0.000000	T	0.27241	0.0668	N	0.24115	0.695	0.80722	D	1	P	0.35844	0.524	B	0.31946	0.138	T	0.07252	-1.0782	10	0.33141	T	0.24	-2.9094	12.2157	0.54404	0.0835:0.0:0.9165:0.0	.	372	Q9Y6J9	TAF6L_HUMAN	I	372	ENSP00000294168:M372I	ENSP00000294168:M372I	M	+	3	0	TAF6L	62310591	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.412000	0.66392	1.553000	0.49476	0.655000	0.94253	ATG	TAF6L	-	NULL	ENSG00000162227		0.572	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	HGNC	protein_coding	OTTHUMT00000395352.1	-	0.00	12	0	G	NM_006473		62554015	+1	tier1	-	no_errors	ENST00000294168	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	A
SYTL2	54843	genome.wustl.edu	37	11	85437481	85437481	+	Intron	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:85437481C>T	ENST00000528231.1	-	7	1737				SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000354566.3_Missense_Mutation_p.E7K|SYTL2_ENST00000527523.1_Intron|SYTL2_ENST00000359152.5_Missense_Mutation_p.E531K|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000525423.1_Missense_Mutation_p.E7K|SYTL2_ENST00000389960.4_Intron	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TAGACCTGTTCTGCATTGGGT	0.378																																																	0													58.0	58.0	58.0					11																	85437481		2203	4296	6499	SO:0001627	intron_variant	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+1457G>A	11.37:g.85437481C>T			B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.E531K	ENST00000528231.1	37	c.1591	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	C	4.512	0.094983	0.08681	.	.	ENSG00000137501	ENST00000359152;ENST00000354566;ENST00000525423	T;T;T	0.29655	1.58;1.56;1.57	5.91	2.59	0.31030	.	1.168800	0.05935	N	0.635891	T	0.21468	0.0517	N	0.20986	0.625	0.09310	N	1	B;B;B	0.23377	0.084;0.084;0.084	B;B;B	0.21917	0.037;0.037;0.037	T	0.27157	-1.0082	9	.	.	.	-7.5345	7.5396	0.27731	0.0:0.6571:0.1387:0.2043	.	7;7;7	Q9HCH5-11;Q9HCH5-7;Q9HCH5-8	.;.;.	K	531;7;7	ENSP00000352065:E531K;ENSP00000346576:E7K;ENSP00000432694:E7K	.	E	-	1	0	SYTL2	85115129	0.945000	0.32115	0.256000	0.24389	0.105000	0.19272	2.300000	0.43620	0.826000	0.34661	-0.175000	0.13238	GAA	SYTL2	-	NULL	ENSG00000137501		0.378	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	-	0.00	29	0	C	NM_206927		85437481	-1	tier1	-	no_errors	ENST00000359152	ensembl	human	known	74_37	missense	38.46	16	10	SNP	0.010	T
TBC1D10B	26000	genome.wustl.edu	37	16	30380585	30380585	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:30380585T>C	ENST00000409939.3	-	1	1000	c.920A>G	c.(919-921)tAt>tGt	p.Y307C		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	307					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			AAGGAAGCCATACTTGTCCGT	0.617																																																	0													37.0	24.0	29.0					16																	30380585		2194	4296	6490	SO:0001583	missense	0			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.920A>G	16.37:g.30380585T>C	ENSP00000386538:p.Tyr307Cys		B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Y307C	ENST00000409939.3	37	c.920	CCDS10676.2	16	.	.	.	.	.	.	.	.	.	.	T	20.6	4.014338	0.75161	.	.	ENSG00000169221	ENST00000409939	T	0.18502	2.21	4.1	4.1	0.47936	.	0.000000	0.64402	D	0.000003	T	0.41213	0.1149	M	0.77616	2.38	0.54753	D	0.999985	D	0.76494	0.999	D	0.75484	0.986	T	0.41088	-0.9528	10	0.87932	D	0	.	12.2043	0.54342	0.0:0.0:0.0:1.0	.	307	Q4KMP7	TB10B_HUMAN	C	307	ENSP00000386538:Y307C	ENSP00000386538:Y307C	Y	-	2	0	TBC1D10B	30288086	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.746000	0.74866	1.730000	0.51580	0.459000	0.35465	TAT	TBC1D10B	-	NULL	ENSG00000169221		0.617	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	-	0.00	40	0	T	NM_015527		30380585	-1	tier1	-	no_errors	ENST00000409939	ensembl	human	known	74_37	missense	49.23	33	32	SNP	1.000	C
TBC1D29	26083	genome.wustl.edu	37	17	28890301	28890301	+	Missense_Mutation	SNP	G	G	A	rs80145926	byFrequency	TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:28890301G>A	ENST00000580161.1	+	6	2808	c.311G>A	c.(310-312)aGc>aAc	p.S104N	TBC1D29_ENST00000584297.1_3'UTR|TBC1D29_ENST00000579181.1_Missense_Mutation_p.S104N|RP11-218M11.1_ENST00000563063.1_lincRNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	104							Rab GTPase activator activity (GO:0005097)	p.S104N(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				TCAGAGAGCAGCAGAGGCCCC	0.587																																																	1	Substitution - Missense(1)	prostate(1)											48.0	45.0	46.0					17																	28890301		2203	4300	6503	SO:0001583	missense	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.311G>A	17.37:g.28890301G>A	ENSP00000462799:p.Ser104Asn			Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S104N	ENST00000580161.1	37	c.311	CCDS32606.1	17	.	.	.	.	.	.	.	.	.	.	.	9.179	1.023040	0.19433	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.18873	N	0.999983	B	0.33000	0.393	B	0.42319	0.383	T	0.34850	-0.9812	7	0.72032	D	0.01	.	5.89	0.18904	8.0E-4:0.0:0.9992:0.0	.	104	Q9UFV1	TBC29_HUMAN	N	104	.	ENSP00000330052:S104N	S	+	2	0	TBC1D29	25914427	0.966000	0.33281	0.071000	0.20095	0.071000	0.16799	-0.367000	0.07553	0.107000	0.17824	0.109000	0.15622	AGC	TBC1D29	-	NULL	ENSG00000266733		0.587	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	HGNC	protein_coding	OTTHUMT00000443632.1		0.00	33	0	G	NM_015594		28890301	+1			no_errors	ENST00000579181	ensembl	human	known	74_37	missense	10.64	42	5	SNP	0.904	A
TBC1D29	26083	genome.wustl.edu	37	17	28890361	28890361	+	Missense_Mutation	SNP	G	G	A	rs372824382		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:28890361G>A	ENST00000580161.1	+	6	2868	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	TBC1D29_ENST00000584297.1_3'UTR|TBC1D29_ENST00000579181.1_Missense_Mutation_p.R124Q|RP11-218M11.1_ENST00000563063.1_lincRNA			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	124							Rab GTPase activator activity (GO:0005097)	p.R124Q(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				GCCTTGAGCCGGGGAGACAAG	0.567																																																	1	Substitution - Missense(1)	prostate(1)											78.0	68.0	71.0					17																	28890361		2203	4300	6503	SO:0001583	missense	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.371G>A	17.37:g.28890361G>A	ENSP00000462799:p.Arg124Gln			Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R124Q	ENST00000580161.1	37	c.371	CCDS32606.1	17	.	.	.	.	.	.	.	.	.	.	.	2.991	-0.208219	0.06180	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.14399	0.0348	N	0.08118	0	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.14559	-1.0468	7	0.33141	T	0.24	.	3.9265	0.09265	0.6657:0.0:0.3343:0.0	.	124	Q9UFV1	TBC29_HUMAN	Q	124	.	ENSP00000330052:R124Q	R	+	2	0	TBC1D29	25914487	0.090000	0.21635	0.024000	0.17045	0.025000	0.11179	-1.180000	0.03088	-1.657000	0.01492	-1.643000	0.00768	CGG	TBC1D29	-	NULL	ENSG00000266733		0.567	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	HGNC	protein_coding	OTTHUMT00000443632.1		0.00	22	0	G	NM_015594		28890361	+1			no_errors	ENST00000579181	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.562	A
TEK	7010	genome.wustl.edu	37	9	27158043	27158043	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr9:27158043G>C	ENST00000380036.4	+	2	709	c.267G>C	c.(265-267)aaG>aaC	p.K89N	TEK_ENST00000519097.1_Intron|TEK_ENST00000406359.4_Missense_Mutation_p.K89N	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	89	Ig-like C2-type 1.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	TTGTTTGGAAGAGAGAAAAGG	0.453																																																	0													113.0	110.0	111.0					9																	27158043		2203	4300	6503	SO:0001583	missense	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.267G>C	9.37:g.27158043G>C	ENSP00000369375:p.Lys89Asn		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K89N	ENST00000380036.4	37	c.267	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645978	0.67358	.	.	ENSG00000120156	ENST00000380036;ENST00000346448;ENST00000406359	T;T	0.74002	-0.76;-0.8	5.92	5.03	0.67393	Tyrosine-protein kinase, receptor Tie-2, Ig-like domain 1, N-terminal (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000055	T	0.73410	0.3583	N	0.24115	0.695	0.41055	D	0.985336	D;D;D;D	0.65815	0.987;0.995;0.984;0.987	P;D;P;P	0.63192	0.855;0.912;0.883;0.855	T	0.74559	-0.3625	10	0.48119	T	0.1	.	9.2013	0.37260	0.2631:0.0:0.7369:0.0	.	122;89;89;89	Q59HG2;B5A953;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	N	89	ENSP00000369375:K89N;ENSP00000383977:K89N	ENSP00000343716:K89N	K	+	3	2	TEK	27148043	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.761000	0.38440	1.507000	0.48752	0.655000	0.94253	AAG	TEK	-	pfam_Tyr_kin_Tie2_Ig-like_dom-1_N	ENSG00000120156		0.453	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	-	0.00	79	0	G			27158043	+1	tier1	-	no_errors	ENST00000380036	ensembl	human	known	74_37	missense	62.07	22	36	SNP	1.000	C
TEX11	56159	genome.wustl.edu	37	X	69871378	69871378	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:69871378C>T	ENST00000395889.2	-	18	1605	c.1450G>A	c.(1450-1452)Gaa>Aaa	p.E484K	TEX11_ENST00000374333.2_Missense_Mutation_p.E469K|TEX11_ENST00000344304.3_Missense_Mutation_p.E484K|TEX11_ENST00000374320.2_Missense_Mutation_p.E159K	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	484					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TCATGTCGTTCAGCTTCTGCC	0.353																																																	0													46.0	43.0	44.0					X																	69871378		2203	4299	6502	SO:0001583	missense	0			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1450G>A	X.37:g.69871378C>T	ENSP00000379226:p.Glu484Lys		A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.E484K	ENST00000395889.2	37	c.1450	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907632	0.52333	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75	2.98	2.98	0.34508	Tetratricopeptide-like helical (1);	0.144296	0.44902	D	0.000404	T	0.78685	0.4322	M	0.68952	2.095	0.09310	N	1	D;P	0.56035	0.974;0.956	P;P	0.57009	0.811;0.651	T	0.68277	-0.5451	9	.	.	.	-4.7451	8.7125	0.34393	0.0:1.0:0.0:0.0	.	469;484	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	K	469;484;159;484	ENSP00000363453:E469K;ENSP00000379226:E484K;ENSP00000363440:E159K;ENSP00000340995:E484K	.	E	-	1	0	TEX11	69788103	1.000000	0.71417	0.027000	0.17364	0.467000	0.32768	3.683000	0.54663	1.476000	0.48215	0.513000	0.50165	GAA	TEX11	-	smart_TPR_repeat	ENSG00000120498		0.353	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	-	0.00	23	0	C			69871378	-1	tier1	-	no_errors	ENST00000344304	ensembl	human	known	74_37	missense	67.50	13	27	SNP	0.173	T
