#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA4	24	genome.wustl.edu	37	1	94502905	94502905	+	Splice_Site	SNP	C	C	A	rs529982548		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:94502905C>A	ENST00000370225.3	-	25	3695	c.3609G>T	c.(3607-3609)ggG>ggT	p.G1203G		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1203					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)	p.G1203G(1)		NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATTTACATCCCCTAGGACAA	0.443																																																	1	Substitution - coding silent(1)	lung(1)											74.0	73.0	73.0					1																	94502905		2203	4300	6503	SO:0001630	splice_region_variant	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3608-1G>T	1.37:g.94502905C>A			O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.G1203	ENST00000370225.3	37	c.3609	CCDS747.1	1																																																																																			ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.443	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1		0.00	18	0	C	NM_000350	Silent	94502905	-1			no_errors	ENST00000370225	ensembl	human	known	74_37	silent	12.50	21	3	SNP	0.997	A
ACBD5	91452	genome.wustl.edu	37	10	27497335	27497335	+	Missense_Mutation	SNP	C	C	T	rs543720340		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:27497335C>T	ENST00000375888.1	-	10	1335	c.1271G>A	c.(1270-1272)cGg>cAg	p.R424Q	ACBD5_ENST00000375897.3_Missense_Mutation_p.R238Q|ACBD5_ENST00000396271.3_Missense_Mutation_p.R415Q|ACBD5_ENST00000375901.1_Missense_Mutation_p.R306Q|ACBD5_ENST00000476758.1_5'UTR|ACBD5_ENST00000375905.4_Missense_Mutation_p.R380Q			Q5T8D3	ACBD5_HUMAN	acyl-CoA binding domain containing 5	424					peroxisome degradation (GO:0030242)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisome (GO:0005777)	fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			breast(1)|endometrium(1)|large_intestine(3)|lung(7)|prostate(1)	13						TCCCACCTGCCGGCCCTTGGT	0.502																																																	0													79.0	74.0	76.0					10																	27497335		2203	4300	6503	SO:0001583	missense	0			AF505653	CCDS7154.1, CCDS44368.1, CCDS73079.1	10p12.1	2010-04-30	2010-04-30		ENSG00000107897	ENSG00000107897			23338	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 5"""			12056414	Standard	NR_024150		Approved	DKFZp434A2417, KIAA1996	uc010qdp.2	Q5T8D3	OTTHUMG00000017854	ENST00000375888.1:c.1271G>A	10.37:g.27497335C>T	ENSP00000365049:p.Arg424Gln		B3KQ56|D3DRW0|Q5T8D4|Q5T8E1|Q5T8E2|Q86UV1|Q8N6E3|Q9UFB5	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,pirsf_M-assoc_diazepam-bd-inh,prints_Acyl-CoA-binding_protein	p.R424Q	ENST00000375888.1	37	c.1271		10	.	.	.	.	.	.	.	.	.	.	C	13.68	2.308574	0.40895	.	.	ENSG00000107897	ENST00000375889;ENST00000396271;ENST00000375905;ENST00000375901;ENST00000375897;ENST00000375888	D;T;T;T;T	0.84589	-1.87;2.2;1.46;1.44;2.44	5.63	2.8	0.32819	.	0.579935	0.19329	N	0.116927	T	0.80529	0.4640	M	0.63428	1.95	0.24898	N	0.992123	P;P;P;P	0.45957	0.869;0.746;0.63;0.63	B;B;B;B	0.38428	0.273;0.273;0.141;0.241	T	0.69139	-0.5224	10	0.35671	T	0.21	-5.0147	11.0565	0.47922	0.0:0.8:0.0:0.2	.	415;238;413;424	Q5T8D3-3;B7Z2A7;B7Z2R7;Q5T8D3	.;.;.;ACBD5_HUMAN	Q	421;415;380;306;238;424	ENSP00000379568:R415Q;ENSP00000365070:R380Q;ENSP00000365066:R306Q;ENSP00000365062:R238Q;ENSP00000365049:R424Q	ENSP00000365049:R424Q	R	-	2	0	ACBD5	27537341	0.985000	0.35326	0.953000	0.39169	0.821000	0.46438	1.265000	0.33027	0.420000	0.25954	0.585000	0.79938	CGG	ACBD5	-	pirsf_M-assoc_diazepam-bd-inh	ENSG00000107897		0.502	ACBD5-005	KNOWN	basic	protein_coding	ACBD5	HGNC	protein_coding	OTTHUMT00000047314.1	-	0.00	31	0	C	NM_145698		27497335	-1	tier1	-	no_errors	ENST00000375888	ensembl	human	known	74_37	missense	46.15	35	30	SNP	0.895	T
ACOT11	26027	genome.wustl.edu	37	1	55064996	55064996	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:55064996G>A	ENST00000371316.3	+	8	874	c.792G>A	c.(790-792)ctG>ctA	p.L264L	ACOT11_ENST00000343744.2_Silent_p.L264L|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	264	Acyl coenzyme A hydrolase 2.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						ACCCTACGCTGAAGGCCATTG	0.582																																					Ovarian(148;1440 1861 22015 32453 51933)												0													105.0	101.0	102.0					1																	55064996		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.792G>A	1.37:g.55064996G>A			B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Silent	SNP	pfam_START_lipid-bd_dom,pfam_Thioestr_supf,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.L264	ENST00000371316.3	37	c.792	CCDS592.1	1																																																																																			ACOT11	-	pfam_Thioestr_supf	ENSG00000162390		0.582	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	-	0.00	26	0	G	NM_015547		55064996	+1	tier1	-	no_errors	ENST00000371316	ensembl	human	known	74_37	silent	37.70	38	23	SNP	1.000	A
ACSS2	55902	genome.wustl.edu	37	20	33508430	33508430	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:33508430G>C	ENST00000360596.2	+	9	1272	c.1061G>C	c.(1060-1062)tGg>tCg	p.W354S	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.W304S|ACSS2_ENST00000253382.5_Missense_Mutation_p.W367S	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	354					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GATGTGTTCTGGTGCACGGCA	0.522																																																	0													214.0	166.0	182.0					20																	33508430		2203	4300	6503	SO:0001583	missense	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1061G>C	20.37:g.33508430G>C	ENSP00000353804:p.Trp354Ser		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.W367S	ENST00000360596.2	37	c.1100	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195719	0.78902	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.40476	1.03;1.03;1.03	5.22	5.22	0.72569	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.73729	0.3624	M	0.92317	3.295	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.80589	-0.1315	10	0.87932	D	0	-21.8247	18.9627	0.92682	0.0:0.0:1.0:0.0	.	367;354	Q5QPH3;Q9NR19	.;ACSA_HUMAN	S	304;354;352;62;367	ENSP00000337190:W304S;ENSP00000353804:W354S;ENSP00000253382:W367S	ENSP00000253382:W367S	W	+	2	0	ACSS2	32972091	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.715000	0.92844	0.655000	0.94253	TGG	ACSS2	-	pfam_AMP-dep_Synth/Lig	ENSG00000131069		0.522	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	22	0	G	NM_018677		33508430	+1	tier1	-	no_errors	ENST00000253382	ensembl	human	known	74_37	missense	29.03	22	9	SNP	1.000	C
ACSS2	55902	genome.wustl.edu	37	20	33508850	33508850	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:33508850G>A	ENST00000360596.2	+	10	1396	c.1185G>A	c.(1183-1185)tgG>tgA	p.W395*	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Nonsense_Mutation_p.W345*|ACSS2_ENST00000253382.5_Nonsense_Mutation_p.W408*	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	395					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	ACCGCCTGTGGAGCATTGTGG	0.512																																																	0													205.0	187.0	193.0					20																	33508850		2203	4300	6503	SO:0001587	stop_gained	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1185G>A	20.37:g.33508850G>A	ENSP00000353804:p.Trp395*		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Nonsense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.W408*	ENST00000360596.2	37	c.1224	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	38	7.133839	0.98085	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.1143	19.6556	0.95837	0.0:0.0:1.0:0.0	.	.	.	.	X	345;395;393;103;408	.	ENSP00000253382:W408X	W	+	3	0	ACSS2	32972511	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	9.657000	0.98554	2.882000	0.98803	0.655000	0.94253	TGG	ACSS2	-	pfam_AMP-dep_Synth/Lig	ENSG00000131069		0.512	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	44	0	G	NM_018677		33508850	+1	tier1	-	no_errors	ENST00000253382	ensembl	human	known	74_37	nonsense	32.65	33	16	SNP	1.000	A
ACSS2	55902	genome.wustl.edu	37	20	33509173	33509173	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:33509173G>A	ENST00000360596.2	+	11	1529	c.1318G>A	c.(1318-1320)Gaa>Aaa	p.E440K	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.E390K|ACSS2_ENST00000253382.5_Missense_Mutation_p.E453K	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	440					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CACAGTGGGTGAACCCATCAA	0.592																																																	0													71.0	72.0	71.0					20																	33509173		2203	4300	6503	SO:0001583	missense	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1318G>A	20.37:g.33509173G>A	ENSP00000353804:p.Glu440Lys		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E453K	ENST00000360596.2	37	c.1357	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.438926	0.96168	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.58358	0.34;2.4;2.4	5.52	5.52	0.82312	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.82958	0.5150	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87980	0.2742	10	0.87932	D	0	-11.0455	19.6361	0.95733	0.0:0.0:1.0:0.0	.	453;440	Q5QPH3;Q9NR19	.;ACSA_HUMAN	K	390;440;438;148;453	ENSP00000337190:E390K;ENSP00000353804:E440K;ENSP00000253382:E453K	ENSP00000253382:E453K	E	+	1	0	ACSS2	32972834	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.878000	0.98634	0.650000	0.86243	GAA	ACSS2	-	pfam_AMP-dep_Synth/Lig	ENSG00000131069		0.592	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	30	0	G	NM_018677		33509173	+1	tier1	-	no_errors	ENST00000253382	ensembl	human	known	74_37	missense	27.78	39	15	SNP	1.000	A
ACSS2	55902	genome.wustl.edu	37	20	33509628	33509628	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:33509628G>A	ENST00000360596.2	+	13	1718	c.1507G>A	c.(1507-1509)Gag>Aag	p.E503K	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.E453K|ACSS2_ENST00000253382.5_Missense_Mutation_p.E516K	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	503					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AATCCTGAATGAGTCCGGGGA	0.522																																																	0													298.0	297.0	298.0					20																	33509628		2203	4300	6503	SO:0001583	missense	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1507G>A	20.37:g.33509628G>A	ENSP00000353804:p.Glu503Lys		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E516K	ENST00000360596.2	37	c.1546	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379579	0.82682	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.44881	0.91;2.68;2.68	5.37	5.37	0.77165	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.57961	0.2089	M	0.81239	2.535	0.80722	D	1	B;B	0.32324	0.364;0.364	B;B	0.42692	0.223;0.395	T	0.57021	-0.7882	10	0.40728	T	0.16	-24.9876	19.3116	0.94189	0.0:0.0:1.0:0.0	.	516;503	Q5QPH3;Q9NR19	.;ACSA_HUMAN	K	453;503;501;211;516	ENSP00000337190:E453K;ENSP00000353804:E503K;ENSP00000253382:E516K	ENSP00000253382:E516K	E	+	1	0	ACSS2	32973289	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.601000	0.98297	2.808000	0.96608	0.650000	0.86243	GAG	ACSS2	-	pfam_AMP-dep_Synth/Lig	ENSG00000131069		0.522	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	83	0	G	NM_018677		33509628	+1	tier1	-	no_errors	ENST00000253382	ensembl	human	known	74_37	missense	43.48	65	50	SNP	1.000	A
ACSS2	55902	genome.wustl.edu	37	20	33509640	33509640	+	Missense_Mutation	SNP	G	G	A	rs372652815		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:33509640G>A	ENST00000360596.2	+	13	1730	c.1519G>A	c.(1519-1521)Gag>Aag	p.E507K	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.E457K|ACSS2_ENST00000253382.5_Missense_Mutation_p.E520K	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	507					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GTCCGGGGAAGAGTTGGAAGG	0.507																																																	0								G	LYS/GLU,LYS/GLU,LYS/GLU	0,4406		0,0,2203	276.0	274.0	275.0		1558,1234,1519	5.4	1.0	20		275	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ACSS2	NM_001076552.2,NM_001242393.1,NM_018677.3	56,56,56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	520/715,412/607,507/702	33509640	1,13005	2203	4300	6503	SO:0001583	missense	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1519G>A	20.37:g.33509640G>A	ENSP00000353804:p.Glu507Lys		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E520K	ENST00000360596.2	37	c.1558	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743360	0.89663	0.0	1.16E-4	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.52295	0.67;2.74;2.74	5.37	5.37	0.77165	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.71600	0.3359	M	0.85710	2.77	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.73708	0.981;0.969	T	0.68228	-0.5464	10	0.23891	T	0.37	-15.0705	19.3116	0.94189	0.0:0.0:1.0:0.0	.	520;507	Q5QPH3;Q9NR19	.;ACSA_HUMAN	K	457;507;505;215;520	ENSP00000337190:E457K;ENSP00000353804:E507K;ENSP00000253382:E520K	ENSP00000253382:E520K	E	+	1	0	ACSS2	32973301	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.601000	0.98297	2.808000	0.96608	0.650000	0.86243	GAG	ACSS2	-	pfam_AMP-dep_Synth/Lig	ENSG00000131069		0.507	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	87	0	G	NM_018677		33509640	+1	tier1	-	no_errors	ENST00000253382	ensembl	human	known	74_37	missense	43.12	62	47	SNP	1.000	A
ACSS2	55902	genome.wustl.edu	37	20	33509658	33509658	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:33509658G>A	ENST00000360596.2	+	13	1748	c.1537G>A	c.(1537-1539)Gaa>Aaa	p.E513K	ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Missense_Mutation_p.E463K|ACSS2_ENST00000253382.5_Missense_Mutation_p.E526K	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2	513					acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	AGGTGAAGCTGAAGGTTATCT	0.488																																																	0													235.0	234.0	235.0					20																	33509658		2203	4300	6503	SO:0001583	missense	0			AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.1537G>A	20.37:g.33509658G>A	ENSP00000353804:p.Glu513Lys		A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E526K	ENST00000360596.2	37	c.1576	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.417585	0.96092	.	.	ENSG00000131069	ENST00000336325;ENST00000360596;ENST00000374693;ENST00000542204;ENST00000253382	T;T;T	0.40225	1.04;1.04;1.04	5.37	5.37	0.77165	AMP-dependent synthetase/ligase (1);	0.046985	0.85682	D	0.000000	T	0.63283	0.2498	M	0.68728	2.09	0.80722	D	1	P;P	0.44195	0.828;0.828	P;P	0.59357	0.777;0.856	T	0.63699	-0.6578	10	0.87932	D	0	-14.2892	19.3116	0.94189	0.0:0.0:1.0:0.0	.	526;513	Q5QPH3;Q9NR19	.;ACSA_HUMAN	K	463;513;511;221;526	ENSP00000337190:E463K;ENSP00000353804:E513K;ENSP00000253382:E526K	ENSP00000253382:E526K	E	+	1	0	ACSS2	32973319	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.601000	0.98297	2.808000	0.96608	0.650000	0.86243	GAA	ACSS2	-	pfam_AMP-dep_Synth/Lig	ENSG00000131069		0.488	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	HGNC	protein_coding	OTTHUMT00000078823.3	-	0.00	87	0	G	NM_018677		33509658	+1	tier1	-	no_errors	ENST00000253382	ensembl	human	known	74_37	missense	41.18	60	42	SNP	1.000	A
ACTN2	88	genome.wustl.edu	37	1	236914838	236914838	+	Silent	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:236914838C>A	ENST00000366578.4	+	15	1891	c.1725C>A	c.(1723-1725)atC>atA	p.I575I	ACTN2_ENST00000542672.1_Silent_p.I575I|ACTN2_ENST00000546208.1_Silent_p.I69I	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	575					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GGCAGTCCATCATGGCCATCC	0.547																																																	0													100.0	84.0	89.0					1																	236914838		2203	4300	6503	SO:0001819	synonymous_variant	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1725C>A	1.37:g.236914838C>A			B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.I575	ENST00000366578.4	37	c.1725	CCDS1613.1	1																																																																																			ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.547	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	-	0.00	76	0	C	NM_001103		236914838	+1	tier1	-	no_errors	ENST00000366578	ensembl	human	known	74_37	silent	23.02	97	29	SNP	0.571	A
ADAM8	101	genome.wustl.edu	37	10	135086008	135086008	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:135086008C>T	ENST00000445355.3	-	9	837	c.787G>A	c.(787-789)Gac>Aac	p.D263N	ADAM8_ENST00000485491.2_Missense_Mutation_p.D224N|ADAM8_ENST00000559180.1_5'Flank|ADAM8_ENST00000415217.3_Missense_Mutation_p.D263N	NM_001109.4	NP_001100.3	P78325	ADAM8_HUMAN	ADAM metallopeptidase domain 8	263	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				activation of MAPK activity involved in innate immune response (GO:0035419)|angiogenesis (GO:0001525)|cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration involved in inflammatory response (GO:0002523)|lymphocyte chemotaxis (GO:0048247)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of bone resorption (GO:0045780)|positive regulation of cell adhesion (GO:0045785)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of fibronectin-dependent thymocyte migration (GO:2000415)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of neutrophil extravasation (GO:2000391)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein processing (GO:0010954)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|regulation of cell-cell adhesion (GO:0022407)|single organismal cell-cell adhesion (GO:0016337)	alpha9-beta1 integrin-ADAM8 complex (GO:0071133)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dense core granule membrane (GO:0032127)|integral component of plasma membrane (GO:0005887)|phagolysosome (GO:0032010)|plasma membrane (GO:0005886)|podosome (GO:0002102)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein self-association (GO:0043621)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)	17		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;7.72e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.23e-06)|Epithelial(32;1.02e-05)		ACACTGGGGTCGGGGCTGACG	0.592																																																	0													95.0	83.0	87.0					10																	135086008		2201	4300	6501	SO:0001583	missense	0			D26579	CCDS31319.2, CCDS58102.1, CCDS58103.1	10q26.3	2014-03-20	2005-08-18		ENSG00000151651	ENSG00000151651		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	215	protein-coding gene	gene with protein product		602267	"""a disintegrin and metalloproteinase domain 8"""			9126482	Standard	NM_001109		Approved	CD156, MS2, CD156a	uc021qbe.1	P78325	OTTHUMG00000019309	ENST00000445355.3:c.787G>A	10.37:g.135086008C>T	ENSP00000453302:p.Asp263Asn		B4DVM6|H0YL36|H0YLR0|H0YN39	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,pfam_ADAM_Cys-rich,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D263N	ENST00000445355.3	37	c.787	CCDS31319.2	10																																																																																			ADAM8	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000151651		0.592	ADAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM8	HGNC	protein_coding	OTTHUMT00000051118.4	-	0.00	75	0	C	NM_001109		135086008	-1	tier1	-	no_errors	ENST00000445355	ensembl	human	known	74_37	missense	70.00	21	49	SNP	0.000	T
AFF3	3899	genome.wustl.edu	37	2	100218011	100218013	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:100218011_100218013delGCT	ENST00000409236.2	-	12	1367_1369	c.1255_1257delAGC	c.(1255-1257)agcdel	p.S419del	AFF3_ENST00000356421.2_In_Frame_Del_p.S444del|AFF3_ENST00000317233.4_In_Frame_Del_p.S419del|AFF3_ENST00000409579.1_In_Frame_Del_p.S444del			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	419	Poly-Ser.				embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						tgctgctgccgctgctgctgctg	0.685																																																	0									,	365,3157		33,299,1429					,	-5.4	0.9			10	878,6286		79,720,2783	no	coding,coding	AFF3	NM_002285.2,NM_001025108.1	,	112,1019,4212	A1A1,A1R,RR		12.2557,10.3634,11.632	,	,		1243,9443				SO:0001651	inframe_deletion	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.1255_1257delAGC	2.37:g.100218020_100218022delGCT	ENSP00000387207:p.Ser419del		B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	In_Frame_Del	DEL	pfam_TF_AF4/FMR2	p.S444in_frame_del	ENST00000409236.2	37	c.1332_1330	CCDS42723.1	2																																																																																			AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.685	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3		0.00	33	0	GCT	NM_002285		100218013	-1	tier1		no_errors	ENST00000356421	ensembl	human	known	74_37	in_frame_del	12.50	35	5	DEL	1.000:1.000:1.000	-
AK3	50808	genome.wustl.edu	37	9	4719272	4719272	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:4719272C>T	ENST00000381809.3	-	3	537	c.307G>A	c.(307-309)Gat>Aat	p.D103N	AK3_ENST00000359883.2_Missense_Mutation_p.D33N|AK3_ENST00000447596.4_Missense_Mutation_p.D63N	NM_016282.3	NP_057366.2	P27144	KAD4_HUMAN	adenylate kinase 3	101					ADP biosynthetic process (GO:0006172)|AMP metabolic process (GO:0046033)|ATP metabolic process (GO:0046034)|brain development (GO:0007420)|GTP metabolic process (GO:0046039)|liver development (GO:0001889)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|response to drug (GO:0042493)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside triphosphate adenylate kinase activity (GO:0046899)			large_intestine(2)|lung(1)|ovary(2)	5	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)	Adefovir Dipivoxil(DB00718)|Tenofovir(DB00300)	TAAGCTCTATCTAGGGCTTCT	0.463																																																	0													79.0	68.0	72.0					9																	4719272		2203	4300	6503	SO:0001583	missense	0			BC013771	CCDS6455.1, CCDS56561.1, CCDS56562.1	9p24.1	2010-09-29	2004-06-11	2005-04-07	ENSG00000147853	ENSG00000147853			17376	protein-coding gene	gene with protein product		609290	"""adenylate kinase 6"", ""adenylate kinase 3 like 1"""	AK6, AK3L1		8288, 182062	Standard	NM_001199852		Approved	AKL3L1	uc003ziq.2	Q9UIJ7	OTTHUMG00000019472	ENST00000381809.3:c.307G>A	9.37:g.4719272C>T	ENSP00000371230:p.Asp103Asn		B2R927|D3DQ62|Q6IBH4|Q6NXQ5|Q8IUU9	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_Adenylate_kinase_lid-dom,superfamily_P-loop_NTPase,superfamily_Adenylate_kinase_lid-dom,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	p.D103N	ENST00000381809.3	37	c.307	CCDS6455.1	9	.	.	.	.	.	.	.	.	.	.	c	11.90	1.777756	0.31502	.	.	ENSG00000147853	ENST00000381809;ENST00000359883;ENST00000474822;ENST00000447596	T;T;T	0.78595	-1.19;-1.19;-1.19	5.66	2.86	0.33363	.	0.134734	0.64402	D	0.000004	T	0.68238	0.2979	L	0.46157	1.445	0.41440	D	0.987912	B;B	0.09022	0.002;0.002	B;B	0.15870	0.014;0.007	T	0.63825	-0.6549	10	0.51188	T	0.08	-8.3301	7.894	0.29695	0.0:0.6865:0.1196:0.194	.	63;103	E7ET30;Q9UIJ7	.;KAD3_HUMAN	N	103;33;33;63	ENSP00000371230:D103N;ENSP00000352948:D33N;ENSP00000413933:D63N	ENSP00000352948:D33N	D	-	1	0	AK3	4709272	1.000000	0.71417	0.876000	0.34364	0.311000	0.27955	2.412000	0.44609	0.778000	0.33520	-0.121000	0.15023	GAT	AK3	-	pfam_Adenylate_kin,superfamily_P-loop_NTPase,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	ENSG00000147853		0.463	AK3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AK3	HGNC	protein_coding	OTTHUMT00000051585.1	-	0.00	39	0	C	NM_016282		4719272	-1	tier1	-	no_errors	ENST00000381809	ensembl	human	known	74_37	missense	73.91	6	17	SNP	1.000	T
AKAP13	11214	genome.wustl.edu	37	15	86262365	86262365	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr15:86262365C>T	ENST00000394518.2	+	23	6155	c.6060C>T	c.(6058-6060)taC>taT	p.Y2020Y	AKAP13_ENST00000394510.2_Silent_p.Y265Y|AKAP13_ENST00000560579.1_3'UTR|AKAP13_ENST00000361243.2_Silent_p.Y2024Y	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2020	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						GTGGTGTGTACAGCCAGGGGA	0.453																																					Melanoma(94;603 1453 3280 32295 32951)												0													133.0	115.0	121.0					15																	86262365		2202	4299	6501	SO:0001819	synonymous_variant	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.6060C>T	15.37:g.86262365C>T			Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.Y2024	ENST00000394518.2	37	c.6072	CCDS32319.1	15																																																																																			AKAP13	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000170776		0.453	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	55	0	C	NM_007200		86262365	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	silent	43.28	38	29	SNP	1.000	T
AMBRA1	55626	genome.wustl.edu	37	11	46563784	46563784	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:46563784C>T	ENST00000458649.2	-	7	2201	c.1783G>A	c.(1783-1785)Gag>Aag	p.E595K	AMBRA1_ENST00000528950.1_Missense_Mutation_p.E595K|AMBRA1_ENST00000298834.3_Missense_Mutation_p.E595K|AMBRA1_ENST00000314845.3_Missense_Mutation_p.E505K|AMBRA1_ENST00000426438.1_Missense_Mutation_p.E595K|AMBRA1_ENST00000534300.1_Missense_Mutation_p.E595K|AMBRA1_ENST00000533727.1_Missense_Mutation_p.E505K			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	595	Ser-rich.				autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GAACTAGCCTCGCCAGAGGAG	0.587																																																	0													64.0	54.0	57.0					11																	46563784		2201	4299	6500	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.1783G>A	11.37:g.46563784C>T	ENSP00000415327:p.Glu595Lys		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E595K	ENST00000458649.2	37	c.1783		11	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851959	0.51270	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.72394	-0.5;-0.65;-0.21;-0.34;-0.21;-0.36;-0.34	5.73	5.73	0.89815	.	0.221865	0.45126	D	0.000384	T	0.63640	0.2528	N	0.19112	0.55	0.35268	D	0.780179	P;P;P;P;D;P	0.62365	0.682;0.938;0.938;0.787;0.991;0.938	B;B;B;B;P;B	0.46320	0.097;0.164;0.212;0.14;0.512;0.164	T	0.75042	-0.3457	10	0.72032	D	0.01	.	17.3978	0.87451	0.0:1.0:0.0:0.0	.	595;595;595;505;505;505	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	K	505;505;595;595;595;505;595;595	ENSP00000318313:E505K;ENSP00000433372:E505K;ENSP00000431926:E595K;ENSP00000410899:E595K;ENSP00000298834:E595K;ENSP00000415327:E595K;ENSP00000433945:E595K	ENSP00000298834:E595K	E	-	1	0	AMBRA1	46520360	0.999000	0.42202	0.997000	0.53966	0.981000	0.71138	4.176000	0.58269	2.689000	0.91719	0.655000	0.94253	GAG	AMBRA1	-	NULL	ENSG00000110497		0.587	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	43	0	C	NM_017749		46563784	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	33.85	43	22	SNP	0.999	T
ANKRD24	170961	genome.wustl.edu	37	19	4219681	4219681	+	Missense_Mutation	SNP	G	G	A	rs546339422		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:4219681G>A	ENST00000600132.1	+	19	3373	c.3097G>A	c.(3097-3099)Gag>Aag	p.E1033K	ANKRD24_ENST00000262970.5_Missense_Mutation_p.E1123K|ANKRD24_ENST00000318934.4_Missense_Mutation_p.E1033K	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1033								p.E1033K(1)|p.E598K(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		GCTACGGACCGAGGCGGAAAG	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		17055	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	large_intestine(2)											41.0	50.0	47.0					19																	4219681		2112	4238	6350	SO:0001583	missense	0			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3097G>A	19.37:g.4219681G>A	ENSP00000471252:p.Glu1033Lys		O75268|O95781	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1033K	ENST00000600132.1	37	c.3097	CCDS45925.1	19	.	.	.	.	.	.	.	.	.	.	g	9.701	1.154577	0.21371	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.29655	1.57;1.56	3.79	3.79	0.43588	.	.	.	.	.	T	0.15912	0.0383	L	0.27053	0.805	0.28627	N	0.907878	P	0.39181	0.663	B	0.31495	0.131	T	0.04915	-1.0918	9	0.02654	T	1	.	11.8657	0.52493	0.0:0.0:1.0:0.0	.	1033	Q8TF21	ANR24_HUMAN	K	1033;1123	ENSP00000321731:E1033K;ENSP00000262970:E1123K	ENSP00000262970:E1123K	E	+	1	0	ANKRD24	4170681	0.999000	0.42202	0.849000	0.33467	0.435000	0.31806	3.400000	0.52594	2.080000	0.62538	0.313000	0.20887	GAG	ANKRD24	-	NULL	ENSG00000089847		0.667	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD24	HGNC	protein_coding	OTTHUMT00000458188.1	-	0.00	36	0	G	XM_114000		4219681	+1	tier1	-	no_errors	ENST00000318934	ensembl	human	known	74_37	missense	33.78	49	25	SNP	0.941	A
ANKRD30A	91074	genome.wustl.edu	37	10	37486225	37486225	+	Silent	SNP	A	A	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:37486225A>C	ENST00000602533.1	+	28	2562	c.2463A>C	c.(2461-2463)ccA>ccC	p.P821P	ANKRD30A_ENST00000374660.1_Silent_p.P940P|ANKRD30A_ENST00000361713.1_Silent_p.P821P			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	877					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CCGAGAAGCCATCTGCCTTCG	0.323																																																	0													189.0	158.0	168.0					10																	37486225		1811	4084	5895	SO:0001819	synonymous_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.2463A>C	10.37:g.37486225A>C			Q5W025	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P821	ENST00000602533.1	37	c.2463		10																																																																																			ANKRD30A	-	NULL	ENSG00000148513		0.323	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	139	0	A	NM_052997		37486225	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	silent	41.62	108	77	SNP	0.000	C
ANKS1B	56899	genome.wustl.edu	37	12	99640579	99640579	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:99640579C>T	ENST00000547776.2	-	13	1819	c.1820G>A	c.(1819-1821)gGc>gAc	p.G607D	ANKS1B_ENST00000329257.7_Missense_Mutation_p.G607D|ANKS1B_ENST00000547010.1_Missense_Mutation_p.G187D|ANKS1B_ENST00000550833.1_5'UTR	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	607						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		ATGGAGCAGGCCTGCAAATTG	0.453																																																	0													151.0	146.0	148.0					12																	99640579		1885	4098	5983	SO:0001583	missense	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.1820G>A	12.37:g.99640579C>T	ENSP00000449629:p.Gly607Asp		A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.G607D	ENST00000547776.2	37	c.1820	CCDS55872.1	12	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470256	0.84533	.	.	ENSG00000185046	ENST00000547776;ENST00000547010;ENST00000329257;ENST00000538702	T;D;T	0.89123	-1.14;-2.47;-1.14	5.62	5.62	0.85841	.	0.059325	0.64402	D	0.000003	D	0.93278	0.7858	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	1.0;0.994	D;P	0.97110	1.0;0.898	D	0.92141	0.5720	9	.	.	.	-7.3731	18.2041	0.89848	0.0:1.0:0.0:0.0	.	187;607	Q7Z6G8-6;Q7Z6G8	.;ANS1B_HUMAN	D	607;187;607;186	ENSP00000449629:G607D;ENSP00000448512:G187D;ENSP00000331381:G607D	.	G	-	2	0	ANKS1B	98164710	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	6.815000	0.75242	2.813000	0.96785	0.561000	0.74099	GGC	ANKS1B	-	NULL	ENSG00000185046		0.453	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3		0.00	18	0	C	NM_020140		99640579	-1			no_errors	ENST00000329257	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
ANKS3	124401	genome.wustl.edu	37	16	4777008	4777008	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:4777008T>C	ENST00000304283.4	-	4	635	c.341A>G	c.(340-342)aAc>aGc	p.N114S	ANKS3_ENST00000446014.2_Intron|ANKS3_ENST00000585773.1_Missense_Mutation_p.N41S|ANKS3_ENST00000592711.1_Intron|ANKS3_ENST00000450067.2_Intron	NM_133450.3	NP_597707.1	Q6ZW76	ANKS3_HUMAN	ankyrin repeat and sterile alpha motif domain containing 3	114										endometrium(5)|kidney(4)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	19						GATGCTCTCGTTGCCACAGCT	0.607																																																	0													102.0	91.0	95.0					16																	4777008		2197	4300	6497	SO:0001583	missense	0			AK057329	CCDS10520.1, CCDS73820.1	16p13.3	2013-01-10			ENSG00000168096	ENSG00000168096		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	29422	protein-coding gene	gene with protein product						11853319	Standard	NM_133450		Approved	KIAA1977, FLJ32345, FLJ32767	uc002cxj.2	Q6ZW76	OTTHUMG00000129478	ENST00000304283.4:c.341A>G	16.37:g.4777008T>C	ENSP00000304586:p.Asn114Ser		B4DWU4|D3DUE2|Q8TF25	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,prints_Ankyrin_rpt	p.N114S	ENST00000304283.4	37	c.341	CCDS10520.1	16	.	.	.	.	.	.	.	.	.	.	T	26.4	4.738223	0.89573	.	.	ENSG00000168096	ENST00000304283	T	0.65732	-0.17	5.69	5.69	0.88448	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.69993	0.3173	L	0.31664	0.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73257	-0.4040	10	0.66056	D	0.02	0.3597	15.1327	0.72536	0.0:0.0:0.0:1.0	.	114	Q6ZW76	ANKS3_HUMAN	S	114	ENSP00000304586:N114S	ENSP00000304586:N114S	N	-	2	0	ANKS3	4717009	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.178000	0.69098	0.528000	0.53228	AAC	ANKS3	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	ENSG00000168096		0.607	ANKS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS3	HGNC	protein_coding	OTTHUMT00000251642.3	-	0.00	27	0	T	NM_133450		4777008	-1	tier1	-	no_errors	ENST00000304283	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	C
APOL4	80832	genome.wustl.edu	37	22	36587208	36587208	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr22:36587208G>T	ENST00000352371.1	-	6	1192	c.968C>A	c.(967-969)gCt>gAt	p.A323D	APOL4_ENST00000479929.1_5'UTR|APOL4_ENST00000429038.2_3'UTR|APOL4_ENST00000404685.3_3'UTR|APOL4_ENST00000405511.1_3'UTR|APOL4_ENST00000332987.1_Missense_Mutation_p.A320D			Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	324					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)			lung(1)	1						CAGCGACTCAGCAGACTCGGA	0.537																																																	0													25.0	27.0	26.0					22																	36587208		2059	4231	6290	SO:0001583	missense	0			AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000352371.1:c.968C>A	22.37:g.36587208G>T	ENSP00000338260:p.Ala323Asp		Q9BQ37|Q9BXQ8	Missense_Mutation	SNP	pfam_ApoL	p.A323D	ENST00000352371.1	37	c.968		22	.	.	.	.	.	.	.	.	.	.	g	12.60	1.987293	0.35036	.	.	ENSG00000100336	ENST00000352371;ENST00000332987	T;T	0.15603	2.41;2.41	2.2	1.1	0.20463	.	0.145437	0.46442	D	0.000281	T	0.37598	0.1009	M	0.83312	2.635	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.989	T	0.07462	-1.0771	10	0.87932	D	0	.	6.5006	0.22166	0.0:0.3061:0.6939:0.0	.	324;320	Q9BPW4;Q9BPW4-3	APOL4_HUMAN;.	D	323;320	ENSP00000338260:A323D;ENSP00000333229:A320D	ENSP00000333229:A320D	A	-	2	0	APOL4	34917154	0.052000	0.20516	0.007000	0.13788	0.003000	0.03518	1.557000	0.36299	0.444000	0.26612	0.407000	0.27541	GCT	APOL4	-	pfam_ApoL	ENSG00000100336		0.537	APOL4-203	KNOWN	basic|appris_candidate_longest	protein_coding	APOL4	HGNC	protein_coding		-	0.00	46	0	G	NM_145660		36587208	-1	tier1	-	no_errors	ENST00000352371	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.007	T
ARHGAP36	158763	genome.wustl.edu	37	X	130222715	130222715	+	Missense_Mutation	SNP	C	C	G	rs371342192		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chrX:130222715C>G	ENST00000276211.5	+	12	1945	c.1600C>G	c.(1600-1602)Cgg>Ggg	p.R534G	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.R398G|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.R522G	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	534					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CCGTGTGCCCCGGGAGAAGGA	0.582																																																	0													76.0	71.0	73.0					X																	130222715		2203	4300	6503	SO:0001583	missense	0				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1600C>G	X.37:g.130222715C>G	ENSP00000276211:p.Arg534Gly		B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R534G	ENST00000276211.5	37	c.1600	CCDS14628.1	X	.	.	.	.	.	.	.	.	.	.	C	15.12	2.737867	0.49045	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.14391	2.51;2.53;2.54;2.52	4.31	3.45	0.39498	.	0.723816	0.12029	N	0.506195	T	0.06917	0.0176	N	0.08118	0	0.26233	N	0.978983	B;P;B	0.35226	0.275;0.491;0.358	B;B;B	0.32211	0.092;0.142;0.042	T	0.22977	-1.0201	10	0.87932	D	0	.	7.0	0.24805	0.0:0.8766:0.0:0.1234	.	503;522;534	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	G	534;522;503;398	ENSP00000276211:R534G;ENSP00000359960:R522G;ENSP00000408515:R503G;ENSP00000359959:R398G	ENSP00000276211:R534G	R	+	1	2	ARHGAP36	130050396	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	1.015000	0.29963	1.163000	0.42636	0.600000	0.82982	CGG	ARHGAP36	-	NULL	ENSG00000147256		0.582	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP36	HGNC	protein_coding	OTTHUMT00000355073.1	-	0.00	21	0	C	NM_144967		130222715	+1	tier1	-	no_errors	ENST00000276211	ensembl	human	known	74_37	missense	79.41	7	27	SNP	1.000	G
ARL6IP5	10550	genome.wustl.edu	37	3	69153771	69153771	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:69153771G>A	ENST00000273258.3	+	3	655	c.551G>A	c.(550-552)aGc>aAc	p.S184N	ARL6IP5_ENST00000478935.1_Intron	NM_006407.3	NP_006398.1	O75915	PRAF3_HUMAN	ADP-ribosylation factor-like 6 interacting protein 5	184	Targeting to endoplasmic reticulum membrane. {ECO:0000250}.				intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|L-glutamate transport (GO:0015813)|negative regulation of mitochondrial membrane potential (GO:0010917)|negative regulation of transport (GO:0051051)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of stress-activated MAPK cascade (GO:0032874)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				biliary_tract(1)|endometrium(1)|large_intestine(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.78e-05)|Epithelial(33;0.000818)|LUSC - Lung squamous cell carcinoma(21;0.0118)|Lung(16;0.0189)|KIRC - Kidney renal clear cell carcinoma(39;0.203)|Kidney(39;0.238)		GACTATATCAGCAAAGTGAAG	0.453																																																	0													85.0	78.0	80.0					3																	69153771		2203	4300	6503	SO:0001583	missense	0			AF070523	CCDS2912.1	3p14	2014-05-12	2014-05-12		ENSG00000144746	ENSG00000144746			16937	protein-coding gene	gene with protein product	"""PRA1 domain family 3"""	605709				11242046, 11042152	Standard	NM_006407		Approved	PRAF3, JWA, GTRAP3-18, DERP11, HSPC127	uc003dnr.3	O75915	OTTHUMG00000158773	ENST00000273258.3:c.551G>A	3.37:g.69153771G>A	ENSP00000273258:p.Ser184Asn		B2R6V5|Q53ES3|Q5KU08	Missense_Mutation	SNP	pfam_Prenylated_rab_accept_PRA1	p.S184N	ENST00000273258.3	37	c.551	CCDS2912.1	3	.	.	.	.	.	.	.	.	.	.	G	13.54	2.267379	0.40095	.	.	ENSG00000144746	ENST00000273258	T	0.48836	0.8	5.69	3.91	0.45181	.	0.156175	0.64402	N	0.000002	T	0.42040	0.1185	L	0.59436	1.845	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.29579	-1.0007	10	0.49607	T	0.09	-14.8222	8.7266	0.34474	0.1456:0.1571:0.6972:0.0	.	184	O75915	PRAF3_HUMAN	N	184	ENSP00000273258:S184N	ENSP00000273258:S184N	S	+	2	0	ARL6IP5	69236461	1.000000	0.71417	0.998000	0.56505	0.692000	0.40212	2.134000	0.42102	0.773000	0.33404	-0.137000	0.14449	AGC	ARL6IP5	-	NULL	ENSG00000144746		0.453	ARL6IP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6IP5	HGNC	protein_coding	OTTHUMT00000352132.1		0.00	23	0	G	NM_006407		69153771	+1			no_errors	ENST00000273258	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
ARL13B	200894	genome.wustl.edu	37	3	93758767	93758767	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:93758767G>T	ENST00000394222.3	+	6	1008	c.733G>T	c.(733-735)Ggt>Tgt	p.G245C	ARL13B_ENST00000471138.1_Missense_Mutation_p.G245C|ARL13B_ENST00000535334.1_Missense_Mutation_p.G142C|ARL13B_ENST00000303097.7_Missense_Mutation_p.G138C|ARL13B_ENST00000539730.1_5'UTR	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	245					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						TGGAACCAGTGGTCTGGCTGA	0.388																																																	0													79.0	74.0	76.0					3																	93758767		2203	4300	6503	SO:0001583	missense	0			AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.733G>T	3.37:g.93758767G>T	ENSP00000377769:p.Gly245Cys		D3DN29|G3V1S8|Q504W8|Q8TCL5	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.G245C	ENST00000394222.3	37	c.733	CCDS2925.1	3	.	.	.	.	.	.	.	.	.	.	G	6.391	0.440174	0.12104	.	.	ENSG00000169379	ENST00000535334;ENST00000303097;ENST00000394222;ENST00000471138	T;T;T;T	0.64085	1.73;-0.08;0.13;0.13	5.57	2.19	0.27852	.	1.000730	0.08061	N	0.998120	T	0.56001	0.1956	L	0.40543	1.245	0.09310	N	0.999998	P;B;P;B	0.39181	0.663;0.151;0.474;0.24	B;B;B;B	0.39904	0.296;0.198;0.313;0.155	T	0.46721	-0.9171	10	0.56958	D	0.05	-2.9697	10.4049	0.44252	0.3378:0.0:0.6622:0.0	.	142;245;138;245	G3V1S8;B4DLH1;Q3SXY8-2;Q3SXY8	.;.;.;AR13B_HUMAN	C	142;138;245;245	ENSP00000445145:G142C;ENSP00000306225:G138C;ENSP00000377769:G245C;ENSP00000420780:G245C	ENSP00000306225:G138C	G	+	1	0	ARL13B	95241457	0.000000	0.05858	0.041000	0.18516	0.002000	0.02628	0.826000	0.27407	0.369000	0.24510	-0.797000	0.03246	GGT	ARL13B	-	NULL	ENSG00000169379		0.388	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ARL13B	HGNC	protein_coding	OTTHUMT00000352904.1	-	0.00	50	0	G	NM_182896		93758767	+1	tier1	-	no_errors	ENST00000394222	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	T
ASMT	438	genome.wustl.edu	37	X	1743287	1743287	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chrX:1743287G>A	ENST00000381229.4	+	3	406	c.370G>A	c.(370-372)Gtg>Atg	p.V124M	ASMT_ENST00000381233.3_Missense_Mutation_p.V124M|ASMT_ENST00000381241.3_Missense_Mutation_p.V124M			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	124					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	GGCAGACGCCGTGAGGTGGGG	0.677													g|||	1	0.000199681	0.0	0.0	5008	,	,		18508	0.001		0.0	False		,,,				2504	0.0																0													73.0	67.0	69.0					X																	1743287		2203	4296	6499	SO:0001583	missense	0			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.370G>A	X.37:g.1743287G>A	ENSP00000370627:p.Val124Met		B2RC33|Q16598|Q5JQ72|Q5JQ73	Missense_Mutation	SNP	pfam_O_MeTrfase_2,pirsf_COMT	p.V124M	ENST00000381229.4	37	c.370		X	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	g	13.19	2.164190	0.38217	.	.	ENSG00000196433	ENST00000381241;ENST00000381229;ENST00000381233	T;T;T	0.31510	1.49;1.49;2.0	2.09	1.11	0.20524	.	0.167807	0.38605	U	0.001625	T	0.50871	0.1641	M	0.82323	2.585	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.985;0.989	T	0.27468	-1.0073	10	0.87932	D	0	.	6.5326	0.22336	0.3023:0.0:0.6977:0.0	.	124;124	P46597-2;P46597-3	.;.	M	124	ENSP00000370639:V124M;ENSP00000370627:V124M;ENSP00000370631:V124M	ENSP00000370627:V124M	V	+	1	0	ASMT	1703287	0.952000	0.32445	0.030000	0.17652	0.026000	0.11368	1.393000	0.34497	0.831000	0.34780	0.415000	0.27848	GTG	ASMT	-	pfam_O_MeTrfase_2,pirsf_COMT	ENSG00000196433		0.677	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	-	0.00	55	0	G	NM_004043		1743287	+1	tier1	-	no_errors	ENST00000381241	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.999	A
ATXN10	25814	genome.wustl.edu	37	22	46098580	46098580	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr22:46098580A>G	ENST00000252934.5	+	5	765	c.500A>G	c.(499-501)aAt>aGt	p.N167S	ATXN10_ENST00000381061.4_Missense_Mutation_p.N103S|ATXN10_ENST00000498009.1_3'UTR	NM_013236.3	NP_037368.1	Q9UBB4	ATX10_HUMAN	ataxin 10	167					cell death (GO:0008219)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	10		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		TCTTGCTTAAATCATCCGGAC	0.328																																																	0													95.0	87.0	90.0					22																	46098580		2203	4300	6503	SO:0001583	missense	0			AK095309	CCDS14070.1, CCDS54540.1	22q13	2013-02-15	2004-08-12	2004-08-12	ENSG00000130638	ENSG00000130638		"""Ataxins"""	10549	protein-coding gene	gene with protein product		611150	"""spinocerebellar ataxia 10"""	SCA10		9973298	Standard	NM_013236		Approved	E46L, FLJ37990	uc003bgm.2	Q9UBB4	OTTHUMG00000150451	ENST00000252934.5:c.500A>G	22.37:g.46098580A>G	ENSP00000252934:p.Asn167Ser		A6NLC4|B4DG05|O14998|O15009|Q6I9X4	Missense_Mutation	SNP	pfam_Ataxin-10_domain,superfamily_ARM-type_fold	p.N167S	ENST00000252934.5	37	c.500	CCDS14070.1	22	.	.	.	.	.	.	.	.	.	.	A	2.951	-0.216639	0.06101	.	.	ENSG00000130638	ENST00000381061;ENST00000252934;ENST00000396011	T;T	0.46451	0.87;0.87	5.9	4.82	0.62117	Armadillo-like helical (1);Armadillo-type fold (1);	0.606738	0.18905	N	0.127938	T	0.13586	0.0329	N	0.03608	-0.345	0.24009	N	0.996187	B;B	0.24132	0.098;0.098	B;B	0.14023	0.01;0.01	T	0.26467	-1.0102	10	0.08599	T	0.76	-7.5395	1.1071	0.01696	0.499:0.2118:0.1164:0.1728	.	103;167	A6NLC4;Q9UBB4	.;ATX10_HUMAN	S	103;167;167	ENSP00000370449:N103S;ENSP00000252934:N167S	ENSP00000252934:N167S	N	+	2	0	ATXN10	44477244	0.449000	0.25689	0.998000	0.56505	0.986000	0.74619	0.690000	0.25451	2.259000	0.74868	0.482000	0.46254	AAT	ATXN10	-	superfamily_ARM-type_fold	ENSG00000130638		0.328	ATXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN10	HGNC	protein_coding	OTTHUMT00000318142.2	-	0.00	124	0	A	NM_013236		46098580	+1	tier1	-	no_errors	ENST00000252934	ensembl	human	known	74_37	missense	41.72	95	68	SNP	0.497	G
BCDIN3D	144233	genome.wustl.edu	37	12	50236730	50236730	+	Silent	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:50236730G>T	ENST00000333924.4	-	1	182	c.141C>A	c.(139-141)ctC>ctA	p.L47L	BCDIN3D-AS1_ENST00000549124.1_RNA|BCDIN3D-AS1_ENST00000548872.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	47					miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						GCAGGAGGCGGAGCCGTTGCT	0.632																																																	0													56.0	67.0	63.0					12																	50236730		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.141C>A	12.37:g.50236730G>T			A8K829	Silent	SNP	pfam_Bin3	p.L47	ENST00000333924.4	37	c.141	CCDS8790.1	12	.	.	.	.	.	.	.	.	.	.	G	13.85	2.359376	0.41801	.	.	ENSG00000186666	ENST00000550861	.	.	.	6.08	1.63	0.23807	.	.	.	.	.	T	0.42291	0.1196	.	.	.	0.24470	N	0.994397	.	.	.	.	.	.	T	0.37150	-0.9718	5	0.87932	D	0	.	7.5654	0.27876	0.2307:0.127:0.6423:0.0	.	.	.	.	Y	40	.	ENSP00000447796:S40Y	S	-	2	0	BCDIN3D	48522997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.118000	0.41949	0.427000	0.26145	0.591000	0.81541	TCC	BCDIN3D	-	NULL	ENSG00000186666		0.632	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCDIN3D	HGNC	protein_coding	OTTHUMT00000405982.1	-	0.00	33	0	G	NM_181708		50236730	-1	tier1	-	no_errors	ENST00000333924	ensembl	human	known	74_37	silent	35.90	25	14	SNP	0.998	T
