#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB5	340273	genome.wustl.edu	37	7	20768053	20768053	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr7:20768053C>T	ENST00000404938.2	+	23	3494	c.2842C>T	c.(2842-2844)Cga>Tga	p.R948*	ABCB5_ENST00000258738.6_Nonsense_Mutation_p.R503*	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	948	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TCAAGCTGGACGAATGACCCC	0.473																																																	0													99.0	96.0	97.0					7																	20768053		2203	4300	6503	SO:0001587	stop_gained	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2842C>T	7.37:g.20768053C>T	ENSP00000384881:p.Arg948*		A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.R503*	ENST00000404938.2	37	c.1507	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	43	10.131910	0.99343	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	.	.	.	3.91	2.99	0.34606	.	3.108400	0.02771	U	0.119757	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	.	10.7564	0.46239	0.1915:0.8085:0.0:0.0	.	.	.	.	X	948;503	.	ENSP00000258738:R503X	R	+	1	2	ABCB5	20734578	0.171000	0.23029	1.000000	0.80357	0.998000	0.95712	-0.642000	0.05427	1.156000	0.42514	0.655000	0.94253	CGA	ABCB5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000004846		0.473	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	-	0.00	45	0	C	NM_178559		20768053	+1	tier1	-	no_errors	ENST00000258738	ensembl	human	known	74_37	nonsense	34.38	21	11	SNP	1.000	T
ADA	100	genome.wustl.edu	37	20	43255195	43255195	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr20:43255195C>A	ENST00000372874.4	-	4	398	c.264G>T	c.(262-264)gaG>gaT	p.E88D	ADA_ENST00000464097.1_5'Flank|ADA_ENST00000537820.1_Missense_Mutation_p.E88D	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase	88					adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	TGGCCTTCATCTCTACAAACT	0.577									Adenosine Deaminase Deficiency																																								0													173.0	127.0	143.0					20																	43255195		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.264G>T	20.37:g.43255195C>A	ENSP00000361965:p.Glu88Asp		Q53F92|Q6LA59	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,tigrfam_Ado/ade_deaminase	p.E88D	ENST00000372874.4	37	c.264	CCDS13335.1	20	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429620	0.43122	.	.	ENSG00000196839	ENST00000372874;ENST00000537820	D;D	0.95980	-3.87;-3.87	5.05	5.05	0.67936	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.96800	0.8955	M	0.91920	3.255	0.80722	D	1	D	0.53151	0.958	P	0.52159	0.691	D	0.96716	0.9529	10	0.66056	D	0.02	0.2803	9.0285	0.36245	0.0:0.7916:0.0:0.2084	.	88	P00813	ADA_HUMAN	D	88	ENSP00000361965:E88D;ENSP00000441818:E88D	ENSP00000361965:E88D	E	-	3	2	ADA	42688609	1.000000	0.71417	0.962000	0.40283	0.002000	0.02628	1.230000	0.32612	2.504000	0.84457	0.655000	0.94253	GAG	ADA	-	pfam_A/AMP_deaminase_dom,tigrfam_Ado/ade_deaminase	ENSG00000196839		0.577	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADA	HGNC	protein_coding	OTTHUMT00000080509.2		0.00	58	0	C	NM_000022		43255195	-1			no_errors	ENST00000372874	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
ADAMTSL4	54507	genome.wustl.edu	37	1	150529724	150529724	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:150529724C>T	ENST00000369038.2	+	10	2161	c.1960C>T	c.(1960-1962)Ccg>Tcg	p.P654S	RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.P654S|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.P654S|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.P677S			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	654	Pro-rich. {ECO:0000255}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GATGCCCGCCCCGCCCCATCC	0.672																																																	0													20.0	21.0	21.0					1																	150529724		2203	4298	6501	SO:0001583	missense	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1960C>T	1.37:g.150529724C>T	ENSP00000358034:p.Pro654Ser		B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.P677S	ENST00000369038.2	37	c.2029	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680091	0.68042	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	T;T;T;T	0.62105	0.12;0.05;0.34;0.05	5.52	5.52	0.82312	.	.	.	.	.	T	0.59636	0.2208	L	0.49350	1.555	0.31415	N	0.675059	D;D;D	0.58268	0.957;0.982;0.98	P;P;P	0.56088	0.791;0.71;0.626	T	0.55835	-0.8078	9	0.26408	T	0.33	.	16.9419	0.86220	0.0:1.0:0.0:0.0	.	677;654;654	F8WAD0;Q6UY14;Q6UY14-2	.;ATL4_HUMAN;.	S	654;654;192;677;654	ENSP00000358037:P654S;ENSP00000271643:P654S;ENSP00000358035:P677S;ENSP00000358034:P654S	ENSP00000271643:P654S	P	+	1	0	ADAMTSL4	148796348	0.020000	0.18652	0.043000	0.18650	0.970000	0.65996	2.932000	0.48940	2.617000	0.88574	0.655000	0.94253	CCG	ADAMTSL4	-	NULL	ENSG00000143382		0.672	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	HGNC	protein_coding	OTTHUMT00000084395.4	-	0.00	31	0	C	NM_019032		150529724	+1	tier1	-	no_errors	ENST00000369039	ensembl	human	known	74_37	missense	27.27	16	6	SNP	0.510	T
ADRA2A	150	genome.wustl.edu	37	10	112837931	112837931	+	Missense_Mutation	SNP	G	G	T	rs376175216		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:112837931G>T	ENST00000280155.2	+	1	1142	c.177G>T	c.(175-177)atG>atT	p.M59I		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	44					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCCTGCTCATGCTGCTCACCG	0.697																																					Esophageal Squamous(173;605 2658 7278 49362)												0													36.0	33.0	34.0					10																	112837931		2203	4300	6503	SO:0001583	missense	0			AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.177G>T	10.37:g.112837931G>T	ENSP00000280155:p.Met59Ile		B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA2A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam,prints_Musac_Ach_rcpt	p.M59I	ENST00000280155.2	37	c.177	CCDS7569.2	10	.	.	.	.	.	.	.	.	.	.	G	3.193	-0.165370	0.06461	.	.	ENSG00000150594	ENST00000280155	T	0.19105	2.17	4.8	1.92	0.25849	.	0.441211	0.25750	N	0.028548	T	0.06096	0.0158	N	0.03608	-0.345	0.42832	D	0.994025	B	0.02656	0.0	B	0.01281	0.0	T	0.36625	-0.9740	10	0.02654	T	1	.	4.9269	0.13898	0.2351:0.0:0.6184:0.1465	.	44	P08913	ADA2A_HUMAN	I	59	ENSP00000280155:M59I	ENSP00000280155:M59I	M	+	3	0	ADRA2A	112827921	1.000000	0.71417	0.770000	0.31555	0.983000	0.72400	3.470000	0.53100	0.111000	0.17947	0.555000	0.69702	ATG	ADRA2A	-	pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_GPCR_Rhodpsn,prints_Musac_Ach_rcpt	ENSG00000150594		0.697	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRA2A	HGNC	protein_coding	OTTHUMT00000050372.2	-	0.00	61	0	G	NM_000681		112837931	+1	tier1	-	no_errors	ENST00000280155	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	T
ARHGAP31	57514	genome.wustl.edu	37	3	119101244	119101244	+	Silent	SNP	C	C	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:119101244C>G	ENST00000264245.4	+	5	1069	c.537C>G	c.(535-537)ctC>ctG	p.L179L		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	179	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)	p.L179L(1)		breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CAAACCTCCTCAGGTAACCAC	0.557																																					Pancreas(7;176 297 5394 51128 51241)												1	Substitution - coding silent(1)	breast(1)											53.0	62.0	59.0					3																	119101244		1931	4126	6057	SO:0001819	synonymous_variant	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.537C>G	3.37:g.119101244C>G			Q9ULL6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L179	ENST00000264245.4	37	c.537	CCDS43135.1	3																																																																																			ARHGAP31	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000031081		0.557	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	-	0.00	40	0	C			119101244	+1	tier1	-	no_errors	ENST00000264245	ensembl	human	known	74_37	silent	40.43	28	19	SNP	1.000	G
ARID2	196528	genome.wustl.edu	37	12	46230371	46230371	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr12:46230371G>T	ENST00000334344.6	+	7	877		c.e7-1		ARID2_ENST00000444670.1_5'Flank|ARID2_ENST00000422737.1_Splice_Site	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TATCATTACAGTTTTGGAAAG	0.338			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													59.0	61.0	60.0					12																	46230371		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.706-1G>T	12.37:g.46230371G>T			Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Splice_Site	SNP	-	e7-1	ENST00000334344.6	37	c.706-1	CCDS31783.1	12	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432596	0.62844	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5742	0.95434	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARID2	44516638	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	6.620000	0.74224	2.698000	0.92095	0.591000	0.81541	.	ARID2	-	-	ENSG00000189079		0.338	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2		0.00	54	0	G	XM_350875	Intron	46230371	+1			no_errors	ENST00000334344	ensembl	human	known	74_37	splice_site	5.88	31	2	SNP	1.000	T
ARRDC2	27106	genome.wustl.edu	37	19	18119840	18119840	+	Silent	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:18119840C>A	ENST00000222250.4	+	3	545	c.402C>A	c.(400-402)acC>acA	p.T134T	ARRDC2_ENST00000608009.1_3'UTR|ARRDC2_ENST00000379656.3_Silent_p.T129T	NM_015683.1	NP_056498.1	Q8TBH0	ARRD2_HUMAN	arrestin domain containing 2	134					signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)	12						TCAAGGCCACCCTGCACCGGC	0.617																																																	0													61.0	56.0	58.0					19																	18119840		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS12370.1, CCDS32956.1	19p13.12	2008-02-05				ENSG00000105643			25225	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015683		Approved	CLONE24945, PP2703	uc002nhv.3	Q8TBH0		ENST00000222250.4:c.402C>A	19.37:g.18119840C>A			B2RBG9|O95895|Q6ZRV9|Q8WYG6	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.T134	ENST00000222250.4	37	c.402	CCDS12370.1	19																																																																																			ARRDC2	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000105643		0.617	ARRDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC2	HGNC	protein_coding	OTTHUMT00000466845.1	-	0.00	79	0	C	NM_015683		18119840	+1	tier1	-	no_errors	ENST00000222250	ensembl	human	known	74_37	silent	45.76	31	27	SNP	0.998	A
ATF4	468	genome.wustl.edu	37	22	39917608	39917609	+	Frame_Shift_Ins	INS	-	-	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr22:39917608_39917609insG	ENST00000337304.2	+	1	1040_1041	c.158_159insG	c.(157-162)aaggctfs	p.A54fs	ATF4_ENST00000404241.2_Frame_Shift_Ins_p.A54fs|ATF4_ENST00000396680.1_Frame_Shift_Ins_p.A54fs	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	54					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TCCAGCGACAAGGCTAAGGCGG	0.579																																																	0																																										SO:0001589	frameshift_variant	0			D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.160dupG	22.37:g.39917610_39917610dupG	ENSP00000336790:p.Ala54fs		Q9UH31	Frame_Shift_Ins	INS	pfam_bZIP,smart_bZIP,pfscan_bZIP	p.A54fs	ENST00000337304.2	37	c.158_159	CCDS13996.1	22																																																																																			ATF4	-	NULL	ENSG00000128272		0.579	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATF4	HGNC	protein_coding	OTTHUMT00000321305.1		0.00	33	0	-	NM_001675		39917609	+1	tier1		no_errors	ENST00000337304	ensembl	human	known	74_37	frame_shift_ins	16.67	20	4	INS	1.000:1.000	G
BTN3A3	10384	genome.wustl.edu	37	6	26452349	26452349	+	Missense_Mutation	SNP	G	G	T	rs147058580	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:26452349G>T	ENST00000244519.2	+	11	1708	c.1465G>T	c.(1465-1467)Gcc>Tcc	p.A489S	BTN3A3_ENST00000339789.4_Missense_Mutation_p.A447S|BTN3A3_ENST00000361232.3_Missense_Mutation_p.A440S	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	489	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.A489S(1)		cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						CTTTCCGCACGCCTCTTTCTC	0.478																																																	1	Substitution - Missense(1)	liver(1)											122.0	112.0	116.0					6																	26452349		2203	4300	6503	SO:0001583	missense	0			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1465G>T	6.37:g.26452349G>T	ENSP00000244519:p.Ala489Ser		B4DWI7|E9PCP5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.A489S	ENST00000244519.2	37	c.1465	CCDS4611.1	6	.	.	.	.	.	.	.	.	.	.	G	8.368	0.834576	0.16820	.	.	ENSG00000111801	ENST00000244519;ENST00000339789;ENST00000361232	T;T;T	0.69926	-0.44;-0.44;-0.44	3.11	-6.22	0.02058	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.25680	0.0625	L	0.45744	1.44	0.09310	N	1	B;B	0.28055	0.199;0.079	B;B	0.26969	0.075;0.074	T	0.16630	-1.0396	9	0.10377	T	0.69	.	8.1981	0.31409	0.2499:0.0:0.6113:0.1388	.	440;489	E9PCP5;O00478	.;BT3A3_HUMAN	S	489;447;440	ENSP00000244519:A489S;ENSP00000344968:A447S;ENSP00000355238:A440S	ENSP00000244519:A489S	A	+	1	0	BTN3A3	26560328	0.000000	0.05858	0.000000	0.03702	0.107000	0.19398	-2.124000	0.01318	-1.669000	0.01470	-0.637000	0.03976	GCC	BTN3A3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000111801		0.478	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2		0.00	80	0	G	NM_006994		26452349	+1			no_errors	ENST00000244519	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.000	T
C11orf95	65998	genome.wustl.edu	37	11	63531137	63531137	+	lincRNA	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr11:63531137C>A	ENST00000433688.1	-	0	1808							C9JLR9	CK095_HUMAN	chromosome 11 open reading frame 95																		CAGGCCGCGCCGGCTGCCGTC	0.721																																																	0													13.0	20.0	18.0					11																	63531137		691	1585	2276			0			BC000572, AK096306		11q13	2011-11-24			ENSG00000188070	ENSG00000188070			28449	protein-coding gene	gene with protein product		615699				20607705	Standard	NM_001144936		Approved	MGC3032	uc010rmv.2	C9JLR9			11.37:g.63531137C>A			A6NLS7|Q3C1V4	RNA	SNP	-	NULL	ENST00000433688.1	37	NULL		11																																																																																			C11orf95	-	-	ENSG00000188070		0.721	C11orf95-201	KNOWN	basic	lincRNA	C11orf95	HGNC	lincRNA		-	0.00	47	0	C	NM_001144936		63531137	-1	tier1	-	no_errors	ENST00000433688	ensembl	human	known	74_37	rna	58.00	21	29	SNP	1.000	A
C1orf87	127795	genome.wustl.edu	37	1	60503712	60503712	+	Missense_Mutation	SNP	G	G	T	rs372981563|rs144642485		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:60503712G>T	ENST00000371201.3	-	6	922	c.815C>A	c.(814-816)gCa>gAa	p.A272E	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	272							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GTCTGCAGCTGCTTTATTTTG	0.388																																					NSCLC(75;811 1386 4923 13371 51772)												0													106.0	93.0	97.0					1																	60503712		2203	4300	6503	SO:0001583	missense	0			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.815C>A	1.37:g.60503712G>T	ENSP00000360244:p.Ala272Glu		Q6ZU07|Q8IVS0	Missense_Mutation	SNP	NULL	p.A272E	ENST00000371201.3	37	c.815	CCDS614.1	1	.	.	.	.	.	.	.	.	.	.	G	7.304	0.613575	0.14066	.	.	ENSG00000162598	ENST00000371201	T	0.17370	2.28	5.65	1.7	0.24286	.	0.782790	0.11876	N	0.520950	T	0.08714	0.0216	N	0.22421	0.69	0.09310	N	1	B	0.28933	0.228	B	0.24394	0.053	T	0.39187	-0.9626	10	0.08599	T	0.76	0.9431	6.5894	0.22638	0.0828:0.1642:0.6435:0.1096	.	272	Q8N0U7	CA087_HUMAN	E	272	ENSP00000360244:A272E	ENSP00000360244:A272E	A	-	2	0	C1orf87	60276300	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.093000	0.15086	0.170000	0.19704	0.655000	0.94253	GCA	C1orf87	-	NULL	ENSG00000162598		0.388	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	HGNC	protein_coding	OTTHUMT00000024943.1		0.00	55	0	G	NM_152377		60503712	-1			no_errors	ENST00000371201	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.000	T
CALM3	808	genome.wustl.edu	37	19	47112431	47112431	+	3'UTR	SNP	G	G	A	rs2229577	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:47112431G>A	ENST00000291295.9	+	0	670				CALM3_ENST00000597743.1_3'UTR|CALM3_ENST00000391918.2_3'UTR|CALM3_ENST00000477244.1_3'UTR|CALM3_ENST00000599839.1_3'UTR|CALM3_ENST00000598871.1_3'UTR|CTB-12A17.3_ENST00000597609.1_RNA|CALM3_ENST00000596362.1_3'UTR|CALM3_ENST00000594523.1_3'UTR	NM_005184.2	NP_005175.2	P62158	CALM_HUMAN	calmodulin 3 (phosphorylase kinase, delta)						activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			breast(1)|cervix(2)|endometrium(1)|lung(1)|ovary(1)	6		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000683)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0341)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	GGCAGCTGGCGATGCCCGTTC	0.567																																																	0													51.0	47.0	48.0					19																	47112431		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS33061.1	19q13.2-q13.3	2013-02-25			ENSG00000160014	ENSG00000160014		"""EF-hand domain containing"", ""Endogenous ligands"""	1449	protein-coding gene	gene with protein product	"""prepro-calmodulin 3"""	114183					Standard	NM_005184		Approved	PHKD	uc002pew.3	P62158	OTTHUMG00000133517	ENST00000291295.9:c.*21G>A	19.37:g.47112431G>A			P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	RNA	SNP	-	NULL	ENST00000291295.9	37	NULL	CCDS33061.1	19																																																																																			CALM3	-	-	ENSG00000160014		0.567	CALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALM3	HGNC	protein_coding	OTTHUMT00000257483.2	-	0.00	54	0	G			47112431	+1	tier1	-	no_errors	ENST00000477244	ensembl	human	known	74_37	rna	15.69	43	8	SNP	0.793	A
CASP2	835	genome.wustl.edu	37	7	142997478	142997478	+	Intron	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr7:142997478A>G	ENST00000310447.5	+	8	1208				CASP2_ENST00000493642.1_3'UTR|RN7SL481P_ENST00000477764.2_RNA	NM_032982.3|NM_032983.3	NP_116764.2|NP_116765.2	P42575	CASP2_HUMAN	caspase 2, apoptosis-related cysteine peptidase						aging (GO:0007568)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|cellular response to mechanical stimulus (GO:0071260)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|ectopic germ cell programmed cell death (GO:0035234)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|luteolysis (GO:0001554)|neural retina development (GO:0003407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron apoptotic process (GO:0043525)|protein processing (GO:0016485)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(164;0.059)					CTCAGGTGCTATTGGATCCCT	0.607																																																	0													49.0	47.0	47.0					7																	142997478		876	1991	2867	SO:0001627	intron_variant	0			AK096245, BC002427, BM998653, BX537669, CB988674, U13021	CCDS5879.1, CCDS47733.1	7q34-q35	2014-01-20	2008-08-01		ENSG00000106144	ENSG00000106144		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1503	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 57"""	600639	"""neural precursor cell expressed, developmentally down-regulated 2"""	NEDD2		7789948, 8780721	Standard	NM_032982		Approved	ICH1, PPP1R57, MGC2181	uc003wco.3	P42575	OTTHUMG00000023641	ENST00000310447.5:c.967+91A>G	7.37:g.142997478A>G			A8K5F9|D3DXD6|E9PDN0|P42576|Q59F21|Q7KZL6|Q86UJ3|Q9BUP7|Q9BZK9|Q9BZL0	RNA	SNP	-	NULL	ENST00000310447.5	37	NULL	CCDS5879.1	7	.	.	.	.	.	.	.	.	.	.	A	27.6	4.845785	0.91197	.	.	ENSG00000106144	ENST00000392923	.	.	.	5.22	4.05	0.47172	.	.	.	.	.	T	0.50274	0.1606	L	0.28556	0.865	0.80722	D	1	.	.	.	.	.	.	T	0.40627	-0.9553	6	0.30078	T	0.28	.	10.4829	0.44704	0.8552:0.0:0.0:0.1448	.	.	.	.	V	295	.	ENSP00000376654:I295V	I	+	1	0	CASP2	142707600	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.053000	0.57427	0.922000	0.37019	0.524000	0.50904	ATT	CASP2	-	-	ENSG00000106144		0.607	CASP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP2	HGNC	protein_coding	OTTHUMT00000059962.3	-	0.00	48	0	A	NM_032982		142997478	+1	tier1	-	no_errors	ENST00000493642	ensembl	human	known	74_37	rna	68.75	10	22	SNP	1.000	G
CATSPERG	57828	genome.wustl.edu	37	19	38837227	38837227	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:38837227G>T	ENST00000409235.3	+	7	922	c.807G>T	c.(805-807)aaG>aaT	p.K269N	CATSPERG_ENST00000410018.1_Missense_Mutation_p.K269N|CATSPERG_ENST00000215069.4_Missense_Mutation_p.K254N|snoU13_ENST00000459333.1_RNA|CATSPERG_ENST00000467739.1_3'UTR	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	269					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						CCAGCTTCAAGGACTTCTCTC	0.597																																																	0													130.0	112.0	117.0					19																	38837227		692	1591	2283	SO:0001583	missense	0			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.807G>T	19.37:g.38837227G>T	ENSP00000386962:p.Lys269Asn		A6NEG6|Q659E1	Missense_Mutation	SNP	NULL	p.K269N	ENST00000409235.3	37	c.807	CCDS12514.2	19	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923794	0.34002	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410;ENST00000215069	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	5.63	0.814	0.18756	.	1.563450	0.03425	N	0.206959	T	0.26629	0.0651	L	0.47716	1.5	0.09310	N	1	B;P	0.37276	0.358;0.589	B;B	0.36608	0.215;0.229	T	0.18587	-1.0332	10	0.44086	T	0.13	-1.7973	2.6594	0.05021	0.1646:0.1445:0.5419:0.149	.	269;269	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	N	269;269;269;254	ENSP00000387057:K269N;ENSP00000386962:K269N;ENSP00000386950:K269N;ENSP00000215069:K254N	ENSP00000215069:K254N	K	+	3	2	CATSPERG	43529067	0.165000	0.22948	0.001000	0.08648	0.278000	0.26855	0.212000	0.17497	0.310000	0.22990	0.491000	0.48974	AAG	CATSPERG	-	NULL	ENSG00000099338		0.597	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPERG	HGNC	protein_coding	OTTHUMT00000330204.1	-	0.00	62	0	G	NM_021185		38837227	+1	tier1	-	no_errors	ENST00000409235	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.002	T
CCSER1	401145	genome.wustl.edu	37	4	91230145	91230145	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr4:91230145G>T	ENST00000509176.1	+	2	998	c.710G>T	c.(709-711)cGg>cTg	p.R237L	CCSER1_ENST00000432775.2_Missense_Mutation_p.R237L|CCSER1_ENST00000333691.8_Missense_Mutation_p.R237L	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	237																	GTAACAGAACGGGCAGGAAGC	0.428																																																	0													68.0	65.0	66.0					4																	91230145		1873	4108	5981	SO:0001583	missense	0				CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.710G>T	4.37:g.91230145G>T	ENSP00000425040:p.Arg237Leu		Q4W5M0|Q86V57	Missense_Mutation	SNP	NULL	p.R237L	ENST00000509176.1	37	c.710	CCDS47099.1	4	.	.	.	.	.	.	.	.	.	.	G	10.52	1.371897	0.24857	.	.	ENSG00000184305	ENST00000509176;ENST00000432775;ENST00000333691;ENST00000458365	T;T;T	0.42513	1.52;0.97;1.52	4.94	-0.309	0.12769	.	0.949186	0.08770	N	0.896393	T	0.26011	0.0634	L	0.40543	1.245	0.09310	N	1	B;B;B	0.31193	0.312;0.003;0.015	B;B;B	0.22753	0.041;0.002;0.003	T	0.19582	-1.0301	10	0.40728	T	0.16	0.2409	1.4476	0.02367	0.2062:0.1216:0.4218:0.2504	.	237;237;237	Q9C0I3-2;Q9C0I3;E7EUW0	.;F190A_HUMAN;.	L	237	ENSP00000425040:R237L;ENSP00000389283:R237L;ENSP00000329482:R237L	ENSP00000329482:R237L	R	+	2	0	FAM190A	91449168	0.084000	0.21492	0.308000	0.25141	0.977000	0.68977	1.554000	0.36266	-0.210000	0.10140	0.655000	0.94253	CGG	CCSER1	-	NULL	ENSG00000184305		0.428	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER1	HGNC	protein_coding	OTTHUMT00000363109.3	-	0.00	35	0	G	NM_001145065		91230145	+1	tier1	-	no_errors	ENST00000333691	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.026	T
CDH13	1012	genome.wustl.edu	37	16	83711879	83711879	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr16:83711879G>A	ENST00000566620.1	+	10	1641	c.1351G>A	c.(1351-1353)Gta>Ata	p.V451I	CDH13_ENST00000268613.10_Missense_Mutation_p.V498I|CDH13_ENST00000428848.3_Missense_Mutation_p.V412I	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	451	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AGACCCACTCGTACCCGACGT	0.547																																																	0													76.0	83.0	80.0					16																	83711879		2066	4193	6259	SO:0001583	missense	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1351G>A	16.37:g.83711879G>A	ENSP00000454435:p.Val451Ile		A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V451I	ENST00000566620.1	37	c.1351	CCDS58486.1	16	.	.	.	.	.	.	.	.	.	.	G	9.916	1.210750	0.22289	.	.	ENSG00000140945	ENST00000268613;ENST00000428848;ENST00000536143;ENST00000538855;ENST00000540531	T	0.58506	0.33	4.88	4.88	0.63580	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.36936	0.0985	N	0.17723	0.515	0.80722	D	1	B;B;B	0.24721	0.012;0.11;0.06	B;B;B	0.18871	0.006;0.022;0.023	T	0.21895	-1.0232	9	0.23302	T	0.38	.	7.135	0.25523	0.1934:0.0:0.8066:0.0	.	412;498;451	B7Z590;B7Z9B1;P55290	.;.;CAD13_HUMAN	I	498;451;412;153;141	ENSP00000268613:V498I	ENSP00000268613:V498I	V	+	1	0	CDH13	82269380	1.000000	0.71417	0.978000	0.43139	0.592000	0.36648	2.787000	0.47798	2.265000	0.75225	0.591000	0.81541	GTA	CDH13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000140945		0.547	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH13	HGNC	protein_coding	OTTHUMT00000432917.1	-	0.00	76	0	G	NM_001257		83711879	+1	tier1	-	no_errors	ENST00000566620	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	A
