#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCF2	10061	genome.wustl.edu	37	7	150918758	150918758	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr7:150918758C>T	ENST00000287844.2	-	7	936	c.827G>A	c.(826-828)cGc>cAc	p.R276H	ABCF2_ENST00000222388.2_Missense_Mutation_p.R276H|ABCF2_ENST00000473874.1_5'UTR	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	276	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACCAAGATGCGCTTAAAACT	0.443																																																	0													172.0	166.0	168.0					7																	150918758		2203	4300	6503	SO:0001583	missense	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.827G>A	7.37:g.150918758C>T	ENSP00000287844:p.Arg276His		O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R276H	ENST00000287844.2	37	c.827	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002462	0.74932	.	.	ENSG00000033050	ENST00000222388;ENST00000287844;ENST00000468073	D;D;T	0.92048	-2.92;-2.96;3.81	5.68	5.68	0.88126	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.109923	0.64402	D	0.000006	T	0.77765	0.4179	N	0.01649	-0.78	0.80722	D	1	P;B	0.38420	0.63;0.258	B;B	0.26094	0.066;0.052	T	0.82010	-0.0669	10	0.41790	T	0.15	0.4624	16.9362	0.86203	0.0:1.0:0.0:0.0	.	276;276	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	H	276	ENSP00000222388:R276H;ENSP00000287844:R276H;ENSP00000419720:R276H	ENSP00000222388:R276H	R	-	2	0	ABCF2	150549691	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.317000	0.79018	2.669000	0.90835	0.561000	0.74099	CGC	ABCF2	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000033050		0.443	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	-	0.00	33	0	C	NM_005692		150918758	-1	tier1	-	no_errors	ENST00000222388	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	T
AGAP11	119385	genome.wustl.edu	37	10	88760457	88760457	+	RNA	DEL	T	T	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:88760457delT	ENST00000444431.1	+	0	1587				RP11-96C23.14_ENST00000444180.3_RNA|RP11-96C23.5_ENST00000433214.2_RNA			Q8TF27	AGA11_HUMAN	ankyrin repeat and GTPase domain Arf GTPase activating protein 11						regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)										CTGTGCATCGTTTTTTTTTTG	0.368																																																	0																																												0					10q23.2	2013-01-11			ENSG00000151303	ENSG00000151303		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	29421	protein-coding gene	gene with protein product						11853319	Standard	NM_133447		Approved	KIAA1975	uc001kee.2	Q8TF27	OTTHUMG00000018667		10.37:g.88760457delT			B9EIP7|D3DWE4	RNA	DEL	-	NULL	ENST00000444431.1	37	NULL		10																																																																																			AGAP11	-	-	ENSG00000151303		0.368	AGAP11-001	KNOWN	basic|readthrough_transcript	processed_transcript	AGAP11	HGNC	processed_transcript	OTTHUMT00000049193.1		0.00	36	0	T	NM_133447		88760457	+1	tier1		no_errors	ENST00000444431	ensembl	human	known	74_37	rna	21.74	18	5	DEL	0.003	-
AGTPBP1	23287	genome.wustl.edu	37	9	88292466	88292466	+	Silent	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:88292466G>T	ENST00000357081.3	-	6	465	c.321C>A	c.(319-321)acC>acA	p.T107T	AGTPBP1_ENST00000491784.1_5'UTR|AGTPBP1_ENST00000432218.1_5'UTR|AGTPBP1_ENST00000376080.1_Silent_p.T49T|AGTPBP1_ENST00000376109.3_Silent_p.T159T|AGTPBP1_ENST00000337006.4_Silent_p.T49T|AGTPBP1_ENST00000376083.3_Silent_p.T107T|AGTPBP1_ENST00000376081.4_Silent_p.T107T			Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	107					adult walking behavior (GO:0007628)|C-terminal protein deglutamylation (GO:0035609)|cerebellar Purkinje cell differentiation (GO:0021702)|eye photoreceptor cell differentiation (GO:0001754)|mitochondrion organization (GO:0007005)|neuromuscular process (GO:0050905)|neurotransmitter metabolic process (GO:0042133)|olfactory bulb development (GO:0021772)|protein side chain deglutamylation (GO:0035610)|retina development in camera-type eye (GO:0060041)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(12)|ovary(5)|skin(2)|urinary_tract(3)	44						AACCACCTTTGGTGACTAAGA	0.299																																																	0													115.0	112.0	113.0					9																	88292466		2203	4300	6503	SO:0001819	synonymous_variant	0			AB028958	CCDS6672.1, CCDS75854.1	9q21.33	2014-06-23			ENSG00000135049	ENSG00000135049			17258	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 1"", ""tubulinyl-Tyr carboxypeptidase"", ""carboxypeptidase-tubulin"", ""tyrosine carboxypeptidase"", ""soluble carboxypeptidase"""	606830				11083920	Standard	NM_015239		Approved	KIAA1035, Nna1, CCP1	uc010mqc.3	Q9UPW5	OTTHUMG00000020124	ENST00000357081.3:c.321C>A	9.37:g.88292466G>T			B4DIT6|B4DRZ8|Q5VV80|Q63HM7|Q658P5|Q6P9D6|Q9H8U6|Q9H9W8|Q9NVK1	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.T159	ENST00000357081.3	37	c.477		9																																																																																			AGTPBP1	-	superfamily_ARM-type_fold	ENSG00000135049		0.299	AGTPBP1-004	KNOWN	basic	protein_coding	AGTPBP1	HGNC	protein_coding	OTTHUMT00000052893.1	-	0.00	14	0	G	NM_015239		88292466	-1	tier1	-	no_errors	ENST00000376109	ensembl	human	known	74_37	silent	20.00	20	5	SNP	0.998	T
AKAP12	9590	genome.wustl.edu	37	6	151673538	151673538	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:151673538G>A	ENST00000253332.1	+	3	4201	c.4012G>A	c.(4012-4014)Gta>Ata	p.V1338I	AKAP12_ENST00000359755.5_Missense_Mutation_p.V1233I|AKAP12_ENST00000354675.6_Missense_Mutation_p.V1240I|AKAP12_ENST00000402676.2_Missense_Mutation_p.V1338I			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1338					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		GAGAGAGATGGTAGTTCAAGT	0.473																																					Melanoma(141;1616 1805 10049 24534 51979)												0													96.0	88.0	91.0					6																	151673538		2203	4300	6503	SO:0001583	missense	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.4012G>A	6.37:g.151673538G>A	ENSP00000253332:p.Val1338Ile		O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.V1338I	ENST00000253332.1	37	c.4012	CCDS5229.1	6	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612445	0.28712	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.08458	3.09;3.09;3.1;3.1	4.34	2.45	0.29901	.	1.476780	0.05082	N	0.483656	T	0.02970	0.0088	L	0.27053	0.805	0.09310	N	1	P;P;P	0.46512	0.879;0.879;0.808	P;P;B	0.48677	0.586;0.586;0.382	T	0.34079	-0.9843	10	0.38643	T	0.18	.	2.039	0.03546	0.1822:0.1568:0.4998:0.1611	.	1233;1240;1338	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	I	1338;1338;1240;1233	ENSP00000384537:V1338I;ENSP00000253332:V1338I;ENSP00000346702:V1240I;ENSP00000352794:V1233I	ENSP00000253332:V1338I	V	+	1	0	AKAP12	151715231	0.024000	0.19004	0.003000	0.11579	0.032000	0.12392	1.144000	0.31565	0.487000	0.27698	0.557000	0.71058	GTA	AKAP12	-	NULL	ENSG00000131016		0.473	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1	-	0.00	39	0	G			151673538	+1	tier1	-	no_errors	ENST00000253332	ensembl	human	known	74_37	missense	25.00	30	10	SNP	0.000	A
ALB	213	genome.wustl.edu	37	4	74283887	74283887	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr4:74283887C>T	ENST00000503124.1	+	10	1268	c.1061C>T	c.(1060-1062)tCc>tTc	p.S354F	ALB_ENST00000401494.3_Missense_Mutation_p.S389F|ALB_ENST00000415165.2_Missense_Mutation_p.S312F|ALB_ENST00000509063.1_Missense_Mutation_p.S504F|ALB_ENST00000295897.4_Missense_Mutation_p.S504F|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGCACAGAATCCTTGGTGAAC	0.453																																																	0													117.0	109.0	112.0					4																	74283887		2203	4300	6503	SO:0001583	missense	0			V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1061C>T	4.37:g.74283887C>T	ENSP00000421027:p.Ser354Phe		B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP,prints_ALB/AFP/VDB	p.S504F	ENST00000503124.1	37	c.1511		4	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885162	0.51908	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16	5.94	5.94	0.96194	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.000000	0.64402	D	0.000001	T	0.81678	0.4873	M	0.90650	3.135	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.994;0.998;0.997;0.997	D	0.84458	0.0592	10	0.87932	D	0	-27.4715	18.9296	0.92560	0.0:1.0:0.0:0.0	.	389;312;354;504;504	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.;.;.;.;ALBU_HUMAN	F	504;312;291;354;504;389;513	ENSP00000295897:S504F;ENSP00000401820:S312F;ENSP00000421027:S354F;ENSP00000422784:S504F;ENSP00000384695:S389F	ENSP00000295897:S504F	S	+	2	0	ALB	74502751	0.986000	0.35501	0.888000	0.34837	0.033000	0.12548	3.013000	0.49582	2.820000	0.97059	0.650000	0.86243	TCC	ALB	-	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP	ENSG00000163631		0.453	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	ALB	HGNC	protein_coding	OTTHUMT00000365419.1	-	0.00	34	0	C	NM_000477		74283887	+1	tier1	-	no_errors	ENST00000295897	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.998	T
ALOX5	240	genome.wustl.edu	37	10	45907711	45907711	+	Silent	SNP	C	C	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:45907711C>A	ENST00000374391.2	+	4	557	c.504C>A	c.(502-504)atC>atA	p.I168I	ALOX5_ENST00000542434.1_Silent_p.I168I	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	168	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CCCGTGATATCCAGTTTGATA	0.483																																																	0													128.0	120.0	123.0					10																	45907711		2203	4300	6503	SO:0001819	synonymous_variant	0			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.504C>A	10.37:g.45907711C>A			B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Silent	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C,pfscan_PLAT/LH2_dom	p.I168	ENST00000374391.2	37	c.504	CCDS7212.1	10																																																																																			ALOX5	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000012779		0.483	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	-	0.00	62	0	C			45907711	+1	tier1	-	no_errors	ENST00000374391	ensembl	human	known	74_37	silent	37.10	39	23	SNP	1.000	A