BCS1L	617	genome.wustl.edu	37	2	219527683	219527683	+	Missense_Mutation	SNP	G	G	A	rs372817977		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:219527683G>A	ENST00000431802.1	+	7	1666	c.967G>A	c.(967-969)Gag>Aag	p.E323K	BCS1L_ENST00000439945.1_Missense_Mutation_p.E323K|BCS1L_ENST00000392111.2_Missense_Mutation_p.E323K|BCS1L_ENST00000465706.1_3'UTR|BCS1L_ENST00000359273.3_Missense_Mutation_p.E323K|BCS1L_ENST00000392110.2_Missense_Mutation_p.E323K|BCS1L_ENST00000412366.1_Missense_Mutation_p.E323K|BCS1L_ENST00000392109.1_Missense_Mutation_p.E323K			Q9Y276	BCS1_HUMAN	BC1 (ubiquinol-cytochrome c reductase) synthesis-like	323					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex III assembly (GO:0034551)|mitochondrial respiratory chain complex IV assembly (GO:0033617)|mitochondrion organization (GO:0007005)	mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	8		Renal(207;0.0474)		Epithelial(149;7.12e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGCTTCCACCGAGGCCCGCAT	0.567																																																	0								G	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	115.0	101.0	106.0		967,967	4.9	1.0	2		106	0,8600		0,0,4300	no	missense,missense	BCS1L	NM_001079866.1,NM_004328.4	56,56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging	323/420,323/420	219527683	1,13005	2203	4300	6503	SO:0001583	missense	0			AF026849	CCDS2419.1	2q35	2014-09-17	2012-10-12		ENSG00000074582	ENSG00000074582		"""ATPases / AAA-type"", ""Mitochondrial respiratory chain complex assembly factors"""	1020	protein-coding gene	gene with protein product	"""GRACILE syndrome"", ""Bjornstad syndrome"""	603647	"""BCS1 (yeast homolog)-like"", ""BCS1-like (yeast)"", ""BCS1-like (S. cerevisiae)"""			9878253, 17314340	Standard	NM_001079866		Approved	Hs.6719, BCS, h-BCS, BJS	uc002viq.3	Q9Y276	OTTHUMG00000133114	ENST00000431802.1:c.967G>A	2.37:g.219527683G>A	ENSP00000413908:p.Glu323Lys		B3KTW9|Q7Z2V7	Missense_Mutation	SNP	pfam_BCS1_N,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E323K	ENST00000431802.1	37	c.967	CCDS2419.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.7|25.7	4.663111|4.663111	0.88251|0.88251	2.27E-4|2.27E-4	0.0|0.0	ENSG00000074582|ENSG00000074582	ENST00000359273;ENST00000392109;ENST00000392110;ENST00000392111;ENST00000412366;ENST00000439945;ENST00000431802|ENST00000426649	D;D;D;D;D;D;D|.	0.93811|.	-3.29;-3.29;-3.29;-3.29;-3.29;-3.29;-3.29|.	4.94|4.94	4.94|4.94	0.65067|0.65067	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75213|0.75213	0.3819|0.3819	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.70487|.	0.969|.	T|T	0.74662|0.74662	-0.3590|-0.3590	10|5	0.87932|.	D|.	0|.	-14.2648|-14.2648	18.357|18.357	0.90361|0.90361	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	323|.	Q9Y276|.	BCS1_HUMAN|.	K|Q	323|104	ENSP00000352219:E323K;ENSP00000375957:E323K;ENSP00000375958:E323K;ENSP00000375959:E323K;ENSP00000406494:E323K;ENSP00000404999:E323K;ENSP00000413908:E323K|.	ENSP00000352219:E323K|.	E|R	+|+	1|2	0|0	BCS1L|BCS1L	219235927|219235927	1.000000|1.000000	0.71417|0.71417	0.972000|0.972000	0.41901|0.41901	0.321000|0.321000	0.28281|0.28281	9.612000|9.612000	0.98347|0.98347	2.560000|2.560000	0.86352|0.86352	0.561000|0.561000	0.74099|0.74099	GAG|CGA	BCS1L	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000074582		0.567	BCS1L-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCS1L	HGNC	protein_coding	OTTHUMT00000336756.1	-	0.00	55	0	G	NM_004328		219527683	+1	tier1	-	no_errors	ENST00000359273	ensembl	human	known	74_37	missense	39.34	37	24	SNP	1.000	A
BIN3	55909	genome.wustl.edu	37	8	22481554	22481554	+	Missense_Mutation	SNP	C	C	G	rs199588752		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:22481554C>G	ENST00000276416.6	-	8	557	c.489G>C	c.(487-489)gaG>gaC	p.E163D	BIN3_ENST00000399977.4_Missense_Mutation_p.E115D|BIN3_ENST00000519513.1_Missense_Mutation_p.E109D|BIN3_ENST00000519335.1_5'UTR	NM_018688.4	NP_061158.1	Q9NQY0	BIN3_HUMAN	bridging integrator 3	163	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				actin filament organization (GO:0007015)|barrier septum assembly (GO:0000917)|cytokinesis (GO:0000910)|myoblast migration involved in skeletal muscle regeneration (GO:0014839)|protein localization (GO:0008104)|regulation of lamellipodium assembly (GO:0010591)|skeletal muscle fiber development (GO:0048741)|unidimensional cell growth (GO:0009826)	actin filament (GO:0005884)|cytoplasm (GO:0005737)	cytoskeletal adaptor activity (GO:0008093)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	9		Prostate(55;0.0424)|Breast(100;0.102)|all_epithelial(46;0.143)		BRCA - Breast invasive adenocarcinoma(99;0.00664)|Colorectal(74;0.0189)|COAD - Colon adenocarcinoma(73;0.0727)		GCCGCAGCTCCTCTCGTGCCT	0.627																																																	0													29.0	35.0	33.0					8																	22481554		2023	4173	6196	SO:0001583	missense	0				CCDS47825.1	8p21.2	2008-07-04			ENSG00000147439	ENSG00000147439			1054	protein-coding gene	gene with protein product		606396				16524918	Standard	NM_018688		Approved		uc003xcl.3	Q9NQY0	OTTHUMG00000163844	ENST00000276416.6:c.489G>C	8.37:g.22481554C>G	ENSP00000276416:p.Glu163Asp		Q9BVG2|Q9NVY9	Missense_Mutation	SNP	pfam_BAR_dom,pfam_Vps5_C,smart_BAR_dom,pfscan_BAR_dom	p.E163D	ENST00000276416.6	37	c.489	CCDS47825.1	8	.	.	.	.	.	.	.	.	.	.	C	10.98	1.503197	0.26949	.	.	ENSG00000147439	ENST00000276416;ENST00000519513;ENST00000399977	T;T;T	0.68765	-0.35;-0.35;-0.35	5.29	0.31	0.15825	BAR (3);	0.000000	0.85682	D	0.000000	T	0.59128	0.2171	L	0.51422	1.61	0.80722	D	1	B;P	0.37573	0.369;0.6	B;B	0.42495	0.222;0.389	T	0.50800	-0.8785	10	0.35671	T	0.21	-25.5012	8.1549	0.31162	0.0:0.3537:0.0:0.6462	.	163;163	Q9NQY0;Q53HW0	BIN3_HUMAN;.	D	163;109;115	ENSP00000276416:E163D;ENSP00000430423:E109D;ENSP00000382859:E115D	ENSP00000276416:E163D	E	-	3	2	BIN3	22537499	0.895000	0.30542	0.999000	0.59377	0.046000	0.14306	-0.042000	0.12063	0.034000	0.15491	-0.367000	0.07326	GAG	BIN3	-	pfam_BAR_dom,pfam_Vps5_C,smart_BAR_dom,pfscan_BAR_dom	ENSG00000147439		0.627	BIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIN3	HGNC	protein_coding	OTTHUMT00000375895.1	-	0.00	26	0	C			22481554	-1	tier1	-	no_errors	ENST00000276416	ensembl	human	known	74_37	missense	29.58	50	21	SNP	0.999	G
BRINP3	339479	genome.wustl.edu	37	1	190250712	190250712	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:190250712G>C	ENST00000367462.3	-	3	636	c.405C>G	c.(403-405)ttC>ttG	p.F135L	BRINP3_ENST00000534846.1_Intron|RP11-547I7.1_ENST00000452178.1_RNA	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	135	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CAGATAGCAAGAAATGTGTCC	0.428																																																	0													87.0	87.0	87.0					1																	190250712		2203	4298	6501	SO:0001583	missense	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.405C>G	1.37:g.190250712G>C	ENSP00000356432:p.Phe135Leu		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.F135L	ENST00000367462.3	37	c.405	CCDS1373.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.45|14.45	2.539006|2.539006	0.45176|0.45176	.|.	.|.	ENSG00000162670|ENSG00000162670	ENST00000367462|ENST00000445957	D|T	0.84070|0.48836	-1.8|0.8	5.67|5.67	4.75|4.75	0.60458|0.60458	Membrane attack complex component/perforin (MACPF) domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.42381|0.42381	0.1200|0.1200	L|L	0.28115|0.28115	0.83|0.83	0.80722|0.80722	D|D	1|1	B|.	0.09022|.	0.002|.	B|.	0.06405|.	0.002|.	T|T	0.38735|0.38735	-0.9647|-0.9647	10|7	0.17369|0.87932	T|D	0.5|0	.|.	7.7055|7.7055	0.28648|0.28648	0.1736:0.0:0.8264:0.0|0.1736:0.0:0.8264:0.0	.|.	135|.	Q76B58|.	FAM5C_HUMAN|.	L|C	135|85	ENSP00000356432:F135L|ENSP00000393441:S85C	ENSP00000356432:F135L|ENSP00000393441:S85C	F|S	-|-	3|2	2|0	FAM5C|FAM5C	188517335|188517335	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.540000|3.540000	0.53611|0.53611	2.677000|2.677000	0.91161|0.91161	0.585000|0.585000	0.79938|0.79938	TTC|TCT	BRINP3	-	pfam_MACPF,smart_MACPF	ENSG00000162670		0.428	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1	-	0.00	46	0	G	NM_199051		190250712	-1	tier1	-	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	20.83	57	15	SNP	1.000	C
C19orf81	342918	genome.wustl.edu	37	19	51161272	51161272	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:51161272G>A	ENST00000425202.1	+	4	288	c.288G>A	c.(286-288)gaG>gaA	p.E96E	SYT3_ENST00000544769.1_Intron	NM_001195076.1	NP_001182005.1	C9J6K1	CS081_HUMAN	chromosome 19 open reading frame 81	96																	CCCACCTGGAGGTGCTGCAAG	0.602																																																	0																																										SO:0001819	synonymous_variant	0				CCDS54296.1	19q13.33	2011-08-15			ENSG00000235034	ENSG00000235034			40041	protein-coding gene	gene with protein product							Standard	NM_001195076		Approved		uc021uyf.1	C9J6K1	OTTHUMG00000154593	ENST00000425202.1:c.288G>A	19.37:g.51161272G>A				Silent	SNP	NULL	p.E96	ENST00000425202.1	37	c.288	CCDS54296.1	19																																																																																			C19orf81	-	NULL	ENSG00000235034		0.602	C19orf81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf81	HGNC	protein_coding	OTTHUMT00000336224.2	-	0.00	45	0	G	NM_001195076		51161272	+1	tier1	-	no_errors	ENST00000425202	ensembl	human	known	74_37	silent	41.98	47	34	SNP	0.990	A
C1orf27	54953	genome.wustl.edu	37	1	186352217	186352217	+	Missense_Mutation	SNP	G	G	A	rs143106529	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:186352217G>A	ENST00000287859.6	+	3	288	c.163G>A	c.(163-165)Gag>Aag	p.E55K	C1orf27_ENST00000419367.3_Missense_Mutation_p.E55K|C1orf27_ENST00000367470.3_Missense_Mutation_p.E55K|C1orf27_ENST00000432021.3_Missense_Mutation_p.E55K	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	55						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						GGAGCAAAGTGAGAACCTCAA	0.378																																																	0													64.0	67.0	66.0					1																	186352217		2000	4192	6192	SO:0001583	missense	0			BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.163G>A	1.37:g.186352217G>A	ENSP00000287859:p.Glu55Lys		B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Missense_Mutation	SNP	NULL	p.E55K	ENST00000287859.6	37	c.163	CCDS53448.1	1	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174880	0.57692	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.88	4.88	0.63580	.	0.324362	0.31784	N	0.007072	T	0.43500	0.1250	L	0.52364	1.645	0.39547	D	0.968917	P;B;B	0.36959	0.575;0.121;0.121	B;B;B	0.36845	0.234;0.046;0.046	T	0.47100	-0.9143	10	0.42905	T	0.14	-4.2729	13.9063	0.63839	0.0:0.0:1.0:0.0	.	55;55;55	E9PFR7;Q5SWX8-2;Q5SWX8	.;.;ODR4_HUMAN	K	55	ENSP00000356440:E55K;ENSP00000395084:E55K;ENSP00000402029:E55K;ENSP00000287859:E55K	ENSP00000287859:E55K	E	+	1	0	C1orf27	184618840	1.000000	0.71417	0.998000	0.56505	0.826000	0.46750	4.751000	0.62169	2.399000	0.81585	0.637000	0.83480	GAG	C1orf27	-	NULL	ENSG00000157181		0.378	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C1orf27	HGNC	protein_coding	OTTHUMT00000086352.2	-	0.00	63	0	G	NM_017847		186352217	+1	tier1	-	no_errors	ENST00000287859	ensembl	human	known	74_37	missense	49.45	46	45	SNP	0.998	A
C20orf196	149840	genome.wustl.edu	37	20	5843675	5843675	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:5843675A>T	ENST00000303142.6	+	3	271	c.184A>T	c.(184-186)Agt>Tgt	p.S62C		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	62										endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						TGCAGACACCAGTAACTTAAA	0.413																																																	0													40.0	44.0	43.0					20																	5843675		2203	4300	6503	SO:0001583	missense	0			AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.184A>T	20.37:g.5843675A>T	ENSP00000305875:p.Ser62Cys		A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	NULL	p.S62C	ENST00000303142.6	37	c.184	CCDS13091.1	20	.	.	.	.	.	.	.	.	.	.	A	10.18	1.278542	0.23307	.	.	ENSG00000171984	ENST00000303142;ENST00000378971;ENST00000445603;ENST00000442185	T;T;T	0.51325	0.71;0.71;0.71	5.64	0.913	0.19354	.	0.830178	0.11091	N	0.600770	T	0.51702	0.1690	L	0.56769	1.78	0.09310	N	1	D	0.59357	0.985	P	0.52267	0.694	T	0.42565	-0.9444	10	0.72032	D	0.01	-16.764	7.8677	0.29547	0.6649:0.0:0.3351:0.0	.	62	Q8IYI0	CT196_HUMAN	C	62;62;62;109	ENSP00000305875:S62C;ENSP00000399331:S62C;ENSP00000410534:S109C	ENSP00000305875:S62C	S	+	1	0	C20orf196	5791675	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.144000	0.16135	-0.114000	0.11936	-1.069000	0.02264	AGT	C20orf196	-	NULL	ENSG00000171984		0.413	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf196	HGNC	protein_coding	OTTHUMT00000077882.2		0.00	20	0	A	NM_152504		5843675	+1			no_errors	ENST00000303142	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	T
C7orf65	401335	genome.wustl.edu	37	7	47698758	47698758	+	Missense_Mutation	SNP	C	C	A	rs527897958	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:47698758C>A	ENST00000408988.2	+	3	423	c.388C>A	c.(388-390)Cag>Aag	p.Q130K		NM_001123065.1	NP_001116537.1	Q6ZTY9	CG065_HUMAN	chromosome 7 open reading frame 65	130										endometrium(1)|lung(2)	3						GAAGGATGCTCAGGCCTGGAT	0.547																																																	0													112.0	102.0	105.0					7																	47698758		1568	3582	5150	SO:0001583	missense	0				CCDS43580.1	7p12.3	2009-02-11			ENSG00000221845	ENSG00000221845			34432	protein-coding gene	gene with protein product							Standard	NM_001123065		Approved	FLJ44108	uc010kyp.1	Q6ZTY9	OTTHUMG00000155550	ENST00000408988.2:c.388C>A	7.37:g.47698758C>A	ENSP00000386198:p.Gln130Lys		A4D2F8	Missense_Mutation	SNP	NULL	p.Q130K	ENST00000408988.2	37	c.388	CCDS43580.1	7	.	.	.	.	.	.	.	.	.	.	C	0.352	-0.944439	0.02304	.	.	ENSG00000221845	ENST00000408988	.	.	.	0.559	-0.658	0.11428	.	.	.	.	.	T	0.08802	0.0218	N	0.08118	0	0.09310	N	1	P	0.45594	0.862	B	0.31751	0.135	T	0.19516	-1.0303	7	0.87932	D	0	.	.	.	.	.	130	Q6ZTY9	CG065_HUMAN	K	130	.	ENSP00000386198:Q130K	Q	+	1	0	C7orf65	47665283	0.003000	0.15002	0.003000	0.11579	0.002000	0.02628	-0.097000	0.11042	-0.351000	0.08249	-0.367000	0.07326	CAG	C7orf65	-	NULL	ENSG00000221845		0.547	C7orf65-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C7orf65	HGNC	protein_coding	OTTHUMT00000340616.1	-	0.00	46	0	C	NM_001123065		47698758	+1	tier1	-	no_errors	ENST00000408988	ensembl	human	putative	74_37	missense	27.17	67	25	SNP	0.003	A
C9orf114	51490	genome.wustl.edu	37	9	131591119	131591120	+	Frame_Shift_Ins	INS	-	-	T	rs370087122		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:131591119_131591120insT	ENST00000361256.5	-	3	142_143	c.102_103insA	c.(100-105)aaatggfs	p.W35fs		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	35							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						AGATCCTTCCATTTTTTTTTCT	0.525																																																	0																																										SO:0001589	frameshift_variant	0				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.103dupA	9.37:g.131591128_131591128dupT	ENSP00000354812:p.Trp35fs		Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Frame_Shift_Ins	INS	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold	p.W34fs	ENST00000361256.5	37	c.103_102	CCDS6913.1	9																																																																																			C9orf114	-	NULL	ENSG00000198917		0.525	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	HGNC	protein_coding	OTTHUMT00000054500.1		0.00	16	0	-	NM_016390		131591120	-1	tier1		no_errors	ENST00000361256	ensembl	human	known	74_37	frame_shift_ins	10.53	17	2	INS	1.000:0.998	T
CALCB	797	genome.wustl.edu	37	11	15096643	15096643	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:15096643C>T	ENST00000533448.1	+	3	234	c.123C>T	c.(121-123)ctC>ctT	p.L41L	CALCB_ENST00000523376.1_Silent_p.L52L|CALCB_ENST00000324229.6_Silent_p.L41L			P10092	CALCB_HUMAN	calcitonin-related polypeptide beta	41					cellular calcium ion homeostasis (GO:0006874)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			endometrium(1)|large_intestine(1)|lung(1)|skin(2)	5						CGGCCACACTCAGTAAAGAGG	0.622											OREG0020793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	59.0	58.0					11																	15096643		2200	4294	6494	SO:0001819	synonymous_variant	0				CCDS7820.1	11p14.2-p12	2013-02-25	2008-02-20			ENSG00000175868		"""Endogenous ligands"""	1438	protein-coding gene	gene with protein product		114160	"""calcitonin 2"""	CALC2			Standard	NM_000728		Approved	FLJ30166, CGRP-II	uc001mlx.1	P10092		ENST00000533448.1:c.123C>T	11.37:g.15096643C>T		700	A8K573|D3DQX4|Q569I0|Q9UCN9	Silent	SNP	pfam_Procalcitonin/adrenomedullin,smart_Calcitonin_peptide-like,prints_Calcitonin_gene-rel_peptide,prints_Pro-islet_amyloid_polypep	p.L41	ENST00000533448.1	37	c.123	CCDS7820.1	11																																																																																			CALCB	-	pfam_Procalcitonin/adrenomedullin	ENSG00000175868		0.622	CALCB-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CALCB	HGNC	protein_coding	OTTHUMT00000387433.1	-	0.00	44	0	C	NM_000728		15096643	+1	tier1	-	no_errors	ENST00000324229	ensembl	human	known	74_37	silent	24.72	67	22	SNP	0.435	T
CAMK2N1	55450	genome.wustl.edu	37	1	20809957	20809959	+	3'UTR	DEL	CTC	CTC	-	rs547323430	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:20809957_20809959delCTC	ENST00000375078.3	-	0	1260_1262				CAMK2N1_ENST00000489020.1_5'UTR	NM_018584.5	NP_061054.2	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II inhibitor 1							cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	calcium-dependent protein kinase inhibitor activity (GO:0008427)			lung(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		CCAGAGccttctcctcctcctcc	0.34														22	0.00439297	0.0106	0.0	5008	,	,		12595	0.0		0.002	False		,,,				2504	0.0061																0																																										SO:0001624	3_prime_UTR_variant	0			AY204901	CCDS207.1	1p36.12	2008-02-05			ENSG00000162545	ENSG00000162545			24190	protein-coding gene	gene with protein product		614986				12477932	Standard	NM_018584		Approved	CaMKIINalpha	uc001bdh.3	Q7Z7J9	OTTHUMG00000002837	ENST00000375078.3:c.*185GAG>-	1.37:g.20809966_20809968delCTC				RNA	DEL	-	NULL	ENST00000375078.3	37	NULL	CCDS207.1	1																																																																																			CAMK2N1	-	-	ENSG00000162545		0.340	CAMK2N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2N1	HGNC	protein_coding	OTTHUMT00000007949.1		0.00	29	0	CTC	NM_018584		20809959	-1	tier1		no_errors	ENST00000489020	ensembl	human	known	74_37	rna	12.12	29	4	DEL	0.000:0.189:0.237	-
CAMSAP2	23271	genome.wustl.edu	37	1	200826893	200826893	+	Silent	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:200826893A>G	ENST00000236925.4	+	18	4225	c.4176A>G	c.(4174-4176)aaA>aaG	p.K1392K	CAMSAP2_ENST00000358823.2_Silent_p.K1381K|CAMSAP2_ENST00000413307.2_Silent_p.K1365K			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1392	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										AAATGGAGAAATCAGATGCCA	0.303																																																	0													64.0	69.0	67.0					1																	200826893		2203	4297	6500	SO:0001819	synonymous_variant	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.4176A>G	1.37:g.200826893A>G			B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.K1392	ENST00000236925.4	37	c.4176		1																																																																																			CAMSAP2	-	pfam_CKK_domain,superfamily_PRC_barrel-like	ENSG00000118200		0.303	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	-	0.00	23	0	A	NM_203459		200826893	+1	tier1	-	no_errors	ENST00000236925	ensembl	human	known	74_37	silent	55.17	26	32	SNP	0.999	G
CARS	833	genome.wustl.edu	37	11	3040371	3040371	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:3040371C>T	ENST00000397111.5	-	11	1389	c.1144G>A	c.(1144-1146)Gag>Aag	p.E382K	CARS_ENST00000380525.4_Missense_Mutation_p.E465K|CARS_ENST00000397114.3_Missense_Mutation_p.E372K|CARS_ENST00000278224.9_Missense_Mutation_p.E382K|CARS_ENST00000401769.3_Missense_Mutation_p.E395K			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	382					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	TCACCTACCTCCGACTGTGCC	0.587			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)			Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	0													142.0	128.0	133.0					11																	3040371		2202	4298	6500	SO:0001583	missense	0			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1144G>A	11.37:g.3040371C>T	ENSP00000380300:p.Glu382Lys		Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	p.E465K	ENST00000397111.5	37	c.1393	CCDS7742.1	11	.	.	.	.	.	.	.	.	.	.	C	29.5	5.014555	0.93404	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.55413	0.52;0.53;0.53;0.53;0.52	4.31	4.31	0.51392	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.76990	0.4065	M	0.89163	3.01	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D	0.97110	0.989;1.0;1.0;1.0;0.989;1.0	T	0.82896	-0.0230	10	0.72032	D	0.01	-43.6251	16.9805	0.86326	0.0:1.0:0.0:0.0	.	395;465;382;382;465;372	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	K	465;382;382;372;395	ENSP00000369897:E465K;ENSP00000380300:E382K;ENSP00000278224:E382K;ENSP00000380303:E372K;ENSP00000384069:E395K	ENSP00000278224:E382K	E	-	1	0	CARS	2996947	1.000000	0.71417	0.985000	0.45067	0.656000	0.38851	7.154000	0.77437	2.234000	0.73211	0.591000	0.81541	GAG	CARS	-	pfam_Cys-tRNA/MSH_ligase,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	ENSG00000110619		0.587	CARS-001	KNOWN	basic|CCDS	protein_coding	CARS	HGNC	protein_coding	OTTHUMT00000030117.4	-	0.00	54	0	C	NM_001751		3040371	-1	tier1	-	no_errors	ENST00000380525	ensembl	human	known	74_37	missense	40.35	34	23	SNP	1.000	T
CARS2	79587	genome.wustl.edu	37	13	111298382	111298382	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:111298382G>T	ENST00000257347.4	-	12	1312	c.1249C>A	c.(1249-1251)Ccc>Acc	p.P417T	CARS2_ENST00000535398.1_5'UTR	NM_024537.2	NP_078813.1	Q9HA77	SYCM_HUMAN	cysteinyl-tRNA synthetase 2, mitochondrial (putative)	417					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|prostate(4)|skin(1)	13	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.163)		L-Cysteine(DB00151)	ACCACCCTGGGTGTGTCAAAA	0.602																																																	0													157.0	136.0	143.0					13																	111298382		2203	4300	6503	SO:0001583	missense	0			BC007220	CCDS9514.1	13q34	2011-07-01	2007-02-22		ENSG00000134905	ENSG00000134905	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	25695	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 2, mitochondrial (putative)"""	612800				15779907	Standard	NM_024537		Approved	FLJ12118	uc001vrd.2	Q9HA77	OTTHUMG00000017347	ENST00000257347.4:c.1249C>A	13.37:g.111298382G>T	ENSP00000257347:p.Pro417Thr		Q8NI84|Q96IV4	Missense_Mutation	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,superfamily_tRNAsynth_1a_anticodon-bd,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	p.P417T	ENST00000257347.4	37	c.1249	CCDS9514.1	13	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694938	0.30052	.	.	ENSG00000134905	ENST00000542993;ENST00000257347	T	0.52754	0.65	4.8	3.03	0.35002	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.377592	0.29383	N	0.012314	T	0.51890	0.1701	M	0.71581	2.175	0.09310	N	0.999998	B	0.34241	0.444	B	0.43867	0.434	T	0.50709	-0.8796	10	0.66056	D	0.02	-18.0922	7.4157	0.27042	0.1595:0.1399:0.7006:0.0	.	417	Q9HA77	SYCM_HUMAN	T	155;417	ENSP00000257347:P417T	ENSP00000257347:P417T	P	-	1	0	CARS2	110096383	0.985000	0.35326	0.010000	0.14722	0.266000	0.26442	2.693000	0.47027	0.432000	0.26286	0.462000	0.41574	CCC	CARS2	-	superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Cys-tRNA-ligase	ENSG00000134905		0.602	CARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARS2	HGNC	protein_coding	OTTHUMT00000045772.3		0.00	46	0	G	NM_024537		111298382	-1			no_errors	ENST00000257347	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.115	T
CCNY	219771	genome.wustl.edu	37	10	35805450	35805450	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:35805450G>A	ENST00000374704.4	+	4	444		c.e4-1		CCNY_ENST00000339497.5_Splice_Site|CCNY_ENST00000492478.1_Splice_Site|CCNY_ENST00000265375.9_Splice_Site|CCNY_ENST00000374706.1_Splice_Site	NM_145012.4	NP_659449.3	Q8ND76	CCNY_HUMAN	cyclin Y						cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			cervix(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	8						TTGTTTTCTAGCATCCTCCAG	0.408																																																	0													106.0	95.0	99.0					10																	35805450		2203	4300	6503	SO:0001630	splice_region_variant	0			AF413522, AY504868	CCDS7189.1, CCDS7190.1, CCDS60513.1	10p11.22	2011-01-25	2007-02-09	2007-02-09	ENSG00000108100	ENSG00000108100			23354	protein-coding gene	gene with protein product		612786	"""chromosome 10 open reading frame 9"""	C10orf9		20441050	Standard	XM_005252388		Approved	CFP1, CBCP1	uc001iyw.4	Q8ND76	OTTHUMG00000017955	ENST00000374704.4:c.265-1G>A	10.37:g.35805450G>A			B7ZKX9|D3DRY9|Q2M3V4|Q2TU96|Q6NT86|Q7Z4U7|Q8TEX2|Q8TEX3|Q96M99|Q96P45	Splice_Site	SNP	-	e4-1	ENST00000374704.4	37	c.265-1	CCDS7189.1	10	.	.	.	.	.	.	.	.	.	.	G	29.4	5.001893	0.93227	.	.	ENSG00000108100	ENST00000374706;ENST00000537547;ENST00000374704;ENST00000339497;ENST00000265375	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0558	0.93064	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCNY	35845456	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.562000	0.82300	2.840000	0.97914	0.655000	0.94253	.	CCNY	-	-	ENSG00000108100		0.408	CCNY-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNY	HGNC	protein_coding	OTTHUMT00000047568.2	-	0.00	57	0	G	NM_181698	Intron	35805450	+1	tier1	-	no_errors	ENST00000374704	ensembl	human	known	74_37	splice_site	23.60	68	21	SNP	1.000	A
CCZ1	51622	genome.wustl.edu	37	7	5951496	5951496	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:5951496C>T	ENST00000325974.6	+	9	851	c.785C>T	c.(784-786)gCa>gTa	p.A262V	CCZ1_ENST00000537980.1_Missense_Mutation_p.A119V	NM_015622.5	NP_056437.4	P86791	CCZ1_HUMAN	CCZ1 vacuolar protein trafficking and biogenesis associated homolog (S. cerevisiae)	262						lysosome (GO:0005764)|membrane (GO:0016020)				large_intestine(3)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	6						TTGCAGTTAGCAGGAAGGGAT	0.348																																																	0													20.0	21.0	20.0					7																	5951496		2143	4247	6390	SO:0001583	missense	0			AF151801	CCDS34597.1	7p22.1	2014-02-13	2010-06-29	2010-06-29	ENSG00000122674	ENSG00000122674			21691	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 28A"""	C7orf28A		10810093, 20305638	Standard	NM_015622		Approved	CGI-43, CCZ1A	uc003spf.3	P86791	OTTHUMG00000155502	ENST00000325974.6:c.785C>T	7.37:g.5951496C>T	ENSP00000325681:p.Ala262Val		A2RU45|O95766|Q9UG65|Q9Y359	Missense_Mutation	SNP	pfam_DUF1712_fun	p.A262V	ENST00000325974.6	37	c.785	CCDS34597.1	7	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947059	0.73672	.	.	ENSG00000122674	ENST00000325974;ENST00000537980	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.50888	0.1642	L	0.36672	1.1	0.80722	D	1	P	0.45348	0.856	B	0.43052	0.406	T	0.43750	-0.9372	9	0.17369	T	0.5	-12.9351	17.7943	0.88565	0.0:1.0:0.0:0.0	.	262	P86790	CCZ1L_HUMAN	V	262;119	.	ENSP00000325681:A262V	A	+	2	0	CCZ1	5918022	1.000000	0.71417	0.991000	0.47740	0.986000	0.74619	7.445000	0.80570	2.447000	0.82792	0.650000	0.86243	GCA	CCZ1	-	pfam_DUF1712_fun	ENSG00000122674		0.348	CCZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCZ1	HGNC	protein_coding	OTTHUMT00000340391.1	-	0.00	19	0	C	NM_015622		5951496	+1	tier1	-	no_errors	ENST00000325974	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	T
CCT6A	908	genome.wustl.edu	37	7	56125732	56125732	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:56125732A>T	ENST00000275603.4	+	6	880	c.661A>T	c.(661-663)Atg>Ttg	p.M221L	SNORA22_ENST00000383876.1_RNA|CCT6A_ENST00000540286.1_Missense_Mutation_p.M190L|CCT6A_ENST00000335503.3_Missense_Mutation_p.M176L|SNORA15_ENST00000384439.1_RNA	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	221					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCATCCTGATATGAAGAAAAG	0.388																																																	0													90.0	81.0	84.0					7																	56125732		2203	4300	6503	SO:0001583	missense	0			M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.661A>T	7.37:g.56125732A>T	ENSP00000275603:p.Met221Leu		A6NCD2|Q3KP28|Q75LP4|Q96S46	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_zeta	p.M221L	ENST00000275603.4	37	c.661	CCDS5523.1	7	.	.	.	.	.	.	.	.	.	.	A	27.0	4.789610	0.90367	.	.	ENSG00000146731	ENST00000275603;ENST00000335503;ENST00000540286;ENST00000539340	T;T;T	0.70282	-0.47;-0.47;-0.47	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.87896	0.6293	H	0.97340	3.985	0.80722	D	1	P;P;P	0.35872	0.478;0.525;0.478	P;P;P	0.50934	0.545;0.654;0.545	D	0.90425	0.4420	10	0.87932	D	0	-27.2732	14.8746	0.70485	1.0:0.0:0.0:0.0	.	190;176;221	B4DPJ8;A6NCD2;P40227	.;.;TCPZ_HUMAN	L	221;176;190;79	ENSP00000275603:M221L;ENSP00000352019:M176L;ENSP00000438488:M190L	ENSP00000275603:M221L	M	+	1	0	CCT6A	56093226	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.485000	0.90448	2.189000	0.69895	0.454000	0.30748	ATG	CCT6A	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_zeta	ENSG00000146731		0.388	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT6A	HGNC	protein_coding	OTTHUMT00000251526.2	-	0.00	60	0	A	NM_001762		56125732	+1	tier1	-	no_errors	ENST00000275603	ensembl	human	known	74_37	missense	54.37	47	56	SNP	1.000	T
CDC123	8872	genome.wustl.edu	37	10	12277093	12277093	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:12277093G>A	ENST00000281141.4	+	8	816	c.536G>A	c.(535-537)cGa>cAa	p.R179Q	CDC123_ENST00000378900.2_Missense_Mutation_p.R179Q|CDC123_ENST00000455773.3_3'UTR	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123	179					cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						GCTGAGTTTCGATGTTTTGTC	0.333																																																	0													216.0	204.0	208.0					10																	12277093		2203	4300	6503	SO:0001583	missense	0			BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.536G>A	10.37:g.12277093G>A	ENSP00000281141:p.Arg179Gln		A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	Missense_Mutation	SNP	pfam_D123,pirsf_Cell_div_Cdc123	p.R179Q	ENST00000281141.4	37	c.536	CCDS7090.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.499324	0.96355	.	.	ENSG00000151465	ENST00000281141;ENST00000378900;ENST00000442050;ENST00000455773	.	.	.	5.8	5.8	0.92144	.	0.052869	0.64402	D	0.000001	D	0.87398	0.6167	H	0.94771	3.58	0.54753	D	0.999989	D	0.89917	1.0	D	0.75484	0.986	D	0.90263	0.4302	9	0.87932	D	0	-12.8722	18.8303	0.92135	0.0:0.0:1.0:0.0	.	179	O75794	CD123_HUMAN	Q	179;179;147;137	.	ENSP00000281141:R179Q	R	+	2	0	CDC123	12317099	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.284000	0.89912	2.732000	0.93576	0.650000	0.86243	CGA	CDC123	-	pfam_D123,pirsf_Cell_div_Cdc123	ENSG00000151465		0.333	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC123	HGNC	protein_coding	OTTHUMT00000046801.1	-	0.00	97	0	G	NM_006023		12277093	+1	tier1	-	no_errors	ENST00000281141	ensembl	human	known	74_37	missense	16.74	179	36	SNP	1.000	A
CDK11A	728642	genome.wustl.edu	37	1	1634944	1634944	+	Silent	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:1634944G>C	ENST00000378633.1	-	18	2119	c.2040C>G	c.(2038-2040)ctC>ctG	p.L680L	CDK11A_ENST00000357760.2_Silent_p.L676L|CDK11A_ENST00000358779.5_Silent_p.L667L|CDK11A_ENST00000356200.3_Silent_p.L643L|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000495016.1_5'Flank|CDK11A_ENST00000404249.3_Silent_p.L677L|CDK11A_ENST00000378638.2_Silent_p.L643L			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	680					apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						CCTGGTCTGAGAGCAGAGCCC	0.602																																					Pancreas(186;965 2119 30274 40311 50569)												0													15.0	25.0	22.0					1																	1634944		1531	4014	5545	SO:0001819	synonymous_variant	0			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.2040C>G	1.37:g.1634944G>C			O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L677	ENST00000378633.1	37	c.2031		1																																																																																			CDK11A	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000008128		0.602	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	HGNC	protein_coding	OTTHUMT00000001735.1	-	0.00	72	0	G	NM_024011		1634944	-1	tier1	-	no_errors	ENST00000404249	ensembl	human	known	74_37	silent	34.83	58	31	SNP	0.993	C
CDK2	1017	genome.wustl.edu	37	12	56365301	56365301	+	Intron	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:56365301C>G	ENST00000266970.4	+	7	1032				CDK2_ENST00000553376.1_Intron|CDK2_ENST00000556656.1_3'UTR|RAB5B_ENST00000360299.5_5'Flank|RAB5B_ENST00000553116.1_5'Flank|CDK2_ENST00000440311.2_Intron|RAB5B_ENST00000448789.2_5'Flank|CDK2_ENST00000354056.4_Intron	NM_001798.3	NP_001789.2	P24941	CDK2_HUMAN	cyclin-dependent kinase 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|blood coagulation (GO:0007596)|cellular response to nitric oxide (GO:0071732)|centrosome duplication (GO:0051298)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone phosphorylation (GO:0016572)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transport (GO:0006813)|Ras protein signal transduction (GO:0007265)|regulation of gene silencing (GO:0060968)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	Cajal body (GO:0015030)|centrosome (GO:0005813)|chromosome, telomeric region (GO:0000781)|condensed chromosome (GO:0000793)|cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|X chromosome (GO:0000805)|Y chromosome (GO:0000806)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	18			UCEC - Uterine corpus endometrioid carcinoma (6;0.123)|OV - Ovarian serous cystadenocarcinoma(18;0.235)		Bosutinib(DB06616)	ATCTCTCCCTCTAGCAAATGC	0.512																																																	0													121.0	101.0	108.0					12																	56365301		2203	4300	6503	SO:0001627	intron_variant	0			M68520	CCDS8898.1, CCDS8899.1	12q13	2011-11-08				ENSG00000123374		"""Cyclin-dependent kinases"""	1771	protein-coding gene	gene with protein product		116953				1717994, 8275715	Standard	NM_001798		Approved		uc001sit.4	P24941		ENST00000266970.4:c.793-4C>G	12.37:g.56365301C>G			A8K7C6|O75100	RNA	SNP	-	NULL	ENST00000266970.4	37	NULL	CCDS8898.1	12																																																																																			CDK2	-	-	ENSG00000123374		0.512	CDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK2	HGNC	protein_coding	OTTHUMT00000409650.1	-	0.00	40	0	C			56365301	+1	tier1	-	no_errors	ENST00000556656	ensembl	human	known	74_37	rna	26.67	33	12	SNP	0.999	G
CELSR2	1952	genome.wustl.edu	37	1	109817677	109817677	+	3'UTR	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:109817677C>G	ENST00000271332.3	+	0	9839				CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2						cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCTACTTTGTCTAACCTGCTG	0.512																																					NSCLC(158;1285 2011 34800 34852 42084)												0																																										SO:0001624	3_prime_UTR_variant	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.*1006C>G	1.37:g.109817677C>G			Q5T2Y7|Q92566	RNA	SNP	-	NULL	ENST00000271332.3	37	NULL	CCDS796.1	1																																																																																			CELSR2	-	-	ENSG00000143126		0.512	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	-	0.00	30	0	C	NM_001408		109817677	+1	tier1	-	no_errors	ENST00000498157	ensembl	human	known	74_37	rna	41.18	30	21	SNP	1.000	G
CENPF	1063	genome.wustl.edu	37	1	214802455	214802455	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:214802455G>A	ENST00000366955.3	+	8	1303	c.1135G>A	c.(1135-1137)Gaa>Aaa	p.E379K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0	Interaction with SNAP25 and required for localization to the cytoplasm. {ECO:0000250}.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		ACAAAATGCAGAAAGTGCCAG	0.333																																					Colon(80;575 1284 11000 14801 43496)												0													65.0	70.0	68.0					1																	214802455		2202	4300	6502	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1135G>A	1.37:g.214802455G>A	ENSP00000355922:p.Glu379Lys		Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.E379K	ENST00000366955.3	37	c.1135	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.341690	0.95783	.	.	ENSG00000117724	ENST00000366955	T	0.80480	-1.38	5.61	5.61	0.85477	.	0.219538	0.23102	N	0.051910	D	0.90435	0.7005	.	.	.	0.46499	D	0.999072	D	0.89917	1.0	D	0.74348	0.983	D	0.91007	0.4847	9	0.72032	D	0.01	.	19.237	0.93864	0.0:0.0:1.0:0.0	.	379	P49454	CENPF_HUMAN	K	379	ENSP00000355922:E379K	ENSP00000355922:E379K	E	+	1	0	CENPF	212869078	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.767000	0.85331	2.640000	0.89533	0.655000	0.94253	GAA	CENPF	-	NULL	ENSG00000117724		0.333	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	-	0.00	47	0	G	NM_016343		214802455	+1	tier1	-	no_errors	ENST00000366955	ensembl	human	known	74_37	missense	27.85	57	22	SNP	1.000	A
CHMP2A	27243	genome.wustl.edu	37	19	59063771	59063771	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:59063771C>G	ENST00000600118.1	-	2	628	c.203G>C	c.(202-204)cGc>cCc	p.R68P	CHMP2A_ENST00000312547.2_Missense_Mutation_p.R68P|CHMP2A_ENST00000601220.1_Missense_Mutation_p.R68P			O43633	CHM2A_HUMAN	charged multivesicular body protein 2A	68	Interaction with VPS4B.				endosomal transport (GO:0016197)|establishment of protein localization (GO:0045184)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)	p.R68H(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	7		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		GCGCCGGGTGCGCACCAAGTC	0.507																																																	1	Substitution - Missense(1)	lung(1)											105.0	97.0	100.0					19																	59063771		2203	4300	6503	SO:0001583	missense	0			AF042384	CCDS12986.1	19q13.43	2014-09-04	2011-09-21		ENSG00000130724	ENSG00000130724		"""Charged multivesicular body proteins"""	30216	protein-coding gene	gene with protein product	"""putative breast adenocarcinoma marker (32kD)"", ""VPS2 homolog A (S. cerevisiae)"""	610893	"""chromatin modifying protein 2A"""			15173323, 11559748	Standard	XM_005258746		Approved	BC-2, CHMP2, VPS2, VPS2A	uc002qtk.3	O43633	OTTHUMG00000183547	ENST00000600118.1:c.203G>C	19.37:g.59063771C>G	ENSP00000469240:p.Arg68Pro		B2R4W6|Q3ZTT0	Missense_Mutation	SNP	pfam_Snf7	p.R68P	ENST00000600118.1	37	c.203	CCDS12986.1	19	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093831	0.56075	.	.	ENSG00000130724	ENST00000312547	T	0.74209	-0.82	5.21	4.18	0.49190	.	0.000000	0.85682	D	0.000000	D	0.89602	0.6762	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91804	0.5454	10	0.87932	D	0	.	11.877	0.52552	0.0:0.9143:0.0:0.0857	.	68	O43633	CHM2A_HUMAN	P	68	ENSP00000310440:R68P	ENSP00000310440:R68P	R	-	2	0	CHMP2A	63755583	1.000000	0.71417	1.000000	0.80357	0.189000	0.23516	7.020000	0.76419	1.353000	0.45828	-0.136000	0.14681	CGC	CHMP2A	-	pfam_Snf7	ENSG00000130724		0.507	CHMP2A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHMP2A	HGNC	protein_coding	OTTHUMT00000467088.1		0.00	41	0	C	NM_014453		59063771	-1			no_errors	ENST00000312547	ensembl	human	known	74_37	missense	7.00	93	7	SNP	1.000	G
CHRNB3	1142	genome.wustl.edu	37	8	42586882	42586882	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:42586882C>T	ENST00000289957.2	+	5	560	c.432C>T	c.(430-432)acC>acT	p.T144T		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	144					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	TTGTCTGGACCCCTCCCGCCA	0.522																																																	0													61.0	53.0	56.0					8																	42586882		2203	4300	6503	SO:0001819	synonymous_variant	0			U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.432C>T	8.37:g.42586882C>T			Q15827	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T144	ENST00000289957.2	37	c.432	CCDS6134.1	8																																																																																			CHRNB3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,tigrfam_Neur_channel	ENSG00000147432		0.522	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB3	HGNC	protein_coding	OTTHUMT00000383055.1	-	0.00	32	0	C			42586882	+1	tier1	-	no_errors	ENST00000289957	ensembl	human	known	74_37	silent	30.67	52	23	SNP	0.245	T
CNPPD1	27013	genome.wustl.edu	37	2	220037669	220037669	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:220037669G>A	ENST00000409789.1	-	9	1299	c.872C>T	c.(871-873)tCt>tTt	p.S291F	SLC23A3_ENST00000396775.3_5'Flank|SLC23A3_ENST00000295738.7_5'Flank|CNPPD1_ENST00000360507.5_Missense_Mutation_p.S291F|SLC23A3_ENST00000409878.3_5'Flank|SLC23A3_ENST00000455516.2_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	291					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						ATTAGCGAGAGACGGCAGGCA	0.632																																																	0													100.0	84.0	90.0					2																	220037669		2203	4300	6503	SO:0001583	missense	0			AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.872C>T	2.37:g.220037669G>A	ENSP00000386277:p.Ser291Phe		B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	pfam_Cyclin_PHO80-like,superfamily_Cyclin-like	p.S291F	ENST00000409789.1	37	c.872	CCDS2433.1	2	.	.	.	.	.	.	.	.	.	.	G	3.414	-0.119544	0.06838	.	.	ENSG00000115649	ENST00000360507;ENST00000409789;ENST00000453038	T;T;T	0.32988	2.39;2.39;1.43	4.66	1.6	0.23607	.	1.036580	0.07584	N	0.920745	T	0.17746	0.0426	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29610	-1.0006	10	0.51188	T	0.08	-17.6549	1.8053	0.03079	0.181:0.2161:0.4501:0.1527	.	291	Q9BV87	CNPD1_HUMAN	F	291	ENSP00000353698:S291F;ENSP00000386277:S291F;ENSP00000410109:S291F	ENSP00000353698:S291F	S	-	2	0	CNPPD1	219745913	0.753000	0.28349	0.001000	0.08648	0.032000	0.12392	0.861000	0.27885	0.442000	0.26555	-0.140000	0.14226	TCT	CNPPD1	-	NULL	ENSG00000115649		0.632	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNPPD1	HGNC	protein_coding	OTTHUMT00000336220.1	-	0.00	33	0	G	NM_015680		220037669	-1	tier1	-	no_errors	ENST00000360507	ensembl	human	known	74_37	missense	38.46	24	15	SNP	0.000	A
COPB1	1315	genome.wustl.edu	37	11	14498549	14498549	+	Silent	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:14498549T>C	ENST00000249923.3	-	12	1671	c.1371A>G	c.(1369-1371)ggA>ggG	p.G457G	RNU7-49P_ENST00000516182.1_RNA|COPB1_ENST00000439561.2_Silent_p.G457G|COPB1_ENST00000526191.1_5'Flank	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	457					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TCCATAATGCTCCTCGGTAAA	0.393																																																	0													156.0	143.0	147.0					11																	14498549		2200	4294	6494	SO:0001819	synonymous_variant	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1371A>G	11.37:g.14498549T>C			D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Silent	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.G457	ENST00000249923.3	37	c.1371	CCDS7815.1	11																																																																																			COPB1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	ENSG00000129083		0.393	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	-	0.00	43	0	T	NM_016451		14498549	-1	tier1	-	no_errors	ENST00000249923	ensembl	human	known	74_37	silent	29.27	29	12	SNP	1.000	C
COPS6	10980	genome.wustl.edu	37	7	99688533	99688533	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:99688533C>T	ENST00000303904.3	+	6	532	c.495C>T	c.(493-495)gtC>gtT	p.V165V	COPS6_ENST00000418625.1_Silent_p.V164V|MIR93_ENST00000385024.1_RNA|MIR25_ENST00000384816.1_RNA	NM_006833.4	NP_006824.2	Q7L5N1	CSN6_HUMAN	COP9 signalosome subunit 6	165					cullin deneddylation (GO:0010388)|viral process (GO:0016032)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|endometrium(3)|large_intestine(4)|lung(2)|prostate(1)|stomach(1)	12	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			AGCTTCCTGTCAGCGTTTTTG	0.438																																																	0													161.0	158.0	159.0					7																	99688533		2203	4300	6503	SO:0001819	synonymous_variant	0			BC002520	CCDS5682.1	7q22.1	2013-03-14	2013-03-14		ENSG00000168090	ENSG00000168090			21749	protein-coding gene	gene with protein product	"""COP9 subunit 6 (MOV34 homolog, 34 kD)"""	614729	"""COP9 constitutive photomorphogenic homolog subunit 6 (Arabidopsis)"""			12477932	Standard	NM_006833		Approved	MOV34-34KD, CSN6	uc003usu.3	Q7L5N1	OTTHUMG00000154632	ENST00000303904.3:c.495C>T	7.37:g.99688533C>T			A4D2A3|O15387	Silent	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.V165	ENST00000303904.3	37	c.495	CCDS5682.1	7																																																																																			COPS6	-	smart_JAB_MPN_dom	ENSG00000168090		0.438	COPS6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COPS6	HGNC	protein_coding	OTTHUMT00000336412.3	-	0.00	23	0	C	NM_006833		99688533	+1	tier1	-	no_errors	ENST00000303904	ensembl	human	known	74_37	silent	28.95	27	11	SNP	1.000	T
COPS7B	64708	genome.wustl.edu	37	2	232646561	232646561	+	5'UTR	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:232646561G>T	ENST00000410024.1	+	0	181				PDE6D_ENST00000409772.1_5'Flank|COPS7B_ENST00000409091.1_5'UTR|COPS7B_ENST00000409295.1_Missense_Mutation_p.V10F|PDE6D_ENST00000477748.1_5'Flank|PDE6D_ENST00000287600.4_5'Flank			Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B						cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GTTAACTTCTGTTTACATGGA	0.438																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000410024.1:c.-49G>T	2.37:g.232646561G>T			Q53S22|Q5BJG3|Q9H7V6	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.V10F	ENST00000410024.1	37	c.28	CCDS2488.1	2	.	.	.	.	.	.	.	.	.	.	G	13.30	2.197187	0.38806	.	.	ENSG00000144524	ENST00000409295	.	.	.	4.69	0.629	0.17687	.	.	.	.	.	T	0.56934	0.2019	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53337	-0.8453	5	0.52906	T	0.07	.	5.1812	0.15161	0.1994:0.3273:0.4733:0.0	.	.	.	.	F	10	.	ENSP00000386438:V10F	V	+	1	0	COPS7B	232354805	1.000000	0.71417	0.997000	0.53966	0.926000	0.56050	0.620000	0.24403	0.101000	0.17610	0.585000	0.79938	GTT	COPS7B	-	NULL	ENSG00000144524		0.438	COPS7B-015	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COPS7B	HGNC	protein_coding	OTTHUMT00000331916.1		0.00	42	0	G	NM_022730		232646561	+1			no_errors	ENST00000409295	ensembl	human	putative	74_37	missense	6.25	45	3	SNP	0.997	T
CORO2A	7464	genome.wustl.edu	37	9	100892121	100892121	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:100892121T>A	ENST00000343933.5	-	8	1179	c.922A>T	c.(922-924)Agc>Tgc	p.S308C	CORO2A_ENST00000375077.4_Missense_Mutation_p.S308C	NM_003389.3	NP_003380.3	Q92828	COR2A_HUMAN	coronin, actin binding protein, 2A	308					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	actin cytoskeleton (GO:0015629)|transcriptional repressor complex (GO:0017053)	actin filament binding (GO:0051015)			endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|skin(4)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				GTCAGGTAGCTCAGGTGAGGC	0.567																																																	0													183.0	141.0	155.0					9																	100892121		2203	4300	6503	SO:0001583	missense	0			U57057	CCDS6735.1	9q22.3	2013-01-10	2001-11-28		ENSG00000106789	ENSG00000106789		"""Coronins"", ""WD repeat domain containing"""	2255	protein-coding gene	gene with protein product	"""coronin 2A"", ""coronin-like protein B"", ""WD protein IR10"", ""WD-repeat protein 2"""	602159	"""coronin, actin-binding protein, 2A"""			8985118	Standard	NM_052820		Approved	IR10, WDR2	uc004aym.3	Q92828	OTTHUMG00000020340	ENST00000343933.5:c.922A>T	9.37:g.100892121T>A	ENSP00000343746:p.Ser308Cys		Q5TBR5|Q92829|Q9BWS5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S308C	ENST00000343933.5	37	c.922	CCDS6735.1	9	.	.	.	.	.	.	.	.	.	.	T	23.1	4.368838	0.82463	.	.	ENSG00000106789	ENST00000343933;ENST00000375077	T;T	0.30448	1.53;1.53	4.99	3.86	0.44501	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Domain of unknown function DUF1900 (1);	0.415818	0.30959	N	0.008524	T	0.31263	0.0791	L	0.28504	0.86	0.27880	N	0.939715	D	0.54207	0.965	P	0.55545	0.778	T	0.08700	-1.0709	10	0.56958	D	0.05	-7.6004	5.7068	0.17913	0.0:0.088:0.2812:0.6308	.	308	Q92828	COR2A_HUMAN	C	308	ENSP00000343746:S308C;ENSP00000364218:S308C	ENSP00000343746:S308C	S	-	1	0	CORO2A	99931942	1.000000	0.71417	0.642000	0.29436	0.995000	0.86356	3.961000	0.56759	0.935000	0.37341	0.454000	0.30748	AGC	CORO2A	-	pfam_DUF1900,superfamily_WD40_repeat_dom	ENSG00000106789		0.567	CORO2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO2A	HGNC	protein_coding	OTTHUMT00000053357.1	-	0.00	50	0	T	NM_003389		100892121	-1	tier1	-	no_errors	ENST00000343933	ensembl	human	known	74_37	missense	43.90	45	36	SNP	0.997	A