CDKN2A	1029	genome.wustl.edu	37	9	21994151	21994151	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr9:21994151delA	ENST00000579755.1	-	1	472	c.180delT	c.(178-180)cttfs	p.L60fs	CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000470819.2_Intron|CDKN2B-AS1_ENST00000468603.2_RNA|CDKN2B-AS1_ENST00000584637.1_RNA|CDKN2B-AS1_ENST00000584020.1_RNA|RP11-149I2.4_ENST00000578935.1_RNA|CDKN2B-AS1_ENST00000582072.1_RNA|CDKN2B-AS1_ENST00000577551.1_RNA|CDKN2B-AS1_ENST00000585267.1_RNA|CDKN2B-AS1_ENST00000580467.1_RNA|CDKN2B-AS1_ENST00000584351.1_RNA|CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.L101fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2B-AS1_ENST00000582301.1_RNA|CDKN2B-AS1_ENST00000580576.1_RNA|CDKN2B-AS1_ENST00000584816.1_RNA|CDKN2B-AS1_ENST00000583719.1_RNA|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.L60fs|CDKN2B-AS1_ENST00000581051.1_RNA|CDKN2B-AS1_ENST00000428597.1_RNA|CDKN2B-AS1_ENST00000455933.2_RNA			P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	0			A -> T.|A -> V (in melanoma; loss of CDK4 binding; dbSNP:rs36204594).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(198)|p.0(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GTCTTCTAGGAAGCGGCTGCT	0.612		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							199	Whole gene deletion(199)	haematopoietic_and_lymphoid_tissue(34)|central_nervous_system(31)|lung(31)|skin(16)|kidney(14)|oesophagus(11)|bone(10)|pancreas(10)|urinary_tract(7)|breast(6)|soft_tissue(5)|thyroid(4)|pleura(4)|large_intestine(3)|stomach(3)|liver(3)|ovary(3)|upper_aerodigestive_tract(1)|vulva(1)|biliary_tract(1)|autonomic_ganglia(1)											13.0	15.0	14.0					9																	21994151		2180	4246	6426	SO:0001589	frameshift_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000579755.1:c.180delT	9.37:g.21994151delA	ENSP00000462950:p.Leu60fs		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	pfam_Cyclin_kinase-Inhib_2A	p.P102fs	ENST00000579755.1	37	c.303	CCDS6511.2	9																																																																																			CDKN2A	-	NULL	ENSG00000147889		0.612	CDKN2A-004	KNOWN	NMD_exception|upstream_ATG|basic|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051918.5		0.00	117	0	A	NM_000077		21994151	-1	tier1		no_errors	ENST00000361570	ensembl	human	known	74_37	frame_shift_del	12.50	14	2	DEL	0.976	-
CECR2	27443	genome.wustl.edu	37	22	18003287	18003287	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr22:18003287G>T	ENST00000400585.2	+	9	1047	c.609G>T	c.(607-609)aaG>aaT	p.K203N	CECR2_ENST00000342247.5_Missense_Mutation_p.K296N|CECR2_ENST00000262608.8_Missense_Mutation_p.K325N|CECR2_ENST00000400573.5_Missense_Mutation_p.K344N			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	366					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		AGAAGGTCAAGGCAGTGGAAG	0.542																																																	0													92.0	102.0	99.0					22																	18003287		2175	4261	6436	SO:0001583	missense	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.609G>T	22.37:g.18003287G>T	ENSP00000383428:p.Lys203Asn		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.K344N	ENST00000400585.2	37	c.1032		22	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721866	0.68959	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.32988	1.91;1.68;1.69;1.43	5.84	2.02	0.26589	.	0.000000	0.53938	D	0.000057	T	0.46171	0.1379	M	0.62723	1.935	0.41418	D	0.987785	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.994;0.994;0.996;0.994	T	0.36187	-0.9758	10	0.54805	T	0.06	-34.4168	7.0517	0.25077	0.4762:0.0:0.5238:0.0	.	366;203;338;344	Q9BXF3;B7WPH3;Q9BXF3-2;E2QRE6	CECR2_HUMAN;.;.;.	N	296;203;344;325	ENSP00000341219:K296N;ENSP00000383428:K203N;ENSP00000383417:K344N;ENSP00000262608:K325N	ENSP00000262608:K325N	K	+	3	2	CECR2	16383287	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.729000	0.38115	0.627000	0.30340	-0.145000	0.13849	AAG	CECR2	-	NULL	ENSG00000099954		0.542	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	-	0.00	59	0	G	NM_031413		18003287	+1	tier1	-	no_errors	ENST00000400573	ensembl	human	novel	74_37	missense	67.86	9	19	SNP	1.000	T
CEP192	55125	genome.wustl.edu	37	18	13015442	13015442	+	5'UTR	SNP	C	C	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr18:13015442C>G	ENST00000325971.8	+	0	715				CEP192_ENST00000506447.1_Missense_Mutation_p.S212C			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa						centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TTGGAAGATTCTTCTGGTACT	0.403																																																	0													145.0	112.0	122.0					18																	13015442		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.-879C>G	18.37:g.13015442C>G			A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.S212C	ENST00000325971.8	37	c.635		18	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619465	0.46736	.	.	ENSG00000101639	ENST00000506447	T	0.09073	3.02	4.6	4.6	0.57074	.	.	.	.	.	T	0.18425	0.0442	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00485	-1.1711	9	0.66056	D	0.02	.	13.1207	0.59325	0.0:1.0:0.0:0.0	.	212	E9PF99	.	C	212	ENSP00000427550:S212C	ENSP00000427550:S212C	S	+	2	0	CEP192	13005442	0.044000	0.20184	0.986000	0.45419	0.319000	0.28217	0.539000	0.23175	2.544000	0.85801	0.563000	0.77884	TCT	CEP192	-	NULL	ENSG00000101639		0.403	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		-	0.00	38	0	C	NM_032142		13015442	+1	tier1	-	no_errors	ENST00000506447	ensembl	human	known	74_37	missense	57.89	8	11	SNP	0.995	G
CIRH1A	84916	genome.wustl.edu	37	16	69173784	69173785	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr16:69173784_69173785insT	ENST00000314423.7	+	5	670_671	c.493_494insT	c.(493-495)atafs	p.I165fs	CIRH1A_ENST00000563094.1_Frame_Shift_Ins_p.I165fs|CIRH1A_ENST00000352319.4_Frame_Shift_Ins_p.I165fs			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	165					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		AGCTGGTTCCATAGACTACATT	0.411																																					Melanoma(69;1156 1278 4951 8715 52012)												0																																										SO:0001589	frameshift_variant	0			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.494dupT	16.37:g.69173785_69173785dupT	ENSP00000327179:p.Ile165fs		Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.D166fs	ENST00000314423.7	37	c.493_494	CCDS10872.1	16																																																																																			CIRH1A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000141076		0.411	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2		0.00	115	0	-	NM_032830		69173785	+1	tier1		no_errors	ENST00000314423	ensembl	human	known	74_37	frame_shift_ins	21.43	33	9	INS	1.000:1.000	T
CHST5	23563	genome.wustl.edu	37	16	75563364	75563364	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr16:75563364G>A	ENST00000336257.3	-	3	2313	c.919C>T	c.(919-921)Cgc>Tgc	p.R307C	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Missense_Mutation_p.R313C	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	307					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						TAGAGTGCGCGGATCTCTGCC	0.697																																																	0													55.0	59.0	58.0					16																	75563364		2194	4296	6490	SO:0001583	missense	0			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.919C>T	16.37:g.75563364G>A	ENSP00000338783:p.Arg307Cys		B2RV23|Q7LCN3|Q9UBY3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.R313C	ENST00000336257.3	37	c.937	CCDS10919.1	16	.	.	.	.	.	.	.	.	.	.	G	6.298	0.423051	0.11928	.	.	ENSG00000135702	ENST00000336257;ENST00000541075	T;T	0.26810	1.71;1.71	2.84	1.86	0.25419	Sulfotransferase domain (1);	0.828220	0.11181	N	0.590974	T	0.42630	0.1211	M	0.68317	2.08	0.23293	N	0.997967	D;D	0.69078	0.996;0.997	P;D	0.65443	0.894;0.935	T	0.18967	-1.0320	10	0.72032	D	0.01	.	5.6375	0.17544	0.1087:0.0:0.5524:0.3389	.	313;307	Q9GZS9-2;Q9GZS9	.;CHST5_HUMAN	C	307;313	ENSP00000338783:R307C;ENSP00000441220:R313C	ENSP00000338783:R307C	R	-	1	0	CHST5	74120865	0.246000	0.23909	0.421000	0.26609	0.100000	0.18952	0.367000	0.20382	0.082000	0.17018	-2.281000	0.00270	CGC	CHST5	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000135702		0.697	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST5	HGNC	protein_coding	OTTHUMT00000269025.2	-	0.00	46	0	G	NM_012126		75563364	-1	tier1	-	no_errors	ENST00000541075	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.016	A
CLASRP	11129	genome.wustl.edu	37	19	45567607	45567609	+	In_Frame_Del	DEL	CTC	CTC	-	rs559550271		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:45567607_45567609delCTC	ENST00000221455.3	+	13	1226_1228	c.1128_1130delCTC	c.(1126-1131)cgctcc>cgc	p.S385del	CLASRP_ENST00000544944.2_In_Frame_Del_p.S385del|CLASRP_ENST00000391953.4_In_Frame_Del_p.S323del	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	385	Arg-rich.|Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GCAGCCGCCGctcctcctcctcc	0.744																																																	0										8,94,3280		1,0,6,8,78,1598						4.4	1.0			5	17,209,6522		2,0,13,25,159,3175	no	codingComplex	CLASRP	NM_007056.2		3,0,19,33,237,4773	A1A1,A1A2,A1R,A2A2,A2R,RR		3.3491,3.016,3.2379				25,303,9802				SO:0001651	inframe_deletion	0			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1128_1130delCTC	19.37:g.45567616_45567618delCTC	ENSP00000221455:p.Ser385del		B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	In_Frame_Del	DEL	pfam_SWAP_N_domain	p.S380in_frame_del	ENST00000221455.3	37	c.1128_1130	CCDS12652.2	19																																																																																			CLASRP	-	NULL	ENSG00000104859		0.744	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLASRP	HGNC	protein_coding	OTTHUMT00000316749.1		0.00	17	0	CTC	NM_007056		45567609	+1			no_errors	ENST00000221455	ensembl	human	known	74_37	in_frame_del	18.18	9	2	DEL	1.000:1.000:1.000	0
CLEC4D	338339	genome.wustl.edu	37	12	8673805	8673805	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr12:8673805G>T	ENST00000299665.2	+	6	779	c.586G>T	c.(586-588)Gat>Tat	p.D196Y		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	196	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					GGCCTGGAATGATGTTCCTTG	0.378																																																	0													131.0	125.0	127.0					12																	8673805		2203	4300	6503	SO:0001583	missense	0			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.586G>T	12.37:g.8673805G>T	ENSP00000299665:p.Asp196Tyr		Q8N5J5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.D196Y	ENST00000299665.2	37	c.586	CCDS8593.1	12	.	.	.	.	.	.	.	.	.	.	G	8.103	0.776999	0.16120	.	.	ENSG00000166527	ENST00000299665	T	0.24538	1.85	4.22	-0.806	0.10875	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.41050	0.1142	H	0.98721	4.31	0.09310	N	0.999999	P	0.35033	0.481	B	0.31946	0.138	T	0.48790	-0.9004	9	0.87932	D	0	.	3.5417	0.07814	0.3882:0.0:0.4402:0.1716	.	196	Q8WXI8	CLC4D_HUMAN	Y	196	ENSP00000299665:D196Y	ENSP00000299665:D196Y	D	+	1	0	CLEC4D	8565072	0.020000	0.18652	0.001000	0.08648	0.098000	0.18820	-0.114000	0.10757	-0.155000	0.11098	-1.000000	0.02509	GAT	CLEC4D	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	ENSG00000166527		0.378	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4D	HGNC	protein_coding	OTTHUMT00000400565.1		0.00	28	0	G	NM_080387		8673805	+1			no_errors	ENST00000299665	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.001	T
CNOT1	23019	genome.wustl.edu	37	16	58615277	58615277	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr16:58615277T>C	ENST00000317147.5	-	11	1519	c.1187A>G	c.(1186-1188)tAt>tGt	p.Y396C	CNOT1_ENST00000569240.1_Missense_Mutation_p.Y396C|CNOT1_ENST00000441024.2_Missense_Mutation_p.Y396C	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	396					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CCAAGGTCTATATATGAGGTC	0.413																																																	0													113.0	104.0	107.0					16																	58615277		2198	4300	6498	SO:0001583	missense	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.1187A>G	16.37:g.58615277T>C	ENSP00000320949:p.Tyr396Cys		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.Y396C	ENST00000317147.5	37	c.1187	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	T	18.33	3.599505	0.66332	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.47869	0.87;0.83	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.66257	0.2771	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.995;0.998;0.999	T	0.65990	-0.6034	9	.	.	.	-3.0954	15.9193	0.79547	0.0:0.0:0.0:1.0	.	396;396;396	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	396	ENSP00000320949:Y396C;ENSP00000413113:Y396C	.	Y	-	2	0	CNOT1	57172778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.968000	0.87980	2.158000	0.67659	0.533000	0.62120	TAT	CNOT1	-	NULL	ENSG00000125107		0.413	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	-	0.00	88	0	T	NM_016284		58615277	-1	tier1	-	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	23.40	36	11	SNP	1.000	C
COLGALT1	79709	genome.wustl.edu	37	19	17692130	17692130	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:17692130C>T	ENST00000252599.4	+	12	1866	c.1746C>T	c.(1744-1746)gtC>gtT	p.V582V		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	582					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)										ATGAGCACGTCAAGACCGACT	0.592																																																	0													143.0	115.0	124.0					19																	17692130		2203	4300	6503	SO:0001819	synonymous_variant	0			AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1746C>T	19.37:g.17692130C>T			Q8NC64	Silent	SNP	pfam_Glyco_trans_25	p.V582	ENST00000252599.4	37	c.1746	CCDS12363.1	19																																																																																			COLGALT1	-	NULL	ENSG00000130309		0.592	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT1	HGNC	protein_coding	OTTHUMT00000464216.1	-	0.00	42	0	C	NM_024656		17692130	+1	tier1	-	no_errors	ENST00000252599	ensembl	human	known	74_37	silent	23.53	26	8	SNP	0.979	T
COX6C	1345	genome.wustl.edu	37	8	100904210	100904210	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:100904210G>A	ENST00000520468.2	-	2	494	c.40C>T	c.(40-42)Ctt>Ttt	p.L14F	COX6C_ENST00000524245.1_Missense_Mutation_p.L14F|COX6C_ENST00000522940.1_Missense_Mutation_p.L14F|COX6C_ENST00000297564.2_Missense_Mutation_p.L14F|COX6C_ENST00000523016.1_Missense_Mutation_p.L14F|COX6C_ENST00000517682.2_Missense_Mutation_p.L14F|COX6C_ENST00000518171.1_Missense_Mutation_p.L14F|COX6C_ENST00000520271.1_Missense_Mutation_p.L14F	NM_004374.3	NP_004365.1	P09669	COX6C_HUMAN	cytochrome c oxidase subunit VIc	14					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)		HMGA2/COX6C(2)	liver(1)|lung(2)	3			all cancers(13;8.32e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			CTGGCCAGAAGGCCACGCATC	0.448			T	HMGA2	uterine leiomyoma																																NSCLC(46;1123 1136 1705 23767 45086)			Dom	yes		8	8q22-q23	1345	cytochrome c oxidase subunit VIc		M	0													122.0	122.0	122.0					8																	100904210		2203	4300	6503	SO:0001583	missense	0			X13238	CCDS6284.1	8q22.2	2011-07-04			ENSG00000164919	ENSG00000164919	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2285	protein-coding gene	gene with protein product		124090				10072584	Standard	NM_004374		Approved		uc003yiy.2	P09669	OTTHUMG00000164703	ENST00000520468.2:c.40C>T	8.37:g.100904210G>A	ENSP00000428895:p.Leu14Phe		B2R4D7	Missense_Mutation	SNP	pfam_COX6C	p.L14F	ENST00000520468.2	37	c.40	CCDS6284.1	8	.	.	.	.	.	.	.	.	.	.	G	19.90	3.912611	0.72983	.	.	ENSG00000164919	ENST00000520468;ENST00000297564;ENST00000520271;ENST00000517682;ENST00000524245;ENST00000522940;ENST00000518171;ENST00000523016	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.73690	0.3619	.	.	.	0.58432	D	0.999993	P	0.46457	0.878	P	0.53988	0.739	T	0.75997	-0.3120	8	0.62326	D	0.03	.	16.3244	0.82970	0.0:0.0:1.0:0.0	.	14	P09669	COX6C_HUMAN	F	14	.	ENSP00000297564:L14F	L	-	1	0	COX6C	100973386	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.710000	0.74670	2.654000	0.90174	0.563000	0.77884	CTT	COX6C	-	pfam_COX6C	ENSG00000164919		0.448	COX6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX6C	HGNC	protein_coding	OTTHUMT00000379834.3	-	0.00	10	0	G	NM_004374		100904210	-1	tier1	-	no_errors	ENST00000297564	ensembl	human	known	74_37	missense	55.56	4	5	SNP	1.000	A
CSF1R	1436	genome.wustl.edu	37	5	149449523	149449523	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr5:149449523C>T	ENST00000286301.3	-	10	1714	c.1423G>A	c.(1423-1425)Gag>Aag	p.E475K	CSF1R_ENST00000515239.1_5'Flank	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	475	Ig-like C2-type 5.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	TCTAAGGTCTCAACAGTCAGC	0.602																																																	0													122.0	115.0	117.0					5																	149449523		2203	4300	6503	SO:0001583	missense	0			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1423G>A	5.37:g.149449523C>T	ENSP00000286301:p.Glu475Lys		B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E475K	ENST00000286301.3	37	c.1423	CCDS4302.1	5	.	.	.	.	.	.	.	.	.	.	C	2.541	-0.306339	0.05458	.	.	ENSG00000182578	ENST00000286301;ENST00000394307	T	0.03181	4.02	5.66	2.74	0.32292	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.837839	0.10415	N	0.677481	T	0.02888	0.0086	N	0.24115	0.695	0.09310	N	1	B;B	0.14805	0.002;0.011	B;B	0.20384	0.029;0.021	T	0.48958	-0.8988	10	0.15952	T	0.53	.	6.853	0.24024	0.0:0.6629:0.1593:0.1778	.	327;475	B4E2Y8;P07333	.;CSF1R_HUMAN	K	475;327	ENSP00000286301:E475K	ENSP00000286301:E475K	E	-	1	0	CSF1R	149429716	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-0.024000	0.12435	0.764000	0.33197	0.455000	0.32223	GAG	CSF1R	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000182578		0.602	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	HGNC	protein_coding	OTTHUMT00000252329.2	-	0.00	59	0	C	NM_005211		149449523	-1	tier1	-	no_errors	ENST00000286301	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.000	T
DCAF16	54876	genome.wustl.edu	37	4	17805701	17805701	+	Missense_Mutation	SNP	T	T	C	rs184417488		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr4:17805701T>C	ENST00000382247.1	-	3	1124	c.64A>G	c.(64-66)Att>Gtt	p.I22V	DCAF16_ENST00000536863.1_Missense_Mutation_p.I22V|DCAF16_ENST00000507768.1_5'Flank	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	22					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						AGGTAACTAATATTTTCTTCT	0.433																																																	0													53.0	56.0	55.0					4																	17805701		2203	4300	6503	SO:0001583	missense	0			AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.64A>G	4.37:g.17805701T>C	ENSP00000371682:p.Ile22Val		B3KPB7	Missense_Mutation	SNP	NULL	p.I22V	ENST00000382247.1	37	c.64	CCDS3423.1	4	.	.	.	.	.	.	.	.	.	.	T	0.026	-1.374173	0.01214	.	.	ENSG00000163257	ENST00000382247;ENST00000536863	T;T	0.28454	1.61;1.61	3.78	-2.72	0.05968	.	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.23476	-1.0187	9	0.87932	D	0	-0.9114	0.8676	0.01207	0.1873:0.1843:0.1598:0.4686	.	22	Q9NXF7	DCA16_HUMAN	V	22	ENSP00000371682:I22V;ENSP00000445736:I22V	ENSP00000371682:I22V	I	-	1	0	DCAF16	17414799	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.593000	0.05740	-0.530000	0.06349	0.459000	0.35465	ATT	DCAF16	-	NULL	ENSG00000163257		0.433	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF16	HGNC	protein_coding	OTTHUMT00000250371.1	-	0.00	28	0	T	NM_017741		17805701	-1	tier1	-	no_errors	ENST00000382247	ensembl	human	known	74_37	missense	56.52	10	13	SNP	0.000	C
DET1	55070	genome.wustl.edu	37	15	89074355	89074355	+	Silent	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr15:89074355A>G	ENST00000268148.8	-	2	727	c.582T>C	c.(580-582)caT>caC	p.H194H	DET1_ENST00000564406.1_Silent_p.H205H|DET1_ENST00000559656.1_5'Flank|DET1_ENST00000444300.1_Silent_p.H205H|DET1_ENST00000558413.1_Intron	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	194						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GGTCAATGATATGGAGGGAAT	0.493																																																	0													59.0	58.0	58.0					15																	89074355		1956	4131	6087	SO:0001819	synonymous_variant	0			BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.582T>C	15.37:g.89074355A>G			B3KNN6|Q2VPC0|Q9NWD5	Silent	SNP	pfam_De-etiolated_protein_1_Det1	p.H205	ENST00000268148.8	37	c.615	CCDS45344.1	15																																																																																			DET1	-	pfam_De-etiolated_protein_1_Det1	ENSG00000140543		0.493	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DET1	HGNC	protein_coding	OTTHUMT00000415442.2	-	0.00	82	0	A	NM_017996		89074355	-1	tier1	-	no_errors	ENST00000444300	ensembl	human	known	74_37	silent	42.19	37	27	SNP	0.838	G
DPCR1	135656	genome.wustl.edu	37	6	30919708	30919708	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:30919708A>G	ENST00000462446.1	+	2	3495	c.3467A>G	c.(3466-3468)cAt>cGt	p.H1156R	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	313						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						ACATTGGCCCATGAGAAGATG	0.473																																																	0													127.0	130.0	129.0					6																	30919708		2203	4300	6503	SO:0001583	missense	0			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3467A>G	6.37:g.30919708A>G	ENSP00000417182:p.His1156Arg		C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	NULL	p.H1156R	ENST00000462446.1	37	c.3467	CCDS4692.2	6	.	.	.	.	.	.	.	.	.	.	A	9.529	1.110419	0.20714	.	.	ENSG00000168631	ENST00000462446	T	0.26373	1.74	3.03	-4.66	0.03329	.	.	.	.	.	T	0.04092	0.0114	N	0.19112	0.55	0.19575	N	0.999963	P	0.52692	0.955	B	0.43478	0.421	T	0.18493	-1.0335	9	0.17832	T	0.49	4.345	4.4594	0.11659	0.2517:0.3813:0.367:0.0	.	1156	E9PEI6	.	R	1156	ENSP00000417182:H1156R	ENSP00000417182:H1156R	H	+	2	0	DPCR1	31027687	0.000000	0.05858	0.000000	0.03702	0.281000	0.26958	-2.357000	0.01086	-0.594000	0.05836	0.368000	0.22195	CAT	DPCR1	-	NULL	ENSG00000168631		0.473	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	HGNC	protein_coding	OTTHUMT00000076173.3	-	0.00	31	0	A	NM_080870		30919708	+1	tier1	-	no_errors	ENST00000462446	ensembl	human	novel	74_37	missense	33.33	6	3	SNP	0.000	G
DSE	29940	genome.wustl.edu	37	6	116747882	116747882	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:116747882A>T	ENST00000331677.3	+	4	1006	c.562A>T	c.(562-564)Atg>Ttg	p.M188L	DSE_ENST00000606265.1_3'UTR|DSE_ENST00000359564.2_Missense_Mutation_p.M188L|DSE_ENST00000452085.3_Missense_Mutation_p.M188L|DSE_ENST00000537543.1_Missense_Mutation_p.M207L			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	188					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		CTCAGGGTATATGTATGAAAC	0.458																																																	0													110.0	98.0	102.0					6																	116747882		2203	4300	6503	SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.562A>T	6.37:g.116747882A>T	ENSP00000332151:p.Met188Leu		Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.M207L	ENST00000331677.3	37	c.619	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	A	22.9	4.351229	0.82132	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.41065	1.01;1.01;1.01;1.01	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.43233	0.1238	L	0.38175	1.15	0.80722	D	1	P;P	0.43024	0.798;0.798	P;P	0.60236	0.871;0.871	T	0.22765	-1.0207	9	.	.	.	-28.0913	16.6093	0.84858	1.0:0.0:0.0:0.0	.	207;188	B7Z765;Q9UL01	.;DSE_HUMAN	L	188;207;188;188	ENSP00000404049:M188L;ENSP00000441152:M207L;ENSP00000332151:M188L;ENSP00000352567:M188L	.	M	+	1	0	DSE	116854575	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.036000	0.70948	2.324000	0.78689	0.533000	0.62120	ATG	DSE	-	superfamily_Chondroitin_lyas	ENSG00000111817		0.458	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	-	0.00	76	0	A	NM_013352		116747882	+1	tier1	-	no_errors	ENST00000537543	ensembl	human	known	74_37	missense	18.18	53	12	SNP	1.000	T
MROH5	389690	genome.wustl.edu	37	8	142445540	142445540	+	RNA	SNP	T	T	C	rs13262445|rs71322135|rs143051012	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:142445540T>C	ENST00000606664.1	+	0	896				MROH5_ENST00000430863.1_RNA																							CAGGCTGGTCTGCCCGCGGCC	0.692													T|||	43	0.00858626	0.028	0.0086	5008	,	,		16026	0.0		0.0	False		,,,				2504	0.0																0																																												0																															8.37:g.142445540T>C				RNA	SNP	-	NULL	ENST00000606664.1	37	NULL		8																																																																																			CTD-3064M3.7	-	-	ENSG00000271959		0.692	CTD-3064M3.7-001	KNOWN	non_canonical_TEC|basic	antisense	ENSG00000271959	Clone_based_vega_gene	antisense	OTTHUMT00000470872.1	-	0.00	22	0	T			142445540	+1	tier1	rs13262445	no_errors	ENST00000606664	ensembl	human	known	74_37	rna	23.81	16	5	SNP	0.000	C