ANK2	287	genome.wustl.edu	37	4	114276595	114276595	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr4:114276595G>A	ENST00000357077.4	+	38	6874	c.6821G>A	c.(6820-6822)cGt>cAt	p.R2274H	ANK2_ENST00000264366.6_Missense_Mutation_p.R2241H|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2274					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ACAGAAATTCGTTCAGAAAAA	0.478																																																	0													39.0	40.0	40.0					4																	114276595		2203	4298	6501	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6821G>A	4.37:g.114276595G>A	ENSP00000349588:p.Arg2274His		Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.R2274H	ENST00000357077.4	37	c.6821	CCDS3702.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	0.005|0.005	-2.206426|-2.206426	0.00292|0.00292	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000431447|ENST00000357077;ENST00000264366	.|T;T	.|0.66460	.|-0.19;-0.21	5.7|5.7	-6.39|-6.39	0.01951|0.01951	.|.	.|1.462180	.|0.04027	.|N	.|0.300720	.|T	.|0.20780	.|0.0500	N|N	0.00197|0.00197	-1.87|-1.87	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	.|T	.|0.19745	.|-1.0296	.|9	.|.	.|.	.|.	.|.	2.3696|2.3696	0.04327|0.04327	0.3061:0.3206:0.2691:0.1042|0.3061:0.3206:0.2691:0.1042	.|.	.|2241;2274	.|Q01484;Q01484-4	.|ANK2_HUMAN;.	.|H	-1|2274;2241	.|ENSP00000349588:R2274H;ENSP00000264366:R2241H	.|.	.|R	+|+	.|2	.|0	ANK2|ANK2	114496044|114496044	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.014000|0.014000	0.08584|0.08584	-0.160000|-0.160000	0.10041|0.10041	-0.876000|-0.876000	0.04017|0.04017	-1.258000|-1.258000	0.01471|0.01471	.|CGT	ANK2	-	NULL	ENSG00000145362		0.478	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	9	0	G	NM_001148		114276595	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	missense	92.86	1	13	SNP	0.000	A
ANKRD16	54522	genome.wustl.edu	37	10	5920183	5920183	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:5920183C>T	ENST00000380094.5	-	7	1539	c.996G>A	c.(994-996)aaG>aaA	p.K332K	ANKRD16_ENST00000191063.8_3'UTR|ANKRD16_ENST00000380092.4_Silent_p.K332K	NM_019046.2	NP_061919.1	Q6P6B7	ANR16_HUMAN	ankyrin repeat domain 16	332										breast(1)|endometrium(1)|large_intestine(5)|lung(3)|stomach(2)	12						CTTCAGAATCCTTCAGTCCCG	0.542																																																	0													126.0	120.0	122.0					10																	5920183		2203	4300	6503	SO:0001819	synonymous_variant	0			AL137614	CCDS31136.1, CCDS31137.1	10p15.1	2013-01-10			ENSG00000134461	ENSG00000134461		"""Ankyrin repeat domain containing"""	23471	protein-coding gene	gene with protein product							Standard	NM_019046		Approved	DKFZP434N1511	uc010qat.2	Q6P6B7	OTTHUMG00000017610	ENST00000380094.5:c.996G>A	10.37:g.5920183C>T			A6NEF0|F8WEI4|Q9NT01	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.K332	ENST00000380094.5	37	c.996	CCDS31136.1	10																																																																																			ANKRD16	-	smart_Ankyrin_rpt	ENSG00000134461		0.542	ANKRD16-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	ANKRD16	HGNC	protein_coding	OTTHUMT00000046611.2	-	0.00	27	0	C	XM_166138		5920183	-1	tier1	-	no_errors	ENST00000380092	ensembl	human	known	74_37	silent	29.41	12	5	SNP	0.694	T
ANKRD20A5P	440482	genome.wustl.edu	37	18	14225639	14225639	+	IGR	DEL	A	A	-	rs547882004	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr18:14225639delA								RNU6-316P (34834 upstream) : RP11-757O6.1 (18984 downstream)																							aataaacattaaaaaaaaaaG	0.363													|||unknown(NO_COVERAGE)	9	0.00179712	0.0	0.0014	5008	,	,		25081	0.002		0.001	False		,,,				2504	0.0051																0																																										SO:0001628	intergenic_variant	0																															18.37:g.14225639delA				RNA	DEL	-	NULL		37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481	0	0.363					ANKRD20A5P	HGNC				0.00	68	0	A			14225639	+1	tier1		no_errors	ENST00000577614	ensembl	human	known	74_37	rna	25.00	57	19	DEL	0.184	-
ARMC4	55130	genome.wustl.edu	37	10	28229562	28229562	+	Missense_Mutation	SNP	C	C	T	rs148908705		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:28229562C>T	ENST00000305242.5	-	13	2008	c.1916G>A	c.(1915-1917)cGg>cAg	p.R639Q	ARMC4_ENST00000537576.1_Missense_Mutation_p.R331Q|ARMC4_ENST00000545014.1_Missense_Mutation_p.R164Q	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	639					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)		p.R639Q(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						CTTCAGCAGCCGAGCCAACAG	0.532																																																	1	Substitution - Missense(1)	large_intestine(1)						C	GLN/ARG	2,4404	4.2+/-10.8	0,2,2201	114.0	100.0	105.0		1916	-0.9	0.0	10	dbSNP_134	105	0,8600		0,0,4300	no	missense	ARMC4	NM_018076.2	43	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	639/1045	28229562	2,13004	2203	4300	6503	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1916G>A	10.37:g.28229562C>T	ENSP00000306410:p.Arg639Gln		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.R639Q	ENST00000305242.5	37	c.1916	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	C	7.143	0.582255	0.13749	4.54E-4	0.0	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	T;T;T	0.67865	-0.29;-0.29;-0.29	5.24	-0.932	0.10435	Armadillo-like helical (1);Armadillo-type fold (2);	0.376195	0.30347	N	0.009821	T	0.50137	0.1598	L	0.40543	1.245	0.09310	N	0.999999	B;B	0.27416	0.178;0.004	B;B	0.21708	0.036;0.008	T	0.35375	-0.9791	10	0.20046	T	0.44	-2.1552	11.6701	0.51396	0.0:0.4794:0.0:0.5206	.	164;639	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	Q	331;639;164	ENSP00000443208:R331Q;ENSP00000306410:R639Q;ENSP00000441076:R164Q	ENSP00000306410:R639Q	R	-	2	0	ARMC4	28269568	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.014000	0.12656	-0.143000	0.11334	-0.137000	0.14449	CGG	ARMC4	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000169126		0.532	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	-	0.00	28	0	C	NM_018076		28229562	-1	tier1	rs148908705	no_errors	ENST00000305242	ensembl	human	known	74_37	missense	31.03	20	9	SNP	0.001	T
ASIC2	40	genome.wustl.edu	37	17	31618690	31618690	+	Intron	SNP	C	C	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:31618690C>G	ENST00000359872.6	-	2	1317				ASIC2_ENST00000225823.2_Missense_Mutation_p.K148N|ASIC2_ENST00000448983.1_5'Flank	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	AGAGGTCCCCCTTGGAGAGGC	0.711																																																	0													23.0	24.0	23.0					17																	31618690		2192	4288	6480	SO:0001627	intron_variant	0			AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179605G>C	17.37:g.31618690C>G			E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.K148N	ENST00000359872.6	37	c.444	CCDS42296.1	17	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383482	0.42207	.	.	ENSG00000108684	ENST00000225823	T	0.63913	-0.07	5.12	4.15	0.48705	.	0.211078	0.39146	N	0.001456	T	0.67571	0.2907	M	0.75615	2.305	0.80722	D	1	P	0.35527	0.507	P	0.49332	0.607	T	0.62581	-0.6824	10	0.15066	T	0.55	-15.8931	7.867	0.29543	0.0:0.811:0.0:0.189	.	148	E9PBX2	.	N	148	ENSP00000225823:K148N	ENSP00000225823:K148N	K	-	3	2	ACCN1	28642803	0.004000	0.15560	1.000000	0.80357	0.987000	0.75469	-0.296000	0.08287	1.924000	0.55735	0.260000	0.18958	AAG	ASIC2	-	pfam_Na+channel_ASC	ENSG00000108684		0.711	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC2	HGNC	protein_coding	OTTHUMT00000447552.1	-	0.00	73	0	C	NM_183377, NM_001094		31618690	-1	tier1	-	no_errors	ENST00000225823	ensembl	human	known	74_37	missense	51.22	20	21	SNP	1.000	G
ATP6V1C2	245973	genome.wustl.edu	37	2	10863041	10863041	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr2:10863041G>A	ENST00000272238.4	+	2	175	c.66G>A	c.(64-66)atG>atA	p.M22I	ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.M22I|AC092687.3_ENST00000452909.1_lincRNA	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	22					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		TGGAGAGGATGAATACTGTAA	0.438																																					NSCLC(188;1042 2136 10807 16813 47705)												0													108.0	104.0	105.0					2																	10863041		2203	4300	6503	SO:0001583	missense	0			AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.66G>A	2.37:g.10863041G>A	ENSP00000272238:p.Met22Ile		Q96EL8	Missense_Mutation	SNP	pfam_ATPase_V1-cplx_csu	p.M22I	ENST00000272238.4	37	c.66	CCDS42653.1	2	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155271	0.57259	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.45276	0.9;0.9	5.57	5.57	0.84162	.	0.138993	0.64402	D	0.000004	T	0.39835	0.1093	L	0.39898	1.24	0.49582	D	0.999805	B;B	0.09022	0.001;0.002	B;B	0.14023	0.003;0.01	T	0.20009	-1.0288	10	0.72032	D	0.01	-9.756	18.3128	0.90206	0.0:0.0:1.0:0.0	.	22;22	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	I	22	ENSP00000272238:M22I;ENSP00000371077:M22I	ENSP00000272238:M22I	M	+	3	0	ATP6V1C2	10780492	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	6.123000	0.71614	2.614000	0.88457	0.655000	0.94253	ATG	ATP6V1C2	-	pfam_ATPase_V1-cplx_csu	ENSG00000143882		0.438	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ATP6V1C2	HGNC	protein_coding	OTTHUMT00000323555.1	-	0.00	83	0	G	NM_144583		10863041	+1	tier1	-	no_errors	ENST00000272238	ensembl	human	known	74_37	missense	18.18	45	10	SNP	1.000	A