CRB2	286204	genome.wustl.edu	37	9	126133015	126133015	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:126133015G>A	ENST00000373631.3	+	7	1684	c.1683G>A	c.(1681-1683)ccG>ccA	p.P561P	CRB2_ENST00000359999.3_Silent_p.P561P|CRB2_ENST00000373629.2_Silent_p.P229P	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	561	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CGGCAACTCCGCTGCCTGCCG	0.682																																																	0													48.0	49.0	49.0					9																	126133015		2203	4299	6502	SO:0001819	synonymous_variant	0			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.1683G>A	9.37:g.126133015G>A			A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Silent	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.P561	ENST00000373631.3	37	c.1683	CCDS6852.2	9																																																																																			CRB2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000148204		0.682	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	-	0.00	35	0	G	NM_173689		126133015	+1	tier1	-	no_errors	ENST00000373631	ensembl	human	known	74_37	silent	41.18	29	21	SNP	0.000	A
CSMD3	114788	genome.wustl.edu	37	8	113316958	113316958	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:113316958T>C	ENST00000297405.5	-	52	8502	c.8258A>G	c.(8257-8259)tAt>tGt	p.Y2753C	CSMD3_ENST00000352409.3_Missense_Mutation_p.Y2683C|CSMD3_ENST00000343508.3_Missense_Mutation_p.Y2713C|CSMD3_ENST00000455883.2_Intron	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2753	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACTTTGGCAATATGGTCTTTC	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													127.0	115.0	119.0					8																	113316958		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8258A>G	8.37:g.113316958T>C	ENSP00000297405:p.Tyr2753Cys		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Y2753C	ENST00000297405.5	37	c.8258	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	15.86	2.957710	0.53400	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	5.04	3.86	0.44501	Complement control module (2);Sushi/SCR/CCP (2);	0.325341	0.25358	N	0.031246	T	0.34571	0.0902	L	0.33339	1.005	0.35870	D	0.828134	D;B	0.63046	0.992;0.015	P;B	0.62813	0.907;0.016	T	0.35151	-0.9800	10	0.42905	T	0.14	.	11.4088	0.49913	0.1355:0.0:0.0:0.8645	.	2753;2713	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	C	2713;2753;2023;2683	ENSP00000345799:Y2713C;ENSP00000297405:Y2753C;ENSP00000341558:Y2023C;ENSP00000343124:Y2683C	ENSP00000297405:Y2753C	Y	-	2	0	CSMD3	113386134	1.000000	0.71417	0.987000	0.45799	0.985000	0.73830	2.707000	0.47143	0.818000	0.34468	0.533000	0.62120	TAT	CSMD3	-	superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.368	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	49	0	T	NM_052900		113316958	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	27.45	37	14	SNP	0.994	C
CSRP1	1465	genome.wustl.edu	37	1	201453557	201453557	+	3'UTR	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:201453557C>T	ENST00000367306.1	-	0	1229				CSRP1_ENST00000532460.1_3'UTR|CSRP1_ENST00000458271.2_5'Flank|CSRP1_ENST00000340006.2_3'UTR|CSRP1_ENST00000533432.1_3'UTR|CSRP1_ENST00000531916.1_Intron			P21291	CSRP1_HUMAN	cysteine and glycine-rich protein 1						platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(2)|ovary(1)	6						gaacagagctctgtggGGCGA	0.602																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M33146	CCDS1413.1	1q32	2008-02-05			ENSG00000159176	ENSG00000159176			2469	protein-coding gene	gene with protein product		123876		CYRP		2115670, 9925910	Standard	NM_004078		Approved	CSRP, D1S181E	uc021phh.1	P21291	OTTHUMG00000035773	ENST00000367306.1:c.*284G>A	1.37:g.201453557C>T			A8K268|Q5U0J2	RNA	SNP	-	NULL	ENST00000367306.1	37	NULL	CCDS1413.1	1																																																																																			CSRP1	-	-	ENSG00000159176		0.602	CSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRP1	HGNC	protein_coding	OTTHUMT00000087027.1	-	0.00	38	0	C	NM_004078		201453557	-1	tier1	-	no_errors	ENST00000526256	ensembl	human	known	74_37	rna	34.33	44	23	SNP	0.001	T
CTDP1	9150	genome.wustl.edu	37	18	77473117	77473117	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr18:77473117G>C	ENST00000299543.7	+	7	1156	c.1009G>C	c.(1009-1011)Gaa>Caa	p.E337Q	CTDP1_ENST00000075430.7_Missense_Mutation_p.E337Q	NM_001202504.1|NM_004715.4	NP_001189433.1|NP_004706.3	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1	337	FCP1 homology. {ECO:0000255|PROSITE- ProRule:PRU00336}.				exit from mitosis (GO:0010458)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|protein dephosphorylation (GO:0006470)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	CTD phosphatase activity (GO:0008420)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(2)|urinary_tract(1)	35		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		TGGGTCCCGAGAATCTCAGAC	0.433																																																	0													59.0	58.0	58.0					18																	77473117		2203	4300	6503	SO:0001583	missense	0			AF081287	CCDS12017.1, CCDS12018.1, CCDS74239.1	18q23	2014-09-17			ENSG00000060069	ENSG00000060069		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	2498	protein-coding gene	gene with protein product		604927				9405607, 9765293	Standard	NM_004715		Approved	FCP1	uc002lnh.2	Q9Y5B0	OTTHUMG00000132920	ENST00000299543.7:c.1009G>C	18.37:g.77473117G>C	ENSP00000299543:p.Glu337Gln		A8MY97|Q7Z644|Q96BZ1|Q9Y6F5	Missense_Mutation	SNP	pfam_FCP1_C,pfam_NIF,superfamily_HAD-like_dom,superfamily_BRCT_dom,superfamily_Single_hybrid_motif,smart_NIF,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_NIF,tigrfam_FCP1_euk	p.E337Q	ENST00000299543.7	37	c.1009	CCDS12017.1	18	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667528	0.67814	.	.	ENSG00000060069	ENST00000299543;ENST00000075430	T;T	0.11712	2.77;2.75	4.82	4.82	0.62117	NLI interacting factor (1);	0.150275	0.64402	D	0.000017	T	0.17238	0.0414	N	0.22421	0.69	0.58432	D	0.999998	P;D;P	0.60160	0.888;0.987;0.908	P;P;P	0.57371	0.661;0.819;0.771	T	0.04360	-1.0957	10	0.36615	T	0.2	-21.7153	18.26	0.90031	0.0:0.0:1.0:0.0	.	218;337;337	Q9Y5B0-3;Q9Y5B0-4;Q9Y5B0	.;.;CTDP1_HUMAN	Q	337	ENSP00000299543:E337Q;ENSP00000075430:E337Q	ENSP00000075430:E337Q	E	+	1	0	CTDP1	75574105	1.000000	0.71417	0.996000	0.52242	0.097000	0.18754	8.561000	0.90715	2.364000	0.80123	0.655000	0.94253	GAA	CTDP1	-	pfscan_NIF	ENSG00000060069		0.433	CTDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDP1	HGNC	protein_coding	OTTHUMT00000256432.1	-	0.00	21	0	G	NM_004715		77473117	+1	tier1	-	no_errors	ENST00000299543	ensembl	human	known	74_37	missense	32.56	29	14	SNP	1.000	C
CTDSP1	58190	genome.wustl.edu	37	2	219269237	219269237	+	3'UTR	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:219269237C>A	ENST00000273062.2	+	0	1211				CTDSP1_ENST00000488627.1_3'UTR|MIR26B_ENST00000362251.2_RNA|CTDSP1_ENST00000443891.1_3'UTR	NM_021198.2|NM_182642.2	NP_067021.1|NP_872580.1	Q9GZU7	CTDS1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1						negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|protein dephosphorylation (GO:0006470)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|metal ion binding (GO:0046872)			NS(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	8		Renal(207;0.0915)		Epithelial(149;9.96e-07)|all cancers(144;0.00017)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TAGGAAAACCCATGGGCCGCC	0.657																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF229162	CCDS2416.1, CCDS56166.1	2q35	2010-06-21			ENSG00000144579	ENSG00000144579		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	21614	protein-coding gene	gene with protein product	"""nuclear LIM interactor-interacting factor"", ""small CTD phosphatase 1"""	605323				11950066, 12721286	Standard	NM_021198		Approved	NLIIF, SCP1	uc021vwv.1	Q9GZU7	OTTHUMG00000133109	ENST00000273062.2:c.*89C>A	2.37:g.219269237C>A			C9IYG0|Q7Z5Q3|Q7Z5Q4	RNA	SNP	-	NULL	ENST00000273062.2	37	NULL	CCDS2416.1	2																																																																																			CTDSP1	-	-	ENSG00000144579		0.657	CTDSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSP1	HGNC	protein_coding	OTTHUMT00000256774.1	-	0.00	63	0	C	NM_182642, NM_021198		219269237	+1	tier1	-	no_errors	ENST00000464255	ensembl	human	known	74_37	rna	33.94	72	37	SNP	0.000	A
CUL7	9820	genome.wustl.edu	37	6	43005697	43005697	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:43005697C>T	ENST00000265348.3	-	26	4911	c.4826G>A	c.(4825-4827)aGc>aAc	p.S1609N	CUL7_ENST00000535468.1_Missense_Mutation_p.S1693N|RN7SL403P_ENST00000481783.2_RNA			Q14999	CUL7_HUMAN	cullin 7	1609					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CTTACCAAGGCTGCTGACCAA	0.637																																																	0													76.0	68.0	71.0					6																	43005697		2203	4300	6503	SO:0001583	missense	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.4826G>A	6.37:g.43005697C>T	ENSP00000265348:p.Ser1609Asn		B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.S1693N	ENST00000265348.3	37	c.5078	CCDS4881.1	6	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326264	0.41197	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.80033	-1.32;-1.33	5.47	3.67	0.42095	.	0.466479	0.24774	N	0.035711	T	0.55737	0.1939	L	0.34521	1.04	0.33818	D	0.628679	B;B;P;P	0.36282	0.005;0.024;0.546;0.546	B;B;B;B	0.34722	0.008;0.008;0.188;0.123	T	0.60424	-0.7266	10	0.62326	D	0.03	-12.2662	8.6619	0.34097	0.0:0.7366:0.1275:0.1359	.	1693;1609;1693;1609	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	N	1609;1693	ENSP00000265348:S1609N;ENSP00000438788:S1693N	ENSP00000265348:S1609N	S	-	2	0	CUL7	43113675	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.905000	0.39878	1.291000	0.44653	-0.165000	0.13383	AGC	CUL7	-	smart_Cullin_neddylation_domain	ENSG00000044090		0.637	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	-	0.00	29	0	C	NM_014780		43005697	-1	tier1	-	no_errors	ENST00000535468	ensembl	human	known	74_37	missense	34.78	15	8	SNP	0.986	T
CYTH3	9265	genome.wustl.edu	37	7	6210572	6210572	+	Silent	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:6210572G>C	ENST00000350796.3	-	8	736	c.600C>G	c.(598-600)ctC>ctG	p.L200L	CYTH3_ENST00000396741.2_Silent_p.L115L|CYTH3_ENST00000488964.1_5'UTR	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	200	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						GGCTGGTGTTGAGCATGATGA	0.627																																																	0													172.0	123.0	140.0					7																	6210572		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.600C>G	7.37:g.6210572G>C			A4D2N8	Silent	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.L200	ENST00000350796.3	37	c.600	CCDS5346.1	7																																																																																			CYTH3	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000008256		0.627	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH3	HGNC	protein_coding	OTTHUMT00000207396.2	-	0.00	65	0	G	NM_004227		6210572	-1	tier1	-	no_errors	ENST00000350796	ensembl	human	known	74_37	silent	19.40	108	26	SNP	0.943	C
CYTH3	9265	genome.wustl.edu	37	7	6210939	6210939	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:6210939G>C	ENST00000350796.3	-	7	592	c.456C>G	c.(454-456)ttC>ttG	p.F152L	CYTH3_ENST00000396741.2_Missense_Mutation_p.F67L|CYTH3_ENST00000488964.1_5'UTR	NM_004227.3	NP_004218.1	O43739	CYH3_HUMAN	cytohesin 3	152	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				establishment of epithelial cell polarity (GO:0090162)|Golgi vesicle transport (GO:0048193)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|urinary_tract(1)	19						AGCTCCATAAGAACTGCCTGT	0.597																																																	0													52.0	54.0	54.0					7																	6210939		2203	4300	6503	SO:0001583	missense	0			AJ223957	CCDS5346.1	7p22.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000008256	ENSG00000008256		"""Pleckstrin homology (PH) domain containing"""	9504	protein-coding gene	gene with protein product		605081	"""pleckstrin homology, Sec7 and coiled-coil domains 3"""	PSCD3		9072969	Standard	NM_004227		Approved	GRP1, ARNO3, cytohesin-3	uc003spt.3	O43739	OTTHUMG00000023440	ENST00000350796.3:c.456C>G	7.37:g.6210939G>C	ENSP00000297044:p.Phe152Leu		A4D2N8	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.F152L	ENST00000350796.3	37	c.456	CCDS5346.1	7	.	.	.	.	.	.	.	.	.	.	G	20.4	3.984840	0.74474	.	.	ENSG00000008256	ENST00000350796;ENST00000396741	T;T	0.55234	0.53;0.53	4.95	3.08	0.35506	.	0.000000	0.85682	D	0.000000	T	0.57873	0.2083	M	0.63169	1.94	0.58432	D	0.999999	P;P	0.48503	0.911;0.881	P;B	0.53722	0.733;0.376	T	0.59204	-0.7498	10	0.59425	D	0.04	.	7.6625	0.28410	0.327:0.0:0.673:0.0	.	67;152	B7Z2V9;O43739-2	.;.	L	152;67	ENSP00000297044:F152L;ENSP00000379967:F67L	ENSP00000297044:F152L	F	-	3	2	CYTH3	6177464	0.985000	0.35326	0.998000	0.56505	0.846000	0.48090	0.217000	0.17603	1.197000	0.43143	0.655000	0.94253	TTC	CYTH3	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000008256		0.597	CYTH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH3	HGNC	protein_coding	OTTHUMT00000207396.2	-	0.00	30	0	G	NM_004227		6210939	-1	tier1	-	no_errors	ENST00000350796	ensembl	human	known	74_37	missense	29.31	41	17	SNP	1.000	C
DFNB31	25861	genome.wustl.edu	37	9	117165569	117165569	+	Silent	SNP	C	C	T	rs144207463		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:117165569C>T	ENST00000362057.3	-	11	2637	c.2469G>A	c.(2467-2469)gcG>gcA	p.A823A	DFNB31_ENST00000265134.6_Silent_p.A440A|DFNB31_ENST00000374059.3_Silent_p.A472A	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	823	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCAGGGTGGCCGCACTTTTCT	0.617													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16614	0.0		0.0	False		,,,				2504	0.0																0								C	,,	3,4403	8.1+/-20.4	0,3,2200	55.0	59.0	57.0		1320,2466,2469	-9.9	0.6	9	dbSNP_134	57	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	DFNB31	NM_001083885.2,NM_001173425.1,NM_015404.3	,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,	440/525,822/907,823/908	117165569	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.2469G>A	9.37:g.117165569C>T			A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A823	ENST00000362057.3	37	c.2469	CCDS6806.1	9																																																																																			DFNB31	-	pfam_PDZ,superfamily_PDZ,pfscan_PDZ	ENSG00000095397		0.617	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	HGNC	protein_coding	OTTHUMT00000053776.2	-	0.00	48	0	C	NM_015404		117165569	-1	tier1	rs144207463	no_errors	ENST00000362057	ensembl	human	known	74_37	silent	46.67	48	42	SNP	0.020	T
DIS3	22894	genome.wustl.edu	37	13	73345944	73345944	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:73345944G>A	ENST00000377767.4	-	11	1694	c.1594C>T	c.(1594-1596)Ctt>Ttt	p.L532F	DIS3_ENST00000377780.4_Missense_Mutation_p.L502F|DIS3_ENST00000545453.1_Missense_Mutation_p.L370F	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	532					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		TTTTCACAAAGATACACAGTT	0.343										Multiple Myeloma(4;0.011)																																							0													82.0	82.0	82.0					13																	73345944		2203	4300	6503	SO:0001583	missense	0			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1594C>T	13.37:g.73345944G>A	ENSP00000366997:p.Leu532Phe		A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	smart_PIN_dom	p.L532F	ENST00000377767.4	37	c.1594	CCDS9447.1	13	.	.	.	.	.	.	.	.	.	.	G	19.78	3.890400	0.72524	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.58210	0.35;0.35;0.35	5.76	5.76	0.90799	Ribonuclease II/R (2);	0.000000	0.85682	D	0.000000	T	0.68714	0.3031	L	0.60067	1.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.70324	-0.4903	10	0.87932	D	0	.	14.1644	0.65466	0.0713:0.0:0.9287:0.0	.	502;532	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	F	532;502;370	ENSP00000366997:L532F;ENSP00000367011:L502F;ENSP00000440058:L370F	ENSP00000366997:L532F	L	-	1	0	DIS3	72243945	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.457000	0.66672	2.724000	0.93272	0.462000	0.41574	CTT	DIS3	-	NULL	ENSG00000083520		0.343	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3	HGNC	protein_coding	OTTHUMT00000045250.2	-	0.00	31	0	G	NM_014953		73345944	-1	tier1	-	no_errors	ENST00000377767	ensembl	human	known	74_37	missense	22.22	28	8	SNP	1.000	A
DIS3L	115752	genome.wustl.edu	37	15	66615878	66615878	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr15:66615878C>G	ENST00000319212.4	+	11	1672	c.1622C>G	c.(1621-1623)tCc>tGc	p.S541C	DIS3L_ENST00000441424.2_3'UTR|DIS3L_ENST00000319194.5_Missense_Mutation_p.S458C|RP11-352G18.2_ENST00000565993.1_RNA	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	541					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ATGCTGCCTTCCGTCCTCAGT	0.517																																																	0													354.0	278.0	304.0					15																	66615878		2201	4299	6500	SO:0001583	missense	0				CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.1622C>G	15.37:g.66615878C>G	ENSP00000321711:p.Ser541Cys		Q8N1N8|Q8WTU9|Q96CM7	Missense_Mutation	SNP	NULL	p.S541C	ENST00000319212.4	37	c.1622	CCDS45286.1	15	.	.	.	.	.	.	.	.	.	.	C	18.06	3.539864	0.65085	.	.	ENSG00000166938	ENST00000319194;ENST00000319212	T;T	0.36878	1.23;1.23	5.74	5.74	0.90152	Ribonuclease II/R (2);	0.373004	0.33875	N	0.004471	T	0.48995	0.1531	M	0.67569	2.06	0.80722	D	1	P;P;P	0.47677	0.899;0.877;0.877	P;P;P	0.52646	0.705;0.58;0.698	T	0.47749	-0.9093	10	0.56958	D	0.05	-6.9813	12.2599	0.54645	0.0:0.9232:0.0:0.0768	.	541;407;541	Q8TF46;Q8TF46-2;Q8TF46-3	DI3L1_HUMAN;.;.	C	458;541	ENSP00000321583:S458C;ENSP00000321711:S541C	ENSP00000321583:S458C	S	+	2	0	DIS3L	64402932	0.653000	0.27358	0.831000	0.32960	0.272000	0.26649	5.928000	0.70088	2.715000	0.92844	0.655000	0.94253	TCC	DIS3L	-	NULL	ENSG00000166938		0.517	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIS3L	HGNC	protein_coding	OTTHUMT00000382792.2	-	0.00	56	0	C	NM_133375		66615878	+1	tier1	-	no_errors	ENST00000319212	ensembl	human	known	74_37	missense	40.70	51	35	SNP	0.985	G
DNASE1L1	1774	genome.wustl.edu	37	X	153631450	153631450	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chrX:153631450C>T	ENST00000393638.1	-	7	893	c.607G>A	c.(607-609)Gag>Aag	p.E203K	SNORA70_ENST00000384436.1_RNA|DNASE1L1_ENST00000369809.1_Missense_Mutation_p.E203K	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	203					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AAGCCTGGCTCAGTCCGCAGC	0.617																																																	0													55.0	54.0	54.0					X																	153631450		2203	4300	6503	SO:0001583	missense	0			L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.607G>A	X.37:g.153631450C>T	ENSP00000377255:p.Glu203Lys		D3DWW7|Q5HY41	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,pirsf_DNase_I,prints_DNase_I	p.E203K	ENST00000393638.1	37	c.607	CCDS14747.1	X	.	.	.	.	.	.	.	.	.	.	C	9.509	1.105338	0.20632	.	.	ENSG00000013563	ENST00000369809;ENST00000393638;ENST00000014935;ENST00000369808;ENST00000369807;ENST00000309585;ENST00000451865	T;T;T;T;T;T;T	0.41758	1.41;1.41;1.41;1.41;1.41;1.41;0.99	5.11	-1.49	0.08718	Endonuclease/exonuclease/phosphatase (2);	1.045490	0.07458	N	0.900100	T	0.24547	0.0595	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.25916	-1.0118	10	0.24483	T	0.36	-13.6477	6.5877	0.22630	0.0:0.3402:0.3746:0.2852	.	203	P49184	DNSL1_HUMAN	K	203	ENSP00000358824:E203K;ENSP00000377255:E203K;ENSP00000014935:E203K;ENSP00000358823:E203K;ENSP00000358822:E203K;ENSP00000309168:E203K;ENSP00000393346:E203K	ENSP00000014935:E203K	E	-	1	0	DNASE1L1	153284644	0.000000	0.05858	0.001000	0.08648	0.276000	0.26787	-0.517000	0.06275	0.029000	0.15352	0.597000	0.82753	GAG	DNASE1L1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,pirsf_DNase_I,prints_DNase_I	ENSG00000013563		0.617	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1L1	HGNC	protein_coding	OTTHUMT00000080928.2	-	0.00	30	0	C			153631450	-1	tier1	-	no_errors	ENST00000014935	ensembl	human	known	74_37	missense	65.12	15	28	SNP	0.000	T
DNASE1L1	1774	genome.wustl.edu	37	X	153633251	153633251	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chrX:153633251C>G	ENST00000393638.1	-	4	515	c.229G>C	c.(229-231)Gat>Cat	p.D77H	DNASE1L1_ENST00000369809.1_Missense_Mutation_p.D77H	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	77					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)	p.D77H(1)		lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAGAGCCATCAAATCTGCCA	0.587																																																	1	Substitution - Missense(1)	lung(1)											38.0	36.0	37.0					X																	153633251		2202	4300	6502	SO:0001583	missense	0			L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.229G>C	X.37:g.153633251C>G	ENSP00000377255:p.Asp77His		D3DWW7|Q5HY41	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,pirsf_DNase_I,prints_DNase_I	p.D77H	ENST00000393638.1	37	c.229	CCDS14747.1	X	.	.	.	.	.	.	.	.	.	.	C	4.642	0.119306	0.08881	.	.	ENSG00000013563	ENST00000369809;ENST00000393638;ENST00000014935;ENST00000369808;ENST00000369807;ENST00000309585;ENST00000451865;ENST00000424626	T;T;T;T;T;T;T;T	0.81247	0.73;0.73;0.73;0.73;0.73;0.73;-1.47;1.49	4.31	2.44	0.29823	Endonuclease/exonuclease/phosphatase (2);	0.368951	0.26563	U	0.023677	T	0.74382	0.3709	M	0.70595	2.14	0.09310	N	1	B	0.24258	0.1	B	0.24701	0.055	T	0.64495	-0.6394	10	0.44086	T	0.13	-10.9502	3.9648	0.09426	0.2374:0.6347:0.0:0.1279	.	77	P49184	DNSL1_HUMAN	H	77	ENSP00000358824:D77H;ENSP00000377255:D77H;ENSP00000014935:D77H;ENSP00000358823:D77H;ENSP00000358822:D77H;ENSP00000309168:D77H;ENSP00000393346:D77H;ENSP00000393000:D77H	ENSP00000014935:D77H	D	-	1	0	DNASE1L1	153286445	0.000000	0.05858	0.091000	0.20842	0.151000	0.21798	0.976000	0.29462	0.613000	0.30089	0.456000	0.33151	GAT	DNASE1L1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I,pirsf_DNase_I,prints_DNase_I	ENSG00000013563		0.587	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	DNASE1L1	HGNC	protein_coding	OTTHUMT00000080928.2	-	0.00	36	0	C			153633251	-1	tier1	-	no_errors	ENST00000014935	ensembl	human	known	74_37	missense	71.43	18	45	SNP	0.017	G
DPY19L2P2	349152	genome.wustl.edu	37	7	102836007	102836007	+	RNA	SNP	G	G	C	rs568174835		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:102836007G>C	ENST00000312132.4	-	0	3592							Q6ZN68	D19P2_HUMAN	DPY19L2 pseudogene 2							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ATCACTGTTAGAATGCCAAAG	0.358																																																	0																																												0			AL834175		7q22.1	2013-09-12	2013-09-12		ENSG00000170629	ENSG00000170629			21764	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 2 (C. elegans)"""				Standard	NR_027768		Approved	DKFZp434E092, FLJ36166	uc003vbh.4	Q6ZN68	OTTHUMG00000157200		7.37:g.102836007G>C			Q8N9V4|Q8ND62	RNA	SNP	-	NULL	ENST00000312132.4	37	NULL		7																																																																																			DPY19L2P2	-	-	ENSG00000170629		0.358	DPY19L2P2-002	KNOWN	basic	processed_transcript	DPY19L2P2	HGNC	pseudogene	OTTHUMT00000347877.1	-	0.00	93	0	G	NM_182634		102836007	-1	tier1	-	no_errors	ENST00000312132	ensembl	human	known	74_37	rna	28.08	105	41	SNP	0.762	C
DRD5	1816	genome.wustl.edu	37	4	9784785	9784785	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr4:9784785T>G	ENST00000304374.2	+	1	1528	c.1132T>G	c.(1132-1134)Ttc>Gtc	p.F378V		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	378					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.F378V(4)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GTGCAGCCACTTCTGCTCCCG	0.562																																																	4	Substitution - Missense(4)	skin(2)|NS(1)|endometrium(1)											63.0	55.0	57.0					4																	9784785		2203	4300	6503	SO:0001583	missense	0			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1132T>G	4.37:g.9784785T>G	ENSP00000306129:p.Phe378Val		B2R9S3|Q8NEQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Dopamine_D5_rcpt,prints_Dopamine_rcpt	p.F378V	ENST00000304374.2	37	c.1132	CCDS3405.1	4	.	.	.	.	.	.	.	.	.	.	t	1.422	-0.572511	0.03882	.	.	ENSG00000169676	ENST00000304374	T	0.36878	1.23	4.73	-0.492	0.12041	.	1.972870	0.02341	N	0.074845	T	0.21103	0.0508	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10109	-1.0644	10	0.16420	T	0.52	.	4.5978	0.12338	0.0:0.3044:0.1738:0.5218	.	378	P21918	DRD5_HUMAN	V	378	ENSP00000306129:F378V	ENSP00000306129:F378V	F	+	1	0	DRD5	9393883	0.067000	0.21026	0.022000	0.16811	0.197000	0.23852	0.558000	0.23469	-0.022000	0.13986	-2.216000	0.00297	TTC	DRD5	-	NULL	ENSG00000169676		0.562	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD5	HGNC	protein_coding	OTTHUMT00000250293.1		0.00	52	0	T			9784785	+1			no_errors	ENST00000304374	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.043	G
DYNC2H1	79659	genome.wustl.edu	37	11	103031724	103031724	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:103031724G>T	ENST00000375735.2	+	29	4586	c.4442G>T	c.(4441-4443)gGa>gTa	p.G1481V	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.G1481V|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1481	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TCTTTAGAGGGAGAAGTTGTA	0.264																																																	0													27.0	27.0	27.0					11																	103031724		1778	3992	5770	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.4442G>T	11.37:g.103031724G>T	ENSP00000364887:p.Gly1481Val		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G1481V	ENST00000375735.2	37	c.4442	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	21.1	4.097285	0.76870	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.66280	-0.2;-0.2	5.33	5.33	0.75918	Dynein heavy chain, domain-2 (1);	0.707303	0.11533	U	0.554536	D	0.84902	0.5575	M	0.92784	3.345	0.80722	D	1	D;D	0.71674	0.998;0.992	D;P	0.73380	0.98;0.875	D	0.85728	0.1329	10	0.72032	D	0.01	.	17.5433	0.87854	0.0:0.0:1.0:0.0	.	1481;1481	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	V	1481	ENSP00000364887:G1481V;ENSP00000381167:G1481V	ENSP00000364887:G1481V	G	+	2	0	DYNC2H1	102536934	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.683000	0.91236	2.652000	0.90054	0.467000	0.42956	GGA	DYNC2H1	-	pfam_Dynein_heavy_dom-2	ENSG00000187240		0.264	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	68	0	G	XM_370652		103031724	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
DYRK3	8444	genome.wustl.edu	37	1	206810256	206810256	+	Intron	SNP	C	C	T	rs201854176		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:206810256C>T	ENST00000367109.2	+	2	245				DYRK3_ENST00000489878.1_3'UTR|DYRK3_ENST00000367108.3_5'UTR|DYRK3_ENST00000367106.1_5'UTR|RP11-343H5.6_ENST00000425161.1_RNA	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3						erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GAGAAGTGATCCTTAATCATT	0.368																																					Melanoma(164;427 2622 26826 51707)												0													100.0	99.0	99.0					1																	206810256		2203	4300	6503	SO:0001627	intron_variant	0			Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.78-739C>T	1.37:g.206810256C>T			D3DT79|Q7Z752|Q9HBY6|Q9HBY7	RNA	SNP	-	NULL	ENST00000367109.2	37	NULL	CCDS30999.1	1																																																																																			DYRK3	-	-	ENSG00000143479		0.368	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK3	HGNC	protein_coding	OTTHUMT00000088458.1	-	0.00	59	0	C	NM_003582		206810256	+1	tier1	rs201854176	no_errors	ENST00000489878	ensembl	human	known	74_37	rna	27.78	65	25	SNP	0.000	T
EBAG9	9166	genome.wustl.edu	37	8	110575650	110575650	+	Intron	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:110575650C>T	ENST00000337573.5	+	7	821				EBAG9_ENST00000395785.2_Intron|EBAG9_ENST00000531677.1_Silent_p.L182L	NM_001278938.1|NM_004215.3	NP_001265867.1|NP_004206.1	O00559	RCAS1_HUMAN	estrogen receptor binding site associated, antigen, 9						regulation of cell growth (GO:0001558)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	peptidase activator activity involved in apoptotic process (GO:0016505)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)	10			OV - Ovarian serous cystadenocarcinoma(57;1.39e-14)			TATGTTTACTCTGCTCTCTCC	0.453																																																	0													583.0	526.0	544.0					8																	110575650		876	1991	2867	SO:0001627	intron_variant	0			AB007619	CCDS6313.1	8q23	2013-03-07			ENSG00000147654	ENSG00000147654			3123	protein-coding gene	gene with protein product		605772					Standard	NM_004215		Approved	EB9, RCAS1	uc003ynf.3	O00559	OTTHUMG00000165346	ENST00000337573.5:c.522-1018C>T	8.37:g.110575650C>T			A8K3N6|Q5Y8C7|Q6IB20|Q9BS76	Silent	SNP	pirsf_Cancer-assoc_antigen_RCAS1	p.L182	ENST00000337573.5	37	c.546	CCDS6313.1	8																																																																																			EBAG9	-	pirsf_Cancer-assoc_antigen_RCAS1	ENSG00000147654		0.453	EBAG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBAG9	HGNC	protein_coding	OTTHUMT00000383536.1	-	0.00	89	0	C	NM_004215		110575650	+1	tier1	-	no_errors	ENST00000531677	ensembl	human	novel	74_37	silent	57.46	77	104	SNP	0.003	T
EBPL	84650	genome.wustl.edu	37	13	50235138	50235138	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:50235138T>A	ENST00000242827.6	-	4	637	c.587A>T	c.(586-588)cAg>cTg	p.Q196L	EBPL_ENST00000495963.2_5'UTR|EBPL_ENST00000378272.5_3'UTR|EBPL_ENST00000378284.2_3'UTR|EBPL_ENST00000378270.5_3'UTR	NM_032565.3	NP_115954.1	Q9BY08	EBPL_HUMAN	emopamil binding protein-like	196					sterol metabolic process (GO:0016125)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholestenol delta-isomerase activity (GO:0047750)	p.Q196P(2)		endometrium(8)|kidney(6)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Lung NSC(96;0.000468)|Breast(56;0.0011)|Prostate(109;0.00243)|Hepatocellular(98;0.0556)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;2.06e-09)		GGTTTCTTTCTGATGCATTTT	0.383																																					NSCLC(39;857 1083 36109 42364 51411)												2	Substitution - Missense(2)	endometrium(2)											73.0	73.0	73.0					13																	50235138		2203	4300	6503	SO:0001583	missense	0			AF243433	CCDS9420.1, CCDS61334.1	13q12-q13	2008-02-05			ENSG00000123179	ENSG00000123179			18061	protein-coding gene	gene with protein product							Standard	NM_032565		Approved	EBRP	uc001vdg.3	Q9BY08	OTTHUMG00000016920	ENST00000242827.6:c.587A>T	13.37:g.50235138T>A	ENSP00000242827:p.Gln196Leu		A6NJ59|Q569H7|Q5JVN2|Q5JVN3|Q5JVN4|Q5JVN5|Q5JVN6	Missense_Mutation	SNP	pfam_EBP	p.Q196L	ENST00000242827.6	37	c.587	CCDS9420.1	13	.	.	.	.	.	.	.	.	.	.	T	12.27	1.886795	0.33348	.	.	ENSG00000123179	ENST00000242827	D	0.97994	-4.65	5.61	-2.45	0.06481	.	1.466260	0.03646	N	0.240220	D	0.93543	0.7939	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	D	0.86645	0.1894	10	0.29301	T	0.29	-0.1548	6.1064	0.20075	0.3657:0.0:0.2518:0.3825	.	196	Q9BY08	EBPL_HUMAN	L	196	ENSP00000242827:Q196L	ENSP00000242827:Q196L	Q	-	2	0	EBPL	49133139	0.002000	0.14202	0.003000	0.11579	0.996000	0.88848	-0.059000	0.11731	-0.151000	0.11176	0.528000	0.53228	CAG	EBPL	-	pfam_EBP	ENSG00000123179		0.383	EBPL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EBPL	HGNC	protein_coding	OTTHUMT00000044932.2		0.00	18	0	T	NM_032565		50235138	-1			no_errors	ENST00000242827	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.002	A
EIF2B1	1967	genome.wustl.edu	37	12	124116905	124116905	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:124116905C>G	ENST00000424014.2	-	2	310	c.102G>C	c.(100-102)ttG>ttC	p.L34F	EIF2B1_ENST00000537073.1_Missense_Mutation_p.L34F|EIF2B1_ENST00000543940.1_5'UTR|EIF2B1_ENST00000539951.1_Missense_Mutation_p.L21F|GTF2H3_ENST00000228955.7_5'Flank|GTF2H3_ENST00000543341.2_5'Flank	NM_001414.3	NP_001405.1	Q14232	EI2BA_HUMAN	eukaryotic translation initiation factor 2B, subunit 1 alpha, 26kDa	34					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme regulator activity (GO:0030234)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			breast(1)|kidney(3)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.67e-05)|Epithelial(86;0.000353)|all cancers(50;0.00489)		TATCTCTCTTCAAGAACTCCA	0.388																																																	0													107.0	122.0	117.0					12																	124116905		2203	4300	6503	SO:0001583	missense	0			X95648	CCDS31924.1	12q24.3	1998-10-16	2002-08-29		ENSG00000111361	ENSG00000111361			3257	protein-coding gene	gene with protein product		606686	"""eukaryotic translation initiation factor 2B, subunit 1 (alpha, 26kD)"""	EIF2B			Standard	NM_001414		Approved	EIF-2Balpha, EIF-2B, EIF2BA	uc001ufm.3	Q14232	OTTHUMG00000168696	ENST00000424014.2:c.102G>C	12.37:g.124116905C>G	ENSP00000416250:p.Leu34Phe		A6NLY9|B4DGX0|Q3SXP4	Missense_Mutation	SNP	pfam_IF-2B-related	p.L34F	ENST00000424014.2	37	c.102	CCDS31924.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.237776|3.237776	0.58886|0.58886	.|.	.|.	ENSG00000111361|ENSG00000111361	ENST00000424014;ENST00000228958;ENST00000539951;ENST00000537073|ENST00000534960	D;D;D;D|.	0.93076|.	-3.16;-3.16;-3.16;-3.16|.	5.38|5.38	0.697|0.697	0.18081|0.18081	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.76062|.	0.3935|.	M|M	0.91196|0.91196	3.185|3.185	0.80722|0.80722	D|D	1|1	P;P;B|.	0.40553|.	0.721;0.454;0.25|.	P;B;B|.	0.47470|.	0.548;0.21;0.252|.	T|.	0.75172|.	-0.3411|.	10|.	0.62326|.	D|.	0.03|.	-14.3012|-14.3012	7.6581|7.6581	0.28388|0.28388	0.0:0.5324:0.2356:0.232|0.0:0.5324:0.2356:0.232	.|.	34;21;34|.	B4DGX0;F5H0D0;Q14232|.	.;.;EI2BA_HUMAN|.	F|S	34;34;21;34|50	ENSP00000416250:L34F;ENSP00000228958:L34F;ENSP00000438060:L21F;ENSP00000444183:L34F|.	ENSP00000228958:L34F|.	L|X	-|-	3|2	2|2	EIF2B1|EIF2B1	122682858|122682858	0.994000|0.994000	0.37717|0.37717	0.998000|0.998000	0.56505|0.56505	0.919000|0.919000	0.55068|0.55068	0.320000|0.320000	0.19540|0.19540	0.210000|0.210000	0.20664|0.20664	0.557000|0.557000	0.71058|0.71058	TTG|TGA	EIF2B1	-	pfam_IF-2B-related	ENSG00000111361		0.388	EIF2B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2B1	HGNC	protein_coding	OTTHUMT00000400628.1	-	0.00	45	0	C	NM_001414		124116905	-1	tier1	-	no_errors	ENST00000424014	ensembl	human	known	74_37	missense	38.64	27	17	SNP	0.993	G
ENAM	10117	genome.wustl.edu	37	4	71508640	71508640	+	Silent	SNP	A	A	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr4:71508640A>T	ENST00000396073.3	+	9	1778	c.1497A>T	c.(1495-1497)ggA>ggT	p.G499G	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	499					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			ACCCAAGAGGAGATTCCAGAA	0.373																																																	0													41.0	42.0	42.0					4																	71508640		2203	4300	6503	SO:0001819	synonymous_variant	0			AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.1497A>T	4.37:g.71508640A>T			Q17RI5|Q9H3D1	Silent	SNP	NULL	p.G499	ENST00000396073.3	37	c.1497	CCDS3544.2	4																																																																																			ENAM	-	NULL	ENSG00000132464		0.373	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	HGNC	protein_coding	OTTHUMT00000252166.3	-	0.00	14	0	A	NM_031889		71508640	+1	tier1	-	no_errors	ENST00000396073	ensembl	human	known	74_37	silent	53.85	6	7	SNP	0.998	T
SLC12A6	9990	genome.wustl.edu	37	15	34607028	34607028	+	Intron	DEL	A	A	-	rs566307709	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr15:34607028delA	ENST00000354181.3	-	2	764				Y_RNA_ENST00000384363.1_RNA|SLC12A6_ENST00000558589.1_Intron|SLC12A6_ENST00000558667.1_Intron|SLC12A6_ENST00000458406.2_Intron|SLC12A6_ENST00000560611.1_Intron|SLC12A6_ENST00000290209.5_Intron|SLC12A6_ENST00000397702.2_Intron|SLC12A6_ENST00000397707.2_Intron			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6						angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	gaccagccttaaaaaaaaaaa	0.383													|||unknown(HR)	981	0.195887	0.1664	0.2594	5008	,	,		20428	0.1062		0.2545	False		,,,				2504	0.2229																0																																										SO:0001627	intron_variant	0			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.271+21582T>-	15.37:g.34607028delA			A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	RNA	DEL	-	NULL	ENST00000354181.3	37	NULL	CCDS58352.1	15																																																																																			Y_RNA	-	-	ENSG00000207091		0.383	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000207091	RFAM	protein_coding	OTTHUMT00000417991.1		0.00	9	0	A	NM_005135		34607028	+1	tier1		no_errors	ENST00000384363	ensembl	human	novel	74_37	rna	11.54	23	3	DEL	0.866	-
SCRIB	23513	genome.wustl.edu	37	8	144872069	144872069	+	IGR	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:144872069G>C	ENST00000320476.3	-	0	5143				RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000534089.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein						activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCGGCTGGGGGCTGGGACATA	0.716																																					Pancreas(51;966 1133 10533 14576 29674)												0																																										SO:0001628	intergenic_variant	0			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154		8.37:g.144872069G>C			Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	RNA	SNP	-	NULL	ENST00000320476.3	37	NULL	CCDS6411.1	8																																																																																			RP11-429J17.8	-	-	ENSG00000214733		0.716	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000214733	Clone_based_vega_gene	protein_coding	OTTHUMT00000382215.1	-	0.00	9	0	G	NM_015356		144872069	+1	tier1	-	no_errors	ENST00000534089	ensembl	human	known	74_37	rna	45.45	12	10	SNP	0.100	C
SCRIB	23513	genome.wustl.edu	37	8	144872149	144872149	+	IGR	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:144872149G>A	ENST00000320476.3	-	0	5143				RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA|SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000534089.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein						activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			AGGGGAGGAAGAGGCGCCTGG	0.677																																					Pancreas(51;966 1133 10533 14576 29674)												0																																										SO:0001628	intergenic_variant	0			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154		8.37:g.144872149G>A			Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	RNA	SNP	-	NULL	ENST00000320476.3	37	NULL	CCDS6411.1	8																																																																																			RP11-429J17.8	-	-	ENSG00000214733		0.677	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000214733	Clone_based_vega_gene	protein_coding	OTTHUMT00000382215.1	-	0.00	10	0	G	NM_015356		144872149	+1	tier1	-	no_errors	ENST00000527139	ensembl	human	known	74_37	rna	40.43	28	19	SNP	0.002	A
TBC1D7	51256	genome.wustl.edu	37	6	13295560	13295560	+	RNA	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:13295560G>A	ENST00000606150.1	-	0	161																											TGAAGACGCTGCGGCTCATGT	0.428																																																	0																																												0																															6.37:g.13295560G>A				RNA	SNP	-	NULL	ENST00000606150.1	37	NULL		6																																																																																			RP1-257A7.4	-	-	ENSG00000215022		0.428	RP1-257A7.4-004	KNOWN	basic	antisense	ENSG00000215022	Clone_based_vega_gene	antisense	OTTHUMT00000470284.1	-	0.00	53	0	G			13295560	-1	tier1	-	no_errors	ENST00000606150	ensembl	human	known	74_37	rna	38.96	47	30	SNP	0.000	A
RAPGEF2	9693	genome.wustl.edu	37	4	160216872	160216873	+	Intron	INS	-	-	GTGT	rs373050400|rs57970154|rs71589223		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr4:160216872_160216873insGTGT	ENST00000264431.4	+	2	479				AC105316.1_ENST00000401270.1_RNA|RAPGEF2_ENST00000504604.1_Intron	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		AGAgtgtgtgagtgtgtgtgtg	0.416																																																	0																																										SO:0001627	intron_variant	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8621->GTGT	4.37:g.160216877_160216880dupGTGT			D3DP27	RNA	INS	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			AC105316.1	-	-	ENSG00000216089		0.416	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000364980.2		0.00	19	0	-	NM_014247		160216873	+1	tier1		no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	9.76	37	4	INS	0.000:0.002	GTGT
TTYH1	57348	genome.wustl.edu	37	19	54942204	54942204	+	Intron	SNP	G	G	A	rs372640517		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:54942204G>A	ENST00000376530.3	+	10	1135				TTYH1_ENST00000489425.1_Intron|TTYH1_ENST00000301194.4_Intron|TTYH1_ENST00000376531.3_Intron|TTYH1_ENST00000391739.3_Intron|AC008746.3_ENST00000457113.1_RNA	NM_001201461.1|NM_020659.3	NP_001188390.1|NP_065710.1	Q9H313	TTYH1_HUMAN	tweety family member 1						cell-substrate adhesion (GO:0031589)|chloride transport (GO:0006821)|filopodium assembly (GO:0046847)|ion transmembrane transport (GO:0034220)|iron ion transmembrane transport (GO:0034755)|iron ion transport (GO:0006826)|mitotic nuclear division (GO:0007067)|regulation of anion transport (GO:0044070)|single organismal cell-cell adhesion (GO:0016337)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|filopodium membrane (GO:0031527)|filopodium tip (GO:0032433)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum membrane (GO:0030868)	calcium ion binding (GO:0005509)|iron ion transmembrane transporter activity (GO:0005381)|volume-sensitive chloride channel activity (GO:0072320)			endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0767)		tgtgggcggggacgcagggcg	0.716																																																	0																																										SO:0001627	intron_variant	0			AF177909	CCDS12893.1, CCDS33106.1, CCDS56102.1	19q13.4	2013-09-02	2013-09-02		ENSG00000167614	ENSG00000167614			13476	protein-coding gene	gene with protein product		605784	"""tweety (Drosophila) homolog 1"", ""tweety homolog 1 (Drosophila)"""			10950931	Standard	NM_020659		Approved		uc002qfr.3	Q9H313	OTTHUMG00000065544	ENST00000376530.3:c.1033-73G>A	19.37:g.54942204G>A			B0VJY3|B0VJY4|B0VJY5|B2VAL9|Q5U682|Q68A17|Q6L750|Q6ZTE5|Q8WUU2	RNA	SNP	-	NULL	ENST00000376530.3	37	NULL	CCDS12893.1	19																																																																																			AC008746.3	-	-	ENSG00000227407		0.716	TTYH1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000227407	Clone_based_vega_gene	protein_coding	OTTHUMT00000140498.1	-	0.00	27	0	G			54942204	-1	tier1	-	no_errors	ENST00000457113	ensembl	human	known	74_37	rna	34.38	42	22	SNP	0.000	A
CROCC	9696	genome.wustl.edu	37	1	17183282	17183282	+	lincRNA	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:17183282G>A	ENST00000414128.1	+	0	193				MIR3675_ENST00000583661.1_RNA																							CGCCGGGGCTGAACGCTGGCT	0.537																																																	0																																												0																															1.37:g.17183282G>A				RNA	SNP	-	NULL	ENST00000414128.1	37	NULL		1																																																																																			RP11-108M9.2	-	-	ENSG00000230239		0.537	RP11-108M9.2-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000230239	Clone_based_vega_gene	lincRNA	OTTHUMT00000006253.1	-	0.00	78	0	G			17183282	+1	tier1	-	no_errors	ENST00000414128	ensembl	human	known	74_37	rna	10.94	57	7	SNP	0.023	A
RP11-213G2.2	0	genome.wustl.edu	37	9	88401221	88401222	+	lincRNA	INS	-	-	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:88401221_88401222insC	ENST00000443630.1	-	0	317																											GTTCTTTAGCACCCCCCAGTGG	0.411																																																	0																																												0																															9.37:g.88401227_88401227dupC				RNA	INS	-	NULL	ENST00000443630.1	37	NULL		9																																																																																			RP11-213G2.2	-	-	ENSG00000230303		0.411	RP11-213G2.2-003	KNOWN	basic	lincRNA	ENSG00000230303	Clone_based_vega_gene	lincRNA	OTTHUMT00000052899.1		0.00	42	0	-			88401222	-1	tier1		no_errors	ENST00000456242	ensembl	human	known	74_37	rna	42.50	23	17	INS	1.000:0.999	C
ANKRD20A3	441425	genome.wustl.edu	37	9	43135138	43135138	+	5'Flank	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:43135138C>G	ENST00000254835.2	-	0	0				AL513478.1_ENST00000377437.2_Missense_Mutation_p.S15C	NM_001012419.1	NP_001012419.1	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3																		TGGCGGGGCTCCCCTGGACGG	0.652																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS35029.1	9q12	2014-05-06			ENSG00000132498	ENSG00000276203		"""Ankyrin repeat domain containing"""	31981	protein-coding gene	gene with protein product							Standard	NM_001012419		Approved		uc004acd.3	Q5VUR7	OTTHUMG00000188432		9.37:g.43135138C>G	Exception_encountered			Missense_Mutation	SNP	NULL	p.S15C	ENST00000254835.2	37	c.44	CCDS35029.1	9																																																																																			AL513478.1	-	NULL	ENSG00000232866		0.652	ANKRD20A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232866	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000037047.1	-	0.00	159	0	C			43135138	+1	tier1	-	no_errors	ENST00000377437	ensembl	human	novel	74_37	missense	38.20	110	68	SNP	0.236	G
LINC01330	646168	genome.wustl.edu	37	3	167632982	167632982	+	lincRNA	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:167632982G>C	ENST00000481578.1	+	0	625																											AGTGCCATAAGATTGCCAAGG	0.378																																																	0																																												0																															3.37:g.167632982G>C				RNA	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			RP11-298O21.5	-	-	ENSG00000244227		0.378	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	-	0.00	46	0	G			167632982	+1	tier1	-	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	24.00	38	12	SNP	0.999	C
DYNC1LI2	1783	genome.wustl.edu	37	16	66755061	66755061	+	3'UTR	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:66755061G>A	ENST00000258198.2	-	0	4249				RP11-63M22.2_ENST00000569274.1_RNA	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TTTCAACTTTGTTAAATTAAT	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.*2564C>T	16.37:g.66755061G>A			A8K6V1|B4DZP4|Q8TAT3	RNA	SNP	-	NULL	ENST00000258198.2	37	NULL	CCDS10818.1	16																																																																																			RP11-63M22.2	-	-	ENSG00000260465		0.299	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260465	Clone_based_vega_gene	protein_coding	OTTHUMT00000268846.1	-	0.00	19	0	G	NM_006141		66755061	+1	tier1	-	no_errors	ENST00000569274	ensembl	human	known	74_37	rna	25.00	15	5	SNP	0.120	A
AGAP11	119385	genome.wustl.edu	37	10	88752169	88752169	+	RNA	SNP	G	G	A	rs111906424	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:88752169G>A	ENST00000444431.1	+	0	7				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										GTCTGGAAGAGAAATCCCAAA	0.428																																																	0																																												0					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88752169G>A			B9EIP7|D3DWE4	RNA	SNP	-	NULL	ENST00000444431.1	37	NULL		10																																																																																			RP11-96C23.5	-	-	ENSG00000271880		0.428	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000271880	Clone_based_vega_gene	processed_transcript	OTTHUMT00000049193.1	-	0.00	183	0	G	NM_133447		88752169	+1	tier1	-	no_errors	ENST00000433214	ensembl	human	known	74_37	rna	39.64	102	67	SNP	0.998	A