THAP3	90326	genome.wustl.edu	37	1	6693086	6693086	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:6693086C>G	ENST00000054650.4	+	6	827	c.669C>G	c.(667-669)tgC>tgG	p.C223W	DNAJC11_ENST00000465508.1_5'Flank|THAP3_ENST00000377627.3_Intron|THAP3_ENST00000307896.6_Missense_Mutation_p.C222W	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3	223							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		TCCGTGCTTGCAAAGGGCACC	0.622																																																	0													17.0	18.0	18.0					1																	6693086		876	1991	2867	SO:0001583	missense	0			BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.669C>G	1.37:g.6693086C>G	ENSP00000054650:p.Cys223Trp		Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.C223W	ENST00000054650.4	37	c.669	CCDS55572.1	1	.	.	.	.	.	.	.	.	.	.	C	9.923	1.212799	0.22289	.	.	ENSG00000041988	ENST00000054650;ENST00000307896	D;D	0.94376	-3.41;-3.41	4.0	4.0	0.46444	.	11.813800	0.00166	N	0.000000	D	0.89030	0.6599	N	0.22421	0.69	0.09310	N	0.999999	P;P	0.40032	0.699;0.574	B;B	0.35073	0.195;0.135	T	0.80614	-0.1304	10	0.38643	T	0.18	-13.4602	11.4538	0.50169	0.0:1.0:0.0:0.0	.	222;223	Q8WTV1-3;Q8WTV1	.;THAP3_HUMAN	W	223;222	ENSP00000054650:C223W;ENSP00000311537:C222W	ENSP00000054650:C223W	C	+	3	2	THAP3	6615673	0.001000	0.12720	0.002000	0.10522	0.048000	0.14542	0.999000	0.29757	2.056000	0.61249	0.462000	0.41574	TGC	THAP3	-	NULL	ENSG00000041988		0.622	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	THAP3	HGNC	protein_coding	OTTHUMT00000004203.1	-	0.00	22	0	C	NM_138350		6693086	+1	tier1	-	no_errors	ENST00000054650	ensembl	human	known	74_37	missense	31.82	30	14	SNP	0.004	G
THAP9	79725	genome.wustl.edu	37	4	83821709	83821709	+	5'Flank	SNP	G	G	A	rs186374887		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr4:83821709G>A	ENST00000302236.5	+	0	0				THAP9-AS1_ENST00000509007.1_RNA|THAP9-AS1_ENST00000507660.1_RNA|THAP9-AS1_ENST00000503704.1_RNA|THAP9-AS1_ENST00000505028.1_RNA|THAP9-AS1_ENST00000511271.1_RNA|THAP9-AS1_ENST00000512932.1_RNA|THAP9-AS1_ENST00000513581.1_RNA|THAP9-AS1_ENST00000504869.1_RNA|THAP9-AS1_ENST00000508772.1_RNA|THAP9-AS1_ENST00000504718.1_RNA|SEC31A_ENST00000355196.2_5'Flank|THAP9-AS1_ENST00000504520.2_RNA|THAP9-AS1_ENST00000504792.2_RNA	NM_024672.4	NP_078948.3	Q9H5L6	THAP9_HUMAN	THAP domain containing 9						DNA integration (GO:0015074)|DNA recombination (GO:0006310)|transposition, DNA-mediated (GO:0006313)		metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transferase activity (GO:0016740)|transposase activity (GO:0004803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(13)|lung(5)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(3)	33		Hepatocellular(203;0.114)				GCGGAGGGAGGAGCGGTCAAA	0.582																																																	0																																										SO:0001631	upstream_gene_variant	0			AK091412	CCDS3598.1	4q21.3	2013-01-25			ENSG00000168152	ENSG00000168152		"""THAP (C2CH-type zinc finger) domain containing"""	23192	protein-coding gene	gene with protein product		612537				12575992	Standard	NM_024672		Approved	FLJ34093	uc003hnt.2	Q9H5L6	OTTHUMG00000130291		4.37:g.83821709G>A	Exception_encountered		B3KRE2|Q59AC9	RNA	SNP	-	NULL	ENST00000302236.5	37	NULL	CCDS3598.1	4																																																																																			THAP9-AS1	-	-	ENSG00000251022		0.582	THAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP9-AS1	HGNC	protein_coding	OTTHUMT00000252633.1	-	0.00	8	0	G	NM_024672		83821709	-1	tier1	-	no_errors	ENST00000503704	ensembl	human	known	74_37	rna	50.00	10	10	SNP	0.001	A
TIE1	7075	genome.wustl.edu	37	1	43783285	43783285	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:43783285C>T	ENST00000372476.3	+	16	2750	c.2671C>T	c.(2671-2673)Ctg>Ttg	p.L891L	TIE1_ENST00000473014.1_3'UTR|TIE1_ENST00000433781.2_Silent_p.L536L	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	891	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				ACTGGAAGTTCTGTGCAAATT	0.488																																																	0													154.0	169.0	164.0					1																	43783285		2203	4300	6503	SO:0001819	synonymous_variant	0			BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2671C>T	1.37:g.43783285C>T			B5A949|B5A950	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L891	ENST00000372476.3	37	c.2671	CCDS482.1	1																																																																																			TIE1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000066056		0.488	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	HGNC	protein_coding	OTTHUMT00000019011.1		0.00	22	0	C	NM_005424		43783285	+1			no_errors	ENST00000372476	ensembl	human	known	74_37	silent	9.68	28	3	SNP	1.000	T
TMEM177	80775	genome.wustl.edu	37	2	120443383	120443383	+	3'UTR	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:120443383C>T	ENST00000409951.1	+	0	516				TMEM177_ENST00000496203.1_3'UTR			Q53S58	TM177_HUMAN	transmembrane protein 177							integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	13	Colorectal(110;0.196)					CTGAAAGTTTCATGGTGCAGA	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC004404	CCDS2128.1	2q14.2	2008-02-05			ENSG00000144120	ENSG00000144120			28143	protein-coding gene	gene with protein product						12477932	Standard	NM_001105198		Approved	MGC10993	uc002tmc.1	Q53S58	OTTHUMG00000153312	ENST00000409951.1:c.*93C>T	2.37:g.120443383C>T			Q9BT20	RNA	SNP	-	NULL	ENST00000409951.1	37	NULL		2																																																																																			TMEM177	-	-	ENSG00000144120		0.383	TMEM177-003	PUTATIVE	basic|exp_conf	protein_coding	TMEM177	HGNC	protein_coding	OTTHUMT00000330675.1	-	0.00	54	0	C	NM_030577		120443383	+1	tier1	-	no_errors	ENST00000496203	ensembl	human	known	74_37	rna	30.00	28	12	SNP	0.001	T
TNFAIP8	25816	genome.wustl.edu	37	5	118729075	118729075	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr5:118729075G>A	ENST00000503646.1	+	3	1284	c.596G>A	c.(595-597)tGa>tAa	p.*199*	TNFAIP8_ENST00000513374.1_Silent_p.*211*|TNFAIP8_ENST00000504771.2_Silent_p.*199*|TNFAIP8_ENST00000504642.1_Silent_p.*201*|TNFAIP8_ENST00000415806.2_3'UTR|TNFAIP8_ENST00000274456.6_Silent_p.*189*			O95379	TFIP8_HUMAN	tumor necrosis factor, alpha-induced protein 8	0					defense response to Gram-positive bacterium (GO:0050830)|interleukin-1 beta production (GO:0032611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)			ovary(1)	1		all_cancers(142;0.0317)|Prostate(80;0.111)|Breast(839;0.231)		Epithelial(69;4.63e-83)|OV - Ovarian serous cystadenocarcinoma(64;1.39e-82)|all cancers(49;4.88e-75)|GBM - Glioblastoma multiforme(465;0.00338)|BRCA - Breast invasive adenocarcinoma(61;0.0148)|COAD - Colon adenocarcinoma(49;0.0829)		GAGAACATATGAGCACATGAG	0.323																																																	0													66.0	67.0	67.0					5																	118729075		1852	4092	5944	SO:0001819	synonymous_variant	0			AF070671	CCDS47257.1, CCDS47258.1, CCDS68933.1	5q23.1	2008-02-05			ENSG00000145779	ENSG00000145779			17260	protein-coding gene	gene with protein product		612111				10233894, 10644768	Standard	NM_001286813		Approved	GG2-1, MDC-3.13, SCC-S2	uc003ksi.3	O95379	OTTHUMG00000162949	ENST00000503646.1:c.596G>A	5.37:g.118729075G>A			B3KMH1|B3KMI2|B7Z713|Q9P1Q1|Q9UER5|Q9UP47	Silent	SNP	pfam_DUF758	p.*199	ENST00000503646.1	37	c.596	CCDS47258.1	5																																																																																			TNFAIP8	-	NULL	ENSG00000145779		0.323	TNFAIP8-002	PUTATIVE	alternative_5_UTR|basic|exp_conf|CCDS	protein_coding	TNFAIP8	HGNC	protein_coding	OTTHUMT00000371134.2	-	0.00	51	0	G	NM_014350		118729075	+1	tier1	-	no_errors	ENST00000504771	ensembl	human	known	74_37	silent	57.14	12	16	SNP	0.999	A
TNRC18	84629	genome.wustl.edu	37	7	5427355	5427355	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:5427355C>T	ENST00000430969.1	-	5	2448	c.2100G>A	c.(2098-2100)ctG>ctA	p.L700L	TNRC18_ENST00000399537.4_Silent_p.L700L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	700							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GCCCAGGCCCCAGCCGGCCAC	0.657																																																	0													32.0	40.0	38.0					7																	5427355		1924	4062	5986	SO:0001819	synonymous_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.2100G>A	7.37:g.5427355C>T			A8MX41|Q96JH1|Q96K91	Silent	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.L700	ENST00000430969.1	37	c.2100	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.657	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		-	0.00	20	0	C			5427355	-1	tier1	-	no_errors	ENST00000399537	ensembl	human	known	74_37	silent	26.19	31	11	SNP	1.000	T
TNS4	84951	genome.wustl.edu	37	17	38652532	38652532	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:38652532C>T	ENST00000254051.6	-	2	304	c.146G>A	c.(145-147)gGa>gAa	p.G49E		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	49					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGCCTGGGCTCCCCAGCCTTC	0.687																																																	0													24.0	27.0	26.0					17																	38652532		2203	4299	6502	SO:0001583	missense	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.146G>A	17.37:g.38652532C>T	ENSP00000254051:p.Gly49Glu		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	pfam_PTB,pfam_SH2,smart_SH2,smart_PTB/PI_dom,pfscan_SH2	p.G49E	ENST00000254051.6	37	c.146	CCDS11368.1	17	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456913	0.63401	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.20881	2.04	5.45	4.48	0.54585	.	.	.	.	.	T	0.18425	0.0442	L	0.27053	0.805	0.34373	D	0.692284	D	0.56968	0.978	P	0.47134	0.539	T	0.12268	-1.0554	9	0.56958	D	0.05	-15.4802	9.1604	0.37019	0.0:0.9034:0.0:0.0966	.	49	Q8IZW8	TENS4_HUMAN	E	49	ENSP00000254051:G49E	ENSP00000254051:G49E	G	-	2	0	TNS4	35906058	0.979000	0.34478	1.000000	0.80357	0.993000	0.82548	1.241000	0.32743	2.544000	0.85801	0.650000	0.86243	GGA	TNS4	-	NULL	ENSG00000131746		0.687	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	-	0.00	9	0	C	NM_032865		38652532	-1	tier1	-	no_errors	ENST00000254051	ensembl	human	known	74_37	missense	40.91	13	9	SNP	1.000	T
TOP3B	8940	genome.wustl.edu	37	22	22322028	22322028	+	Missense_Mutation	SNP	G	G	A	rs146485968		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:22322028G>A	ENST00000398793.2	-	8	1233	c.799C>T	c.(799-801)Cgg>Tgg	p.R267W	TOP3B_ENST00000357179.5_Missense_Mutation_p.R267W|TOP3B_ENST00000413067.2_5'UTR	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	267					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		GCGATCTCCCGGTCAAACACT	0.483																																																	0								G	TRP/ARG	0,4406		0,0,2203	161.0	138.0	146.0		799	1.2	1.0	22	dbSNP_134	146	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TOP3B	NM_003935.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	267/863	22322028	1,13005	2203	4300	6503	SO:0001583	missense	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.799C>T	22.37:g.22322028G>A	ENSP00000381773:p.Arg267Trp		A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.R267W	ENST00000398793.2	37	c.799	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414726	0.62511	0.0	1.16E-4	ENSG00000100038	ENST00000357179;ENST00000398793	T;T	0.23754	1.89;1.89	4.71	1.16	0.20824	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central (1);	0.054141	0.64402	N	0.000001	T	0.47340	0.1440	M	0.89287	3.02	0.80722	D	1	D	0.76494	0.999	P	0.61658	0.892	T	0.45071	-0.9286	10	0.59425	D	0.04	.	7.6323	0.28247	0.0751:0.0:0.5117:0.4132	.	267	O95985	TOP3B_HUMAN	W	267	ENSP00000349705:R267W;ENSP00000381773:R267W	ENSP00000349705:R267W	R	-	1	2	TOP3B	20652028	1.000000	0.71417	0.999000	0.59377	0.768000	0.43524	1.129000	0.31381	0.144000	0.18951	0.655000	0.94253	CGG	TOP3B	-	pfam_Topo_IA_cen,superfamily_Topo_IA_core_domain	ENSG00000100038		0.483	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1		0.00	45	0	G	NM_003935		22322028	-1			no_errors	ENST00000357179	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M							132.0	118.0	123.0					17																	7578212		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	461	0	G	NM_000546		7578212	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	37.45	299	179	SNP	0.893	A