ERMP1	79956	genome.wustl.edu	37	9	5784880	5784880	+	3'UTR	DEL	T	T	-			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr9:5784880delT	ENST00000339450.5	-	0	5068				ERMP1_ENST00000214893.5_5'UTR	NM_024896.2	NP_079172.2	Q7Z2K6	ERMP1_HUMAN	endoplasmic reticulum metallopeptidase 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(2)|kidney(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|skin(1)	20		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00115)|Lung(218;0.111)		CATCTAATTCTGTAGAAAATA	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB058718	CCDS34983.1	9p24	2008-02-05	2007-07-05	2007-07-05	ENSG00000099219	ENSG00000099219			23703	protein-coding gene	gene with protein product	"""Felix-ina"""	611156	"""KIAA1815"""	KIAA1815		11347906	Standard	XM_005251587		Approved	FLJ23309, FXNA	uc003zjm.1	Q7Z2K6	OTTHUMG00000019508	ENST00000339450.5:c.*2264A>-	9.37:g.5784880delT			B2RNA4|B3KSB1|Q8N5T5|Q9H5M1	RNA	DEL	-	NULL	ENST00000339450.5	37	NULL	CCDS34983.1	9																																																																																			ERMP1	-	-	ENSG00000099219		0.284	ERMP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMP1	HGNC	protein_coding	OTTHUMT00000354877.1		0.00	11	0	T	NM_024896		5784880	-1	tier1		no_errors	ENST00000214893	ensembl	human	known	74_37	rna	66.67	2	4	DEL	0.003	-
FAM178A	55719	genome.wustl.edu	37	10	102672870	102672870	+	Start_Codon_SNP	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:102672870G>T	ENST00000238961.4	+	1	545	c.3G>T	c.(1-3)atG>atT	p.M1I	RP11-179B2.2_ENST00000608554.1_RNA|FAM178A_ENST00000370269.3_Start_Codon_SNP_p.M1I|FAM178A_ENST00000370271.3_Start_Codon_SNP_p.M1I|FAM178A_ENST00000609386.1_Start_Codon_SNP_p.M1I	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	1						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											GCGCCGACATGACAAGGCGCT	0.697																																																	0													23.0	26.0	25.0					10																	102672870		2201	4296	6497	SO:0001582	initiator_codon_variant	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.3G>T	10.37:g.102672870G>T	ENSP00000238961:p.Met1Ile		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.M1I	ENST00000238961.4	37	c.3	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	G	29.6	5.023072	0.93462	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.52526	0.66;1.31;1.29	5.25	5.25	0.73442	.	0.159461	0.45606	D	0.000346	T	0.66867	0.2833	.	.	.	0.21719	N	0.999577	P;P;D	0.61080	0.954;0.954;0.989	D;D;D	0.72982	0.943;0.943;0.979	T	0.60757	-0.7200	9	0.87932	D	0	-16.5542	14.5433	0.68011	0.0:0.0:1.0:0.0	.	1;1;1	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	I	1	ENSP00000359294:M1I;ENSP00000238961:M1I;ENSP00000359292:M1I	ENSP00000238961:M1I	M	+	3	0	FAM178A	102662860	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.007000	0.49536	2.894000	0.99253	0.591000	0.81541	ATG	FAM178A	-	NULL	ENSG00000119906		0.697	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3		0.00	44	0	G		Missense_Mutation	102672870	+1			no_errors	ENST00000370269	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	T
FAM230B	642633	genome.wustl.edu	37	22	21537734	21537734	+	RNA	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr22:21537734A>T	ENST00000451257.1	+	0	720									family with sequence similarity 230, member B (non-protein coding)																		GCCAGCGAGGACGCCGCCCAC	0.716																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21537734A>T				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.716	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	-	0.00	69	0	A	NR_108107		21537734	+1	tier1	-	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	9.68	28	3	SNP	0.114	T
FILIP1	27145	genome.wustl.edu	37	6	76024322	76024322	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:76024322T>C	ENST00000237172.7	-	5	1556	c.1226A>G	c.(1225-1227)aAg>aGg	p.K409R	FILIP1_ENST00000393004.2_Missense_Mutation_p.K409R|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Missense_Mutation_p.K310R	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	409										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TTGCAGCTTCTTCCTCAATTC	0.418																																																	0													170.0	168.0	168.0					6																	76024322		2203	4300	6503	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1226A>G	6.37:g.76024322T>C	ENSP00000237172:p.Lys409Arg		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.K409R	ENST00000237172.7	37	c.1226	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	T	10.20	1.283750	0.23392	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.18657	2.2;2.2;2.21	5.65	5.65	0.86999	.	0.048629	0.85682	D	0.000000	T	0.08223	0.0205	L	0.27053	0.805	0.52099	D	0.999944	B;B;B	0.26635	0.155;0.014;0.023	B;B;B	0.24394	0.019;0.024;0.053	T	0.11767	-1.0574	10	0.30078	T	0.28	-32.6521	16.1778	0.81874	0.0:0.0:0.0:1.0	.	409;409;409	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	R	409;409;310	ENSP00000376728:K409R;ENSP00000237172:K409R;ENSP00000359037:K310R	ENSP00000237172:K409R	K	-	2	0	FILIP1	76081042	1.000000	0.71417	1.000000	0.80357	0.430000	0.31655	5.095000	0.64529	2.279000	0.76181	0.533000	0.62120	AAG	FILIP1	-	NULL	ENSG00000118407		0.418	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	-	0.00	78	0	T	XM_029179		76024322	-1	tier1	-	no_errors	ENST00000237172	ensembl	human	known	74_37	missense	16.36	45	9	SNP	1.000	C
FLG	2312	genome.wustl.edu	37	1	152279527	152279527	+	Missense_Mutation	SNP	T	T	C	rs200423945	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:152279527T>C	ENST00000368799.1	-	3	7870	c.7835A>G	c.(7834-7836)gAc>gGc	p.D2612G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2612	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCAGCTCTGTCTTCTTGATG	0.552									Ichthyosis																																								0													31.0	36.0	34.0					1																	152279527		2188	4271	6459	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7835A>G	1.37:g.152279527T>C	ENSP00000357789:p.Asp2612Gly		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.D2612G	ENST00000368799.1	37	c.7835	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	6.277	0.419155	0.11870	.	.	ENSG00000143631	ENST00000368799	T	0.01685	4.69	1.54	0.239	0.15484	.	.	.	.	.	T	0.00608	0.0020	M	0.70595	2.14	0.09310	N	1	P	0.51933	0.949	B	0.37304	0.246	T	0.43294	-0.9400	9	0.11485	T	0.65	.	3.7345	0.08506	0.3321:0.0:0.0:0.6679	.	2612	P20930	FILA_HUMAN	G	2612	ENSP00000357789:D2612G	ENSP00000357789:D2612G	D	-	2	0	FLG	150546151	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.023000	0.13533	0.040000	0.15660	0.254000	0.18369	GAC	FLG	-	NULL	ENSG00000143631		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	51	0	T	NM_002016		152279527	-1	tier1	rs200423945	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.000	C
FOXJ2	55810	genome.wustl.edu	37	12	8196342	8196342	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr12:8196342A>G	ENST00000162391.3	+	4	1599	c.454A>G	c.(454-456)Aga>Gga	p.R152G	FOXJ2_ENST00000428177.2_Missense_Mutation_p.R152G	NM_018416.2	NP_060886.1	Q9P0K8	FOXJ2_HUMAN	forkhead box J2	152					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|large_intestine(2)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	16				Kidney(36;0.0944)		TTCCCGAAAGAGAAGACACCC	0.488																																																	0													173.0	167.0	169.0					12																	8196342		2203	4300	6503	SO:0001583	missense	0			AF155132	CCDS8587.1	12p13.31	2006-12-15				ENSG00000065970		"""Forkhead boxes"""	24818	protein-coding gene	gene with protein product						10777590, 10966786	Standard	NM_018416		Approved	FHX	uc001qtu.3	Q9P0K8		ENST00000162391.3:c.454A>G	12.37:g.8196342A>G	ENSP00000162391:p.Arg152Gly		A0AVK4|B2RMP3|Q96PS9|Q9NSN5	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R152G	ENST00000162391.3	37	c.454	CCDS8587.1	12	.	.	.	.	.	.	.	.	.	.	A	20.4	3.983360	0.74474	.	.	ENSG00000065970	ENST00000162391;ENST00000428177	D;D	0.95949	-3.64;-3.86	5.05	5.05	0.67936	Transcription factor, fork head (1);	0.157695	0.44483	N	0.000443	D	0.89887	0.6845	N	0.17082	0.46	0.44798	D	0.997808	B;B	0.29085	0.094;0.232	B;B	0.30495	0.116;0.085	D	0.87358	0.2342	10	0.33141	T	0.24	.	11.2169	0.48831	1.0:0.0:0.0:0.0	.	152;152	Q9P0K8;Q9P0K8-2	FOXJ2_HUMAN;.	G	152	ENSP00000162391:R152G;ENSP00000403411:R152G	ENSP00000162391:R152G	R	+	1	2	FOXJ2	8087609	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.019000	0.76412	1.902000	0.55061	0.459000	0.35465	AGA	FOXJ2	-	smart_TF_fork_head	ENSG00000065970		0.488	FOXJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXJ2	HGNC	protein_coding	OTTHUMT00000400088.1	-	0.00	68	0	A	NM_018416		8196342	+1	tier1	-	no_errors	ENST00000162391	ensembl	human	known	74_37	missense	45.36	53	44	SNP	1.000	G
FRMD1	79981	genome.wustl.edu	37	6	168479699	168479699	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:168479699G>A	ENST00000283309.6	-	1	140	c.76C>T	c.(76-78)Cga>Tga	p.R26*		NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	26						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TCCATACATCGCGCCCCTGAA	0.657																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												0													66.0	63.0	64.0					6																	168479699		2203	4300	6503	SO:0001587	stop_gained	0				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.76C>T	6.37:g.168479699G>A	ENSP00000283309:p.Arg26*		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Nonsense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.R26*	ENST00000283309.6	37	c.76	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784747	0.49997	.	.	ENSG00000153303	ENST00000283309;ENST00000511714	.	.	.	1.79	0.55	0.17219	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	3.3202	0.07048	0.0:0.2836:0.4305:0.2859	.	.	.	.	X	26;68	.	ENSP00000283309:R26X	R	-	1	2	FRMD1	168222548	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.488000	0.06497	0.911000	0.36747	0.313000	0.20887	CGA	FRMD1	-	NULL	ENSG00000153303		0.657	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	HGNC	protein_coding	OTTHUMT00000362513.2	-	0.00	77	0	G	NM_024919		168479699	-1	tier1	-	no_errors	ENST00000283309	ensembl	human	known	74_37	nonsense	17.39	57	12	SNP	0.001	A
GDI2	2665	genome.wustl.edu	37	10	5807199	5807199	+	3'UTR	SNP	T	T	C	rs576613566	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:5807199T>C	ENST00000380191.4	-	0	2398				GDI2_ENST00000479928.1_5'UTR	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2						protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						TTTCCAGAATTTGGCTTTATT	0.468																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.*770A>G	10.37:g.5807199T>C			O43928|Q5SX88|Q9UQM6	RNA	SNP	-	NULL	ENST00000380191.4	37	NULL	CCDS7071.1	10																																																																																			GDI2	-	-	ENSG00000057608		0.468	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI2	HGNC	protein_coding	OTTHUMT00000046580.1	-	0.00	32	0	T	NM_001494		5807199	-1	tier1	-	no_errors	ENST00000479928	ensembl	human	known	74_37	rna	23.81	16	5	SNP	1.000	C
GMEB1	10691	genome.wustl.edu	37	1	29030774	29030774	+	Silent	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:29030774G>A	ENST00000294409.2	+	8	921	c.831G>A	c.(829-831)caG>caA	p.Q277Q	GMEB1_ENST00000361872.4_Silent_p.Q267Q|GMEB1_ENST00000373816.1_Silent_p.Q267Q|GMEB1_ENST00000480454.1_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1	277					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GCAATATACAGAAGGAAATAG	0.473																																																	0													129.0	130.0	130.0					1																	29030774		2203	4300	6503	SO:0001819	synonymous_variant	0			AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.831G>A	1.37:g.29030774G>A			B1AT48|Q9NWH1|Q9UKD0	Silent	SNP	pfam_SAND_dom,superfamily_SAND_dom-like,smart_SAND_dom,pfscan_SAND_dom	p.Q277	ENST00000294409.2	37	c.831	CCDS327.1	1																																																																																			GMEB1	-	NULL	ENSG00000162419		0.473	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1	-	0.00	42	0	G	NM_006582		29030774	+1	tier1	-	no_errors	ENST00000294409	ensembl	human	known	74_37	silent	54.17	11	13	SNP	0.998	A
GRAMD3	65983	genome.wustl.edu	37	5	125821384	125821384	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr5:125821384C>A	ENST00000285689.3	+	11	1438	c.977C>A	c.(976-978)tCa>tAa	p.S326*	GRAMD3_ENST00000542322.1_Nonsense_Mutation_p.S334*|RP11-517I3.1_ENST00000512500.1_RNA|GRAMD3_ENST00000515200.1_Nonsense_Mutation_p.S304*|GRAMD3_ENST00000511134.1_Nonsense_Mutation_p.S310*|GRAMD3_ENST00000543198.1_Nonsense_Mutation_p.S304*|GRAMD3_ENST00000502348.1_Nonsense_Mutation_p.S217*|RP11-517I3.1_ENST00000515808.1_RNA|GRAMD3_ENST00000544396.1_Nonsense_Mutation_p.S222*|GRAMD3_ENST00000513040.1_Nonsense_Mutation_p.S341*	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	326						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		ACAGGTCTGTCAGAAACTGTT	0.353																																																	0													118.0	110.0	113.0					5																	125821384		2203	4300	6503	SO:0001587	stop_gained	0			BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.977C>A	5.37:g.125821384C>A	ENSP00000285689:p.Ser326*		B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Nonsense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.S334*	ENST00000285689.3	37	c.1001	CCDS4136.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.543966	0.98348	.	.	ENSG00000155324	ENST00000513040;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	.	.	.	6.07	4.23	0.50019	.	0.825894	0.11378	N	0.570106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4553	0.38751	0.0:0.8293:0.0:0.1707	.	.	.	.	X	341;326;304;334;222;304;217;310	.	ENSP00000285689:S326X	S	+	2	0	GRAMD3	125849283	0.841000	0.29509	1.000000	0.80357	0.678000	0.39670	1.677000	0.37576	1.495000	0.48549	0.655000	0.94253	TCA	GRAMD3	-	NULL	ENSG00000155324		0.353	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD3	HGNC	protein_coding	OTTHUMT00000250922.2	-	0.00	67	0	C	NM_023927		125821384	+1	tier1	-	no_errors	ENST00000542322	ensembl	human	known	74_37	nonsense	53.23	29	33	SNP	0.997	A
GRHL2	79977	genome.wustl.edu	37	8	102570742	102570742	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:102570742A>G	ENST00000251808.3	+	4	718	c.380A>G	c.(379-381)aAt>aGt	p.N127S	GRHL2_ENST00000395927.1_Missense_Mutation_p.N111S	NM_024915.3	NP_079191.2	Q6ISB3	GRHL2_HUMAN	grainyhead-like 2 (Drosophila)	127					brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac ventricle morphogenesis (GO:0003208)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|face development (GO:0060324)|in utero embryonic development (GO:0001701)|lung lobe morphogenesis (GO:0060463)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			CTTTCCCTAAATCAAGATCAC	0.512																																																	0													131.0	132.0	132.0					8																	102570742		2203	4300	6503	SO:0001583	missense	0			AK023844	CCDS34931.1	8q22.3	2008-02-05	2005-07-11	2005-07-11	ENSG00000083307	ENSG00000083307			2799	protein-coding gene	gene with protein product		608576	"""deafness, autosomal dominant 28"", ""transcription factor CP2-like 3"""	DFNA28, TFCP2L3		12393799	Standard	NM_024915		Approved	FLJ13782, BOM	uc010mbu.3	Q6ISB3	OTTHUMG00000149915	ENST00000251808.3:c.380A>G	8.37:g.102570742A>G	ENSP00000251808:p.Asn127Ser		A1L303|Q6NT03|Q9H8B8	Missense_Mutation	SNP	pfam_CP2	p.N127S	ENST00000251808.3	37	c.380	CCDS34931.1	8	.	.	.	.	.	.	.	.	.	.	A	6.556	0.470960	0.12461	.	.	ENSG00000083307	ENST00000251808;ENST00000395927;ENST00000395928	T;T	0.11712	2.75;2.75	5.26	3.94	0.45596	.	0.089097	0.85682	N	0.000000	T	0.06735	0.0172	L	0.29908	0.895	0.39731	D	0.971617	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.001	T	0.19257	-1.0311	10	0.06494	T	0.89	-22.8331	8.838	0.35123	0.8856:0.0:0.1144:0.0	.	127;127	B4DL28;Q6ISB3	.;GRHL2_HUMAN	S	127;111;127	ENSP00000251808:N127S;ENSP00000379260:N111S	ENSP00000251808:N127S	N	+	2	0	GRHL2	102639918	1.000000	0.71417	0.792000	0.32020	0.967000	0.64934	3.447000	0.52936	0.683000	0.31428	0.519000	0.50382	AAT	GRHL2	-	NULL	ENSG00000083307		0.512	GRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL2	HGNC	protein_coding	OTTHUMT00000313882.1	-	0.00	38	0	A	NM_024915		102570742	+1	tier1	-	no_errors	ENST00000251808	ensembl	human	known	74_37	missense	23.53	38	12	SNP	1.000	G
HNF4A	3172	genome.wustl.edu	37	20	43058230	43058230	+	Silent	SNP	G	G	A	rs377052026		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr20:43058230G>A	ENST00000316099.4	+	10	1439	c.1350G>A	c.(1348-1350)ccG>ccA	p.P450P	HNF4A_ENST00000316673.4_Silent_p.P428P|HNF4A_ENST00000457232.1_Silent_p.P418P|HNF4A_ENST00000415691.2_Silent_p.P440P	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	450					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			AGCTCCTGCCGGGAGCCGTCG	0.642													G|||	1	0.000199681	0.0	0.0014	5008	,	,		13126	0.0		0.0	False		,,,				2504	0.0				Colon(79;2 1269 8820 14841 52347)												0								G	,,,	0,4406		0,0,2203	79.0	84.0	82.0		1350,1254,1284,1320	-2.8	1.0	20		82	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	HNF4A	NM_000457.3,NM_001030003.1,NM_175914.3,NM_178849.1	,,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,,	450/475,418/443,428/453,440/465	43058230	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1350G>A	20.37:g.43058230G>A			A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.P450	ENST00000316099.4	37	c.1350	CCDS13330.1	20																																																																																			HNF4A	-	NULL	ENSG00000101076		0.642	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	-	0.00	108	0	G			43058230	+1	tier1	-	no_errors	ENST00000316099	ensembl	human	known	74_37	silent	41.67	49	35	SNP	0.944	A
RGS11	8786	genome.wustl.edu	37	16	318798	318798	+	3'UTR	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr16:318798A>T	ENST00000397770.3	-	0	1891				ITFG3_ENST00000301679.2_Missense_Mutation_p.R523S|RGS11_ENST00000316163.5_3'UTR|ITFG3_ENST00000450082.2_Missense_Mutation_p.R523S|ITFG3_ENST00000600536.1_Missense_Mutation_p.R491W|ITFG3_ENST00000442458.2_Missense_Mutation_p.R491W			O94810	RGS11_HUMAN	regulator of G-protein signaling 11						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|lung(4)|ovary(1)|pancreas(1)	8		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GACAGCGGAGAGGCTCTTGGA	0.652																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF035153	CCDS10403.1, CCDS42088.1, CCDS66884.1	16p13.3	2008-07-28	2007-08-14		ENSG00000076344	ENSG00000076344		"""Regulators of G-protein signaling"""	9993	protein-coding gene	gene with protein product		603895	"""regulator of G-protein signalling 11"""			9789084	Standard	NM_001286486		Approved		uc002cgj.1	O94810	OTTHUMG00000064893	ENST00000397770.3:c.*470T>A	16.37:g.318798A>T			O75883|Q4TT71|Q4TT72	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.R523S	ENST00000397770.3	37	c.1569	CCDS42088.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.697|7.697	0.692193|0.692193	0.15039|0.15039	.|.	.|.	ENSG00000167930|ENSG00000167930	ENST00000301679;ENST00000450082|ENST00000442458	.|.	.|.	.|.	1.58|1.58	-1.25|-1.25	0.09405|0.09405	.|.	.|.	.|.	.|.	.|.	T|T	0.29423|0.29423	0.0733|0.0733	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.35919|0.35919	-0.9769|-0.9769	7|5	0.87932|0.87932	D|D	0|0	.|.	2.1511|2.1511	0.03800|0.03800	0.4118:0.2642:0.0:0.324|0.4118:0.2642:0.0:0.324	.|.	523|.	Q9H0X4-2|.	.|.	S|W	523|491	.|.	ENSP00000301679:R523S|ENSP00000397477:R491W	R|R	+|+	3|1	2|2	ITFG3|ITFG3	258799|258799	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.076000|0.076000	0.17211|0.17211	-0.571000|-0.571000	0.05889|0.05889	-0.360000|-0.360000	0.08138|0.08138	0.260000|0.260000	0.18958|0.18958	AGA|AGG	ITFG3	-	NULL	ENSG00000167930		0.652	RGS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG3	HGNC	protein_coding	OTTHUMT00000139325.2	-	0.00	68	0	A			318798	+1	tier1	-	no_errors	ENST00000450082	ensembl	human	known	74_37	missense	35.56	29	16	SNP	0.001	T
JRK	8629	genome.wustl.edu	37	8	143746717	143746717	+	RNA	SNP	T	T	C	rs369670710		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:143746717T>C	ENST00000507178.2	-	0	1093							O75564	JERKY_HUMAN	Jrk homolog (mouse)							nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;2.31e-05)				ctgggccttataggcgacggg	0.577																																																	0								T	CYS/TYR,CYS/TYR	1,2797		0,1,1398	13.0	16.0	15.0		761,761	2.5	0.0	8		15	0,5592		0,0,2796	no	missense,missense	JRK	NM_001077527.1,NM_003724.2	194,194	0,1,4194	CC,CT,TT		0.0,0.0357,0.0119	probably-damaging,probably-damaging	254/557,254/569	143746717	1,8389	1399	2796	4195			0			AF072467	CCDS75796.1, CCDS75797.1	8q24.3	2014-03-28	2014-03-28			ENSG00000234616			6199	protein-coding gene	gene with protein product		603210	"""jerky (mouse) homolog"", ""jerky homolog (mouse)"""			9675132	Standard	NM_003724		Approved	JH8, jerky	uc003ywo.3	O75564			8.37:g.143746717T>C			O75565	RNA	SNP	-	NULL	ENST00000507178.2	37	NULL		8																																																																																			JRK	-	-	ENSG00000234616		0.577	JRK-003	KNOWN	basic	processed_transcript	JRK	HGNC	processed_transcript	OTTHUMT00000362914.1	-	0.00	37	0	T	NM_003724		143746717	-1	tier1	-	no_errors	ENST00000422119	ensembl	human	known	74_37	rna	29.03	44	18	SNP	0.041	C
KPNA4	3840	genome.wustl.edu	37	3	160227638	160227638	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:160227638C>T	ENST00000334256.4	-	14	1464	c.1159G>A	c.(1159-1161)Gaa>Aaa	p.E387K		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	387	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CAAGCAGCTTCTTTTTGAGTG	0.323																																																	0													132.0	136.0	134.0					3																	160227638		2203	4300	6503	SO:0001583	missense	0			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.1159G>A	3.37:g.160227638C>T	ENSP00000334373:p.Glu387Lys		A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.E387K	ENST00000334256.4	37	c.1159	CCDS3191.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.270759	0.95429	.	.	ENSG00000186432	ENST00000334256	T	0.72505	-0.66	5.0	5.0	0.66597	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91216	0.7232	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94941	0.8091	10	0.87932	D	0	-4.4495	17.6453	0.88147	0.0:1.0:0.0:0.0	.	387	O00629	IMA4_HUMAN	K	387	ENSP00000334373:E387K	ENSP00000334373:E387K	E	-	1	0	KPNA4	161710332	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.582000	0.82546	2.496000	0.84212	0.305000	0.20034	GAA	KPNA4	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000186432		0.323	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA4	HGNC	protein_coding	OTTHUMT00000352960.1	-	0.00	56	0	C	NM_002268		160227638	-1	tier1	-	no_errors	ENST00000334256	ensembl	human	known	74_37	missense	16.95	49	10	SNP	1.000	T
LCN1	3933	genome.wustl.edu	37	9	138413998	138413998	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr9:138413998A>T	ENST00000263598.2	+	2	256	c.196A>T	c.(196-198)Aac>Tac	p.N66Y	LCN1_ENST00000371781.3_Missense_Mutation_p.N66Y	NM_001252617.1|NM_001252618.1|NM_001252619.1|NM_002297.3	NP_001239546.1|NP_001239547.1|NP_001239548.1|NP_002288.1	P31025	LCN1_HUMAN	lipocalin 1	66					negative regulation of endopeptidase activity (GO:0010951)|proteolysis (GO:0006508)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|sensory perception of taste (GO:0050909)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)	13		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.54e-08)|Epithelial(140;5.25e-08)|all cancers(34;9.27e-07)|READ - Rectum adenocarcinoma(205;0.155)		GGAAGGGGGCAACCTGGAAGC	0.612																																																	0													14.0	14.0	14.0					9																	138413998		2197	4281	6478	SO:0001583	missense	0				CCDS6991.1	9q34	2011-11-14	2011-11-01		ENSG00000160349	ENSG00000160349		"""Lipocalins"""	6525	protein-coding gene	gene with protein product	"""Von Ebner gland protein"", ""tear lipocalin"", ""lipocalin 1-like 2"", ""tear prealbumin"""	151675	"""lipocalin 1 (protein migrating faster than albumin, tear prealbumin)"", ""lipocalin 1 (tear prealbumin)"""			8276406	Standard	NM_002297		Approved	VEGP, TP, PMFA, MGC71975, TLC	uc022bpk.1	P31025	OTTHUMG00000020908	ENST00000263598.2:c.196A>T	9.37:g.138413998A>T	ENSP00000263598:p.Asn66Tyr		Q5T8A1	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_von_Ebner_gland	p.N66Y	ENST00000263598.2	37	c.196	CCDS6991.1	9	.	.	.	.	.	.	.	.	.	.	A	14.48	2.549230	0.45383	.	.	ENSG00000160349	ENST00000263598;ENST00000371781	T;T	0.13901	2.55;2.55	2.84	0.281	0.15687	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.566103	0.15796	N	0.244192	T	0.30696	0.0773	M	0.81942	2.565	0.20821	N	0.999843	D	0.89917	1.0	D	0.83275	0.996	T	0.09862	-1.0655	10	0.87932	D	0	.	2.9623	0.05896	0.5899:0.2601:0.1499:0.0	.	66	P31025	LCN1_HUMAN	Y	66	ENSP00000263598:N66Y;ENSP00000360846:N66Y	ENSP00000263598:N66Y	N	+	1	0	LCN1	137553819	0.005000	0.15991	0.467000	0.27180	0.200000	0.23975	0.602000	0.24134	0.056000	0.16144	0.405000	0.27470	AAC	LCN1	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000160349		0.612	LCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN1	HGNC	protein_coding	OTTHUMT00000054992.1	-	0.00	107	0	A	NM_002297		138413998	+1	tier1	-	no_errors	ENST00000263598	ensembl	human	known	74_37	missense	75.45	27	83	SNP	0.513	T