EPB41L5	57669	genome.wustl.edu	37	2	120799600	120799600	+	Missense_Mutation	SNP	G	G	A	rs142458983		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:120799600G>A	ENST00000263713.5	+	3	413	c.199G>A	c.(199-201)Gag>Aag	p.E67K	EPB41L5_ENST00000443124.1_Missense_Mutation_p.E67K|EPB41L5_ENST00000331393.4_Missense_Mutation_p.E67K|EPB41L5_ENST00000452780.1_Missense_Mutation_p.E67K|EPB41L5_ENST00000443902.2_Missense_Mutation_p.E67K	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	67	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						CAAAGGACAAGAGTTGTTTGA	0.348																																																	0													157.0	150.0	152.0					2																	120799600		2203	4300	6503	SO:0001583	missense	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.199G>A	2.37:g.120799600G>A	ENSP00000263713:p.Glu67Lys		Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.E67K	ENST00000263713.5	37	c.199	CCDS2130.1	2	.	.	.	.	.	.	.	.	.	.	G	16.47	3.133311	0.56828	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.18	5.18	0.71444	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.496080	0.17838	N	0.160299	D	0.83166	0.5195	M	0.89601	3.045	0.58432	D	0.999993	P;B;P	0.45044	0.818;0.234;0.849	B;B;B	0.43990	0.311;0.197;0.438	D	0.84709	0.0733	10	0.39692	T	0.17	.	13.8361	0.63410	0.0:0.1544:0.8456:0.0	.	67;67;67	Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;E41L5_HUMAN	K	67	ENSP00000263713:E67K;ENSP00000393856:E67K;ENSP00000329687:E67K;ENSP00000393722:E67K;ENSP00000390439:E67K	ENSP00000263713:E67K	E	+	1	0	EPB41L5	120516070	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	7.137000	0.77295	2.420000	0.82092	0.460000	0.39030	GAG	EPB41L5	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain,prints_Ez/rad/moesin_like	ENSG00000115109		0.348	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	-	0.00	57	0	G	NM_020909		120799600	+1	tier1	-	no_errors	ENST00000263713	ensembl	human	known	74_37	missense	31.67	41	19	SNP	1.000	A
EPHA4	2043	genome.wustl.edu	37	2	222433469	222433469	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:222433469A>T	ENST00000281821.2	-	2	169	c.128T>A	c.(127-129)cTt>cAt	p.L43H	EPHA4_ENST00000392071.4_Intron|EPHA4_ENST00000409854.1_Missense_Mutation_p.L43H|EPHA4_ENST00000409938.1_Missense_Mutation_p.L43H	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	43	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TATCCACCCAAGTTCTCCCTG	0.403																																																	0													62.0	59.0	60.0					2																	222433469		2203	4300	6503	SO:0001583	missense	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.128T>A	2.37:g.222433469A>T	ENSP00000281821:p.Leu43His		A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L43H	ENST00000281821.2	37	c.128	CCDS2447.1	2	.	.	.	.	.	.	.	.	.	.	A	19.47	3.834051	0.71373	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000541600;ENST00000434266	T;T;T;T;T	0.08634	3.07;3.07;3.07;3.07;3.07	5.61	5.61	0.85477	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.40372	0.1114	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.54886	-0.8226	10	0.87932	D	0	.	15.7987	0.78433	1.0:0.0:0.0:0.0	.	43	P54764	EPHA4_HUMAN	H	43	ENSP00000281821:L43H;ENSP00000386276:L43H;ENSP00000386829:L43H;ENSP00000444085:L43H;ENSP00000404089:L43H	ENSP00000281821:L43H	L	-	2	0	EPHA4	222141713	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.643000	0.91040	2.125000	0.65367	0.455000	0.32223	CTT	EPHA4	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000116106		0.403	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	-	0.00	57	0	A			222433469	-1	tier1	-	no_errors	ENST00000281821	ensembl	human	known	74_37	missense	37.14	44	26	SNP	1.000	T
ESPN	83715	genome.wustl.edu	37	1	6517321	6517321	+	Missense_Mutation	SNP	G	G	C	rs145302595		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:6517321G>C	ENST00000377828.1	+	11	2571	c.2403G>C	c.(2401-2403)gaG>gaC	p.E801D	ESPN_ENST00000461727.1_Missense_Mutation_p.E235D|ESPN_ENST00000416731.1_Missense_Mutation_p.E235D|ESPN_ENST00000475228.1_3'UTR	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	801	Glu-rich.				locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		TGGAAGAAGAGAGGTGAGCTG	0.617																																																	0													36.0	40.0	39.0					1																	6517321		2203	4300	6503	SO:0001583	missense	0			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.2403G>C	1.37:g.6517321G>C	ENSP00000367059:p.Glu801Asp		Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_WH2_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_WH2_dom	p.E801D	ENST00000377828.1	37	c.2403	CCDS70.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.14|19.14	3.769835|3.769835	0.69992|0.69992	.|.	.|.	ENSG00000187017|ENSG00000187017	ENST00000377828;ENST00000416731|ENST00000434576	T;D|D	0.84442|0.84516	-0.37;-1.85|-1.86	5.08|5.08	5.08|5.08	0.68730|0.68730	.|.	0.109437|0.109437	0.64402|0.64402	N|D	0.000013|0.000013	D|D	0.88592|0.88592	0.6478|0.6478	M|M	0.64567|0.64567	1.98|1.98	0.43372|0.43372	D|D	0.995463|0.995463	B;P|.	0.46220|.	0.22;0.874|.	B;P|.	0.45794|.	0.1;0.493|.	D|D	0.89457|0.89457	0.3734|0.3734	10|8	0.37606|0.72032	T|D	0.19|0.01	-39.0921|-39.0921	12.8676|12.8676	0.57948|0.57948	0.0:0.1641:0.8359:0.0|0.0:0.1641:0.8359:0.0	.|.	235;801|.	B1AK53-2;B1AK53|.	.;ESPN_HUMAN|.	D|Q	801;235|145	ENSP00000367059:E801D;ENSP00000399239:E235D|ENSP00000413621:E145Q	ENSP00000367059:E801D|ENSP00000413621:E145Q	E|E	+|+	3|1	2|0	ESPN|ESPN	6439908|6439908	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	2.628000|2.628000	0.46477|0.46477	2.350000|2.350000	0.79820|0.79820	0.561000|0.561000	0.74099|0.74099	GAG|GAG	ESPN	-	NULL	ENSG00000187017		0.617	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	HGNC	protein_coding	OTTHUMT00000001887.3	-	0.00	80	0	G	NM_031475		6517321	+1	tier1	-	no_errors	ENST00000377828	ensembl	human	known	74_37	missense	39.66	70	46	SNP	1.000	C
FAM230A	653203	genome.wustl.edu	37	22	20710110	20710110	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr22:20710110G>A	ENST00000434783.3	+	8	2026	c.1842G>A	c.(1840-1842)ccG>ccA	p.P614P	USP41_ENST00000486536.2_Intron|USP41_ENST00000454608.2_Intron					family with sequence similarity 230, member A																		CGAGGACGCCGCCCACGGCGT	0.706																																																	0																																										SO:0001819	synonymous_variant	0			JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.1842G>A	22.37:g.20710110G>A				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.P614	ENST00000434783.3	37	c.1842		22																																																																																			FAM230A	-	superfamily_Kinase-like_dom	ENSG00000188280		0.706	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	-	0.00	26	0	G			20710110	+1	tier1	-	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	37.68	43	26	SNP	0.091	A
FLT1	2321	genome.wustl.edu	37	13	28880885	28880885	+	Missense_Mutation	SNP	G	G	T	rs61226903		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:28880885G>T	ENST00000282397.4	-	29	3996	c.3745C>A	c.(3745-3747)Ctg>Atg	p.L1249M	FLT1_ENST00000540678.1_Missense_Mutation_p.L467M|FLT1_ENST00000543394.1_Missense_Mutation_p.L272M	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	1249					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)	p.L1249M(1)		NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAGGCCAACAGAGTGCTGCTG	0.552																																																	1	Substitution - Missense(1)	lung(1)											91.0	83.0	86.0					13																	28880885		2203	4300	6503	SO:0001583	missense	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.3745C>A	13.37:g.28880885G>T	ENSP00000282397:p.Leu1249Met		A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.L1249M	ENST00000282397.4	37	c.3745	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	G	10.08	1.253530	0.22965	.	.	ENSG00000102755	ENST00000282397;ENST00000543394;ENST00000540678	T;T;T	0.78246	-0.93;-1.13;-1.16	5.23	3.3	0.37823	.	0.161309	0.39615	N	0.001305	T	0.69833	0.3155	L	0.38175	1.15	0.80722	D	1	P	0.46395	0.877	B	0.42462	0.388	T	0.73987	-0.3809	10	0.72032	D	0.01	.	12.729	0.57187	0.0:0.5082:0.4918:0.0	.	1249	P17948	VGFR1_HUMAN	M	1249;272;467	ENSP00000282397:L1249M;ENSP00000437841:L272M;ENSP00000443311:L467M	ENSP00000282397:L1249M	L	-	1	2	FLT1	27778885	0.995000	0.38212	0.757000	0.31301	0.261000	0.26267	2.921000	0.48852	1.293000	0.44690	0.650000	0.86243	CTG	FLT1	-	NULL	ENSG00000102755		0.552	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1		0.00	57	0	G			28880885	-1			no_errors	ENST00000282397	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.791	T
FLT1	2321	genome.wustl.edu	37	13	28908259	28908259	+	Silent	SNP	T	T	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:28908259T>G	ENST00000282397.4	-	18	2747	c.2496A>C	c.(2494-2496)tcA>tcC	p.S832S	FLT1_ENST00000540678.1_Silent_p.S50S	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	832	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTCTTCCAAGTGATTTGCCTG	0.438																																																	0													151.0	142.0	145.0					13																	28908259		2203	4300	6503	SO:0001819	synonymous_variant	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.2496A>C	13.37:g.28908259T>G			A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR1_rcpt	p.S832	ENST00000282397.4	37	c.2496	CCDS9330.1	13																																																																																			FLT1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000102755		0.438	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	-	0.00	18	0	T			28908259	-1	tier1	-	no_errors	ENST00000282397	ensembl	human	known	74_37	silent	80.95	4	17	SNP	0.005	G
FOLH1	2346	genome.wustl.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame|FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																																	1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.R281H	ENST00000256999.2	37	c.842	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	FOLH1	-	NULL	ENSG00000086205		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	62	0	C	NM_004476		49204779	-1	tier1	rs116795343	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	6.41	72	5	SNP	0.843	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																																	0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	47	0	A	NM_004476		49204790	-1	tier1	rs76509850	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	8.96	61	6	SNP	1.000	G
FOXH1	8928	genome.wustl.edu	37	8	145701071	145701071	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:145701071C>T	ENST00000377317.4	-	1	647	c.69G>A	c.(67-69)agG>agA	p.R23R	FOXH1_ENST00000525197.1_5'UTR	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	23					aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TCTTCTTCCTCCTCTTAGGGG	0.672																																																	0													23.0	21.0	22.0					8																	145701071		2153	4223	6376	SO:0001819	synonymous_variant	0			AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.69G>A	8.37:g.145701071C>T			D3DWM4	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R23	ENST00000377317.4	37	c.69	CCDS6428.1	8																																																																																			FOXH1	-	NULL	ENSG00000160973		0.672	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXH1	HGNC	protein_coding	OTTHUMT00000382451.1	-	0.00	48	0	C			145701071	-1	tier1	-	no_errors	ENST00000377317	ensembl	human	known	74_37	silent	20.61	104	27	SNP	0.998	T
GABRG2	2566	genome.wustl.edu	37	5	161522556	161522556	+	Missense_Mutation	SNP	C	C	A	rs11135176	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:161522556C>A	ENST00000361925.4	+	3	535	c.315C>A	c.(313-315)aaC>aaA	p.N105K	GABRG2_ENST00000414552.2_Missense_Mutation_p.N105K|GABRG2_ENST00000356592.3_Missense_Mutation_p.N105K|GABRG2_ENST00000393933.4_Missense_Mutation_p.N10K			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	105					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCCAGTGAACGCTATCAATA	0.368																																																	0													172.0	163.0	166.0					5																	161522556		2203	4299	6502	SO:0001583	missense	0				CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.315C>A	5.37:g.161522556C>A	ENSP00000354651:p.Asn105Lys		F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg2_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.N105K	ENST00000361925.4	37	c.315	CCDS4358.1	5	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521493	0.44866	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933;ENST00000522053	T;T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23;-1.23	6.07	-1.95	0.07548	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.65281	0.2676	N	0.12961	0.28	0.19945	P	0.9999499211	P;B;B	0.41978	0.767;0.155;0.402	P;B;B	0.47346	0.544;0.239;0.229	T	0.70421	-0.4876	9	0.87932	D	0	.	11.1543	0.48478	0.0:0.3708:0.0:0.6292	.	105;105;105	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	K	105;105;105;10;10	ENSP00000349000:N105K;ENSP00000410732:N105K;ENSP00000354651:N105K;ENSP00000377510:N10K;ENSP00000430182:N10K	ENSP00000349000:N105K	N	+	3	2	GABRG2	161455134	0.780000	0.28664	0.979000	0.43373	0.815000	0.46073	-0.141000	0.10327	-0.533000	0.06323	-0.956000	0.02647	AAC	GABRG2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000113327		0.368	GABRG2-002	KNOWN	basic|CCDS	protein_coding	GABRG2	HGNC	protein_coding	OTTHUMT00000252706.1	-	0.00	11	0	C			161522556	+1	tier1	-	no_errors	ENST00000356592	ensembl	human	known	74_37	missense	65.85	3	27	SNP	0.994	A
GJC2	57165	genome.wustl.edu	37	1	228346302	228346302	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:228346302C>T	ENST00000366714.2	+	2	1018	c.843C>T	c.(841-843)ctC>ctT	p.L281L		NM_020435.3	NP_065168.2	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	281					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|response to toxic substance (GO:0009636)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	gap junction channel activity (GO:0005243)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Prostate(94;0.0405)				GCCTGCTGCTCAACCTCTGTG	0.721																																																	0													61.0	64.0	63.0					1																	228346302		2203	4300	6503	SO:0001819	synonymous_variant	0			AF014643	CCDS1569.1	1q41-q42	2009-01-02	2007-12-14	2007-11-06	ENSG00000198835	ENSG00000198835		"""Ion channels / Gap junction proteins (connexins)"""	17494	protein-coding gene	gene with protein product	"""connexin 47"""	608803	"""gap junction protein, alpha 12, 47kDa"""	GJA12		19056803	Standard	NM_020435		Approved	CX47, CX46.6, SPG44	uc001hsk.3	Q5T442	OTTHUMG00000039771	ENST00000366714.2:c.843C>T	1.37:g.228346302C>T			O43440|Q7Z7J2|Q8IWJ9	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.L281	ENST00000366714.2	37	c.843	CCDS1569.1	1																																																																																			GJC2	-	pfam_Connexin_CCC,prints_Connexin	ENSG00000198835		0.721	GJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJC2	HGNC	protein_coding	OTTHUMT00000095985.1	-	0.00	27	0	C	NM_020435		228346302	+1	tier1	-	no_errors	ENST00000366714	ensembl	human	known	74_37	silent	26.67	33	12	SNP	0.857	T
GOLGA8S	653061	genome.wustl.edu	37	15	23605572	23605572	+	Splice_Site	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr15:23605572T>C	ENST00000562295.1	+	10	679	c.679T>C	c.(679-681)Ttg>Ctg	p.L227L	RN7SL536P_ENST00000491146.2_RNA					golgin A8 family, member S																		ATTCTTGCAGTTGAAGGAGTC	0.502																																																	0																																										SO:0001630	splice_region_variant	0					15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.679-1T>C	15.37:g.23605572T>C				Silent	SNP	NULL	p.L227	ENST00000562295.1	37	c.679		15																																																																																			GOLGA8S	-	NULL	ENSG00000261739		0.502	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8S	HGNC	protein_coding	OTTHUMT00000431934.1	-	0.00	66	0	T	NR_038843	Silent	23605572	+1	tier1	-	no_errors	ENST00000562295	ensembl	human	novel	74_37	silent	28.00	54	21	SNP	0.872	C
GPBP1	65056	genome.wustl.edu	37	5	56545287	56545287	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:56545287C>T	ENST00000506184.2	+	9	1961	c.856C>T	c.(856-858)Cgt>Tgt	p.R286C	GPBP1_ENST00000454432.2_Missense_Mutation_p.R306C|GPBP1_ENST00000511209.1_Missense_Mutation_p.R278C|GPBP1_ENST00000514387.2_Missense_Mutation_p.R115C|GPBP1_ENST00000264779.6_Missense_Mutation_p.R293C|GPBP1_ENST00000424459.3_Missense_Mutation_p.R306C|GPBP1_ENST00000538707.1_Missense_Mutation_p.R293C			Q86WP2	GPBP1_HUMAN	GC-rich promoter binding protein 1	286					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	19		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.222)		OV - Ovarian serous cystadenocarcinoma(10;7.64e-39)		TCAGCAGCCTCGTCTAACCAA	0.383																																																	0													107.0	101.0	103.0					5																	56545287		2203	4299	6502	SO:0001583	missense	0				CCDS34162.1, CCDS47211.1, CCDS47212.1, CCDS47212.2, CCDS56368.1	5q11.2	2008-02-05				ENSG00000062194			29520	protein-coding gene	gene with protein product		608412				12842993	Standard	NM_022913		Approved	DKFZp761C169, vasculin	uc003jrk.4	Q86WP2		ENST00000506184.2:c.856C>T	5.37:g.56545287C>T	ENSP00000421202:p.Arg286Cys		A6NKW3|Q6NSH6|Q9H0D4|Q9H785|Q9NSN4	Missense_Mutation	SNP	NULL	p.R306C	ENST00000506184.2	37	c.916	CCDS34162.1	5	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410892	0.83340	.	.	ENSG00000062194	ENST00000424459;ENST00000514387;ENST00000506184;ENST00000454432;ENST00000511209;ENST00000264779;ENST00000538707	T;T;T;T;T;T;T	0.55588	1.51;0.51;1.55;1.51;1.61;1.52;1.52	6.16	4.38	0.52667	.	0.104471	0.64402	D	0.000005	T	0.65123	0.2661	M	0.62723	1.935	0.47374	D	0.999402	D;D;D;D	0.76494	0.999;0.998;0.997;0.997	P;P;P;P	0.61592	0.891;0.833;0.653;0.833	T	0.69124	-0.5228	10	0.87932	D	0	-9.0939	12.011	0.53286	0.0:0.8641:0.0:0.1359	.	306;293;278;286	D4PHA4;Q86WP2-2;Q86WP2-3;Q86WP2	.;.;.;GPBP1_HUMAN	C	306;115;286;306;278;293;293	ENSP00000401596:R306C;ENSP00000421709:R115C;ENSP00000421202:R286C;ENSP00000403522:R306C;ENSP00000422337:R278C;ENSP00000264779:R293C;ENSP00000440090:R293C	ENSP00000264779:R293C	R	+	1	0	GPBP1	56581044	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.771000	0.55318	1.626000	0.50381	0.650000	0.86243	CGT	GPBP1	-	NULL	ENSG00000062194		0.383	GPBP1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPBP1	HGNC	protein_coding	OTTHUMT00000374496.1	-	0.00	56	0	C	NM_022913		56545287	+1	tier1	-	no_errors	ENST00000424459	ensembl	human	known	74_37	missense	45.83	26	22	SNP	1.000	T
GPR149	344758	genome.wustl.edu	37	3	154146875	154146875	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:154146875C>G	ENST00000389740.2	-	1	629	c.530G>C	c.(529-531)cGc>cCc	p.R177P		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	177					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CCAGGGCGTGCGCACGAAGGC	0.662																																																	0													24.0	30.0	28.0					3																	154146875		2051	4182	6233	SO:0001583	missense	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.530G>C	3.37:g.154146875C>G	ENSP00000374390:p.Arg177Pro			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.R177P	ENST00000389740.2	37	c.530	CCDS43162.1	3	.	.	.	.	.	.	.	.	.	.	C	11.23	1.578475	0.28180	.	.	ENSG00000174948	ENST00000389740	T	0.38401	1.14	5.41	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	0.165435	0.53938	D	0.000057	T	0.20414	0.0491	N	0.12502	0.225	0.38063	D	0.936136	B	0.19583	0.037	B	0.24006	0.05	T	0.07616	-1.0763	10	0.07990	T	0.79	-19.8482	14.5679	0.68191	0.0:0.7531:0.2469:0.0	.	177	Q86SP6	GP149_HUMAN	P	177	ENSP00000374390:R177P	ENSP00000374390:R177P	R	-	2	0	GPR149	155629569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.916000	0.39986	2.541000	0.85698	0.655000	0.94253	CGC	GPR149	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174948		0.662	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	-	0.00	73	0	C	XM_293580		154146875	-1	tier1	-	no_errors	ENST00000389740	ensembl	human	known	74_37	missense	43.01	53	40	SNP	1.000	G
GPR52	9293	genome.wustl.edu	37	1	174418064	174418064	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:174418064G>A	ENST00000367685.2	+	1	853	c.815G>A	c.(814-816)aGt>aAt	p.S272N	RABGAP1L_ENST00000367689.3_Intron|RABGAP1L_ENST00000251507.4_Intron|RABGAP1L_ENST00000357444.6_Intron	NM_005684.4	NP_005675.3	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	272					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(3)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|prostate(1)|skin(2)	20						AGGATAACCAGTGTATTTTAT	0.468																																					Ovarian(92;924 1390 1930 16467 40583)												0													116.0	117.0	117.0					1																	174418064		2203	4300	6503	SO:0001583	missense	0			AF096784	CCDS30941.1	1q24	2012-08-21			ENSG00000203737	ENSG00000203737		"""GPCR / Class A : Orphans"""	4508	protein-coding gene	gene with protein product		604106				9931487	Standard	NM_005684		Approved		uc001gka.1	Q9Y2T5	OTTHUMG00000034901	ENST00000367685.2:c.815G>A	1.37:g.174418064G>A	ENSP00000356658:p.Ser272Asn		O75654|Q4VBL6|Q6ISM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S272N	ENST00000367685.2	37	c.815	CCDS30941.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182040	0.78677	.	.	ENSG00000203737	ENST00000367685	T	0.38077	1.16	6.16	6.16	0.99307	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	M	0.68317	2.08	0.43863	D	0.996469	D	0.89917	1.0	D	0.79784	0.993	T	0.60727	-0.7206	10	0.87932	D	0	-14.6501	20.8598	0.99761	0.0:0.0:1.0:0.0	.	272	Q9Y2T5	GPR52_HUMAN	N	272	ENSP00000356658:S272N	ENSP00000356658:S272N	S	+	2	0	GPR52	172684687	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.441000	0.97557	2.937000	0.99478	0.650000	0.86243	AGT	GPR52	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000203737		0.468	GPR52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR52	HGNC	protein_coding	OTTHUMT00000084511.1	-	0.00	25	0	G	NM_005684		174418064	+1	tier1	-	no_errors	ENST00000367685	ensembl	human	known	74_37	missense	33.33	30	15	SNP	1.000	A
GRIN2D	2906	genome.wustl.edu	37	19	48945210	48945210	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:48945210G>A	ENST00000263269.3	+	11	2525	c.2437G>A	c.(2437-2439)Gat>Aat	p.D813N		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	813					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTTCCTGGGGGATGGTGCGGC	0.662																																																	0													28.0	28.0	28.0					19																	48945210		2203	4300	6503	SO:0001583	missense	0			U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2437G>A	19.37:g.48945210G>A	ENSP00000263269:p.Asp813Asn			Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.D813N	ENST00000263269.3	37	c.2437	CCDS12719.1	19	.	.	.	.	.	.	.	.	.	.	G	18.54	3.646915	0.67358	.	.	ENSG00000105464	ENST00000263269	T	0.32988	1.43	4.5	4.5	0.54988	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	N	0.03948	-0.315	0.58432	D	0.999998	D	0.76494	0.999	D	0.83275	0.996	T	0.42464	-0.9450	10	0.30078	T	0.28	.	16.565	0.84577	0.0:0.0:1.0:0.0	.	813	O15399	NMDE4_HUMAN	N	813	ENSP00000263269:D813N	ENSP00000263269:D813N	D	+	1	0	GRIN2D	53637022	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	9.643000	0.98464	2.515000	0.84797	0.456000	0.33151	GAT	GRIN2D	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000105464		0.662	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2D	HGNC	protein_coding	OTTHUMT00000466121.1	-	0.00	30	0	G			48945210	+1	tier1	-	no_errors	ENST00000263269	ensembl	human	known	74_37	missense	21.57	40	11	SNP	1.000	A
GSN	2934	genome.wustl.edu	37	9	124074856	124074857	+	Intron	INS	-	-	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:124074856_124074857insA	ENST00000373818.4	+	5	885				GSN_ENST00000373823.3_Intron|GSN_ENST00000449733.1_Intron|GSN_ENST00000412819.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000436847.1_Intron|GSN_ENST00000485767.1_3'UTR|GSN_ENST00000373807.1_Intron|GSN_ENST00000341272.2_Intron|GSN_ENST00000545652.1_Intron|GSN_ENST00000394353.2_Intron	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TGAATTTGAGGAAAAAAAAAAA	0.426																																																	0																																										SO:0001627	intron_variant	0			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.816+90->A	9.37:g.124074867_124074867dupA			A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	INS	-	NULL	ENST00000373818.4	37	NULL	CCDS6828.1	9																																																																																			GSN	-	-	ENSG00000148180		0.426	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	HGNC	protein_coding	OTTHUMT00000053861.1		0.00	10	0	-	NM_000177		124074857	+1	tier1		no_errors	ENST00000485767	ensembl	human	known	74_37	rna	21.43	11	3	INS	0.003:0.000	A
HACE1	57531	genome.wustl.edu	37	6	105177163	105177163	+	3'UTR	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:105177163T>C	ENST00000262903.4	-	0	3380				HACE1_ENST00000517995.1_5'UTR|HACE1_ENST00000369125.2_3'UTR	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1						cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TGACCTCATATAATATATCAG	0.323																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.*374A>G	6.37:g.105177163T>C			A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	RNA	SNP	-	NULL	ENST00000262903.4	37	NULL	CCDS5050.1	6																																																																																			HACE1	-	-	ENSG00000085382		0.323	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	-	0.00	49	0	T	XM_045095		105177163	-1	tier1	-	no_errors	ENST00000517995	ensembl	human	known	74_37	rna	36.36	35	20	SNP	0.010	C
HMGB1P5	10354	genome.wustl.edu	37	3	22423504	22423504	+	RNA	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:22423504G>A	ENST00000451497.1	+	0	69									high mobility group box 1 pseudogene 5																		ATATGGCAAAGGCGGACAAGG	0.438																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22423504G>A				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.438	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1	-	0.00	54	0	G	NG_000897		22423504	+1	tier1	-	no_errors	ENST00000451497	ensembl	human	known	74_37	rna	40.91	39	27	SNP	1.000	A
HOMER1	9456	genome.wustl.edu	37	5	78752821	78752821	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:78752821G>T	ENST00000334082.6	-	2	1468	c.26C>A	c.(25-27)aCt>aAt	p.T9N	HOMER1_ENST00000282260.6_Missense_Mutation_p.T9N|HOMER1_ENST00000508576.1_Missense_Mutation_p.T9N|HOMER1_ENST00000535690.1_Intron	NM_004272.3	NP_004263.1	Q86YM7	HOME1_HUMAN	homer homolog 1 (Drosophila)	9	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				behavioral response to cocaine (GO:0048148)|chemical homeostasis within a tissue (GO:0048875)|circadian rhythm (GO:0007623)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of signal transduction (GO:0009967)|protein localization to synapse (GO:0035418)|regulation of calcium ion import (GO:0090279)|regulation of cation channel activity (GO:2001257)|regulation of store-operated calcium entry (GO:2001256)|response to calcium ion (GO:0051592)|response to nicotine (GO:0035094)|skeletal muscle contraction (GO:0003009)|skeletal muscle fiber development (GO:0048741)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell junction (GO:0030054)|costamere (GO:0043034)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|signaling adaptor activity (GO:0035591)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|skin(1)	14		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)		ATGAGCTCGAGTGCTGAAGAT	0.433																																																	0													226.0	211.0	216.0					5																	78752821		1904	4123	6027	SO:0001583	missense	0			BC015502	CCDS43335.1, CCDS64188.1, CCDS64189.1	5q14.2	2008-02-05			ENSG00000152413	ENSG00000152413			17512	protein-coding gene	gene with protein product		604798				9808459, 9808458	Standard	NM_004272		Approved	Ves-1, SYN47, HOMER-1B	uc003kfy.4	Q86YM7	OTTHUMG00000134278	ENST00000334082.6:c.26C>A	5.37:g.78752821G>T	ENSP00000334382:p.Thr9Asn		B2R688|O96003|Q86YM5	Missense_Mutation	SNP	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.T9N	ENST00000334082.6	37	c.26	CCDS43335.1	5	.	.	.	.	.	.	.	.	.	.	G	22.1	4.250175	0.80024	.	.	ENSG00000152413	ENST00000334082;ENST00000508576;ENST00000282260	D;D;D	0.98914	-5.23;-5.23;-5.23	5.93	5.93	0.95920	EVH1 (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.99187	0.9718	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	0.99;0.982;1.0	D;D;D	0.87578	0.974;0.945;0.998	D	0.99802	1.1036	10	0.87932	D	0	-5.0564	20.3368	0.98748	0.0:0.0:1.0:0.0	.	9;9;9	Q86YM7-2;Q86YM7-3;Q86YM7	.;.;HOME1_HUMAN	N	9	ENSP00000334382:T9N;ENSP00000426651:T9N;ENSP00000282260:T9N	ENSP00000282260:T9N	T	-	2	0	HOMER1	78788577	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.805000	0.96524	0.655000	0.94253	ACT	HOMER1	-	pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	ENSG00000152413		0.433	HOMER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOMER1	HGNC	protein_coding	OTTHUMT00000258856.1		0.00	79	0	G	NM_004272		78752821	-1			no_errors	ENST00000334082	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
HOXC11	3227	genome.wustl.edu	37	12	54369204	54369204	+	3'UTR	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:54369204G>C	ENST00000546378.1	+	0	1038				HOTAIR_ENST00000424518.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.R309T|HOTAIR_ENST00000455246.1_RNA			O43248	HXC11_HUMAN	homeobox C11						anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						GTAACCTGCAGACCGGGCCCT	0.433			T	NUP98	AML																																			Dom	yes		12	12q13.3	3227	homeo box C11		L	0													18.0	21.0	20.0					12																	54369204		2166	4288	6454	SO:0001624	3_prime_UTR_variant	0				CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.*7G>C	12.37:g.54369204G>C			A8K7D1|Q96DH2	Missense_Mutation	SNP	pfam_DUF3528	p.R309T	ENST00000546378.1	37	c.926	CCDS8867.1	12	.	.	.	.	.	.	.	.	.	.	G	7.524	0.657210	0.14580	.	.	ENSG00000123388	ENST00000243082	T	0.27890	1.64	4.68	2.83	0.33086	.	.	.	.	.	T	0.29321	0.0730	.	.	.	0.18873	N	0.999989	.	.	.	.	.	.	T	0.19647	-1.0299	6	0.52906	T	0.07	.	5.9498	0.19239	0.0996:0.0:0.7118:0.1886	.	.	.	.	T	309	ENSP00000243082:R309T	ENSP00000243082:R309T	R	+	2	0	HOXC11	52655471	0.996000	0.38824	0.710000	0.30468	0.989000	0.77384	1.318000	0.33643	0.504000	0.28082	0.555000	0.69702	AGA	HOXC11	-	NULL	ENSG00000123388		0.433	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC11	HGNC	protein_coding	OTTHUMT00000358869.2	-	0.00	23	0	G			54369204	+1	tier1	-	no_errors	ENST00000243082	ensembl	human	novel	74_37	missense	36.67	19	11	SNP	0.612	C
HOXC10	3226	genome.wustl.edu	37	12	54383371	54383371	+	3'UTR	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:54383371T>A	ENST00000303460.4	+	0	1244				HOXC10_ENST00000511575.1_3'UTR|RP11-834C11.12_ENST00000513209.1_Intron|MIR196A2_ENST00000385189.1_RNA	NM_017409.3	NP_059105.2	Q9NYD6	HXC10_HUMAN	homeobox C10						anterior/posterior pattern specification (GO:0009952)|embryonic limb morphogenesis (GO:0030326)|neuromuscular process (GO:0050905)|positive regulation of cell proliferation (GO:0008284)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|spinal cord motor neuron cell fate specification (GO:0021520)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(3)|lung(14)|pancreas(1)	20						AGACTCTCCTTCCAAGGGACC	0.517											OREG0021882	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001624	3_prime_UTR_variant	0				CCDS8868.1	12q13.13	2011-06-20	2005-12-22		ENSG00000180818	ENSG00000180818		"""Homeoboxes / ANTP class : HOXL subclass"""	5122	protein-coding gene	gene with protein product		605560	"""homeo box C10"""	HOX3I		1358459	Standard	NM_017409		Approved		uc001sen.3	Q9NYD6	OTTHUMG00000160031	ENST00000303460.4:c.*141T>A	12.37:g.54383371T>A		999	O15219|O15220|Q9BVD5	RNA	SNP	-	NULL	ENST00000303460.4	37	NULL	CCDS8868.1	12																																																																																			HOXC10	-	-	ENSG00000180818		0.517	HOXC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC10	HGNC	protein_coding	OTTHUMT00000358952.2	-	0.00	24	0	T			54383371	+1	tier1	-	no_errors	ENST00000511575	ensembl	human	known	74_37	rna	59.38	13	19	SNP	1.000	A
HSPA1B	3304	genome.wustl.edu	37	6	31797494	31797494	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:31797494G>A	ENST00000375650.3	+	1	1983	c.1767G>A	c.(1765-1767)aaG>aaA	p.K589K	HSPA1B_ENST00000545241.1_Silent_p.K498K	NM_005346.4	NP_005337.2	P08107	HSP71_HUMAN	heat shock 70kDa protein 1B	589					ATP catabolic process (GO:0006200)|cellular heat acclimation (GO:0070370)|cellular response to heat (GO:0034605)|gene expression (GO:0010467)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of erythrocyte differentiation (GO:0045648)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)	aggresome (GO:0016235)|blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|protein N-terminus binding (GO:0047485)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|virus receptor activity (GO:0001618)			breast(1)|large_intestine(1)|prostate(1)	3						TGGCCGAGAAGGACGAGTTTG	0.602																																																	0													46.0	37.0	40.0					6																	31797494		1670	3421	5091	SO:0001819	synonymous_variant	0				CCDS34415.1	6p21.3	2011-09-02	2002-08-29		ENSG00000204388	ENSG00000204388		"""Heat shock proteins / HSP70"""	5233	protein-coding gene	gene with protein product		603012	"""heat shock 70kD protein 1B"""			1700760	Standard	NM_005346		Approved	HSP70-2	uc003nxk.2	P08107	OTTHUMG00000031202	ENST00000375650.3:c.1767G>A	6.37:g.31797494G>A			B4E3B6|P19790|Q5JQI4|Q5SP17|Q9UQL9|Q9UQM0	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.K589	ENST00000375650.3	37	c.1767	CCDS34415.1	6																																																																																			HSPA1B	-	pfam_Hsp_70_fam	ENSG00000204388		0.602	HSPA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA1B	HGNC	protein_coding	OTTHUMT00000076402.2	-	0.00	54	0	G			31797494	+1	tier1	-	no_errors	ENST00000375650	ensembl	human	known	74_37	silent	36.05	55	31	SNP	1.000	A
HSPG2	3339	genome.wustl.edu	37	1	22202445	22202445	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:22202445G>T	ENST00000374695.3	-	24	3173	c.3094C>A	c.(3094-3096)Ctg>Atg	p.L1032M		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1032	Laminin IV type A 2. {ECO:0000255|PROSITE-ProRule:PRU00458}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TTACCTTGCAGCACCACCAAC	0.632																																																	0													63.0	66.0	65.0					1																	22202445		2203	4300	6503	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3094C>A	1.37:g.22202445G>T	ENSP00000363827:p.Leu1032Met		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.L1032M	ENST00000374695.3	37	c.3094	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529195	0.64860	.	.	ENSG00000142798	ENST00000374695	T	0.51817	0.69	5.51	2.6	0.31112	Laminin B type IV (2);Laminin B, subgroup (1);	0.000000	0.31747	N	0.007121	T	0.62392	0.2424	M	0.71871	2.18	0.47511	D	0.999444	D	0.89917	1.0	D	0.91635	0.999	T	0.60250	-0.7300	10	0.72032	D	0.01	.	7.3152	0.26498	0.3562:0.0:0.6438:0.0	.	1032	P98160	PGBM_HUMAN	M	1032	ENSP00000363827:L1032M	ENSP00000363827:L1032M	L	-	1	2	HSPG2	22075032	1.000000	0.71417	0.853000	0.33588	0.809000	0.45718	2.964000	0.49192	0.279000	0.22186	0.561000	0.74099	CTG	HSPG2	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV	ENSG00000142798		0.632	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1		0.00	56	0	G	NM_005529		22202445	-1			no_errors	ENST00000374695	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.997	T
IFI27	3429	genome.wustl.edu	37	14	94582128	94582128	+	Splice_Site	SNP	T	T	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr14:94582128T>G	ENST00000555744.1	+	4	311	c.123T>G	c.(121-123)gtT>gtG	p.V41V	IFI27_ENST00000557098.1_5'UTR|IFI27_ENST00000444961.1_Splice_Site|IFI27_ENST00000448882.1_Splice_Site_p.I44M|IFI27_ENST00000298902.5_Splice_Site_p.V41V|IFI27_ENST00000557634.1_Splice_Site_p.V31V			P40305	IFI27_HUMAN	interferon, alpha-inducible protein 27	41					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)				breast(1)|lung(3)	4				Epithelial(152;0.112)|all cancers(159;0.187)|COAD - Colon adenocarcinoma(157;0.206)		TCCCTGCAGTTGTGGCTGTGC	0.632																																					GBM(128;797 1667 20895 29868 47129)												0													14.0	13.0	14.0					14																	94582128		2182	4276	6458	SO:0001630	splice_region_variant	0			X67325	CCDS32148.1	14q32.12	2012-10-02			ENSG00000165949	ENSG00000165949			5397	protein-coding gene	gene with protein product		600009				8358738	Standard	NM_005532		Approved	P27, FAM14D	uc021sba.1	P40305	OTTHUMG00000171303	ENST00000555744.1:c.122-1T>G	14.37:g.94582128T>G			Q53YA6|Q6IEC1|Q96BK3	Splice_Site	SNP	-	e3-2	ENST00000555744.1	37	c.134-2	CCDS32148.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.020|0.020	-1.442570|-1.442570	0.01089|0.01089	.|.	.|.	ENSG00000165949|ENSG00000165949	ENST00000444961|ENST00000448882	.|T	.|0.33865	.|1.39	3.24|3.24	-6.48|-6.48	0.01896|0.01896	.|.	.|.	.|.	.|.	.|.	.|T	.|0.27697	.|0.0681	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.35699	.|-0.9778	.|6	.|0.45353	.|T	.|0.12	.|.	6.6042|6.6042	0.22716|0.22716	0.0:0.1938:0.2509:0.5553|0.0:0.1938:0.2509:0.5553	.|.	.|.	.|.	.|.	.|M	-1|44	.|ENSP00000410901:I44M	.|ENSP00000410901:I44M	.|I	+|+	.|3	.|3	IFI27|IFI27	93651881|93651881	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-1.255000|-1.255000	0.02872|0.02872	-2.000000|-2.000000	0.00965|0.00965	-1.525000|-1.525000	0.00928|0.00928	.|ATT	IFI27	-	-	ENSG00000165949		0.632	IFI27-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IFI27	HGNC	protein_coding	OTTHUMT00000412889.1		0.00	53	0	T	NM_005532	Silent	94582128	+1			no_errors	ENST00000444961	ensembl	human	known	74_37	splice_site	7.94	58	5	SNP	0.000	G
IGDCC4	57722	genome.wustl.edu	37	15	65674432	65674433	+	3'UTR	INS	-	-	A	rs555753230	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr15:65674432_65674433insA	ENST00000352385.2	-	0	5876_5877				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTTTCTTCTTTAAAAAAAAAAA	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*1915->T	15.37:g.65674443_65674443dupA			Q9HCE4	RNA	INS	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			IGDCC4	-	-	ENSG00000103742		0.351	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2		0.00	23	0	-	NM_020962		65674433	-1	tier1		no_errors	ENST00000558048	ensembl	human	known	74_37	rna	14.29	24	4	INS	0.000:0.000	A
IGFBP4	3487	genome.wustl.edu	37	17	38612738	38612738	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:38612738G>T	ENST00000269593.4	+	4	955	c.680G>T	c.(679-681)tGg>tTg	p.W227L	IGFBP4_ENST00000542955.1_Missense_Mutation_p.W127L	NM_001552.2	NP_001543.2	P22692	IBP4_HUMAN	insulin-like growth factor binding protein 4	227	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|DNA metabolic process (GO:0006259)|inflammatory response (GO:0006954)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of MAPK cascade (GO:0043410)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)	5		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGCAAGTGCTGGTGTGTGGAC	0.627																																					GBM(160;940 3581 26177)												0													54.0	57.0	56.0					17																	38612738		2203	4300	6503	SO:0001583	missense	0			M38177	CCDS11367.1	17q21.2	2014-09-16	2001-11-28		ENSG00000141753	ENSG00000141753			5473	protein-coding gene	gene with protein product	"""IGF-binding protein 4"""	146733	"""insulin-like growth factor-binding protein 4"""			1707125, 1704481	Standard	NM_001552		Approved	IBP4, BP-4, HT29-IGFBP, IGFBP-4	uc002hus.3	P22692	OTTHUMG00000133326	ENST00000269593.4:c.680G>T	17.37:g.38612738G>T	ENSP00000269593:p.Trp227Leu		A0N9W2|B4E351|Q5U012|Q9UCL6	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_IGFBP-like,superfamily_Thyroglobulin_1,superfamily_Growth_fac_rcpt_N_dom,smart_IGFBP-like,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata,prints_IGFBP-4	p.W227L	ENST00000269593.4	37	c.680	CCDS11367.1	17	.	.	.	.	.	.	.	.	.	.	G	31	5.086337	0.94100	.	.	ENSG00000141753	ENST00000542955;ENST00000269593	T;T	0.81415	-1.49;-1.49	5.43	5.43	0.79202	Thyroglobulin type-1 (5);	0.000000	0.85682	D	0.000000	D	0.92877	0.7734	H	0.95504	3.68	0.51012	D	0.999902	D	0.89917	1.0	D	0.91635	0.999	D	0.94735	0.7913	10	0.87932	D	0	0.9026	17.0572	0.86537	0.0:0.0:1.0:0.0	.	227	P22692	IBP4_HUMAN	L	127;227	ENSP00000437734:W127L;ENSP00000269593:W227L	ENSP00000269593:W227L	W	+	2	0	IGFBP4	35866264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.449000	0.90337	2.546000	0.85860	0.655000	0.94253	TGG	IGFBP4	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1,prints_IGFBP_1-6_chordata	ENSG00000141753		0.627	IGFBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFBP4	HGNC	protein_coding	OTTHUMT00000257134.1		0.00	26	0	G	NM_001552		38612738	+1			no_errors	ENST00000269593	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
IGFN1	91156	genome.wustl.edu	37	1	201185638	201185638	+	Missense_Mutation	SNP	G	G	A	rs574892301	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:201185638G>A	ENST00000335211.4	+	16	9482	c.9352G>A	c.(9352-9354)Gtc>Atc	p.V3118I	IGFN1_ENST00000295591.8_Missense_Mutation_p.V278I	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	661						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TAGGGCTGGCGTCTGCCTCCG	0.647													G|||	2	0.000399361	0.0	0.0029	5008	,	,		11366	0.0		0.0	False		,,,				2504	0.0																0													21.0	23.0	22.0					1																	201185638		2203	4299	6502	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.9352G>A	1.37:g.201185638G>A	ENSP00000334714:p.Val3118Ile		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V3118I	ENST00000335211.4	37	c.9352	CCDS53455.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.36|11.36	1.614618|1.614618	0.28712|0.28712	.|.	.|.	ENSG00000163395|ENSG00000163395	ENST00000412892|ENST00000335211;ENST00000295591	.|T;T	.|0.57907	.|0.37;0.37	4.06|4.06	1.99|1.99	0.26369|0.26369	.|.	.|0.161370	.|0.42053	.|D	.|0.000777	T|T	0.29976|0.29976	0.0750|0.0750	N|N	0.26042|0.26042	0.785|0.785	0.09310|0.09310	N|N	0.999999|0.999999	.|P	.|0.37441	.|0.595	.|B	.|0.34346	.|0.18	T|T	0.11717|0.11717	-1.0576|-1.0576	5|10	.|0.13470	.|T	.|0.59	.|.	6.3698|6.3698	0.21475|0.21475	0.3706:0.0:0.6294:0.0|0.3706:0.0:0.6294:0.0	.|.	.|3118	.|F8WAI1	.|.	H|I	535|3118;278	.|ENSP00000334714:V3118I;ENSP00000295591:V278I	.|ENSP00000295591:V278I	R|V	+|+	2|1	0|0	IGFN1|IGFN1	199452261|199452261	0.295000|0.295000	0.24389|0.24389	0.709000|0.709000	0.30452|0.30452	0.695000|0.695000	0.40330|0.40330	0.868000|0.868000	0.27982|0.27982	0.921000|0.921000	0.36994|0.36994	0.561000|0.561000	0.74099|0.74099	CGT|GTC	IGFN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000163395		0.647	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		-	0.00	63	0	G	NM_178275		201185638	+1	tier1	-	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	26.32	84	30	SNP	0.080	A
IGSF9B	22997	genome.wustl.edu	37	11	133796853	133796853	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:133796853C>A	ENST00000321016.8	-	13	1995	c.1765G>T	c.(1765-1767)Gga>Tga	p.G589*	IGSF9B_ENST00000533871.2_Nonsense_Mutation_p.G589*			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	589	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GCGCTGGTTCCCAGCTTGTTC	0.647																																																	0													31.0	36.0	34.0					11																	133796853		2076	4205	6281	SO:0001587	stop_gained	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.1765G>T	11.37:g.133796853C>A	ENSP00000317980:p.Gly589*		G5EA26	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G589*	ENST00000321016.8	37	c.1765		11	.	.	.	.	.	.	.	.	.	.	C	42	9.385210	0.99155	.	.	ENSG00000080854	ENST00000321016;ENST00000533871;ENST00000527648	.	.	.	5.8	5.8	0.92144	.	0.000000	0.43416	D	0.000576	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.0609	0.97674	0.0:1.0:0.0:0.0	.	.	.	.	X	589;431;589	.	ENSP00000317980:G589X	G	-	1	0	IGSF9B	133302063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.757000	0.85209	2.755000	0.94549	0.655000	0.94253	GGA	IGSF9B	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080854		0.647	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		-	0.00	41	0	C	XM_290502		133796853	-1	tier1	-	no_errors	ENST00000321016	ensembl	human	known	74_37	nonsense	36.76	43	25	SNP	1.000	A
IL6ST	3572	genome.wustl.edu	37	5	55260105	55260105	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:55260105C>T	ENST00000381298.2	-	6	839	c.527G>A	c.(526-528)cGt>cAt	p.R176H	IL6ST_ENST00000381294.3_Missense_Mutation_p.R176H|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000536319.1_Missense_Mutation_p.R176H|IL6ST_ENST00000522633.2_Missense_Mutation_p.R176H|IL6ST_ENST00000336909.5_Missense_Mutation_p.R176H|IL6ST_ENST00000502326.3_Missense_Mutation_p.R176H|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000396816.1_Missense_Mutation_p.V34M|IL6ST_ENST00000381287.4_Missense_Mutation_p.R176H|IL6ST_ENST00000577363.1_5'UTR	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	176	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.R176H(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				GGGGGTGTCACGTTTTGCTTT	0.368			O		hepatocellular ca																																			Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	1	Substitution - Missense(1)	prostate(1)											94.0	85.0	88.0					5																	55260105		2203	4300	6503	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.527G>A	5.37:g.55260105C>T	ENSP00000370698:p.Arg176His		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R176H	ENST00000381298.2	37	c.527	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	C	8.928	0.962784	0.18583	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000522633;ENST00000542298	D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	6.17	-2.02	0.07388	Interleukin-6 receptor alpha chain, binding (1);Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.276180	0.04642	N	0.405558	T	0.65365	0.2684	N	0.12471	0.22	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.004	B;B;B	0.08055	0.002;0.001;0.003	T	0.50808	-0.8784	10	0.12766	T	0.61	.	6.9012	0.24283	0.0:0.2953:0.3185:0.3863	.	176;176;176	Q5FC04;P40189-2;P40189	.;.;IL6RB_HUMAN	H	176	ENSP00000370698:R176H;ENSP00000338799:R176H;ENSP00000370694:R176H;ENSP00000370687:R176H;ENSP00000444456:R176H;ENSP00000435399:R176H	ENSP00000338799:R176H	R	-	2	0	IL6ST	55295862	0.003000	0.15002	0.723000	0.30687	0.615000	0.37417	-0.709000	0.05030	-0.271000	0.09272	0.655000	0.94253	CGT	IL6ST	-	pfam_IL-6_rcpt_alpha-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000134352		0.368	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3		0.00	36	0	C	NM_002184		55260105	-1			no_errors	ENST00000336909	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.193	T
IQCB1	9657	genome.wustl.edu	37	3	121547357	121547357	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:121547357C>T	ENST00000310864.6	-	4	437	c.223G>A	c.(223-225)Ggt>Agt	p.G75S	IQCB1_ENST00000349820.6_Missense_Mutation_p.G75S	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	75					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)			NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		GTCCAACCACCCTGGATTCGA	0.363																																																	0													94.0	91.0	92.0					3																	121547357		2203	4300	6503	SO:0001583	missense	0			D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.223G>A	3.37:g.121547357C>T	ENSP00000311505:p.Gly75Ser		Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.G75S	ENST00000310864.6	37	c.223	CCDS33837.1	3	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690320	0.88735	.	.	ENSG00000173226	ENST00000310864;ENST00000349820;ENST00000462442	T;T;T	0.10668	2.85;2.85;2.85	5.35	5.35	0.76521	.	0.047687	0.85682	D	0.000000	T	0.23014	0.0556	L	0.34521	1.04	0.29564	N	0.850443	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	T	0.01015	-1.1480	10	0.87932	D	0	-11.8491	14.4364	0.67284	0.0:1.0:0.0:0.0	.	75;75	Q15051;Q15051-2	IQCB1_HUMAN;.	S	75	ENSP00000311505:G75S;ENSP00000323756:G75S;ENSP00000419376:G75S	ENSP00000311505:G75S	G	-	1	0	IQCB1	123030047	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.637000	0.61346	2.789000	0.95967	0.655000	0.94253	GGT	IQCB1	-	NULL	ENSG00000173226		0.363	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCB1	HGNC	protein_coding	OTTHUMT00000250573.1	-	0.00	71	0	C	NM_014642		121547357	-1	tier1	-	no_errors	ENST00000310864	ensembl	human	known	74_37	missense	6.41	73	5	SNP	1.000	T