TP53	7157	genome.wustl.edu	37	17	7578527	7578527	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:7578527A>G	ENST00000269305.4	-	5	592	c.403T>C	c.(403-405)Tgc>Cgc	p.C135R	TP53_ENST00000445888.2_Missense_Mutation_p.C135R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C135R|TP53_ENST00000420246.2_Missense_Mutation_p.C135R|TP53_ENST00000413465.2_Missense_Mutation_p.C135R|TP53_ENST00000359597.4_Missense_Mutation_p.C135R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135R(11)|p.0?(8)|p.C135G(6)|p.C135fs*35(4)|p.C135S(4)|p.N131fs*27(2)|p.V73fs*9(1)|p.F134_T140>S(1)|p.C135_T140delCQLAKT(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C135_A138delCQLA(1)|p.K132_A138delKMFCQLA(1)|p.C135fs*36(1)|p.S127_Q136del10(1)|p.C135T(1)|p.F134fs*14(1)|p.C42R(1)|p.M133fs*13(1)|p.C3R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCAGTTGGCAAAACATCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	49	Substitution - Missense(24)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(2)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(8)|central_nervous_system(5)|biliary_tract(5)|breast(5)|large_intestine(4)|oesophagus(4)|lung(4)|bone(4)|upper_aerodigestive_tract(2)|urinary_tract(2)|pancreas(2)|stomach(1)|skin(1)|penis(1)|ovary(1)											49.0	50.0	49.0					17																	7578527		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.403T>C	17.37:g.7578527A>G	ENSP00000269305:p.Cys135Arg		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C135R	ENST00000269305.4	37	c.403	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.8	4.340491	0.81911	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99800	-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8;-6.8	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99743	0.9898	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;P;D;D;D;D	0.97110	0.997;1.0;0.904;1.0;1.0;1.0;1.0	D	0.97181	0.9851	10	0.87932	D	0	-26.815	13.8301	0.63375	1.0:0.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135R;ENSP00000352610:C135R;ENSP00000269305:C135R;ENSP00000398846:C135R;ENSP00000391127:C135R;ENSP00000391478:C135R;ENSP00000425104:C3R;ENSP00000423862:C42R;ENSP00000424104:C135R	ENSP00000269305:C135R	C	-	1	0	TP53	7519252	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.283000	0.95860	2.206000	0.71126	0.533000	0.62120	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	287	0	A	NM_000546		7578527	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	40.06	202	135	SNP	1.000	G
TPM3	7170	genome.wustl.edu	37	1	154155547	154155547	+	Intron	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:154155547G>A	ENST00000368530.2	-	3	436				TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000271850.7_Intron|TPM3_ENST00000341372.3_Silent_p.L17L|TPM3_ENST00000323144.7_Silent_p.L17L|TPM3_ENST00000368531.2_Silent_p.L17L|TPM3_ENST00000368533.3_Silent_p.L17L|TPM3_ENST00000330188.9_Silent_p.L17L|TPM3_ENST00000328159.4_Silent_p.L17L|TPM3_ENST00000341485.5_Silent_p.L17L	NM_152263.2	NP_689476.2	P06753	TPM3_HUMAN	tropomyosin 3						cellular component movement (GO:0006928)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle thin filament tropomyosin (GO:0005862)|stress fiber (GO:0001725)			TPM3/NTRK1_ENST00000392302(70)|TPM3/ALK(33)	breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)					TGCTGCTGCAGAACCTGGATC	0.647			T	"""NTRK1, ALK, ROS1"""	"""papillary thyroid, ALCL, NSCLC"""																																			Dom	yes		1	1q22-q23	7170	tropomyosin 3		"""E, L"""	0													62.0	60.0	61.0					1																	154155547		2203	4296	6499	SO:0001627	intron_variant	0			BC008425	CCDS1060.1, CCDS41400.1, CCDS41401.1, CCDS41402.1, CCDS41403.1, CCDS60274.1, CCDS60275.1, CCDS72922.1	1q21.2	2014-09-17			ENSG00000143549	ENSG00000143549		"""Tropomyosins"""	12012	protein-coding gene	gene with protein product		191030		NEM1		1829807	Standard	NM_153649		Approved	TRK	uc001fec.2	P06753	OTTHUMG00000035853	ENST00000368530.2:c.244-6823C>T	1.37:g.154155547G>A			D3DV71|P12324|Q2QD06|Q5VU58|Q5VU63|Q5VU66|Q5VU71|Q5VU72|Q8TCG3|Q969Q2|Q9NQH8	Silent	SNP	pfam_Tropomyosin,superfamily_HR1_rho-bd,prints_Tropomyosin	p.L17	ENST00000368530.2	37	c.49	CCDS41403.1	1																																																																																			TPM3	-	pfam_Tropomyosin	ENSG00000143549		0.647	TPM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM3	HGNC	protein_coding	OTTHUMT00000087271.2	-	0.00	35	0	G	NM_152263		154155547	-1	tier1	-	no_errors	ENST00000330188	ensembl	human	known	74_37	silent	32.69	35	17	SNP	1.000	A
TPRXL	348825	genome.wustl.edu	37	3	14106434	14106434	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:14106434G>A	ENST00000424053.1	+	3	1305	c.758G>A	c.(757-759)tGa>tAa	p.*253*	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000326972.8_Silent_p.*253*|TPRXL_ENST00000429201.1_Silent_p.*253*			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0										endometrium(1)	1						CCCTTTCCCTGAAGCTGCGGC	0.667																																																	0																																										SO:0001819	synonymous_variant	0			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.758G>A	3.37:g.14106434G>A			Q8NAM5	Silent	SNP	NULL	p.*253	ENST00000424053.1	37	c.758		3																																																																																			TPRXL	-	NULL	ENSG00000180438		0.667	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	TPRXL	HGNC	protein_coding	OTTHUMT00000340436.1	-	0.00	36	0	G	NR_002223		14106434	+1	tier1	-	no_errors	ENST00000326972	ensembl	human	known	74_37	silent	25.86	43	15	SNP	0.000	A
TRHDE	29953	genome.wustl.edu	37	12	72956810	72956810	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:72956810C>T	ENST00000261180.4	+	9	1993	c.1897C>T	c.(1897-1899)Cag>Tag	p.Q633*	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	633					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ACTTAAACTTCAGAATAACAG	0.274																																																	0													74.0	80.0	78.0					12																	72956810		2203	4292	6495	SO:0001587	stop_gained	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1897C>T	12.37:g.72956810C>T	ENSP00000261180:p.Gln633*		A5PL19|Q6UWJ4	Nonsense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Q633*	ENST00000261180.4	37	c.1897	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	C	37	5.992750	0.97179	.	.	ENSG00000072657	ENST00000261180	.	.	.	6.17	5.27	0.74061	.	1.137960	0.06297	N	0.700240	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	.	9.3126	0.37915	0.1174:0.6239:0.2588:0.0	.	.	.	.	X	633	.	ENSP00000261180:Q633X	Q	+	1	0	TRHDE	71243077	0.967000	0.33354	0.977000	0.42913	0.498000	0.33706	1.145000	0.31577	2.941000	0.99782	0.655000	0.94253	CAG	TRHDE	-	NULL	ENSG00000072657		0.274	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1		0.00	17	0	C	NM_013381		72956810	+1			no_errors	ENST00000261180	ensembl	human	known	74_37	nonsense	29.41	12	5	SNP	0.925	T
TRIOBP	11078	genome.wustl.edu	37	22	38109392	38109392	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr22:38109392G>C	ENST00000406386.3	+	5	685	c.430G>C	c.(430-432)Gat>Cat	p.D144H		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	144					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CGCCACCCCTGATGATACCAG	0.622																																																	0													77.0	92.0	87.0					22																	38109392		2152	4271	6423	SO:0001583	missense	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.430G>C	22.37:g.38109392G>C	ENSP00000384312:p.Asp144His		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D144H	ENST00000406386.3	37	c.430	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370921	0.61624	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.26957	1.7	4.69	3.65	0.41850	.	.	.	.	.	T	0.16041	0.0386	N	0.14661	0.345	0.80722	D	1	B	0.24882	0.113	B	0.25506	0.061	T	0.06373	-1.0830	9	0.72032	D	0.01	.	10.3902	0.44164	0.0:0.2083:0.7917:0.0	.	144	Q9H2D6	TARA_HUMAN	H	144	ENSP00000384312:D144H	ENSP00000384312:D144H	D	+	1	0	TRIOBP	36439338	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	1.823000	0.39062	1.155000	0.42497	0.650000	0.86243	GAT	TRIOBP	-	NULL	ENSG00000100106		0.622	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2		0.00	22	0	G			38109392	+1			no_errors	ENST00000406386	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	C
TRPM4	54795	genome.wustl.edu	37	19	49705305	49705305	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:49705305C>T	ENST00000252826.5	+	20	3164	c.3038C>T	c.(3037-3039)tCc>tTc	p.S1013F	TRPM4_ENST00000355712.5_Missense_Mutation_p.S659F|TRPM4_ENST00000427978.2_Missense_Mutation_p.S868F	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	1013					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		ACCTGCGTCTCCCAGTATGCC	0.617																																																	0													112.0	93.0	99.0					19																	49705305		2203	4300	6503	SO:0001583	missense	0			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.3038C>T	19.37:g.49705305C>T	ENSP00000252826:p.Ser1013Phe		A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.S1013F	ENST00000252826.5	37	c.3038	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	C	17.47	3.397861	0.62177	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.73575	-0.76;-0.76;-0.76	4.05	3.0	0.34707	.	0.364033	0.22070	U	0.065044	T	0.72598	0.3480	L	0.50333	1.59	0.19300	N	0.99997	P;D;D;P	0.54207	0.94;0.965;0.965;0.855	P;P;P;P	0.51355	0.467;0.667;0.66;0.459	T	0.63457	-0.6633	10	0.56958	D	0.05	-24.2792	7.1504	0.25608	0.3194:0.5175:0.1631:0.0	.	659;839;868;1013	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	F	1013;868;659	ENSP00000252826:S1013F;ENSP00000407492:S868F;ENSP00000347944:S659F	ENSP00000252826:S1013F	S	+	2	0	TRPM4	54397117	.	.	0.044000	0.18714	0.562000	0.35680	.	.	0.807000	0.34208	0.467000	0.42956	TCC	TRPM4	-	NULL	ENSG00000130529		0.617	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	-	0.00	32	0	C	NM_017636		49705305	+1	tier1	-	no_errors	ENST00000252826	ensembl	human	known	74_37	missense	29.41	36	15	SNP	0.211	T
TRRAP	8295	genome.wustl.edu	37	7	98509816	98509816	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:98509816G>A	ENST00000359863.4	+	18	2388	c.2179G>A	c.(2179-2181)Gaa>Aaa	p.E727K	TRRAP_ENST00000446306.3_Missense_Mutation_p.E726K|TRRAP_ENST00000355540.3_Missense_Mutation_p.E727K	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	727					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTTGCAGCTGAAAATGAACA	0.478																																																	0													148.0	131.0	137.0					7																	98509816		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.2179G>A	7.37:g.98509816G>A	ENSP00000352925:p.Glu727Lys		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E727K	ENST00000359863.4	37	c.2179	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.630756	0.96682	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.68181	4.04;-0.31	5.66	5.66	0.87406	Armadillo-like helical (1);Armadillo-type fold (2);	0.000000	0.85682	D	0.000000	T	0.81138	0.4760	M	0.64404	1.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.995;0.998	T	0.80774	-0.1232	10	0.54805	T	0.06	.	19.7617	0.96321	0.0:0.0:1.0:0.0	.	727;441;727	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	K	727;727;725	ENSP00000352925:E727K;ENSP00000347733:E727K	ENSP00000347733:E727K	E	+	1	0	TRRAP	98347752	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.671000	0.90904	0.655000	0.94253	GAA	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.478	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	74	0	G	NM_003496		98509816	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	34.52	55	29	SNP	1.000	A