ATPAF2	91647	genome.wustl.edu	37	17	17925098	17925098	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:17925098C>T	ENST00000474627.3	-	6	731	c.577G>A	c.(577-579)Gtc>Atc	p.V193I	ATPAF2_ENST00000585101.1_Intron|ATPAF2_ENST00000469327.1_5'UTR	NM_145691.3	NP_663729.1	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly factor 2	193					proton-transporting ATP synthase complex assembly (GO:0043461)	mitochondrion (GO:0005739)|nuclear speck (GO:0016607)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|urinary_tract(1)	8	all_neural(463;0.228)					AGGTGGCTGACGAGCACCTCC	0.547																																																	0													232.0	203.0	213.0					17																	17925098		2203	4300	6503	SO:0001583	missense	0			AF052185	CCDS32585.1	17p11.2	2012-10-12			ENSG00000171953	ENSG00000171953		"""Mitochondrial respiratory chain complex assembly factors"""	18802	protein-coding gene	gene with protein product		608918				11410595, 11997338	Standard	NM_145691		Approved	Atp12p, ATP12, LP3663, MGC29736	uc002gse.1	Q8N5M1	OTTHUMG00000059354	ENST00000474627.3:c.577G>A	17.37:g.17925098C>T	ENSP00000417190:p.Val193Ile		A6NDE5|A8K2J2|Q6XYC7	Missense_Mutation	SNP	pfam_ATP12_ATPase-F1F0-assembly	p.V193I	ENST00000474627.3	37	c.577	CCDS32585.1	17	.	.	.	.	.	.	.	.	.	.	C	10.02	1.235113	0.22626	.	.	ENSG00000171953	ENST00000474627;ENST00000444058	T;T	0.76316	-1.01;-1.01	5.41	-9.79	0.00494	ATPase assembly, ATP12, domain (1);	1.281030	0.04893	N	0.449871	T	0.40347	0.1113	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45527	-0.9255	10	0.37606	T	0.19	-12.9771	7.7394	0.28833	0.0806:0.1749:0.0808:0.6636	.	193	Q8N5M1	ATPF2_HUMAN	I	193	ENSP00000417190:V193I;ENSP00000397198:V193I	ENSP00000434980:V193I	V	-	1	0	ATPAF2	17865823	0.000000	0.05858	0.000000	0.03702	0.580000	0.36256	-0.628000	0.05515	-1.726000	0.01370	-0.175000	0.13238	GTC	ATPAF2	-	NULL	ENSG00000171953		0.547	ATPAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATPAF2	HGNC	protein_coding	OTTHUMT00000131934.3	-	0.00	24	0	C	NM_145691		17925098	-1	tier1	-	no_errors	ENST00000474627	ensembl	human	known	74_37	missense	50.00	13	13	SNP	0.000	T
ATRNL1	26033	genome.wustl.edu	37	10	117221465	117221465	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:117221465G>T	ENST00000355044.3	+	22	3463	c.3337G>T	c.(3337-3339)Gat>Tat	p.D1113Y	ATRNL1_ENST00000423111.2_Missense_Mutation_p.D164Y|ATRNL1_ENST00000303745.7_Intron	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1113					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		CCTTTTGATTGATTATCAATT	0.333																																																	0													160.0	154.0	156.0					10																	117221465		2203	4299	6502	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3337G>T	10.37:g.117221465G>T	ENSP00000347152:p.Asp1113Tyr		O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB_dom,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_EG-like_dom,smart_CUB_dom,smart_Plexin-like_fold,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.D1113Y	ENST00000355044.3	37	c.3337	CCDS7592.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.299224|4.299224	0.81025|0.81025	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000355044;ENST00000423111|ENST00000526373	T;T|.	0.51325|.	0.71;0.71|.	5.05|5.05	5.05|5.05	0.67936|0.67936	.|.	0.091997|.	0.64402|.	D|.	0.000001|.	T|.	0.81917|.	0.4924|.	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.87578|.	0.998;0.997|.	T|.	0.83218|.	-0.0070|.	10|.	0.87932|.	D|.	0|.	-17.1206|-17.1206	18.7909|18.7909	0.91974|0.91974	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	164;1113|.	B4DH41;Q5VV63|.	.;ATRN1_HUMAN|.	Y|L	1113;164|196	ENSP00000347152:D1113Y;ENSP00000409624:D164Y|.	ENSP00000347152:D1113Y|.	D|X	+|+	1|2	0|2	ATRNL1|ATRNL1	117211455|117211455	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.720000|9.720000	0.98763|0.98763	2.522000|2.522000	0.85027|0.85027	0.650000|0.650000	0.86243|0.86243	GAT|TGA	ATRNL1	-	NULL	ENSG00000107518		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	-	0.00	32	0	G	XM_049349		117221465	+1	tier1	-	no_errors	ENST00000355044	ensembl	human	known	74_37	missense	38.36	45	28	SNP	1.000	T
BCL9	607	genome.wustl.edu	37	1	147096223	147096223	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:147096223G>A	ENST00000234739.3	+	10	4484	c.3744G>A	c.(3742-3744)acG>acA	p.T1248T		NM_004326.2	NP_004317.2	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1248	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|myotube differentiation involved in skeletal muscle regeneration (GO:0014908)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				breast(1)|large_intestine(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	7	all_hematologic(923;0.115)					CCAGCCAGACGCTGCAATATT	0.557			T	"""IGH@, IGL@"""	B-ALL																																			Dom	yes		1	1q21	607	B-cell CLL/lymphoma 9		L	0													51.0	55.0	54.0					1																	147096223		2202	4299	6501	SO:0001819	synonymous_variant	0			Y13620	CCDS30833.1	1q21	2008-02-05			ENSG00000116128	ENSG00000116128			1008	protein-coding gene	gene with protein product		602597				9490669	Standard	NM_004326		Approved		uc001epq.3	O00512	OTTHUMG00000014031	ENST00000234739.3:c.3744G>A	1.37:g.147096223G>A			Q5T489	Silent	SNP	pfam_BCL9_beta-catenin-bd_dom	p.T1248	ENST00000234739.3	37	c.3744	CCDS30833.1	1																																																																																			BCL9	-	NULL	ENSG00000116128		0.557	BCL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9	HGNC	protein_coding	OTTHUMT00000039468.1	-	0.00	38	0	G	NM_004326		147096223	+1	tier1	-	no_errors	ENST00000234739	ensembl	human	known	74_37	silent	10.00	45	5	SNP	1.000	A
BIN2	51411	genome.wustl.edu	37	12	51717865	51717865	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr12:51717865C>T	ENST00000267012.4	-	1	83	c.22G>A	c.(22-24)Ggc>Agc	p.G8S	BIN2_ENST00000452142.2_Missense_Mutation_p.G8S|BIN2_ENST00000603260.1_5'UTR|BIN2_ENST00000544402.1_Intron|BIN2_ENST00000604560.1_Missense_Mutation_p.G8S	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	8					cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						CCGGCCGCGCCGCCTGCCTTG	0.701																																																	0													21.0	23.0	22.0					12																	51717865		2187	4271	6458	SO:0001583	missense	0			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.22G>A	12.37:g.51717865C>T	ENSP00000267012:p.Gly8Ser		Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	p.G8S	ENST00000267012.4	37	c.22	CCDS8811.1	12	.	.	.	.	.	.	.	.	.	.	C	13.94	2.387348	0.42308	.	.	ENSG00000110934	ENST00000452142;ENST00000267012	T;T	0.66099	-0.07;-0.19	3.81	3.81	0.43845	.	0.388394	0.24191	N	0.040719	T	0.60907	0.2305	L	0.34521	1.04	0.22903	N	0.998586	D;D	0.89917	1.0;0.999	D;P	0.62955	0.909;0.744	T	0.50625	-0.8806	10	0.07175	T	0.84	-6.3742	11.4905	0.50379	0.0:1.0:0.0:0.0	.	8;8	Q9UBW5-2;Q9UBW5	.;BIN2_HUMAN	S	8	ENSP00000410217:G8S;ENSP00000267012:G8S	ENSP00000267012:G8S	G	-	1	0	BIN2	50004132	0.109000	0.22037	0.998000	0.56505	0.988000	0.76386	0.548000	0.23314	2.426000	0.82243	0.561000	0.74099	GGC	BIN2	-	NULL	ENSG00000110934		0.701	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	HGNC	protein_coding	OTTHUMT00000469800.1	-	0.00	53	0	C			51717865	-1	tier1	-	no_errors	ENST00000267012	ensembl	human	known	74_37	missense	18.00	41	9	SNP	0.989	T
C10orf82	143379	genome.wustl.edu	37	10	118425180	118425180	+	Silent	SNP	G	G	A	rs374577819		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:118425180G>A	ENST00000369210.3	-	3	267	c.213C>T	c.(211-213)tcC>tcT	p.S71S	C10orf82_ENST00000588184.1_Silent_p.S71S	NM_144661.2	NP_653262.1	Q8WW14	CJ082_HUMAN	chromosome 10 open reading frame 82	71										endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7				all cancers(201;0.0143)		CCGTCTCCTCGGAGTTGACAG	0.572																																																	0								G		2,4404	4.2+/-10.8	0,2,2201	119.0	109.0	112.0		213	-5.4	0.0	10		112	0,8600		0,0,4300	no	coding-synonymous	C10orf82	NM_144661.2		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		71/155	118425180	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			BC021737	CCDS7596.1	10q26.12	2012-05-31			ENSG00000165863	ENSG00000165863			28500	protein-coding gene	gene with protein product						12477932	Standard	NM_144661		Approved	MGC33547, Em:AC016825.4	uc001lcr.3	Q8WW14	OTTHUMG00000019105	ENST00000369210.3:c.213C>T	10.37:g.118425180G>A			B3KUM9|D3DRC3	Silent	SNP	NULL	p.S71	ENST00000369210.3	37	c.213	CCDS7596.1	10																																																																																			C10orf82	-	NULL	ENSG00000165863		0.572	C10orf82-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C10orf82	HGNC	protein_coding	OTTHUMT00000050527.1	-	0.00	40	0	G	NM_144661		118425180	-1	tier1	-	no_errors	ENST00000588184	ensembl	human	known	74_37	silent	15.22	39	7	SNP	0.012	A
C17orf85	55421	genome.wustl.edu	37	17	3719429	3719429	+	Silent	SNP	T	T	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:3719429T>G	ENST00000389005.4	-	11	1473	c.1446A>C	c.(1444-1446)ccA>ccC	p.P482P	C17orf85_ENST00000158149.3_Silent_p.P202P	NM_001114118.2	NP_001107590.1	Q53F19	CQ085_HUMAN	chromosome 17 open reading frame 85	482							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		TACTGCTGACTGGTGGCCGTG	0.468																																																	0													88.0	75.0	79.0					17																	3719429		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS45578.1	17p13.2	2012-10-23			ENSG00000074356	ENSG00000074356			24612	protein-coding gene	gene with protein product	"""ELG protein"""					11412301	Standard	NM_001114118		Approved	HSA277841, ELG	uc010ckl.2	Q53F19	OTTHUMG00000177672	ENST00000389005.4:c.1446A>C	17.37:g.3719429T>G			B3KWG7|Q7L406|Q96FK1|Q9NXZ4	Silent	SNP	pfam_DUF2414	p.P482	ENST00000389005.4	37	c.1446	CCDS45578.1	17																																																																																			C17orf85	-	NULL	ENSG00000074356		0.468	C17orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf85	HGNC	protein_coding	OTTHUMT00000438385.1	-	0.00	61	0	T	NM_018553		3719429	-1	tier1	-	no_errors	ENST00000389005	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.288	G
C3	718	genome.wustl.edu	37	19	6697509	6697509	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr19:6697509C>T	ENST00000245907.6	-	21	2734	c.2642G>A	c.(2641-2643)cGt>cAt	p.R881H		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	881					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	CTGCTGGTGACGCCTCTTGGT	0.582																																																	0													111.0	87.0	95.0					19																	6697509		2203	4300	6503	SO:0001583	missense	0			J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.2642G>A	19.37:g.6697509C>T	ENSP00000245907:p.Arg881His		A7E236	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_Netrin_module_non-TIMP,pfam_A2M_N_2,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,prints_Anaphylatoxn_comp_syst_dom,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain	p.R881H	ENST00000245907.6	37	c.2642	CCDS32883.1	19	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946206	0.73672	.	.	ENSG00000125730	ENST00000245907	T	0.34667	1.35	5.96	1.52	0.23074	.	2.382910	0.01040	N	0.004281	T	0.57446	0.2054	M	0.80746	2.51	0.09310	N	0.999999	D	0.71674	0.998	P	0.59012	0.85	T	0.12116	-1.0560	10	0.62326	D	0.03	.	5.3561	0.16061	0.0:0.5663:0.1398:0.2939	.	881	P01024	CO3_HUMAN	H	881	ENSP00000245907:R881H	ENSP00000245907:R881H	R	-	2	0	C3	6648509	0.013000	0.17824	0.396000	0.26296	0.836000	0.47400	0.773000	0.26661	0.416000	0.25844	0.650000	0.86243	CGT	C3	-	NULL	ENSG00000125730		0.582	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3	HGNC	protein_coding	OTTHUMT00000317636.2	-	0.00	60	0	C	NM_000064		6697509	-1	tier1	-	no_errors	ENST00000245907	ensembl	human	known	74_37	missense	25.56	67	23	SNP	0.064	T