KIF17	57576	genome.wustl.edu	37	1	21042067	21042067	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:21042067G>A	ENST00000247986.2	-	2	607	c.297C>T	c.(295-297)ttC>ttT	p.F99F	KIF17_ENST00000375044.1_5'UTR|KIF17_ENST00000400463.3_Silent_p.F99F			Q9P2E2	KIF17_HUMAN	kinesin family member 17	99	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)	p.F99F(1)		NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCTGCATGGTGAAGGACTTCC	0.652																																																	1	Substitution - coding silent(1)	lung(1)											96.0	80.0	86.0					1																	21042067		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.297C>T	1.37:g.21042067G>A			A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.F99	ENST00000247986.2	37	c.297	CCDS213.1	1																																																																																			KIF17	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000117245		0.652	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	-	0.00	37	0	G	NM_020816		21042067	-1	tier1	-	no_errors	ENST00000247986	ensembl	human	known	74_37	silent	24.19	47	15	SNP	1.000	A
KIF26A	26153	genome.wustl.edu	37	14	104640529	104640529	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr14:104640529C>T	ENST00000423312.2	+	11	2075	c.2075C>T	c.(2074-2076)gCt>gTt	p.A692V	KIF26A_ENST00000315264.7_Missense_Mutation_p.A553V	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	692	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CTGGCCACCGCTGGCTGCCGC	0.682																																																	0													16.0	23.0	21.0					14																	104640529		2165	4255	6420	SO:0001583	missense	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2075C>T	14.37:g.104640529C>T	ENSP00000388241:p.Ala692Val		Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A692V	ENST00000423312.2	37	c.2075	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	C	3.371	-0.128450	0.06753	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.77489	-1.1;-1.1	3.98	-1.12	0.09808	Kinesin, motor domain (4);	.	.	.	.	T	0.43299	0.1241	N	0.02916	-0.46	0.21325	N	0.999725	B	0.14805	0.011	B	0.16289	0.015	T	0.32955	-0.9887	9	0.08837	T	0.75	.	0.4196	0.00454	0.1956:0.2001:0.1967:0.4075	.	692	Q9ULI4	KI26A_HUMAN	V	692;553	ENSP00000388241:A692V;ENSP00000325452:A553V	ENSP00000325452:A553V	A	+	2	0	KIF26A	103710282	1.000000	0.71417	0.000000	0.03702	0.311000	0.27955	3.131000	0.50515	-0.047000	0.13423	0.313000	0.20887	GCT	KIF26A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000066735		0.682	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	-	0.00	84	0	C			104640529	+1	tier1	-	no_errors	ENST00000423312	ensembl	human	known	74_37	missense	77.46	32	110	SNP	0.992	T
KLF11	8462	genome.wustl.edu	37	2	10187774	10187775	+	Intron	INS	-	-	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:10187774_10187775insA	ENST00000305883.1	+	3	474				KLF11_ENST00000540845.1_Intron|KLF11_ENST00000535335.1_Intron	NM_003597.4	NP_003588.1	O14901	KLF11_HUMAN	Kruppel-like factor 11						apoptotic process (GO:0006915)|cellular response to peptide (GO:1901653)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		CTTTTTTTTTTAGTGCATAACT	0.406																																					Melanoma(56;431 1507 23687 50789)												0																																										SO:0001627	intron_variant	0			AF028008	CCDS1668.1, CCDS54333.1	2p25	2013-01-08	2004-11-29	2004-12-01	ENSG00000172059	ENSG00000172059		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11811	protein-coding gene	gene with protein product		603301	"""TGFB inducible early growth response 2"""	TIEG2		9748269, 11087666	Standard	NM_001177716		Approved	Tieg3, MODY7	uc002raf.1	O14901	OTTHUMG00000119004	ENST00000305883.1:c.313-2->A	2.37:g.10187775_10187775dupA			B4DZE7|Q9EPF4	Splice_Site	INS	-	e3-2	ENST00000305883.1	37	c.313-3_313-2	CCDS1668.1	2																																																																																			KLF11	-	-	ENSG00000172059		0.406	KLF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLF11	HGNC	protein_coding	OTTHUMT00000239202.3		0.00	43	0	-	NM_003597		10187775	+1	tier1		no_errors	ENST00000305883	ensembl	human	known	74_37	splice_site_ins	28.89	32	13	INS	0.309:1.000	A
KLHL28	54813	genome.wustl.edu	37	14	45400680	45400680	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr14:45400680T>A	ENST00000396128.4	-	4	1527	c.1408A>T	c.(1408-1410)Att>Ttt	p.I470F	KLHL28_ENST00000355081.2_Missense_Mutation_p.I484F	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	470								p.I470V(1)		breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CCAAAGTGAATCCTTTTATCT	0.403																																																	1	Substitution - Missense(1)	lung(1)											103.0	100.0	101.0					14																	45400680		2203	4300	6503	SO:0001583	missense	0			AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.1408A>T	14.37:g.45400680T>A	ENSP00000379434:p.Ile470Phe		Q0VAL5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.I470F	ENST00000396128.4	37	c.1408	CCDS9680.1	14	.	.	.	.	.	.	.	.	.	.	T	21.6	4.172398	0.78452	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	T;T	0.77489	-1.1;-1.1	4.72	4.72	0.59763	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.80347	0.4606	N	0.21508	0.67	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.82520	-0.0416	10	0.56958	D	0.05	.	14.1529	0.65398	0.0:0.0:0.0:1.0	.	470	Q9NXS3	KLH28_HUMAN	F	470;484	ENSP00000379434:I470F;ENSP00000347193:I484F	ENSP00000347193:I484F	I	-	1	0	KLHL28	44470430	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.620000	0.83070	1.881000	0.54492	0.460000	0.39030	ATT	KLHL28	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000179454		0.403	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL28	HGNC	protein_coding	OTTHUMT00000276790.3		0.00	35	0	T			45400680	-1			no_errors	ENST00000396128	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
KMT2D	8085	genome.wustl.edu	37	12	49435976	49435976	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:49435976C>A	ENST00000301067.7	-	28	6004	c.6005G>T	c.(6004-6006)aGt>aTt	p.S2002I		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2002					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GCGCTGAAGACTCCGCTGGTT	0.597																																																	0													40.0	43.0	42.0					12																	49435976		2084	4199	6283	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.6005G>T	12.37:g.49435976C>A	ENSP00000301067:p.Ser2002Ile		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.S2002I	ENST00000301067.7	37	c.6005	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	15.07	2.725442	0.48833	.	.	ENSG00000167548	ENST00000301067	D	0.81996	-1.56	5.2	5.2	0.72013	.	0.000000	0.42964	D	0.000628	D	0.90356	0.6982	M	0.68317	2.08	0.58432	D	0.999997	D	0.76494	0.999	D	0.83275	0.996	D	0.91152	0.4954	10	0.87932	D	0	.	17.8762	0.88826	0.0:1.0:0.0:0.0	.	2002	O14686	MLL2_HUMAN	I	2002	ENSP00000301067:S2002I	ENSP00000301067:S2002I	S	-	2	0	MLL2	47722243	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.964000	0.63701	2.606000	0.88127	0.561000	0.74099	AGT	KMT2D	-	NULL	ENSG00000167548		0.597	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	26	0	C			49435976	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	53.85	18	21	SNP	1.000	A
KSR1	8844	genome.wustl.edu	37	17	25936279	25936279	+	Missense_Mutation	SNP	G	G	A	rs200491363		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:25936279G>A	ENST00000319524.6	+	17	2215	c.2215G>A	c.(2215-2217)Gtc>Atc	p.V739I	KSR1_ENST00000398988.3_Missense_Mutation_p.V602I|KSR1_ENST00000582410.1_5'Flank|KSR1_ENST00000509603.2_Missense_Mutation_p.V717I|KSR1_ENST00000268763.6_Missense_Mutation_p.V602I			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	739	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		ATCTAAGAACGTCTTCTATGA	0.522																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0								G	ILE/VAL	0,4060		0,0,2030	137.0	136.0	137.0		1804	4.5	1.0	17		137	3,8387		0,3,4192	yes	missense	KSR1	NM_014238.1	29	0,3,6222	AA,AG,GG		0.0358,0.0,0.0241	benign	602/763	25936279	3,12447	2030	4195	6225	SO:0001583	missense	0			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.2215G>A	17.37:g.25936279G>A	ENSP00000323178:p.Val739Ile		F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V739I	ENST00000319524.6	37	c.2215		17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.36|13.36	2.213273|2.213273	0.39102|0.39102	0.0|0.0	3.58E-4|3.58E-4	ENSG00000141068|ENSG00000141068	ENST00000398988|ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	T|T;T;T	0.80566|0.34859	-1.39|1.34;1.34;1.34	5.52|5.52	4.54|4.54	0.55810|0.55810	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.059504	.|0.64402	.|D	.|0.000003	T|T	0.14917|0.14917	0.0360|0.0360	N|N	0.02674|0.02674	-0.535|-0.535	0.52501|0.52501	D|D	0.999951|0.999951	.|B;B	.|0.24675	.|0.109;0.002	.|B;B	.|0.28991	.|0.097;0.009	T|T	0.12682|0.12682	-1.0538|-1.0538	6|10	.|0.02654	.|T	.|1	.|.	14.3799|14.3799	0.66905|0.66905	0.075:0.0:0.925:0.0|0.075:0.0:0.925:0.0	.|.	.|737;717	.|Q8IVT5;F5H0K8	.|KSR1_HUMAN;.	H|I	452|739;717;602;602	ENSP00000381958:R452H|ENSP00000323178:V739I;ENSP00000438795:V717I;ENSP00000268763:V602I	.|ENSP00000268763:V602I	R|V	+|+	2|1	0|0	KSR1|KSR1	22960406|22960406	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.946000|0.946000	0.59487|0.59487	5.602000|5.602000	0.67612|0.67612	2.748000|2.748000	0.94277|0.94277	0.655000|0.655000	0.94253|0.94253	CGT|GTC	KSR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000141068		0.522	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		-	0.00	62	0	G	NM_014238		25936279	+1	tier1	rs200491363	no_errors	ENST00000319524	ensembl	human	known	74_37	missense	21.00	79	21	SNP	1.000	A
KRTAP9-9	81870	genome.wustl.edu	37	17	39411984	39411984	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:39411984A>G	ENST00000394008.1	+	1	349	c.347A>G	c.(346-348)tAc>tGc	p.Y116C		NM_030975.2	NP_112237.2	Q9BYP9	KRA99_HUMAN	keratin associated protein 9-9	101	14 X 5 AA repeats of C-C-[RQVGE]- [SPSTNQ]-[TASL].					keratin filament (GO:0045095)				endometrium(3)|skin(2)|upper_aerodigestive_tract(1)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			AGAACCTGCTACTACCCGACG	0.637																																																	0													170.0	172.0	171.0					17																	39411984		2203	4300	6503	SO:0001583	missense	0			AJ406951	CCDS54127.1	17q21.2	2010-06-03			ENSG00000198083	ENSG00000198083		"""Keratin associated proteins"""	16773	protein-coding gene	gene with protein product			"""keratin associated protein 9-5"""	KRTAP9-5		11279113	Standard	NM_030975		Approved	KAP9.9, KAP9.5	uc021txh.1	Q9BYP9	OTTHUMG00000133602	ENST00000394008.1:c.347A>G	17.37:g.39411984A>G	ENSP00000377576:p.Tyr116Cys		B5MDD6|Q9BYQ1	Missense_Mutation	SNP	NULL	p.Y116C	ENST00000394008.1	37	c.347	CCDS54127.1	17	.	.	.	.	.	.	.	.	.	.	.	10.74	1.435387	0.25813	.	.	ENSG00000198083	ENST00000431129;ENST00000394008	T	0.00808	5.67	2.35	2.35	0.29111	.	.	.	.	.	T	0.01092	0.0036	N	0.03177	-0.4	0.25017	N	0.99137	D	0.76494	0.999	D	0.73380	0.98	T	0.51244	-0.8730	9	0.06625	T	0.88	.	8.6072	0.33780	1.0:0.0:0.0:0.0	.	101	Q9BYP9	KRA99_HUMAN	C	122;116	ENSP00000377576:Y116C	ENSP00000377576:Y116C	Y	+	2	0	KRTAP9-9	36665510	0.958000	0.32768	0.975000	0.42487	0.054000	0.15201	1.097000	0.30988	1.351000	0.45789	0.374000	0.22700	TAC	KRTAP9-9	-	NULL	ENSG00000198083		0.637	KRTAP9-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-9	HGNC	protein_coding	OTTHUMT00000257710.1	-	0.00	117	0	A	NM_030975		39411984	+1	tier1	-	no_errors	ENST00000394008	ensembl	human	known	74_37	missense	51.08	112	118	SNP	0.988	G
LINC00634	339674	genome.wustl.edu	37	22	42353815	42353815	+	RNA	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr22:42353815G>A	ENST00000381348.4	+	0	388					NR_024355.1				long intergenic non-protein coding RNA 634																		AGTGGCGCATGCAGCGCCCCC	0.652																																																	0																																												0					22q13.2	2012-10-12			ENSG00000205704	ENSG00000205704		"""Long non-coding RNAs"""	27930	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_024355		Approved				OTTHUMG00000151274		22.37:g.42353815G>A				RNA	SNP	-	NULL	ENST00000381348.4	37	NULL		22																																																																																			LINC00634	-	-	ENSG00000205704		0.652	LINC00634-002	KNOWN	basic|exp_conf	processed_transcript	LINC00634	HGNC	pseudogene	OTTHUMT00000322049.1	-	0.00	45	0	G	NR_024355		42353815	+1	tier1	-	no_errors	ENST00000381348	ensembl	human	known	74_37	rna	5.80	65	4	SNP	1.000	A
LOC100190940	100190940	genome.wustl.edu	37	12	130520932	130520932	+	lincRNA	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:130520932G>C	ENST00000567788.1	-	0	1769				RP11-474D1.4_ENST00000561864.1_lincRNA																							GCCAAGTGCAGATATTAATTC	0.458																																																	0																																												0																															12.37:g.130520932G>C				RNA	SNP	-	NULL	ENST00000567788.1	37	NULL		12																																																																																			RP11-474D1.3	-	-	ENSG00000214039		0.458	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	Clone_based_vega_gene	lincRNA	OTTHUMT00000399498.1	-	0.00	32	0	G			130520932	-1	tier1	-	no_errors	ENST00000291374	ensembl	human	known	74_37	rna	21.62	28	8	SNP	0.000	C
FAR2P2	100216479	genome.wustl.edu	37	2	131175859	131175859	+	RNA	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:131175859C>T	ENST00000424873.1	-	0	538					NR_046260.1																						atgagggtatcttccttcggt	0.438																																																	0																																												0																															2.37:g.131175859C>T				RNA	SNP	-	NULL	ENST00000424873.1	37	NULL		2																																																																																			AC140481.1	-	-	ENSG00000178162		0.438	AC140481.1-001	KNOWN	basic	processed_transcript	LOC100288897	Clone_based_vega_gene	pseudogene	OTTHUMT00000333044.1	-	0.00	28	0	C			131175859	-1	tier1	-	no_errors	ENST00000423905	ensembl	human	known	74_37	rna	30.43	32	14	SNP	0.013	T
LOC400043	400043	genome.wustl.edu	37	12	54520191	54520191	+	lincRNA	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:54520191G>A	ENST00000508564.1	+	0	310				RP11-834C11.5_ENST00000508763.1_RNA	NR_026656.1																						CTCTCCCTCCGGATCGCTGCT	0.701																																																	0																																												0																															12.37:g.54520191G>A				RNA	SNP	-	NULL	ENST00000508564.1	37	NULL		12																																																																																			RP11-834C11.4	-	-	ENSG00000250742		0.701	RP11-834C11.4-001	KNOWN	basic	lincRNA	LOC400043	Clone_based_vega_gene	lincRNA	OTTHUMT00000358962.1	-	0.00	26	0	G			54520191	+1	tier1	-	no_errors	ENST00000508564	ensembl	human	known	74_37	rna	27.78	13	5	SNP	0.001	A
LOXHD1	125336	genome.wustl.edu	37	18	44140157	44140157	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr18:44140157G>A	ENST00000398722.4	-	12	2115	c.2116C>T	c.(2116-2118)Cag>Tag	p.Q706*	LOXHD1_ENST00000441893.2_5'Flank|LOXHD1_ENST00000300591.6_5'Flank|LOXHD1_ENST00000441551.2_Intron|LOXHD1_ENST00000536736.1_Nonsense_Mutation_p.Q984*|LOXHD1_ENST00000582408.1_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	706	Glu-rich.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						ATCACCTCCTGCATCCCCGGC	0.612																																																	0													83.0	80.0	81.0					18																	44140157		692	1591	2283	SO:0001587	stop_gained	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2116C>T	18.37:g.44140157G>A	ENSP00000381707:p.Gln706*		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Nonsense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.Q984*	ENST00000398722.4	37	c.2950		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.988929|8.988929	0.99027|0.99027	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000441551|ENST00000398722;ENST00000536736;ENST00000335730	.|.	.|.	.|.	5.24|5.24	4.3|4.3	0.51218|0.51218	.|.	.|0.137730	.|0.49305	.|D	.|0.000149	T|.	0.33411|.	0.0862|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.13899|.	-1.0492|.	4|.	.|0.05959	.|T	.|0.93	.|.	10.1645|10.1645	0.42871|0.42871	0.0:0.1561:0.702:0.1418|0.0:0.1561:0.702:0.1418	.|.	.|.	.|.	.|.	V|X	964|706;984;706	.|.	.|ENSP00000338222:Q706X	A|Q	-|-	2|1	0|0	LOXHD1|LOXHD1	42394155|42394155	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	3.524000|3.524000	0.53495|0.53495	2.450000|2.450000	0.82876|0.82876	0.448000|0.448000	0.29417|0.29417	GCA|CAG	LOXHD1	-	NULL	ENSG00000167210		0.612	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	46	0	G	NM_144612		44140157	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	A
LPO	4025	genome.wustl.edu	37	17	56343639	56343639	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:56343639G>A	ENST00000262290.4	+	11	1961	c.1645G>A	c.(1645-1647)Gac>Aac	p.D549N	LPO_ENST00000421678.2_Missense_Mutation_p.D466N|LPO_ENST00000543544.1_Missense_Mutation_p.D490N|LPO_ENST00000582328.1_Missense_Mutation_p.D466N	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	549					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						CCATGGCTTTGACCTGGCTGC	0.507																																																	0													58.0	52.0	54.0					17																	56343639		2203	4300	6503	SO:0001583	missense	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.1645G>A	17.37:g.56343639G>A	ENSP00000262290:p.Asp549Asn		A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.D549N	ENST00000262290.4	37	c.1645	CCDS32689.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.546229	0.96488	.	.	ENSG00000167419	ENST00000262290;ENST00000421678;ENST00000543544;ENST00000389576	T;T;T	0.79454	-1.27;-1.27;-1.27	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.93350	0.7880	H	0.98507	4.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95415	0.8502	10	0.87932	D	0	-44.0512	19.0909	0.93227	0.0:0.0:1.0:0.0	.	466;549	E7EMJ3;P22079	.;PERL_HUMAN	N	549;466;490;294	ENSP00000262290:D549N;ENSP00000400245:D466N;ENSP00000445344:D490N	ENSP00000262290:D549N	D	+	1	0	LPO	53698638	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.435000	0.97529	2.756000	0.94617	0.655000	0.94253	GAC	LPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000167419		0.507	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	-	0.00	30	0	G			56343639	+1	tier1	-	no_errors	ENST00000262290	ensembl	human	known	74_37	missense	19.05	34	8	SNP	1.000	A
LUC7L	55692	genome.wustl.edu	37	16	239289	239289	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:239289T>A	ENST00000293872.8	-	10	1134	c.1024A>T	c.(1024-1026)Agc>Tgc	p.S342C	LA16c-OS12.2_ENST00000595428.1_lincRNA|LUC7L_ENST00000397783.1_3'UTR|LUC7L_ENST00000337351.4_3'UTR	NM_201412.1	NP_958815.1	Q9NQ29	LUC7L_HUMAN	LUC7-like (S. cerevisiae)	342	Arg/Ser-rich.				mRNA splice site selection (GO:0006376)|negative regulation of striated muscle tissue development (GO:0045843)	U1 snRNP (GO:0005685)	identical protein binding (GO:0042802)|mRNA binding (GO:0003729)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	11		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				CCTCGCTCGCTCCGCCCGCTC	0.642																																																	0													47.0	54.0	51.0					16																	239289		2203	4300	6503	SO:0001583	missense	0			AY005111	CCDS10401.1, CCDS32348.1	16p13.3	2010-01-25	2001-11-28		ENSG00000007392	ENSG00000007392			6723	protein-coding gene	gene with protein product		607782	"""LUC7 (S. cerevisiae)-like"""				Standard	NM_201412		Approved	LUC7B1, hLuc7B1, Luc7	uc002cgc.1	Q9NQ29	OTTHUMG00000060730	ENST00000293872.8:c.1024A>T	16.37:g.239289T>A	ENSP00000293872:p.Ser342Cys		B8ZZ13|Q96S32|Q9NPH4	Missense_Mutation	SNP	pfam_Luc7-rel	p.S342C	ENST00000293872.8	37	c.1024	CCDS32348.1	16	.	.	.	.	.	.	.	.	.	.	T	10.32	1.317925	0.23994	.	.	ENSG00000007392	ENST00000293872;ENST00000429378	T	0.48201	0.82	5.1	4.01	0.46588	.	0.294605	0.37393	N	0.002114	T	0.30885	0.0779	N	0.14661	0.345	0.80722	D	1	B	0.28512	0.214	B	0.30105	0.111	T	0.13045	-1.0524	10	0.66056	D	0.02	.	9.6967	0.40161	0.0:0.0814:0.0:0.9186	.	342	Q9NQ29	LUC7L_HUMAN	C	342;141	ENSP00000413033:S141C	ENSP00000293872:S342C	S	-	1	0	LUC7L	179290	0.801000	0.28930	0.800000	0.32199	0.927000	0.56198	2.262000	0.43285	0.801000	0.34066	0.533000	0.62120	AGC	LUC7L	-	NULL	ENSG00000007392		0.642	LUC7L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LUC7L	HGNC	protein_coding	OTTHUMT00000134239.1	-	0.00	56	0	T			239289	-1	tier1	-	no_errors	ENST00000293872	ensembl	human	known	74_37	missense	51.67	29	31	SNP	0.911	A
MED1	5469	genome.wustl.edu	37	17	37564050	37564050	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:37564050G>A	ENST00000300651.6	-	17	4647	c.4424C>T	c.(4423-4425)tCt>tTt	p.S1475F	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		ATTCTGATAAGATTTCTCTGC	0.453										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													91.0	88.0	89.0					17																	37564050		2203	4300	6503	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.4424C>T	17.37:g.37564050G>A	ENSP00000300651:p.Ser1475Phe		B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.S1475F	ENST00000300651.6	37	c.4424	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	G	17.57	3.423368	0.62733	.	.	ENSG00000125686	ENST00000300651	T	0.47528	0.84	4.66	4.66	0.58398	.	.	.	.	.	T	0.56804	0.2010	N	0.24115	0.695	0.58432	D	0.999999	D	0.65815	0.995	D	0.75484	0.986	T	0.63060	-0.6721	9	0.87932	D	0	-7.3549	18.1035	0.89513	0.0:0.0:1.0:0.0	.	1475	Q15648	MED1_HUMAN	F	1475	ENSP00000300651:S1475F	ENSP00000300651:S1475F	S	-	2	0	MED1	34817576	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.166000	0.94766	2.573000	0.86826	0.561000	0.74099	TCT	MED1	-	NULL	ENSG00000125686		0.453	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	-	0.00	26	0	G	NM_004774		37564050	-1	tier1	-	no_errors	ENST00000300651	ensembl	human	known	74_37	missense	53.06	23	26	SNP	1.000	A
MED21	9412	genome.wustl.edu	37	12	27175645	27175645	+	Intron	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:27175645G>T	ENST00000282892.3	+	1	72				MED21_ENST00000546323.1_Intron|MED21_ENST00000536503.1_Intron	NM_001271811.1|NM_004264.3	NP_001258740.1|NP_004255.2	Q13503	MED21_HUMAN	mediator complex subunit 21						blastocyst development (GO:0001824)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	mediator complex (GO:0016592)	DNA-directed RNA polymerase activity (GO:0003899)|transcription coactivator activity (GO:0003713)					Colorectal(261;0.0847)					ACTTGAAAGTGGGGAGCGGAC	0.557																																																	0																																										SO:0001627	intron_variant	0			U46837	CCDS8711.1	12p12	2007-07-30	2007-07-30	2007-07-30		ENSG00000152944			11473	protein-coding gene	gene with protein product		603800	"""SRB7 (suppressor of RNA polymerase B, yeast) homolog"", ""SRB7 suppressor of RNA polymerase B homolog (yeast)"""	SURB7		8598913	Standard	NM_004264		Approved	SRB7	uc001rhp.2	Q13503		ENST00000282892.3:c.42+91G>T	12.37:g.27175645G>T			B2R4I3|Q6IB05|Q92811	Missense_Mutation	SNP	NULL	p.G45W	ENST00000282892.3	37	c.133	CCDS8711.1	12																																																																																			MED21	-	NULL	ENSG00000152944		0.557	MED21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED21	HGNC	protein_coding	OTTHUMT00000403262.1	-	0.00	12	0	G	NM_004264		27175645	+1	tier1	-	no_errors	ENST00000536711	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.000	T
MEGF11	84465	genome.wustl.edu	37	15	66249960	66249960	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr15:66249960C>T	ENST00000409699.2	-	10	1384	c.1212G>A	c.(1210-1212)caG>caA	p.Q404Q	MEGF11_ENST00000288745.3_Silent_p.Q329Q|MEGF11_ENST00000422354.1_Silent_p.Q404Q|MEGF11_ENST00000395625.2_Silent_p.Q329Q|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000360698.4_Silent_p.Q404Q			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	404	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						TGCAAGGCAGCTGGCAGCCAT	0.617																																																	0													51.0	42.0	45.0					15																	66249960		2201	4299	6500	SO:0001819	synonymous_variant	0			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.1212G>A	15.37:g.66249960C>T			Q17R86|Q6UXS5|Q8ND91|Q96KG6	Silent	SNP	pfam_EGF_laminin,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_EMI_domain	p.Q404	ENST00000409699.2	37	c.1212	CCDS10213.2	15																																																																																			MEGF11	-	smart_EG-like_dom,pfscan_EG-like_dom,pfscan_EGF_laminin	ENSG00000157890		0.617	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF11	HGNC	protein_coding	OTTHUMT00000329307.2		0.00	44	0	C	NM_032445		66249960	-1			no_errors	ENST00000409699	ensembl	human	known	74_37	silent	5.45	52	3	SNP	1.000	T
METTL15	196074	genome.wustl.edu	37	11	28232685	28232685	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:28232685A>G	ENST00000407364.3	+	4	699	c.347A>G	c.(346-348)tAt>tGt	p.Y116C	METTL15_ENST00000342303.5_Missense_Mutation_p.Y116C|METTL15_ENST00000406787.3_Missense_Mutation_p.Y116C|METTL15_ENST00000303459.6_Missense_Mutation_p.Y116C			A6NJ78	MET15_HUMAN	methyltransferase like 15	116							methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	14						ATTGTTCTCTATGCCTTGGAC	0.378																																																	0													117.0	105.0	109.0					11																	28232685		2202	4296	6498	SO:0001583	missense	0			AL832668	CCDS31450.1, CCDS44559.1, CCDS73269.1	11p14.1	2011-03-02	2011-03-02	2011-03-02	ENSG00000169519	ENSG00000169519			26606	protein-coding gene	gene with protein product			"""methyltransferase 5 domain containing 1"""	METT5D1		12477932	Standard	NM_152636		Approved	FLJ33979	uc001msh.2	A6NJ78	OTTHUMG00000150448	ENST00000407364.3:c.347A>G	11.37:g.28232685A>G	ENSP00000384369:p.Tyr116Cys		A8MRS5|B7WNU2|Q3MHD3|Q8N601|Q8NBA7	Missense_Mutation	SNP	pfam_RsmH,superfamily_SAM-dep_MeTrfase_MraW_recog,tigrfam_RsmH	p.Y116C	ENST00000407364.3	37	c.347	CCDS44559.1	11	.	.	.	.	.	.	.	.	.	.	A	11.55	1.673226	0.29693	.	.	ENSG00000169519	ENST00000406787;ENST00000342303;ENST00000407364;ENST00000303459	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.52	4.37	0.52481	.	0.156358	0.44902	D	0.000402	T	0.53594	0.1806	M	0.81802	2.56	0.52099	D	0.999942	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.80764	0.984;0.982;0.994	T	0.54050	-0.8351	9	.	.	.	.	9.0487	0.36363	0.7058:0.0:0.0:0.2942	.	116;116;116	A6NJ78;A6NJ78-2;A6NJ78-4	MET15_HUMAN;.;.	C	116	ENSP00000385507:Y116C;ENSP00000342259:Y116C;ENSP00000384369:Y116C;ENSP00000307251:Y116C	.	Y	+	2	0	METTL15	28189261	1.000000	0.71417	0.182000	0.23118	0.115000	0.19883	2.415000	0.44635	0.892000	0.36259	0.377000	0.23210	TAT	METTL15	-	pfam_RsmH,tigrfam_RsmH	ENSG00000169519		0.378	METTL15-003	NOVEL	basic|appris_principal|CCDS	protein_coding	METTL15	HGNC	protein_coding	OTTHUMT00000318135.2	-	0.00	105	0	A	NM_152636		28232685	+1	tier1	-	no_errors	ENST00000303459	ensembl	human	known	74_37	missense	38.46	56	35	SNP	0.716	G
MIA3	375056	genome.wustl.edu	37	1	222819066	222819066	+	Intron	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:222819066G>T	ENST00000344922.5	+	7	3634				MIA3_ENST00000344507.1_Intron|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000340535.7_Intron|MIA3_ENST00000344441.6_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3						chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		ATAAATTCAAGTATGGTTTTA	0.294																																																	0													116.0	95.0	101.0					1																	222819066		1805	4072	5877	SO:0001627	intron_variant	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.3609+39G>T	1.37:g.222819066G>T			A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	RNA	SNP	-	NULL	ENST00000344922.5	37	NULL	CCDS41470.1	1																																																																																			MIA3	-	-	ENSG00000154305		0.294	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	-	0.00	95	0	G	NM_198551		222819066	+1	tier1	-	no_errors	ENST00000470521	ensembl	human	known	74_37	rna	48.34	78	73	SNP	0.000	T
MMS22L	253714	genome.wustl.edu	37	6	97599743	97599743	+	Splice_Site	SNP	A	A	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:97599743A>T	ENST00000275053.4	-	23	3651	c.3386T>A	c.(3385-3387)gTt>gAt	p.V1129D	MMS22L_ENST00000369251.2_Splice_Site_p.V1089D	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1129					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CAGCCTTTTAACTAGAAGGAA	0.403																																																	0													113.0	115.0	114.0					6																	97599743		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3386-1T>A	6.37:g.97599743A>T			D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.V1129D	ENST00000275053.4	37	c.3386	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	A	22.4	4.283098	0.80803	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.47528	3.0;0.84	5.44	5.44	0.79542	.	0.058089	0.64402	D	0.000002	T	0.61148	0.2324	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.65821	-0.6075	10	0.59425	D	0.04	.	15.4909	0.75605	1.0:0.0:0.0:0.0	.	1089;1129	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	D	1129;1089	ENSP00000275053:V1129D;ENSP00000358254:V1089D	ENSP00000275053:V1129D	V	-	2	0	MMS22L	97706464	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.111000	0.64628	2.061000	0.61500	0.528000	0.53228	GTT	MMS22L	-	superfamily_ARM-type_fold	ENSG00000146263		0.403	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	-	0.00	41	0	A	NM_198468	Missense_Mutation	97599743	-1	tier1	-	no_errors	ENST00000275053	ensembl	human	known	74_37	missense	42.86	24	18	SNP	1.000	T
MMS22L	253714	genome.wustl.edu	37	6	97613184	97613184	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:97613184C>G	ENST00000275053.4	-	21	3424	c.3159G>C	c.(3157-3159)ttG>ttC	p.L1053F	MMS22L_ENST00000369251.2_Missense_Mutation_p.L1013F	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	1053					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CTGTGTTTCTCAATGCCAGCA	0.363																																																	0													106.0	106.0	106.0					6																	97613184		2203	4300	6503	SO:0001583	missense	0				CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.3159G>C	6.37:g.97613184C>G	ENSP00000275053:p.Leu1053Phe		D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L1053F	ENST00000275053.4	37	c.3159	CCDS5039.1	6	.	.	.	.	.	.	.	.	.	.	C	16.93	3.258104	0.59321	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	T;T	0.54071	3.07;0.59	5.79	4.92	0.64577	.	0.209790	0.42548	D	0.000692	T	0.47229	0.1434	M	0.62723	1.935	0.38769	D	0.954519	P;D	0.55800	0.928;0.973	P;P	0.51016	0.541;0.656	T	0.54476	-0.8288	10	0.54805	T	0.06	-21.8493	11.3194	0.49412	0.0:0.8438:0.0:0.1562	.	1013;1053	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	F	1053;1013	ENSP00000275053:L1053F;ENSP00000358254:L1013F	ENSP00000275053:L1053F	L	-	3	2	MMS22L	97719905	0.929000	0.31497	0.995000	0.50966	0.687000	0.40016	0.410000	0.21098	1.443000	0.47586	0.655000	0.94253	TTG	MMS22L	-	superfamily_ARM-type_fold	ENSG00000146263		0.363	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMS22L	HGNC	protein_coding	OTTHUMT00000041573.3	-	0.00	60	0	C	NM_198468		97613184	-1	tier1	-	no_errors	ENST00000275053	ensembl	human	known	74_37	missense	37.65	53	32	SNP	0.965	G
MTIF2	4528	genome.wustl.edu	37	2	55470218	55470218	+	Splice_Site	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:55470218T>C	ENST00000263629.4	-	13	1880		c.e13-2		MTIF2_ENST00000403721.1_Splice_Site|MTIF2_ENST00000394600.3_Splice_Site	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2						formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CAACATCACCTAAATACAGAA	0.328																																																	0													78.0	70.0	72.0					2																	55470218		2203	4300	6503	SO:0001630	splice_region_variant	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1565-2A>G	2.37:g.55470218T>C			D6W5D0	Splice_Site	SNP	-	e10-2	ENST00000263629.4	37	c.1565-2	CCDS1853.1	2	.	.	.	.	.	.	.	.	.	.	T	21.3	4.127530	0.77549	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2108	0.82158	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MTIF2	55323722	1.000000	0.71417	0.997000	0.53966	0.826000	0.46750	7.739000	0.84976	2.232000	0.73038	0.533000	0.62120	.	MTIF2	-	-	ENSG00000085760		0.328	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	-	0.00	12	0	T	NM_002453	Intron	55470218	-1	tier1	-	no_errors	ENST00000263629	ensembl	human	known	74_37	splice_site	48.00	13	12	SNP	1.000	C
MUC4	4585	genome.wustl.edu	37	3	195509726	195509726	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:195509726C>T	ENST00000463781.3	-	2	9184	c.8725G>A	c.(8725-8727)Gac>Aac	p.D2909N	MUC4_ENST00000475231.1_Missense_Mutation_p.D2909N|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGCGTGGTGTCACCTGTGGAT	0.582																																																	0																																										SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8725G>A	3.37:g.195509726C>T	ENSP00000417498:p.Asp2909Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.D2909N	ENST00000463781.3	37	c.8725	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	c	8.562	0.878046	0.17395	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.28069	1.63;1.63	.	.	.	.	.	.	.	.	T	0.15782	0.0380	N	0.19112	0.55	0.09310	N	1	B	0.22909	0.077	B	0.22880	0.042	T	0.29822	-0.9999	7	.	.	.	.	4.6597	0.12636	0.0:1.0:0.0:0.0	.	2781	E7ESK3	.	N	2909	ENSP00000417498:D2909N;ENSP00000420243:D2909N	.	D	-	1	0	MUC4	196994505	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.530000	0.23036	-0.000000	0.14550	0.000000	0.15137	GAC	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	381	0	C	NM_018406		195509726	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	13.96	445	74	SNP	0.125	T
MUC4	4585	genome.wustl.edu	37	3	195518038	195518038	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:195518038A>G	ENST00000463781.3	-	2	872	c.413T>C	c.(412-414)aTa>aCa	p.I138T	MUC4_ENST00000475231.1_Missense_Mutation_p.I138T|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	143					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCATTGTTATAGTCTTTGA	0.453																																																	0													188.0	164.0	171.0					3																	195518038		2002	4183	6185	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.413T>C	3.37:g.195518038A>G	ENSP00000417498:p.Ile138Thr		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.I138T	ENST00000463781.3	37	c.413	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	3.486	-0.104818	0.06967	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.38560	1.14;1.13	3.29	-5.69	0.02428	.	5.959390	0.00714	N	0.000841	T	0.31638	0.0803	L	0.42245	1.32	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.11329	0.006;0.002	T	0.12116	-1.0560	10	0.19147	T	0.46	.	7.4077	0.27000	0.2735:0.163:0.5635:0.0	.	138;143	E7ESK3;Q99102	.;MUC4_HUMAN	T	138;138;112	ENSP00000417498:I138T;ENSP00000420243:I138T	ENSP00000376209:I112T	I	-	2	0	MUC4	197002433	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.009000	0.00648	-1.242000	0.02523	-0.425000	0.05940	ATA	MUC4	-	NULL	ENSG00000145113		0.453	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	106	0	A	NM_018406		195518038	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	40.14	85	57	SNP	0.000	G
MYH11	4629	genome.wustl.edu	37	16	15854505	15854505	+	Silent	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:15854505T>C	ENST00000300036.5	-	11	1249	c.1140A>G	c.(1138-1140)aaA>aaG	p.K380K	MYH11_ENST00000576790.2_Silent_p.K380K|MYH11_ENST00000396324.3_Silent_p.K387K|MYH11_ENST00000452625.2_Silent_p.K387K	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	380	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGTGGCAAACTTTCTGAGCAG	0.443			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													237.0	197.0	210.0					16																	15854505		2197	4300	6497	SO:0001819	synonymous_variant	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1140A>G	16.37:g.15854505T>C			D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.K387	ENST00000300036.5	37	c.1161	CCDS10565.1	16																																																																																			MYH11	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000133392		0.443	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	-	0.00	106	0	T	NM_001040113		15854505	-1	tier1	-	no_errors	ENST00000396324	ensembl	human	known	74_37	silent	37.59	83	50	SNP	1.000	C
MYH14	79784	genome.wustl.edu	37	19	50783319	50783319	+	Missense_Mutation	SNP	C	C	T	rs561525083	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:50783319C>T	ENST00000596571.1	+	28	3935	c.3935C>T	c.(3934-3936)gCg>gTg	p.A1312V	MYH14_ENST00000440075.2_Missense_Mutation_p.A1353V|MYH14_ENST00000262269.8_Missense_Mutation_p.A1353V|MYH14_ENST00000425460.1_Missense_Mutation_p.A1320V|MYH14_ENST00000376970.2_Missense_Mutation_p.A1345V|MYH14_ENST00000601313.1_Missense_Mutation_p.A1353V|MYH14_ENST00000598205.1_Missense_Mutation_p.A1320V			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1312					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GTGTCTGGGGCGCTGAACGAG	0.597													C|||	2	0.000399361	0.0	0.0	5008	,	,		20391	0.002		0.0	False		,,,				2504	0.0																0													55.0	61.0	59.0					19																	50783319		2165	4256	6421	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.3935C>T	19.37:g.50783319C>T	ENSP00000472819:p.Ala1312Val		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1353V	ENST00000596571.1	37	c.4058	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	C	9.651	1.141646	0.21205	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	3.38	3.38	0.38709	Myosin tail (1);	.	.	.	.	T	0.62768	0.2455	N	0.20986	0.625	0.09310	N	1	B;B;B	0.25272	0.122;0.057;0.02	B;B;B	0.22753	0.041;0.022;0.006	T	0.54622	-0.8266	9	0.54805	T	0.06	.	6.7016	0.23229	0.0:0.8686:0.0:0.1313	.	1353;1312;1320	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	V	1312;1353;1345;1320;1312;1353	ENSP00000406273:A1353V;ENSP00000366169:A1345V;ENSP00000407879:A1320V;ENSP00000262269:A1353V	ENSP00000262269:A1353V	A	+	2	0	MYH14	55475131	0.059000	0.20769	0.730000	0.30809	0.888000	0.51559	2.913000	0.48790	1.922000	0.55676	0.455000	0.32223	GCG	MYH14	-	pfam_Myosin_tail	ENSG00000105357		0.597	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	-	0.00	52	0	C	NM_024729		50783319	+1	tier1	-	no_errors	ENST00000262269	ensembl	human	known	74_37	missense	17.98	73	16	SNP	0.012	T
MYH14	79784	genome.wustl.edu	37	19	50785086	50785086	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:50785086G>A	ENST00000596571.1	+	30	4403	c.4403G>A	c.(4402-4404)cGc>cAc	p.R1468H	MYH14_ENST00000440075.2_Missense_Mutation_p.R1509H|MYH14_ENST00000262269.8_Missense_Mutation_p.R1509H|MYH14_ENST00000425460.1_Missense_Mutation_p.R1476H|MYH14_ENST00000376970.2_Missense_Mutation_p.R1501H|MYH14_ENST00000601313.1_Missense_Mutation_p.R1509H|MYH14_ENST00000598205.1_Missense_Mutation_p.R1476H			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1468					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		AAGAAGCAGCGCAAGTTTGAC	0.632																																																	0													16.0	18.0	18.0					19																	50785086		2087	4162	6249	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4403G>A	19.37:g.50785086G>A	ENSP00000472819:p.Arg1468His		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1509H	ENST00000596571.1	37	c.4526	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063383	0.76187	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000262269	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	3.9	2.86	0.33363	Myosin tail (1);	.	.	.	.	D	0.90748	0.7096	M	0.74881	2.28	0.30620	N	0.7586	D;D;D	0.76494	0.999;0.997;0.998	D;D;P	0.68621	0.959;0.958;0.897	D	0.85527	0.1207	8	.	.	.	.	5.3555	0.16059	0.228:0.0:0.772:0.0	.	1509;1468;1476	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	H	1509;1501;1476;1509	ENSP00000406273:R1509H;ENSP00000366169:R1501H;ENSP00000407879:R1476H;ENSP00000262269:R1509H	.	R	+	2	0	MYH14	55476898	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.899000	0.75682	2.195000	0.70347	0.561000	0.74099	CGC	MYH14	-	pfam_Myosin_tail	ENSG00000105357		0.632	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	-	0.00	32	0	G	NM_024729		50785086	+1	tier1	-	no_errors	ENST00000262269	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	A
N4BP2L1	90634	genome.wustl.edu	37	13	32976725	32976725	+	3'UTR	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:32976725G>A	ENST00000380130.2	-	0	1181				N4BP2L1_ENST00000380133.2_Intron|N4BP2L1_ENST00000380139.4_3'UTR|N4BP2L1_ENST00000530622.2_3'UTR|N4BP2L1_ENST00000459716.1_5'UTR	NM_052818.2	NP_438169.2	Q5TBK1	N42L1_HUMAN	NEDD4 binding protein 2-like 1											large_intestine(1)|lung(2)|ovary(1)|skin(1)	5		Lung SC(185;0.0262)		all cancers(112;6.3e-06)|Epithelial(112;3.51e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00607)|BRCA - Breast invasive adenocarcinoma(63;0.0171)		AAAATAAATAGATCACTTCAG	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U50527	CCDS9345.2, CCDS41877.1	13q13.1	2008-11-05			ENSG00000139597	ENSG00000139597			25037	protein-coding gene	gene with protein product	"""hypothetical gene CG018"""					8812419	Standard	NM_052818		Approved	CG018	uc001uuc.3	Q5TBK1	OTTHUMG00000016697	ENST00000380130.2:c.*354C>T	13.37:g.32976725G>A			A4QN21|Q5TBK0	RNA	SNP	-	NULL	ENST00000380130.2	37	NULL	CCDS9345.2	13																																																																																			N4BP2L1	-	-	ENSG00000139597		0.358	N4BP2L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2L1	HGNC	protein_coding		-	0.00	8	0	G	NM_052818		32976725	-1	tier1	-	no_errors	ENST00000459716	ensembl	human	known	74_37	rna	85.71	2	12	SNP	0.190	A
NEB	4703	genome.wustl.edu	37	2	152411479	152411479	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:152411479G>A	ENST00000172853.10	-	97	14438	c.14291C>T	c.(14290-14292)gCa>gTa	p.A4764V	NEB_ENST00000397345.3_Missense_Mutation_p.A6465V|NEB_ENST00000604864.1_Missense_Mutation_p.A6465V|NEB_ENST00000603639.1_Missense_Mutation_p.A6465V|NEB_ENST00000409198.1_Missense_Mutation_p.A4764V|NEB_ENST00000427231.2_Missense_Mutation_p.A6465V			P20929	NEBU_HUMAN	nebulin	4764					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GAGGCACCGTGCTGTGTTCGG	0.423																																																	0													181.0	182.0	181.0					2																	152411479		2077	4227	6304	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.14291C>T	2.37:g.152411479G>A	ENSP00000172853:p.Ala4764Val		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.A6465V	ENST00000172853.10	37	c.19394		2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083738	0.76642	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000397342;ENST00000413693;ENST00000172853	T;T;T;T;T	0.10763	2.91;2.86;2.85;2.84;2.91	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.20333	0.0489	N	0.20483	0.58	0.80722	D	1	D;P	0.76494	0.999;0.885	D;P	0.87578	0.998;0.61	T	0.02339	-1.1174	10	0.32370	T	0.25	.	17.0623	0.86550	0.0:0.0:0.8725:0.1275	.	4764;1195	P20929;Q14215	NEBU_HUMAN;.	V	4764;6465;6465;813;1195;4764	ENSP00000386259:A4764V;ENSP00000380505:A6465V;ENSP00000416578:A6465V;ENSP00000410961:A1195V;ENSP00000172853:A4764V	ENSP00000172853:A4764V	A	-	2	0	NEB	152119725	1.000000	0.71417	0.974000	0.42286	0.963000	0.63663	5.657000	0.67996	2.941000	0.99782	0.655000	0.94253	GCA	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.423	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding			0.00	98	0	G	NM_004543		152411479	-1			no_errors	ENST00000397345	ensembl	human	known	74_37	missense	5.43	87	5	SNP	0.991	A
NEDD8	4738	genome.wustl.edu	37	14	24687342	24687342	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr14:24687342T>C	ENST00000250495.5	-	3	332	c.146A>G	c.(145-147)cAg>cGg	p.Q49R	AL136419.6_ENST00000565988.1_RNA|MDP1_ENST00000396833.2_5'Flank|NEDD8_ENST00000524927.1_Missense_Mutation_p.Q49R|NEDD8-MDP1_ENST00000604306.1_5'UTR|NEDD8-MDP1_ENST00000534348.1_Missense_Mutation_p.Q49R|MDP1_ENST00000288087.7_5'Flank|MDP1_ENST00000532557.1_5'Flank	NM_006156.2	NP_006147.1	Q15843	NEDD8_HUMAN	neural precursor cell expressed, developmentally down-regulated 8	49					anatomical structure morphogenesis (GO:0009653)|cellular protein modification process (GO:0006464)|protein localization (GO:0008104)|protein neddylation (GO:0045116)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to organic cyclic compound (GO:0014070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5				GBM - Glioblastoma multiforme(265;0.0186)		AACTCACATCTGCTTGCCACT	0.517																																																	0													175.0	147.0	156.0					14																	24687342		2203	4300	6503	SO:0001583	missense	0			D23662	CCDS9621.1	14q11.2	2008-08-13			ENSG00000129559	ENSG00000129559			7732	protein-coding gene	gene with protein product		603171				9353319	Standard	NM_006156		Approved	Nedd-8		Q15843	OTTHUMG00000029325	ENST00000250495.5:c.146A>G	14.37:g.24687342T>C	ENSP00000250495:p.Gln49Arg		Q3SXN8|Q6LES6	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.Q49R	ENST00000250495.5	37	c.146	CCDS9621.1	14	.	.	.	.	.	.	.	.	.	.	T	32	5.136285	0.94517	.	.	ENSG00000255526;ENSG00000129559;ENSG00000129559	ENST00000534348;ENST00000250495;ENST00000524927	T;T;T	0.73363	-0.74;-0.74;-0.74	5.53	5.53	0.82687	Ubiquitin supergroup (1);Ubiquitin conserved site (1);Ubiquitin (2);	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.81850	-0.0743	10	0.87932	D	0	.	14.7802	0.69760	0.0:0.0:0.0:1.0	.	49	Q15843	NEDD8_HUMAN	R	49	ENSP00000431482:Q49R;ENSP00000250495:Q49R;ENSP00000448192:Q49R	ENSP00000250495:Q49R	Q	-	2	0	NEDD8-MDP1;NEDD8	23757182	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.604000	0.74150	2.324000	0.78689	0.533000	0.62120	CAG	NEDD8-MDP1	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	ENSG00000255526		0.517	NEDD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEDD8-MDP1	HGNC	protein_coding	OTTHUMT00000073146.2	-	0.00	27	0	T	NM_006156		24687342	-1	tier1	-	no_errors	ENST00000605847	ensembl	human	known	74_37	missense	79.03	13	49	SNP	1.000	C