LNX1	84708	genome.wustl.edu	37	4	54362373	54362373	+	Silent	SNP	G	G	T	rs140094412	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr4:54362373G>T	ENST00000263925.7	-	6	1481	c.1167C>A	c.(1165-1167)ccC>ccA	p.P389P	LNX1_ENST00000306888.2_Silent_p.P293P|LNX1-AS1_ENST00000502373.1_RNA|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	389	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GCTGCTCCTCGGGGCTACTTT	0.532																																																	0													105.0	102.0	103.0					4																	54362373		2203	4300	6503	SO:0001819	synonymous_variant	0			AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.1167C>A	4.37:g.54362373G>T			Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.P389	ENST00000263925.7	37	c.1167	CCDS47057.1	4																																																																																			LNX1	-	pfam_PDZ,superfamily_PDZ,pfscan_PDZ	ENSG00000072201		0.532	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX1	HGNC	protein_coding	OTTHUMT00000219934.2	-	0.00	74	0	G			54362373	-1	tier1	-	no_errors	ENST00000263925	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.001	T
CACNA1B	774	genome.wustl.edu	37	9	140777395	140777395	+	Intron	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr9:140777395C>T	ENST00000371372.1	+	3	675				RP11-188C12.3_ENST00000371390.1_RNA|CACNA1B_ENST00000371355.4_Intron|CACNA1B_ENST00000371357.1_Intron|CACNA1B_ENST00000371363.1_Intron|CACNA1B_ENST00000277549.5_Intron|CACNA1B_ENST00000277551.2_Intron	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit						calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCTCTGAAGCTCAGTTGCGC	0.632																																																	0																																										SO:0001627	intron_variant	0			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.530+60C>T	9.37:g.140777395C>T			B1AQK5	RNA	SNP	-	NULL	ENST00000371372.1	37	NULL	CCDS59522.1	9																																																																																			RP11-188C12.3	-	-	ENSG00000203987		0.632	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	LOC100133077	Clone_based_vega_gene	protein_coding	OTTHUMT00000055380.1	-	0.00	56	0	C	NM_000718		140777395	-1	tier1	-	no_errors	ENST00000371390	ensembl	human	known	74_37	rna	10.81	33	4	SNP	0.001	T
RNF213	57674	genome.wustl.edu	37	17	78328011	78328011	+	Intron	SNP	C	C	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:78328011C>G	ENST00000582970.1	+	35	10869				CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Intron|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Intron	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213						ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CACGTGGGCTCTTCCTGAGGA	0.592																																																	0													18.0	18.0	18.0					17																	78328011		2202	4299	6501	SO:0001627	intron_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.10726+45C>G	17.37:g.78328011C>G			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	RNA	SNP	-	NULL	ENST00000582970.1	37	NULL	CCDS58606.1	17																																																																																			CTD-2047H16.4	-	-	ENSG00000263069		0.592	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100294362	Clone_based_vega_gene	protein_coding	OTTHUMT00000443298.1	-	0.00	13	0	C	NM_020914		78328011	-1	tier1	-	no_errors	ENST00000575034	ensembl	human	known	74_37	rna	75.00	3	9	SNP	0.000	G
NMNAT3	349565	genome.wustl.edu	37	3	139302147	139302147	+	Intron	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:139302147T>C	ENST00000296202.7	-	4	491				RP11-319G6.1_ENST00000515247.1_RNA|NMNAT3_ENST00000413939.2_Intron|RN7SKP124_ENST00000364730.1_RNA|NMNAT3_ENST00000406824.1_Intron|NMNAT3_ENST00000507242.1_5'Flank|NMNAT3_ENST00000511444.1_Intron|NMNAT3_ENST00000512391.1_Intron|RP11-319G6.1_ENST00000381790.3_RNA|NMNAT3_ENST00000406164.1_Intron|NMNAT3_ENST00000339837.5_Intron			Q96T66	NMNA3_HUMAN	nicotinamide nucleotide adenylyltransferase 3						NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)	9						TTTGGATGTTTAATGATGTCA	0.338																																																	0																																										SO:0001627	intron_variant	0			AF345564	CCDS3111.1, CCDS56282.1	3q23	2013-09-20			ENSG00000163864	ENSG00000163864			20989	protein-coding gene	gene with protein product		608702				12574164	Standard	NM_178177		Approved	PNAT3	uc003etk.3	Q96T66	OTTHUMG00000159951	ENST00000296202.7:c.110-4250A>G	3.37:g.139302147T>C			B3KVR6|D3DNF2|D3DNF3|Q8N4G1	RNA	SNP	-	NULL	ENST00000296202.7	37	NULL		3																																																																																			RP11-319G6.1	-	-	ENSG00000248932		0.338	NMNAT3-004	KNOWN	basic|appris_principal	protein_coding	LOC100507291	Clone_based_vega_gene	protein_coding	OTTHUMT00000358469.1	-	0.00	115	0	T	NM_178177		139302147	+1	tier1	-	no_errors	ENST00000515247	ensembl	human	known	74_37	rna	42.02	69	50	SNP	1.000	C
MAP3K19	80122	genome.wustl.edu	37	2	135749143	135749143	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr2:135749143C>T	ENST00000375845.3	-	6	612	c.582G>A	c.(580-582)tcG>tcA	p.S194S	MAP3K19_ENST00000392917.3_Silent_p.S194S|MAP3K19_ENST00000358371.4_Silent_p.S81S|MAP3K19_ENST00000375844.3_Silent_p.S194S|MAP3K19_ENST00000392918.3_Silent_p.S194S|MAP3K19_ENST00000392915.1_Silent_p.S211S|MAP3K19_ENST00000315513.3_5'UTR	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	194							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TATGAGAGGTCGAAAACTCTA	0.358																																																	0													80.0	81.0	81.0					2																	135749143		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.582G>A	2.37:g.135749143C>T			B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S194	ENST00000375845.3	37	c.582	CCDS2176.2	2																																																																																			MAP3K19	-	NULL	ENSG00000176601		0.358	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K19	HGNC	protein_coding	OTTHUMT00000158244.1		0.00	40	0	C	NM_025052		135749143	-1			no_errors	ENST00000375845	ensembl	human	known	74_37	silent	5.71	32	2	SNP	0.005	T
MARK1	4139	genome.wustl.edu	37	1	220791724	220791724	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:220791724G>T	ENST00000366917.4	+	8	891	c.625G>T	c.(625-627)Gtt>Ttt	p.V209F	MARK1_ENST00000402574.1_Missense_Mutation_p.V74F|MARK1_ENST00000366918.4_Missense_Mutation_p.V187F					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TGAATTTACAGTTGGGAACAA	0.393																																																	0													58.0	61.0	60.0					1																	220791724		2203	4300	6503	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.625G>T	1.37:g.220791724G>T	ENSP00000355884:p.Val209Phe			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.V209F	ENST00000366917.4	37	c.625	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992501	0.35131	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.65549	-0.16;-0.16;-0.16	5.32	3.42	0.39159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.352176	0.29775	N	0.011233	T	0.39809	0.1092	N	0.19112	0.55	0.58432	D	0.999996	B;B;B;B	0.12630	0.004;0.006;0.002;0.0	B;B;B;B	0.17979	0.02;0.003;0.004;0.009	T	0.18461	-1.0336	10	0.09084	T	0.74	.	8.4161	0.32672	0.2702:0.0:0.7298:0.0	.	209;74;209;187	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	F	74;187;209	ENSP00000386017:V74F;ENSP00000355885:V187F;ENSP00000355884:V209F	ENSP00000355884:V209F	V	+	1	0	MARK1	218858347	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.355000	0.34068	2.488000	0.83962	0.650000	0.86243	GTT	MARK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000116141		0.393	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1		0.00	63	0	G			220791724	+1			no_errors	ENST00000366917	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.983	T
MAT2B	27430	genome.wustl.edu	37	5	162943690	162943690	+	Silent	SNP	C	C	T	rs199601793		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr5:162943690C>T	ENST00000321757.6	+	5	832	c.693C>T	c.(691-693)tgC>tgT	p.C231C	MAT2B_ENST00000518095.1_Silent_p.C231C|MAT2B_ENST00000280969.5_Silent_p.C220C	NM_013283.3	NP_037415.1	Q9NZL9	MAT2B_HUMAN	methionine adenosyltransferase II, beta	231					cellular nitrogen compound metabolic process (GO:0034641)|extracellular polysaccharide biosynthetic process (GO:0045226)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|regulation of catalytic activity (GO:0050790)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|methionine adenosyltransferase complex (GO:0048269)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dTDP-4-dehydrorhamnose reductase activity (GO:0008831)|enzyme binding (GO:0019899)|methionine adenosyltransferase regulator activity (GO:0048270)			endometrium(3)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	14	Renal(175;0.000281)	Medulloblastoma(196;0.0208)|all_neural(177;0.0765)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.027)|OV - Ovarian serous cystadenocarcinoma(192;0.0406)|Epithelial(171;0.0797)	L-Methionine(DB00134)	CCACTGTGTGCCGGCAGCTAG	0.483																																																	0													82.0	77.0	79.0					5																	162943690		2203	4300	6503	SO:0001819	synonymous_variant	0			AF182814	CCDS4364.1, CCDS4365.1	5q34-q35	2011-09-14			ENSG00000038274	ENSG00000038274		"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	6905	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 23E, member 1"""	605527				9055605, 10644686, 19027726	Standard	NM_182796		Approved	MATIIbeta, SDR23E1	uc003lzk.4	Q9NZL9	OTTHUMG00000130379	ENST00000321757.6:c.693C>T	5.37:g.162943690C>T			B2R5Y6|Q1WAI7|Q27J92|Q3LIE8|Q567T7|Q6NYC7|Q9BS89|Q9H3E1|Q9UJ54	Silent	SNP	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_Polysac_CapD-like,pfam_3Beta_OHSteriod_DH/Estase	p.C231	ENST00000321757.6	37	c.693	CCDS4365.1	5																																																																																			MAT2B	-	pfam_dTDP_dehydrorham_reduct,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase	ENSG00000038274		0.483	MAT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2B	HGNC	protein_coding	OTTHUMT00000252749.2		0.00	99	0	C	NM_013283		162943690	+1			no_errors	ENST00000321757	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	T
MBL1P	8512	genome.wustl.edu	37	10	81666392	81666392	+	IGR	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:81666392A>G								NUTM2E (55760 upstream) : MBL1P (13541 downstream)																							AAACAAAGAAAGAAAAACAGT	0.438																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.81666392A>G				RNA	SNP	-	NULL		37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600	0	0.438					MBL1P	HGNC			-	0.00	293	0	A			81666392	+1	tier1	-	no_errors	ENST00000453174	ensembl	human	known	74_37	rna	17.36	257	54	SNP	1.000	G
MFN1	55669	genome.wustl.edu	37	3	179069778	179069778	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:179069778G>A	ENST00000471841.1	+	3	329	c.203G>A	c.(202-204)gGt>gAt	p.G68D	MFN1_ENST00000280653.7_Missense_Mutation_p.G68D|MFN1_ENST00000263969.5_Missense_Mutation_p.G68D	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	68					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			TCCATCATTGGTGAGGTGCTA	0.378																																																	0													167.0	167.0	167.0					3																	179069778		2203	4300	6503	SO:0001583	missense	0			AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.203G>A	3.37:g.179069778G>A	ENSP00000420617:p.Gly68Asp		B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.G68D	ENST00000471841.1	37	c.203	CCDS3228.1	3	.	.	.	.	.	.	.	.	.	.	G	11.57	1.677566	0.29783	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000467174;ENST00000263969	D;D;D;D	0.95724	-3.79;-3.79;-3.79;-3.79	5.16	3.31	0.37934	.	0.261022	0.44902	D	0.000402	D	0.95156	0.8430	L	0.59436	1.845	0.47584	D	0.999462	D;D	0.59767	0.986;0.986	P;P	0.53062	0.717;0.717	D	0.92564	0.6060	10	0.15499	T	0.54	-11.7381	15.5978	0.76599	0.0:0.261:0.739:0.0	.	96;68	Q4AEJ4;Q8IWA4	.;MFN1_HUMAN	D	68	ENSP00000420617:G68D;ENSP00000280653:G68D;ENSP00000419134:G68D;ENSP00000263969:G68D	ENSP00000263969:G68D	G	+	2	0	MFN1	180552472	1.000000	0.71417	0.998000	0.56505	0.542000	0.35054	4.224000	0.58593	0.646000	0.30693	-0.463000	0.05309	GGT	MFN1	-	superfamily_P-loop_NTPase	ENSG00000171109		0.378	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN1	HGNC	protein_coding	OTTHUMT00000348654.2	-	0.00	85	0	G	NM_017927		179069778	+1	tier1	-	no_errors	ENST00000263969	ensembl	human	known	74_37	missense	39.73	44	29	SNP	0.997	A
MFSD5	84975	genome.wustl.edu	37	12	53647345	53647345	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr12:53647345C>T	ENST00000329548.4	+	2	917	c.726C>T	c.(724-726)tgC>tgT	p.C242C	MFSD5_ENST00000534842.1_Silent_p.C349C	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	242					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						GCCTGCGCTGCCTCCTGTCGG	0.602																																																	0													89.0	89.0	89.0					12																	53647345		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.726C>T	12.37:g.53647345C>T			G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Silent	SNP	pfam_DUF791,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.C349	ENST00000329548.4	37	c.1047	CCDS8851.1	12																																																																																			MFSD5	-	pfam_DUF791,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000182544		0.602	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD5	HGNC	protein_coding	OTTHUMT00000406896.1		0.00	79	0	C	NM_032889		53647345	+1			no_errors	ENST00000534842	ensembl	human	known	74_37	silent	10.64	42	5	SNP	1.000	T
MGAT3	4248	genome.wustl.edu	37	22	39883900	39883900	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr22:39883900G>A	ENST00000341184.6	+	2	763	c.548G>A	c.(547-549)gGc>gAc	p.G183D		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	183					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					CCCAGCTGCGGCGTGCCCACT	0.721																																																	0													16.0	15.0	15.0					22																	39883900		2194	4288	6482	SO:0001583	missense	0			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.548G>A	22.37:g.39883900G>A	ENSP00000345270:p.Gly183Asp		A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	pfam_Glyco_trans_17	p.G183D	ENST00000341184.6	37	c.548	CCDS13994.2	22	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883655	0.72410	.	.	ENSG00000128268	ENST00000341184	.	.	.	5.42	4.41	0.53225	.	0.000000	0.85682	D	0.000000	T	0.60235	0.2253	L	0.46741	1.465	0.58432	D	0.999993	P	0.47034	0.889	P	0.49799	0.622	T	0.63567	-0.6608	9	0.59425	D	0.04	.	14.1199	0.65180	0.0726:0.0:0.9274:0.0	.	183	Q09327	MGAT3_HUMAN	D	183	.	ENSP00000345270:G183D	G	+	2	0	MGAT3	38213846	1.000000	0.71417	0.963000	0.40424	0.815000	0.46073	6.141000	0.71744	1.312000	0.45043	-0.251000	0.11542	GGC	MGAT3	-	pfam_Glyco_trans_17	ENSG00000128268		0.721	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2	-	0.00	27	0	G	NM_002409		39883900	+1	tier1	-	no_errors	ENST00000341184	ensembl	human	known	74_37	missense	26.09	17	6	SNP	0.998	A
C3orf52	79669	genome.wustl.edu	37	3	111831724	111831724	+	Intron	DEL	A	A	-	rs76778672		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:111831724delA	ENST00000264848.5	+	5	526				C3orf52_ENST00000431717.2_Intron|MIR567_ENST00000385205.1_RNA|C3orf52_ENST00000430855.1_Intron|C3orf52_ENST00000467942.2_Intron	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						ATGCAAAACTAAAAAAAAAAA	0.323																																																	0													45.0	42.0	43.0					3																	111831724		1560	3556	5116	SO:0001627	intron_variant	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.468-87A>-	3.37:g.111831724delA			B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	RNA	DEL	-	NULL	ENST00000264848.5	37	NULL	CCDS46887.1	3																																																																																			MIR567	-	-	ENSG00000207940		0.323	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR567	HGNC	protein_coding	OTTHUMT00000353961.1		0.00	45	0	A	NM_024616		111831724	+1	tier1		no_errors	ENST00000385205	ensembl	human	known	74_37	rna	6.82	41	3	DEL	0.000	-
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				STRN3_ENST00000355683.5_Intron|MIR624_ENST00000385217.1_RNA	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																																	0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T			A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	-	0.00	94	0	G	NM_014574		31483858	-1	tier1	-	no_errors	ENST00000385217	ensembl	human	known	74_37	rna	9.52	57	6	SNP	0.001	T
MOG	4340	genome.wustl.edu	37	6	29637970	29637970	+	Intron	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:29637970A>G	ENST00000376917.3	+	6	821				MOG_ENST00000533330.2_Intron|MOG_ENST00000483013.1_Intron|MOG_ENST00000376902.3_Intron|MOG_ENST00000494692.1_Silent_p.G204G|MOG_ENST00000490427.1_Silent_p.G88G|MOG_ENST00000396701.2_Intron|MOG_ENST00000376888.2_Intron|MOG_ENST00000376894.4_Intron|MOG_ENST00000431798.2_Intron|MOG_ENST00000376891.4_Intron|MOG_ENST00000396704.3_Silent_p.G204G|MOG_ENST00000416766.2_Intron|MOG_ENST00000376898.3_Intron	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GTGTTCTAGGACCCCAGGTTA	0.433																																																	0													61.0	64.0	63.0					6																	29637970		1511	2709	4220	SO:0001627	intron_variant	0				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099	ENST00000376917.3:c.593-88A>G	6.37:g.29637970A>G			A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	pirsf_Myelin-oligodendrocyte_glycop,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.G204	ENST00000376917.3	37	c.612	CCDS34370.1	6																																																																																			MOG	-	pirsf_Myelin-oligodendrocyte_glycop	ENSG00000204655		0.433	MOG-001	KNOWN	basic|CCDS	protein_coding	MOG	HGNC	protein_coding	OTTHUMT00000076160.3	-	0.00	41	0	A	NM_002433		29637970	+1	tier1	-	no_errors	ENST00000494692	ensembl	human	known	74_37	silent	38.24	21	13	SNP	0.000	G
MORC1	27136	genome.wustl.edu	37	3	108723734	108723734	+	Splice_Site	SNP	C	C	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:108723734C>G	ENST00000483760.1	-	19	1995	c.1952G>C	c.(1951-1953)aGa>aCa	p.R651T	MORC1_ENST00000232603.5_Splice_Site_p.R672T					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						AATCTGACTTCTCTTTCAAAA	0.343																																																	0													125.0	139.0	134.0					3																	108723734		2203	4300	6503	SO:0001630	splice_region_variant	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.1951-1G>C	3.37:g.108723734C>G				Missense_Mutation	SNP	pfam_Znf_CW,superfamily_HATPase_ATP-bd,pfscan_Znf_CW	p.R672T	ENST00000483760.1	37	c.2015		3	.	.	.	.	.	.	.	.	.	.	C	0.675	-0.800352	0.02841	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06068	3.4;3.35	4.13	0.413	0.16401	.	.	.	.	.	T	0.02807	0.0084	N	0.08118	0	0.09310	N	1	B;B	0.16166	0.016;0.016	B;B	0.14023	0.01;0.01	T	0.49103	-0.8974	9	0.12430	T	0.62	0.4096	6.3417	0.21327	0.0:0.3099:0.0:0.6901	.	651;672	E7ERX1;Q86VD1	.;MORC1_HUMAN	T	672;651	ENSP00000232603:R672T;ENSP00000417282:R651T	ENSP00000232603:R672T	R	-	2	0	MORC1	110206424	0.075000	0.21258	0.006000	0.13384	0.150000	0.21749	1.043000	0.30316	0.068000	0.16574	-0.606000	0.04082	AGA	MORC1	-	NULL	ENSG00000114487		0.343	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	-	0.00	36	0	C		Missense_Mutation	108723734	-1	tier1	-	no_errors	ENST00000232603	ensembl	human	known	74_37	missense	42.50	23	17	SNP	0.009	G
MPO	4353	genome.wustl.edu	37	17	56356572	56356572	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:56356572G>T	ENST00000225275.3	-	6	858	c.682C>A	c.(682-684)Cgc>Agc	p.R228S	MPO_ENST00000340482.3_Missense_Mutation_p.R260S|MPO_ENST00000578493.1_5'Flank	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	228					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	GAGACCGCGCGAGCCTGCGGG	0.692																																																	0													29.0	30.0	30.0					17																	56356572		2201	4297	6498	SO:0001583	missense	0				CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.682C>A	17.37:g.56356572G>T	ENSP00000225275:p.Arg228Ser		A1L4B8|Q14862|Q4PJH5|Q9UCL7	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R260S	ENST00000225275.3	37	c.778	CCDS11604.1	17	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366314	0.82463	.	.	ENSG00000005381	ENST00000340482;ENST00000225275	T;T	0.72942	-0.7;-0.7	5.37	3.28	0.37604	.	0.000000	0.85682	D	0.000000	T	0.81927	0.4926	H	0.98314	4.2	0.80722	D	1	P	0.41569	0.755	B	0.43445	0.42	D	0.86433	0.1762	10	0.87932	D	0	-26.3161	9.1113	0.36730	0.0773:0.0:0.7754:0.1474	.	228	P05164	PERM_HUMAN	S	260;228	ENSP00000344419:R260S;ENSP00000225275:R228S	ENSP00000225275:R228S	R	-	1	0	MPO	53711571	1.000000	0.71417	0.926000	0.36857	0.620000	0.37586	3.626000	0.54245	2.536000	0.85505	0.462000	0.41574	CGC	MPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000005381		0.692	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPO	HGNC	protein_coding	OTTHUMT00000443971.1	-	0.00	28	0	G			56356572	-1	tier1	-	no_errors	ENST00000340482	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.999	T
MUL1	79594	genome.wustl.edu	37	1	20827583	20827583	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:20827583T>C	ENST00000264198.3	-	4	795	c.659A>G	c.(658-660)tAt>tGt	p.Y220C		NM_024544.2	NP_078820.2	Q969V5	MUL1_HUMAN	mitochondrial E3 ubiquitin protein ligase 1	220					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|cellular response to exogenous dsRNA (GO:0071360)|mitochondrial fission (GO:0000266)|mitochondrion localization (GO:0051646)|negative regulation of cell growth (GO:0030308)|negative regulation of chemokine (C-C motif) ligand 5 production (GO:0071650)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of innate immune response (GO:0045824)|negative regulation of mitochondrial fusion (GO:0010637)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein sumoylation (GO:0033235)|protein stabilization (GO:0050821)|protein sumoylation (GO:0016925)|protein ubiquitination (GO:0016567)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)	cytoplasm (GO:0005737)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(5)	11		Colorectal(325;0.000147)|Renal(390;0.000469)|Lung NSC(340;0.00412)|all_lung(284;0.00419)|Breast(348;0.00748)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000137)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		GCTGCTTAGATAGTACTGCAT	0.602																																																	0													74.0	71.0	72.0					1																	20827583		2203	4300	6503	SO:0001583	missense	0			BC014010	CCDS208.1	1p36.12	2013-01-11	2010-09-17	2008-03-26	ENSG00000090432	ENSG00000090432		"""RING-type (C3HC4) zinc fingers"""	25762	protein-coding gene	gene with protein product	"""ring finger protein 218"", ""mitochondria-anchored protein ligase"", ""growth inhibition and death E3 ligase"", ""mitochondrial ubiquitin ligase activator of NFKB 1"""	612037	"""chromosome 1 open reading frame 166"""	C1orf166		18591963, 12761501, 18213395, 18207745	Standard	NM_024544		Approved	FLJ12875, MULAN, RNF218, MAPL, GIDE	uc001bdi.4	Q969V5	OTTHUMG00000002838	ENST00000264198.3:c.659A>G	1.37:g.20827583T>C	ENSP00000264198:p.Tyr220Cys		B5M497|Q7Z431|Q9H9B5	Missense_Mutation	SNP	pfam_MULAN,pfscan_Znf_RING	p.Y220C	ENST00000264198.3	37	c.659	CCDS208.1	1	.	.	.	.	.	.	.	.	.	.	T	13.32	2.203473	0.38905	.	.	ENSG00000090432	ENST00000264198	T	0.31769	1.48	6.16	6.16	0.99307	.	0.048342	0.85682	D	0.000000	T	0.44393	0.1291	L	0.58101	1.795	0.53688	D	0.999979	D	0.56287	0.975	P	0.52957	0.714	T	0.38845	-0.9642	10	0.72032	D	0.01	-18.3734	14.7581	0.69583	0.0:0.0:0.0:1.0	.	220	Q969V5	MUL1_HUMAN	C	220	ENSP00000264198:Y220C	ENSP00000264198:Y220C	Y	-	2	0	MUL1	20700170	1.000000	0.71417	0.956000	0.39512	0.018000	0.09664	3.991000	0.56973	2.367000	0.80283	0.528000	0.53228	TAT	MUL1	-	pfam_MULAN	ENSG00000090432		0.602	MUL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUL1	HGNC	protein_coding	OTTHUMT00000007951.1	-	0.00	48	0	T	NM_024544		20827583	-1	tier1	-	no_errors	ENST00000264198	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	C
NCOR2	9612	genome.wustl.edu	37	12	124826549	124826549	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr12:124826549T>C	ENST00000405201.1	-	34	5008	c.5008A>G	c.(5008-5010)Atc>Gtc	p.I1670V	NCOR2_ENST00000356219.3_Missense_Mutation_p.I1677V|NCOR2_ENST00000397355.1_Missense_Mutation_p.I1661V|NCOR2_ENST00000404121.2_Missense_Mutation_p.I1231V|NCOR2_ENST00000404621.1_Missense_Mutation_p.I1660V|NCOR2_ENST00000429285.2_Missense_Mutation_p.I1660V			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1678					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TAGCCGCGGATGAGGTAGGGT	0.662																																																	0													43.0	56.0	51.0					12																	124826549		2090	4199	6289	SO:0001583	missense	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5008A>G	12.37:g.124826549T>C	ENSP00000384018:p.Ile1670Val		O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.I1677V	ENST00000405201.1	37	c.5029	CCDS41858.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.63|14.63	2.591599|2.591599	0.46214|0.46214	.|.	.|.	ENSG00000196498|ENSG00000196498	ENST00000453428|ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285	.|T;T;T;T;T;T	.|0.22336	.|1.96;2.23;1.97;2.23;1.98;2.23	4.23|4.23	3.04|3.04	0.35103|0.35103	.|.	.|0.062472	.|0.64402	.|D	.|0.000006	T|T	0.36358|0.36358	0.0964|0.0964	L|L	0.50333|0.50333	1.59|1.59	0.42662|0.42662	D|D	0.993489|0.993489	.|D;P;P	.|0.60575	.|0.988;0.913;0.948	.|D;P;D	.|0.69654	.|0.965;0.891;0.949	T|T	0.06734|0.06734	-1.0810|-1.0810	5|10	.|0.87932	.|D	.|0	-19.6383|-19.6383	10.5697|10.5697	0.45194|0.45194	0.0:0.0:0.1624:0.8376|0.0:0.0:0.1624:0.8376	.|.	.|1660;1661;1670	.|C9J0Q5;C9J239;C9JFD3	.|.;.;.	R|V	18|1670;1660;1677;1661;1669;1231;1660	.|ENSP00000384018:I1670V;ENSP00000384202:I1660V;ENSP00000348551:I1677V;ENSP00000380513:I1661V;ENSP00000385618:I1231V;ENSP00000400281:I1660V	.|ENSP00000348551:I1677V	H|I	-|-	2|1	0|0	NCOR2|NCOR2	123392502|123392502	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.120000|4.120000	0.57897|0.57897	0.459000|0.459000	0.27016|0.27016	0.402000|0.402000	0.26972|0.26972	CAT|ATC	NCOR2	-	NULL	ENSG00000196498		0.662	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	-	0.00	179	0	T	NM_006312		124826549	-1	tier1	-	no_errors	ENST00000356219	ensembl	human	known	74_37	missense	53.57	39	45	SNP	1.000	C