C4orf50	389197	genome.wustl.edu	37	4	5981916	5981916	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr4:5981916C>T	ENST00000324058.5	-	2	242	c.153G>A	c.(151-153)gaG>gaA	p.E51E	C4orf50_ENST00000531445.1_Silent_p.E525E			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50	51										breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						CCTGGAGCTCCTCCTGGAGGC	0.647																																																	0													22.0	22.0	22.0					4																	5981916		2185	4262	6447	SO:0001819	synonymous_variant	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.153G>A	4.37:g.5981916C>T				Silent	SNP	NULL	p.E525	ENST00000324058.5	37	c.1575		4																																																																																			C4orf50	-	NULL	ENSG00000181215		0.647	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		-	0.00	46	0	C	NM_207405		5981916	-1	tier1	-	no_errors	ENST00000531445	ensembl	human	known	74_37	silent	17.24	48	10	SNP	0.001	T
CA8	767	genome.wustl.edu	37	8	61121437	61121437	+	Silent	SNP	T	T	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr8:61121437T>C	ENST00000317995.4	-	8	1044	c.780A>G	c.(778-780)gcA>gcG	p.A260A		NM_004056.4	NP_004047.3	P35219	CAH8_HUMAN	carbonic anhydrase VIII	260					one-carbon metabolic process (GO:0006730)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasm (GO:0005737)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|prostate(2)|skin(1)	16		all_cancers(86;0.172)|all_epithelial(80;0.0383)|all_lung(136;0.0413)|Lung NSC(129;0.0474)			Zonisamide(DB00909)	CCACAAGTTCTGCCCCCTTAA	0.413																																																	0													115.0	103.0	107.0					8																	61121437		2203	4300	6503	SO:0001819	synonymous_variant	0			L04656	CCDS6174.1	8q12.1	2012-08-21			ENSG00000178538	ENSG00000178538		"""Carbonic anhydrases"""	1382	protein-coding gene	gene with protein product		114815		CALS		17219437	Standard	NM_004056		Approved	CARP	uc003xtz.1	P35219	OTTHUMG00000165325	ENST00000317995.4:c.780A>G	8.37:g.61121437T>C			A8K0A5|B3KQZ7|Q32MY2	Silent	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.A260	ENST00000317995.4	37	c.780	CCDS6174.1	8																																																																																			CA8	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000178538		0.413	CA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA8	HGNC	protein_coding	OTTHUMT00000383445.1	-	0.00	76	0	T			61121437	-1	tier1	-	no_errors	ENST00000317995	ensembl	human	known	74_37	silent	7.95	81	7	SNP	1.000	C
CACNB1	782	genome.wustl.edu	37	17	37343091	37343091	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:37343091C>T	ENST00000394303.3	-	5	713	c.506G>A	c.(505-507)cGc>cAc	p.R169H	CACNB1_ENST00000582877.1_5'UTR|CACNB1_ENST00000394310.3_Missense_Mutation_p.R169H|CACNB1_ENST00000344140.5_Missense_Mutation_p.R169H	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	169					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGCAGCAGGCGAAGGCTGTC	0.602																																					Esophageal Squamous(5;100 366 38393 41452 45827)												0													63.0	60.0	61.0					17																	37343091		2203	4300	6503	SO:0001583	missense	0				CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.506G>A	17.37:g.37343091C>T	ENSP00000377840:p.Arg169His		A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b1su	p.R169H	ENST00000394303.3	37	c.506	CCDS42311.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.238418	0.95240	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	D;D;D	0.83506	-1.73;-1.73;-1.73	5.06	5.06	0.68205	Src homology-3 domain (1);	0.000000	0.85682	D	0.000000	D	0.91119	0.7204	M	0.78916	2.43	0.80722	D	1	D;D;D;D;D	0.89917	0.999;0.998;1.0;0.999;1.0	D;D;D;D;D	0.87578	0.989;0.966;0.998;0.984;0.991	D	0.92312	0.5858	10	0.87932	D	0	-12.5295	17.1868	0.86868	0.0:1.0:0.0:0.0	.	122;169;169;169;169	F5H6X1;Q6TME4;Q02641-2;Q02641-3;Q02641	.;.;.;.;CACB1_HUMAN	H	119;169;169;169;122	ENSP00000377840:R169H;ENSP00000345461:R169H;ENSP00000377847:R169H	ENSP00000345461:R169H	R	-	2	0	CACNB1	34596617	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.711000	0.84669	2.362000	0.80069	0.313000	0.20887	CGC	CACNB1	-	superfamily_SH3_domain	ENSG00000067191		0.602	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB1	HGNC	protein_coding	OTTHUMT00000256945.3	-	0.00	54	0	C			37343091	-1	tier1	-	no_errors	ENST00000394303	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	T
CC2D1B	200014	genome.wustl.edu	37	1	52821306	52821306	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:52821306G>A	ENST00000371586.2	-	20	2317	c.2179C>T	c.(2179-2181)Cgg>Tgg	p.R727W	RP11-155O18.6_ENST00000606527.1_RNA|CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Missense_Mutation_p.R721W|CC2D1B_ENST00000438831.1_Missense_Mutation_p.R102W	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	727	C2.					nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						AACTCAAACCGCACAAAAGCA	0.552																																																	0													64.0	64.0	64.0					1																	52821306		2203	4300	6503	SO:0001583	missense	0			AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.2179C>T	1.37:g.52821306G>A	ENSP00000360642:p.Arg727Trp		Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_DM14,smart_C2_dom	p.R727W	ENST00000371586.2	37	c.2179	CCDS30714.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060073	0.76074	.	.	ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371573;ENST00000438831	T;T;T	0.26223	1.75;1.75;1.75	4.68	4.68	0.58851	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.205916	0.39146	N	0.001448	T	0.44540	0.1298	L	0.59436	1.845	0.46901	D	0.999249	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.984;0.991	T	0.34601	-0.9822	10	0.87932	D	0	-18.0576	10.9815	0.47497	0.0:0.0:0.6921:0.3079	.	507;721;727	Q5T0G1;Q5T0F9-2;Q5T0F9	.;.;C2D1B_HUMAN	W	727;721;635;102	ENSP00000360642:R727W;ENSP00000284376:R721W;ENSP00000406300:R102W	ENSP00000284376:R721W	R	-	1	2	CC2D1B	52593894	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	2.451000	0.44952	2.598000	0.87819	0.561000	0.74099	CGG	CC2D1B	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	ENSG00000154222		0.552	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CC2D1B	HGNC	protein_coding	OTTHUMT00000022189.1	-	0.00	28	0	G	NM_032449		52821306	-1	tier1	-	no_errors	ENST00000371586	ensembl	human	known	74_37	missense	14.29	23	4	SNP	1.000	A
CCDC71	64925	genome.wustl.edu	37	3	49201104	49201104	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr3:49201104C>T	ENST00000321895.6	-	2	644	c.538G>A	c.(538-540)Gag>Aag	p.E180K		NM_022903.3	NP_075054.3	Q8IV32	CCD71_HUMAN	coiled-coil domain containing 71	180										endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	10				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		ACCAGGGCCTCAAGGACAACA	0.587																																																	0													56.0	61.0	59.0					3																	49201104		2203	4300	6503	SO:0001583	missense	0			AK022862	CCDS2790.1	3p21.31	2014-02-12			ENSG00000177352	ENSG00000177352			25760	protein-coding gene	gene with protein product						12477932	Standard	NM_022903		Approved	FLJ12800	uc003cwg.4	Q8IV32	OTTHUMG00000156815	ENST00000321895.6:c.538G>A	3.37:g.49201104C>T	ENSP00000319006:p.Glu180Lys		Q6IPE2|Q9H8H4|Q9H9F1	Missense_Mutation	SNP	NULL	p.E180K	ENST00000321895.6	37	c.538	CCDS2790.1	3	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709157	0.68615	.	.	ENSG00000177352	ENST00000321895	T	0.37058	1.22	5.44	5.44	0.79542	.	0.147304	0.44688	D	0.000427	T	0.61324	0.2338	M	0.68952	2.095	0.43054	D	0.994661	D	0.89917	1.0	D	0.87578	0.998	T	0.64296	-0.6441	10	0.87932	D	0	-14.9245	19.2503	0.93921	0.0:1.0:0.0:0.0	.	180	Q8IV32	CCD71_HUMAN	K	180	ENSP00000319006:E180K	ENSP00000319006:E180K	E	-	1	0	CCDC71	49176108	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.108000	0.64609	2.565000	0.86533	0.585000	0.79938	GAG	CCDC71	-	NULL	ENSG00000177352		0.587	CCDC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC71	HGNC	protein_coding	OTTHUMT00000345980.1	-	0.00	41	0	C	NM_022903		49201104	-1	tier1	-	no_errors	ENST00000321895	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	T
CDC40	51362	genome.wustl.edu	37	6	110541037	110541037	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:110541037C>T	ENST00000368932.1	+	13	1406	c.1305C>T	c.(1303-1305)agC>agT	p.S435S	CDC40_ENST00000307731.1_Silent_p.S435S|CDC40_ENST00000368930.1_Silent_p.S435S			O60508	PRP17_HUMAN	cell division cycle 40	435					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		GATTTGTGAGCACATCTGATG	0.373																																																	0													193.0	175.0	181.0					6																	110541037		2203	4300	6503	SO:0001819	synonymous_variant	0			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.1305C>T	6.37:g.110541037C>T			B2RBC5|O75471|Q5SRN0|Q9UPG1	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S435	ENST00000368932.1	37	c.1305	CCDS5081.1	6																																																																																			CDC40	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000168438		0.373	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	HGNC	protein_coding	OTTHUMT00000041791.1	-	0.00	31	0	C	NM_015891		110541037	+1	tier1	-	no_errors	ENST00000307731	ensembl	human	known	74_37	silent	11.76	30	4	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109816112	109816112	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:109816112G>A	ENST00000271332.3	+	33	8625	c.8564G>A	c.(8563-8565)cGg>cAg	p.R2855Q	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2855					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AGCCTCCTGCGGCTCCCCCTG	0.697																																					NSCLC(158;1285 2011 34800 34852 42084)												0													14.0	19.0	17.0					1																	109816112		2185	4286	6471	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.8564G>A	1.37:g.109816112G>A	ENSP00000271332:p.Arg2855Gln		Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R2855Q	ENST00000271332.3	37	c.8564	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.113634	0.37339	.	.	ENSG00000143126	ENST00000271332	T	0.74209	-0.82	4.44	4.44	0.53790	.	.	.	.	.	T	0.52403	0.1732	L	0.49778	1.585	0.38709	D	0.953181	P	0.49253	0.921	B	0.37047	0.24	T	0.61821	-0.6984	9	0.51188	T	0.08	.	9.7315	0.40363	0.0973:0.0:0.9027:0.0	.	2855	Q9HCU4	CELR2_HUMAN	Q	2855	ENSP00000271332:R2855Q	ENSP00000271332:R2855Q	R	+	2	0	CELSR2	109617635	0.231000	0.23751	0.863000	0.33907	0.305000	0.27757	2.078000	0.41567	2.292000	0.77174	0.561000	0.74099	CGG	CELSR2	-	NULL	ENSG00000143126		0.697	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	-	0.00	21	0	G	NM_001408		109816112	+1	tier1	-	no_errors	ENST00000271332	ensembl	human	known	74_37	missense	40.00	12	8	SNP	1.000	A