TRPV5	56302	genome.wustl.edu	37	7	142612479	142612479	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:142612479G>A	ENST00000265310.1	-	10	1632	c.1284C>T	c.(1282-1284)atC>atT	p.I428I		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	428					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					ATACTCACATGATGACATGGA	0.512																																																	0													146.0	142.0	143.0					7																	142612479		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1284C>T	7.37:g.142612479G>A			A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV5,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.I428	ENST00000265310.1	37	c.1284	CCDS5875.1	7																																																																																			TRPV5	-	prints_TRPV5/TRPV6,tigrfam_TRP_channel	ENSG00000127412		0.512	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV5	HGNC	protein_coding	OTTHUMT00000347660.1	-	0.00	40	0	G	NM_019841		142612479	-1	tier1	-	no_errors	ENST00000265310	ensembl	human	known	74_37	silent	42.86	16	12	SNP	1.000	A
TSC2	7249	genome.wustl.edu	37	16	2127484	2127484	+	Intron	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:2127484C>T	ENST00000219476.3	+	26	3467				TSC2_ENST00000353929.4_Intron|TSC2_ENST00000568454.1_Intron|TSC2_ENST00000382538.6_Intron|TSC2_ENST00000401874.2_Intron|TSC2_ENST00000350773.4_Intron|TSC2_ENST00000568366.1_3'UTR|TSC2_ENST00000439673.2_Intron	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				CGCGGGATCTCTCCATCCTGA	0.562			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	0																																										SO:0001627	intron_variant	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.2838-115C>T	16.37:g.2127484C>T			A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	RNA	SNP	-	NULL	ENST00000219476.3	37	NULL	CCDS10458.1	16																																																																																			TSC2	-	-	ENSG00000103197		0.562	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSC2	HGNC	protein_coding	OTTHUMT00000250657.2	-	0.00	23	0	C	NM_000548		2127484	+1	tier1	-	no_errors	ENST00000568366	ensembl	human	known	74_37	rna	25.81	23	8	SNP	0.982	T
TTLL7	79739	genome.wustl.edu	37	1	84335655	84335655	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:84335655C>T	ENST00000260505.8	-	21	3031	c.2654G>A	c.(2653-2655)gGc>gAc	p.G885D	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	885					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TCACAGATGGCCATATCTGGA	0.403																																																	0													153.0	133.0	140.0					1																	84335655		2203	4300	6503	SO:0001583	missense	0			AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.2654G>A	1.37:g.84335655C>T	ENSP00000260505:p.Gly885Asp		Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.G885D	ENST00000260505.8	37	c.2654	CCDS690.2	1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408689	0.42715	.	.	ENSG00000137941	ENST00000260505	T	0.03772	3.81	5.88	2.79	0.32731	.	0.751851	0.12671	N	0.448790	T	0.01730	0.0055	L	0.40543	1.245	0.30260	N	0.793279	B	0.18741	0.03	B	0.18561	0.022	T	0.39502	-0.9611	10	0.59425	D	0.04	.	7.9194	0.29837	0.0:0.6533:0.1296:0.2172	.	885	Q6ZT98	TTLL7_HUMAN	D	885	ENSP00000260505:G885D	ENSP00000260505:G885D	G	-	2	0	TTLL7	84108243	0.999000	0.42202	1.000000	0.80357	0.963000	0.63663	0.520000	0.22878	0.828000	0.34709	0.655000	0.94253	GGC	TTLL7	-	NULL	ENSG00000137941		0.403	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	HGNC	protein_coding	OTTHUMT00000027498.1	-	0.00	46	0	C	NM_024686		84335655	-1	tier1	-	no_errors	ENST00000260505	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.999	T
TUBA3D	113457	genome.wustl.edu	37	2	132237645	132237645	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:132237645G>A	ENST00000321253.6	+	4	486	c.379G>A	c.(379-381)Gat>Aat	p.D127N	TUBA3D_ENST00000409047.2_3'UTR	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	127					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		CTCTCAGGCGGATCTGTGCAC	0.577																																					Ovarian(137;2059 2432 35543 39401)												0													42.0	47.0	45.0					2																	132237645		2203	4300	6503	SO:0001583	missense	0			K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.379G>A	2.37:g.132237645G>A	ENSP00000326042:p.Asp127Asn		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.D127N	ENST00000321253.6	37	c.379	CCDS33290.1	2	.	.	.	.	.	.	.	.	.	.	g	5.914	0.352748	0.11182	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	T	0.75477	-0.94	2.24	2.24	0.28232	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.47093	U	0.000244	T	0.74764	0.3759	M	0.86268	2.805	0.80722	D	1	B	0.06786	0.001	B	0.21360	0.034	T	0.76296	-0.3011	10	0.72032	D	0.01	.	10.1507	0.42791	0.0:0.0:1.0:0.0	.	127	Q13748	TBA3C_HUMAN	N	127	ENSP00000326042:D127N	ENSP00000326042:D127N	D	+	1	0	TUBA3D	131954115	1.000000	0.71417	0.994000	0.49952	0.080000	0.17528	6.286000	0.72665	1.243000	0.43853	0.194000	0.17425	GAT	TUBA3D	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin	ENSG00000075886		0.577	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	HGNC	protein_coding	OTTHUMT00000331800.2	-	0.00	93	0	G	NM_080386		132237645	+1	tier1	-	no_errors	ENST00000321253	ensembl	human	known	74_37	missense	35.06	50	27	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179667001	179667001	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:179667001G>A	ENST00000591111.1	-	3	383	c.159C>T	c.(157-159)ggC>ggT	p.G53G	TTN_ENST00000359218.5_Silent_p.G53G|TTN_ENST00000460472.2_Silent_p.G53G|TTN_ENST00000342992.6_Silent_p.G53G|TTN_ENST00000589042.1_Silent_p.G53G|TTN_ENST00000360870.5_Silent_p.G53G|TTN_ENST00000342175.6_Silent_p.G53G			Q8WZ42	TITIN_HUMAN	titin	32664	Ig-like 1.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGATCTGCACGCCGGGCAGAG	0.517																																																	0													96.0	85.0	89.0					2																	179667001		2203	4300	6503	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.159C>T	2.37:g.179667001G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G53	ENST00000591111.1	37	c.159		2																																																																																			TTN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.517	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	40	0	G	NM_133378		179667001	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	30.16	43	19	SNP	1.000	A
TUBGCP2	10844	genome.wustl.edu	37	10	135111525	135111525	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr10:135111525C>G	ENST00000252936.3	-	4	586	c.547G>C	c.(547-549)Gag>Cag	p.E183Q	TUBGCP2_ENST00000543663.1_Missense_Mutation_p.E183Q|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.E53Q|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.E183Q|TUBGCP2_ENST00000470829.1_5'Flank|RP11-122K13.12_ENST00000424450.1_RNA			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	183					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GCAGGTCTCTCATACACCCAT	0.512																																																	0													172.0	151.0	158.0					10																	135111525		2203	4300	6503	SO:0001583	missense	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.547G>C	10.37:g.135111525C>G	ENSP00000252936:p.Glu183Gln		B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_TUBGCP,superfamily_Ocr	p.E183Q	ENST00000252936.3	37	c.547	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	C	24.6	4.553774	0.86231	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000543663	T;T;T;T	0.18960	2.43;2.18;2.43;2.31	5.24	5.24	0.73138	.	0.094116	0.64402	D	0.000001	T	0.35364	0.0929	L	0.59436	1.845	0.49915	D	0.999834	P;P;D	0.56968	0.831;0.74;0.978	P;B;P	0.52424	0.615;0.41;0.698	T	0.03453	-1.1035	10	0.49607	T	0.09	-33.9696	17.7919	0.88555	0.0:1.0:0.0:0.0	.	183;183;183	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	Q	183;53;183;183	ENSP00000252936:E183Q;ENSP00000395666:E53Q;ENSP00000357551:E183Q;ENSP00000446093:E183Q	ENSP00000252936:E183Q	E	-	1	0	TUBGCP2	134961515	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	5.792000	0.69052	2.619000	0.88677	0.561000	0.74099	GAG	TUBGCP2	-	NULL	ENSG00000130640		0.512	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	-	0.00	64	0	C			135111525	-1	tier1	-	no_errors	ENST00000543663	ensembl	human	known	74_37	missense	43.18	25	19	SNP	1.000	G
TXNRD1	7296	genome.wustl.edu	37	12	104742133	104742133	+	Silent	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr12:104742133A>G	ENST00000529546.1	+	14	1545	c.1320A>G	c.(1318-1320)gtA>gtG	p.V440V	TXNRD1_ENST00000526950.1_Silent_p.V547V|TXNRD1_ENST00000378070.4_3'UTR|TXNRD1_ENST00000354940.6_Silent_p.V478V|TXNRD1_ENST00000525566.1_Silent_p.V628V|TXNRD1_ENST00000524698.1_Silent_p.V478V|TXNRD1_ENST00000427956.1_Silent_p.V593V|TXNRD1_ENST00000542918.1_Silent_p.V528V|TXNRD1_ENST00000429002.2_Silent_p.V628V|TXNRD1_ENST00000388854.3_Silent_p.V530V|TXNRD1_ENST00000540716.1_Silent_p.V440V|TXNRD1_ENST00000526390.1_Silent_p.V522V|TXNRD1_ENST00000503506.2_Silent_p.V478V|TXNRD1_ENST00000397736.2_Silent_p.V522V|TXNRD1_ENST00000526691.1_Silent_p.V530V			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	628					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	CCCTGCAGGTATTCACAACAT	0.488																																					Ovarian(139;555 1836 9186 9946 10884)												0													156.0	148.0	151.0					12																	104742133		1973	4169	6142	SO:0001819	synonymous_variant	0				CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.1320A>G	12.37:g.104742133A>G			B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Silent	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/NAD-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.V628	ENST00000529546.1	37	c.1884	CCDS58274.1	12																																																																																			TXNRD1	-	pfam_Pyr_nucl-diS_OxRdtase_dimer,superfamily_FAD/NAD-linked_Rdtase_dimer,tigrfam_Thioredoxin/glutathione_Rdtase	ENSG00000198431		0.488	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	HGNC	protein_coding	OTTHUMT00000389969.1	-	0.00	59	0	A	NM_003330		104742133	+1	tier1	-	no_errors	ENST00000429002	ensembl	human	known	74_37	silent	25.00	45	15	SNP	0.256	G
USP24	23358	genome.wustl.edu	37	1	55557762	55557762	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:55557762delT	ENST00000294383.6	-	54	6487	c.6488delA	c.(6487-6489)aagfs	p.K2163fs	USP24_ENST00000407756.1_Frame_Shift_Del_p.K2003fs	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	2163					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TAAGCTCACCTTTGCCATGCA	0.333																																																	0													98.0	93.0	94.0					1																	55557762		1840	4084	5924	SO:0001589	frameshift_variant	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.6488delA	1.37:g.55557762delT	ENSP00000294383:p.Lys2163fs		Q6ZSY2|Q8N2Y4|Q9NXD1	Frame_Shift_Del	DEL	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.K2003fs	ENST00000294383.6	37	c.6008	CCDS44154.2	1																																																																																			USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.333	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2		0.00	51	0	T			55557762	-1	tier1		no_errors	ENST00000407756	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	1.000	-