NEU4	129807	genome.wustl.edu	37	2	242756095	242756095	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:242756095G>T	ENST00000391969.2	+	4	919	c.208G>T	c.(208-210)Gcc>Tcc	p.A70S	NEU4_ENST00000404257.1_Missense_Mutation_p.A82S|AC114730.3_ENST00000420272.2_RNA|NEU4_ENST00000407683.1_Missense_Mutation_p.A70S|NEU4_ENST00000325935.6_Missense_Mutation_p.A83S|NEU4_ENST00000405370.1_Missense_Mutation_p.A70S	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	70					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		GCAGTGGGGTGCCCTGCACGT	0.672																																																	0													38.0	40.0	39.0					2																	242756095		2203	4299	6502	SO:0001583	missense	0			BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.208G>T	2.37:g.242756095G>T	ENSP00000375830:p.Ala70Ser		A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	superfamily_Sialidases	p.A83S	ENST00000391969.2	37	c.247	CCDS54442.1	2	.	.	.	.	.	.	.	.	.	.	G	0.075	-1.193687	0.01594	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000423583;ENST00000404257;ENST00000391969;ENST00000325935;ENST00000435894;ENST00000420288;ENST00000428592	D;D;D;D;D;D;D;D;D	0.84370	-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84;-1.84	4.24	-1.73	0.08081	Neuraminidase (2);	0.302919	0.33290	U	0.005077	T	0.73009	0.3532	L	0.37750	1.13	0.09310	N	1	B;B;B	0.22146	0.065;0.053;0.027	B;B;B	0.25759	0.055;0.032;0.063	T	0.56786	-0.7921	10	0.21540	T	0.41	-0.8956	7.6809	0.28513	0.1509:0.3715:0.4776:0.0	.	82;82;70	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	S	70;70;80;70;82;70;83;70;70;111	ENSP00000385402:A70S;ENSP00000384804:A70S;ENSP00000397860:A70S;ENSP00000385149:A82S;ENSP00000375830:A70S;ENSP00000320318:A83S;ENSP00000398571:A70S;ENSP00000388707:A70S;ENSP00000396197:A111S	ENSP00000320318:A83S	A	+	1	0	NEU4	242404768	0.797000	0.28877	0.000000	0.03702	0.084000	0.17831	1.370000	0.34238	-0.890000	0.03945	0.462000	0.41574	GCC	NEU4	-	superfamily_Sialidases	ENSG00000204099		0.672	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NEU4	HGNC	protein_coding	OTTHUMT00000257270.2	-	0.00	75	0	G	NM_080741		242756095	+1	tier1	-	no_errors	ENST00000325935	ensembl	human	known	74_37	missense	43.82	50	39	SNP	0.029	T
NOC3L	64318	genome.wustl.edu	37	10	96100090	96100090	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:96100090T>C	ENST00000371361.3	-	16	1823	c.1723A>G	c.(1723-1725)Att>Gtt	p.I575V	NOC3L_ENST00000543788.1_Missense_Mutation_p.I313V|NOC3L_ENST00000371350.1_Missense_Mutation_p.I575V	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	575					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				AATGGATCAATATTCAGAACA	0.289																																																	0													112.0	108.0	109.0					10																	96100090		2203	4298	6501	SO:0001583	missense	0			AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1723A>G	10.37:g.96100090T>C	ENSP00000360412:p.Ile575Val		Q9H5M6|Q9H9D8	Missense_Mutation	SNP	pfam_CCAAT-binding_factor,pfam_NOC3p,superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	p.I575V	ENST00000371361.3	37	c.1723	CCDS7433.1	10	.	.	.	.	.	.	.	.	.	.	T	13.39	2.224187	0.39300	.	.	ENSG00000173145	ENST00000543788;ENST00000371361;ENST00000371350	T;T;T	0.22336	1.96;1.96;1.96	5.41	5.41	0.78517	CCAAT-binding factor (1);	0.051425	0.85682	D	0.000000	T	0.15652	0.0377	N	0.25245	0.725	0.46954	D	0.999264	P	0.39443	0.674	B	0.41088	0.347	T	0.02539	-1.1144	10	0.06494	T	0.89	-21.566	15.7499	0.77976	0.0:0.0:0.0:1.0	.	575	Q8WTT2	NOC3L_HUMAN	V	313;575;575	ENSP00000437838:I313V;ENSP00000360412:I575V;ENSP00000360401:I575V	ENSP00000360401:I575V	I	-	1	0	NOC3L	96090080	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.840000	0.69402	2.188000	0.69820	0.533000	0.62120	ATT	NOC3L	-	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	ENSG00000173145		0.289	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOC3L	HGNC	protein_coding	OTTHUMT00000049466.1	-	0.00	92	0	T	NM_022451		96100090	-1	tier1	-	no_errors	ENST00000371350	ensembl	human	known	74_37	missense	41.59	66	47	SNP	1.000	C
NUDT8	254552	genome.wustl.edu	37	11	67395589	67395589	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:67395589C>A	ENST00000376693.2	-	4	548	c.539G>T	c.(538-540)gGc>gTc	p.G180V	RP11-655M14.13_ENST00000533311.1_lincRNA|NUDT8_ENST00000301490.4_3'UTR	NM_001243750.1	NP_001230679.1	Q8WV74	NUDT8_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 8	180						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|prostate(1)|skin(1)	4						AGCTGTGAGGCCCCAGACCCG	0.642																																																	0													77.0	76.0	77.0					11																	67395589		873	1985	2858	SO:0001583	missense	0			AI743601	CCDS8174.1, CCDS58151.1	11q13.2	2008-07-21			ENSG00000167799	ENSG00000167799		"""Nudix motif containing"""	8055	protein-coding gene	gene with protein product						11415433	Standard	NM_181843		Approved	FLJ41567	uc001omo.2	Q8WV74	OTTHUMG00000167292	ENST00000376693.2:c.539G>T	11.37:g.67395589C>A	ENSP00000365883:p.Gly180Val		Q6ZW59	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.G180V	ENST00000376693.2	37	c.539	CCDS58151.1	11	.	.	.	.	.	.	.	.	.	.	C	20.4	3.989474	0.74589	.	.	ENSG00000167799	ENST00000376693	T	0.78595	-1.19	4.28	4.28	0.50868	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.000000	0.85682	D	0.000000	D	0.87577	0.6212	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89300	0.3625	9	0.87932	D	0	-30.7911	13.5774	0.61883	0.0:1.0:0.0:0.0	.	180	Q8WV74	NUDT8_HUMAN	V	180	ENSP00000365883:G180V	ENSP00000365883:G180V	G	-	2	0	NUDT8	67152165	1.000000	0.71417	0.991000	0.47740	0.932000	0.56968	6.302000	0.72788	2.224000	0.72417	0.491000	0.48974	GGC	NUDT8	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000167799		0.642	NUDT8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUDT8	HGNC	protein_coding	OTTHUMT00000394036.1	-	0.00	52	0	C	NM_181843		67395589	-1	tier1	-	no_errors	ENST00000376693	ensembl	human	known	74_37	missense	35.40	73	40	SNP	0.998	A
OR1L6	392390	genome.wustl.edu	37	9	125512921	125512921	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:125512921C>T	ENST00000373684.1	+	1	903	c.903C>T	c.(901-903)tcC>tcT	p.S301S	OR1L6_ENST00000304720.2_Silent_p.S265S			Q8NGR2	OR1L6_HUMAN	olfactory receptor, family 1, subfamily L, member 6	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	12						GGCCCCTGTCCATGTACTCAG	0.493																																																	0													99.0	86.0	91.0					9																	125512921		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35130.1, CCDS35130.2	9q33.2	2013-09-20			ENSG00000171459	ENSG00000171459		"""GPCR / Class A : Olfactory receptors"""	8218	protein-coding gene	gene with protein product				OR1L7			Standard	NM_001004453		Approved		uc022bna.1	Q8NGR2	OTTHUMG00000020621	ENST00000373684.1:c.903C>T	9.37:g.125512921C>T			Q6IFM8|Q96R80	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S301	ENST00000373684.1	37	c.903		9																																																																																			OR1L6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171459		0.493	OR1L6-201	KNOWN	basic	protein_coding	OR1L6	HGNC	protein_coding		-	0.00	64	0	C			125512921	+1	tier1	-	no_errors	ENST00000373684	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	T
OR2G6	391211	genome.wustl.edu	37	1	248685431	248685431	+	Missense_Mutation	SNP	C	C	T	rs568353162	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:248685431C>T	ENST00000343414.4	+	1	516	c.484C>T	c.(484-486)Ctc>Ttc	p.L162F		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCAGTGCTCCCTCACTGTGCA	0.557																																																	0													88.0	71.0	77.0					1																	248685431		2203	4300	6503	SO:0001583	missense	0				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.484C>T	1.37:g.248685431C>T	ENSP00000341291:p.Leu162Phe		B2RP33	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L162F	ENST00000343414.4	37	c.484	CCDS31119.1	1	.	.	.	.	.	.	.	.	.	.	N	7.096	0.573099	0.13623	.	.	ENSG00000188558	ENST00000343414	T	0.00145	8.67	3.68	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.196341	0.25047	U	0.033541	T	0.00144	0.0004	L	0.39514	1.22	0.20307	N	0.999917	B	0.22480	0.07	B	0.26969	0.075	T	0.22417	-1.0217	10	0.38643	T	0.18	.	10.3544	0.43956	0.1971:0.8029:0.0:0.0	.	162	Q5TZ20	OR2G6_HUMAN	F	162	ENSP00000341291:L162F	ENSP00000341291:L162F	L	+	1	0	OR2G6	246752054	0.000000	0.05858	0.050000	0.19076	0.210000	0.24377	-1.545000	0.02190	1.869000	0.54173	0.400000	0.26472	CTC	OR2G6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000188558		0.557	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	HGNC	protein_coding	OTTHUMT00000097358.1	-	0.00	33	0	C	XM_372842		248685431	+1	tier1	-	no_errors	ENST00000343414	ensembl	human	known	74_37	missense	28.95	54	22	SNP	0.410	T
OR4K1	79544	genome.wustl.edu	37	14	20404131	20404131	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr14:20404131C>T	ENST00000285600.4	+	1	365	c.306C>T	c.(304-306)ttC>ttT	p.F102F		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		CCCAGATATTCGTTCTTCACA	0.413																																																	0													146.0	145.0	145.0					14																	20404131		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.306C>T	14.37:g.20404131C>T			B9EKV9|Q8NGD6|Q96R73	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F102	ENST00000285600.4	37	c.306	CCDS32025.1	14																																																																																			OR4K1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000155249		0.413	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K1	HGNC	protein_coding	OTTHUMT00000409881.1	-	0.00	48	0	C			20404131	+1	tier1	-	no_errors	ENST00000285600	ensembl	human	known	74_37	silent	33.64	73	37	SNP	0.037	T
OR5T3	390154	genome.wustl.edu	37	11	56020398	56020398	+	Silent	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:56020398C>A	ENST00000303059.3	+	1	723	c.723C>A	c.(721-723)atC>atA	p.I241I		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					TAGTCACTATCCTGATTGTCC	0.428																																																	0													254.0	230.0	238.0					11																	56020398		2201	4295	6496	SO:0001819	synonymous_variant	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.723C>A	11.37:g.56020398C>A			Q6IFC7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I241	ENST00000303059.3	37	c.723	CCDS31524.1	11																																																																																			OR5T3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172489		0.428	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	-	0.00	79	0	C	NM_001004747		56020398	+1	tier1	-	no_errors	ENST00000303059	ensembl	human	known	74_37	silent	39.13	70	45	SNP	0.000	A
OSBPL3	26031	genome.wustl.edu	37	7	24903154	24903155	+	Frame_Shift_Ins	INS	-	-	AGGA			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:24903154_24903155insAGGA	ENST00000313367.2	-	8	1188_1189	c.737_738insTCCT	c.(736-738)ctgfs	p.-246fs	OSBPL3_ENST00000396429.1_Frame_Shift_Ins_p.-246fs|OSBPL3_ENST00000431825.2_Frame_Shift_Ins_p.-246fs|OSBPL3_ENST00000396431.1_Frame_Shift_Ins_p.-246fs|OSBPL3_ENST00000409069.1_Frame_Shift_Ins_p.-246fs|OSBPL3_ENST00000353930.1_Frame_Shift_Ins_p.-246fs|OSBPL3_ENST00000352860.1_Frame_Shift_Ins_p.-246fs	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3						lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						ATGTCCGATGCAGGACGTCCAT	0.554																																																	0																																										SO:0001589	frameshift_variant	0			AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.734_737dupTCCT	7.37:g.24903155_24903158dupAGGA	ENSP00000315410:p.Leu246fs		A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Frame_Shift_Ins	INS	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.H247fs	ENST00000313367.2	37	c.738_737	CCDS5390.1	7																																																																																			OSBPL3	-	NULL	ENSG00000070882		0.554	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL3	HGNC	protein_coding	OTTHUMT00000214085.2		0.00	31	0	-			24903155	-1	tier1		no_errors	ENST00000313367	ensembl	human	known	74_37	frame_shift_ins	17.65	84	18	INS	0.998:1.000	AGGA
PABPC1	26986	genome.wustl.edu	37	8	101725016	101725016	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:101725016G>T	ENST00000318607.5	-	6	1868	c.740C>A	c.(739-741)gCt>gAt	p.A247D	PABPC1_ENST00000519004.1_Splice_Site_p.A202D|PABPC1_ENST00000522387.1_Splice_Site_p.A215D|PABPC1_ENST00000519596.1_5'UTR	NM_002568.3	NP_002559.2	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	247	CSDE1-binding.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|mRNA stabilization (GO:0048255)|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|translation activator activity (GO:0008494)			breast(2)|endometrium(4)|kidney(15)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	40	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			CTCATCCACAGCCTTCCCCCC	0.363																																																	0													70.0	64.0	66.0					8																	101725016		2203	4300	6503	SO:0001630	splice_region_variant	0			Y00345	CCDS6289.1	8q22.2-q23	2013-02-12	2004-04-20		ENSG00000070756	ENSG00000070756		"""RNA binding motif (RRM) containing"""	8554	protein-coding gene	gene with protein product		604679	"""poly(A)-binding protein, cytoplasmic 2"""	PAB1, PABPC2		2885805	Standard	XM_005250861		Approved	PABP1, PABPL1	uc003yjs.1	P11940	OTTHUMG00000164779	ENST00000318607.5:c.739-1C>A	8.37:g.101725016G>T			Q15097|Q93004	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.A247D	ENST00000318607.5	37	c.740	CCDS6289.1	8	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	29.5|29.5|29.5	5.014547|5.014547|5.014547	0.93404|0.93404|0.93404	.|.|.	.|.|.	ENSG00000070756|ENSG00000070756|ENSG00000070756	ENST00000318607;ENST00000347137;ENST00000519004;ENST00000522387|ENST00000519100|ENST00000519596	T;T;T|.|.	0.38077|.|.	1.16;1.16;1.16|.|.	5.57|5.57|5.57	5.57|5.57|5.57	0.84162|0.84162|0.84162	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);|.|.	0.000000|.|.	0.64402|.|.	D|.|.	0.000012|.|.	D|D|D	0.91703|0.91703|0.91703	0.7377|0.7377|0.7377	H|H|H	0.99325|0.99325|0.99325	4.515|4.515|4.515	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D|.|.	0.89917|.|.	0.999;1.0;1.0|.|.	D;D;D|.|.	0.91635|.|.	0.986;0.999;0.998|.|.	D|D|D	0.94711|0.94711|0.94711	0.7892|0.7892|0.7892	10|5|5	0.87932|.|.	D|.|.	0|.|.	.|.|.	19.9103|19.9103|19.9103	0.97024|0.97024|0.97024	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	215;247;247|.|.	E7ERJ7;B3KT93;P11940|.|.	.;.;PABP1_HUMAN|.|.	D|M|R	247;247;202;215|116|79	ENSP00000313007:A247D;ENSP00000429594:A202D;ENSP00000429395:A215D|.|.	ENSP00000313007:A247D|.|.	A|L|S	-|-|-	2|1|3	0|2|2	PABPC1|PABPC1|PABPC1	101794192|101794192|101794192	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.952000|0.952000|0.952000	0.60782|0.60782|0.60782	9.755000|9.755000|9.755000	0.98912|0.98912|0.98912	2.779000|2.779000|2.779000	0.95612|0.95612|0.95612	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GCT|CTG|AGC	PABPC1	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000070756		0.363	PABPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC1	HGNC	protein_coding	OTTHUMT00000380217.1	-	0.00	17	0	G	NM_002568	Missense_Mutation	101725016	-1	tier1	-	no_errors	ENST00000318607	ensembl	human	known	74_37	missense	40.91	13	9	SNP	1.000	T
PAK4	10298	genome.wustl.edu	37	19	39665640	39665640	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:39665640G>A	ENST00000593690.1	+	7	1595	c.1168G>A	c.(1168-1170)Gag>Aag	p.E390K	PAK4_ENST00000321944.4_Missense_Mutation_p.E300K|PAK4_ENST00000435673.2_Missense_Mutation_p.E390K|PAK4_ENST00000358301.3_Missense_Mutation_p.E390K|PAK4_ENST00000599470.1_Missense_Mutation_p.E237K|PAK4_ENST00000599386.1_Missense_Mutation_p.E237K|PAK4_ENST00000360442.3_Missense_Mutation_p.E390K	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	390	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGTGGGGGACGAGCTCTGGGT	0.597																																																	0													187.0	170.0	176.0					19																	39665640		2203	4300	6503	SO:0001583	missense	0			AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.1168G>A	19.37:g.39665640G>A	ENSP00000469413:p.Glu390Lys		B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.E390K	ENST00000593690.1	37	c.1168	CCDS12528.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.101975	0.94245	.	.	ENSG00000130669	ENST00000358301;ENST00000321944;ENST00000358801;ENST00000542377;ENST00000435673;ENST00000360442	T;T;T	0.65549	-0.16;-0.16;-0.16	4.24	4.24	0.50183	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64832	0.2634	N	0.17082	0.46	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.72982	0.955;0.97;0.979	T	0.70988	-0.4722	10	0.87932	D	0	.	14.1669	0.65483	0.0:0.0:1.0:0.0	.	300;237;390	O96013-4;O96013-3;O96013	.;.;PAK4_HUMAN	K	390;237;194;146;390;390	ENSP00000351049:E390K;ENSP00000392753:E390K;ENSP00000353625:E390K	ENSP00000326864:E237K	E	+	1	0	PAK4	44357480	1.000000	0.71417	0.974000	0.42286	0.995000	0.86356	9.541000	0.98083	2.189000	0.69895	0.556000	0.70494	GAG	PAK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000130669		0.597	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK4	HGNC	protein_coding	OTTHUMT00000463823.1	-	0.00	47	0	G			39665640	+1	tier1	-	no_errors	ENST00000358301	ensembl	human	known	74_37	missense	22.06	53	15	SNP	1.000	A
PARP14	54625	genome.wustl.edu	37	3	122447375	122447375	+	Silent	SNP	T	T	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:122447375T>C	ENST00000474629.2	+	17	5603	c.5337T>C	c.(5335-5337)caT>caC	p.H1779H		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1779	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		ATGTGCACCATCCAAGTTTAT	0.363																																																	0													168.0	163.0	165.0					3																	122447375		1910	4133	6043	SO:0001819	synonymous_variant	0			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.5337T>C	3.37:g.122447375T>C			B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	pfam_Macro_dom,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.H1779	ENST00000474629.2	37	c.5337	CCDS46894.1	3																																																																																			PARP14	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000173193		0.363	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2	-	0.00	75	0	T	NM_017554		122447375	+1	tier1	-	no_errors	ENST00000474629	ensembl	human	known	74_37	silent	45.71	37	32	SNP	0.008	C
PAXIP1	22976	genome.wustl.edu	37	7	154746044	154746044	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:154746044G>C	ENST00000404141.1	-	16	2896	c.2742C>G	c.(2740-2742)ttC>ttG	p.F914L	PAXIP1_ENST00000473219.1_5'UTR|RP11-5C23.1_ENST00000608064.1_RNA|RP11-5C23.2_ENST00000609134.1_RNA|PAXIP1_ENST00000397192.1_Missense_Mutation_p.F914L			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	914	BRCT 5. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		TCGCCGTCAGGAACTTCACGG	0.517																																																	0													88.0	91.0	90.0					7																	154746044		2091	4223	6314	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2742C>G	7.37:g.154746044G>C	ENSP00000384048:p.Phe914Leu		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.F914L	ENST00000404141.1	37	c.2742	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	G	11.33	1.608169	0.28623	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	D;D	0.86230	-2.09;-2.09	4.91	4.0	0.46444	BRCT (4);	0.000000	0.56097	U	0.000033	D	0.89615	0.6766	L	0.55213	1.73	0.49582	D	0.999805	D;D;D	0.89917	0.969;1.0;1.0	P;D;D	0.79784	0.761;0.987;0.993	D	0.85943	0.1459	10	0.10111	T	0.7	-29.9759	12.2655	0.54676	0.0858:0.0:0.9142:0.0	.	867;880;914	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	L	914;914;738;867	ENSP00000384048:F914L;ENSP00000380376:F914L	ENSP00000319149:F867L	F	-	3	2	PAXIP1	154376977	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	4.681000	0.61663	1.007000	0.39238	0.650000	0.86243	TTC	PAXIP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000157212		0.517	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	-	0.00	43	0	G	NM_007349		154746044	-1	tier1	-	no_errors	ENST00000397192	ensembl	human	known	74_37	missense	26.74	63	23	SNP	1.000	C
PCDHB2	56133	genome.wustl.edu	37	5	140476527	140476527	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:140476527G>C	ENST00000194155.4	+	1	2301	c.2153G>C	c.(2152-2154)aGg>aCg	p.R718T		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	718					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTGCAGGAGGAGCAGGGCG	0.682																																																	0													23.0	28.0	26.0					5																	140476527		2039	3964	6003	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.2153G>C	5.37:g.140476527G>C	ENSP00000194155:p.Arg718Thr		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R718T	ENST00000194155.4	37	c.2153	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974902	0.34848	.	.	ENSG00000112852	ENST00000194155	T	0.13901	2.55	4.45	4.45	0.53987	.	.	.	.	.	T	0.40743	0.1129	M	0.93763	3.455	0.23704	N	0.997068	D	0.62365	0.991	P	0.60345	0.873	T	0.41466	-0.9507	9	0.56958	D	0.05	.	8.4207	0.32698	0.0887:0.1584:0.7529:0.0	.	718	Q9Y5E7	PCDB2_HUMAN	T	718	ENSP00000194155:R718T	ENSP00000194155:R718T	R	+	2	0	PCDHB2	140456711	0.000000	0.05858	0.257000	0.24404	0.005000	0.04900	-0.030000	0.12308	2.169000	0.68431	0.558000	0.71614	AGG	PCDHB2	-	NULL	ENSG00000112852		0.682	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	-	0.00	135	0	G	NM_018936		140476527	+1	tier1	-	no_errors	ENST00000194155	ensembl	human	known	74_37	missense	50.40	62	63	SNP	0.558	C
PDE3B	5140	genome.wustl.edu	37	11	14793546	14793547	+	Intron	INS	-	-	AT			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:14793546_14793547insAT	ENST00000282096.4	+	2	1382				PDE3B_ENST00000455098.2_Intron|PDE3B_ENST00000534317.1_3'UTR	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited						angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	AAGTATAATTAATATCTGTGAT	0.282																																																	0																																										SO:0001627	intron_variant	0			U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.1029+13->AT	11.37:g.14793549_14793550dupAT			B7ZM37|O00639|Q14408|Q6SEI4	RNA	INS	-	NULL	ENST00000282096.4	37	NULL	CCDS7817.1	11																																																																																			PDE3B	-	-	ENSG00000152270		0.282	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	HGNC	protein_coding	OTTHUMT00000386974.1		0.00	82	0	-	NM_000922		14793547	+1	tier1		no_errors	ENST00000534317	ensembl	human	putative	74_37	rna	24.74	73	24	INS	0.000:0.019	AT
PGM5	5239	genome.wustl.edu	37	9	71006576	71006576	+	Missense_Mutation	SNP	C	C	T	rs148242804		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:71006576C>T	ENST00000396396.1	+	5	1053	c.824C>T	c.(823-825)aCg>aTg	p.T275M	PGM5_ENST00000604870.2_3'UTR|PGM5_ENST00000396392.1_Missense_Mutation_p.T275M	NM_021965.3	NP_068800.2	Q15124	PGM5_HUMAN	phosphoglucomutase 5	275					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)	cell-cell adherens junction (GO:0005913)|costamere (GO:0043034)|cytoplasmic side of plasma membrane (GO:0009898)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|sarcolemma (GO:0042383)|spot adherens junction (GO:0005914)|stress fiber (GO:0001725)|Z disc (GO:0030018)	intramolecular transferase activity, phosphotransferases (GO:0016868)|magnesium ion binding (GO:0000287)|structural molecule activity (GO:0005198)			endometrium(5)|kidney(1)|large_intestine(5)|liver(2)|lung(15)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	34						ACATATGCAACGACTCTTCTG	0.502																																																	0													113.0	109.0	111.0					9																	71006576		2201	4298	6499	SO:0001583	missense	0			L40933	CCDS6622.2	9q13	2008-02-05			ENSG00000154330	ENSG00000154330			8908	protein-coding gene	gene with protein product	"""phosphoglucomutase-related protein"""	600981				8586438, 8631316	Standard	NM_021965		Approved	PGMRP	uc004agr.3	Q15124	OTTHUMG00000019966	ENST00000396396.1:c.824C>T	9.37:g.71006576C>T	ENSP00000379678:p.Thr275Met		B1AM46|B4DLQ6|Q5VYV3|Q8N527|Q9UDH4	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.T275M	ENST00000396396.1	37	c.824	CCDS6622.2	9	79	0.036172161172161175	8	0.016260162601626018	9	0.024861878453038673	19	0.033216783216783216	43	0.05672823218997362	.	19.18	3.778278	0.70107	.	.	ENSG00000154330	ENST00000396396;ENST00000396392;ENST00000377314;ENST00000431583	T;T;T	0.63913	-0.07;-0.07;-0.07	4.92	4.92	0.64577	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (1);Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (1);	0.177992	0.48286	D	0.000200	T	0.16214	0.0390	N	0.10645	0.015	0.44012	D	0.99672	D	0.69078	0.997	D	0.67725	0.953	T	0.60929	-0.7165	10	0.72032	D	0.01	.	16.8751	0.86050	0.0:1.0:0.0:0.0	.	275	Q15124	PGM5_HUMAN	M	275;275;226;192	ENSP00000379678:T275M;ENSP00000379674:T275M;ENSP00000394864:T192M	ENSP00000366531:T226M	T	+	2	0	PGM5	70196396	0.995000	0.38212	0.967000	0.41034	0.992000	0.81027	3.210000	0.51129	2.274000	0.75844	0.555000	0.69702	ACG	PGM5	-	pfam_A-D-PHexomutase_a/b/a-II	ENSG00000154330		0.502	PGM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PGM5	HGNC	protein_coding	OTTHUMT00000052548.2		0.00	113	0	C	NM_021965		71006576	+1			no_errors	ENST00000396396	ensembl	human	known	74_37	missense	5.56	102	6	SNP	0.979	T
PHF14	9678	genome.wustl.edu	37	7	11143171	11143171	+	3'UTR	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:11143171C>G	ENST00000403050.3	+	0	4165				PHF14_ENST00000445996.2_Intron	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14						lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		ATCACTCAATCTTGAACTGAT	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.*1046C>G	7.37:g.11143171C>G			A7MCZ3|B4DI82	RNA	SNP	-	NULL	ENST00000403050.3	37	NULL	CCDS47542.1	7																																																																																			PHF14	-	-	ENSG00000106443		0.299	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	-	0.00	61	0	C	NM_014660		11143171	+1	tier1	-	no_errors	ENST00000481418	ensembl	human	known	74_37	rna	31.40	59	27	SNP	1.000	G
PHYHIPL	84457	genome.wustl.edu	37	10	60994160	60994161	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:60994160_60994161delTT	ENST00000373880.4	+	2	467_468	c.203_204delTT	c.(202-204)attfs	p.I68fs	PHYHIPL_ENST00000373878.3_Frame_Shift_Del_p.I42fs	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	68	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						TCATTCAAGATTTCATGGGAAA	0.361																																																	0																																										SO:0001589	frameshift_variant	0			AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.203_204delTT	10.37:g.60994160_60994161delTT	ENSP00000362987:p.Ile68fs		B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.S69fs	ENST00000373880.4	37	c.203_204	CCDS7254.1	10																																																																																			PHYHIPL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000165443		0.361	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYHIPL	HGNC	protein_coding	OTTHUMT00000048156.1		0.00	36	0	TT	NM_032439		60994161	+1	tier1		no_errors	ENST00000373880	ensembl	human	known	74_37	frame_shift_del	14.29	36	6	DEL	1.000:1.000	-
PKD2	5311	genome.wustl.edu	37	4	88977399	88977399	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr4:88977399C>T	ENST00000508588.1	+	3	527	c.132C>T	c.(130-132)ttC>ttT	p.F44F	PKD2_ENST00000237596.2_Silent_p.F626F|PKD2_ENST00000502363.1_Silent_p.F44F|PKD2_ENST00000511337.1_3'UTR			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TCGATGACTTCAGTACTTTCC	0.363																																																	0													86.0	68.0	74.0					4																	88977399		2203	4300	6503	SO:0001819	synonymous_variant	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.132C>T	4.37:g.88977399C>T			Q8TB08|Q9P0T6|Q9Y3X8	Silent	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.F626	ENST00000508588.1	37	c.1878		4																																																																																			PKD2	-	pfam_PKD1_2_channel,pfam_Ion_trans_dom	ENSG00000118762		0.363	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000363253.2	-	0.00	23	0	C	NM_000297		88977399	+1	tier1	-	no_errors	ENST00000237596	ensembl	human	known	74_37	silent	39.13	14	9	SNP	1.000	T
PLXNA4	91584	genome.wustl.edu	37	7	131848918	131848918	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:131848918T>A	ENST00000359827.3	-	24	5445	c.4483A>T	c.(4483-4485)Att>Ttt	p.I1495F	PLXNA4_ENST00000321063.4_Missense_Mutation_p.I1495F			Q9HCM2	PLXA4_HUMAN	plexin A4	1495					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TTGTAGTCAATCTGCTGGCGG	0.602																																																	0													78.0	87.0	84.0					7																	131848918		2203	4300	6503	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4483A>T	7.37:g.131848918T>A	ENSP00000352882:p.Ile1495Phe		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.I1495F	ENST00000359827.3	37	c.4483	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	T	24.5	4.536672	0.85812	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.15139	2.45;2.45	5.45	5.45	0.79879	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.43100	0.1232	M	0.74258	2.255	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34900	-0.9810	10	0.52906	T	0.07	.	15.542	0.76057	0.0:0.0:0.0:1.0	.	1495	Q9HCM2	PLXA4_HUMAN	F	1495	ENSP00000323194:I1495F;ENSP00000352882:I1495F	ENSP00000323194:I1495F	I	-	1	0	PLXNA4	131499458	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.289000	0.72696	2.064000	0.61679	0.533000	0.62120	ATT	PLXNA4	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000221866		0.602	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	47	0	T	NM_181775		131848918	-1	tier1	-	no_errors	ENST00000321063	ensembl	human	known	74_37	missense	53.16	37	42	SNP	1.000	A
PNCK	139728	genome.wustl.edu	37	X	152938410	152938411	+	Intron	DEL	AC	AC	-	rs201978519|rs10542443		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chrX:152938410_152938411delAC	ENST00000370150.1	-	2	247				PNCK_ENST00000447676.2_Intron|PNCK_ENST00000393831.2_Intron|PNCK_ENST00000370142.1_Intron|PNCK_ENST00000340888.3_Intron|PNCK_ENST00000475172.1_Intron|PNCK_ENST00000370145.4_Intron			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase							cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					tcacacaggtacacacacacac	0.55																																																	0																																										SO:0001627	intron_variant	0			BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.68+52GT>-	X.37:g.152938420_152938421delAC			B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	RNA	DEL	-	NULL	ENST00000370150.1	37	NULL		X																																																																																			PNCK	-	-	ENSG00000130822		0.550	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	PNCK	HGNC	protein_coding	OTTHUMT00000061044.2		0.00	21	0	AC	NM_198452		152938411	-1	tier1		no_errors	ENST00000462280	ensembl	human	putative	74_37	rna	22.22	21	6	DEL	0.001:0.002	-
POLQ	10721	genome.wustl.edu	37	3	121260276	121260276	+	Silent	SNP	G	G	T	rs201454367		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:121260276G>T	ENST00000264233.5	-	3	522	c.394C>A	c.(394-396)Cgg>Agg	p.R132R		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	132	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCCAAAACCCGCTTCAAAATA	0.348								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													147.0	164.0	158.0					3																	121260276		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.394C>A	3.37:g.121260276G>T			O95160|Q6VMB5	Silent	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.R132	ENST00000264233.5	37	c.394	CCDS33833.1	3																																																																																			POLQ	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000051341		0.348	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	23	0	G	NM_199420		121260276	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	silent	14.29	24	4	SNP	1.000	T
PRMT3	10196	genome.wustl.edu	37	11	20414545	20414545	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:20414545G>T	ENST00000331079.6	+	5	617	c.400G>T	c.(400-402)Gat>Tat	p.D134Y	PRMT3_ENST00000437750.2_Splice_Site_p.D72Y	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	134					histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						ACTTCAATTTGGTAAGATGAA	0.353																																																	0													132.0	135.0	134.0					11																	20414545		2203	4299	6502	SO:0001630	splice_region_variant	0			AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.400+1G>T	11.37:g.20414545G>T			B4DUC7	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_mo5U34_MeTrfas-like,pfam_Methyltransf_11,pfam_Arg_MeTrfase,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.D134Y	ENST00000331079.6	37	c.400	CCDS7853.1	11	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801077	0.90538	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	T;T	0.47528	0.84;0.84	5.65	5.65	0.86999	.	0.044811	0.85682	D	0.000000	T	0.70168	0.3193	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.71265	-0.4644	10	0.72032	D	0.01	-22.1066	19.6715	0.95914	0.0:0.0:1.0:0.0	.	72;134	O60678-2;O60678	.;ANM3_HUMAN	Y	134;134;72	ENSP00000331879:D134Y;ENSP00000397766:D72Y	ENSP00000331879:D134Y	D	+	1	0	PRMT3	20371121	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.336000	0.90033	2.809000	0.96659	0.650000	0.86243	GAT	PRMT3	-	NULL	ENSG00000185238		0.353	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT3	HGNC	protein_coding	OTTHUMT00000387489.1	-	0.00	57	0	G	NM_005788	Missense_Mutation	20414545	+1	tier1	-	no_errors	ENST00000331079	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
PROS1	5627	genome.wustl.edu	37	3	93624933	93624933	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr3:93624933C>T	ENST00000394236.3	-	5	717	c.401G>A	c.(400-402)tGc>tAc	p.C134Y	PROS1_ENST00000407433.1_Missense_Mutation_p.C3Y	NM_000313.3	NP_000304.2	P07225	PROS_HUMAN	protein S (alpha)	134	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|negative regulation of endopeptidase activity (GO:0010951)|peptidyl-glutamic acid carboxylation (GO:0017187)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|endopeptidase inhibitor activity (GO:0004866)			endometrium(3)|kidney(5)|large_intestine(8)|lung(26)|ovary(1)|skin(2)|urinary_tract(1)	46					Drotrecogin alfa(DB00055)|Menadione(DB00170)|Sodium Tetradecyl Sulfate(DB00464)	TCCATCTTTGCAGCTCATATA	0.413																																																	0													114.0	120.0	118.0					3																	93624933		2203	4300	6503	SO:0001583	missense	0				CCDS2923.1	3q11.1	2013-06-03			ENSG00000184500	ENSG00000184500			9456	protein-coding gene	gene with protein product		176880		PROS		214811, 1833851	Standard	NM_000313		Approved		uc003drb.4	P07225	OTTHUMG00000150354	ENST00000394236.3:c.401G>A	3.37:g.93624933C>T	ENSP00000377783:p.Cys134Tyr		A8KAC9|D3DN28|Q15518|Q7Z715|Q9UCZ8	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,pfam_GLA_domain,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.C134Y	ENST00000394236.3	37	c.401	CCDS2923.1	3	.	.	.	.	.	.	.	.	.	.	C	20.9	4.067095	0.76301	.	.	ENSG00000184500	ENST00000394236;ENST00000407433;ENST00000348974;ENST00000472684	D;D;D;D	0.99992	-12.4;-3.19;-12.4;-3.25	4.44	4.44	0.53790	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.115168	0.64402	D	0.000006	D	0.99994	0.9999	H	0.95816	3.725	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.99986	1.3252	10	0.87932	D	0	.	17.2572	0.87060	0.0:1.0:0.0:0.0	.	134	P07225	PROS_HUMAN	Y	134;3;166;3	ENSP00000377783:C134Y;ENSP00000385794:C3Y;ENSP00000330021:C166Y;ENSP00000419616:C3Y	ENSP00000330021:C166Y	C	-	2	0	PROS1	95107623	1.000000	0.71417	0.966000	0.40874	0.940000	0.58332	5.659000	0.68010	2.314000	0.78098	0.484000	0.47621	TGC	PROS1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000184500		0.413	PROS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROS1	HGNC	protein_coding	OTTHUMT00000317762.1	-	0.00	32	0	C	NM_000313		93624933	-1	tier1	-	no_errors	ENST00000394236	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
PRSS51	346702	genome.wustl.edu	37	8	10355353	10355353	+	RNA	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:10355353C>G	ENST00000523024.1	-	0	477				PRSS51_ENST00000521149.1_RNA					protease, serine, 51																		AGAGAGGTCACTGTCGAGCTG	0.507																																																	0																																												0					8p23.1	2013-01-16			ENSG00000253649	ENSG00000253649			37321	other	unknown							Standard			Approved				OTTHUMG00000163805		8.37:g.10355353C>G				RNA	SNP	-	NULL	ENST00000523024.1	37	NULL		8																																																																																			PRSS51	-	-	ENSG00000253649		0.507	PRSS51-002	KNOWN	basic	antisense	PRSS51	HGNC	antisense	OTTHUMT00000375669.1	-	0.00	80	0	C			10355353	-1	tier1	-	no_errors	ENST00000523024	ensembl	human	known	74_37	rna	32.23	143	68	SNP	0.828	G
PSMC4	5704	genome.wustl.edu	37	19	40477127	40477127	+	Missense_Mutation	SNP	C	C	G	rs547778812		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:40477127C>G	ENST00000157812.2	+	1	216	c.18C>G	c.(16-18)atC>atG	p.I6M	PSMC4_ENST00000455878.2_Missense_Mutation_p.I6M	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	6					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.I6M(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGATAGGCATCTTGGTGGAGA	0.617																																					Colon(105;1478 1543 4034 6132 38638)												1	Substitution - Missense(1)	lung(1)											153.0	133.0	139.0					19																	40477127		2203	4300	6503	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.18C>G	19.37:g.40477127C>G	ENSP00000157812:p.Ile6Met		Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.I6M	ENST00000157812.2	37	c.18	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	C	15.33	2.802883	0.50315	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95307	-3.57;-3.67	6.06	-0.256	0.12984	.	0.289012	0.38548	N	0.001659	D	0.90086	0.6903	L	0.43923	1.385	0.30516	N	0.768943	P;P	0.39216	0.571;0.664	B;B	0.42653	0.394;0.115	D	0.85866	0.1413	10	0.87932	D	0	-0.8958	4.6991	0.12818	0.1482:0.4928:0.0:0.3591	.	6;6	P43686-2;P43686	.;PRS6B_HUMAN	M	6	ENSP00000157812:I6M;ENSP00000413869:I6M	ENSP00000157812:I6M	I	+	3	3	PSMC4	45168967	0.765000	0.28485	0.989000	0.46669	0.981000	0.71138	-0.005000	0.12855	0.142000	0.18901	-0.188000	0.12872	ATC	PSMC4	-	NULL	ENSG00000013275		0.617	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1	-	0.00	61	0	C	NM_006503		40477127	+1	tier1	-	no_errors	ENST00000157812	ensembl	human	known	74_37	missense	36.17	90	51	SNP	0.972	G
PIKFYVE	200576	genome.wustl.edu	37	2	209224558	209224558	+	IGR	SNP	A	A	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:209224558A>T	ENST00000264380.4	+	0	9901				PTH2R_ENST00000413482.1_3'UTR	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing						cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GGGGAAGGCGAGGGTGGCTGG	0.692																																																	0																																										SO:0001628	intergenic_variant	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945		2.37:g.209224558A>T			Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	RNA	SNP	-	NULL	ENST00000264380.4	37	NULL	CCDS2382.1	2																																																																																			PTH2R	-	-	ENSG00000144407		0.692	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH2R	HGNC	protein_coding	OTTHUMT00000256477.2	-	0.00	8	0	A	NM_015040		209224558	+1	tier1	-	no_errors	ENST00000413482	ensembl	human	known	74_37	rna	66.67	2	4	SNP	0.014	T
PTMA	5757	genome.wustl.edu	37	2	232573421	232573421	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:232573421C>G	ENST00000341369.7	+	1	196	c.5C>G	c.(4-6)tCa>tGa	p.S2*	PTMA_ENST00000409321.1_Intron|PTMA_ENST00000466801.1_Intron|PTMA_ENST00000409683.1_Nonsense_Mutation_p.S2*|PTMA_ENST00000409115.3_Nonsense_Mutation_p.S2*|MGC4771_ENST00000595658.1_5'Flank|PTMA_ENST00000410064.1_5'Flank	NM_001099285.1	NP_001092755.1	P06454	PTMA_HUMAN	prothymosin, alpha	2					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				lung(3)|ovary(1)|prostate(1)|skin(1)	6		Renal(207;0.0112)|all_hematologic(139;0.0315)|Acute lymphoblastic leukemia(138;0.0921)|all_lung(227;0.142)		Epithelial(121;1.75e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00221)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		CCCACCATGTCAGACGCAGCC	0.667																																																	0													18.0	20.0	19.0					2																	232573421		1618	3624	5242	SO:0001587	stop_gained	0				CCDS42833.1, CCDS46541.1	2q37.1	2008-07-04	2008-04-03		ENSG00000187514	ENSG00000187514			9623	protein-coding gene	gene with protein product	"""gene sequence 28"""	188390	"""prothymosin, alpha (gene sequence 28)"""	TMSA		1612591	Standard	NM_002823		Approved		uc002vsc.4	P06454	OTTHUMG00000153810	ENST00000341369.7:c.5C>G	2.37:g.232573421C>G	ENSP00000344547:p.Ser2*		Q15249|Q15592	Nonsense_Mutation	SNP	pfam_Pro/parathymosin	p.S2*	ENST00000341369.7	37	c.5	CCDS42833.1	2	.	.	.	.	.	.	.	.	.	.	C	38	7.041708	0.98021	.	.	ENSG00000187514	ENST00000409115;ENST00000341369;ENST00000409683	.	.	.	3.36	3.36	0.38483	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.0321	0.58847	0.0:1.0:0.0:0.0	.	.	.	.	X	2	.	ENSP00000344547:S2X	S	+	2	0	PTMA	232281665	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.067000	0.71193	1.853000	0.53794	0.561000	0.74099	TCA	PTMA	-	pfam_Pro/parathymosin	ENSG00000187514		0.667	PTMA-002	KNOWN	basic|CCDS	protein_coding	PTMA	HGNC	protein_coding	OTTHUMT00000332553.1	-	0.00	24	0	C			232573421	+1	tier1	-	no_errors	ENST00000341369	ensembl	human	known	74_37	nonsense	26.09	17	6	SNP	1.000	G
PTPRM	5797	genome.wustl.edu	37	18	8244113	8244113	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr18:8244113G>A	ENST00000332175.8	+	15	3395	c.2358G>A	c.(2356-2358)gtG>gtA	p.V786V	PTPRM_ENST00000580170.1_Silent_p.V786V|PTPRM_ENST00000400053.4_Silent_p.V724V|PTPRM_ENST00000444013.1_Silent_p.V573V|PTPRM_ENST00000400060.4_Silent_p.V786V	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	786					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AGATGACTGTGATGGTGAACT	0.473																																																	0													145.0	137.0	140.0					18																	8244113		2203	4300	6503	SO:0001819	synonymous_variant	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2358G>A	18.37:g.8244113G>A			A7MBN1|D3DUH8|J3QL11	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.V786	ENST00000332175.8	37	c.2358	CCDS11840.1	18																																																																																			PTPRM	-	NULL	ENSG00000173482		0.473	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	-	0.00	81	0	G			8244113	+1	tier1	-	no_errors	ENST00000400060	ensembl	human	known	74_37	silent	28.30	76	30	SNP	1.000	A
PYY	5697	genome.wustl.edu	37	17	42030684	42030684	+	Silent	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:42030684G>C	ENST00000360085.2	-	5	708	c.168C>G	c.(166-168)ctC>ctG	p.L56L	PYY_ENST00000592796.1_Silent_p.L56L	NM_004160.4	NP_004151	P10082	PYY_HUMAN	peptide YY	56					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|digestion (GO:0007586)|eating behavior (GO:0042755)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(1)|ovary(1)	2		Breast(137;0.00314)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.12)		TGACCAGGTTGAGGTAGTGGC	0.721																																																	0													17.0	19.0	18.0					17																	42030684		2201	4298	6499	SO:0001819	synonymous_variant	0				CCDS32662.1	17q21.1	2013-02-28				ENSG00000131096		"""Endogenous ligands"""	9748	protein-coding gene	gene with protein product	"""prepro-PYY"""	600781				7782089	Standard	NM_004160		Approved	PYY1	uc002ieq.3	P10082		ENST00000360085.2:c.168C>G	17.37:g.42030684G>C			Q5U5Q6|Q6FGH8	Silent	SNP	pfam_Pancreatic_hormone-like,smart_Pancreatic_hormone-like,pfscan_Pancreatic_hormone-like,prints_Pancreatic_hormone-like	p.L56	ENST00000360085.2	37	c.168	CCDS32662.1	17																																																																																			PYY	-	pfam_Pancreatic_hormone-like,smart_Pancreatic_hormone-like,pfscan_Pancreatic_hormone-like,prints_Pancreatic_hormone-like	ENSG00000131096		0.721	PYY-001	KNOWN	basic|CCDS	protein_coding	PYY	HGNC	protein_coding	OTTHUMT00000457658.1	-	0.00	19	0	G	NM_004160		42030684	-1	tier1	-	no_errors	ENST00000360085	ensembl	human	known	74_37	silent	28.57	40	16	SNP	1.000	C
RAB13	5872	genome.wustl.edu	37	1	153954779	153954782	+	Intron	DEL	ACAC	ACAC	-	rs371625659|rs71584158|rs56853500|rs530111525|rs550367961	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	ACAC	ACAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:153954779_153954782delACAC	ENST00000368575.3	-	7	650				RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ATCAACACCAacacacacacacac	0.451														843	0.168331	0.1861	0.0749	5008	,	,		23862	0.3046		0.1133	False		,,,				2504	0.1268				Ovarian(138;395 2427 24306 43415)												0																																										SO:0001627	intron_variant	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.534+84GTGT>-	1.37:g.153954787_153954790delACAC			A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	RNA	DEL	-	NULL	ENST00000368575.3	37	NULL	CCDS1058.1	1																																																																																			RAB13	-	-	ENSG00000143545		0.451	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1		0.00	26	0	ACAC	NM_002870		153954782	-1	tier1		no_errors	ENST00000462680	ensembl	human	known	74_37	rna	10.00	27	3	DEL	0.000:0.001:0.000:0.002	-
RAB3GAP2	25782	genome.wustl.edu	37	1	220440993	220440993	+	Intron	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:220440993G>T	ENST00000358951.2	-	1	232				RAB3GAP2_ENST00000462353.1_5'UTR	NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)						establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CAGTGGCCTGGAGGCAGGATG	0.483																																																	0																																										SO:0001627	intron_variant	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.115+4571C>A	1.37:g.220440993G>T			A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	RNA	SNP	-	NULL	ENST00000358951.2	37	NULL	CCDS31028.1	1																																																																																			RAB3GAP2	-	-	ENSG00000118873		0.483	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	-	0.00	34	0	G	NM_012414		220440993	-1	tier1	-	no_errors	ENST00000462353	ensembl	human	known	74_37	rna	20.63	50	13	SNP	0.001	T
RASA1	5921	genome.wustl.edu	37	5	86645150	86645150	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:86645150C>T	ENST00000274376.6	+	8	1786	c.1222C>T	c.(1222-1224)Cag>Tag	p.Q408*	RASA1_ENST00000456692.2_Nonsense_Mutation_p.Q231*|RASA1_ENST00000506290.1_Nonsense_Mutation_p.Q242*|RASA1_ENST00000512763.1_Nonsense_Mutation_p.Q241*	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	408	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GCCAAACAATCAGTTTATGAT	0.333																																																	0													68.0	73.0	71.0					5																	86645150		2201	4298	6499	SO:0001587	stop_gained	0				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1222C>T	5.37:g.86645150C>T	ENSP00000274376:p.Gln408*		B2R6W3|Q9UDI1	Nonsense_Mutation	SNP	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.Q408*	ENST00000274376.6	37	c.1222	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	C	44	10.850656	0.99477	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.0172	0.97481	0.0:1.0:0.0:0.0	.	.	.	.	X	408;441;231;241;242	.	ENSP00000274376:Q408X	Q	+	1	0	RASA1	86680906	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.790000	0.85794	2.723000	0.93209	0.585000	0.79938	CAG	RASA1	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000145715		0.333	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	HGNC	protein_coding	OTTHUMT00000369729.1	-	0.00	41	0	C	NM_002890		86645150	+1	tier1	-	no_errors	ENST00000274376	ensembl	human	known	74_37	nonsense	53.57	13	15	SNP	1.000	T