CEP170B	283638	genome.wustl.edu	37	14	105359964	105359964	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr14:105359964C>T	ENST00000414716.3	+	15	4371	c.4143C>T	c.(4141-4143)gaC>gaT	p.D1381D	CEP170B_ENST00000453495.1_Silent_p.D1417D|CEP170B_ENST00000556508.1_Silent_p.D1346D|CEP170B_ENST00000418279.1_Silent_p.D1311D	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1416						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GCTGTGAGGACGCCCTGGCCA	0.672																																																	0													15.0	19.0	17.0					14																	105359964		2133	4221	6354	SO:0001819	synonymous_variant	0			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.4143C>T	14.37:g.105359964C>T			Q2KHR7|Q86TI7	Silent	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.D1417	ENST00000414716.3	37	c.4251	CCDS45175.1	14																																																																																			CEP170B	-	NULL	ENSG00000099814		0.672	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP170B	HGNC	protein_coding	OTTHUMT00000410289.2	-	0.00	55	0	C	NM_001112726		105359964	+1	tier1	-	no_errors	ENST00000453495	ensembl	human	known	74_37	silent	13.21	46	7	SNP	0.000	T
CLIP2	7461	genome.wustl.edu	37	7	73790244	73790244	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr7:73790244G>A	ENST00000395060.1	+	9	1513	c.1513G>A	c.(1513-1515)Gtg>Atg	p.V505M	CLIP2_ENST00000223398.6_Missense_Mutation_p.V505M|CLIP2_ENST00000361545.5_Missense_Mutation_p.V470M			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	505						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						GAAGTCGCGCGTGCTGCAGCT	0.657																																																	0													13.0	12.0	12.0					7																	73790244		2189	4291	6480	SO:0001583	missense	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.1513G>A	7.37:g.73790244G>A	ENSP00000378500:p.Val505Met		O14527|O43611	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.V505M	ENST00000395060.1	37	c.1513	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998096	0.54147	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060;ENST00000537700	T;T;T	0.61627	0.09;0.13;0.09	5.11	4.02	0.46733	.	0.194204	0.45361	D	0.000369	T	0.57257	0.2041	L	0.40543	1.245	0.37150	D	0.902102	D;D	0.61080	0.989;0.982	P;P	0.55965	0.788;0.565	T	0.64516	-0.6389	10	0.72032	D	0.01	-34.209	6.9882	0.24741	0.2411:0.0:0.7589:0.0	.	470;505	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	M	505;505;470;505;47	ENSP00000223398:V505M;ENSP00000355151:V470M;ENSP00000378500:V505M	ENSP00000223398:V505M	V	+	1	0	CLIP2	73428180	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	4.206000	0.58473	2.375000	0.81037	0.558000	0.71614	GTG	CLIP2	-	NULL	ENSG00000106665		0.657	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	-	0.00	35	0	G	NM_003388		73790244	+1	tier1	-	no_errors	ENST00000223398	ensembl	human	known	74_37	missense	35.48	20	11	SNP	1.000	A
CNGB1	1258	genome.wustl.edu	37	16	57965772	57965772	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:57965772C>T	ENST00000251102.8	-	17	1443	c.1383G>A	c.(1381-1383)acG>acA	p.T461T	CNGB1_ENST00000564448.1_Silent_p.T455T|CNGB1_ENST00000564654.1_5'UTR	NM_001297.4	NP_001288.3	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1	461					cation transport (GO:0006812)|cytosolic calcium ion homeostasis (GO:0051480)|detection of light stimulus involved in visual perception (GO:0050908)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|protein heterotetramerization (GO:0051290)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina homeostasis (GO:0001895)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of smell (GO:0007608)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|intracellular cyclic nucleotide activated cation channel complex (GO:0017071)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|transmembrane transporter complex (GO:1902495)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(7)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(11)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	54						GGTGCTGTTTCGTGGCAGGCA	0.547																																					Colon(156;1293 1853 16336 28962 38659)												0													47.0	52.0	51.0					16																	57965772		2005	4174	6179	SO:0001819	synonymous_variant	0			AF042498	CCDS42169.1, CCDS45495.1, CCDS67042.1	16q13	2013-02-14			ENSG00000070729	ENSG00000070729		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2151	protein-coding gene	gene with protein product	"""glutamic acid-rich protein"""	600724		CNCG2, CNCG3L		8766832, 7590744, 16382102	Standard	NM_001297		Approved	RCNC2, RCNCb, GARP, GAR1, CNGB1B, RP45	uc002emt.2	Q14028	OTTHUMG00000154810	ENST00000251102.8:c.1383G>A	16.37:g.57965772C>T			H3BN09|O43636|Q13059|Q14029|Q9UMG2	Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.T461	ENST00000251102.8	37	c.1383	CCDS42169.1	16																																																																																			CNGB1	-	NULL	ENSG00000070729		0.547	CNGB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGB1	HGNC	protein_coding	OTTHUMT00000337167.2	-	0.00	65	0	C	NM_001297		57965772	-1	tier1	-	no_errors	ENST00000251102	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.000	T
COL9A3	1299	genome.wustl.edu	37	20	61472147	61472147	+	3'UTR	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:61472147C>T	ENST00000343916.3	+	0	2121				COL9A3_ENST00000462700.1_3'UTR	NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CATGAAGGAGCGGGGGTGTGG	0.652																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.*63C>T	20.37:g.61472147C>T			Q13681|Q9H4G9|Q9UPE2	RNA	SNP	-	NULL	ENST00000343916.3	37	NULL	CCDS13505.1	20																																																																																			COL9A3	-	-	ENSG00000092758		0.652	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	HGNC	protein_coding	OTTHUMT00000080071.2	-	0.00	25	0	C	NM_001853		61472147	+1	tier1	-	no_errors	ENST00000462700	ensembl	human	putative	74_37	rna	35.14	24	13	SNP	0.000	T
CSNK1A1	1452	genome.wustl.edu	37	5	148876034	148876034	+	3'UTR	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:148876034G>A	ENST00000377843.2	-	0	1875				CSNK1A1_ENST00000261798.5_3'UTR|CSNK1A1_ENST00000504676.1_3'UTR|CSNK1A1_ENST00000515435.1_3'UTR|CTB-89H12.4_ENST00000412431.2_RNA	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1						cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		TGTTCATGCCGTTCTTCTGAA	0.378																																					Colon(5;64 69 1309 10383)												0																																										SO:0001624	3_prime_UTR_variant	0			AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.*382C>T	5.37:g.148876034G>A			D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	RNA	SNP	-	NULL	ENST00000377843.2	37	NULL	CCDS47303.1	5																																																																																			CTB-89H12.4	-	-	ENSG00000230551		0.378	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	CSNK1A1	Clone_based_vega_gene	protein_coding		-	0.00	17	0	G	NM_001892		148876034	-1	tier1	-	no_errors	ENST00000412431	ensembl	human	known	74_37	rna	33.33	10	5	SNP	0.985	A
DDX3X	1654	genome.wustl.edu	37	X	41198321	41198321	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrX:41198321C>T	ENST00000399959.2	+	3	991	c.136C>T	c.(136-138)Cga>Tga	p.R46*	DDX3X_ENST00000441189.2_Nonsense_Mutation_p.R46*|DDX3X_ENST00000542215.1_Nonsense_Mutation_p.R90*|DDX3X_ENST00000478993.1_3'UTR|DDX3X_ENST00000457138.2_Intron	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	46	Interaction with EIF4E.|Required for TBK1 and IKBKE-dependent IFN-beta activation.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TTTAAGGAACCGAGAAGCTAC	0.338										HNSCC(61;0.18)																																							0													90.0	77.0	81.0					X																	41198321		1804	4075	5879	SO:0001587	stop_gained	0			U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.136C>T	X.37:g.41198321C>T	ENSP00000382840:p.Arg46*		A8K538|B4E3E8|O15536	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R46*	ENST00000399959.2	37	c.136	CCDS43931.1	X	.	.	.	.	.	.	.	.	.	.	C	22.7	4.320583	0.81469	.	.	ENSG00000215301	ENST00000399959;ENST00000441189;ENST00000542215	.	.	.	5.42	3.0	0.34707	.	0.052093	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1954	10.7934	0.46447	0.6138:0.3862:0.0:0.0	.	.	.	.	X	46;46;90	.	ENSP00000382840:R46X	R	+	1	2	DDX3X	41083265	1.000000	0.71417	0.999000	0.59377	0.798000	0.45092	4.852000	0.62904	0.184000	0.20083	-0.490000	0.04691	CGA	DDX3X	-	NULL	ENSG00000215301		0.338	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3X	HGNC	protein_coding	OTTHUMT00000056253.1	-	0.00	23	0	C	NM_024005		41198321	+1	tier1	-	no_errors	ENST00000399959	ensembl	human	known	74_37	nonsense	44.00	14	11	SNP	1.000	T