USP28	57646	genome.wustl.edu	37	11	113672343	113672343	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr11:113672343C>T	ENST00000003302.4	-	24	2988	c.2920G>A	c.(2920-2922)Gag>Aag	p.E974K	USP28_ENST00000545540.1_Missense_Mutation_p.E817K|USP28_ENST00000260188.5_Missense_Mutation_p.E942K|USP28_ENST00000544967.1_Missense_Mutation_p.E650K	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	974					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TTAATGCCCTCAGTTACGGAG	0.398																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)												0													130.0	108.0	115.0					11																	113672343		2201	4296	6497	SO:0001583	missense	0			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.2920G>A	11.37:g.113672343C>T	ENSP00000003302:p.Glu974Lys		B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,pfscan_Peptidase_C19/C67	p.E974K	ENST00000003302.4	37	c.2920	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	C	20.9	4.066841	0.76301	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540	T;T;T;T	0.47528	1.4;1.41;0.84;1.42	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.64505	0.2604	L	0.59436	1.845	0.80722	D	1	D;P;D	0.89917	1.0;0.589;1.0	D;B;D	0.91635	0.997;0.222;0.999	T	0.56786	-0.7921	10	0.18276	T	0.48	-25.884	18.7047	0.91633	0.0:1.0:0.0:0.0	.	817;974;650	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	K	974;942;650;817	ENSP00000003302:E974K;ENSP00000260188:E942K;ENSP00000442431:E650K;ENSP00000444991:E817K	ENSP00000003302:E974K	E	-	1	0	USP28	113177553	0.999000	0.42202	0.923000	0.36655	0.911000	0.54048	4.286000	0.58995	2.639000	0.89480	0.585000	0.79938	GAG	USP28	-	NULL	ENSG00000048028		0.398	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	HGNC	protein_coding	OTTHUMT00000398789.1	-	0.00	33	0	C			113672343	-1	tier1	-	no_errors	ENST00000003302	ensembl	human	known	74_37	missense	58.82	14	20	SNP	0.999	T
VCL	7414	genome.wustl.edu	37	10	75802874	75802874	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr10:75802874C>T	ENST00000211998.4	+	2	296	c.202C>T	c.(202-204)Cag>Tag	p.Q68*	VCL_ENST00000372755.3_Nonsense_Mutation_p.Q68*|VCL_ENST00000478896.2_3'UTR|VCL_ENST00000417648.2_Nonsense_Mutation_p.Q68*	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	68	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					CACTGAGGATCAGATTTTGAA	0.303																																																	0													104.0	115.0	111.0					10																	75802874		2203	4294	6497	SO:0001587	stop_gained	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.202C>T	10.37:g.75802874C>T	ENSP00000211998:p.Gln68*		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Nonsense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.Q68*	ENST00000211998.4	37	c.202	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	C	38	6.764113	0.97821	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648	.	.	.	5.11	5.11	0.69529	.	0.072219	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	17.664	0.88199	0.0:1.0:0.0:0.0	.	.	.	.	X	68	.	ENSP00000211998:Q68X	Q	+	1	0	VCL	75472880	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.933000	0.70130	2.526000	0.85167	0.655000	0.94253	CAG	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.303	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		-	0.00	64	0	C	NM_003373, NM_014000		75802874	+1	tier1	-	no_errors	ENST00000211998	ensembl	human	known	74_37	nonsense	40.91	26	18	SNP	1.000	T
VPS13C	54832	genome.wustl.edu	37	15	62207918	62207918	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:62207918C>G	ENST00000261517.5	-	61	8432	c.8359G>C	c.(8359-8361)Gaa>Caa	p.E2787Q	VPS13C_ENST00000249837.3_Missense_Mutation_p.E2744Q|RN7SL613P_ENST00000584412.1_RNA|VPS13C_ENST00000395896.4_Missense_Mutation_p.E2787Q|VPS13C_ENST00000395898.3_Missense_Mutation_p.E2744Q	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TGAATATCTTCTGAACGATAC	0.393																																																	0													67.0	66.0	66.0					15																	62207918		2203	4300	6503	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.8359G>C	15.37:g.62207918C>G	ENSP00000261517:p.Glu2787Gln			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.E2787Q	ENST00000261517.5	37	c.8359	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772841	0.90108	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.33216	1.42;1.42;1.42	5.39	5.39	0.77823	Vacuolar protein sorting-associated protein (1);	0.000000	0.85682	D	0.000000	T	0.57829	0.2080	M	0.74881	2.28	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.997;0.998;0.998;0.999	D;D;D;D;D	0.77557	0.947;0.947;0.964;0.976;0.99	T	0.57329	-0.7830	10	0.45353	T	0.12	.	19.1603	0.93527	0.0:1.0:0.0:0.0	.	2787;2744;2787;2744;2787	F5GZG8;Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;.;VP13C_HUMAN	Q	2744;2787;2787;2787	ENSP00000249837:E2744Q;ENSP00000261517:E2787Q;ENSP00000379233:E2787Q	ENSP00000249837:E2744Q	E	-	1	0	VPS13C	59995210	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.434000	0.80377	2.514000	0.84764	0.557000	0.71058	GAA	VPS13C	-	pfam_VPSAP_dom	ENSG00000129003		0.393	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	-	0.00	39	0	C	NM_017684		62207918	-1	tier1	-	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	G
VTA1	51534	genome.wustl.edu	37	6	142525187	142525187	+	Missense_Mutation	SNP	A	A	C	rs199631870		TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:142525187A>C	ENST00000367630.4	+	7	821	c.763A>C	c.(763-765)Aat>Cat	p.N255H	VTA1_ENST00000452973.2_Intron|VTA1_ENST00000367621.1_Missense_Mutation_p.N197H	NM_016485.3	NP_057569.2	Q9NP79	VTA1_HUMAN	vesicle (multivesicular body) trafficking 1	255	Interaction with VPS4B. {ECO:0000250}.				endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;1.34e-05)|GBM - Glioblastoma multiforme(68;0.00182)		CGCACTTTTCAATACAATTTC	0.383																																																	0													133.0	117.0	122.0					6																	142525187		2203	4300	6503	SO:0001583	missense	0			AF060225	CCDS5197.1, CCDS69214.1, CCDS75531.1	6q24.1	2013-08-05	2013-08-05	2007-04-03	ENSG00000009844	ENSG00000009844			20954	protein-coding gene	gene with protein product		610902	"""chromosome 6 open reading frame 55"", ""Vps20-associated 1 homolog (S. cerevisiae)"""	C6orf55		11489251, 15644320	Standard	NM_001286372		Approved	HSPC228, My012	uc003qiw.3	Q9NP79	OTTHUMG00000015707	ENST00000367630.4:c.763A>C	6.37:g.142525187A>C	ENSP00000356602:p.Asn255His		B4DW55|E1P594|E7ETQ7|Q5TGM1|Q6IAE8|Q9H0R2|Q9H3K9|Q9P0Q0	Missense_Mutation	SNP	NULL	p.N255H	ENST00000367630.4	37	c.763	CCDS5197.1	6	.	.	.	.	.	.	.	.	.	.	A	13.58	2.280775	0.40294	.	.	ENSG00000009844	ENST00000367630;ENST00000367621	T;T	0.43688	0.94;0.94	5.29	5.29	0.74685	.	0.372577	0.34580	N	0.003852	T	0.16599	0.0399	N	0.22421	0.69	0.80722	D	1	B	0.14438	0.01	B	0.13407	0.009	T	0.04723	-1.0931	10	0.39692	T	0.17	-3.2542	13.1921	0.59717	1.0:0.0:0.0:0.0	.	255	Q9NP79	VTA1_HUMAN	H	255;197	ENSP00000356602:N255H;ENSP00000356593:N197H	ENSP00000356593:N197H	N	+	1	0	VTA1	142566880	0.999000	0.42202	0.933000	0.37362	0.963000	0.63663	5.026000	0.64103	1.988000	0.58038	0.460000	0.39030	AAT	VTA1	-	NULL	ENSG00000009844		0.383	VTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTA1	HGNC	protein_coding	OTTHUMT00000042483.2	-	0.00	61	0	A	NM_016485		142525187	+1	tier1	-	no_errors	ENST00000367630	ensembl	human	known	74_37	missense	40.26	46	31	SNP	0.979	C
VWA3A	146177	genome.wustl.edu	37	16	22149768	22149768	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:22149768C>T	ENST00000389398.5	+	22	2323	c.2227C>T	c.(2227-2229)Cag>Tag	p.Q743*	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	743						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		AAAGACACTTCAGCTAAGAAG	0.532																																																	0													55.0	59.0	58.0					16																	22149768		1921	4133	6054	SO:0001587	stop_gained	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2227C>T	16.37:g.22149768C>T	ENSP00000374049:p.Gln743*		A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Nonsense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.Q743*	ENST00000389398.5	37	c.2227	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	C	2.458	-0.324895	0.05350	.	.	ENSG00000175267	ENST00000389398;ENST00000299840	.	.	.	5.15	0.0385	0.14200	.	0.632857	0.16361	N	0.217761	.	.	.	.	.	.	0.21984	N	0.999432	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	13.3271	0.60465	0.3596:0.6404:0.0:0.0	.	.	.	.	X	743;366	.	ENSP00000299840:Q366X	Q	+	1	0	VWA3A	22057269	0.944000	0.32072	0.008000	0.14137	0.154000	0.21943	1.386000	0.34419	-0.192000	0.10432	0.655000	0.94253	CAG	VWA3A	-	NULL	ENSG00000175267		0.532	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	-	0.00	58	0	C			22149768	+1	tier1	-	no_errors	ENST00000389398	ensembl	human	known	74_37	nonsense	33.33	38	19	SNP	0.074	T
ALG3	10195	genome.wustl.edu	37	3	183958839	183958839	+	IGR	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:183958839C>T	ENST00000397676.3	-	0	1528				ALG3_ENST00000463495.1_5'Flank|VWA5B2_ENST00000426955.2_Missense_Mutation_p.P969L|MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000273794.5_Missense_Mutation_p.P751L|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGAACCCCTCCTGCCTCTCAC	0.587																																																	0													40.0	43.0	42.0					3																	183958839		692	1591	2283	SO:0001628	intergenic_variant	0			BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		3.37:g.183958839C>T			A8JZZ6|Q9BT71	Missense_Mutation	SNP	NULL	p.P969L	ENST00000397676.3	37	c.2906	CCDS46968.1	3	.	.	.	.	.	.	.	.	.	.	C	6.610	0.480904	0.12581	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	T;T	0.17213	2.97;2.29	4.64	2.51	0.30379	.	0.733111	0.12077	N	0.501673	T	0.10723	0.0262	L	0.31664	0.95	0.09310	N	1	B;B;B	0.14012	0.009;0.001;0.001	B;B;B	0.12156	0.007;0.001;0.001	T	0.35574	-0.9783	10	0.25106	T	0.35	.	4.112	0.10063	0.212:0.6381:0.0:0.1499	.	751;969;980	E9PF42;B9EGN7;Q8N398	.;.;VW5B2_HUMAN	L	969;751	ENSP00000398688:P969L;ENSP00000273794:P751L	ENSP00000273794:P751L	P	+	2	0	VWA5B2	185441533	0.003000	0.15002	0.002000	0.10522	0.038000	0.13279	1.662000	0.37418	0.488000	0.27723	0.462000	0.41574	CCT	VWA5B2	-	NULL	ENSG00000145198		0.587	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5B2	HGNC	protein_coding	OTTHUMT00000346033.1	-	0.00	27	0	C	NM_005787		183958839	+1	tier1	-	no_errors	ENST00000426955	ensembl	human	known	74_37	missense	30.95	29	13	SNP	0.002	T