RARS	5917	genome.wustl.edu	37	5	167929026	167929026	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:167929026G>T	ENST00000231572.3	+	9	1027	c.973G>T	c.(973-975)Gca>Tca	p.A325S	RARS_ENST00000538719.1_Missense_Mutation_p.A119S|RARS_ENST00000520421.1_3'UTR	NM_002887.3	NP_002878.2	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	325					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	aminoacyl-tRNA synthetase multienzyme complex (GO:0017101)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	arginine binding (GO:0034618)|arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|tRNA binding (GO:0000049)	p.A325T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(1)|stomach(1)	22	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		AATCTATGATGCATTGGACGT	0.313																																																	1	Substitution - Missense(1)	endometrium(1)											88.0	95.0	93.0					5																	167929026		2202	4295	6497	SO:0001583	missense	0			BC000528	CCDS4367.1	5q35.1	2011-07-01			ENSG00000113643	ENSG00000113643	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	9870	protein-coding gene	gene with protein product	"""arginine tRNA ligase 1, cytoplasmic"""	107820				7590355	Standard	NM_002887		Approved	DALRD1	uc003lzx.3	P54136	OTTHUMG00000130411	ENST00000231572.3:c.973G>T	5.37:g.167929026G>T	ENSP00000231572:p.Ala325Ser		B2RBS9|Q53GY4|Q9BWA1	Missense_Mutation	SNP	pfam_Arg-tRNA-synth_Ia_core,pfam_DALR_anticod-bd,pfam_Arg-tRNA-synth_N,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Arg-tRNA-synth_N,smart_DALR_anticod-bd,prints_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-ligase_Ia	p.A325S	ENST00000231572.3	37	c.973	CCDS4367.1	5	.	.	.	.	.	.	.	.	.	.	G	13.52	2.260917	0.39995	.	.	ENSG00000113643	ENST00000231572;ENST00000538719	T;T	0.63744	-0.06;-0.06	5.14	5.14	0.70334	Arginyl-tRNA synthetase, class Ia, core (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.096119	0.64402	D	0.000001	T	0.52725	0.1752	L	0.29908	0.895	0.32607	N	0.525158	B	0.14438	0.01	B	0.29524	0.103	T	0.61431	-0.7064	10	0.54805	T	0.06	-3.2398	12.2046	0.54345	0.0:0.0:0.7132:0.2868	.	325	P54136	SYRC_HUMAN	S	325;119	ENSP00000231572:A325S;ENSP00000439108:A119S	ENSP00000231572:A325S	A	+	1	0	RARS	167861604	1.000000	0.71417	0.248000	0.24265	0.527000	0.34593	5.050000	0.64251	2.543000	0.85770	0.655000	0.94253	GCA	RARS	-	pfam_Arg-tRNA-synth_Ia_core,tigrfam_Arg-tRNA-ligase_Ia	ENSG00000113643		0.313	RARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS	HGNC	protein_coding	OTTHUMT00000252794.2		0.00	62	0	G	NM_002887		167929026	+1			no_errors	ENST00000231572	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.959	T
RASAL2	9462	genome.wustl.edu	37	1	178426981	178426981	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:178426981G>A	ENST00000462775.1	+	12	2256	c.2131G>A	c.(2131-2133)Gac>Aac	p.D711N	RASAL2_ENST00000448150.3_Missense_Mutation_p.D841N|RASAL2_ENST00000367649.3_Missense_Mutation_p.D852N	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	711					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						CTCCCTCATGGACCTCCAGGA	0.507																																																	0													93.0	89.0	91.0					1																	178426981		2203	4300	6503	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.2131G>A	1.37:g.178426981G>A	ENSP00000420558:p.Asp711Asn		F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.D852N	ENST00000462775.1	37	c.2554	CCDS1322.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.744868|4.744868	0.89663|0.89663	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	T;T;T|.	0.22336|.	1.96;1.96;1.96|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.054842|.	0.64402|.	D|.	0.000001|.	T|T	0.79076|0.79076	0.4385|0.4385	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	D;D;D|.	0.76494|.	0.983;0.999;0.965|.	P;D;P|.	0.79108|.	0.874;0.992;0.602|.	T|T	0.79567|0.79567	-0.1750|-0.1750	10|5	0.72032|.	D|.	0.01|.	.|.	19.2521|19.2521	0.93929|0.93929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	841;711;852|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	N|E	841;852;711|261	ENSP00000407768:D841N;ENSP00000356621:D852N;ENSP00000420558:D711N|.	ENSP00000356621:D852N|.	D|G	+|+	1|2	0|0	RASAL2|RASAL2	176693604|176693604	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.039000|9.039000	0.93777|0.93777	2.542000|2.542000	0.85734|0.85734	0.655000|0.655000	0.94253|0.94253	GAC|GGA	RASAL2	-	pfam_DUF3498	ENSG00000075391		0.507	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	-	0.00	25	0	G	NM_170692		178426981	+1	tier1	-	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	29.17	34	14	SNP	1.000	A
RASAL2	9462	genome.wustl.edu	37	1	178427011	178427011	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:178427011G>C	ENST00000462775.1	+	12	2286	c.2161G>C	c.(2161-2163)Gag>Cag	p.E721Q	RASAL2_ENST00000448150.3_Missense_Mutation_p.E851Q|RASAL2_ENST00000367649.3_Missense_Mutation_p.E862Q	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	721					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TGCTCAAGTGGAGCATGCATC	0.522																																																	0													91.0	84.0	87.0					1																	178427011		2203	4300	6503	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.2161G>C	1.37:g.178427011G>C	ENSP00000420558:p.Glu721Gln		F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.E862Q	ENST00000462775.1	37	c.2584	CCDS1322.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.128|8.128	0.782394|0.782394	0.16189|0.16189	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775|ENST00000433130	T;T;T|.	0.12039|.	2.72;2.72;2.72|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.255145|.	0.39146|.	N|.	0.001454|.	T|T	0.49115|0.49115	0.1538|0.1538	N|N	0.19112|0.19112	0.55|0.55	0.33894|0.33894	D|D	0.637704|0.637704	B;B;B|.	0.24043|.	0.02;0.096;0.039|.	B;B;B|.	0.33620|.	0.03;0.167;0.048|.	T|T	0.55503|0.55503	-0.8131|-0.8131	10|5	0.23891|.	T|.	0.37|.	.|.	19.2521|19.2521	0.93929|0.93929	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	851;721;862|.	B1AKC7;Q9UJF2;F8W755|.	.;NGAP_HUMAN;.|.	Q|A	851;862;721|271	ENSP00000407768:E851Q;ENSP00000356621:E862Q;ENSP00000420558:E721Q|.	ENSP00000356621:E862Q|.	E|G	+|+	1|2	0|0	RASAL2|RASAL2	176693634|176693634	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.744000|0.744000	0.42396|0.42396	3.999000|3.999000	0.57031|0.57031	2.542000|2.542000	0.85734|0.85734	0.655000|0.655000	0.94253|0.94253	GAG|GGA	RASAL2	-	pfam_DUF3498	ENSG00000075391		0.522	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	-	0.00	23	0	G	NM_170692		178427011	+1	tier1	-	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.985	C
RCOR3	55758	genome.wustl.edu	37	1	211447585	211447585	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:211447585A>G	ENST00000367005.4	+	3	302	c.161A>G	c.(160-162)cAt>cGt	p.H54R	RCOR3_ENST00000367006.4_Missense_Mutation_p.H112R|RCOR3_ENST00000452621.2_Missense_Mutation_p.H112R|RCOR3_ENST00000419091.2_Missense_Mutation_p.H112R	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	54	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		AAGGAAAAGCATGGCTACAAT	0.323																																																	0													85.0	74.0	78.0					1																	211447585		2203	4300	6503	SO:0001583	missense	0			AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.161A>G	1.37:g.211447585A>G	ENSP00000355972:p.His54Arg		B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.H54R	ENST00000367005.4	37	c.161	CCDS31016.1	1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.149867	0.78001	.	.	ENSG00000117625	ENST00000534478;ENST00000533469;ENST00000367006;ENST00000452621;ENST00000419091;ENST00000367005	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.58	5.58	0.84498	ELM2 domain (1);	0.000000	0.85682	D	0.000000	T	0.64204	0.2577	M	0.80183	2.485	0.80722	D	1	D;P;B;P	0.76494	0.999;0.559;0.164;0.679	D;P;B;B	0.64144	0.922;0.519;0.316;0.29	T	0.65088	-0.6253	10	0.36615	T	0.2	-23.1253	16.0283	0.80558	1.0:0.0:0.0:0.0	.	112;54;112;112	Q9P2K3-3;Q9P2K3;Q9P2K3-2;Q9P2K3-4	.;RCOR3_HUMAN;.;.	R	54;54;112;112;112;54	ENSP00000436057:H54R;ENSP00000436838:H54R;ENSP00000355973:H112R;ENSP00000398558:H112R;ENSP00000413929:H112R;ENSP00000355972:H54R	ENSP00000355972:H54R	H	+	2	0	RCOR3	209514208	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.236000	0.95360	2.244000	0.73946	0.477000	0.44152	CAT	RCOR3	-	pfscan_ELM2_dom	ENSG00000117625		0.323	RCOR3-001	KNOWN	basic|CCDS	protein_coding	RCOR3	HGNC	protein_coding	OTTHUMT00000089821.1	-	0.00	80	0	A	NM_018254		211447585	+1	tier1	-	no_errors	ENST00000367005	ensembl	human	known	74_37	missense	25.41	91	31	SNP	1.000	G
RHBDD2	57414	genome.wustl.edu	37	7	75512836	75512837	+	Intron	INS	-	-	A	rs143886218		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:75512836_75512837insA	ENST00000006777.6	+	3	721				RHBDD2_ENST00000468304.1_Intron|RHBDD2_ENST00000318622.4_Intron|RHBDD2_ENST00000428119.1_Intron	NM_001040456.1	NP_001035546.1	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2							Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|lung(4)|prostate(1)	6						gactccatctcaaaaaaaaaaa	0.535																																																	0																																										SO:0001627	intron_variant	0			AF226732	CCDS43602.1, CCDS43603.1	7q11	2008-09-04	2006-02-22	2006-02-22	ENSG00000005486	ENSG00000005486			23082	protein-coding gene	gene with protein product		615203	"""rhomboid, veinlet-like 7 (Drosophila)"""	RHBDL7		12838346	Standard	XM_005250511		Approved	NPD007	uc003udw.1	Q6NTF9	OTTHUMG00000156435	ENST00000006777.6:c.587-179->A	7.37:g.75512847_75512847dupA			Q7L534|Q9H5W6|Q9HBK7|Q9UDT2	RNA	INS	-	NULL	ENST00000006777.6	37	NULL	CCDS43602.1	7																																																																																			RHBDD2	-	-	ENSG00000005486		0.535	RHBDD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDD2	HGNC	protein_coding	OTTHUMT00000344176.1		0.00	11	0	-	NM_020684		75512837	+1	tier1		no_errors	ENST00000467406	ensembl	human	putative	74_37	rna	16.13	26	5	INS	0.001:0.010	A
RELN	5649	genome.wustl.edu	37	7	103159843	103159843	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:103159843C>T	ENST00000428762.1	-	49	7948	c.7789G>A	c.(7789-7791)Gaa>Aaa	p.E2597K	RELN_ENST00000343529.5_Missense_Mutation_p.E2597K|RELN_ENST00000424685.2_Missense_Mutation_p.E2597K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2597					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ACAGAATATTCCAAGAGAACA	0.408																																					NSCLC(146;835 1944 15585 22231 52158)												0													161.0	133.0	143.0					7																	103159843		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.7789G>A	7.37:g.103159843C>T	ENSP00000392423:p.Glu2597Lys		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.E2597K	ENST00000428762.1	37	c.7789	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.580229	0.96565	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.22336	1.96;1.96;1.96	5.87	5.87	0.94306	Neuraminidase (3);	0.000000	0.85682	D	0.000000	T	0.43919	0.1269	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.87578	0.998;0.952	T	0.15492	-1.0435	10	0.72032	D	0.01	.	20.2192	0.98319	0.0:1.0:0.0:0.0	.	2597;2597	P78509-2;P78509	.;RELN_HUMAN	K	2597;2597;2597;114;2597	ENSP00000392423:E2597K;ENSP00000345694:E2597K;ENSP00000388446:E2597K	ENSP00000345694:E2597K	E	-	1	0	RELN	102947079	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.461000	0.80834	2.780000	0.95670	0.655000	0.94253	GAA	RELN	-	superfamily_Sialidases	ENSG00000189056		0.408	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	70	0	C	NM_005045		103159843	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	19.86	113	28	SNP	1.000	T
RHPN1	114822	genome.wustl.edu	37	8	144464122	144464122	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:144464122C>G	ENST00000289013.6	+	14	1882	c.1781C>G	c.(1780-1782)tCt>tGt	p.S594C		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	619	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)	p.S594F(2)		endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			CTGCCCAGCTCTAGACTGCCC	0.692																																																	2	Substitution - Missense(2)	endometrium(2)											26.0	38.0	34.0					8																	144464122		2075	4210	6285	SO:0001583	missense	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1781C>G	8.37:g.144464122C>G	ENSP00000289013:p.Ser594Cys		Q8TAV1|Q96PV9	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.S594C	ENST00000289013.6	37	c.1781	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657643	0.47467	.	.	ENSG00000158106	ENST00000289013	T	0.54479	0.57	4.59	2.52	0.30459	.	0.394487	0.21594	N	0.072055	T	0.38692	0.1050	N	0.22421	0.69	0.09310	N	1	P	0.51791	0.948	B	0.44163	0.443	T	0.23619	-1.0183	10	0.62326	D	0.03	-1.6315	9.503	0.39028	0.1518:0.7617:0.0:0.0865	.	594	Q8TCX5-2	.	C	594	ENSP00000289013:S594C	ENSP00000289013:S594C	S	+	2	0	RHPN1	144535265	0.000000	0.05858	0.001000	0.08648	0.043000	0.13939	0.205000	0.17356	0.914000	0.36822	0.462000	0.41574	TCT	RHPN1	-	NULL	ENSG00000158106		0.692	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	HGNC	protein_coding	OTTHUMT00000381417.1	-	0.00	38	0	C			144464122	+1	tier1	-	no_errors	ENST00000289013	ensembl	human	known	74_37	missense	43.52	61	47	SNP	0.022	G
RHPN1	114822	genome.wustl.edu	37	8	144464685	144464685	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr8:144464685C>G	ENST00000289013.6	+	15	1978	c.1877C>G	c.(1876-1878)tCc>tGc	p.S626C		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	651					signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			ACCCCGGCATCCACGTGGGCC	0.697																																																	0													16.0	20.0	19.0					8																	144464685		1909	4112	6021	SO:0001583	missense	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1877C>G	8.37:g.144464685C>G	ENSP00000289013:p.Ser626Cys		Q8TAV1|Q96PV9	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.S626C	ENST00000289013.6	37	c.1877	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	C	8.676	0.903932	0.17760	.	.	ENSG00000158106	ENST00000289013	T	0.54071	0.59	3.47	1.36	0.22044	.	0.766887	0.11433	N	0.564597	T	0.33933	0.0880	N	0.12182	0.205	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.31806	-0.9930	10	0.59425	D	0.04	-5.68	10.7579	0.46247	0.0:0.6312:0.3688:0.0	.	626	Q8TCX5-2	.	C	626	ENSP00000289013:S626C	ENSP00000289013:S626C	S	+	2	0	RHPN1	144535828	0.000000	0.05858	0.007000	0.13788	0.002000	0.02628	0.640000	0.24705	0.741000	0.32674	-0.264000	0.10439	TCC	RHPN1	-	NULL	ENSG00000158106		0.697	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	HGNC	protein_coding	OTTHUMT00000381417.1	-	0.00	15	0	C			144464685	+1	tier1	-	no_errors	ENST00000289013	ensembl	human	known	74_37	missense	39.13	28	18	SNP	0.001	G
RIMBP2	23504	genome.wustl.edu	37	12	130921539	130921539	+	Missense_Mutation	SNP	G	G	T	rs143584336	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:130921539G>T	ENST00000261655.4	-	10	2066	c.1903C>A	c.(1903-1905)Cat>Aat	p.H635N	RIMBP2_ENST00000536002.1_Missense_Mutation_p.H543N|RIMBP2_ENST00000535703.1_Missense_Mutation_p.H543N	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	635	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		ATGTGCCCATGCACAGGGCCA	0.677													G|||	4	0.000798722	0.0	0.0014	5008	,	,		12653	0.0		0.002	False		,,,				2504	0.001																0								G	ASN/HIS	1,4401	2.1+/-5.4	0,1,2200	51.0	47.0	49.0		1903	4.6	0.2	12	dbSNP_134	49	5,8595	4.3+/-15.6	0,5,4295	yes	missense	RIMBP2	NM_015347.4	68	0,6,6495	TT,TG,GG		0.0581,0.0227,0.0461	probably-damaging	635/1053	130921539	6,12996	2201	4300	6501	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1903C>A	12.37:g.130921539G>T	ENSP00000261655:p.His635Asn		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.H635N	ENST00000261655.4	37	c.1903	CCDS31925.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	9.955	1.221122	0.22457	2.27E-4	5.81E-4	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.19105	2.17;2.91;2.91	4.63	4.63	0.57726	.	0.791350	0.11738	N	0.534288	T	0.21347	0.0514	L	0.56769	1.78	0.33499	D	0.589722	P;P;P	0.43094	0.651;0.799;0.534	B;B;B	0.33454	0.057;0.164;0.107	T	0.36817	-0.9732	10	0.17832	T	0.49	-9.9813	17.4987	0.87725	0.0:0.0:1.0:0.0	.	543;543;635	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	N	635;543;543;543	ENSP00000261655:H635N;ENSP00000440347:H543N;ENSP00000439159:H543N	ENSP00000261655:H635N	H	-	1	0	RIMBP2	129487492	1.000000	0.71417	0.211000	0.23655	0.189000	0.23516	6.254000	0.72460	2.121000	0.65114	0.561000	0.74099	CAT	RIMBP2	-	NULL	ENSG00000060709		0.677	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1		0.00	36	0	G	NM_015347		130921539	-1			no_errors	ENST00000261655	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.857	T
RIMKLA	284716	genome.wustl.edu	37	1	42880277	42880277	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:42880277G>T	ENST00000431473.3	+	5	937	c.808G>T	c.(808-810)Gtg>Ttg	p.V270L		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	270	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TGGCTCCTTTGTGGTGTGTGA	0.488																																																	0													352.0	312.0	325.0					1																	42880277		2203	4300	6503	SO:0001583	missense	0			BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.808G>T	1.37:g.42880277G>T	ENSP00000414330:p.Val270Leu		Q5VUS5	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.V270L	ENST00000431473.3	37	c.808	CCDS466.2	1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.582063	0.28180	.	.	ENSG00000177181	ENST00000431473	.	.	.	5.22	3.32	0.38043	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 2 (1);	0.119212	0.56097	D	0.000031	T	0.45377	0.1339	L	0.33485	1.01	0.37031	D	0.896677	B	0.22080	0.064	B	0.28305	0.088	T	0.42032	-0.9475	9	0.38643	T	0.18	-24.5937	9.1907	0.37197	0.1813:0.0:0.8187:0.0	.	270	Q8IXN7	RIMKA_HUMAN	L	270	.	ENSP00000414330:V270L	V	+	1	0	RIMKLA	42652864	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	3.947000	0.56652	0.580000	0.29522	0.555000	0.69702	GTG	RIMKLA	-	pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	ENSG00000177181		0.488	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLA	HGNC	protein_coding	OTTHUMT00000019174.3		0.00	64	0	G	NM_173642		42880277	+1			no_errors	ENST00000431473	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.999	T
SALL1	6299	genome.wustl.edu	37	16	51173802	51173802	+	Silent	SNP	G	G	A	rs144747142	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:51173802G>A	ENST00000251020.4	-	2	2364	c.2331C>T	c.(2329-2331)aaC>aaT	p.N777N	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Silent_p.N680N	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	777					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGACCACAGCGTTCGTGAACT	0.562													G|||	5	0.000998403	0.0	0.0	5008	,	,		19267	0.005		0.0	False		,,,				2504	0.0				GBM(103;1352 1446 1855 4775 8890)												0								G	,	1,4395	2.1+/-5.4	0,1,2197	93.0	95.0	94.0		2040,2331	-1.0	0.6	16	dbSNP_134	94	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	SALL1	NM_001127892.1,NM_002968.2	,	0,3,6495	AA,AG,GG		0.0233,0.0227,0.0231	,	680/1228,777/1325	51173802	3,12993	2198	4300	6498	SO:0001819	synonymous_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2331C>T	16.37:g.51173802G>A			Q99881|Q9NSC3|Q9P1R0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N777	ENST00000251020.4	37	c.2331	CCDS10747.1	16																																																																																			SALL1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000103449		0.562	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	54	0	G	NM_002968		51173802	-1	tier1	rs144747142	no_errors	ENST00000251020	ensembl	human	known	74_37	silent	33.85	43	22	SNP	1.000	A
SCN4B	6330	genome.wustl.edu	37	11	118006753	118006753	+	3'UTR	DEL	G	G	-	rs576946955|rs5795119|rs5795117	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:118006753delG	ENST00000324727.4	-	0	1822				SCN4B_ENST00000423160.2_5'UTR	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit						AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	AGGGCACGGTGGGGGGGGGGG	0.667																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.*989C>-	11.37:g.118006753delG			E9PPT5|Q6PIG5	RNA	DEL	-	NULL	ENST00000324727.4	37	NULL	CCDS8389.1	11																																																																																			SCN4B	-	-	ENSG00000177098		0.667	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN4B	HGNC	protein_coding	OTTHUMT00000392326.1		0.00	14	0	G			118006753	-1	tier1		no_errors	ENST00000423160	ensembl	human	known	74_37	rna	23.33	23	7	DEL	0.004	-
SCUBE3	222663	genome.wustl.edu	37	6	35211826	35211826	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:35211826C>T	ENST00000274938.7	+	17	2158	c.2158C>T	c.(2158-2160)Cgg>Tgg	p.R720W	SCUBE3_ENST00000394681.1_Missense_Mutation_p.R736W	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						TGAAGCAGGACGGACCCTATG	0.557																																																	0													130.0	106.0	114.0					6																	35211826		2203	4300	6503	SO:0001583	missense	0			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2158C>T	6.37:g.35211826C>T	ENSP00000274938:p.Arg720Trp			Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.R736W	ENST00000274938.7	37	c.2206	CCDS4800.1	6	.	.	.	.	.	.	.	.	.	.	C	20.8	4.050634	0.75960	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	T;T	0.15952	2.38;2.38	5.75	5.75	0.90469	Tyrosine-protein kinase ephrin type A/B receptor-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	M	0.92923	3.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.60949	-0.7161	10	0.87932	D	0	.	19.9447	0.97177	0.0:1.0:0.0:0.0	.	736;720	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	W	736;720	ENSP00000378174:R736W;ENSP00000274938:R720W	ENSP00000274938:R720W	R	+	1	2	SCUBE3	35319804	0.437000	0.25593	1.000000	0.80357	0.995000	0.86356	1.058000	0.30504	2.719000	0.93026	0.655000	0.94253	CGG	SCUBE3	-	pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Growth_fac_rcpt_N_dom	ENSG00000146197		0.557	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	HGNC	protein_coding	OTTHUMT00000040275.1	-	0.00	39	0	C	NM_152753		35211826	+1	tier1	-	no_errors	ENST00000394681	ensembl	human	known	74_37	missense	25.45	41	14	SNP	1.000	T
SEC31A	22872	genome.wustl.edu	37	4	83776067	83776067	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr4:83776067G>A	ENST00000395310.2	-	17	2179	c.1997C>T	c.(1996-1998)tCa>tTa	p.S666L	SEC31A_ENST00000355196.2_Missense_Mutation_p.S666L|SEC31A_ENST00000505472.1_Missense_Mutation_p.S666L|SEC31A_ENST00000311785.7_Missense_Mutation_p.S666L|SEC31A_ENST00000432794.1_Missense_Mutation_p.S666L|SEC31A_ENST00000500777.2_Missense_Mutation_p.S627L|SEC31A_ENST00000508479.1_Missense_Mutation_p.S666L|SEC31A_ENST00000513858.1_Missense_Mutation_p.S627L|SEC31A_ENST00000264405.5_Missense_Mutation_p.S399L|SEC31A_ENST00000508502.1_Missense_Mutation_p.S666L|SEC31A_ENST00000448323.1_Missense_Mutation_p.S666L|SEC31A_ENST00000509142.1_Missense_Mutation_p.S666L|SEC31A_ENST00000505984.1_Missense_Mutation_p.S627L|SEC31A_ENST00000443462.2_Missense_Mutation_p.S661L|SEC31A_ENST00000348405.4_Missense_Mutation_p.S627L|SEC31A_ENST00000326950.5_Missense_Mutation_p.S627L	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	666					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)		SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				ACAAAGGGCTGAAAATTCATC	0.343																																																	0													82.0	79.0	80.0					4																	83776067		2203	4300	6503	SO:0001583	missense	0			AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.1997C>T	4.37:g.83776067G>A	ENSP00000378721:p.Ser666Leu		B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S666L	ENST00000395310.2	37	c.1997	CCDS3596.1	4	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657786	0.67586	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479;ENST00000510167	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.40476	1.22;1.09;2.28;2.27;1.15;2.17;2.28;1.22;1.15;1.03;1.09;2.27;2.28;3.07;2.2;2.17;2.15	5.51	5.51	0.81932	.	0.251415	0.41396	D	0.000890	T	0.58278	0.2111	M	0.74647	2.275	0.80722	D	1	B;B;B;B;B;P;B;B;P	0.42010	0.17;0.053;0.304;0.38;0.12;0.721;0.348;0.146;0.768	P;B;B;B;B;P;B;B;P	0.49012	0.472;0.056;0.414;0.373;0.06;0.476;0.189;0.201;0.598	T	0.60835	-0.7184	10	0.59425	D	0.04	-2.2843	19.4176	0.94708	0.0:0.0:1.0:0.0	.	661;627;666;627;627;666;666;666;399	B4DIW6;B7ZL00;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7	.;.;.;.;.;.;.;SC31A_HUMAN;.	L	627;627;666;661;666;666;666;627;666;666;627;666;666;399;627;666;254	ENSP00000337602:S627L;ENSP00000426886:S627L;ENSP00000378721:S666L;ENSP00000408027:S661L;ENSP00000426569:S666L;ENSP00000407944:S666L;ENSP00000400926:S666L;ENSP00000325087:S627L;ENSP00000309070:S666L;ENSP00000421633:S666L;ENSP00000421464:S627L;ENSP00000424635:S666L;ENSP00000347329:S666L;ENSP00000264405:S399L;ENSP00000424451:S627L;ENSP00000425999:S666L;ENSP00000422267:S254L	ENSP00000264405:S399L	S	-	2	0	SEC31A	83995091	1.000000	0.71417	0.284000	0.24805	0.137000	0.21094	9.869000	0.99810	2.596000	0.87737	0.650000	0.86243	TCA	SEC31A	-	NULL	ENSG00000138674		0.343	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEC31A	HGNC	protein_coding	OTTHUMT00000252640.1	-	0.00	58	0	G	NM_016211		83776067	-1	tier1	-	no_errors	ENST00000432794	ensembl	human	known	74_37	missense	67.39	15	31	SNP	0.985	A
SEMA4D	10507	genome.wustl.edu	37	9	91994288	91994288	+	Silent	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:91994288G>T	ENST00000450295.1	-	16	2696	c.1920C>A	c.(1918-1920)gcC>gcA	p.A640A	SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000356444.2_Silent_p.A640A|SEMA4D_ENST00000438547.2_Silent_p.A640A|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000422704.2_Silent_p.A640A|SEMA4D_ENST00000343780.4_Intron			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	640					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GGACGTGCTTGGCGACCACTT	0.512																																																	0													191.0	191.0	191.0					9																	91994288		2203	4300	6503	SO:0001819	synonymous_variant	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1920C>A	9.37:g.91994288G>T			B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.A640	ENST00000450295.1	37	c.1920	CCDS6685.1	9																																																																																			SEMA4D	-	smart_Ig_sub	ENSG00000187764		0.512	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1		0.00	56	0	G	NM_006378		91994288	-1			no_errors	ENST00000356444	ensembl	human	known	74_37	silent	6.15	60	4	SNP	0.925	T
SEMA5A	9037	genome.wustl.edu	37	5	9043022	9043022	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:9043022T>A	ENST00000382496.5	-	23	3877	c.3212A>T	c.(3211-3213)tAt>tTt	p.Y1071F	CTD-2215L10.1_ENST00000506519.1_RNA	NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	1071					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GTACTCATCATAATTATTGAG	0.408																																																	0													181.0	172.0	175.0					5																	9043022		2203	4300	6503	SO:0001583	missense	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.3212A>T	5.37:g.9043022T>A	ENSP00000371936:p.Tyr1071Phe		D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.Y1071F	ENST00000382496.5	37	c.3212	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	T	21.8	4.207978	0.79240	.	.	ENSG00000112902	ENST00000382496	T	0.37235	1.21	5.45	5.45	0.79879	.	0.062754	0.64402	D	0.000003	T	0.29817	0.0745	N	0.14661	0.345	0.47183	D	0.999342	D	0.54397	0.966	P	0.48425	0.577	T	0.14309	-1.0477	10	0.87932	D	0	.	12.206	0.54353	0.0:0.0:0.0:1.0	.	1071	Q13591	SEM5A_HUMAN	F	1071	ENSP00000371936:Y1071F	ENSP00000371936:Y1071F	Y	-	2	0	SEMA5A	9096022	1.000000	0.71417	0.996000	0.52242	0.614000	0.37383	7.155000	0.77445	2.194000	0.70268	0.533000	0.62120	TAT	SEMA5A	-	NULL	ENSG00000112902		0.408	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	-	0.00	69	0	T			9043022	-1	tier1	-	no_errors	ENST00000382496	ensembl	human	known	74_37	missense	42.35	98	72	SNP	1.000	A
SIPA1L2	57568	genome.wustl.edu	37	1	232579369	232579369	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:232579369C>T	ENST00000366630.1	-	11	3774	c.3416G>A	c.(3415-3417)aGa>aAa	p.R1139K	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.R1139K|SIPA1L2_ENST00000308942.4_Missense_Mutation_p.R213K			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1139					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CACTTGTGGTCTCCAGGGTCC	0.507																																																	0													83.0	93.0	90.0					1																	232579369		1915	4127	6042	SO:0001583	missense	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3416G>A	1.37:g.232579369C>T	ENSP00000355589:p.Arg1139Lys		Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.R1139K	ENST00000366630.1	37	c.3416	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.345338	0.61073	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.77750	-1.12;-1.12;2.87	5.75	5.75	0.90469	.	0.131822	0.53938	D	0.000054	T	0.80014	0.4546	M	0.67397	2.05	0.34829	D	0.739506	B;P	0.46859	0.2;0.885	B;P	0.44946	0.036;0.465	D	0.84743	0.0752	10	0.39692	T	0.17	-30.3068	18.1467	0.89659	0.0:1.0:0.0:0.0	.	1139;213	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	K	1139;1139;213	ENSP00000355589:R1139K;ENSP00000262861:R1139K;ENSP00000309102:R213K	ENSP00000262861:R1139K	R	-	2	0	SIPA1L2	230645992	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.934000	0.56553	2.701000	0.92244	0.650000	0.86243	AGA	SIPA1L2	-	NULL	ENSG00000116991		0.507	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	-	0.00	22	0	C	XM_045839		232579369	-1	tier1	-	no_errors	ENST00000262861	ensembl	human	known	74_37	missense	16.07	47	9	SNP	1.000	T
SLA2	84174	genome.wustl.edu	37	20	35242308	35242308	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:35242308G>C	ENST00000262866.4	-	8	1169	c.747C>G	c.(745-747)atC>atG	p.I249M	SLA2_ENST00000360672.2_3'UTR	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	249	SLA C-terminal.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CATTCAGGCTGATGTAGAAGC	0.542																																					Ovarian(59;720 1165 26994 46188 51693)												0													79.0	73.0	75.0					20																	35242308		2203	4300	6503	SO:0001583	missense	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.747C>G	20.37:g.35242308G>C	ENSP00000262866:p.Ile249Met		A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.I249M	ENST00000262866.4	37	c.747	CCDS13282.1	20	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987112	0.35036	.	.	ENSG00000101082	ENST00000262866	T	0.78816	-1.21	5.35	3.38	0.38709	.	0.293591	0.37577	N	0.002039	T	0.67458	0.2895	L	0.42245	1.32	0.80722	D	1	B	0.18013	0.025	B	0.18263	0.021	T	0.62651	-0.6809	10	0.46703	T	0.11	-11.2037	7.7637	0.28968	0.0866:0.1623:0.7511:0.0	.	249	Q9H6Q3	SLAP2_HUMAN	M	249	ENSP00000262866:I249M	ENSP00000262866:I249M	I	-	3	3	SLA2	34675722	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	1.240000	0.32731	0.915000	0.36847	0.655000	0.94253	ATC	SLA2	-	NULL	ENSG00000101082		0.542	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	-	0.00	40	0	G	NM_175077		35242308	-1	tier1	-	no_errors	ENST00000262866	ensembl	human	known	74_37	missense	37.10	39	23	SNP	1.000	C
SLA2	84174	genome.wustl.edu	37	20	35242375	35242375	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:35242375G>C	ENST00000262866.4	-	8	1102	c.680C>G	c.(679-681)tCt>tGt	p.S227C	SLA2_ENST00000360672.2_Missense_Mutation_p.F210L	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	227	SLA C-terminal.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GGCAGCTTCAGAAAACAGGAG	0.502																																					Ovarian(59;720 1165 26994 46188 51693)												0													67.0	65.0	66.0					20																	35242375		2203	4300	6503	SO:0001583	missense	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.680C>G	20.37:g.35242375G>C	ENSP00000262866:p.Ser227Cys		A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.S227C	ENST00000262866.4	37	c.680	CCDS13282.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.885|8.885	0.952692|0.952692	0.18431|0.18431	.|.	.|.	ENSG00000101082|ENSG00000101082	ENST00000360672|ENST00000262866	T|T	0.73681|0.79247	-0.77|-1.25	5.11|5.11	2.67|2.67	0.31697|0.31697	.|.	.|1.366640	.|0.04347	.|N	.|0.355095	T|T	0.78559|0.78559	0.4302|0.4302	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|D	0.02656|0.59357	0.0|0.985	B|P	0.04013|0.50490	0.001|0.642	T|T	0.61496|0.61496	-0.7051|-0.7051	8|9	0.87932|0.72032	D|D	0|0.01	1.2618|1.2618	5.0814|5.0814	0.14659|0.14659	0.1487:0.1916:0.6597:0.0|0.1487:0.1916:0.6597:0.0	.|.	210|227	Q9H6Q3-2|Q9H6Q3	.|SLAP2_HUMAN	L|C	210|227	ENSP00000353890:F210L|ENSP00000262866:S227C	ENSP00000353890:F210L|ENSP00000262866:S227C	F|S	-|-	3|2	2|0	SLA2|SLA2	34675789|34675789	0.459000|0.459000	0.25768|0.25768	0.014000|0.014000	0.15608|0.15608	0.832000|0.832000	0.47134|0.47134	1.983000|1.983000	0.40648|0.40648	0.571000|0.571000	0.29365|0.29365	0.655000|0.655000	0.94253|0.94253	TTC|TCT	SLA2	-	NULL	ENSG00000101082		0.502	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	-	0.00	39	0	G	NM_175077		35242375	-1	tier1	-	no_errors	ENST00000262866	ensembl	human	known	74_37	missense	22.50	31	9	SNP	0.029	C
SLA2	84174	genome.wustl.edu	37	20	35242776	35242776	+	Silent	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:35242776G>C	ENST00000262866.4	-	7	1019	c.597C>G	c.(595-597)ctC>ctG	p.L199L	SLA2_ENST00000360672.2_Missense_Mutation_p.P183A	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	199	SLA C-terminal.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				CCTTGCCAGGGAGCGGGCCAG	0.562																																					Ovarian(59;720 1165 26994 46188 51693)												0													136.0	126.0	129.0					20																	35242776		2203	4300	6503	SO:0001819	synonymous_variant	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.597C>G	20.37:g.35242776G>C			A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.P183A	ENST00000262866.4	37	c.547	CCDS13282.1	20	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002209	0.35320	.	.	ENSG00000101082	ENST00000360672	T	0.74106	-0.81	5.43	-0.479	0.12089	.	.	.	.	.	T	0.58906	0.2155	.	.	.	0.09310	N	1	B	0.30914	0.3	B	0.27608	0.081	T	0.52162	-0.8612	8	0.87932	D	0	-0.457	4.6846	0.12752	0.3974:0.0:0.4502:0.1524	.	183	Q9H6Q3-2	.	A	183	ENSP00000353890:P183A	ENSP00000353890:P183A	P	-	1	0	SLA2	34676190	0.003000	0.15002	0.190000	0.23270	0.873000	0.50193	-0.181000	0.09740	0.060000	0.16281	0.655000	0.94253	CCC	SLA2	-	NULL	ENSG00000101082		0.562	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	-	0.00	72	0	G	NM_175077		35242776	-1	tier1	-	no_errors	ENST00000360672	ensembl	human	known	74_37	missense	25.86	86	30	SNP	0.056	C
SLA2	84174	genome.wustl.edu	37	20	35242812	35242812	+	Silent	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:35242812G>C	ENST00000262866.4	-	7	983	c.561C>G	c.(559-561)ctC>ctG	p.L187L	SLA2_ENST00000360672.2_Intron	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	187	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)	p.L187L(1)		endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				AGGGCTCCTTGAGTAGGCAGC	0.587																																					Ovarian(59;720 1165 26994 46188 51693)												1	Substitution - coding silent(1)	endometrium(1)											112.0	100.0	104.0					20																	35242812		2203	4300	6503	SO:0001819	synonymous_variant	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.561C>G	20.37:g.35242812G>C			A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Silent	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.L187	ENST00000262866.4	37	c.561	CCDS13282.1	20																																																																																			SLA2	-	pfscan_SH2	ENSG00000101082		0.587	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	-	0.00	61	0	G	NM_175077		35242812	-1	tier1	-	no_errors	ENST00000262866	ensembl	human	known	74_37	silent	27.06	62	23	SNP	0.996	C
SLA2	84174	genome.wustl.edu	37	20	35242824	35242824	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:35242824G>C	ENST00000262866.4	-	7	971	c.549C>G	c.(547-549)atC>atG	p.I183M	SLA2_ENST00000360672.2_Intron	NM_032214.3|NM_175077.2	NP_115590.1|NP_778252.1	Q9H6Q3	SLAP2_HUMAN	Src-like-adaptor 2	183	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				antigen receptor-mediated signaling pathway (GO:0050851)|B cell mediated immunity (GO:0019724)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of B cell activation (GO:0050869)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of signal transduction (GO:0009967)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|late endosome (GO:0005770)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|skin(2)	5	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				GTAGGCAGCAGATGTCATCCG	0.592																																					Ovarian(59;720 1165 26994 46188 51693)												0													104.0	92.0	96.0					20																	35242824		2203	4300	6503	SO:0001583	missense	0			AF326353	CCDS13282.1, CCDS13283.1	20q11.23	2013-02-14			ENSG00000101082	ENSG00000101082		"""SH2 domain containing"""	17329	protein-coding gene	gene with protein product		606577		C20orf156		11696592	Standard	NM_032214		Approved	FLJ21992, SLAP-2	uc002xfv.3	Q9H6Q3	OTTHUMG00000032393	ENST00000262866.4:c.549C>G	20.37:g.35242824G>C	ENSP00000262866:p.Ile183Met		A8K648|E1P5U1|E1P5U2|Q5TH27|Q5TH28|Q8WY18|Q96QI4|Q9H135	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.I183M	ENST00000262866.4	37	c.549	CCDS13282.1	20	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451269	0.63290	.	.	ENSG00000101082	ENST00000262866	T	0.31510	1.49	5.43	4.45	0.53987	SH2 motif (2);	0.138874	0.49305	D	0.000141	T	0.34629	0.0904	L	0.39326	1.205	0.80722	D	1	P	0.51057	0.941	P	0.54460	0.753	T	0.14615	-1.0466	10	0.87932	D	0	-24.6991	6.5218	0.22279	0.0879:0.0:0.7308:0.1812	.	183	Q9H6Q3	SLAP2_HUMAN	M	183	ENSP00000262866:I183M	ENSP00000262866:I183M	I	-	3	3	SLA2	34676238	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.105000	0.31086	1.454000	0.47793	0.655000	0.94253	ATC	SLA2	-	pfscan_SH2	ENSG00000101082		0.592	SLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA2	HGNC	protein_coding	OTTHUMT00000079037.2	-	0.00	59	0	G	NM_175077		35242824	-1	tier1	-	no_errors	ENST00000262866	ensembl	human	known	74_37	missense	26.32	56	20	SNP	1.000	C
SLAMF6	114836	genome.wustl.edu	37	1	160465850	160465850	+	Splice_Site	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:160465850C>G	ENST00000368057.3	-	2	443		c.e2+1		SLAMF6_ENST00000368059.3_Splice_Site|SLAMF6_ENST00000368055.1_Intron			Q96DU3	SLAF6_HUMAN	SLAM family member 6							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			TTTTGACTTACTTAATATCCT	0.408																																																	0													93.0	95.0	95.0					1																	160465850		2203	4300	6503	SO:0001630	splice_region_variant	0			AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.382+1G>C	1.37:g.160465850C>G			A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Splice_Site	SNP	-	e2+1	ENST00000368057.3	37	c.382+1	CCDS53394.1	1	.	.	.	.	.	.	.	.	.	.	C	13.11	2.139949	0.37728	.	.	ENSG00000162739	ENST00000368059;ENST00000368057	.	.	.	4.65	4.65	0.58169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2187	0.59875	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLAMF6	158732474	0.912000	0.30974	0.938000	0.37757	0.020000	0.10135	1.892000	0.39748	2.577000	0.86979	0.655000	0.94253	.	SLAMF6	-	-	ENSG00000162739		0.408	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLAMF6	HGNC	protein_coding	OTTHUMT00000059010.1	-	0.00	80	0	C	NM_052931	Intron	160465850	-1	tier1	-	no_errors	ENST00000368057	ensembl	human	known	74_37	splice_site	20.93	102	27	SNP	0.956	G
SLC12A5	57468	genome.wustl.edu	37	20	44674582	44674582	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:44674582C>T	ENST00000454036.2	+	13	1753	c.1704C>T	c.(1702-1704)tgC>tgT	p.C568C	SLC12A5_ENST00000243964.3_Silent_p.C545C	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	568					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCTGCATCTGCGAGATTGGCA	0.592																																																	0													141.0	120.0	127.0					20																	44674582		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.1704C>T	20.37:g.44674582C>T			A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.C568	ENST00000454036.2	37	c.1704	CCDS46610.1	20																																																																																			SLC12A5	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.592	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	-	0.00	37	0	C			44674582	+1	tier1	-	no_errors	ENST00000454036	ensembl	human	known	74_37	silent	34.57	53	28	SNP	0.885	T
SMARCA2	6595	genome.wustl.edu	37	9	2056795	2056795	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:2056795G>T	ENST00000382203.1	+	7	1506	c.1297G>T	c.(1297-1299)Gag>Tag	p.E433*	SMARCA2_ENST00000357248.2_Nonsense_Mutation_p.E433*|SMARCA2_ENST00000349721.2_Nonsense_Mutation_p.E433*|SMARCA2_ENST00000382194.1_Nonsense_Mutation_p.E433*			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	433					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CGAGAAGCTGGAGAAGCAGCA	0.557																																																	0													82.0	77.0	78.0					9																	2056795		2203	4300	6503	SO:0001587	stop_gained	0			D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1297G>T	9.37:g.2056795G>T	ENSP00000371638:p.Glu433*		B1ALG3|B1ALG4|D3DRH4|D3DRH5	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.E433*	ENST00000382203.1	37	c.1297	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	G	38	7.140863	0.98092	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000382203;ENST00000382194	.	.	.	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-31.4145	18.2849	0.90111	0.0:0.0:1.0:0.0	.	.	.	.	X	433	.	ENSP00000265773:E433X	E	+	1	0	SMARCA2	2046795	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.832000	0.99423	2.403000	0.81681	0.655000	0.94253	GAG	SMARCA2	-	NULL	ENSG00000080503		0.557	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	HGNC	protein_coding	OTTHUMT00000051505.1	-	0.00	68	0	G	NM_003070		2056795	+1	tier1	-	no_errors	ENST00000349721	ensembl	human	known	74_37	nonsense	9.30	39	4	SNP	1.000	T
SNORD3D	780854	genome.wustl.edu	37	17	19015811	19015811	+	lincRNA	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:19015811A>G	ENST00000362793.1	-	0	138									small nucleolar RNA, C/D box 3D																		cggcagttgcagccaagcaac	0.517																																																	0																																												0					17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015811A>G				RNA	SNP	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			SNORD3D	-	-	ENSG00000262202		0.517	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	HGNC	lincRNA		-	0.00	14	0	A	NR_006882		19015811	-1	tier1	-	no_errors	ENST00000362793	ensembl	human	known	74_37	rna	54.55	5	6	SNP	0.004	G
SNORD3D	780854	genome.wustl.edu	37	17	19015833	19015833	+	lincRNA	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:19015833G>A	ENST00000362793.1	-	0	116									small nucleolar RNA, C/D box 3D																		ccagaaagccggcttcacgct	0.512																																																	0													4.0	6.0	6.0					17																	19015833		732	1829	2561			0					17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015833G>A				RNA	SNP	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			SNORD3D	-	-	ENSG00000262202		0.512	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	HGNC	lincRNA		-	0.00	13	0	G	NR_006882		19015833	-1	tier1	-	no_errors	ENST00000362793	ensembl	human	known	74_37	rna	77.78	2	7	SNP	0.042	A
SNX13	23161	genome.wustl.edu	37	7	17929992	17929993	+	Missense_Mutation	DNP	GC	GC	CT			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:17929992_17929993GC>CT	ENST00000409389.1	-	5	605_606	c.433_434GC>AG	c.(433-435)GCt>AGt	p.A145S	SNX13_ENST00000409604.1_Missense_Mutation_p.A145S|SNX13_ENST00000428135.3_Missense_Mutation_p.A145S			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	145	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TTACCTAGTAGCAAACTGAATG	0.347																																																	0																																										SO:0001583	missense	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.433_434delinsCT	7.37:g.17929992_17929993delinsCT	ENSP00000386705:p.Ala145Ser		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,superfamily_Cyt_c_oxidase_su5A/6,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.A145G|p.A145T	ENST00000409389.1	37	c.434|c.433		7																																																																																			SNX13	-	pfam_Phox_assoc,superfamily_Cyt_c_oxidase_su5A/6,smart_PX_assoc_Snx13,pfscan_Phox_assoc	ENSG00000071189		0.347	SNX13-002	NOVEL	basic|exp_conf	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327608.1	-	0.00	43|42	0	G|C	NM_015132		17929992|17929993	-1	tier1	-	no_errors	ENST00000428135	ensembl	human	known	74_37	missense	55.17|52.63	26|27	32|30	SNP	1.000	C|T
SP3	6670	genome.wustl.edu	37	2	174774748	174774748	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr2:174774748G>C	ENST00000310015.6	-	7	2797	c.2267C>G	c.(2266-2268)aCc>aGc	p.T756S	SP3_ENST00000455789.2_Missense_Mutation_p.T703S|SP3_ENST00000418194.2_Missense_Mutation_p.T688S	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	756					B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			TTGATTGCTGGTGGCGGAAGT	0.378																																																	0													115.0	107.0	110.0					2																	174774748		2203	4300	6503	SO:0001583	missense	0			M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.2267C>G	2.37:g.174774748G>C	ENSP00000310301:p.Thr756Ser		A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Galactose-bd-like,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T756S	ENST00000310015.6	37	c.2267	CCDS2254.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.37|10.37	1.331756|1.331756	0.24167|0.24167	.|.	.|.	ENSG00000172845|ENSG00000172845	ENST00000416195|ENST00000310015;ENST00000455789;ENST00000418194	.|T;T;T	.|0.04809	.|3.55;3.55;3.55	5.58|5.58	4.7|4.7	0.59300|0.59300	.|.	.|0.237699	.|0.41500	.|D	.|0.000864	T|T	0.04770|0.04770	0.0129|0.0129	L|L	0.36672|0.36672	1.1|1.1	0.36847|0.36847	D|D	0.887681|0.887681	.|B;B;B	.|0.19583	.|0.037;0.037;0.023	.|B;B;B	.|0.15484	.|0.01;0.01;0.013	T|T	0.32134|0.32134	-0.9918|-0.9918	5|10	.|0.09590	.|T	.|0.72	.|.	14.8518|14.8518	0.70303|0.70303	0.0702:0.0:0.9298:0.0|0.0702:0.0:0.9298:0.0	.|.	.|753;756;703	.|B7ZLN9;Q02447;Q02447-6	.|.;SP3_HUMAN;.	A|S	713|756;703;688	.|ENSP00000310301:T756S;ENSP00000388903:T703S;ENSP00000406140:T688S	.|ENSP00000310301:T756S	P|T	-|-	1|2	0|0	SP3|SP3	174482994|174482994	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	4.316000|4.316000	0.59178|0.59178	2.632000|2.632000	0.89209|0.89209	0.655000|0.655000	0.94253|0.94253	CCA|ACC	SP3	-	NULL	ENSG00000172845		0.378	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP3	HGNC	protein_coding	OTTHUMT00000255452.1	-	0.00	34	0	G	NM_003111		174774748	-1	tier1	-	no_errors	ENST00000310015	ensembl	human	known	74_37	missense	34.38	21	11	SNP	1.000	C
SPATA31E1	286234	genome.wustl.edu	37	9	90502183	90502183	+	Silent	SNP	G	G	A	rs556337873		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:90502183G>A	ENST00000325643.5	+	4	2847	c.2781G>A	c.(2779-2781)caG>caA	p.Q927Q		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	927					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CGCCTGAGCAGGAGGGAGTCC	0.617																																																	0													44.0	47.0	46.0					9																	90502183		2201	4299	6500	SO:0001819	synonymous_variant	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2781G>A	9.37:g.90502183G>A			B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	NULL	p.Q927	ENST00000325643.5	37	c.2781	CCDS6676.1	9																																																																																			SPATA31E1	-	NULL	ENSG00000177992		0.617	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	-	0.00	13	0	G	NM_178828		90502183	+1	tier1	-	no_errors	ENST00000325643	ensembl	human	known	74_37	silent	41.67	21	15	SNP	0.000	A