DDX3Y	8653	genome.wustl.edu	37	Y	15029443	15029443	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrY:15029443G>T	ENST00000336079.3	+	16	1998	c.1892G>T	c.(1891-1893)gGa>gTa	p.G631V	DDX3Y_ENST00000360160.4_Missense_Mutation_p.G631V	NM_001122665.1|NM_004660.3	NP_001116137.1|NP_004651.2	O15523	DDX3Y_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, Y-linked	631						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			kidney(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	5						AACAGCAGAGGATTTGGTGGA	0.453																																																	0																																										SO:0001583	missense	0			AF000984	CCDS14782.1	Yq11	2013-07-16	2013-07-16	2003-06-20	ENSG00000067048	ENSG00000067048		"""DEAD-boxes"""	2699	protein-coding gene	gene with protein product		400010	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide, Y chromosome"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked"""	DBY		9381176	Standard	NM_004660		Approved		uc004fsv.2	O15523	OTTHUMG00000036324	ENST00000336079.3:c.1892G>T	Y.37:g.15029443G>T	ENSP00000336725:p.Gly631Val		B4DK29|B4DXX7|Q8IYV7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G631V	ENST00000336079.3	37	c.1892	CCDS14782.1	Y																																																																																			DDX3Y	-	NULL	ENSG00000067048		0.453	DDX3Y-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX3Y	HGNC	protein_coding	OTTHUMT00000088407.1	-	0.00	48	0	G	NM_004660		15029443	+1	tier1	-	no_errors	ENST00000336079	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
DIAPH1	1729	genome.wustl.edu	37	5	140957145	140957145	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:140957145C>T	ENST00000398557.4	-	12	1317	c.1177G>A	c.(1177-1179)Gtc>Atc	p.V393I	DIAPH1_ENST00000389057.5_Missense_Mutation_p.V384I|DIAPH1_ENST00000520569.1_Missense_Mutation_p.V339I|DIAPH1_ENST00000389054.3_Missense_Mutation_p.V393I|DIAPH1_ENST00000398562.2_Missense_Mutation_p.V384I|DIAPH1_ENST00000518047.1_Missense_Mutation_p.V384I|DIAPH1_ENST00000253811.6_Missense_Mutation_p.V393I|DIAPH1_ENST00000398566.3_Missense_Mutation_p.V384I	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	393	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTGAAAGACTTCATTAAAG	0.403																																																	0													110.0	106.0	108.0					5																	140957145		1864	4101	5965	SO:0001583	missense	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1177G>A	5.37:g.140957145C>T	ENSP00000381565:p.Val393Ile		A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.V393I	ENST00000398557.4	37	c.1177	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	C	14.48	2.549236	0.45383	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047	D;D;D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	5.77	3.99	0.46301	GTPase-binding/formin homology 3 (1);Diaphanous FH3 (1);Armadillo-type fold (1);	0.406292	0.21019	N	0.081549	T	0.71108	0.3301	N	0.20845	0.615	0.46564	D	0.999107	B;B	0.27823	0.19;0.19	B;B	0.26094	0.066;0.066	T	0.65932	-0.6048	10	0.45353	T	0.12	.	11.1759	0.48598	0.0:0.8494:0.0:0.1506	.	384;393	E9PEZ2;O60610	.;DIAP1_HUMAN	I	393;339;384;384;384;393;393;384	ENSP00000373706:V393I;ENSP00000429282:V339I;ENSP00000381570:V384I;ENSP00000373709:V384I;ENSP00000381572:V384I;ENSP00000381565:V393I;ENSP00000253811:V393I;ENSP00000428268:V384I	ENSP00000253811:V393I	V	-	1	0	DIAPH1	140937329	0.993000	0.37304	1.000000	0.80357	0.978000	0.69477	1.978000	0.40598	0.788000	0.33755	0.467000	0.42956	GTC	DIAPH1	-	pfam_FH3_dom,superfamily_ARM-type_fold	ENSG00000131504		0.403	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		-	0.00	36	0	C	NM_005219		140957145	-1	tier1	-	no_errors	ENST00000253811	ensembl	human	known	74_37	missense	97.22	1	35	SNP	1.000	T
DLGAP4	22839	genome.wustl.edu	37	20	35060728	35060728	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:35060728G>T	ENST00000373907.2	+	2	807	c.608G>T	c.(607-609)gGc>gTc	p.G203V	DLGAP4_ENST00000401952.2_Missense_Mutation_p.G203V|DLGAP4_ENST00000373913.3_Missense_Mutation_p.G203V|DLGAP4_ENST00000339266.5_Missense_Mutation_p.G203V			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	203					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				AACATCTCAGGCTGGTGGAGC	0.672																																																	0													39.0	48.0	45.0					20																	35060728		2203	4299	6502	SO:0001583	missense	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.608G>T	20.37:g.35060728G>T	ENSP00000363014:p.Gly203Val		E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	pfam_GKAP	p.G203V	ENST00000373907.2	37	c.608		20	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390864	0.82902	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.28255	1.62;1.62;1.67;1.67	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.57917	0.2086	M	0.73430	2.235	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62358	-0.6871	10	0.87932	D	0	.	17.8061	0.88601	0.0:0.0:1.0:0.0	.	203	Q9Y2H0-1	.	V	203	ENSP00000363023:G203V;ENSP00000384954:G203V;ENSP00000363014:G203V;ENSP00000341633:G203V	ENSP00000341633:G203V	G	+	2	0	DLGAP4	34494142	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	6.712000	0.74681	2.438000	0.82558	0.462000	0.41574	GGC	DLGAP4	-	NULL	ENSG00000080845		0.672	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	-	0.00	51	0	G	NM_014902		35060728	+1	tier1	-	no_errors	ENST00000339266	ensembl	human	known	74_37	missense	6.17	76	5	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118556217	118556217	+	Silent	SNP	G	G	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:118556217G>C	ENST00000311085.8	+	35	8081	c.8001G>C	c.(7999-8001)ctG>ctC	p.L2667L	DMXL1_ENST00000505312.1_3'UTR|DMXL1_ENST00000539542.1_Silent_p.L2688L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2667										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTCAAGAACTGGATGTTTCTG	0.363																																																	0													107.0	103.0	104.0					5																	118556217		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8001G>C	5.37:g.118556217G>C				Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L2688	ENST00000311085.8	37	c.8064	CCDS4125.1	5																																																																																			DMXL1	-	NULL	ENSG00000172869		0.363	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	-	0.00	24	0	G	NM_005509		118556217	+1	tier1	-	no_errors	ENST00000539542	ensembl	human	known	74_37	silent	18.52	22	5	SNP	0.998	C
DNAJB8	165721	genome.wustl.edu	37	3	128182859	128182859	+	5'UTR	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr3:128182859C>T	ENST00000469083.1	-	0	1787				DNAJB8-AS1_ENST00000471626.1_RNA|DNAJB8_ENST00000319153.3_5'UTR			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8						chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		acacacagtgctcaaggtcac	0.552																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.-771G>A	3.37:g.128182859C>T			B3KWV7	RNA	SNP	-	NULL	ENST00000469083.1	37	NULL	CCDS3048.1	3																																																																																			DNAJB8-AS1	-	-	ENSG00000242049		0.552	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJB8-AS1	HGNC	protein_coding	OTTHUMT00000356933.1	-	0.00	29	0	C	NM_153330		128182859	+1	tier1	-	no_errors	ENST00000471626	ensembl	human	known	74_37	rna	46.67	16	14	SNP	0.265	T
DNTTIP1	116092	genome.wustl.edu	37	20	44424079	44424079	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:44424079G>T	ENST00000372622.3	+	4	437	c.369G>T	c.(367-369)gaG>gaT	p.E123D		NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	123						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				GCTGCCTGGAGCAGGTGAGAC	0.557																																																	0													39.0	26.0	30.0					20																	44424079		2202	4300	6502	SO:0001583	missense	0			AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.369G>T	20.37:g.44424079G>T	ENSP00000361705:p.Glu123Asp		B2RA18|Q96DE3|Q9BQP2|Q9H148	Missense_Mutation	SNP	NULL	p.E123D	ENST00000372622.3	37	c.369	CCDS13369.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	19.32|19.32	3.805549|3.805549	0.70682|0.70682	.|.	.|.	ENSG00000101457|ENSG00000101457	ENST00000372622;ENST00000449078;ENST00000415790|ENST00000435014	T;T|.	0.56941|.	0.43;0.56|.	5.47|5.47	-0.00389|-0.00389	0.14024|0.14024	.|.	0.088059|.	0.85682|.	D|.	0.000000|.	T|T	0.54935|0.54935	0.1889|0.1889	L|L	0.46741|0.46741	1.465|1.465	0.44295|0.44295	D|D	0.997168|0.997168	P|.	0.50272|.	0.933|.	P|.	0.47251|.	0.542|.	T|T	0.48790|0.48790	-0.9004|-0.9004	10|5	0.44086|.	T|.	0.13|.	-27.3276|-27.3276	10.3318|10.3318	0.43827|0.43827	0.3922:0.0:0.6078:0.0|0.3922:0.0:0.6078:0.0	.|.	123|.	Q9H147|.	TDIF1_HUMAN|.	D|I	123;118;83|50	ENSP00000361705:E123D;ENSP00000392509:E83D|.	ENSP00000361705:E123D|.	E|S	+|+	3|2	2|0	DNTTIP1|DNTTIP1	43857486|43857486	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.942000|0.942000	0.58702|0.58702	0.816000|0.816000	0.27267|0.27267	0.151000|0.151000	0.19162|0.19162	-0.147000|-0.147000	0.13772|0.13772	GAG|AGC	DNTTIP1	-	NULL	ENSG00000101457		0.557	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNTTIP1	HGNC	protein_coding	OTTHUMT00000079502.1	-	0.00	28	0	G	NM_052951		44424079	+1	tier1	-	no_errors	ENST00000372622	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.995	T
EHBP1	23301	genome.wustl.edu	37	2	63091905	63091905	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr2:63091905A>T	ENST00000263991.5	+	10	1384	c.902A>T	c.(901-903)gAc>gTc	p.D301V	EHBP1_ENST00000354487.3_Missense_Mutation_p.D266V|EHBP1_ENST00000405289.1_Missense_Mutation_p.D266V|EHBP1_ENST00000431489.1_Missense_Mutation_p.D266V|EHBP1_ENST00000405015.3_Missense_Mutation_p.D266V	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	301						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AAAACAGAAGACTCTTTTTAT	0.328																																																	0													71.0	80.0	77.0					2																	63091905		2200	4300	6500	SO:0001583	missense	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.902A>T	2.37:g.63091905A>T	ENSP00000263991:p.Asp301Val		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.D301V	ENST00000263991.5	37	c.902	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	A	13.48	2.251219	0.39797	.	.	ENSG00000115504	ENST00000405015;ENST00000405482;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T;T	0.74632	-0.86;0.8;-0.86;-0.86;-0.84;-0.84	5.54	5.54	0.83059	.	0.122998	0.56097	D	0.000030	T	0.66771	0.2823	N	0.22421	0.69	0.58432	D	0.999999	B;B;B	0.26258	0.119;0.096;0.145	B;B;B	0.34093	0.175;0.122;0.115	T	0.65421	-0.6172	10	0.48119	T	0.1	.	15.9665	0.79974	1.0:0.0:0.0:0.0	.	266;266;301	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	V	266;266;266;301;266;266	ENSP00000384143:D266V;ENSP00000384829:D266V;ENSP00000403783:D266V;ENSP00000263991:D301V;ENSP00000346482:D266V;ENSP00000385524:D266V	ENSP00000263991:D301V	D	+	2	0	EHBP1	62945409	1.000000	0.71417	0.995000	0.50966	0.645000	0.38454	5.783000	0.68982	2.231000	0.72958	0.455000	0.32223	GAC	EHBP1	-	NULL	ENSG00000115504		0.328	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	-	0.00	21	0	A	NM_015252		63091905	+1	tier1	-	no_errors	ENST00000263991	ensembl	human	known	74_37	missense	90.00	2	18	SNP	0.997	T