NEK7	140609	genome.wustl.edu	37	1	198288588	198288588	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:198288588G>T	ENST00000367385.4	+	10	1187	c.845G>T	c.(844-846)cGa>cTa	p.R282L	NEK7_ENST00000538004.1_Missense_Mutation_p.R282L	NM_133494.2	NP_598001.1	Q8TDX7	NEK7_HUMAN	NIMA-related kinase 7	282	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|protein phosphorylation (GO:0006468)|regulation of mitotic cell cycle (GO:0007346)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			endometrium(3)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21						CCAGAGAAGCGACCAGACGTC	0.393																																																	0													111.0	100.0	104.0					1																	198288588		2203	4300	6503	SO:0001583	missense	0			AB062450	CCDS1394.1	1q31.3	2012-11-15	2012-11-15		ENSG00000151414	ENSG00000151414			13386	protein-coding gene	gene with protein product		606848	"""NIMA (never in mitosis gene a)-related kinase 7"""			11701951	Standard	NM_133494		Approved		uc001gun.4	Q8TDX7	OTTHUMG00000035658	ENST00000367385.4:c.845G>T	1.37:g.198288588G>T	ENSP00000356355:p.Arg282Leu		A6NGT8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R282L	ENST00000367385.4	37	c.845	CCDS1394.1	1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992452	0.93167	.	.	ENSG00000151414	ENST00000367385;ENST00000538004	T;T	0.80653	-1.4;-1.4	5.54	5.54	0.83059	Serine/threonine-protein kinase-like domain (1);Serine-threonine/tyrosine-protein kinase (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92776	0.7703	M	0.93462	3.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94182	0.7433	10	0.87932	D	0	.	19.4923	0.95056	0.0:0.0:1.0:0.0	.	282	Q8TDX7	NEK7_HUMAN	L	282	ENSP00000356355:R282L;ENSP00000444621:R282L	ENSP00000356355:R282L	R	+	2	0	NEK7	196555211	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.497000	0.81536	2.607000	0.88179	0.650000	0.86243	CGA	NEK7	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000151414		0.393	NEK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK7	HGNC	protein_coding	OTTHUMT00000086550.2		0.00	83	0	G	NM_133494		198288588	+1			no_errors	ENST00000367385	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
NFATC2	4773	genome.wustl.edu	37	20	50140465	50140466	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr20:50140465_50140466insA	ENST00000396009.3	-	2	533_534	c.314_315insT	c.(313-315)gggfs	p.G105fs	NFATC2_ENST00000610033.1_Intron|NFATC2_ENST00000609943.1_Frame_Shift_Ins_p.G85fs|NFATC2_ENST00000609507.1_Intron|NFATC2_ENST00000414705.1_Frame_Shift_Ins_p.G85fs|NFATC2_ENST00000371564.3_Frame_Shift_Ins_p.G105fs	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	105					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGCCCGAGGCCCCTGCTGGCTT	0.678																																																	0																																										SO:0001589	frameshift_variant	0			U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.314_315insT	20.37:g.50140465_50140466insA	ENSP00000379330:p.Gly105fs		B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Frame_Shift_Ins	INS	pfam_RHD,pfam_IPT,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.A106fs	ENST00000396009.3	37	c.315_314	CCDS13437.1	20																																																																																			NFATC2	-	NULL	ENSG00000101096		0.678	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFATC2	HGNC	protein_coding	OTTHUMT00000079730.2		0.00	43	0	-	NM_012340		50140466	-1	tier1		no_errors	ENST00000396009	ensembl	human	known	74_37	frame_shift_ins	25.81	23	8	INS	1.000:1.000	A
NHSL2	340527	genome.wustl.edu	37	X	71359229	71359229	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chrX:71359229C>G	ENST00000373677.1	+	2	1995	c.733C>G	c.(733-735)Cac>Gac	p.H245D	NHSL2_ENST00000540800.1_Missense_Mutation_p.H611D|NHSL2_ENST00000510661.1_Missense_Mutation_p.H380D|NHSL2_ENST00000535692.1_Missense_Mutation_p.H245D			Q5HYW2	NHSL2_HUMAN	NHS-like 2	245										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					TCAAGGACATCACTCGTCCCA	0.527																																																	0													125.0	92.0	103.0					X																	71359229		2203	4300	6503	SO:0001583	missense	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.733C>G	X.37:g.71359229C>G	ENSP00000362781:p.His245Asp		B2RN94	Missense_Mutation	SNP	NULL	p.H611D	ENST00000373677.1	37	c.1831		X	.	.	.	.	.	.	.	.	.	.	C	7.052	0.564605	0.13498	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.42900	1.56;0.98;0.96;0.98	5.68	3.85	0.44370	.	0.760641	0.13027	N	0.419599	T	0.30792	0.0776	L	0.27053	0.805	0.23003	N	0.998446	B;B;B	0.25667	0.034;0.131;0.131	B;B;B	0.22601	0.04;0.04;0.04	T	0.16600	-1.0397	10	0.40728	T	0.16	-0.1107	11.1014	0.48177	0.4872:0.5128:0.0:0.0	.	611;380;245	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	D	611;245;380;245	ENSP00000444617:H611D;ENSP00000362781:H245D;ENSP00000424079:H380D;ENSP00000444914:H245D	ENSP00000362781:H245D	H	+	1	0	NHSL2	71275954	0.000000	0.05858	0.196000	0.23383	0.984000	0.73092	0.345000	0.19979	0.512000	0.28257	0.600000	0.82982	CAC	NHSL2	-	NULL	ENSG00000204131		0.527	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	-	0.00	18	0	C	NM_001013627		71359229	+1	tier1	-	no_errors	ENST00000540800	ensembl	human	known	74_37	missense	85.00	3	17	SNP	0.410	G
NSUN4	387338	genome.wustl.edu	37	1	46826379	46826380	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:46826379_46826380insT	ENST00000474844.1	+	5	1407_1408	c.757_758insT	c.(757-759)ctgfs	p.L253fs	NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_Frame_Shift_Ins_p.L204fs|NSUN4_ENST00000536062.1_Frame_Shift_Ins_p.L204fs	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	253					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					TGGGTAGGTGCTGGTGGATGTG	0.48																																																	0																																										SO:0001589	frameshift_variant	0			AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.758dupT	1.37:g.46826380_46826380dupT	ENSP00000419740:p.Leu253fs		A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Frame_Shift_Ins	INS	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.V254fs	ENST00000474844.1	37	c.757_758	CCDS534.1	1																																																																																			NSUN4	-	pfam_Fmu/NOL1/Nop2p,prints_RCMT	ENSG00000117481		0.480	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	HGNC	protein_coding	OTTHUMT00000021427.1		0.00	57	0	-	NM_199044		46826380	+1	tier1		no_errors	ENST00000474844	ensembl	human	known	74_37	frame_shift_ins	20.59	27	7	INS	1.000:1.000	T
NTM	50863	genome.wustl.edu	37	11	131530893	131530893	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr11:131530893C>T	ENST00000427481.2	+	1	6	c.6C>T	c.(4-6)aaC>aaT	p.N2N	NTM_ENST00000539799.1_Intron|NTM_ENST00000374791.3_Intron|AP003039.3_ENST00000416725.1_lincRNA			Q9P121	NTRI_HUMAN	neurotrimin	0					cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AAAAAATGAACGGAAAAAGAA	0.433																																																	0																																										SO:0001819	synonymous_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000427481.2:c.6C>T	11.37:g.131530893C>T			A0MTT2|Q6UXJ3|Q86VJ9	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N2	ENST00000427481.2	37	c.6		11																																																																																			NTM	-	NULL	ENSG00000182667		0.433	NTM-201	KNOWN	basic	protein_coding	NTM	HGNC	protein_coding		-	0.00	34	0	C	NM_016522		131530893	+1	tier1	-	no_errors	ENST00000427481	ensembl	human	known	74_37	silent	38.89	11	7	SNP	0.053	T
OR11H4	390442	genome.wustl.edu	37	14	20711735	20711735	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr14:20711735A>G	ENST00000315409.2	+	1	838	c.785A>G	c.(784-786)tAt>tGt	p.Y262C		NM_001004479.1	NP_001004479.1	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H, member 4	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	29	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		TCTCTTTTCTATGGGACAGTC	0.423																																																	0													238.0	228.0	231.0					14																	20711735		2203	4300	6503	SO:0001583	missense	0				CCDS32034.1	14q11.2	2013-09-24			ENSG00000176198	ENSG00000176198		"""GPCR / Class A : Olfactory receptors"""	15347	protein-coding gene	gene with protein product							Standard	NM_001004479		Approved		uc010tld.2	Q8NGC9	OTTHUMG00000170852	ENST00000315409.2:c.785A>G	14.37:g.20711735A>G	ENSP00000318997:p.Tyr262Cys		B2RNQ4|Q6IF07	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y262C	ENST00000315409.2	37	c.785	CCDS32034.1	14	.	.	.	.	.	.	.	.	.	.	A	11.92	1.782984	0.31593	.	.	ENSG00000176198	ENST00000315409	T	0.41758	0.99	4.7	4.7	0.59300	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47455	D	0.000222	T	0.65647	0.2711	M	0.88105	2.93	0.35598	D	0.807651	D	0.59767	0.986	P	0.62089	0.898	T	0.79072	-0.1953	10	0.72032	D	0.01	-7.807	12.1356	0.53968	1.0:0.0:0.0:0.0	.	262	Q8NGC9	O11H4_HUMAN	C	262	ENSP00000318997:Y262C	ENSP00000318997:Y262C	Y	+	2	0	OR11H4	19781575	0.647000	0.27304	1.000000	0.80357	0.958000	0.62258	0.925000	0.28791	1.971000	0.57363	0.533000	0.62120	TAT	OR11H4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176198		0.423	OR11H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H4	HGNC	protein_coding	OTTHUMT00000410678.1	-	0.00	109	0	A			20711735	+1	tier1	-	no_errors	ENST00000315409	ensembl	human	known	74_37	missense	73.08	21	57	SNP	1.000	G
OR14A16	284532	genome.wustl.edu	37	1	247978881	247978881	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:247978881G>A	ENST00000357627.1	-	1	150	c.151C>T	c.(151-153)Cat>Tat	p.H51Y		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						TGGAGATGATGGTCCAAAGTT	0.393																																					Ovarian(112;180 1586 15073 21914 33526)												0													81.0	79.0	80.0					1																	247978881		2203	4300	6503	SO:0001583	missense	0			BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.151C>T	1.37:g.247978881G>A	ENSP00000350248:p.His51Tyr		Q6IF96	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H51Y	ENST00000357627.1	37	c.151	CCDS31097.1	1	.	.	.	.	.	.	.	.	.	.	G	3.405	-0.121483	0.06838	.	.	ENSG00000196772	ENST00000357627	T	0.01076	5.37	3.51	1.35	0.21983	GPCR, rhodopsin-like superfamily (1);	0.706038	0.12138	U	0.496171	T	0.01124	0.0037	L	0.31476	0.935	0.09310	N	1	B	0.27166	0.17	B	0.17722	0.019	T	0.47100	-0.9143	10	0.21540	T	0.41	.	11.8228	0.52250	0.0:0.0:0.604:0.396	.	51	Q8NHC5	O14AG_HUMAN	Y	51	ENSP00000350248:H51Y	ENSP00000350248:H51Y	H	-	1	0	OR14A16	246045504	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	-0.264000	0.08658	0.821000	0.34540	0.590000	0.80494	CAT	OR14A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196772		0.393	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14A16	HGNC	protein_coding	OTTHUMT00000096856.1	-	0.00	23	0	G	NM_001001966		247978881	-1	tier1	-	no_errors	ENST00000357627	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.004	A
OR2A4	79541	genome.wustl.edu	37	6	132021790	132021790	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:132021790T>C	ENST00000315453.2	-	1	845	c.752A>G	c.(751-753)tAt>tGt	p.Y251C	ENPP3_ENST00000414305.1_Intron|ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Intron	NM_030908.1	NP_112170.1	O95047	OR2A4_HUMAN	olfactory receptor, family 2, subfamily A, member 4	251					positive regulation of cytokinesis (GO:0032467)|regulation of actin cytoskeleton organization (GO:0032956)	cleavage furrow (GO:0032154)|Flemming body (GO:0090543)|integral component of membrane (GO:0016021)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|ovary(1)|skin(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.018)|OV - Ovarian serous cystadenocarcinoma(155;0.041)		GGCTGTGCCATAAACGAGTCC	0.483																																																	0													69.0	96.0	88.0					6																	132021790		1790	4253	6043	SO:0001583	missense	0			AC005587	CCDS5149.1	6q23	2012-08-09	2003-05-22		ENSG00000180658	ENSG00000180658		"""GPCR / Class A : Olfactory receptors"""	14729	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily A, member 10"""	OR2A10			Standard	NM_030908		Approved		uc011ecd.2	O95047	OTTHUMG00000016316	ENST00000315453.2:c.752A>G	6.37:g.132021790T>C	ENSP00000319546:p.Tyr251Cys		Q0VAR3|Q6IF18|Q9NQN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.Y251C	ENST00000315453.2	37	c.752	CCDS5149.1	6	.	.	.	.	.	.	.	.	.	.	-	10.67	1.414311	0.25465	.	.	ENSG00000180658	ENST00000315453	T	0.41758	0.99	1.65	1.65	0.23941	GPCR, rhodopsin-like superfamily (1);	0.251610	0.20813	U	0.085205	T	0.53238	0.1784	M	0.87456	2.885	0.35157	D	0.770298	D	0.89917	1.0	D	0.97110	1.0	T	0.57985	-0.7716	10	0.62326	D	0.03	.	7.5979	0.28058	0.0:0.0:0.0:1.0	.	251	O95047	OR2A4_HUMAN	C	251	ENSP00000319546:Y251C	ENSP00000319546:Y251C	Y	-	2	0	OR2A4	132063483	0.000000	0.05858	0.999000	0.59377	0.000000	0.00434	-0.944000	0.03913	0.791000	0.33826	0.000000	0.15137	TAT	OR2A4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180658		0.483	OR2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A4	HGNC	protein_coding	OTTHUMT00000109221.1	-	0.00	64	0	T	NM_030908		132021790	-1	tier1	-	no_errors	ENST00000315453	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	C
OR5P3	120066	genome.wustl.edu	37	11	7847098	7847098	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr11:7847098C>T	ENST00000328375.1	-	1	421	c.422G>A	c.(421-423)tGc>tAc	p.C141Y	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153445.1	NP_703146.1	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P, member 3	141						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	15				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TAAGATGATGCAGACTCCAGG	0.532																																																	0													96.0	93.0	94.0					11																	7847098		2186	4296	6482	SO:0001583	missense	0			AF158377	CCDS7783.1	11p15.4	2012-08-09			ENSG00000182334	ENSG00000182334		"""GPCR / Class A : Olfactory receptors"""	14784	protein-coding gene	gene with protein product							Standard	NM_153445		Approved	JCG1	uc010rbg.2	Q8WZ94	OTTHUMG00000165669	ENST00000328375.1:c.422G>A	11.37:g.7847098C>T	ENSP00000332068:p.Cys141Tyr		Q6IFE1|Q8NGM2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C141Y	ENST00000328375.1	37	c.422	CCDS7783.1	11	.	.	.	.	.	.	.	.	.	.	C	13.16	2.153283	0.38021	.	.	ENSG00000182334	ENST00000328375	T	0.00237	8.47	5.28	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.103996	0.43260	D	0.000599	T	0.00440	0.0014	M	0.78801	2.425	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.45056	-0.9287	10	0.54805	T	0.06	-19.8126	6.3994	0.21630	0.1478:0.6933:0.0:0.159	.	141	Q8WZ94	OR5P3_HUMAN	Y	141	ENSP00000332068:C141Y	ENSP00000332068:C141Y	C	-	2	0	OR5P3	7803674	0.056000	0.20664	0.003000	0.11579	0.003000	0.03518	1.105000	0.31086	0.382000	0.24878	0.644000	0.83932	TGC	OR5P3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000182334		0.532	OR5P3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5P3	HGNC	protein_coding	OTTHUMT00000385697.1	-	0.00	46	0	C	NM_153445		7847098	-1	tier1	-	no_errors	ENST00000328375	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.003	T
OR8H3	390152	genome.wustl.edu	37	11	55890163	55890163	+	Silent	SNP	C	C	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr11:55890163C>G	ENST00000313472.3	+	1	315	c.315C>G	c.(313-315)gtC>gtG	p.V105V		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TCTGTTTTGTCTTCTTGGGTA	0.438																																																	0													310.0	298.0	302.0					11																	55890163		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.315C>G	11.37:g.55890163C>G			Q6IFB7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V105	ENST00000313472.3	37	c.315	CCDS31519.1	11																																																																																			OR8H3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181761		0.438	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	162	0	C	NM_001005201		55890163	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	silent	32.22	61	29	SNP	0.000	G
OR8A1	390275	genome.wustl.edu	37	11	124440069	124440069	+	Silent	SNP	G	G	T	rs147478128	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr11:124440069G>T	ENST00000284287.3	+	1	177	c.105G>T	c.(103-105)acG>acT	p.T35T		NM_001005194.1	NP_001005194.1	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A, member 1	35					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			haematopoietic_and_lymphoid_tissue(1)|lung(16)|ovary(2)|prostate(1)|skin(2)	22		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		AGGGTTTAACGAAGAGAGCAG	0.527																																																	0													95.0	89.0	91.0					11																	124440069		2201	4299	6500	SO:0001819	synonymous_variant	0			BK004495	CCDS31712.1	11q24.2	2012-08-09			ENSG00000196119	ENSG00000196119		"""GPCR / Class A : Olfactory receptors"""	8469	protein-coding gene	gene with protein product							Standard	NM_001005194		Approved	OST025	uc010san.2	Q8NGG7	OTTHUMG00000165923	ENST00000284287.3:c.105G>T	11.37:g.124440069G>T			Q6IEW7|Q96RC6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T35	ENST00000284287.3	37	c.105	CCDS31712.1	11																																																																																			OR8A1	-	NULL	ENSG00000196119		0.527	OR8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8A1	HGNC	protein_coding	OTTHUMT00000387062.1		0.00	41	0	G	NM_001005194		124440069	+1			no_errors	ENST00000284287	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.000	T
PAXBP1	94104	genome.wustl.edu	37	21	34110493	34110493	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr21:34110493delT	ENST00000331923.4	-	16	2661	c.2472delA	c.(2470-2472)aaafs	p.K824fs	PAXBP1-AS1_ENST00000455170.1_RNA|PAXBP1-AS1_ENST00000440052.1_RNA	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	824					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CATTTTGGGCTTTTTTGATGC	0.279																																																	0													82.0	84.0	83.0					21																	34110493		2202	4295	6497	SO:0001589	frameshift_variant	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.2472delA	21.37:g.34110493delT	ENSP00000328992:p.Lys824fs		D3DSE7|Q96DU8|Q9NYQ0	Frame_Shift_Del	DEL	pfam_GCFC_dom	p.A825fs	ENST00000331923.4	37	c.2472	CCDS13619.1	21																																																																																			PAXBP1	-	NULL	ENSG00000159086		0.279	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAXBP1	HGNC	protein_coding	OTTHUMT00000139563.1		0.00	34	0	T	NM_013329		34110493	-1	tier1		no_errors	ENST00000331923	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	1.000	-
PCDH15	65217	genome.wustl.edu	37	10	55849756	55849756	+	Missense_Mutation	SNP	T	T	C	rs373731707		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:55849756T>C	ENST00000320301.6	-	16	2379	c.1985A>G	c.(1984-1986)aAt>aGt	p.N662S	PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.N669S|PCDH15_ENST00000395432.2_Missense_Mutation_p.N625S|PCDH15_ENST00000395438.1_Missense_Mutation_p.N662S|PCDH15_ENST00000373965.2_Missense_Mutation_p.N669S|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.N662S|PCDH15_ENST00000395430.1_Missense_Mutation_p.N662S|PCDH15_ENST00000373957.3_Missense_Mutation_p.N640S|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.N662S|PCDH15_ENST00000409834.1_Missense_Mutation_p.N273S|PCDH15_ENST00000414778.1_Missense_Mutation_p.N667S|PCDH15_ENST00000395446.1_Missense_Mutation_p.N662S|PCDH15_ENST00000395433.1_Missense_Mutation_p.N640S	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	662	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TTCTGAAAGATTAAAAACTCT	0.348										HNSCC(58;0.16)			T|||	1	0.000199681	0.0	0.0	5008	,	,		16785	0.0		0.001	False		,,,				2504	0.0																0								T	SER/ASN,SER/ASN,,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN,SER/ASN	1,4405	2.1+/-5.4	0,1,2202	59.0	62.0	61.0		2000,1985,,1985,1874,1919,2021,1985,2000,1985,1919,1985	6.2	1.0	10		61	0,8594		0,0,4297	no	missense,missense,intron,missense,missense,missense,missense,missense,missense,missense,missense,missense	PCDH15	NM_001142763.1,NM_001142764.1,NM_001142765.1,NM_001142766.1,NM_001142767.1,NM_001142768.1,NM_001142769.1,NM_001142770.1,NM_001142771.1,NM_001142772.1,NM_001142773.1,NM_033056.3	46,46,,46,46,46,46,46,46,46,46,46	0,1,6499	CC,CT,TT		0.0,0.0227,0.0077	probably-damaging,probably-damaging,,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	667/1963,662/1958,,662/1953,625/1916,640/1936,674/1791,662/1540,667/1683,662/1678,640/1933,662/1956	55849756	1,12999	2203	4297	6500	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1985A>G	10.37:g.55849756T>C	ENSP00000322604:p.Asn662Ser		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N662S	ENST00000320301.6	37	c.1985	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	T	15.61	2.884158	0.51908	2.27E-4	0.0	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	6.16	6.16	0.99307	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.45518	0.1346	N	0.05608	-0.01	0.80722	D	1	D;P;P;B;D;D;P;B;P;P;B;B;P;P	0.71674	0.998;0.939;0.592;0.392;0.974;0.998;0.475;0.392;0.592;0.475;0.242;0.203;0.629;0.592	D;P;P;B;P;D;B;B;B;P;B;B;P;P	0.77557	0.99;0.688;0.475;0.262;0.771;0.99;0.439;0.262;0.349;0.542;0.224;0.059;0.542;0.475	T	0.40534	-0.9558	9	0.08381	T	0.77	.	15.0359	0.71748	0.0:0.0:0.0:1.0	.	640;662;662;667;625;662;662;669;669;662;667;662;640;662	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	S	669;667;662;662;273;669;662;625;662;640;640;662;662;667;662	ENSP00000363076:N669S;ENSP00000410304:N667S;ENSP00000378826:N662S;ENSP00000386693:N273S;ENSP00000378832:N669S;ENSP00000378833:N662S;ENSP00000378820:N625S;ENSP00000354950:N662S;ENSP00000378821:N640S;ENSP00000363068:N640S;ENSP00000322604:N662S;ENSP00000378818:N662S;ENSP00000363066:N662S	ENSP00000322604:N662S	N	-	2	0	PCDH15	55519762	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.237000	0.65360	2.367000	0.80283	0.528000	0.53228	AAT	PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000150275		0.348	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	39	0	T	NM_033056		55849756	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	52.94	16	18	SNP	1.000	C
PCDHB3	56132	genome.wustl.edu	37	5	140482555	140482555	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr5:140482555C>T	ENST00000231130.2	+	1	2322	c.2322C>T	c.(2320-2322)ttC>ttT	p.F774F	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	774					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCCCAACTTCGTTGCTCAGG	0.507																																																	0													78.0	81.0	80.0					5																	140482555		2202	4297	6499	SO:0001819	synonymous_variant	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2322C>T	5.37:g.140482555C>T			B2R8P2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F774	ENST00000231130.2	37	c.2322	CCDS4245.1	5																																																																																			PCDHB3	-	NULL	ENSG00000113205		0.507	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	77	0	C	NM_018937		140482555	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	silent	65.52	20	38	SNP	0.000	T
PCMTD1	115294	genome.wustl.edu	37	8	52733124	52733124	+	Silent	SNP	A	A	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:52733124A>C	ENST00000360540.5	-	7	1267	c.861T>G	c.(859-861)acT>acG	p.T287T	PCMTD1_ENST00000522514.1_Silent_p.T287T|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000544451.1_Silent_p.T211T	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	287						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CAAATACGTAAGTGTTAATTC	0.393																																																	0													192.0	190.0	191.0					8																	52733124		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.861T>G	8.37:g.52733124A>C			Q96FK9	Silent	SNP	pfam_PCMT	p.T287	ENST00000360540.5	37	c.861	CCDS6148.1	8																																																																																			PCMTD1	-	NULL	ENSG00000168300		0.393	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCMTD1	HGNC	protein_coding	OTTHUMT00000377909.2	-	0.00	145	0	A	NM_052937		52733124	-1	tier1	-	no_errors	ENST00000360540	ensembl	human	known	74_37	silent	9.76	74	8	SNP	0.566	C