SPDYC	387778	genome.wustl.edu	37	11	64938815	64938815	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:64938815C>T	ENST00000377185.2	+	2	126	c.44C>T	c.(43-45)tCc>tTc	p.S15F	AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C											breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						TGCCCCATCTCCATCTCCTAT	0.592																																																	0													95.0	96.0	96.0					11																	64938815		2201	4297	6498	SO:0001583	missense	0			AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.44C>T	11.37:g.64938815C>T	ENSP00000366390:p.Ser15Phe			Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.S15F	ENST00000377185.2	37	c.44	CCDS31606.1	11	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605582	0.28623	.	.	ENSG00000204710	ENST00000377185	.	.	.	3.95	2.07	0.26955	.	.	.	.	.	T	0.25680	0.0625	N	0.19112	0.55	0.09310	N	0.999993	B	0.11235	0.004	B	0.06405	0.002	T	0.19811	-1.0294	8	0.54805	T	0.06	.	5.6544	0.17635	0.0:0.7505:0.0:0.2495	.	15	Q5MJ68	SPDYC_HUMAN	F	15	.	ENSP00000366390:S15F	S	+	2	0	SPDYC	64695391	0.000000	0.05858	0.051000	0.19133	0.098000	0.18820	0.461000	0.21940	0.343000	0.23821	0.591000	0.81541	TCC	SPDYC	-	NULL	ENSG00000204710		0.592	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYC	HGNC	protein_coding	OTTHUMT00000385299.1	-	0.00	30	0	C	NM_001008778		64938815	+1	tier1	-	no_errors	ENST00000377185	ensembl	human	known	74_37	missense	58.14	18	25	SNP	0.353	T
SRCAP	10847	genome.wustl.edu	37	16	30734343	30734343	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:30734343C>T	ENST00000262518.4	+	24	4337	c.3952C>T	c.(3952-3954)Cgg>Tgg	p.R1318W	SRCAP_ENST00000395059.2_Missense_Mutation_p.R1256W|SRCAP_ENST00000344771.4_Missense_Mutation_p.R1160W	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1318	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ACAAGCCCCTCGGGATGGACT	0.557																																																	0													98.0	97.0	97.0					16																	30734343		2197	4300	6497	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3952C>T	16.37:g.30734343C>T	ENSP00000262518:p.Arg1318Trp		B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.R1318W	ENST00000262518.4	37	c.3952	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194598	0.38806	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92149	-2.98;-2.86;-2.85	5.83	3.68	0.42216	.	0.000000	0.50627	D	0.000111	D	0.91851	0.7421	N	0.19112	0.55	0.23506	N	0.997534	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70016	0.967;0.967;0.928	D	0.86155	0.1590	10	0.87932	D	0	-14.675	14.0034	0.64446	0.2855:0.7145:0.0:0.0	.	1160;1256;1318	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	W	1318;1256;1160	ENSP00000262518:R1318W;ENSP00000378499:R1256W;ENSP00000343042:R1160W	ENSP00000262518:R1318W	R	+	1	2	SRCAP	30641844	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.209000	0.42806	1.454000	0.47793	0.655000	0.94253	CGG	SRCAP	-	NULL	ENSG00000080603		0.557	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	-	0.00	46	0	C	NM_006662		30734343	+1	tier1	-	no_errors	ENST00000262518	ensembl	human	known	74_37	missense	21.33	59	16	SNP	1.000	T
SSPO	23145	genome.wustl.edu	37	7	149512296	149512296	+	RNA	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr7:149512296G>C	ENST00000378016.2	+	0	10616							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CATCCCTGTGGGCAGCCCTGC	0.667																																																	0													34.0	41.0	39.0					7																	149512296		2021	4163	6184			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149512296G>C			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.667	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	29	0	G			149512296	+1	tier1	-	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	25.68	55	19	SNP	1.000	C
SUPV3L1	6832	genome.wustl.edu	37	10	70968804	70968805	+	3'UTR	INS	-	-	T	rs372365210|rs35757450|rs373514760	byFrequency	TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr10:70968804_70968805insT	ENST00000359655.4	+	0	2434_2435					NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)						ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTCTGTTCCTGttttttttttt	0.337																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.*14->T	10.37:g.70968815_70968815dupT			A8K301|O43630	RNA	INS	-	NULL	ENST00000359655.4	37	NULL	CCDS7287.1	10																																																																																			SUPV3L1	-	-	ENSG00000156502		0.337	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPV3L1	HGNC	protein_coding	OTTHUMT00000048396.2		0.00	9	0	-	NM_003171		70968805	+1	tier1		no_errors	ENST00000497254	ensembl	human	known	74_37	rna	28.57	10	4	INS	0.013:0.002	T
SWT1	54823	genome.wustl.edu	37	1	185144184	185144184	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:185144184G>A	ENST00000367500.4	+	5	1070	c.905G>A	c.(904-906)cGa>cAa	p.R302Q	SWT1_ENST00000367501.3_Missense_Mutation_p.R302Q	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	302								p.R302Q(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						GAGTGGAAACGAAAACATCAT	0.348																																																	1	Substitution - Missense(1)	large_intestine(1)											38.0	40.0	39.0					1																	185144184		2203	4298	6501	SO:0001583	missense	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.905G>A	1.37:g.185144184G>A	ENSP00000356470:p.Arg302Gln		Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	smart_PIN_dom	p.R302Q	ENST00000367500.4	37	c.905	CCDS1367.1	1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270761	0.40194	.	.	ENSG00000116668	ENST00000367501;ENST00000367500	T;T	0.17213	2.29;2.29	5.76	2.41	0.29592	.	0.964631	0.08608	N	0.920449	T	0.10680	0.0261	L	0.34521	1.04	0.09310	N	1	B	0.29115	0.233	B	0.17098	0.017	T	0.36529	-0.9744	10	0.13108	T	0.6	.	6.0281	0.19665	0.3842:0.0:0.6158:0.0	.	302	Q5T5J6	SWT1_HUMAN	Q	302	ENSP00000356471:R302Q;ENSP00000356470:R302Q	ENSP00000356470:R302Q	R	+	2	0	SWT1	183410807	0.006000	0.16342	0.055000	0.19348	0.454000	0.32378	0.320000	0.19540	0.638000	0.30545	0.650000	0.86243	CGA	SWT1	-	NULL	ENSG00000116668		0.348	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1	-	0.00	45	0	G	NM_017673		185144184	+1	tier1	-	no_errors	ENST00000367500	ensembl	human	known	74_37	missense	29.69	45	19	SNP	0.104	A
TADA2B	93624	genome.wustl.edu	37	4	7056084	7056084	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr4:7056084C>G	ENST00000310074.7	+	2	755	c.566C>G	c.(565-567)tCt>tGt	p.S189C	TADA2B_ENST00000512388.1_Missense_Mutation_p.S114C|TADA2B_ENST00000515646.1_Missense_Mutation_p.S97C	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	189					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						AGCGGGCTCTCTGTCAACTAT	0.577																																																	0													48.0	51.0	50.0					4																	7056084		2026	4199	6225	SO:0001583	missense	0			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.566C>G	4.37:g.7056084C>G	ENSP00000308022:p.Ser189Cys		A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.S189C	ENST00000310074.7	37	c.566	CCDS47007.1	4	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864760	0.32977	.	.	ENSG00000173011	ENST00000506692;ENST00000310074;ENST00000512388;ENST00000515646;ENST00000510704	T;T;T;T;T	0.47528	0.84;0.86;0.86;0.86;0.86	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.44307	0.1287	L	0.54323	1.7	0.80722	D	1	P;B	0.38167	0.621;0.068	B;B	0.30251	0.113;0.031	T	0.51076	-0.8751	10	0.59425	D	0.04	-18.2	18.9307	0.92564	0.0:1.0:0.0:0.0	.	114;189	Q86TJ2-2;Q86TJ2	.;TAD2B_HUMAN	C	97;189;114;97;97	ENSP00000422398:S97C;ENSP00000308022:S189C;ENSP00000423947:S114C;ENSP00000423181:S97C;ENSP00000425731:S97C	ENSP00000308022:S189C	S	+	2	0	TADA2B	7106985	1.000000	0.71417	1.000000	0.80357	0.141000	0.21300	5.690000	0.68241	2.481000	0.83766	0.561000	0.74099	TCT	TADA2B	-	pirsf_Transcriptional_adaptor_2	ENSG00000173011		0.577	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2	-	0.00	17	0	C	NM_152293		7056084	+1	tier1	-	no_errors	ENST00000310074	ensembl	human	known	74_37	missense	72.73	3	8	SNP	1.000	G
TAOK3	51347	genome.wustl.edu	37	12	118693355	118693355	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:118693355C>T	ENST00000392533.3	-	3	508	c.18G>A	c.(16-18)ctG>ctA	p.L6L	TAOK3_ENST00000419821.2_Silent_p.L6L	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3	6					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGGGTCCTTCAGCACCCCTT	0.398																																																	0													135.0	135.0	135.0					12																	118693355		2203	4300	6503	SO:0001819	synonymous_variant	0			AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.18G>A	12.37:g.118693355C>T			Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L6	ENST00000392533.3	37	c.18	CCDS9188.1	12																																																																																			TAOK3	-	NULL	ENSG00000135090		0.398	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK3	HGNC	protein_coding	OTTHUMT00000401456.2	-	0.00	40	0	C	NM_016281		118693355	-1	tier1	-	no_errors	ENST00000392533	ensembl	human	known	74_37	silent	55.10	22	27	SNP	0.393	T
TARBP1	6894	genome.wustl.edu	37	1	234534112	234534112	+	Intron	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:234534112G>T	ENST00000040877.1	-	26	4243				TARBP1_ENST00000483404.1_Intron	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1						regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			AAAATAAAATGAAAATTATTT	0.338																																																	0													36.0	39.0	38.0					1																	234534112		2196	4297	6493	SO:0001627	intron_variant	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4243+15C>A	1.37:g.234534112G>T			Q9H581	RNA	SNP	-	NULL	ENST00000040877.1	37	NULL	CCDS1601.1	1																																																																																			TARBP1	-	-	ENSG00000059588		0.338	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	-	0.00	29	0	G	NM_005646		234534112	-1	tier1	-	no_errors	ENST00000484454	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.001	T
TENM2	57451	genome.wustl.edu	37	5	167517587	167517587	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr5:167517587C>T	ENST00000518659.1	+	8	1563	c.1524C>T	c.(1522-1524)ttC>ttT	p.F508F	TENM2_ENST00000519204.1_Silent_p.F387F|TENM2_ENST00000545108.1_Silent_p.F508F|TENM2_ENST00000520394.1_Silent_p.F276F|CTB-178M22.1_ENST00000517408.1_RNA|TENM2_ENST00000403607.2_Silent_p.F341F	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	508					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										AGTATGACTTCATGGAACGTC	0.522																																																	0													125.0	124.0	124.0					5																	167517587		2026	4177	6203	SO:0001819	synonymous_variant	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.1524C>T	5.37:g.167517587C>T			Q9ULU2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.F508	ENST00000518659.1	37	c.1524		5																																																																																			TENM2	-	NULL	ENSG00000145934		0.522	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	-	0.00	112	0	C	NM_001122679		167517587	+1	tier1	-	no_errors	ENST00000518659	ensembl	human	known	74_37	silent	54.90	46	56	SNP	1.000	T
TMEM132D	121256	genome.wustl.edu	37	12	130184990	130184991	+	Missense_Mutation	DNP	CA	CA	AC			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C|A	C|A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr12:130184990_130184991CA>AC	ENST00000422113.2	-	2	658_659	c.332_333TG>GT	c.(331-333)aTG>aGT	p.M111S	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	111					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGGAAGGTAGCATTAAATCCTG	0.5																																																	0																																										SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.332_333delinsAC	12.37:g.130184990_130184991delinsAC	ENSP00000408581:p.Met111Ser		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.M111I|p.M111R	ENST00000422113.2	37	c.333|c.332	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.500	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	45	0	C|A	NM_133448		130184990|130184991	-1	tier1	-	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	40.82|42.00	29	20|21	SNP	0.976|0.977	A|C
TOX3	27324	genome.wustl.edu	37	16	52473227	52473227	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr16:52473227G>C	ENST00000219746.9	-	7	1925	c.1641C>G	c.(1639-1641)atC>atG	p.I547M	TOX3_ENST00000407228.3_Missense_Mutation_p.I542M	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	547	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						GGGGGCTCCCGATGGCAGGGA	0.557																																																	0													27.0	30.0	29.0					16																	52473227		2035	4201	6236	SO:0001583	missense	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1641C>G	16.37:g.52473227G>C	ENSP00000219746:p.Ile547Met		B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.I547M	ENST00000219746.9	37	c.1641	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	G	9.819	1.185164	0.21870	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.12672	2.68;2.66	5.99	-5.37	0.02681	.	0.368223	0.28252	N	0.016038	T	0.08846	0.0219	N	0.19112	0.55	0.26326	N	0.977592	P;P	0.43477	0.808;0.497	B;B	0.40702	0.338;0.139	T	0.12142	-1.0559	10	0.72032	D	0.01	.	16.5019	0.84259	0.6868:0.0:0.3132:0.0	.	542;547	B4DRD0;O15405	.;TOX3_HUMAN	M	547;542	ENSP00000219746:I547M;ENSP00000385705:I542M	ENSP00000219746:I547M	I	-	3	3	TOX3	51030728	0.006000	0.16342	0.795000	0.32087	0.986000	0.74619	-0.552000	0.06020	-0.886000	0.03966	-0.137000	0.14449	ATC	TOX3	-	NULL	ENSG00000103460		0.557	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	-	0.00	63	0	G	XM_049037		52473227	-1	tier1	-	no_errors	ENST00000219746	ensembl	human	known	74_37	missense	48.57	36	34	SNP	0.341	C
TP53	7157	genome.wustl.edu	37	17	7579315	7579315	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr17:7579315G>T	ENST00000269305.4	-	4	561	c.372C>A	c.(370-372)tgC>tgA	p.C124*	TP53_ENST00000445888.2_Nonsense_Mutation_p.C124*|TP53_ENST00000420246.2_Nonsense_Mutation_p.C124*|TP53_ENST00000359597.4_Nonsense_Mutation_p.C124*|TP53_ENST00000413465.2_Nonsense_Mutation_p.C124*|TP53_ENST00000455263.2_Nonsense_Mutation_p.C124*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	124	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> G (in a sporadic cancer; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in a sporadic cancer; somatic mutation).|C -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.C124*(3)|p.G59fs*23(3)|p.C124fs*1(1)|p.V73fs*9(1)|p.G105_T125del21(1)|p.Y107fs*44(1)|p.T125fs*24(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACTGACCGTGCAAGTCACAG	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	21	Whole gene deletion(8)|Deletion - Frameshift(8)|Substitution - Nonsense(3)|Deletion - In frame(1)|Insertion - Frameshift(1)	lung(5)|upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(2)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|ovary(1)											66.0	61.0	63.0					17																	7579315		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.372C>A	17.37:g.7579315G>T	ENSP00000269305:p.Cys124*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C124*	ENST00000269305.4	37	c.372	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.183644	0.94885	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.75	3.77	0.43336	.	0.099990	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.7577	13.0886	0.59154	0.0:0.1626:0.8374:0.0	.	.	.	.	X	124;124;124;124;124;124;113;124;124	.	ENSP00000269305:C124X	C	-	3	2	TP53	7520040	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.834000	0.27518	1.343000	0.45638	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	262	0	G	NM_000546		7579315	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	77.96	67	237	SNP	1.000	T
TREM1	54210	genome.wustl.edu	37	6	41250446	41250446	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:41250446C>T	ENST00000244709.4	-	2	156	c.93G>A	c.(91-93)ctG>ctA	p.L31L	TREM1_ENST00000334475.6_Silent_p.L31L|TREM1_ENST00000591620.1_Silent_p.L31L|TREM1_ENST00000589614.1_Silent_p.L31L	NM_018643.3	NP_061113.1	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	31	Ig-like V-type.				blood coagulation (GO:0007596)|chemokine metabolic process (GO:0050755)|cytokine secretion involved in immune response (GO:0002374)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			NS(1)|breast(2)|endometrium(2)|large_intestine(5)|lung(5)|skin(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCCCCTCTTTCAGTTCATACT	0.453																																																	0													102.0	108.0	106.0					6																	41250446		2203	4300	6503	SO:0001819	synonymous_variant	0			AF196329	CCDS4854.1, CCDS56427.1, CCDS59499.1	6p21.1	2013-01-11			ENSG00000124731	ENSG00000124731		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17760	protein-coding gene	gene with protein product		605085				11922939, 10799849	Standard	NM_018643		Approved	TREM-1, CD354	uc003oqf.2	Q9NP99	OTTHUMG00000014674	ENST00000244709.4:c.93G>A	6.37:g.41250446C>T			B4DWG2|K7EJW1|Q53FL8|Q5T2C9|Q86YU1	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub	p.L31	ENST00000244709.4	37	c.93	CCDS4854.1	6																																																																																			TREM1	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000124731		0.453	TREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREM1	HGNC	protein_coding	OTTHUMT00000040505.2	-	0.00	45	0	C	NM_018643		41250446	-1	tier1	-	no_errors	ENST00000244709	ensembl	human	known	74_37	silent	41.30	27	19	SNP	0.000	T
TUBA3C	7278	genome.wustl.edu	37	13	19748259	19748259	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr13:19748259C>A	ENST00000400113.3	-	5	1201	c.1097G>T	c.(1096-1098)gGa>gTa	p.G366V		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	366					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GGCCAGGTCTCCCCCAGGGAC	0.582																																																	0													54.0	52.0	53.0					13																	19748259		2203	4300	6503	SO:0001583	missense	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1097G>T	13.37:g.19748259C>A	ENSP00000382982:p.Gly366Val		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.G366V	ENST00000400113.3	37	c.1097	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	c	9.798	1.179803	0.21787	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.81415	-1.49	1.22	1.22	0.21188	.	0.000000	0.47455	U	0.000239	D	0.82416	0.5032	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82273	-0.0539	7	0.87932	D	0	.	8.3643	0.32378	0.0:1.0:0.0:0.0	.	.	.	.	V	366	ENSP00000382982:G366V	ENSP00000354037:G366V	G	-	2	0	TUBA3C	18646259	0.998000	0.40836	0.871000	0.34182	0.367000	0.29736	6.342000	0.72982	0.982000	0.38575	0.194000	0.17425	GGA	TUBA3C	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin	ENSG00000198033		0.582	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	76	0	C	NM_006001		19748259	-1	tier1	-	no_errors	ENST00000400113	ensembl	human	known	74_37	missense	64.79	25	46	SNP	1.000	A
TUBB2A	7280	genome.wustl.edu	37	6	3154963	3154963	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:3154963C>G	ENST00000333628.3	-	4	534	c.472G>C	c.(472-474)Gag>Cag	p.E158Q	RP1-40E16.11_ENST00000447644.1_RNA|TUBB2A_ENST00000489942.1_5'UTR	NM_001069.2	NP_001060.1	Q13885	TBB2A_HUMAN	tubulin, beta 2A class IIa	158					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				TCTGGGTACTCTTCCCGGATC	0.622																																																	0													35.0	24.0	28.0					6																	3154963		2202	4276	6478	SO:0001583	missense	0			AY159127	CCDS4484.1	6p25.2	2012-10-02	2011-10-10	2005-11-03	ENSG00000137267	ENSG00000137267		"""Tubulins"""	12412	protein-coding gene	gene with protein product	"""class IIa beta-tubulin"""	615101	"""tubulin, beta polypeptide"", ""tubulin, beta 2"", ""tubulin, beta 2A"""	TUBB, TUBB2		14574404	Standard	NM_001069		Approved	dJ40E16.7	uc003mvc.3	Q13885	OTTHUMG00000014135	ENST00000333628.3:c.472G>C	6.37:g.3154963C>G	ENSP00000369703:p.Glu158Gln		Q6FGZ8|Q8IWR2	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.E158Q	ENST00000333628.3	37	c.472	CCDS4484.1	6	.	.	.	.	.	.	.	.	.	.	C	17.63	3.437755	0.62955	.	.	ENSG00000137267	ENST00000333628;ENST00000392362	T	0.70986	-0.53	4.88	4.88	0.63580	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.53938	U	0.000043	D	0.85173	0.5636	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	0.961;0.994;1.0	P;P;D	0.91635	0.874;0.874;0.999	D	0.88155	0.2853	10	0.87932	D	0	.	18.397	0.90502	0.0:1.0:0.0:0.0	.	158;158;158	B2R6L0;Q13885;Q8N6N5	.;TBB2A_HUMAN;.	Q	158;68	ENSP00000369703:E158Q	ENSP00000369703:E158Q	E	-	1	0	TUBB2A	3099962	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.303000	0.78871	2.422000	0.82143	0.557000	0.71058	GAG	TUBB2A	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Alpha_tubulin	ENSG00000137267		0.622	TUBB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2A	HGNC	protein_coding	OTTHUMT00000039662.1	-	0.00	53	0	C	NM_001069		3154963	-1	tier1	-	no_errors	ENST00000333628	ensembl	human	known	74_37	missense	44.44	30	24	SNP	1.000	G
UBE2R2	54926	genome.wustl.edu	37	9	33923379	33923379	+	IGR	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr9:33923379G>C	ENST00000263228.3	+	0	4075				UBAP2_ENST00000379235.1_Missense_Mutation_p.T204R|UBAP2_ENST00000379238.1_Missense_Mutation_p.T965R|UBAP2_ENST00000379239.4_Missense_Mutation_p.T698R|UBAP2_ENST00000449054.1_Missense_Mutation_p.T965R|UBAP2_ENST00000539807.1_Missense_Mutation_p.T720R|UBAP2_ENST00000360802.1_Missense_Mutation_p.T965R	NM_017811.3	NP_060281.2	Q712K3	UB2R2_HUMAN	ubiquitin-conjugating enzyme E2R 2						protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			LUSC - Lung squamous cell carcinoma(29;0.0176)	GBM - Glioblastoma multiforme(74;0.188)		CCCCTCACCTGTACTGTAGCC	0.587																																																	0													252.0	246.0	248.0					9																	33923379		2203	4300	6503	SO:0001628	intergenic_variant	0			AK000426	CCDS6546.1	9p11.2	2008-02-05			ENSG00000107341	ENSG00000107341		"""Ubiquitin-conjugating enzymes E2"""	19907	protein-coding gene	gene with protein product		612506				12037680	Standard	XM_005251496		Approved	UBC3B, CDC34B, FLJ20419, MGC10481	uc003ztm.3	Q712K3	OTTHUMG00000019797		9.37:g.33923379G>C			D3DRL5|Q9NX64	Missense_Mutation	SNP	pfam_DUF3697_Uba2,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk	p.T965R	ENST00000263228.3	37	c.2894	CCDS6546.1	9	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517264	0.44763	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379235;ENST00000379239;ENST00000539807;ENST00000351580	T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21	5.85	5.85	0.93711	.	0.250227	0.47455	D	0.000222	T	0.44477	0.1295	L	0.57536	1.79	0.80722	D	1	P;P;P;P	0.42203	0.773;0.773;0.773;0.664	B;B;B;B	0.42422	0.387;0.387;0.387;0.216	T	0.37619	-0.9698	10	0.62326	D	0.03	-12.1694	20.5471	0.99284	0.0:0.0:1.0:0.0	.	720;698;874;965	F5H2U4;A6NCA8;F5H2C8;Q5T6F2	.;.;.;UBAP2_HUMAN	R	965;965;965;874;204;698;720;399	ENSP00000368540:T965R;ENSP00000416932:T965R;ENSP00000354039:T965R;ENSP00000368537:T204R;ENSP00000368541:T698R;ENSP00000439329:T720R	ENSP00000259602:T399R	T	-	2	0	UBAP2	33913379	1.000000	0.71417	0.970000	0.41538	0.164000	0.22412	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	ACA	UBAP2	-	NULL	ENSG00000137073		0.587	UBE2R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000052118.1	-	0.00	38	0	G	NM_017811		33923379	-1	tier1	-	no_errors	ENST00000360802	ensembl	human	known	74_37	missense	32.43	50	24	SNP	1.000	C
UBE2M	9040	genome.wustl.edu	37	19	59068438	59068438	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:59068438G>A	ENST00000253023.3	-	2	774	c.196C>T	c.(196-198)Cct>Tct	p.P66S	AC016629.8_ENST00000600534.1_RNA|AC016629.8_ENST00000593642.1_RNA|CHMP2A_ENST00000600118.1_5'Flank|CHMP2A_ENST00000312547.2_5'Flank|AC016629.8_ENST00000600726.1_RNA|CHMP2A_ENST00000601220.1_5'Flank	NM_003969.3	NP_003960.1	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	66					cellular protein modification process (GO:0006464)|positive regulation of neuron apoptotic process (GO:0043525)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)|ribosomal S6-glutamic acid ligase activity (GO:0018169)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	5		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		ACCTCATCAGGACAGATGACC	0.547																																																	0													167.0	140.0	149.0					19																	59068438		2203	4300	6503	SO:0001583	missense	0			AB012191	CCDS12987.1	19q13.43	2011-05-19	2011-05-19		ENSG00000130725	ENSG00000130725		"""Ubiquitin-conjugating enzymes E2"""	12491	protein-coding gene	gene with protein product		603173	"""ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12)"", ""ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)"""			9694792	Standard	NM_003969		Approved	hUbc12, UBC12	uc002qtl.4	P61081		ENST00000253023.3:c.196C>T	19.37:g.59068438G>A	ENSP00000253023:p.Pro66Ser		O76069|Q8VC50	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P66S	ENST00000253023.3	37	c.196	CCDS12987.1	19	.	.	.	.	.	.	.	.	.	.	G	17.97	3.518502	0.64634	.	.	ENSG00000130725	ENST00000253023	T	0.37411	1.2	4.25	4.25	0.50352	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.49305	D	0.000144	T	0.67785	0.2930	H	0.96365	3.81	0.50171	D	0.999858	D	0.89917	1.0	D	0.83275	0.996	T	0.74765	-0.3554	10	0.87932	D	0	.	8.1808	0.31309	0.1081:0.0:0.8918:0.0	.	66	P61081	UBC12_HUMAN	S	66	ENSP00000253023:P66S	ENSP00000253023:P66S	P	-	1	0	UBE2M	63760250	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.995000	0.63908	2.385000	0.81259	0.491000	0.48974	CCT	UBE2M	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000130725		0.547	UBE2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2M	HGNC	protein_coding	OTTHUMT00000467097.1	-	0.00	56	0	G	NM_003969		59068438	-1	tier1	-	no_errors	ENST00000253023	ensembl	human	known	74_37	missense	64.86	13	24	SNP	1.000	A
WBP11P1	441818	genome.wustl.edu	37	18	30092380	30092380	+	RNA	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr18:30092380C>G	ENST00000567636.1	+	0	755					NR_003558.1				WW domain binding protein 11 pseudogene 1																		ACGTGGTGTTCCACATTTGCC	0.562																																																	0																																												0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092380C>G				RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.562	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	-	0.00	33	0	C			30092380	+1	tier1	-	no_errors	ENST00000567636	ensembl	human	known	74_37	rna	41.67	14	10	SNP	1.000	G
XKR7	343702	genome.wustl.edu	37	20	30584580	30584580	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr20:30584580A>C	ENST00000562532.2	+	3	1234	c.1060A>C	c.(1060-1062)Aag>Cag	p.K354Q		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	354						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CTGCATGTCCAAGTGGGAGGA	0.562																																																	0													80.0	63.0	68.0					20																	30584580		2203	4300	6503	SO:0001583	missense	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1060A>C	20.37:g.30584580A>C	ENSP00000477059:p.Lys354Gln		Q9NUG5	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.K354Q	ENST00000562532.2	37	c.1060	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	a	18.94	3.730100	0.69074	.	.	ENSG00000101321	ENST00000217299	T	0.64618	-0.11	5.41	5.41	0.78517	.	0.055146	0.64402	D	0.000002	T	0.74366	0.3707	M	0.63428	1.95	0.49130	D	0.999758	D	0.89917	1.0	D	0.79784	0.993	T	0.76019	-0.3112	10	0.56958	D	0.05	.	10.7473	0.46187	0.8408:0.1592:0.0:0.0	.	354	Q5GH72	XKR7_HUMAN	Q	354	ENSP00000217299:K354Q	ENSP00000217299:K354Q	K	+	1	0	XKR7	30048241	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.336000	0.96533	2.058000	0.61347	0.454000	0.30748	AAG	XKR7	-	pfam_Transport_prot_XK	ENSG00000260903		0.562	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	-	0.00	41	0	A	NM_001011718		30584580	+1	tier1	-	no_errors	ENST00000562532	ensembl	human	known	74_37	missense	38.78	30	19	SNP	1.000	C
ZC3H7B	23264	genome.wustl.edu	37	22	41723332	41723332	+	Silent	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr22:41723332C>T	ENST00000352645.4	+	5	665	c.408C>T	c.(406-408)taC>taT	p.Y136Y	ZC3H7B_ENST00000351589.4_Silent_p.Y136Y	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	136					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						AGGAGGCCTACGAGTGCAGCA	0.662																																																	0													118.0	98.0	105.0					22																	41723332		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.408C>T	22.37:g.41723332C>T			A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Silent	SNP	pfam_Znf_CCCH,pfam_TPR_1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Y136	ENST00000352645.4	37	c.408	CCDS14013.1	22																																																																																			ZC3H7B	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000100403		0.662	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	-	0.00	63	0	C	NM_017590		41723332	+1	tier1	-	no_errors	ENST00000351589	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.993	T
ZBED4	9889	genome.wustl.edu	37	22	50279480	50279480	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr22:50279480G>A	ENST00000216268.5	+	2	2647	c.2170G>A	c.(2170-2172)Gag>Aag	p.E724K		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	724						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		TAAGGAAGCTGAGAGTGGTGT	0.522																																																	0													74.0	75.0	75.0					22																	50279480		2203	4300	6503	SO:0001583	missense	0			AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2170G>A	22.37:g.50279480G>A	ENSP00000216268:p.Glu724Lys		B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	pfam_Znf_BED_prd,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.E724K	ENST00000216268.5	37	c.2170	CCDS33677.1	22	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289122	0.80914	.	.	ENSG00000100426	ENST00000216268	T	0.45668	0.89	5.43	5.43	0.79202	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.62171	0.2406	L	0.58428	1.81	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.59080	-0.7521	10	0.40728	T	0.16	-36.6208	19.239	0.93875	0.0:0.0:1.0:0.0	.	724	O75132	ZBED4_HUMAN	K	724	ENSP00000216268:E724K	ENSP00000216268:E724K	E	+	1	0	ZBED4	48665484	1.000000	0.71417	0.944000	0.38274	0.852000	0.48524	9.312000	0.96287	2.533000	0.85409	0.561000	0.74099	GAG	ZBED4	-	superfamily_RNaseH-like_dom	ENSG00000100426		0.522	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED4	HGNC	protein_coding	OTTHUMT00000317408.2	-	0.00	31	0	G	NM_014838		50279480	+1	tier1	-	no_errors	ENST00000216268	ensembl	human	known	74_37	missense	44.74	21	17	SNP	1.000	A
ZKSCAN3	80317	genome.wustl.edu	37	6	28331513	28331513	+	Silent	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:28331513A>G	ENST00000377255.3	+	6	975	c.678A>G	c.(676-678)gaA>gaG	p.E226E	ZKSCAN3_ENST00000252211.2_Silent_p.E226E|ZKSCAN3_ENST00000341464.5_Silent_p.E78E	NM_001242894.1	NP_001229823.1	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	226	KRAB.				autophagy (GO:0006914)|lysosome organization (GO:0007040)|negative regulation of autophagy (GO:0010507)|negative regulation of cellular senescence (GO:2000773)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(4)|large_intestine(3)|lung(8)|pancreas(1)|skin(2)|stomach(2)|urinary_tract(1)	21						TCACCCCTGAATGGACACAGC	0.498																																																	0													89.0	83.0	85.0					6																	28331513		2203	4300	6503	SO:0001819	synonymous_variant	0			U71601	CCDS4650.1, CCDS56408.1	6p22.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000189298		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13853	protein-coding gene	gene with protein product		612791	"""zinc finger protein 306"", ""zinc finger protein 309"""	ZNF306, ZNF309		10520746, 22531714	Standard	NM_024493		Approved	Zfp47, ZF47, ZSCAN35	uc003nle.4	Q9BRR0	OTTHUMG00000014521	ENST00000377255.3:c.678A>G	6.37:g.28331513A>G			B2R8W2|B3KVC0|H7BXX1|Q5VXH3|Q92972|Q9H4T3	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E226	ENST00000377255.3	37	c.678	CCDS4650.1	6																																																																																			ZKSCAN3	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box	ENSG00000189298		0.498	ZKSCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN3	HGNC	protein_coding	OTTHUMT00000040189.3	-	0.00	72	0	A	NM_024493		28331513	+1	tier1	-	no_errors	ENST00000252211	ensembl	human	known	74_37	silent	34.33	44	23	SNP	0.000	G
ZMYM1	79830	genome.wustl.edu	37	1	35576032	35576032	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:35576032G>A	ENST00000373330.1	+	8	1119	c.945G>A	c.(943-945)aaG>aaA	p.K315K	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Silent_p.K315K			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	315						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GTAAAGCTAAGATGGAATCTT	0.313																																																	0													178.0	166.0	169.0					1																	35576032		1867	4124	5991	SO:0001819	synonymous_variant	0			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.945G>A	1.37:g.35576032G>A			D3DPR7|Q7Z3Q4	Silent	SNP	pfam_Znf_MYM,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.K315	ENST00000373330.1	37	c.945	CCDS41302.1	1																																																																																			ZMYM1	-	smart_TRASH_dom	ENSG00000197056		0.313	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	-	0.00	88	0	G	NM_024772		35576032	+1	tier1	-	no_errors	ENST00000359858	ensembl	human	novel	74_37	silent	40.54	66	45	SNP	0.998	A
ZNF214	7761	genome.wustl.edu	37	11	7021950	7021950	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr11:7021950G>T	ENST00000278314.4	-	3	1279	c.964C>A	c.(964-966)Caa>Aaa	p.Q322K	ZNF214_ENST00000536068.1_Missense_Mutation_p.Q322K|ZNF214_ENST00000531083.1_5'Flank	NM_013249.2	NP_037381.2	Q9UL59	ZN214_HUMAN	zinc finger protein 214	322					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				Epithelial(150;3.87e-08)|BRCA - Breast invasive adenocarcinoma(625;0.081)		TGGACTCTTTGATGATTGTGA	0.398																																					Ovarian(22;251 657 736 21522 46864)												0													105.0	110.0	108.0					11																	7021950		2200	4294	6494	SO:0001583	missense	0			AF056617	CCDS31418.1	11p15.4	2013-01-08				ENSG00000149050		"""Zinc fingers, C2H2-type"", ""-"""	13006	protein-coding gene	gene with protein product		605015					Standard	NM_013249		Approved		uc001mfa.2	Q9UL59		ENST00000278314.4:c.964C>A	11.37:g.7021950G>T	ENSP00000278314:p.Gln322Lys		B2R8Q1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q322K	ENST00000278314.4	37	c.964	CCDS31418.1	11	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625677	0.28889	.	.	ENSG00000149050	ENST00000278314;ENST00000536068	T;T	0.53423	0.62;0.62	3.46	3.46	0.39613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.345430	0.21229	N	0.078016	T	0.30166	0.0756	N	0.17800	0.525	0.23454	N	0.997648	B	0.25609	0.13	B	0.15870	0.014	T	0.19418	-1.0306	10	0.46703	T	0.11	.	10.7323	0.46104	0.0:0.0:1.0:0.0	.	322	Q9UL59	ZN214_HUMAN	K	322	ENSP00000278314:Q322K;ENSP00000445373:Q322K	ENSP00000278314:Q322K	Q	-	1	0	ZNF214	6978526	0.993000	0.37304	0.970000	0.41538	0.822000	0.46500	0.818000	0.27295	2.221000	0.72209	0.655000	0.94253	CAA	ZNF214	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000149050		0.398	ZNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF214	HGNC	protein_coding	OTTHUMT00000385349.1	-	0.00	66	0	G			7021950	-1	tier1	-	no_errors	ENST00000278314	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
ZNF264	9422	genome.wustl.edu	37	19	57723030	57723030	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:57723030G>C	ENST00000263095.6	+	4	979	c.565G>C	c.(565-567)Gag>Cag	p.E189Q	ZNF264_ENST00000536056.1_Missense_Mutation_p.E189Q	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	189					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TAACTCATGTGAGTCAGGTAA	0.433																																																	0													92.0	84.0	87.0					19																	57723030		2203	4300	6503	SO:0001583	missense	0			AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.565G>C	19.37:g.57723030G>C	ENSP00000263095:p.Glu189Gln		A8K8Y9|Q9P1V0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E189Q	ENST00000263095.6	37	c.565	CCDS33127.1	19	.	.	.	.	.	.	.	.	.	.	G	3.667	-0.068313	0.07228	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.25085	1.82;1.82	1.79	0.715	0.18186	.	.	.	.	.	T	0.19886	0.0478	L	0.46157	1.445	0.09310	N	1	B	0.20550	0.046	B	0.18263	0.021	T	0.23190	-1.0195	9	0.44086	T	0.13	.	5.4434	0.16521	0.3127:0.0:0.6873:0.0	.	189	O43296	ZN264_HUMAN	Q	189	ENSP00000263095:E189Q;ENSP00000440376:E189Q	ENSP00000263095:E189Q	E	+	1	0	ZNF264	62414842	0.056000	0.20664	0.001000	0.08648	0.013000	0.08279	1.699000	0.37804	0.321000	0.23259	0.555000	0.69702	GAG	ZNF264	-	NULL	ENSG00000083844		0.433	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF264	HGNC	protein_coding	OTTHUMT00000465080.1	-	0.00	31	0	G			57723030	+1	tier1	-	no_errors	ENST00000263095	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.004	C
ZNF292	23036	genome.wustl.edu	37	6	87967531	87967531	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:87967531C>G	ENST00000369577.3	+	8	4227	c.4184C>G	c.(4183-4185)tCc>tGc	p.S1395C	ZNF292_ENST00000339907.4_Missense_Mutation_p.S1390C	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1395						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GGGCACTTATCCAAGCGATCT	0.448																																																	0													88.0	88.0	88.0					6																	87967531		1883	4121	6004	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.4184C>G	6.37:g.87967531C>G	ENSP00000358590:p.Ser1395Cys		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1395C	ENST00000369577.3	37	c.4184	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412311	0.62511	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.26067	1.76;1.79	5.32	5.32	0.75619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.34513	0.0900	L	0.34521	1.04	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.21109	-1.0255	10	0.87932	D	0	.	19.0058	0.92851	0.0:1.0:0.0:0.0	.	1395	O60281	ZN292_HUMAN	C	1395;1390	ENSP00000358590:S1395C;ENSP00000342847:S1390C	ENSP00000342847:S1390C	S	+	2	0	ZNF292	88024250	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.818000	0.86416	2.496000	0.84212	0.650000	0.86243	TCC	ZNF292	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188994		0.448	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	46	0	C	NM_015021		87967531	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	29.09	39	16	SNP	1.000	G
ZNF320	162967	genome.wustl.edu	37	19	53385226	53385226	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:53385226G>A	ENST00000595635.1	-	8	654	c.153C>T	c.(151-153)tcC>tcT	p.S51S	ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000600930.1_Intron|ZNF320_ENST00000391781.2_Silent_p.S51S	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	51	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		TCATGCATTTGGAAGAGATAT	0.353																																																	0													113.0	112.0	112.0					19																	53385226		2200	4298	6498	SO:0001819	synonymous_variant	0			AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.153C>T	19.37:g.53385226G>A			Q8NDR6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S51	ENST00000595635.1	37	c.153	CCDS33095.1	19																																																																																			ZNF320	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000182986		0.353	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF320	HGNC	protein_coding	OTTHUMT00000463771.1	-	0.00	107	0	G	NM_207333		53385226	-1	tier1	-	no_errors	ENST00000391781	ensembl	human	known	74_37	silent	28.36	144	57	SNP	0.000	A
ZNF451	26036	genome.wustl.edu	37	6	57018677	57018677	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr6:57018677C>T	ENST00000370706.4	+	13	3146	c.2902C>T	c.(2902-2904)Caa>Taa	p.Q968*	RP11-203B9.4_ENST00000588811.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|ZNF451_ENST00000357489.3_Nonsense_Mutation_p.Q920*|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000491832.2_Nonsense_Mutation_p.Q968*|RP11-203B9.4_ENST00000586432.1_RNA|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	968					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TCTAGATGAACAACTACCCAA	0.393																																																	0													107.0	103.0	104.0					6																	57018677		2203	4300	6503	SO:0001587	stop_gained	0			AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2902C>T	6.37:g.57018677C>T	ENSP00000359740:p.Gln968*		Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q968*	ENST00000370706.4	37	c.2902	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	C	40	8.523252	0.98848	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	.	.	.	6.02	5.15	0.70609	.	0.224693	0.39909	N	0.001232	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-12.5198	14.3843	0.66934	0.269:0.731:0.0:0.0	.	.	.	.	X	968;920;968	.	ENSP00000350083:Q920X	Q	+	1	0	ZNF451	57126636	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	3.997000	0.57016	1.543000	0.49345	-0.175000	0.13238	CAA	ZNF451	-	NULL	ENSG00000112200		0.393	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	HGNC	protein_coding	OTTHUMT00000041035.2	-	0.00	35	0	C	NM_015555		57018677	+1	tier1	-	no_errors	ENST00000370706	ensembl	human	known	74_37	nonsense	45.71	19	16	SNP	1.000	T
ZNF671	79891	genome.wustl.edu	37	19	58232613	58232613	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:58232613C>A	ENST00000317398.6	-	4	936	c.841G>T	c.(841-843)Gga>Tga	p.G281*	ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron|ZNF671_ENST00000335820.3_Nonsense_Mutation_p.G183*	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TACCTCTGTCCCATGAGAAAG	0.517																																																	0													86.0	81.0	83.0					19																	58232613		2203	4300	6503	SO:0001587	stop_gained	0				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.841G>T	19.37:g.58232613C>A	ENSP00000321848:p.Gly281*		A6NF07|Q9H5E9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G281*	ENST00000317398.6	37	c.841	CCDS12961.1	19	.	.	.	.	.	.	.	.	.	.	C	24.1	4.496363	0.85069	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	.	.	.	1.94	0.846	0.18955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.2314	0.31601	0.0:0.7498:0.2502:0.0	.	.	.	.	X	281;183	.	ENSP00000321848:G281X	G	-	1	0	ZNF671	62924425	0.000000	0.05858	0.001000	0.08648	0.327000	0.28475	0.704000	0.25661	0.364000	0.24374	0.467000	0.42956	GGA	ZNF671	-	NULL	ENSG00000083814		0.517	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	-	0.00	52	0	C	NM_024833		58232613	-1	tier1	-	no_errors	ENST00000317398	ensembl	human	known	74_37	nonsense	8.71	262	25	SNP	0.001	A
ZNF672	79894	genome.wustl.edu	37	1	249142293	249142293	+	Missense_Mutation	SNP	C	C	T	rs371348856		TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr1:249142293C>T	ENST00000306562.3	+	4	1566	c.820C>T	c.(820-822)Cgg>Tgg	p.R274W		NM_024836.1	NP_079112.1	Q499Z4	ZN672_HUMAN	zinc finger protein 672	274					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(1)	5	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GCTGCGCCATCGGCGCAGCCA	0.687																																																	0																																										SO:0001583	missense	0			AK027476	CCDS1638.1	1q44	2013-01-08			ENSG00000171161	ENSG00000171161		"""Zinc fingers, C2H2-type"""	26179	protein-coding gene	gene with protein product	"""hypothetical protein FLJ22301"""					12477932	Standard	NM_024836		Approved	FLJ22301	uc001iex.3	Q499Z4	OTTHUMG00000040377	ENST00000306562.3:c.820C>T	1.37:g.249142293C>T	ENSP00000421915:p.Arg274Trp		Q96H65|Q96IM3|Q9H6G5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R274W	ENST00000306562.3	37	c.820	CCDS1638.1	1	.	.	.	.	.	.	.	.	.	.	C	15.50	2.853186	0.51270	.	.	ENSG00000171161	ENST00000306562	T	0.18810	2.19	3.32	1.34	0.21922	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.522525	0.14222	U	0.333358	T	0.31071	0.0785	M	0.70787	2.145	0.09310	N	1	D	0.69078	0.997	P	0.51229	0.663	T	0.12218	-1.0556	9	.	.	.	.	9.6637	0.39972	0.3584:0.6416:0.0:0.0	.	274	Q499Z4	ZN672_HUMAN	W	274	ENSP00000421915:R274W	.	R	+	1	2	ZNF672	247108916	0.022000	0.18835	0.603000	0.28903	0.566000	0.35808	0.651000	0.24873	0.217000	0.20800	0.561000	0.74099	CGG	ZNF672	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171161		0.687	ZNF672-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF672	HGNC	protein_coding	OTTHUMT00000097125.2	-	0.00	17	0	C	NM_024836		249142293	+1	tier1	-	no_errors	ENST00000306562	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.337	T
ZNF81	347344	genome.wustl.edu	37	X	47775250	47775250	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chrX:47775250A>G	ENST00000376954.1	+	6	1573	c.1205A>G	c.(1204-1206)aAt>aGt	p.N402S	ZNF81_ENST00000338637.7_Missense_Mutation_p.N402S			P51508	ZNF81_HUMAN	zinc finger protein 81	402					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				TCAGCCCTCAATATACATCAG	0.428																																																	0													50.0	49.0	49.0					X																	47775250		2194	4297	6491	SO:0001583	missense	0			AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.1205A>G	X.37:g.47775250A>G	ENSP00000366153:p.Asn402Ser		Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N402S	ENST00000376954.1	37	c.1205	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	a	0.026	-1.373114	0.01214	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.17054	2.3;2.3	4.16	-7.87	0.01183	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.798861	0.10893	N	0.622444	T	0.07369	0.0186	N	0.12569	0.235	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31641	-0.9936	10	0.29301	T	0.29	.	10.8325	0.46669	0.1812:0.2366:0.5822:0.0	.	402	P51508	ZNF81_HUMAN	S	402	ENSP00000366153:N402S;ENSP00000341151:N402S	ENSP00000341151:N402S	N	+	2	0	ZNF81	47660194	0.000000	0.05858	0.122000	0.21767	0.972000	0.66771	-0.879000	0.04188	-2.083000	0.00867	-1.191000	0.01696	AAT	ZNF81	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197779		0.428	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	-	0.00	20	0	A	NM_007137		47775250	+1	tier1	-	no_errors	ENST00000338637	ensembl	human	known	74_37	missense	87.50	3	21	SNP	0.002	G
ZNF99	7652	genome.wustl.edu	37	19	22940566	22940566	+	Silent	SNP	G	G	A			TCGA-LN-A49U-01A-31D-A27G-09	TCGA-LN-A49U-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	93ad526c-d7d9-4e57-813e-81fe8e061d0b	c374778c-bec4-4e10-80b1-441d101dae87	g.chr19:22940566G>A	ENST00000596209.1	-	4	2235	c.2145C>T	c.(2143-2145)agC>agT	p.S715S	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Silent_p.S624S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	715					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTGAGGACTGGCTAAAAGCTT	0.373																																																	0													41.0	44.0	43.0					19																	22940566		2079	4218	6297	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2145C>T	19.37:g.22940566G>A			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S624	ENST00000596209.1	37	c.1872	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.373	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	-	0.00	49	0	G	XM_065124		22940566	-1	tier1	-	no_errors	ENST00000397104	ensembl	human	known	74_37	silent	38.89	33	21	SNP	0.000	A