DYSF	8291	genome.wustl.edu	37	2	71827929	71827929	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr2:71827929C>A	ENST00000258104.3	+	34	4077	c.3800C>A	c.(3799-3801)tCg>tAg	p.S1267*	DYSF_ENST00000410041.1_Nonsense_Mutation_p.S1285*|DYSF_ENST00000413539.2_Nonsense_Mutation_p.S1298*|DYSF_ENST00000409366.1_Nonsense_Mutation_p.S1268*|DYSF_ENST00000409744.1_Nonsense_Mutation_p.S1254*|DYSF_ENST00000394120.2_Nonsense_Mutation_p.S1268*|DYSF_ENST00000429174.2_Nonsense_Mutation_p.S1267*|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409651.1_Nonsense_Mutation_p.S1299*|DYSF_ENST00000410020.3_Nonsense_Mutation_p.S1285*|DYSF_ENST00000409762.1_Nonsense_Mutation_p.S1284*|DYSF_ENST00000409582.3_Nonsense_Mutation_p.S1284*	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1267					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGCCAGCCGTCGGGGGAGCTG	0.622																																																	0													51.0	59.0	56.0					2																	71827929		2203	4299	6502	SO:0001587	stop_gained	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.3800C>A	2.37:g.71827929C>A	ENSP00000258104:p.Ser1267*		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Nonsense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.S1298*	ENST00000258104.3	37	c.3893	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.545165	0.98857	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	.	.	.	5.56	5.56	0.83823	.	0.158423	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-7.3271	10.4673	0.44616	0.0:0.9116:0.0:0.0884	.	.	.	.	X	1298;1284;1284;1267;1267;1299;1268;1254;1268;1285;1285	.	ENSP00000258104:S1267X	S	+	2	0	DYSF	71681437	0.996000	0.38824	0.009000	0.14445	0.131000	0.20780	3.679000	0.54634	2.628000	0.89032	0.591000	0.81541	TCG	DYSF	-	superfamily_C2_dom	ENSG00000135636		0.622	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	-	0.00	64	0	C	NM_003494		71827929	+1	tier1	-	no_errors	ENST00000413539	ensembl	human	known	74_37	nonsense	19.61	41	10	SNP	0.813	A
EHMT1	79813	genome.wustl.edu	37	9	140611421	140611421	+	Silent	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:140611421G>T	ENST00000460843.1	+	3	456	c.429G>T	c.(427-429)ctG>ctT	p.L143L	EHMT1_ENST00000462484.1_Silent_p.L143L|EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000334856.6_Silent_p.L112L	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	143					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCAGCACTCTGGCCTCTTCGC	0.597																																																	0													60.0	62.0	62.0					9																	140611421		2202	4300	6502	SO:0001819	synonymous_variant	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.429G>T	9.37:g.140611421G>T			B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.L143	ENST00000460843.1	37	c.429	CCDS7050.2	9																																																																																			EHMT1	-	NULL	ENSG00000181090		0.597	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	-	0.00	36	0	G	NM_024757		140611421	+1	tier1	-	no_errors	ENST00000460843	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.920	T
EHMT2	10919	genome.wustl.edu	37	6	31851546	31851546	+	Intron	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:31851546G>A	ENST00000375537.4	-	22	2923				EHMT2-AS1_ENST00000434689.1_RNA|EHMT2_ENST00000395728.3_Intron|EHMT2_ENST00000375528.4_Intron|EHMT2_ENST00000480912.1_Intron|EHMT2_ENST00000375530.4_Intron	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2						DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						ggcagctctCGGTGTCCTTTT	0.592																																																	0													89.0	97.0	94.0					6																	31851546		2203	4300	6503	SO:0001627	intron_variant	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.2916+36C>T	6.37:g.31851546G>A			B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	RNA	SNP	-	NULL	ENST00000375537.4	37	NULL	CCDS4725.1	6																																																																																			EHMT2-AS1	-	-	ENSG00000237080		0.592	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2-AS1	HGNC	protein_coding	OTTHUMT00000076355.5	-	0.00	46	0	G	NM_006709		31851546	+1	tier1	-	no_errors	ENST00000434689	ensembl	human	known	74_37	rna	19.23	42	10	SNP	0.000	A
EIF3E	3646	genome.wustl.edu	37	8	109252218	109252218	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr8:109252218G>A	ENST00000220849.5	-	3	354	c.292C>T	c.(292-294)Cca>Tca	p.P98S	EIF3E_ENST00000519030.1_Missense_Mutation_p.P5S	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GTAGTTTCTGGATCTTCAAAC	0.348																																					GBM(15;360 410 8460 34179 52246)												0													203.0	187.0	192.0					8																	109252218		2203	4300	6503	SO:0001583	missense	0			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.292C>T	8.37:g.109252218G>A	ENSP00000220849:p.Pro98Ser			Missense_Mutation	SNP	pfam_eIF3e_N,pfam_PCI_dom,smart_PCI_dom,pirsf_eIF3e	p.P98S	ENST00000220849.5	37	c.292	CCDS6308.1	8	.	.	.	.	.	.	.	.	.	.	G	16.90	3.251297	0.59212	.	.	ENSG00000104408	ENST00000220849;ENST00000519030;ENST00000518345	T;T	0.46451	0.9;0.87	5.67	4.75	0.60458	Eukaryotic translation initiation factor 3 (eIF3), subunit 6, N-terminal (1);	0.051464	0.85682	D	0.000000	T	0.49898	0.1584	M	0.77313	2.365	0.80722	D	1	B;P;B	0.39352	0.063;0.669;0.097	B;B;B	0.41374	0.068;0.355;0.196	T	0.54357	-0.8306	10	0.45353	T	0.12	-5.0927	16.599	0.84804	0.0:0.0:0.8696:0.1304	.	98;98;98	Q6IAX5;B2R806;P60228	.;.;EIF3E_HUMAN	S	98;5;49	ENSP00000220849:P98S;ENSP00000428796:P5S	ENSP00000220849:P98S	P	-	1	0	EIF3E	109321394	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.404000	0.73268	2.833000	0.97629	0.585000	0.79938	CCA	EIF3E	-	pfam_eIF3e_N,pirsf_eIF3e	ENSG00000104408		0.348	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380612.2	-	0.00	74	0	G	NM_001568		109252218	-1	tier1	-	no_errors	ENST00000220849	ensembl	human	known	74_37	missense	19.79	150	37	SNP	1.000	A
ELAC2	60528	genome.wustl.edu	37	17	12899085	12899085	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:12899085delG	ENST00000338034.4	-	19	1982	c.1743delC	c.(1741-1743)cccfs	p.P581fs	ELAC2_ENST00000395962.2_Frame_Shift_Del_p.P562fs|ELAC2_ENST00000426905.3_Frame_Shift_Del_p.P541fs	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2	581					mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						TGAGCTGGTTGGGGGCAACCA	0.567																																																	0													61.0	51.0	55.0					17																	12899085		2203	4300	6503	SO:0001589	frameshift_variant	0			AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.1743delC	17.37:g.12899085delG	ENSP00000337445:p.Pro581fs		B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Frame_Shift_Del	DEL	pfam_Beta-lactamas-like	p.N582fs	ENST00000338034.4	37	c.1743	CCDS11164.1	17																																																																																			ELAC2	-	pfam_Beta-lactamas-like	ENSG00000006744		0.567	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAC2	HGNC	protein_coding	OTTHUMT00000129934.5		0.00	25	0	G			12899085	-1	tier1		no_errors	ENST00000338034	ensembl	human	known	74_37	frame_shift_del	13.79	25	4	DEL	0.002	-
RP11-764K9.1	0	genome.wustl.edu	37	9	68400476	68400476	+	lincRNA	SNP	G	G	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:68400476G>C	ENST00000417843.2	-	0	1343																											AGGCCACAGTGTGGACtgttg	0.483																																																	0																																												0																															9.37:g.68400476G>C				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.483	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	19	0	G			68400476	-1	tier1	-	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	21.43	11	3	SNP	0.009	C
DHDDS	79947	genome.wustl.edu	37	1	26793747	26793747	+	Intron	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:26793747C>T	ENST00000236342.7	+	9	858				DHDDS_ENST00000525682.2_Intron|RP3-476K8.3_ENST00000423060.1_RNA|DHDDS_ENST00000360009.2_Intron|DHDDS_ENST00000526219.1_Intron			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		tcgtgtcctgcgcatctccat	0.527																																																	0																																										SO:0001627	intron_variant	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.766-1639C>T	1.37:g.26793747C>T			B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	RNA	SNP	-	NULL	ENST00000236342.7	37	NULL	CCDS282.1	1																																																																																			RP3-476K8.3	-	-	ENSG00000225891		0.527	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000225891	Clone_based_vega_gene	protein_coding	OTTHUMT00000392504.1	-	0.00	42	0	C	NM_024887		26793747	-1	tier1	-	no_errors	ENST00000423060	ensembl	human	known	74_37	rna	27.27	32	12	SNP	0.000	T