WDR87	83889	genome.wustl.edu	37	19	38383553	38383553	+	Silent	SNP	G	G	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:38383553G>T	ENST00000303868.5	-	4	2897	c.2673C>A	c.(2671-2673)gtC>gtA	p.V891V	WDR87_ENST00000447313.2_Silent_p.V930V	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	891										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						AGGAAGCATGGACCATAATAT	0.478																																																	0													70.0	55.0	60.0					19																	38383553		692	1591	2283	SO:0001819	synonymous_variant	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2673C>A	19.37:g.38383553G>T			Q9BWV9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V930	ENST00000303868.5	37	c.2790	CCDS46063.1	19																																																																																			WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.478	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	49	0	G	XM_940478		38383553	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.000	T
WDR91	29062	genome.wustl.edu	37	7	134878362	134878362	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:134878362G>A	ENST00000354475.4	-	10	1489	c.1458C>T	c.(1456-1458)ctC>ctT	p.L486L	WDR91_ENST00000485942.1_5'Flank|WDR91_ENST00000423565.1_Silent_p.L451L|WDR91_ENST00000344400.5_Silent_p.L486L	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	486										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						TGATTTCACAGAGATTCTTCT	0.567																																																	0													116.0	92.0	100.0					7																	134878362		2203	4300	6503	SO:0001819	synonymous_variant	0			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1458C>T	7.37:g.134878362G>A			A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L486	ENST00000354475.4	37	c.1458	CCDS34758.1	7																																																																																			WDR91	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000105875		0.567	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR91	HGNC	protein_coding	OTTHUMT00000340019.1	-	0.00	81	0	G	NM_014149		134878362	-1	tier1	-	no_errors	ENST00000354475	ensembl	human	known	74_37	silent	22.58	72	21	SNP	1.000	A
WNT10A	80326	genome.wustl.edu	37	2	219757942	219757942	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr2:219757942C>T	ENST00000258411.3	+	4	1836	c.1203C>T	c.(1201-1203)ttC>ttT	p.F401F		NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	401					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGTGCTGTTTCGTGGTCTGCG	0.692																																																	0													8.0	7.0	8.0					2																	219757942		2183	4256	6439	SO:0001819	synonymous_variant	0			AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.1203C>T	2.37:g.219757942C>T			Q53S44|Q96TA7|Q9H7S8	Silent	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.F401	ENST00000258411.3	37	c.1203	CCDS2426.1	2																																																																																			WNT10A	-	pfam_Wnt,smart_Wnt	ENSG00000135925		0.692	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10A	HGNC	protein_coding	OTTHUMT00000256730.2	-	0.00	39	0	C	NM_025216		219757942	+1	tier1	-	no_errors	ENST00000258411	ensembl	human	known	74_37	silent	54.05	17	20	SNP	1.000	T
XPNPEP2	7512	genome.wustl.edu	37	X	128885744	128885744	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:128885744G>C	ENST00000371106.3	+	9	955	c.763G>C	c.(763-765)Gac>Cac	p.D255H		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	255						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TCGAGCCAGTGACATCCCCTA	0.438																																																	0													243.0	245.0	244.0					X																	128885744		2203	4300	6503	SO:0001583	missense	0			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.763G>C	X.37:g.128885744G>C	ENSP00000360147:p.Asp255His		A0AV16|O75994	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.D255H	ENST00000371106.3	37	c.763	CCDS14613.1	X	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403630	0.83230	.	.	ENSG00000122121	ENST00000371106	T	0.74632	-0.86	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.90497	0.7023	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93401	0.6760	10	0.87932	D	0	-29.5569	15.5497	0.76141	0.0:0.0:1.0:0.0	.	255	O43895	XPP2_HUMAN	H	255	ENSP00000360147:D255H	ENSP00000360147:D255H	D	+	1	0	XPNPEP2	128713425	1.000000	0.71417	0.982000	0.44146	0.956000	0.61745	8.711000	0.91396	2.266000	0.75297	0.436000	0.28706	GAC	XPNPEP2	-	NULL	ENSG00000122121		0.438	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	-	0.00	49	0	G	NM_003399		128885744	+1	tier1	-	no_errors	ENST00000371106	ensembl	human	known	74_37	missense	52.24	32	35	SNP	1.000	C
YBX1	4904	genome.wustl.edu	37	1	43162401	43162401	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:43162401A>G	ENST00000321358.7	+	5	582	c.443A>G	c.(442-444)tAt>tGt	p.Y148C	YBX1_ENST00000467957.1_3'UTR	NM_004559.3	NP_004550.2	P67809	YBOX1_HUMAN	Y box binding protein 1	148					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|histone pre-mRNA 3'end processing complex (GO:0071204)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|U12-type spliceosomal complex (GO:0005689)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			large_intestine(2)|lung(4)|ovary(4)|prostate(4)|upper_aerodigestive_tract(2)	16	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TATAGACGCTATCCACGTCGT	0.512																																																	0													76.0	78.0	77.0					1																	43162401		2203	4300	6503	SO:0001583	missense	0			BC013838	CCDS470.1	1p34	2008-02-05	2005-08-11	2005-08-11	ENSG00000065978	ENSG00000065978			8014	protein-coding gene	gene with protein product		154030	"""nuclease sensitive element binding protein 1"""	NSEP1		1891370, 3174636	Standard	NM_004559		Approved	YB-1, YB1, DBPB, NSEP-1, MDR-NF1, BP-8, CSDB, CSDA2	uc001chs.3	P67809	OTTHUMG00000007523	ENST00000321358.7:c.443A>G	1.37:g.43162401A>G	ENSP00000361626:p.Tyr148Cys		P16990|P16991|Q14972|Q15325|Q5FVF0	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold,smart_Cold_shock_prot,prints_CSP_DNA-bd	p.Y148C	ENST00000321358.7	37	c.443	CCDS470.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.52|17.52	3.410592|3.410592	0.62399|0.62399	.|.	.|.	ENSG00000065978|ENSG00000065978	ENST00000436427|ENST00000321358;ENST00000332220;ENST00000318612	.|T;T	.|0.37584	.|1.25;1.19	5.24|5.24	5.24|5.24	0.73138|0.73138	.|.	.|0.228496	.|0.47093	.|N	.|0.000256	T|T	0.49932|0.49932	0.1586|0.1586	M|M	0.73217|0.73217	2.22|2.22	0.53688|0.53688	D|D	0.999979|0.999979	.|D	.|0.69078	.|0.997	.|P	.|0.53912	.|0.737	T|T	0.50972|0.50972	-0.8764|-0.8764	5|10	.|0.41790	.|T	.|0.15	-0.5043|-0.5043	13.372|13.372	0.60719|0.60719	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|148	.|P67809	.|YBOX1_HUMAN	V|C	198|148;118;144	.|ENSP00000361626:Y148C;ENSP00000405937:Y118C	.|ENSP00000361621:Y144C	I|Y	+|+	1|2	0|0	YBX1|YBX1	42934988|42934988	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.781000|6.781000	0.75068|0.75068	2.101000|2.101000	0.63845|0.63845	0.460000|0.460000	0.39030|0.39030	ATC|TAT	YBX1	-	NULL	ENSG00000065978		0.512	YBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBX1	HGNC	protein_coding	OTTHUMT00000019786.2	-	0.00	65	0	A	NM_004559		43162401	+1	tier1	-	no_errors	ENST00000321358	ensembl	human	known	74_37	missense	37.04	51	30	SNP	1.000	G
YBX2	51087	genome.wustl.edu	37	17	7193791	7193791	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr17:7193791G>A	ENST00000007699.5	-	5	586	c.523C>T	c.(523-525)Ccc>Tcc	p.P175S	YBX2_ENST00000570627.1_5'UTR	NM_015982.3	NP_057066.2	Q9Y2T7	YBOX2_HUMAN	Y box binding protein 2	175					mRNA stabilization (GO:0048255)|negative regulation of binding (GO:0051100)|negative regulation of translation (GO:0017148)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|translational attenuation (GO:0009386)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lipid binding (GO:0008289)|mRNA 3'-UTR binding (GO:0003730)|ribonucleoprotein complex binding (GO:0043021)|translation regulator activity (GO:0045182)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|skin(3)	12						CGTCGGTTGGGGGCATAACGG	0.637																																																	0													32.0	35.0	34.0					17																	7193791		2197	4294	6491	SO:0001583	missense	0			AF096834	CCDS11098.1	17p13.1	2013-12-20			ENSG00000006047	ENSG00000006047			17948	protein-coding gene	gene with protein product		611447				10100484, 9780336	Standard	NM_015982		Approved	MSY2, CSDA3	uc002gfq.2	Q9Y2T7	OTTHUMG00000177992	ENST00000007699.5:c.523C>T	17.37:g.7193791G>A	ENSP00000007699:p.Pro175Ser		D3DTP1|Q8N4P0	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold,smart_Cold_shock_prot,prints_CSP_DNA-bd	p.P175S	ENST00000007699.5	37	c.523	CCDS11098.1	17	.	.	.	.	.	.	.	.	.	.	G	23.3	4.396023	0.83011	.	.	ENSG00000006047	ENST00000007699	T	0.24723	1.84	4.67	3.69	0.42338	.	0.116802	0.64402	D	0.000017	T	0.41096	0.1144	L	0.61218	1.895	0.45621	D	0.998559	D	0.67145	0.996	P	0.57620	0.824	T	0.39231	-0.9624	10	0.66056	D	0.02	-7.0798	12.8186	0.57679	0.0:0.1658:0.8342:0.0	.	175	Q9Y2T7	YBOX2_HUMAN	S	175	ENSP00000007699:P175S	ENSP00000007699:P175S	P	-	1	0	YBX2	7134515	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.837000	0.62796	1.323000	0.45263	0.561000	0.74099	CCC	YBX2	-	NULL	ENSG00000006047		0.637	YBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YBX2	HGNC	protein_coding	OTTHUMT00000440172.2	-	0.00	60	0	G	NM_015982		7193791	-1	tier1	-	no_errors	ENST00000007699	ensembl	human	known	74_37	missense	40.58	40	28	SNP	1.000	A
ZBTB17	7709	genome.wustl.edu	37	1	16271287	16271287	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:16271287G>A	ENST00000375743.4	-	8	1207	c.975C>T	c.(973-975)atC>atT	p.I325I	ZBTB17_ENST00000537142.1_Silent_p.I243I|ZBTB17_ENST00000448462.2_Silent_p.I262I|ZBTB17_ENST00000479282.1_5'Flank|ZBTB17_ENST00000375733.2_Silent_p.I325I	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	325					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TGTGGATGCGGATGTGCCGCT	0.657																																																	0													42.0	42.0	42.0					1																	16271287		2202	4300	6502	SO:0001819	synonymous_variant	0			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.975C>T	1.37:g.16271287G>A			A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.I325	ENST00000375743.4	37	c.975	CCDS165.1	1																																																																																			ZBTB17	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000116809		0.657	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB17	HGNC	protein_coding	OTTHUMT00000025998.1		0.00	9	0	G	NM_003443		16271287	-1			no_errors	ENST00000375733	ensembl	human	known	74_37	silent	18.75	13	3	SNP	1.000	A
ZC3H12B	340554	genome.wustl.edu	37	X	64722232	64722232	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chrX:64722232T>C	ENST00000338957.4	+	5	1721	c.1654T>C	c.(1654-1656)Ttc>Ctc	p.F552L	ZC3H12B_ENST00000423889.3_Missense_Mutation_p.F541L	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	552							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GTTAGGTGACTTCTCCAAACT	0.478																																																	0													47.0	45.0	45.0					X																	64722232		1937	4125	6062	SO:0001583	missense	0			BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.1654T>C	X.37:g.64722232T>C	ENSP00000340839:p.Phe552Leu		B2RTQ3|E9PAJ6|Q5H9C0	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.F552L	ENST00000338957.4	37	c.1654	CCDS48131.2	X	.	.	.	.	.	.	.	.	.	.	T	18.59	3.656830	0.67586	.	.	ENSG00000102053	ENST00000338957;ENST00000423889;ENST00000218172	T;T	0.29142	1.58;1.58	4.95	4.95	0.65309	.	0.045990	0.85682	D	0.000000	T	0.49012	0.1532	L	0.57536	1.79	0.53005	D	0.999962	D	0.69078	0.997	D	0.70716	0.97	T	0.45542	-0.9254	10	0.45353	T	0.12	-24.0848	12.4661	0.55759	0.0:0.0:0.0:1.0	.	541	Q5HYM0	ZC12B_HUMAN	L	552;541;488	ENSP00000340839:F552L;ENSP00000408077:F541L	ENSP00000218172:F488L	F	+	1	0	ZC3H12B	64638957	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.572000	0.60886	1.825000	0.53177	0.417000	0.27973	TTC	ZC3H12B	-	NULL	ENSG00000102053		0.478	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	HGNC	protein_coding	OTTHUMT00000378734.2	-	0.00	18	0	T	XM_293334		64722232	+1	tier1	-	no_errors	ENST00000338957	ensembl	human	known	74_37	missense	80.77	5	21	SNP	1.000	C