PHOSPHO2	493911	genome.wustl.edu	37	2	170557861	170557862	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr2:170557861_170557862insT	ENST00000359744.3	+	4	768_769	c.380_381insT	c.(379-384)gcttttfs	p.AF127fs	KLHL23_ENST00000602521.1_Intron|KLHL23_ENST00000272797.4_Intron	NM_001008489.3|NM_001199285.1|NM_001199286.1|NM_001199288.1	NP_001008489.1|NP_001186214.1|NP_001186215.1|NP_001186217.1	Q8TCD6	PHOP2_HUMAN	phosphatase, orphan 2	127							metal ion binding (GO:0046872)|pyridoxal phosphatase activity (GO:0033883)			breast(1)|large_intestine(1)|lung(6)|skin(2)	10						AATCCAGCAGCTTTTAATAGCA	0.322																																																	0																																										SO:0001589	frameshift_variant	0			BC022324	CCDS33319.1	2q31.1	2008-02-05			ENSG00000144362	ENSG00000144362			28316	protein-coding gene	gene with protein product						16054448	Standard	NM_001199285		Approved	MGC22679	uc021vsh.1	Q8TCD6	OTTHUMG00000153981	ENST00000359744.3:c.384dupT	2.37:g.170557865_170557865dupT	ENSP00000352782:p.Ala127fs		B2RC30|D3DPC7	Frame_Shift_Ins	INS	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel,tigrfam_HAD-SF_hydro_IB_PSP-like	p.N129fs	ENST00000359744.3	37	c.380_381	CCDS33319.1	2																																																																																			PHOSPHO2	-	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel,tigrfam_HAD-SF_hydro_IB_PSP-like	ENSG00000144362		0.322	PHOSPHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHOSPHO2	HGNC	protein_coding	OTTHUMT00000333304.1		0.00	37	0	-	NM_001008489		170557862	+1	tier1		no_errors	ENST00000359744	ensembl	human	known	74_37	frame_shift_ins	33.33	14	7	INS	0.815:0.819	T
PI16	221476	genome.wustl.edu	37	6	36927007	36927007	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:36927007C>T	ENST00000373674.3	+	2	586	c.258C>T	c.(256-258)ggC>ggT	p.G86G		NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	86	SCP.				negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGCGCCGCGGCGAGAATCTGT	0.677																																																	0													25.0	23.0	23.0					6																	36927007		2197	4297	6494	SO:0001819	synonymous_variant	0				CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.258C>T	6.37:g.36927007C>T			Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Silent	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.G86	ENST00000373674.3	37	c.258	CCDS34440.1	6																																																																																			PI16	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000164530		0.677	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PI16	HGNC	protein_coding	OTTHUMT00000040380.1	-	0.00	93	0	C	NM_153370		36927007	+1	tier1	-	no_errors	ENST00000373674	ensembl	human	known	74_37	silent	53.12	30	34	SNP	0.442	T
PIPSL	266971	genome.wustl.edu	37	10	95718405	95718405	+	RNA	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:95718405C>T	ENST00000480546.1	-	0	2892					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										ttctttctttctttctttctt	0.303																																																	0																																												0			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95718405C>T			Q6NUK8	RNA	SNP	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			PIPSL	-	-	ENSG00000180764		0.303	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1	-	0.00	10	0	C	NR_002319		95718405	-1	tier1	-	no_errors	ENST00000480546	ensembl	human	putative	74_37	rna	50.00	4	4	SNP	0.063	T
PKHD1L1	93035	genome.wustl.edu	37	8	110376813	110376813	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:110376813A>G	ENST00000378402.5	+	2	215	c.111A>G	c.(109-111)atA>atG	p.I37M		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	37	IPT/TIG 1.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CAGAAATAATACCTAAATATG	0.328										HNSCC(38;0.096)																																							0													54.0	51.0	52.0					8																	110376813		1814	4072	5886	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.111A>G	8.37:g.110376813A>G	ENSP00000367655:p.Ile37Met		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.I37M	ENST00000378402.5	37	c.111	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	10.73	1.431619	0.25813	.	.	ENSG00000205038	ENST00000378402	T	0.76448	-1.02	4.97	-0.513	0.11962	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.649919	0.14287	N	0.329147	T	0.59514	0.2199	L	0.31294	0.92	0.21967	N	0.999449	B	0.14012	0.009	B	0.17979	0.02	T	0.41734	-0.9492	10	0.29301	T	0.29	.	3.9692	0.09446	0.5931:0.0:0.2537:0.1532	.	37	Q86WI1	PKHL1_HUMAN	M	37	ENSP00000367655:I37M	ENSP00000367655:I37M	I	+	3	3	PKHD1L1	110445989	0.961000	0.32948	0.999000	0.59377	0.994000	0.84299	-0.115000	0.10741	0.046000	0.15833	0.477000	0.44152	ATA	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.328	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	81	0	A	NM_177531		110376813	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	26.09	51	18	SNP	0.997	G
PLEKHM1P	440456	genome.wustl.edu	37	17	62800958	62800958	+	RNA	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:62800958C>T	ENST00000582986.1	-	0	874					NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										CCATCTGCCTCCGGTGTACCA	0.597																																																	0																																												0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62800958C>T				RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.597	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	-	0.00	69	0	C	NR_024386		62800958	-1	tier1	-	no_errors	ENST00000578036	ensembl	human	known	74_37	rna	35.29	33	18	SNP	0.858	T
PLXNA2	5362	genome.wustl.edu	37	1	208213028	208213028	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:208213028C>T	ENST00000367033.3	-	24	5195	c.4438G>A	c.(4438-4440)Gag>Aag	p.E1480K		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1480					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		TAGCGGGCCTCGCCCGTGATG	0.612																																																	0													88.0	84.0	86.0					1																	208213028		2203	4300	6503	SO:0001583	missense	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4438G>A	1.37:g.208213028C>T	ENSP00000356000:p.Glu1480Lys		A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.E1480K	ENST00000367033.3	37	c.4438	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.278447	0.95459	.	.	ENSG00000076356	ENST00000367033	T	0.10668	2.85	5.51	5.51	0.81932	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.26195	0.0639	L	0.37507	1.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00500	-1.1703	10	0.41790	T	0.15	.	19.4545	0.94882	0.0:1.0:0.0:0.0	.	1480	O75051	PLXA2_HUMAN	K	1480	ENSP00000356000:E1480K	ENSP00000356000:E1480K	E	-	1	0	PLXNA2	206279651	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	5.825000	0.69286	2.590000	0.87494	0.650000	0.86243	GAG	PLXNA2	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000076356		0.612	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	46	0	C	NM_025179		208213028	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	missense	30.00	21	9	SNP	1.000	T
PPP4R2	151987	genome.wustl.edu	37	3	73096461	73096461	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:73096461G>T	ENST00000356692.5	+	3	494	c.241G>T	c.(241-243)Gat>Tat	p.D81Y	PPP4R2_ENST00000295862.9_Missense_Mutation_p.D25Y|PPP4R2_ENST00000394284.3_Intron			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	81					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)	p.D81H(1)		breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		TATTCCCTTTGATGAAATGAA	0.338																																																	1	Substitution - Missense(1)	breast(1)											60.0	66.0	64.0					3																	73096461		2203	4300	6503	SO:0001583	missense	0			AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.241G>T	3.37:g.73096461G>T	ENSP00000349124:p.Asp81Tyr		A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Missense_Mutation	SNP	pfam_PPP4R2	p.D81Y	ENST00000356692.5	37	c.241	CCDS2917.1	3	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693993	0.88735	.	.	ENSG00000163605	ENST00000356692;ENST00000488810;ENST00000295862;ENST00000476505	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.48	5.48	0.80851	.	0.102153	0.64402	D	0.000003	T	0.66548	0.2800	L	0.59436	1.845	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	T	0.68172	-0.5479	10	0.72032	D	0.01	.	19.3579	0.94422	0.0:0.0:1.0:0.0	.	81	Q9NY27	PP4R2_HUMAN	Y	81;81;25;43	ENSP00000349124:D81Y;ENSP00000418750:D81Y;ENSP00000295862:D25Y;ENSP00000420098:D43Y	ENSP00000295862:D25Y	D	+	1	0	PPP4R2	73179151	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.576000	0.86940	0.557000	0.71058	GAT	PPP4R2	-	pfam_PPP4R2	ENSG00000163605		0.338	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R2	HGNC	protein_coding	OTTHUMT00000352321.1		0.00	49	0	G	NM_174907		73096461	+1			no_errors	ENST00000356692	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
PREX1	57580	genome.wustl.edu	37	20	47251277	47251277	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr20:47251277T>C	ENST00000371941.3	-	33	4226	c.4204A>G	c.(4204-4206)Acg>Gcg	p.T1402A	PREX1_ENST00000396220.1_Missense_Mutation_p.T1402A	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1402					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TCTGACAGCGTCACCCAGATG	0.557																																																	0													142.0	102.0	116.0					20																	47251277		2203	4300	6503	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4204A>G	20.37:g.47251277T>C	ENSP00000361009:p.Thr1402Ala		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T1402A	ENST00000371941.3	37	c.4204	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	T	5.631	0.301201	0.10678	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.49139	0.79;0.79	5.22	1.65	0.23941	.	0.000000	0.56097	U	0.000030	T	0.19485	0.0468	N	0.05078	-0.115	0.39156	D	0.962314	B;B	0.09022	0.0;0.002	B;B	0.10450	0.001;0.005	T	0.29088	-1.0023	10	0.02654	T	1	.	8.3319	0.32191	0.0:0.2432:0.0:0.7568	.	1402;699	Q8TCU6;Q8TCU6-2	PREX1_HUMAN;.	A	1402	ENSP00000361009:T1402A;ENSP00000379522:T1402A	ENSP00000361009:T1402A	T	-	1	0	PREX1	46684684	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	2.819000	0.48049	0.014000	0.14944	0.459000	0.35465	ACG	PREX1	-	NULL	ENSG00000124126		0.557	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	-	0.00	42	0	T	NM_020820		47251277	-1	tier1	-	no_errors	ENST00000371941	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.995	C
PSKH2	85481	genome.wustl.edu	37	8	87060700	87060700	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:87060700C>T	ENST00000276616.2	-	3	1223	c.1149G>A	c.(1147-1149)gcG>gcA	p.A383A		NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	383							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			CTTACAAAAGCGCAGACAGTG	0.433																																																	0													91.0	92.0	91.0					8																	87060700		2203	4300	6503	SO:0001819	synonymous_variant	0			AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.1149G>A	8.37:g.87060700C>T			A0AV22	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A383	ENST00000276616.2	37	c.1149	CCDS6240.1	8																																																																																			PSKH2	-	NULL	ENSG00000147613		0.433	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSKH2	HGNC	protein_coding	OTTHUMT00000374628.1	-	0.00	98	0	C	NM_033126		87060700	-1	tier1	-	no_errors	ENST00000276616	ensembl	human	known	74_37	silent	30.67	52	23	SNP	0.006	T
RAI1	10743	genome.wustl.edu	37	17	17701660	17701660	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:17701660G>A	ENST00000353383.1	+	3	5867	c.5398G>A	c.(5398-5400)Gac>Aac	p.D1800N	RAI1_ENST00000261641.6_Intron	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1800					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		AGCCCCAGCCGACAAGGGTCG	0.711																																																	0																																										SO:0001583	missense	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.5398G>A	17.37:g.17701660G>A	ENSP00000323074:p.Asp1800Asn		Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Missense_Mutation	SNP	smart_Znf_PHD	p.D1800N	ENST00000353383.1	37	c.5398	CCDS11188.1	17	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735449	0.69189	.	.	ENSG00000108557	ENST00000353383;ENST00000395776;ENST00000315321	T	0.68331	-0.32	4.56	4.56	0.56223	.	0.081778	0.52532	D	0.000078	T	0.57213	0.2038	N	0.19112	0.55	0.80722	D	1	D	0.58268	0.982	P	0.44772	0.46	T	0.66044	-0.6021	10	0.66056	D	0.02	.	17.5171	0.87777	0.0:0.0:1.0:0.0	.	1800	Q7Z5J4	RAI1_HUMAN	N	1800;1800;1688	ENSP00000323074:D1800N	ENSP00000322928:D1688N	D	+	1	0	RAI1	17642385	1.000000	0.71417	0.980000	0.43619	0.443000	0.32047	3.790000	0.55461	2.387000	0.81309	0.561000	0.74099	GAC	RAI1	-	NULL	ENSG00000108557		0.711	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	-	0.00	56	0	G	NM_030665		17701660	+1	tier1	-	no_errors	ENST00000353383	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	A
RANBP6	26953	genome.wustl.edu	37	9	6015307	6015307	+	Missense_Mutation	SNP	G	G	T	rs555096862		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr9:6015307G>T	ENST00000259569.5	-	1	311	c.301C>A	c.(301-303)Ctg>Atg	p.L101M	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	101					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		GCCAGAATCAGTTCAATCTTG	0.443																																																	0													82.0	83.0	83.0					9																	6015307		2203	4300	6503	SO:0001583	missense	0			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.301C>A	9.37:g.6015307G>T	ENSP00000259569:p.Leu101Met		Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.L101M	ENST00000259569.5	37	c.301	CCDS6467.1	9	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077802	0.55753	.	.	ENSG00000137040	ENST00000259569	T	0.77750	-1.12	4.51	3.61	0.41365	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	D	0.84969	0.5590	M	0.72118	2.19	0.58432	D	0.999998	D	0.89917	1.0	D	0.75020	0.985	D	0.84911	0.0848	10	0.48119	T	0.1	-4.7514	10.9196	0.47156	0.0923:0.0:0.9077:0.0	.	101	O60518	RNBP6_HUMAN	M	101	ENSP00000259569:L101M	ENSP00000259569:L101M	L	-	1	2	RANBP6	6005307	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.897000	0.48664	1.505000	0.48720	0.561000	0.74099	CTG	RANBP6	-	superfamily_ARM-type_fold	ENSG00000137040		0.443	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1		0.00	53	0	G	NM_012416		6015307	-1			no_errors	ENST00000259569	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
RHOBTB1	9886	genome.wustl.edu	37	10	62648194	62648194	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:62648194A>G	ENST00000337910.5	-	6	1569	c.1232T>C	c.(1231-1233)tTt>tCt	p.F411S	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.F411S	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	411	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					CAGGGTCCGAAAAGGGCCTGG	0.527																																																	0													61.0	60.0	60.0					10																	62648194		2203	4300	6503	SO:0001583	missense	0			AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1232T>C	10.37:g.62648194A>G	ENSP00000338671:p.Phe411Ser			Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.F411S	ENST00000337910.5	37	c.1232	CCDS7261.1	10	.	.	.	.	.	.	.	.	.	.	A	21.8	4.208811	0.79240	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.73152	-0.72;-0.72	5.71	5.71	0.89125	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.84406	0.5465	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86482	0.1792	10	0.87932	D	0	.	15.9958	0.80243	1.0:0.0:0.0:0.0	.	411	O94844	RHBT1_HUMAN	S	411	ENSP00000350595:F411S;ENSP00000338671:F411S	ENSP00000338671:F411S	F	-	2	0	RHOBTB1	62318200	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.667000	0.91153	2.188000	0.69820	0.533000	0.62120	TTT	RHOBTB1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000072422		0.527	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB1	HGNC	protein_coding	OTTHUMT00000048220.1	-	0.00	27	0	A			62648194	-1	tier1	-	no_errors	ENST00000337910	ensembl	human	known	74_37	missense	44.44	15	12	SNP	1.000	G
RLF	6018	genome.wustl.edu	37	1	40654740	40654740	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:40654740A>G	ENST00000372771.4	+	2	278	c.251A>G	c.(250-252)tAt>tGt	p.Y84C		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	84					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTATTGCAATATGCAAGCAAC	0.343																																																	0													74.0	60.0	65.0					1																	40654740		2203	4300	6503	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.251A>G	1.37:g.40654740A>G	ENSP00000361857:p.Tyr84Cys		Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y84C	ENST00000372771.4	37	c.251	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.778228	0.70107	.	.	ENSG00000117000	ENST00000372771	T	0.21361	2.01	5.24	5.24	0.73138	.	0.064020	0.64402	D	0.000004	T	0.43722	0.1260	M	0.63843	1.955	0.51767	D	0.999937	D	0.76494	0.999	D	0.70716	0.97	T	0.40440	-0.9563	10	0.87932	D	0	-18.4139	15.1521	0.72709	1.0:0.0:0.0:0.0	.	84	Q13129	RLF_HUMAN	C	84	ENSP00000361857:Y84C	ENSP00000361857:Y84C	Y	+	2	0	RLF	40427327	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.810000	0.69179	1.984000	0.57885	0.533000	0.62120	TAT	RLF	-	NULL	ENSG00000117000		0.343	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	-	0.00	44	0	A	NM_012421		40654740	+1	tier1	-	no_errors	ENST00000372771	ensembl	human	known	74_37	missense	32.43	25	12	SNP	1.000	G
RNF213	57674	genome.wustl.edu	37	17	78360667	78360667	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:78360667G>T	ENST00000582970.1	+	63	15041	c.14898G>T	c.(14896-14898)caG>caT	p.Q4966H	CTD-2047H16.4_ENST00000572151.1_RNA|RNF213_ENST00000508628.2_Missense_Mutation_p.Q5015H|CTD-2047H16.4_ENST00000573394.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000336301.6_Missense_Mutation_p.Q3039H|RNF213_ENST00000427003.3_3'UTR	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4966					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCTTCCTCCAGGGCAAGCCCC	0.582																																																	0													28.0	26.0	27.0					17																	78360667		2203	4300	6503	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.14898G>T	17.37:g.78360667G>T	ENSP00000464087:p.Gln4966His		C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.Q4966H	ENST00000582970.1	37	c.14898	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	18.11	3.551517	0.65311	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000336301;ENST00000427003	T	0.23348	1.91	5.04	4.06	0.47325	.	0.156815	0.44097	D	0.000496	T	0.47691	0.1459	M	0.82517	2.595	0.30806	N	0.739353	D	0.89917	1.0	D	0.70935	0.971	T	0.49753	-0.8906	10	0.24483	T	0.36	.	10.0831	0.42401	0.1553:0.0:0.8447:0.0	.	3039	Q63HN8	RN213_HUMAN	H	4966;5015;3039;316	ENSP00000338218:Q3039H	ENSP00000338218:Q3039H	Q	+	3	2	RNF213	75975262	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	1.582000	0.36568	2.353000	0.79882	0.561000	0.74099	CAG	RNF213	-	NULL	ENSG00000173821		0.582	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	34	0	G	NM_020914		78360667	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	missense	70.00	6	14	SNP	1.000	T
SCAPER	49855	genome.wustl.edu	37	15	77096904	77096904	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr15:77096904T>A	ENST00000563290.1	-	6	559	c.464A>T	c.(463-465)gAa>gTa	p.E155V	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000324767.7_Missense_Mutation_p.E155V			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	155						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						CTCTAGCTTTTCCTGAAGCTG	0.368																																																	0													121.0	111.0	114.0					15																	77096904		1852	4094	5946	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.464A>T	15.37:g.77096904T>A	ENSP00000454973:p.Glu155Val		F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.E155V	ENST00000563290.1	37	c.464	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735899	0.89482	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.26518	1.73	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.44912	0.1316	L	0.47716	1.5	0.58432	D	0.999999	D;P	0.89917	1.0;0.864	D;P	0.76575	0.988;0.671	T	0.40346	-0.9568	10	0.72032	D	0.01	.	15.3287	0.74190	0.0:0.0:0.0:1.0	.	155;170	Q6NSF1;Q9BY12-2	.;.	V	155;171	ENSP00000326924:E155V	ENSP00000303560:E171V	E	-	2	0	SCAPER	74883959	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.624000	0.83124	2.011000	0.59026	0.528000	0.53228	GAA	SCAPER	-	NULL	ENSG00000140386		0.368	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	-	0.00	54	0	T	NM_020843		77096904	-1	tier1	-	no_errors	ENST00000324767	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	A
SCN11A	11280	genome.wustl.edu	37	3	38888583	38888583	+	Missense_Mutation	SNP	C	C	T	rs564668486		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:38888583C>T	ENST00000302328.3	-	26	5176	c.4978G>A	c.(4978-4980)Gca>Aca	p.A1660T	SCN11A_ENST00000456224.3_Missense_Mutation_p.A1622T|SCN11A_ENST00000450244.1_Missense_Mutation_p.A1660T	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1660					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTGGCTTTGCGACACGCAAA	0.438													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22450	0.0		0.0	False		,,,				2504	0.0																0													91.0	94.0	93.0					3																	38888583		2203	4300	6503	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4978G>A	3.37:g.38888583C>T	ENSP00000307599:p.Ala1660Thr		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.A1660T	ENST00000302328.3	37	c.4978	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	C	15.27	2.782624	0.49891	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.96232	-3.95;-3.95;-3.91	5.27	2.12	0.27331	.	0.239727	0.42682	D	0.000680	D	0.95884	0.8660	M	0.82823	2.61	0.35073	D	0.762673	D	0.57571	0.98	B	0.42882	0.401	D	0.98395	1.0565	10	0.72032	D	0.01	.	16.3774	0.83410	0.0:0.5977:0.4022:0.0	.	1660	Q9UI33	SCNBA_HUMAN	T	1660;1660;1622	ENSP00000307599:A1660T;ENSP00000400945:A1660T;ENSP00000416757:A1622T	ENSP00000307599:A1660T	A	-	1	0	SCN11A	38863587	0.084000	0.21492	0.841000	0.33234	0.898000	0.52572	0.219000	0.17641	1.161000	0.42604	0.650000	0.86243	GCA	SCN11A	-	NULL	ENSG00000168356		0.438	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	-	0.00	60	0	C	NM_014139		38888583	-1	tier1	-	no_errors	ENST00000302328	ensembl	human	known	74_37	missense	80.95	4	17	SNP	0.811	T
SEPT7P9	285961	genome.wustl.edu	37	10	38680984	38680984	+	RNA	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr10:38680984G>A	ENST00000489259.1	-	0	409									septin 7 pseudogene 9																		CTGTTCACTCGCGATTCTGCA	0.388																																																	0																																												0					10p11.21	2013-04-02	2013-04-02	2013-04-02	ENSG00000120555	ENSG00000120555			30810	pseudogene	pseudogene			"""CDC10 cell division cycle 10 homolog (S. cerevisiae) like"", ""CDC10 cell division cycle 10 homolog (S. cerevisiae)-like"", ""septin 7-like"""	CDC10L, SEPT7L			Standard	NR_027269		Approved	bA291L22.2	uc009xmd.2		OTTHUMG00000017994		10.37:g.38680984G>A				RNA	SNP	-	NULL	ENST00000489259.1	37	NULL		10	.	.	.	.	.	.	.	.	.	.	.	16.41	3.114704	0.56505	.	.	ENSG00000120555	ENST00000239730;ENST00000328105	.	.	.	1.21	0.155	0.14906	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	6.2937	0.21075	0.0:0.0:0.7045:0.2955	.	.	.	.	X	55	.	ENSP00000239730:R55X	R	-	1	2	SEPT7L	38720990	1.000000	0.71417	0.998000	0.56505	0.477000	0.33069	5.003000	0.63959	0.091000	0.17302	0.121000	0.15741	CGA	SEPT7P9	-	-	ENSG00000120555		0.388	SEPT7P9-006	KNOWN	basic	processed_transcript	SEPT7P9	HGNC	pseudogene	OTTHUMT00000047644.1	-	0.00	183	0	G	NR_027269		38680984	-1	tier1	-	no_errors	ENST00000475691	ensembl	human	known	74_37	rna	23.81	80	25	SNP	1.000	A
SERPINA9	327657	genome.wustl.edu	37	14	94942497	94942497	+	5'Flank	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr14:94942497C>A	ENST00000380365.3	-	0	0				SERPINA9_ENST00000298845.7_Missense_Mutation_p.G5C|SERPINA9_ENST00000337425.5_Missense_Mutation_p.G5C|SERPINA9_ENST00000448305.2_5'UTR|SERPINA9_ENST00000539349.1_Intron|SERPINA9_ENST00000424550.2_5'UTR|SERPINA9_ENST00000546329.1_Missense_Mutation_p.G32V			Q86WD7	SPA9_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(17)	21		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		cttctcctgccctgtccttgc	0.542																																																	0													314.0	318.0	317.0					14																	94942497		2070	4219	6289	SO:0001631	upstream_gene_variant	0			AY185497	CCDS41982.1, CCDS41983.1, CCDS61542.1	14q32.1	2014-02-18	2005-08-18		ENSG00000170054	ENSG00000170054		"""Serine (or cysteine) peptidase inhibitors"""	15995	protein-coding gene	gene with protein product		615677	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9"""			24172014	Standard	NM_175739		Approved	CENTERIN, SERPINA11b, GCET1	uc001ydf.3	Q86WD7	OTTHUMG00000167710		14.37:g.94942497C>A	Exception_encountered		B4DVH4|B9ZVX3|Q2T9J2|Q6UWP9|Q86WD4|Q86WD5|Q86WD6|Q86YP6|Q86YP7	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.G5C	ENST00000380365.3	37	c.13		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.423|1.423	-0.572275|-0.572275	0.03882|0.03882	.|.	.|.	ENSG00000170054|ENSG00000170054	ENST00000298845;ENST00000337425|ENST00000546329	D;D|D	0.85629|0.82433	-2.01;-1.91|-1.61	1.55|1.55	-0.501|-0.501	0.12008|0.12008	.|.	.|.	.|.	.|.	.|.	T|T	0.71600|0.71600	0.3359|0.3359	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	D;D|B	0.65815|0.26195	0.987;0.995|0.144	B;B|B	0.43386|0.26517	0.418;0.418|0.07	T|T	0.61317|0.61317	-0.7087|-0.7087	8|8	0.87932|0.87932	D|D	0|0	.|.	3.8529|3.8529	0.08963|0.08963	0.0:0.4876:0.0:0.5124|0.0:0.4876:0.0:0.5124	.|.	5;5|32	Q86WD7-7;Q86WD7-2|Q86WD7-4	.;.|.	C|V	5|32	ENSP00000298845:G5C;ENSP00000337133:G5C|ENSP00000445476:G32V	ENSP00000298845:G5C|ENSP00000441511:G32V	G|G	-|-	1|2	0|0	SERPINA9|SERPINA9	94012250|94012250	0.000000|0.000000	0.05858|0.05858	0.038000|0.038000	0.18304|0.18304	0.020000|0.020000	0.10135|0.10135	-0.179000|-0.179000	0.09768|0.09768	-0.164000|-0.164000	0.10927|0.10927	0.508000|0.508000	0.49915|0.49915	GGC|GGG	SERPINA9	-	NULL	ENSG00000170054		0.542	SERPINA9-008	KNOWN	basic|appris_principal	protein_coding	SERPINA9	HGNC	protein_coding	OTTHUMT00000395803.2	-	0.00	140	0	C	NM_175739		94942497	-1	tier1	-	no_errors	ENST00000337425	ensembl	human	known	74_37	missense	26.19	93	33	SNP	0.045	A