ZNF14	7561	genome.wustl.edu	37	19	19823885	19823885	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:19823885C>G	ENST00000344099.3	-	4	343	c.205G>C	c.(205-207)Gag>Cag	p.E69Q		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				CAGAGTCTCTCAACCATATGA	0.318																																																	0													88.0	85.0	86.0					19																	19823885		2203	4300	6503	SO:0001583	missense	0			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.205G>C	19.37:g.19823885C>G	ENSP00000340514:p.Glu69Gln		B9EGA4|Q9ULZ5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E69Q	ENST00000344099.3	37	c.205	CCDS12409.1	19	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814027	0.50527	.	.	ENSG00000105708	ENST00000344099	T	0.06449	3.3	1.67	-2.03	0.07365	Krueppel-associated box (1);	.	.	.	.	T	0.03011	0.0089	N	0.13168	0.305	0.19945	N	0.999943	P	0.41188	0.741	B	0.37267	0.245	T	0.38499	-0.9658	9	0.39692	T	0.17	.	3.6554	0.08218	0.2793:0.4454:0.2753:0.0	.	69	P17017	ZNF14_HUMAN	Q	69	ENSP00000340514:E69Q	ENSP00000340514:E69Q	E	-	1	0	ZNF14	19684885	0.000000	0.05858	0.001000	0.08648	0.788000	0.44548	0.334000	0.19787	-0.549000	0.06191	-0.535000	0.04281	GAG	ZNF14	-	pfscan_Krueppel-associated_box	ENSG00000105708		0.318	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF14	HGNC	protein_coding	OTTHUMT00000460775.1	-	0.00	49	0	C	NM_021030		19823885	-1	tier1	-	no_errors	ENST00000344099	ensembl	human	known	74_37	missense	26.98	46	17	SNP	0.673	G
ZNF197	10168	genome.wustl.edu	37	3	44671001	44671001	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr3:44671001G>A	ENST00000396058.1	+	1	522	c.355G>A	c.(355-357)Gag>Aag	p.E119K	ZNF197_ENST00000383745.2_Missense_Mutation_p.E119K|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000344387.4_Missense_Mutation_p.E119K|ZNF197_ENST00000383744.4_Missense_Mutation_p.E119K			O14709	ZN197_HUMAN	zinc finger protein 197	119	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		CCTGGTAGAGGAGCTGCAGAA	0.567																																																	0													43.0	43.0	43.0					3																	44671001		2203	4300	6503	SO:0001583	missense	0			AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.355G>A	3.37:g.44671001G>A	ENSP00000379370:p.Glu119Lys		B2RAH8|Q86VG0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E119K	ENST00000396058.1	37	c.355	CCDS2717.1	3	.	.	.	.	.	.	.	.	.	.	G	19.95	3.922401	0.73213	.	.	ENSG00000186448	ENST00000383744;ENST00000536299;ENST00000344387;ENST00000383745;ENST00000396058	T;T;T;T	0.05649	3.41;3.41;3.41;3.41	5.09	5.09	0.68999	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.199965	0.24742	N	0.035980	T	0.11793	0.0287	L	0.55103	1.725	0.29758	N	0.835771	P;P	0.48834	0.916;0.822	P;B	0.46110	0.504;0.325	T	0.00899	-1.1522	10	0.72032	D	0.01	.	15.8651	0.79057	0.0:0.0:1.0:0.0	.	119;119	Q86VG0;O14709	.;ZN197_HUMAN	K	119	ENSP00000373250:E119K;ENSP00000345809:E119K;ENSP00000373251:E119K;ENSP00000379370:E119K	ENSP00000334616:E119K	E	+	1	0	ZNF197	44646005	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	3.802000	0.55553	2.791000	0.96007	0.655000	0.94253	GAG	ZNF197	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000186448		0.567	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF197	HGNC	protein_coding	OTTHUMT00000256747.4	-	0.00	19	0	G	NM_006991		44671001	+1	tier1	-	no_errors	ENST00000344387	ensembl	human	known	74_37	missense	29.09	39	16	SNP	0.995	A
ZNF223	7766	genome.wustl.edu	37	19	44559295	44559295	+	5'UTR	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:44559295C>G	ENST00000434772.3	+	0	221				ZNF223_ENST00000588518.1_3'UTR|ZNF223_ENST00000591793.1_Nonsense_Mutation_p.S99*|ZNF223_ENST00000585552.1_5'UTR	NM_013361.4	NP_037493.3	Q9UK11	ZN223_HUMAN	zinc finger protein 223						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18		Prostate(69;0.0352)				CTGTGTCATTCAGGACTCTGC	0.448																																																	0													127.0	105.0	113.0					19																	44559295		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF187989	CCDS12635.1	19q13.2	2013-01-08				ENSG00000178386		"""Zinc fingers, C2H2-type"", ""-"""	13016	protein-coding gene	gene with protein product							Standard	XM_006723365		Approved		uc002oyf.1	Q9UK11		ENST00000434772.3:c.-35C>G	19.37:g.44559295C>G			Q15736|Q8TBJ3|Q9HCA9	Nonsense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S99*	ENST00000434772.3	37	c.296	CCDS12635.1	19																																																																																			ZNF223	-	NULL	ENSG00000267022		0.448	ZNF223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF223	Uniprot_gn	protein_coding	OTTHUMT00000460469.2	-	0.00	52	0	C			44559295	+1	tier1	-	no_errors	ENST00000591793	ensembl	human	known	74_37	nonsense	37.93	36	22	SNP	0.001	G
ZNF292	23036	genome.wustl.edu	37	6	87970002	87970002	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr6:87970002G>A	ENST00000369577.3	+	8	6698	c.6655G>A	c.(6655-6657)Gac>Aac	p.D2219N	ZNF292_ENST00000339907.4_Missense_Mutation_p.D2214N	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2219						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GTTTCCATGTGACCAGTTAGA	0.378																																																	0													142.0	142.0	142.0					6																	87970002		1889	4111	6000	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6655G>A	6.37:g.87970002G>A	ENSP00000358590:p.Asp2219Asn		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D2219N	ENST00000369577.3	37	c.6655	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882097	0.72294	.	.	ENSG00000188994	ENST00000369577;ENST00000339907;ENST00000496806	T;T;T	0.46819	3.26;3.27;0.86	5.3	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.52741	0.1753	L	0.43646	1.37	0.47153	D	0.999334	D	0.89917	1.0	D	0.83275	0.996	T	0.39901	-0.9591	10	0.23891	T	0.37	.	18.9535	0.92649	0.0:0.0:1.0:0.0	.	2219	O60281	ZN292_HUMAN	N	2219;2214;137	ENSP00000358590:D2219N;ENSP00000342847:D2214N;ENSP00000428857:D137N	ENSP00000342847:D2214N	D	+	1	0	ZNF292	88026721	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.476000	0.97823	2.473000	0.83533	0.591000	0.81541	GAC	ZNF292	-	smart_Znf_C2H2-like	ENSG00000188994		0.378	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	43	0	G	NM_015021		87970002	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	A
ZNF335	63925	genome.wustl.edu	37	20	44579100	44579100	+	Silent	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr20:44579100G>A	ENST00000322927.2	-	21	3424	c.3324C>T	c.(3322-3324)tgC>tgT	p.C1108C	ZNF335_ENST00000426788.1_Silent_p.C953C	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1108					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				ACCGCTGCCCGCAGAGGTGGC	0.567																																																	0													113.0	112.0	112.0					20																	44579100		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3324C>T	20.37:g.44579100G>A			B4DLG7|Q548D0|Q9H684	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1108	ENST00000322927.2	37	c.3324	CCDS13389.1	20																																																																																			ZNF335	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198026		0.567	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	-	0.00	70	0	G	NM_022095		44579100	-1	tier1	-	no_errors	ENST00000322927	ensembl	human	known	74_37	silent	5.80	64	4	SNP	0.997	A
ZNF517	340385	genome.wustl.edu	37	8	146032926	146032926	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr8:146032926G>C	ENST00000531720.1	+	4	670	c.625G>C	c.(625-627)Gag>Cag	p.E209Q	ZNF517_ENST00000526178.1_Intron|ZNF517_ENST00000525105.1_Intron|ZNF517_ENST00000359971.3_Missense_Mutation_p.E209Q			Q6ZMY9	ZN517_HUMAN	zinc finger protein 517	209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			CCAGTGCACAGAGTGCGGGAA	0.622																																																	0													33.0	29.0	30.0					8																	146032926		2195	4299	6494	SO:0001583	missense	0			AK096527	CCDS6434.1	8q24.3	2013-01-08				ENSG00000197363		"""Zinc fingers, C2H2-type"", ""-"""	27984	protein-coding gene	gene with protein product							Standard	NM_213605		Approved		uc003zed.1	Q6ZMY9		ENST00000531720.1:c.625G>C	8.37:g.146032926G>C	ENSP00000436103:p.Glu209Gln			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E209Q	ENST00000531720.1	37	c.625	CCDS6434.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.05|14.05	2.420101|2.420101	0.42918|0.42918	.|.	.|.	ENSG00000197363|ENSG00000197363	ENST00000359971;ENST00000531720|ENST00000529429	T;T|.	0.18502|.	2.21;2.21|.	2.7|2.7	-0.619|-0.619	0.11572|0.11572	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.10208|0.10208	0.0250|0.0250	N|N	0.04063|0.04063	-0.285|-0.285	0.09310|0.09310	N|N	0.999994|0.999994	B|.	0.22800|.	0.075|.	B|.	0.20184|.	0.028|.	T|T	0.28808|0.28808	-1.0032|-1.0032	9|5	0.56958|.	D|.	0.05|.	.|.	3.0825|3.0825	0.06267|0.06267	0.1107:0.1706:0.5439:0.1748|0.1107:0.1706:0.5439:0.1748	.|.	209|.	Q6ZMY9|.	ZN517_HUMAN|.	Q|H	209|175	ENSP00000353058:E209Q;ENSP00000436103:E209Q|.	ENSP00000353058:E209Q|.	E|Q	+|+	1|3	0|2	ZNF517|ZNF517	146003730|146003730	0.000000|0.000000	0.05858|0.05858	0.024000|0.024000	0.17045|0.17045	0.868000|0.868000	0.49771|0.49771	0.077000|0.077000	0.14738|0.14738	-0.324000|-0.324000	0.08589|0.08589	0.462000|0.462000	0.41574|0.41574	GAG|CAG	ZNF517	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197363		0.622	ZNF517-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF517	HGNC	protein_coding	OTTHUMT00000382642.1	-	0.00	51	0	G	XM_291261		146032926	+1	tier1	-	no_errors	ENST00000359971	ensembl	human	known	74_37	missense	26.23	45	16	SNP	0.591	C
ZNF569	148266	genome.wustl.edu	37	19	37904952	37904952	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:37904952C>G	ENST00000316950.6	-	6	1165	c.608G>C	c.(607-609)aGa>aCa	p.R203T	ZNF569_ENST00000392149.2_Missense_Mutation_p.R203T|ZNF569_ENST00000392150.2_Missense_Mutation_p.R44T	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCTCAGATGTCTGATGAGGTC	0.363																																																	0													66.0	67.0	67.0					19																	37904952		2203	4300	6503	SO:0001583	missense	0			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.608G>C	19.37:g.37904952C>G	ENSP00000325018:p.Arg203Thr		A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R203T	ENST00000316950.6	37	c.608	CCDS12503.1	19	.	.	.	.	.	.	.	.	.	.	C	1.740	-0.491918	0.04322	.	.	ENSG00000196437	ENST00000316950;ENST00000392150	T;T	0.26223	1.75;3.2	3.73	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.40728	N	0.001039	T	0.14874	0.0359	N	0.25286	0.73	0.09310	N	1	B;P	0.40066	0.19;0.701	B;P	0.44696	0.055;0.458	T	0.11446	-1.0587	10	0.12103	T	0.63	.	3.7682	0.08630	0.1617:0.5774:0.1586:0.1023	.	44;203	Q17RR6;Q5MCW4	.;ZN569_HUMAN	T	203;44	ENSP00000325018:R203T;ENSP00000375993:R44T	ENSP00000325018:R203T	R	-	2	0	ZNF569	42596792	0.000000	0.05858	0.890000	0.34922	0.967000	0.64934	-4.213000	0.00273	0.913000	0.36797	0.591000	0.81541	AGA	ZNF569	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196437		0.363	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF569	HGNC	protein_coding	OTTHUMT00000109594.2	-	0.00	55	0	C	NM_152484		37904952	-1	tier1	-	no_errors	ENST00000316950	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.007	G