SLC15A2	6565	genome.wustl.edu	37	3	121634493	121634493	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:121634493A>G	ENST00000489711.1	+	7	1038	c.650A>G	c.(649-651)tAt>tGt	p.Y217C	SLC15A2_ENST00000295605.2_Missense_Mutation_p.Y186C	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	217					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GAAGACTGCTATGCATTGGCT	0.393																																																	0													187.0	170.0	176.0					3																	121634493		2203	4300	6503	SO:0001583	missense	0			BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.650A>G	3.37:g.121634493A>G	ENSP00000417085:p.Tyr217Cys		A8K1A5|B4E2A7	Missense_Mutation	SNP	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt,tigrfam_Oligopep_transport	p.Y217C	ENST00000489711.1	37	c.650	CCDS3007.1	3	.	.	.	.	.	.	.	.	.	.	A	24.7	4.557612	0.86231	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.59638	0.25;0.25	5.93	5.93	0.95920	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.81351	0.4804	M	0.93016	3.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85820	0.1385	10	0.87932	D	0	-12.8823	14.3286	0.66537	1.0:0.0:0.0:0.0	.	186;217	B4E2A7;Q16348	.;S15A2_HUMAN	C	217;179;186	ENSP00000417085:Y217C;ENSP00000295605:Y186C	ENSP00000295605:Y186C	Y	+	2	0	SLC15A2	123117183	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	6.829000	0.75314	2.263000	0.75096	0.533000	0.62120	TAT	SLC15A2	-	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt,tigrfam_Oligopep_transport	ENSG00000163406		0.393	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A2	HGNC	protein_coding	OTTHUMT00000355239.1	-	0.00	60	0	A	NM_021082		121634493	+1	tier1	-	no_errors	ENST00000489711	ensembl	human	known	74_37	missense	36.07	39	22	SNP	1.000	G
SI	6476	genome.wustl.edu	37	3	164783108	164783108	+	Missense_Mutation	SNP	G	G	A	rs200745562		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr3:164783108G>A	ENST00000264382.3	-	7	810	c.748C>T	c.(748-750)Cgt>Tgt	p.R250C		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	250	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)	p.R250C(2)		NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAATCATGACGAAATCTCTTA	0.343										HNSCC(35;0.089)																																							2	Substitution - Missense(2)	ovary(1)|large_intestine(1)											76.0	75.0	75.0					3																	164783108		2203	4300	6503	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.748C>T	3.37:g.164783108G>A	ENSP00000264382:p.Arg250Cys		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.R250C	ENST00000264382.3	37	c.748	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035583	0.75617	.	.	ENSG00000090402	ENST00000264382	D	0.90955	-2.76	5.9	5.9	0.94986	Glycoside hydrolase-type carbohydrate-binding (1);	0.105792	0.64402	D	0.000003	D	0.97049	0.9036	H	0.97540	4.025	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.97789	1.0237	10	0.72032	D	0.01	.	14.5224	0.67859	0.0:0.0:0.7337:0.2663	.	250	P14410	SUIS_HUMAN	C	250	ENSP00000264382:R250C	ENSP00000264382:R250C	R	-	1	0	SI	166265802	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.105000	0.57797	2.788000	0.95919	0.650000	0.86243	CGT	SI	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000090402		0.343	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	45	0	G	NM_001041		164783108	-1	tier1	rs200745562	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	32.35	23	11	SNP	0.998	A
SLC38A9	153129	genome.wustl.edu	37	5	55008260	55008260	+	5'UTR	SNP	C	C	A	rs190705960		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr5:55008260C>A	ENST00000396865.2	-	0	294				SLC38A9_ENST00000504880.1_5'UTR	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				TCCCAGAGGGCTCTGCGACGG	0.706																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.-298G>T	5.37:g.55008260C>A			B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	RNA	SNP	-	NULL	ENST00000396865.2	37	NULL	CCDS3968.1	5																																																																																			SLC38A9	-	-	ENSG00000177058		0.706	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC38A9	HGNC	protein_coding	OTTHUMT00000253912.2	-	0.00	44	0	C	NM_173514		55008260	-1	tier1	-	no_errors	ENST00000504880	ensembl	human	known	74_37	rna	76.00	6	19	SNP	0.065	A
SLC7A11	23657	genome.wustl.edu	37	4	139103481	139103481	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr4:139103481C>A	ENST00000280612.5	-	9	1365	c.1086G>T	c.(1084-1086)aaG>aaT	p.K362N		NM_014331.3	NP_055146.1	Q9UPY5	XCT_HUMAN	solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11	362					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|brain development (GO:0007420)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|lens fiber cell differentiation (GO:0070306)|leukocyte migration (GO:0050900)|platelet aggregation (GO:0070527)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	cystine:glutamate antiporter activity (GO:0015327)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)	18	all_hematologic(180;0.166)				Acetylcysteine(DB06151)|L-Cystine(DB00138)|Riluzole(DB00740)|Rosuvastatin(DB01098)|Sulfasalazine(DB00795)|Tauroursodeoxycholic acid(DB08834)	GAGGAGTGTGCTTGCGGACAT	0.408																																																	0													99.0	102.0	101.0					4																	139103481		2203	4300	6503	SO:0001583	missense	0			AB026891	CCDS3742.1	4q28-q32	2013-05-22	2011-07-12		ENSG00000151012	ENSG00000151012		"""Solute carriers"""	11059	protein-coding gene	gene with protein product		607933				10206947, 12763038	Standard	XM_005262875		Approved	xCT	uc021xrw.1	Q9UPY5	OTTHUMG00000133396	ENST00000280612.5:c.1086G>T	4.37:g.139103481C>A	ENSP00000280612:p.Lys362Asn		A8K2U4	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_transpt_TM,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.K362N	ENST00000280612.5	37	c.1086	CCDS3742.1	4	.	.	.	.	.	.	.	.	.	.	C	15.72	2.916116	0.52546	.	.	ENSG00000151012	ENST00000280612	D	0.89552	-2.53	5.48	4.55	0.56014	Amino acid permease domain (1);	0.045456	0.85682	D	0.000000	T	0.81158	0.4764	N	0.25201	0.72	0.38989	D	0.95911	B	0.21821	0.061	B	0.22152	0.038	T	0.77197	-0.2676	10	0.49607	T	0.09	.	10.2257	0.43225	0.0:0.8388:0.0:0.1612	.	362	Q9UPY5	XCT_HUMAN	N	362	ENSP00000280612:K362N	ENSP00000280612:K362N	K	-	3	2	SLC7A11	139322931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.791000	0.38744	1.153000	0.42468	0.655000	0.94253	AAG	SLC7A11	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000151012		0.408	SLC7A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A11	HGNC	protein_coding	OTTHUMT00000257251.2	-	0.00	58	0	C			139103481	-1	tier1	-	no_errors	ENST00000280612	ensembl	human	known	74_37	missense	61.54	10	16	SNP	1.000	A
SMYD4	114826	genome.wustl.edu	37	17	1704284	1704284	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:1704284T>A	ENST00000305513.7	-	5	571	c.404A>T	c.(403-405)cAt>cTt	p.H135L		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	135							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TGGATACCCATGTGTCTGTGC	0.443																																																	0													152.0	153.0	153.0					17																	1704284		2203	4300	6503	SO:0001583	missense	0			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.404A>T	17.37:g.1704284T>A	ENSP00000304360:p.His135Leu		Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.H135L	ENST00000305513.7	37	c.404	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	T	15.14	2.743589	0.49151	.	.	ENSG00000186532	ENST00000305513	T	0.14766	2.48	5.98	5.98	0.97165	Tetratricopeptide-like helical (1);	0.304252	0.41001	D	0.000967	T	0.20861	0.0502	N	0.21373	0.66	0.58432	D	0.999994	D	0.71674	0.998	D	0.68039	0.955	T	0.08764	-1.0706	10	0.10902	T	0.67	-20.006	15.6593	0.77169	0.0:0.0:0.0:1.0	.	135	Q8IYR2	SMYD4_HUMAN	L	135	ENSP00000304360:H135L	ENSP00000304360:H135L	H	-	2	0	SMYD4	1651034	1.000000	0.71417	0.851000	0.33527	0.024000	0.10985	5.718000	0.68455	2.288000	0.76882	0.528000	0.53228	CAT	SMYD4	-	NULL	ENSG00000186532		0.443	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4		0.00	45	0	T	XM_056082		1704284	-1			no_errors	ENST00000305513	ensembl	human	known	74_37	missense	6.67	4	4	SNP	1.000	A
SNX7	51375	genome.wustl.edu	37	1	99157106	99157106	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:99157106T>G	ENST00000306121.3	+	4	499	c.490T>G	c.(490-492)Ttt>Gtt	p.F164V	SNX7_ENST00000370189.5_Missense_Mutation_p.F100V|SNX7_ENST00000529992.1_Intron	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	100					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		GCCAGAAAAGTTTATAGTAAA	0.358																																																	0													45.0	46.0	46.0					1																	99157106		2203	4299	6502	SO:0001583	missense	0			AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.490T>G	1.37:g.99157106T>G	ENSP00000304429:p.Phe164Val		A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.F164V	ENST00000306121.3	37	c.490	CCDS755.2	1	.	.	.	.	.	.	.	.	.	.	T	26.0	4.695398	0.88830	.	.	ENSG00000162627	ENST00000370189;ENST00000306121;ENST00000454199	T;T;T	0.35789	1.29;1.29;1.29	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	N	0.21097	0.63	0.80722	D	1	P;D	0.54397	0.926;0.966	P;P	0.55391	0.775;0.775	T	0.04115	-1.0976	10	0.15499	T	0.54	-27.7318	15.5892	0.76512	0.0:0.0:0.0:1.0	.	164;100	Q9UNH6-3;Q9UNH6-2	.;.	V	100;164;100	ENSP00000359208:F100V;ENSP00000304429:F164V;ENSP00000388266:F100V	ENSP00000304429:F164V	F	+	1	0	SNX7	98929694	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.035000	0.88872	2.087000	0.62958	0.528000	0.53228	TTT	SNX7	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000162627		0.358	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX7	HGNC	protein_coding	OTTHUMT00000029609.2	-	0.00	51	0	T			99157106	+1	tier1	-	no_errors	ENST00000306121	ensembl	human	known	74_37	missense	23.53	26	8	SNP	1.000	G
SOWAHB	345079	genome.wustl.edu	37	4	77816698	77816698	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr4:77816698G>T	ENST00000334306.2	-	1	2304	c.2305C>A	c.(2305-2307)Cag>Aag	p.Q769K		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	769																	TTGTTGTGCTGACTTTTGAGT	0.463																																																	0													267.0	248.0	255.0					4																	77816698		2203	4300	6503	SO:0001583	missense	0				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.2305C>A	4.37:g.77816698G>T	ENSP00000334879:p.Gln769Lys		B2RP29	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q769K	ENST00000334306.2	37	c.2305	CCDS34017.1	4	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741783	0.69304	.	.	ENSG00000186212	ENST00000334306	T	0.11930	2.73	5.5	5.5	0.81552	.	0.135159	0.32258	U	0.006347	T	0.28764	0.0713	L	0.44542	1.39	0.38976	D	0.958855	D	0.76494	0.999	P	0.60609	0.877	T	0.00619	-1.1641	10	0.66056	D	0.02	-17.339	18.332	0.90272	0.0:0.0:1.0:0.0	.	769	A6NEL2	ANR56_HUMAN	K	769	ENSP00000334879:Q769K	ENSP00000334879:Q769K	Q	-	1	0	ANKRD56	78035722	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	4.279000	0.58953	2.861000	0.98227	0.655000	0.94253	CAG	SOWAHB	-	NULL	ENSG00000186212		0.463	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHB	HGNC	protein_coding	OTTHUMT00000362762.1	-	0.00	111	0	G	NM_001029870		77816698	-1	tier1	-	no_errors	ENST00000334306	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
SSBP1	6742	genome.wustl.edu	37	7	141450109	141450109	+	Splice_Site	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr7:141450109A>T	ENST00000481508.1	+	7	838		c.e7-1		SSBP1_ENST00000484178.1_Splice_Site|SSBP1_ENST00000498107.1_Splice_Site|SSBP1_ENST00000265304.6_Splice_Site|SSBP1_ENST00000465582.1_Splice_Site|SSBP1_ENST00000469123.1_Splice_Site	NM_001256510.1	NP_001243439.1	Q04837	SSBP_HUMAN	single-stranded DNA binding protein 1, mitochondrial						DNA replication (GO:0006260)|mitochondrion morphogenesis (GO:0070584)|positive regulation of helicase activity (GO:0051096)	extracellular vesicular exosome (GO:0070062)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|skin(1)	7	Melanoma(164;0.0171)					GCTTTTTTACAGATAATATTA	0.313																																																	0													50.0	54.0	53.0					7																	141450109		2203	4300	6503	SO:0001630	splice_region_variant	0			M94556	CCDS5866.1	7q34	2012-05-25	2012-05-25		ENSG00000106028	ENSG00000106028			11317	protein-coding gene	gene with protein product		600439	"""single-stranded DNA-binding protein"", ""single-stranded DNA binding protein 1"""			7789991	Standard	NM_001256510		Approved	SSBP, mtSSB	uc031szi.1	Q04837	OTTHUMG00000157572	ENST00000481508.1:c.404-1A>T	7.37:g.141450109A>T				Splice_Site	SNP	-	e6-2	ENST00000481508.1	37	c.404-2	CCDS5866.1	7	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198670	0.79015	.	.	ENSG00000106028	ENST00000265304;ENST00000498107;ENST00000467681;ENST00000465582;ENST00000484178;ENST00000481508	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2958	0.66311	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SSBP1	141096578	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.324000	0.72896	2.246000	0.74042	0.533000	0.62120	.	SSBP1	-	-	ENSG00000106028		0.313	SSBP1-006	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SSBP1	HGNC	protein_coding	OTTHUMT00000349187.1		0.00	38	0	A	NM_003143	Intron	141450109	+1			no_errors	ENST00000265304	ensembl	human	known	74_37	splice_site	16.00	21	4	SNP	1.000	T
SSFA2	6744	genome.wustl.edu	37	2	182774683	182774683	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr2:182774683A>T	ENST00000431877.2	+	9	1650	c.1471A>T	c.(1471-1473)Acg>Tcg	p.T491S	SSFA2_ENST00000320370.7_Missense_Mutation_p.T491S|SSFA2_ENST00000428267.2_Missense_Mutation_p.T338S|SSFA2_ENST00000409136.1_5'Flank|SSFA2_ENST00000409001.1_Missense_Mutation_p.T491S	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	491						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.T491A(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			GCTAGGTCTTACGAAGTCGAA	0.383																																																	1	Substitution - Missense(1)	kidney(1)											66.0	57.0	60.0					2																	182774683		2203	4300	6503	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1471A>T	2.37:g.182774683A>T	ENSP00000388731:p.Thr491Ser		A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.T491S	ENST00000431877.2	37	c.1471	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	A	8.583	0.882778	0.17467	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267	T;T;T;T	0.14266	2.75;2.52;2.75;2.76	5.98	2.4	0.29515	.	0.563870	0.19375	N	0.115818	T	0.13243	0.0321	L	0.54323	1.7	0.19575	N	0.999964	B;B;B;B	0.27068	0.167;0.167;0.167;0.167	B;B;B;B	0.28011	0.085;0.053;0.053;0.085	T	0.17319	-1.0373	10	0.44086	T	0.13	0.0	7.441	0.27183	0.7415:0.0:0.2585:0.0	.	338;491;491;491	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	S	491;491;491;338	ENSP00000388731:T491S;ENSP00000314669:T491S;ENSP00000387319:T491S;ENSP00000409867:T338S	ENSP00000314669:T491S	T	+	1	0	SSFA2	182482928	0.009000	0.17119	0.032000	0.17829	0.269000	0.26545	1.379000	0.34340	0.518000	0.28383	0.482000	0.46254	ACG	SSFA2	-	NULL	ENSG00000138434		0.383	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2		0.00	65	0	A	NM_006751		182774683	+1			no_errors	ENST00000431877	ensembl	human	known	74_37	missense	5.26	35	2	SNP	0.538	T
SSR1	6745	genome.wustl.edu	37	6	7269350	7269350	+	3'UTR	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:7269350C>T	ENST00000474597.1	-	0	996							P43307	SSRA_HUMAN	signal sequence receptor, alpha						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					GCTGCAGGAGCGGCCCGATGT	0.657																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000474597.1:c.*13G>A	6.37:g.7269350C>T			A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	RNA	SNP	-	NULL	ENST00000474597.1	37	NULL		6																																																																																			SSR1	-	-	ENSG00000124783		0.657	SSR1-003	NOVEL	not_organism_supported|basic	protein_coding	SSR1	HGNC	protein_coding	OTTHUMT00000353162.1	-	0.00	127	0	C			7269350	-1	tier1	-	no_errors	ENST00000475213	ensembl	human	known	74_37	rna	30.26	53	23	SNP	0.001	T
STAG2	10735	genome.wustl.edu	37	X	123210195	123210195	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chrX:123210195G>T	ENST00000371160.1	+	26	2837	c.2547G>T	c.(2545-2547)gaG>gaT	p.E849D	STAG2_ENST00000218089.9_Missense_Mutation_p.E849D|STAG2_ENST00000371157.3_Missense_Mutation_p.E849D|STAG2_ENST00000371144.3_Missense_Mutation_p.E849D|STAG2_ENST00000371145.3_Missense_Mutation_p.E849D|STAG2_ENST00000354548.5_Missense_Mutation_p.E780D|STAG2_ENST00000469481.1_Intron	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	849					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GTCAGCAAGAGGATGAAGCCA	0.338																																																	0													96.0	99.0	98.0					X																	123210195		2203	4300	6503	SO:0001583	missense	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2547G>T	X.37:g.123210195G>T	ENSP00000360202:p.Glu849Asp		B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.E849D	ENST00000371160.1	37	c.2547	CCDS14607.1	X	.	.	.	.	.	.	.	.	.	.	G	9.579	1.123139	0.20959	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.33865	1.8;1.4;1.39;1.39;1.8;1.39	5.34	0.867	0.19085	.	0.050716	0.85682	D	0.000000	T	0.13415	0.0325	N	0.10664	0.02	0.32363	N	0.556901	B;B	0.02656	0.0;0.0	B;B	0.08055	0.002;0.003	T	0.05146	-1.0903	10	0.34782	T	0.22	-5.3075	0.6887	0.00887	0.2927:0.1107:0.3363:0.2604	.	849;849	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	D	849;780;849;849;849;849	ENSP00000218089:E849D;ENSP00000346555:E780D;ENSP00000360202:E849D;ENSP00000360199:E849D;ENSP00000360187:E849D;ENSP00000360186:E849D	ENSP00000218089:E849D	E	+	3	2	STAG2	123037876	0.646000	0.27295	1.000000	0.80357	0.963000	0.63663	-0.133000	0.10451	0.188000	0.20168	0.544000	0.68410	GAG	STAG2	-	NULL	ENSG00000101972		0.338	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2		0.00	55	0	G	NM_006603		123210195	+1			no_errors	ENST00000218089	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.998	T
STARD10	10809	genome.wustl.edu	37	11	72466800	72466800	+	Splice_Site	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr11:72466800T>C	ENST00000334805.6	-	6	1497		c.e6-2		STARD10_ENST00000538536.1_Splice_Site|STARD10_ENST00000538437.1_Splice_Site|STARD10_ENST00000545082.1_Splice_Site|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000543304.1_Splice_Site	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10						bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			GTAAGGAGCCTGTGAGGGCAG	0.602																																																	0													50.0	54.0	53.0					11																	72466800		1923	4128	6051	SO:0001630	splice_region_variant	0			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.578-2A>G	11.37:g.72466800T>C			O60532	Splice_Site	SNP	-	e5-2	ENST00000334805.6	37	c.578-2	CCDS41688.1	11	.	.	.	.	.	.	.	.	.	.	T	20.3	3.975401	0.74360	.	.	ENSG00000214530	ENST00000537351;ENST00000543304;ENST00000334805;ENST00000538536;ENST00000545082;ENST00000544767;ENST00000537947;ENST00000400925	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9027	0.63815	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	STARD10	72144448	1.000000	0.71417	0.888000	0.34837	0.972000	0.66771	8.022000	0.88759	1.958000	0.56883	0.402000	0.26972	.	STARD10	-	-	ENSG00000214530		0.602	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	-	0.00	41	0	T		Intron	72466800	-1	tier1	-	no_errors	ENST00000334805	ensembl	human	known	74_37	splice_site	42.86	12	9	SNP	0.998	C
SYMPK	8189	genome.wustl.edu	37	19	46333319	46333319	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:46333319G>T	ENST00000245934.7	-	13	1986	c.1742C>A	c.(1741-1743)gCa>gAa	p.A581E	AC092301.3_ENST00000601618.1_RNA	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	581					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CACCTGGGCTGCCCCGCTGCA	0.647																																																	0													13.0	12.0	12.0					19																	46333319		2163	4188	6351	SO:0001583	missense	0			U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1742C>A	19.37:g.46333319G>T	ENSP00000245934:p.Ala581Glu		O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.A581E	ENST00000245934.7	37	c.1742	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975907	0.74360	.	.	ENSG00000125755	ENST00000245934	.	.	.	6.14	6.14	0.99180	Armadillo-type fold (1);	0.100775	0.64402	D	0.000002	T	0.63141	0.2486	L	0.42245	1.32	0.53005	D	0.999965	D;P	0.62365	0.991;0.804	P;B	0.51806	0.68;0.274	T	0.63373	-0.6652	9	0.62326	D	0.03	.	18.3535	0.90348	0.0:0.0:1.0:0.0	.	596;581	Q4LE61;Q92797	.;SYMPK_HUMAN	E	581	.	ENSP00000245934:A581E	A	-	2	0	SYMPK	51025159	1.000000	0.71417	0.980000	0.43619	0.962000	0.63368	6.655000	0.74392	2.937000	0.99478	0.650000	0.86243	GCA	SYMPK	-	superfamily_ARM-type_fold	ENSG00000125755		0.647	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	HGNC	protein_coding	OTTHUMT00000316581.1	-	0.00	95	0	G	NM_004819		46333319	-1	tier1	-	no_errors	ENST00000245934	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.997	T
TBC1D29	26083	genome.wustl.edu	37	17	28890301	28890301	+	Missense_Mutation	SNP	G	G	A	rs80145926	byFrequency	TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:28890301G>A	ENST00000580161.1	+	6	2808	c.311G>A	c.(310-312)aGc>aAc	p.S104N	RP11-218M11.1_ENST00000563063.1_lincRNA|TBC1D29_ENST00000579181.1_Missense_Mutation_p.S104N|TBC1D29_ENST00000584297.1_3'UTR			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	104							Rab GTPase activator activity (GO:0005097)	p.S104N(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				TCAGAGAGCAGCAGAGGCCCC	0.587																																																	1	Substitution - Missense(1)	prostate(1)											48.0	45.0	46.0					17																	28890301		2203	4300	6503	SO:0001583	missense	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.311G>A	17.37:g.28890301G>A	ENSP00000462799:p.Ser104Asn			Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S104N	ENST00000580161.1	37	c.311	CCDS32606.1	17	.	.	.	.	.	.	.	.	.	.	.	9.179	1.023040	0.19433	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.18873	N	0.999983	B	0.33000	0.393	B	0.42319	0.383	T	0.34850	-0.9812	7	0.72032	D	0.01	.	5.89	0.18904	8.0E-4:0.0:0.9992:0.0	.	104	Q9UFV1	TBC29_HUMAN	N	104	.	ENSP00000330052:S104N	S	+	2	0	TBC1D29	25914427	0.966000	0.33281	0.071000	0.20095	0.071000	0.16799	-0.367000	0.07553	0.107000	0.17824	0.109000	0.15622	AGC	TBC1D29	-	NULL	ENSG00000266733		0.587	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	HGNC	protein_coding	OTTHUMT00000443632.1		0.00	39	0	G	NM_015594		28890301	+1			no_errors	ENST00000579181	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.904	A
TADA2A	6871	genome.wustl.edu	37	17	35800613	35800613	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:35800613G>T	ENST00000394395.2	+	6	465	c.292G>T	c.(292-294)Gta>Tta	p.V98L	TADA2A_ENST00000225396.6_Missense_Mutation_p.V98L|TADA2A_ENST00000417170.1_Missense_Mutation_p.V98L|TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000586023.1_Missense_Mutation_p.V98L	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	98	SANT. {ECO:0000255|PROSITE- ProRule:PRU00624}.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						TAGGCAGGATGTAGCCAATCA	0.393																																																	0													102.0	85.0	91.0					17																	35800613		2203	4300	6503	SO:0001583	missense	0			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.292G>T	17.37:g.35800613G>T	ENSP00000377918:p.Val98Leu		A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM,pfscan_Myb-like_dom	p.V98L	ENST00000394395.2	37	c.292	CCDS11319.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.441522	0.96187	.	.	ENSG00000108264	ENST00000394395;ENST00000225396;ENST00000417170	T;T;T	0.52295	0.67;0.67;0.67	5.42	5.42	0.78866	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.70579	0.3240	M	0.85630	2.765	0.80722	D	1	D;D	0.62365	0.991;0.981	P;P	0.59643	0.861;0.832	T	0.75926	-0.3145	10	0.72032	D	0.01	-16.2868	19.2126	0.93763	0.0:0.0:1.0:0.0	.	98;98	O75478-2;O75478	.;TAD2A_HUMAN	L	98	ENSP00000377918:V98L;ENSP00000225396:V98L;ENSP00000406699:V98L	ENSP00000225396:V98L	V	+	1	0	TADA2A	32874726	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.869000	0.99810	2.538000	0.85594	0.561000	0.74099	GTA	TADA2A	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Myb-like_dom	ENSG00000108264		0.393	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2A	HGNC	protein_coding	OTTHUMT00000256677.3	-	0.00	65	0	G	NM_001488		35800613	+1	tier1	-	no_errors	ENST00000225396	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