ZNF546	339327	genome.wustl.edu	37	19	40521329	40521329	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:40521329G>A	ENST00000347077.4	+	7	2368	c.2152G>A	c.(2152-2154)Gag>Aag	p.E718K	ZNF546_ENST00000596894.1_Intron|ZNF546_ENST00000600094.1_Missense_Mutation_p.E692K	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	718					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TCACACTGGTGAGCTTCCATA	0.388																																																	0													95.0	92.0	93.0					19																	40521329		2203	4300	6503	SO:0001583	missense	0			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.2152G>A	19.37:g.40521329G>A	ENSP00000339823:p.Glu718Lys		A8K913	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E718K	ENST00000347077.4	37	c.2152	CCDS12548.1	19	.	.	.	.	.	.	.	.	.	.	g	20.6	4.015162	0.75161	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.24350	1.86	2.91	2.91	0.33838	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.41971	0.1182	L	0.49640	1.575	0.34528	D	0.708901	D	0.71674	0.998	D	0.71184	0.972	T	0.56360	-0.7992	9	0.66056	D	0.02	.	12.0227	0.53352	0.0:0.0:1.0:0.0	.	718	Q86UE3	ZN546_HUMAN	K	718;327	ENSP00000339823:E718K	ENSP00000339823:E718K	E	+	1	0	ZNF546	45213169	1.000000	0.71417	0.981000	0.43875	0.794000	0.44872	2.774000	0.47694	1.920000	0.55613	0.591000	0.81541	GAG	ZNF546	-	pfscan_Znf_C2H2	ENSG00000187187		0.388	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF546	HGNC	protein_coding	OTTHUMT00000462495.2	-	0.00	39	0	G	NM_178544		40521329	+1	tier1	-	no_errors	ENST00000347077	ensembl	human	known	74_37	missense	36.36	28	16	SNP	1.000	A
ZNF597	146434	genome.wustl.edu	37	16	3487023	3487023	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr16:3487023G>A	ENST00000301744.4	-	4	911	c.676C>T	c.(676-678)Cat>Tat	p.H226Y		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	226					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						CGGGATAGATGAGAGTGCTGG	0.478																																																	0													131.0	122.0	125.0					16																	3487023		2197	4300	6497	SO:0001583	missense	0			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.676C>T	16.37:g.3487023G>A	ENSP00000301744:p.His226Tyr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H226Y	ENST00000301744.4	37	c.676	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	G	8.856	0.945706	0.18356	.	.	ENSG00000167981	ENST00000301744	T	0.13089	2.62	4.83	2.78	0.32641	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.334103	0.21813	N	0.068739	T	0.09335	0.0230	L	0.38733	1.17	0.09310	N	1	B	0.34161	0.439	B	0.29267	0.1	T	0.25293	-1.0136	10	0.27785	T	0.31	-2.0994	8.6402	0.33972	0.1994:0.0:0.8006:0.0	.	226	Q96LX8	ZN597_HUMAN	Y	226	ENSP00000301744:H226Y	ENSP00000301744:H226Y	H	-	1	0	ZNF597	3427024	0.000000	0.05858	0.023000	0.16930	0.009000	0.06853	-1.267000	0.02839	0.681000	0.31386	-0.345000	0.07892	CAT	ZNF597	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167981		0.478	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2	-	0.00	45	0	G	NM_152457		3487023	-1	tier1	-	no_errors	ENST00000301744	ensembl	human	known	74_37	missense	53.85	12	14	SNP	0.000	A
ZNF695	57116	genome.wustl.edu	37	1	247151124	247151124	+	Silent	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr1:247151124C>T	ENST00000339986.7	-	4	840	c.693G>A	c.(691-693)aaG>aaA	p.K231K	ZNF695_ENST00000487338.2_Intron|ZNF695_ENST00000498046.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	231					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CATGAATTCTCTTACAGTCAG	0.353																																																	0													81.0	82.0	82.0					1																	247151124		1957	4156	6113	SO:0001819	synonymous_variant	0				CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.693G>A	1.37:g.247151124C>T			Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K231	ENST00000339986.7	37	c.693	CCDS44344.1	1																																																																																			ZNF695	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197472		0.353	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000097823.5	-	0.00	37	0	C	NM_020394		247151124	-1	tier1	-	no_errors	ENST00000339986	ensembl	human	known	74_37	silent	40.91	26	18	SNP	0.496	T
ZNF710	374655	genome.wustl.edu	37	15	90610643	90610643	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr15:90610643G>A	ENST00000268154.4	+	2	525	c.274G>A	c.(274-276)Gag>Aag	p.E92K		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	92					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			GGCAGCCTGTGAGAAGCACAC	0.662																																																	0													52.0	51.0	51.0					15																	90610643		2196	4293	6489	SO:0001583	missense	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.274G>A	15.37:g.90610643G>A	ENSP00000268154:p.Glu92Lys		A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E92K	ENST00000268154.4	37	c.274	CCDS10358.1	15	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310802	0.81358	.	.	ENSG00000140548	ENST00000268154	T	0.11277	2.79	5.29	5.29	0.74685	.	2.220610	0.01826	N	0.034375	T	0.11965	0.0291	N	0.19112	0.55	0.41999	D	0.990882	B	0.32781	0.384	B	0.23716	0.048	T	0.36040	-0.9764	10	0.87932	D	0	-42.9663	17.6687	0.88210	0.0:0.0:1.0:0.0	.	92	Q8N1W2	ZN710_HUMAN	K	92	ENSP00000268154:E92K	ENSP00000268154:E92K	E	+	1	0	ZNF710	88411647	0.997000	0.39634	0.975000	0.42487	0.946000	0.59487	2.802000	0.47916	2.757000	0.94681	0.462000	0.41574	GAG	ZNF710	-	NULL	ENSG00000140548		0.662	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1	-	0.00	77	0	G	NM_198526		90610643	+1	tier1	-	no_errors	ENST00000268154	ensembl	human	known	74_37	missense	31.25	55	25	SNP	0.988	A
ZNF791	163049	genome.wustl.edu	37	19	12739636	12739636	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:12739636G>A	ENST00000343325.4	+	4	1455	c.1293G>A	c.(1291-1293)atG>atA	p.M431I	ZNF791_ENST00000446165.1_3'UTR|ZNF490_ENST00000465656.1_Intron|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000540038.1_Missense_Mutation_p.M322I|ZNF791_ENST00000458122.3_Missense_Mutation_p.M399I	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						GAAGACACATGATCACCCACA	0.413																																																	0													105.0	108.0	107.0					19																	12739636		2203	4300	6503	SO:0001583	missense	0			AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1293G>A	19.37:g.12739636G>A	ENSP00000342974:p.Met431Ile		B7Z586|Q8NC99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M431I	ENST00000343325.4	37	c.1293	CCDS12273.1	19	.	.	.	.	.	.	.	.	.	.	G	8.251	0.809033	0.16537	.	.	ENSG00000173875	ENST00000343325;ENST00000458122;ENST00000540038	T;T;T	0.35605	1.3;1.3;1.3	1.83	0.729	0.18266	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.27524	0.0676	L	0.52823	1.66	0.09310	N	1	P	0.42735	0.788	B	0.36766	0.232	T	0.19811	-1.0294	9	0.87932	D	0	.	4.0546	0.09811	0.2351:0.0:0.7649:0.0	.	431	Q3KP31	ZN791_HUMAN	I	431;399;322	ENSP00000342974:M431I;ENSP00000441761:M399I;ENSP00000441038:M322I	ENSP00000342974:M431I	M	+	3	0	ZNF791	12600636	0.000000	0.05858	0.026000	0.17262	0.872000	0.50106	0.081000	0.14823	0.104000	0.17725	0.491000	0.48974	ATG	ZNF791	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173875		0.413	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF791	HGNC	protein_coding	OTTHUMT00000344140.1	-	0.00	80	0	G	NM_153358		12739636	+1	tier1	-	no_errors	ENST00000343325	ensembl	human	known	74_37	missense	37.38	67	40	SNP	0.009	A
ZNF728	388523	genome.wustl.edu	37	19	23158499	23158499	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr19:23158499C>T	ENST00000594710.1	-	4	1785	c.1640G>A	c.(1639-1641)tGg>tAg	p.W547*		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	547					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TCTTGAGGACCAGATGAAGGC	0.403																																																	0																																										SO:0001587	stop_gained	0			BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.1640G>A	19.37:g.23158499C>T	ENSP00000471593:p.Trp547*			Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W547*	ENST00000594710.1	37	c.1640	CCDS59370.1	19																																																																																			ZNF728	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000269067		0.403	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF728	HGNC	protein_coding	OTTHUMT00000465176.1	-	0.00	21	0	C	NM_001267716		23158499	-1	tier1	-	no_errors	ENST00000594710	ensembl	human	novel	74_37	nonsense	23.53	13	4	SNP	0.000	T
ZNF92	168374	genome.wustl.edu	37	7	64863308	64863308	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49M-01A-21D-A27G-09	TCGA-LN-A49M-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c633253f-7f42-4fa0-bd73-2d24487c0acd	4145a8ee-5e08-48aa-861b-6a8a6bfe3fb2	g.chr7:64863308C>A	ENST00000328747.7	+	4	480	c.281C>A	c.(280-282)tCt>tAt	p.S94Y	ZNF92_ENST00000357512.2_Missense_Mutation_p.S62Y|ZNF92_ENST00000431504.1_Missense_Mutation_p.S18Y|ZNF92_ENST00000450302.2_Missense_Mutation_p.S25Y	NM_152626.2	NP_689839.1	Q03936	ZNF92_HUMAN	zinc finger protein 92	94					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(3)|lung(4)|pancreas(1)|skin(1)|stomach(1)	13		Lung NSC(55;0.159)				ATAAAAGATTCTTTCCAAAAA	0.333																																																	0													50.0	53.0	52.0					7																	64863308		2203	4300	6503	SO:0001583	missense	0			M61872	CCDS34646.1, CCDS47596.1, CCDS75608.1, CCDS75609.1	7q11.21	2013-01-08	2006-05-12		ENSG00000146757	ENSG00000146757		"""Zinc fingers, C2H2-type"", ""-"""	13168	protein-coding gene	gene with protein product		603974	"""zinc finger protein 92 (HTF12)"""			8467795	Standard	NM_001287533		Approved	HPF12, TF12	uc003ttz.3	Q03936	OTTHUMG00000156557	ENST00000328747.7:c.281C>A	7.37:g.64863308C>A	ENSP00000332595:p.Ser94Tyr		A6NNF9|Q8N492|Q8NB35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S94Y	ENST00000328747.7	37	c.281	CCDS34646.1	7	.	.	.	.	.	.	.	.	.	.	C	3.968	-0.008856	0.07727	.	.	ENSG00000146757	ENST00000328747;ENST00000431504;ENST00000357512;ENST00000450302	T;T;T;T	0.06849	3.42;3.25;3.41;3.25	0.418	0.418	0.16429	.	.	.	.	.	T	0.09818	0.0241	L	0.60067	1.865	0.09310	N	1	B;B	0.26547	0.152;0.021	B;B	0.31547	0.132;0.029	T	0.32025	-0.9922	8	0.38643	T	0.18	.	.	.	.	.	62;94	Q03936-3;Q03936	.;ZNF92_HUMAN	Y	94;18;62;25	ENSP00000332595:S94Y;ENSP00000400495:S18Y;ENSP00000350113:S62Y;ENSP00000396126:S25Y	ENSP00000332595:S94Y	S	+	2	0	ZNF92	64500743	0.000000	0.05858	0.137000	0.22149	0.134000	0.20937	-1.007000	0.03667	0.452000	0.26830	0.460000	0.39030	TCT	ZNF92	-	NULL	ENSG00000146757		0.333	ZNF92-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF92	HGNC	protein_coding	OTTHUMT00000344589.2		0.00	39	0	C	NM_152626		64863308	+1			no_errors	ENST00000328747	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.062	A