TMEM201	199953	genome.wustl.edu	37	1	9661232	9661232	+	Missense_Mutation	SNP	G	G	T	rs569987514		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:9661232G>T	ENST00000340381.6	+	5	685	c.676G>T	c.(676-678)Gcc>Tcc	p.A226S	TMEM201_ENST00000340305.5_Missense_Mutation_p.A226S|TMEM201_ENST00000377376.4_Missense_Mutation_p.A226S	NM_001130924.2	NP_001124396.2	Q5SNT2	TM201_HUMAN	transmembrane protein 201	226					fibroblast migration (GO:0010761)|nuclear migration (GO:0007097)	integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				lung(3)|upper_aerodigestive_tract(1)	4	all_lung(157;0.222)	all_epithelial(116;2.09e-14)|Renal(390;0.000469)|all_lung(118;0.000521)|Lung NSC(185;0.000744)|Colorectal(325;0.0062)|Breast(348;0.0157)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.5e-08)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|STAD - Stomach adenocarcinoma(132;0.00345)|READ - Rectum adenocarcinoma(331;0.0419)		CCTGGCCTGCGCCTTCCTACT	0.657																																																	0													73.0	74.0	74.0					1																	9661232		2203	4300	6503	SO:0001583	missense	0				CCDS30579.1, CCDS44055.1, CCDS44055.2	1p36.22	2009-11-06			ENSG00000188807	ENSG00000188807			33719	protein-coding gene	gene with protein product							Standard	NM_001130924		Approved	RP13-15M17.2, NET5	uc021ofy.1	Q5SNT2	OTTHUMG00000057457	ENST00000340381.6:c.676G>T	1.37:g.9661232G>T	ENSP00000344503:p.Ala226Ser		B9EH90|Q5SNT3	Missense_Mutation	SNP	pfam_DUF2448,pfam_Ima1_N	p.A226S	ENST00000340381.6	37	c.676	CCDS44055.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.11|14.11	2.438587|2.438587	0.43326|0.43326	.|.	.|.	ENSG00000188807|ENSG00000188807	ENST00000377376;ENST00000340305;ENST00000340381|ENST00000416541	.|.	.|.	.|.	4.98|4.98	2.37|2.37	0.29283|0.29283	.|.	0.449576|.	0.22570|.	N|.	0.058356|.	T|T	0.28995|0.28995	0.0720|0.0720	N|N	0.19112|0.19112	0.55|0.55	0.29688|0.29688	N|N	0.841153|0.841153	P;B|.	0.35481|.	0.504;0.268|.	B;B|.	0.40565|.	0.333;0.132|.	T|T	0.24693|0.24693	-1.0153|-1.0153	9|5	0.28530|.	T|.	0.3|.	-16.1182|-16.1182	9.0218|9.0218	0.36204|0.36204	0.2436:0.0:0.7564:0.0|0.2436:0.0:0.7564:0.0	.|.	226;226|.	E9PBR6;Q5SNT2-2|.	.;.|.	S|L	226|135	.|.	ENSP00000344772:A226S|.	A|R	+|+	1|2	0|0	TMEM201|TMEM201	9583819|9583819	0.988000|0.988000	0.35896|0.35896	0.987000|0.987000	0.45799|0.45799	0.835000|0.835000	0.47333|0.47333	2.757000|2.757000	0.47557|0.47557	0.837000|0.837000	0.34925|0.34925	0.563000|0.563000	0.77884|0.77884	GCC|CGC	TMEM201	-	pfam_DUF2448	ENSG00000188807		0.657	TMEM201-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM201	HGNC	protein_coding	OTTHUMT00000127672.1		0.00	68	0	G	NM_001010866		9661232	+1			no_errors	ENST00000340381	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.897	T
TMEM64	169200	genome.wustl.edu	37	8	91657797	91657797	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr8:91657797A>T	ENST00000458549.2	-	1	514	c.337T>A	c.(337-339)Tgc>Agc	p.C113S	TMEM64_ENST00000519519.1_Intron|RP11-68L18.1_ENST00000519233.1_RNA|RP11-68L18.1_ENST00000501194.2_RNA|TMEM64_ENST00000418210.2_Missense_Mutation_p.C113S	NM_001008495.3	NP_001008495.2	Q6YI46	TMM64_HUMAN	transmembrane protein 64	113					cytosolic calcium ion homeostasis (GO:0051480)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of ATPase activity (GO:0043462)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)	2			BRCA - Breast invasive adenocarcinoma(11;0.0598)			CTGCCGAGGCAGCAGCAGCGC	0.736																																																	0													7.0	13.0	11.0					8																	91657797		674	1560	2234	SO:0001583	missense	0			AL834364	CCDS34920.2, CCDS55260.1	8q21.3	2005-08-09			ENSG00000180694	ENSG00000180694			25441	protein-coding gene	gene with protein product							Standard	NM_001008495		Approved	DKFZp762C1112	uc003yen.2	Q6YI46	OTTHUMG00000157185	ENST00000458549.2:c.337T>A	8.37:g.91657797A>T	ENSP00000414786:p.Cys113Ser		B4DUC0|F5GXM4|Q2HIZ7|Q8N3G6	Missense_Mutation	SNP	pfam_SNARE_assoc	p.C113S	ENST00000458549.2	37	c.337	CCDS34920.2	8	.	.	.	.	.	.	.	.	.	.	A	14.70	2.614559	0.46631	.	.	ENSG00000180694	ENST00000458549;ENST00000418210	.	.	.	3.47	2.25	0.28309	.	0.000000	0.85682	U	0.000000	T	0.35508	0.0934	L	0.32530	0.975	0.47407	D	0.99941	P;P	0.41450	0.75;0.634	B;B	0.36335	0.222;0.111	T	0.06899	-1.0801	9	0.38643	T	0.18	.	8.5976	0.33725	0.8048:0.1951:0.0:0.0	.	113;113	F5GXM4;Q6YI46	.;TMM64_HUMAN	S	113	.	ENSP00000411951:C113S	C	-	1	0	TMEM64	91726973	0.996000	0.38824	1.000000	0.80357	0.164000	0.22412	0.804000	0.27098	0.464000	0.27142	0.254000	0.18369	TGC	TMEM64	-	NULL	ENSG00000180694		0.736	TMEM64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM64	HGNC	protein_coding	OTTHUMT00000347825.1	-	0.00	10	0	A	NM_001008495		91657797	-1	tier1	-	no_errors	ENST00000458549	ensembl	human	known	74_37	missense	85.71	1	6	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578403	7578403	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr17:7578403C>T	ENST00000269305.4	-	5	716	c.527G>A	c.(526-528)tGc>tAc	p.C176Y	TP53_ENST00000413465.2_Missense_Mutation_p.C176Y|TP53_ENST00000455263.2_Missense_Mutation_p.C176Y|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.C176Y|TP53_ENST00000359597.4_Missense_Mutation_p.C176Y|TP53_ENST00000420246.2_Missense_Mutation_p.C176Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	176	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:8829627, ECO:0000269|PubMed:9450901}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation).|CP -> FS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C176F(129)|p.C176Y(63)|p.C83F(9)|p.C44F(9)|p.C176S(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.C44Y(3)|p.C83Y(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.C176fs*65(1)|p.C176_P177delCP(1)|p.V173fs*69(1)|p.C176fs*68(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.C176del(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H178fs*3(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGTGGGGGCAGCGCCTCAC	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	267	Substitution - Missense(224)|Deletion - Frameshift(18)|Deletion - In frame(13)|Whole gene deletion(8)|Complex - deletion inframe(3)|Insertion - Frameshift(1)	lung(42)|large_intestine(38)|upper_aerodigestive_tract(36)|oesophagus(26)|breast(26)|liver(20)|ovary(19)|haematopoietic_and_lymphoid_tissue(13)|stomach(10)|central_nervous_system(9)|bone(9)|urinary_tract(7)|genital_tract(2)|skin(2)|pancreas(2)|prostate(2)|adrenal_gland(1)|vulva(1)|biliary_tract(1)|endometrium(1)											49.0	49.0	49.0					17																	7578403		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.527G>A	17.37:g.7578403C>T	ENSP00000269305:p.Cys176Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C176Y	ENST00000269305.4	37	c.527	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497871	0.85069	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99982	-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62;-10.62	5.59	4.61	0.57282	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.092184	0.85682	D	0.000000	D	0.99981	0.9994	M	0.92923	3.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.996;0.997;0.998;0.998;0.997;0.997	D	0.96187	0.9135	10	0.87932	D	0	-18.1821	13.8336	0.63395	0.1543:0.8457:0.0:0.0	.	137;176;176;83;176;176;176	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Y	176;176;176;176;176;176;165;83;44;83;44	ENSP00000410739:C176Y;ENSP00000352610:C176Y;ENSP00000269305:C176Y;ENSP00000398846:C176Y;ENSP00000391127:C176Y;ENSP00000391478:C176Y;ENSP00000425104:C44Y;ENSP00000423862:C83Y	ENSP00000269305:C176Y	C	-	2	0	TP53	7519128	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.775000	0.85489	1.472000	0.48140	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	42	0	C	NM_000546		7578403	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	78.57	6	22	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98548596	98548596	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr7:98548596C>A	ENST00000359863.4	+	38	5620	c.5411C>A	c.(5410-5412)cCa>cAa	p.P1804Q	TRRAP_ENST00000446306.3_Missense_Mutation_p.P1785Q|TRRAP_ENST00000355540.3_Missense_Mutation_p.P1786Q	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1804					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)	p.P1804Q(2)|p.P1786Q(2)		NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGAGATAACCCAGAAAGCATC	0.478																																																	4	Substitution - Missense(4)	lung(4)											241.0	223.0	229.0					7																	98548596		2203	4300	6503	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.5411C>A	7.37:g.98548596C>A	ENSP00000352925:p.Pro1804Gln		A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.P1804Q	ENST00000359863.4	37	c.5411	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.77|19.77	3.890133|3.890133	0.72524|0.72524	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.02812|.	4.15;4.15|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.056610|.	0.64402|.	D|.	0.000001|.	T|T	0.69682|0.69682	0.3138|0.3138	L|L	0.56769|0.56769	1.78|1.78	0.58432|0.58432	D|D	0.999999|0.999999	D;D;P|.	0.60575|.	0.988;0.98;0.859|.	P;P;P|.	0.59948|.	0.866;0.597;0.551|.	T|T	0.67260|0.67260	-0.5715|-0.5715	10|5	0.15952|.	T|.	0.53|.	.|.	14.4435|14.4435	0.67333|0.67333	0.1472:0.8528:0.0:0.0|0.1472:0.8528:0.0:0.0	.|.	1786;1525;1804|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	Q|K	1804;1786;1784|1526	ENSP00000352925:P1804Q;ENSP00000347733:P1786Q|.	ENSP00000347733:P1786Q|.	P|Q	+|+	2|1	0|0	TRRAP|TRRAP	98386532|98386532	0.999000|0.999000	0.42202|0.42202	0.999000|0.999000	0.59377|0.59377	0.994000|0.994000	0.84299|0.84299	3.908000|3.908000	0.56355|0.56355	2.653000|2.653000	0.90120|0.90120	0.561000|0.561000	0.74099|0.74099	CCA|CAG	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.478	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	-	0.00	100	0	C	NM_003496		98548596	+1	tier1	-	no_errors	ENST00000359863	ensembl	human	known	74_37	missense	29.46	79	33	SNP	0.998	A
TUBB2A	7280	genome.wustl.edu	37	6	3155143	3155143	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr6:3155143C>T	ENST00000333628.3	-	4	354	c.292G>A	c.(292-294)Ggg>Agg	p.G98R	TUBB2A_ENST00000489942.1_5'UTR|RP1-40E16.11_ENST00000447644.1_RNA	NM_001069.2	NP_001060.1	Q13885	TBB2A_HUMAN	tubulin, beta 2A class IIa	98					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.G98R(1)		endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CAGTTATTCCCGGCTCCACTC	0.512																																																	1	Substitution - Missense(1)	endometrium(1)											21.0	25.0	24.0					6																	3155143		2195	4297	6492	SO:0001583	missense	0			AY159127	CCDS4484.1	6p25.2	2012-10-02	2011-10-10	2005-11-03	ENSG00000137267	ENSG00000137267		"""Tubulins"""	12412	protein-coding gene	gene with protein product	"""class IIa beta-tubulin"""	615101	"""tubulin, beta polypeptide"", ""tubulin, beta 2"", ""tubulin, beta 2A"""	TUBB, TUBB2		14574404	Standard	NM_001069		Approved	dJ40E16.7	uc003mvc.3	Q13885	OTTHUMG00000014135	ENST00000333628.3:c.292G>A	6.37:g.3155143C>T	ENSP00000369703:p.Gly98Arg		Q6FGZ8|Q8IWR2	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.G98R	ENST00000333628.3	37	c.292	CCDS4484.1	6	.	.	.	.	.	.	.	.	.	.	C	15.25	2.777879	0.49786	.	.	ENSG00000137267	ENST00000333628	T	0.80214	-1.35	5.01	5.01	0.66863	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.53938	U	0.000051	D	0.93523	0.7933	H	0.97783	4.075	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.998	D;D;D	0.91635	0.935;0.999;0.99	D	0.95786	0.8821	10	0.87932	D	0	.	18.6816	0.91548	0.0:1.0:0.0:0.0	.	98;98;98	B2R6L0;Q13885;Q8N6N5	.;TBB2A_HUMAN;.	R	98	ENSP00000369703:G98R	ENSP00000369703:G98R	G	-	1	0	TUBB2A	3100142	1.000000	0.71417	0.823000	0.32752	0.722000	0.41435	7.681000	0.84073	2.491000	0.84063	0.650000	0.86243	GGG	TUBB2A	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Alpha_tubulin	ENSG00000137267		0.512	TUBB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2A	HGNC	protein_coding	OTTHUMT00000039662.1		0.00	42	0	C	NM_001069		3155143	-1			no_errors	ENST00000333628	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	T
UBIAD1	29914	genome.wustl.edu	37	1	11333860	11333860	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr1:11333860T>A	ENST00000376810.5	+	1	598	c.272T>A	c.(271-273)gTc>gAc	p.V91D	UBIAD1_ENST00000376804.2_Missense_Mutation_p.V91D	NM_013319.2	NP_037451.1	Q9Y5Z9	UBIA1_HUMAN	UbiA prenyltransferase domain containing 1	91					menaquinone biosynthetic process (GO:0009234)|ubiquinone biosynthetic process (GO:0006744)|vitamin K biosynthetic process (GO:0042371)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	antioxidant activity (GO:0016209)|prenyltransferase activity (GO:0004659)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(3)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.012)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.52e-06)|COAD - Colon adenocarcinoma(227;0.000254)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0487)		GCCGTGGCTGTCCTGGCTGTG	0.567																																																	0													119.0	114.0	116.0					1																	11333860		2203	4300	6503	SO:0001583	missense	0				CCDS129.1	1p36.22	2012-05-02			ENSG00000120942	ENSG00000120942			30791	protein-coding gene	gene with protein product	"""transitional epithelia response protein"""	611632	"""Schnyder crystalline corneal dystrophy"""	SCCD		20953171, 12497587, 11314041, 17668063, 17962451, 8894705	Standard	NM_013319		Approved	TERE1	uc001asg.3	Q9Y5Z9	OTTHUMG00000002075	ENST00000376810.5:c.272T>A	1.37:g.11333860T>A	ENSP00000366006:p.Val91Asp		B3KQG3|Q53GX3|Q5THD4	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase	p.V91D	ENST00000376810.5	37	c.272	CCDS129.1	1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.900117	0.92035	.	.	ENSG00000120942	ENST00000376810;ENST00000376804	D;D	0.93488	-3.23;-3.23	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	D	0.96470	0.8848	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	D	0.70487	0.969	D	0.96792	0.9583	10	0.59425	D	0.04	-12.3428	14.2365	0.65929	0.0:0.0:0.0:1.0	.	91	Q9Y5Z9	UBIA1_HUMAN	D	91	ENSP00000366006:V91D;ENSP00000366000:V91D	ENSP00000366000:V91D	V	+	2	0	UBIAD1	11256447	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.439000	0.80444	2.010000	0.58986	0.372000	0.22366	GTC	UBIAD1	-	pfam_UbiA_prenyltransferase	ENSG00000120942		0.567	UBIAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBIAD1	HGNC	protein_coding	OTTHUMT00000005773.1	-	0.00	73	0	T	NM_013319		11333860	+1	tier1	-	no_errors	ENST00000376810	ensembl	human	known	74_37	missense	51.92	24	27	SNP	1.000	A
UCKL1	54963	genome.wustl.edu	37	20	62572378	62572378	+	Silent	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr20:62572378G>A	ENST00000354216.6	-	10	1083	c.1041C>T	c.(1039-1041)cgC>cgT	p.R347R	UCKL1_ENST00000369908.5_Silent_p.R332R|UCKL1_ENST00000358711.3_Nonsense_Mutation_p.R364*|MIR647_ENST00000384823.1_RNA|UCKL1_ENST00000369892.3_Silent_p.R347R|MIR1914_ENST00000607800.1_RNA	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	347					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGAACTCGTCGCGACTGGTCT	0.647																																																	0													49.0	43.0	45.0					20																	62572378		2188	4296	6484	SO:0001819	synonymous_variant	0			AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.1041C>T	20.37:g.62572378G>A			B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Nonsense_Mutation	SNP	pfam_PRK/URK,pfam_CPT,superfamily_P-loop_NTPase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.R364*	ENST00000354216.6	37	c.1090	CCDS13547.1	20	.	.	.	.	.	.	.	.	.	.	G	24.9	4.579452	0.86645	.	.	ENSG00000198276	ENST00000358711	.	.	.	5.27	-10.5	0.00291	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-32.4509	3.9169	0.09227	0.3852:0.384:0.0931:0.1377	.	.	.	.	X	364	.	ENSP00000351546:R364X	R	-	1	2	UCKL1	62042822	0.000000	0.05858	0.878000	0.34440	0.838000	0.47535	-3.029000	0.00638	-1.313000	0.02303	-0.266000	0.10368	CGA	UCKL1	-	NULL	ENSG00000198276		0.647	UCKL1-001	KNOWN	basic|CCDS	protein_coding	UCKL1	HGNC	protein_coding	OTTHUMT00000080236.1	-	0.00	40	0	G	NM_017859		62572378	-1	tier1	-	no_errors	ENST00000358711	ensembl	human	known	74_37	nonsense	20.83	19	5	SNP	0.046	A
WNT5B	81029	genome.wustl.edu	37	12	1755098	1755098	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr12:1755098G>A	ENST00000397196.2	+	5	992	c.760G>A	c.(760-762)Gcc>Acc	p.A254T	WNT5B_ENST00000545747.1_3'UTR|WNT5B_ENST00000542408.1_3'UTR|WNT5B_ENST00000310594.3_Missense_Mutation_p.A254T|WNT5B_ENST00000537031.1_Missense_Mutation_p.A254T	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	254					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			CAGCGCGGCCGCCATGCGCGT	0.692																																																	0													26.0	28.0	27.0					12																	1755098		2201	4298	6499	SO:0001583	missense	0			AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.760G>A	12.37:g.1755098G>A	ENSP00000380379:p.Ala254Thr		A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt	p.A254T	ENST00000397196.2	37	c.760	CCDS8510.1	12	.	.	.	.	.	.	.	.	.	.	G	17.12	3.307114	0.60305	.	.	ENSG00000111186	ENST00000537031;ENST00000310594;ENST00000397196	T;T;T	0.75477	-0.94;-0.94;-0.94	5.14	5.14	0.70334	.	0.049807	0.85682	D	0.000000	T	0.66056	0.2751	L	0.41492	1.28	0.80722	D	1	P	0.40032	0.699	B	0.37239	0.244	T	0.70472	-0.4862	10	0.59425	D	0.04	.	13.7304	0.62783	0.0:0.0:0.8463:0.1537	.	254	Q9H1J7	WNT5B_HUMAN	T	254	ENSP00000439312:A254T;ENSP00000308887:A254T;ENSP00000380379:A254T	ENSP00000308887:A254T	A	+	1	0	WNT5B	1625359	1.000000	0.71417	0.976000	0.42696	0.470000	0.32858	7.661000	0.83786	2.668000	0.90789	0.650000	0.86243	GCC	WNT5B	-	pfam_Wnt,smart_Wnt	ENSG00000111186		0.692	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT5B	HGNC	protein_coding	OTTHUMT00000206747.2	-	0.00	50	0	G			1755098	+1	tier1	-	no_errors	ENST00000310594	ensembl	human	known	74_37	missense	30.26	53	23	SNP	0.999	A
ZFR	51663	genome.wustl.edu	37	5	32355672	32355672	+	3'UTR	DEL	T	T	-	rs377173878		TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr5:32355672delT	ENST00000265069.8	-	0	3521				ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein						multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		TCGGAGCACATTTTTTTTTTT	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.*194A>-	5.37:g.32355672delT			B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	RNA	DEL	-	NULL	ENST00000265069.8	37	NULL	CCDS34139.1	5																																																																																			ZFR	-	-	ENSG00000056097		0.328	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1		0.00	16	0	T			32355672	-1	tier1		no_errors	ENST00000510369	ensembl	human	known	74_37	rna	11.11	24	3	DEL	0.003	-
ZNF554	115196	genome.wustl.edu	37	19	2834252	2834252	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:2834252G>T	ENST00000317243.5	+	5	1217	c.1019G>T	c.(1018-1020)aGc>aTc	p.S340I		NM_001102651.1	NP_001096121.1	Q86TJ5	ZN554_HUMAN	zinc finger protein 554	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATTCTTTGAGCGAACATCAA	0.537																																																	0													67.0	74.0	72.0					19																	2834252		2067	4237	6304	SO:0001583	missense	0			AK027860	CCDS42462.1	19p13.3	2013-09-20			ENSG00000172006	ENSG00000172006		"""Zinc fingers, C2H2-type"", ""-"""	26629	protein-coding gene	gene with protein product						12477932	Standard	NM_001102651		Approved	FLJ34817	uc002lwm.2	Q86TJ5	OTTHUMG00000180493	ENST00000317243.5:c.1019G>T	19.37:g.2834252G>T	ENSP00000321132:p.Ser340Ile		Q8NAT3|Q9BWN3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S340I	ENST00000317243.5	37	c.1019	CCDS42462.1	19	.	.	.	.	.	.	.	.	.	.	G	4.056	0.008119	0.07912	.	.	ENSG00000172006	ENST00000317243	T	0.07908	3.15	2.65	0.0559	0.14317	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04634	0.0126	N	0.25426	0.745	0.09310	N	1	B	0.25272	0.122	B	0.21546	0.035	T	0.46091	-0.9216	9	0.11485	T	0.65	.	4.7922	0.13254	0.0:0.2057:0.3758:0.4185	.	340	Q86TJ5	ZN554_HUMAN	I	340	ENSP00000321132:S340I	ENSP00000321132:S340I	S	+	2	0	ZNF554	2785252	0.000000	0.05858	0.070000	0.20053	0.472000	0.32918	-1.746000	0.01829	0.437000	0.26423	0.573000	0.79308	AGC	ZNF554	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000172006		0.537	ZNF554-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF554	HGNC	protein_coding	OTTHUMT00000451598.3		0.00	23	0	G	NM_152303		2834252	+1			no_errors	ENST00000317243	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.000	T
ZNF709	163051	genome.wustl.edu	37	19	12576489	12576489	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:12576489T>C	ENST00000397732.3	-	4	418	c.247A>G	c.(247-249)Atc>Gtc	p.I83V	ZNF709_ENST00000428311.1_Missense_Mutation_p.I83V|CTD-3105H18.18_ENST00000598753.1_Intron	NM_152601.3	NP_689814.1	Q8N972	ZN709_HUMAN	zinc finger protein 709	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(3)|upper_aerodigestive_tract(3)	6						GTCTGACTGATGGTTTCTCCA	0.368																																					GBM(33;565 669 12371 29134 51667)												0													102.0	87.0	92.0					19																	12576489		1864	4107	5971	SO:0001583	missense	0			AK095600	CCDS42504.1	19p13.2	2013-01-08			ENSG00000242852	ENSG00000242852		"""Zinc fingers, C2H2-type"", ""-"""	20629	protein-coding gene	gene with protein product							Standard	NM_152601		Approved	FLJ38281	uc002mtv.4	Q8N972	OTTHUMG00000156406	ENST00000397732.3:c.247A>G	19.37:g.12576489T>C	ENSP00000380840:p.Ile83Val		A8K4E6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Znf_C2H2_jaz,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I83V	ENST00000397732.3	37	c.247	CCDS42504.1	19	.	.	.	.	.	.	.	.	.	.	T	9.062	0.994703	0.19043	.	.	ENSG00000242852;ENSG00000242852;ENSG00000196826	ENST00000397732;ENST00000455490;ENST00000428311	T;T;T	0.05382	3.45;5.31;3.45	3.1	-6.19	0.02078	Krueppel-associated box (1);	2.928650	0.01777	N	0.031517	T	0.03871	0.0109	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37291	-0.9712	10	0.59425	D	0.04	.	8.1297	0.31020	0.1335:0.24:0.0:0.6266	.	83	Q8N972	ZN709_HUMAN	V	83;112;83	ENSP00000380840:I83V;ENSP00000398085:I112V;ENSP00000404127:I83V	ENSP00000404127:I83V	I	-	1	0	ZNF709;CTD-2192J16.17	12437489	0.000000	0.05858	0.000000	0.03702	0.477000	0.33069	-0.273000	0.08548	-3.489000	0.00153	0.260000	0.18958	ATC	ZNF709	-	pfscan_Krueppel-associated_box	ENSG00000242852		0.368	ZNF709-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF709	HGNC	protein_coding	OTTHUMT00000344088.1	-	0.00	79	0	T	NM_152601		12576489	-1	tier1	-	no_errors	ENST00000397732	ensembl	human	known	74_37	missense	51.72	28	30	SNP	0.000	C
ZNF221	7638	genome.wustl.edu	37	19	44470083	44470083	+	Silent	SNP	C	C	T			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr19:44470083C>T	ENST00000251269.5	+	6	757	c.429C>T	c.(427-429)agC>agT	p.S143S	ZNF221_ENST00000587682.1_Silent_p.S143S|ZNF221_ENST00000592350.1_Silent_p.S143S	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TAAGGAACAGCTCTCAGTTCT	0.443																																																	0													105.0	93.0	97.0					19																	44470083		2203	4300	6503	SO:0001819	synonymous_variant	0			AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.429C>T	19.37:g.44470083C>T			B2RAI6|Q2M2H2|Q9P1U8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S143	ENST00000251269.5	37	c.429	CCDS12633.1	19																																																																																			ZNF221	-	NULL	ENSG00000159905		0.443	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF221	HGNC	protein_coding	OTTHUMT00000460068.1	-	0.00	76	0	C			44470083	+1	tier1	-	no_errors	ENST00000251269	ensembl	human	known	74_37	silent	40.00	15	10	SNP	0.001	T
ZNF804B	219578	genome.wustl.edu	37	7	88963384	88963384	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49O-01A-11D-A247-09	TCGA-LN-A49O-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4a309e69-3970-434f-8504-fbd71533c8f7	d8f34a63-8393-4ded-b6ce-58e16e452144	g.chr7:88963384C>A	ENST00000333190.4	+	4	1697	c.1088C>A	c.(1087-1089)gCa>gAa	p.A363E		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	363							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			CCATGCCAAGCAAATGCTTCC	0.388										HNSCC(36;0.09)																																							0													41.0	46.0	44.0					7																	88963384		2203	4300	6503	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.1088C>A	7.37:g.88963384C>A	ENSP00000329638:p.Ala363Glu		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.A363E	ENST00000333190.4	37	c.1088	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	C	6.201	0.405295	0.11754	.	.	ENSG00000182348	ENST00000333190	T	0.05139	3.49	5.19	2.32	0.28847	.	0.340181	0.25264	N	0.031938	T	0.07863	0.0197	L	0.54323	1.7	0.09310	N	0.999997	B	0.12630	0.006	B	0.12156	0.007	T	0.22661	-1.0210	10	0.72032	D	0.01	-0.1941	10.0934	0.42460	0.398:0.4738:0.1283:0.0	.	363	A4D1E1	Z804B_HUMAN	E	363	ENSP00000329638:A363E	ENSP00000329638:A363E	A	+	2	0	ZNF804B	88801320	0.085000	0.21516	0.556000	0.28293	0.945000	0.59286	0.738000	0.26158	0.320000	0.23234	-0.169000	0.13324	GCA	ZNF804B	-	NULL	ENSG00000182348		0.388	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	22	0	C	NM_181646		88963384	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.213	A