SLC24A3	57419	genome.wustl.edu	37	20	19673859	19673860	+	Intron	INS	-	-	TTA	rs34549308|rs11472865|rs11473178		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:19673859_19673860insTTA	ENST00000328041.6	+	13	1521				RP4-718D20.3_ENST00000593770.1_RNA|RP4-718D20.3_ENST00000609846.1_RNA|RP4-718D20.3_ENST00000435992.2_RNA|RP4-718D20.3_ENST00000600889.1_RNA|RP4-718D20.3_ENST00000608476.1_RNA|RP4-718D20.3_ENST00000609610.1_RNA|RP4-718D20.3_ENST00000598694.1_RNA	NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3						ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGGGTTCTTTGTTATTTTTTTT	0.366											OREG0025804	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0										791,3455		90,611,1422						-1.3	0.0		dbSNP_120	19	237,8013		3,231,3891	no	intron	SLC24A3	NM_020689.3		93,842,5313	A1A1,A1R,RR		2.8727,18.6293,8.2266				1028,11468				SO:0001627	intron_variant	0			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1325-43->TTA	20.37:g.19673860_19673862dupTTA		735	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	RNA	INS	-	NULL	ENST00000328041.6	37	NULL	CCDS13140.1	20																																																																																			RP4-718D20.3	-	-	ENSG00000232675		0.366	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232675	Clone_based_vega_gene	protein_coding	OTTHUMT00000078207.4		0.00	14	0	-	NM_020689		19673860	-1	tier1		no_errors	ENST00000435992	ensembl	human	known	74_37	rna	40.00	9	6	INS	0.000:0.000	TTA
PGAP2	27315	genome.wustl.edu	37	11	3838572	3838572	+	Intron	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:3838572G>A	ENST00000463452.2	+	2	248				PGAP2_ENST00000465307.2_Intron|PGAP2_ENST00000493547.2_Intron|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000300730.6_Intron|PGAP2_ENST00000532017.1_Intron|PGAP2_ENST00000396993.4_Intron|PGAP2_ENST00000396991.2_Intron|PGAP2_ENST00000479072.1_Intron|PGAP2_ENST00000278243.4_Intron|PGAP2_ENST00000496834.2_Intron|PGAP2_ENST00000396986.2_Intron	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2						GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						TGTATCCCTCGTGCTGCTTAG	0.587																																																	0													100.0	94.0	96.0					11																	3838572		2201	4298	6499	SO:0001627	intron_variant	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.165+5918G>A	11.37:g.3838572G>A			E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	RNA	SNP	-	NULL	ENST00000463452.2	37	NULL	CCDS58112.1	11																																																																																			AC090587.2	-	-	ENSG00000250404		0.587	PGAP2-049	KNOWN	basic|CCDS	protein_coding	ENSG00000250404	Clone_based_vega_gene	protein_coding	OTTHUMT00000383260.1	-	0.00	56	0	G			3838572	+1	tier1	-	no_errors	ENST00000507938	ensembl	human	known	74_37	rna	40.00	39	26	SNP	0.010	A
EP300	2033	genome.wustl.edu	37	22	41568668	41568668	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr22:41568668G>A	ENST00000263253.7	+	28	5836		c.e28+1		RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300						apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)	p.?(1)		NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AAGCACAGATGTAAGGGCATT	0.378			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											93.0	96.0	95.0					22																	41568668		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.4617+1G>A	22.37:g.41568668G>A			B1AKC2	Splice_Site	SNP	-	e28+1	ENST00000263253.7	37	c.4617+1	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	29.4	4.999998	0.93227	.	.	ENSG00000100393	ENST00000263253	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EP300	39898614	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.760000	0.98935	2.941000	0.99782	0.655000	0.94253	.	EP300	-	-	ENSG00000100393		0.378	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	-	0.00	28	0	G	NM_001429	Intron	41568668	+1	tier1	-	no_errors	ENST00000263253	ensembl	human	known	74_37	splice_site	90.00	3	27	SNP	1.000	A
LOC101929008	101929008	genome.wustl.edu	37	16	90168697	90168697	+	lincRNA	DEL	A	A	-	rs58731535|rs12447065|rs544421598	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:90168697delA	ENST00000562203.1	-	0	832																											TGgcggcggcagcagcagcag	0.557																																																	0																																												0																															16.37:g.90168697delA				RNA	DEL	-	NULL	ENST00000562203.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.557	RP11-356C4.3-001	KNOWN	basic	lincRNA	FAM157C	HGNC	lincRNA	OTTHUMT00000420874.1		0.00	71	0	A			90168697	+1	tier1		no_errors	ENST00000563357	ensembl	human	known	74_37	rna	14.29	36	6	DEL	0.019	-
FAM71A	149647	genome.wustl.edu	37	1	212798804	212798804	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:212798804G>A	ENST00000294829.3	+	1	1016	c.585G>A	c.(583-585)atG>atA	p.M195I	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	195						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		TGATGTGGATGCCTGTGTTTC	0.522																																																	0													79.0	82.0	81.0					1																	212798804		2203	4300	6503	SO:0001583	missense	0				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.585G>A	1.37:g.212798804G>A	ENSP00000294829:p.Met195Ile		Q5VTZ1	Missense_Mutation	SNP	pfam_DUF3699	p.M195I	ENST00000294829.3	37	c.585	CCDS1507.1	1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.920622	0.33908	.	.	ENSG00000162771	ENST00000294829	T	0.03468	3.92	4.12	4.12	0.48240	.	0.601212	0.14906	N	0.291509	T	0.04815	0.0130	L	0.59436	1.845	0.28775	N	0.900147	B	0.34103	0.437	B	0.28305	0.088	T	0.16394	-1.0404	10	0.22109	T;T	0.4;0.4	-28.3615	12.0991	0.53772	0.0:0.0:1.0:0.0	.	195	Q8IYT1	FA71A_HUMAN	I	195	ENSP00000294829:M195I	ENSP00000294829:M195I;ENSP00000294829:M195I	M	+	3	0	FAM71A	210865427	0.237000	0.23815	0.967000	0.41034	0.023000	0.10783	0.942000	0.29017	2.306000	0.77630	0.563000	0.77884	ATG	FAM71A	-	NULL	ENSG00000162771		0.522	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	-	0.00	20	0	G	NM_153606		212798804	+1	tier1	-	no_errors	ENST00000294829	ensembl	human	known	74_37	missense	47.92	25	23	SNP	0.917	A
FHOD1	29109	genome.wustl.edu	37	16	67264528	67264528	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:67264528A>G	ENST00000258201.4	-	18	3081	c.2834T>C	c.(2833-2835)aTa>aCa	p.I945T		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	945	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GCGGTGCACTATCCTTAGCAT	0.632																																																	0													148.0	151.0	150.0					16																	67264528		2198	4300	6498	SO:0001583	missense	0			AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2834T>C	16.37:g.67264528A>G	ENSP00000258201:p.Ile945Thr		Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.I945T	ENST00000258201.4	37	c.2834	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	A	13.33	2.205265	0.39003	.	.	ENSG00000135723	ENST00000258201	T	0.16324	2.35	5.37	5.37	0.77165	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.171321	0.51477	D	0.000086	T	0.17662	0.0424	L	0.45352	1.415	0.36671	D	0.878491	B	0.10296	0.003	B	0.25759	0.063	T	0.09997	-1.0649	10	0.27082	T	0.32	.	14.2019	0.65710	1.0:0.0:0.0:0.0	.	945	Q9Y613	FHOD1_HUMAN	T	945	ENSP00000258201:I945T	ENSP00000258201:I945T	I	-	2	0	FHOD1	65822029	0.994000	0.37717	0.828000	0.32881	0.933000	0.57130	7.174000	0.77620	2.045000	0.60652	0.459000	0.35465	ATA	FHOD1	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000135723		0.632	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	HGNC	protein_coding	OTTHUMT00000268844.2	-	0.00	62	0	A			67264528	-1	tier1	-	no_errors	ENST00000258201	ensembl	human	known	74_37	missense	76.47	4	13	SNP	0.961	G
GABRE	2564	genome.wustl.edu	37	X	151138169	151138169	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrX:151138169C>A	ENST00000370328.3	-	3	367	c.314G>T	c.(313-315)aGc>aTc	p.S105I	GABRE_ENST00000393914.3_5'UTR|GABRE_ENST00000370325.1_Missense_Mutation_p.S105I	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	105					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGGACCAAGGCTGTTGACGGA	0.517																																																	0													99.0	82.0	88.0					X																	151138169		2203	4300	6503	SO:0001583	missense	0			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.314G>T	X.37:g.151138169C>A	ENSP00000359353:p.Ser105Ile		E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAe_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.S105I	ENST00000370328.3	37	c.314	CCDS14703.1	X	.	.	.	.	.	.	.	.	.	.	c	13.24	2.177209	0.38413	.	.	ENSG00000102287	ENST00000370328;ENST00000370325	T;T	0.80738	-1.41;-1.41	5.28	3.51	0.40186	Neurotransmitter-gated ion-channel ligand-binding (3);	0.208429	0.33346	N	0.005013	D	0.83714	0.5314	M	0.85542	2.76	0.80722	D	1	D	0.54772	0.968	P	0.50314	0.637	T	0.82497	-0.0428	10	0.87932	D	0	.	6.0439	0.19750	0.0:0.624:0.2571:0.1189	.	105	P78334	GBRE_HUMAN	I	105	ENSP00000359353:S105I;ENSP00000359350:S105I	ENSP00000359350:S105I	S	-	2	0	GABRE	150888825	1.000000	0.71417	0.103000	0.21229	0.103000	0.19146	2.998000	0.49465	0.538000	0.28769	0.597000	0.82753	AGC	GABRE	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000102287		0.517	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRE	HGNC	protein_coding	OTTHUMT00000060903.1	-	0.00	34	0	C	NM_004961, NM_021990, NM_021984		151138169	-1	tier1	-	no_errors	ENST00000370328	ensembl	human	known	74_37	missense	84.62	4	22	SNP	1.000	A
GALNT18	374378	genome.wustl.edu	37	11	11314686	11314686	+	Missense_Mutation	SNP	C	C	T	rs529247669		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:11314686C>T	ENST00000227756.4	-	10	1978	c.1567G>A	c.(1567-1569)Gtg>Atg	p.V523M		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	523	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										TCATCATCCACGGTGGGGCTC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		19879	0.0		0.0	False		,,,				2504	0.001																0													92.0	74.0	80.0					11																	11314686		2201	4294	6495	SO:0001583	missense	0			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1567G>A	11.37:g.11314686C>T	ENSP00000227756:p.Val523Met		O95903|Q8NDY9	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V523M	ENST00000227756.4	37	c.1567	CCDS7807.1	11	.	.	.	.	.	.	.	.	.	.	C	11.19	1.566670	0.28003	.	.	ENSG00000110328	ENST00000227756	T	0.56776	0.44	5.7	-0.524	0.11920	Ricin B-related lectin (1);Ricin B lectin (3);	0.480244	0.20229	N	0.096535	T	0.44456	0.1294	L	0.40543	1.245	0.09310	N	1	P	0.46952	0.887	P	0.46758	0.526	T	0.40021	-0.9585	10	0.34782	T	0.22	.	9.814	0.40840	0.0:0.3975:0.0:0.6025	.	523	Q6P9A2	GLTL4_HUMAN	M	523	ENSP00000227756:V523M	ENSP00000227756:V523M	V	-	1	0	GALNTL4	11271262	0.050000	0.20438	0.000000	0.03702	0.506000	0.33950	0.362000	0.20284	-0.126000	0.11682	-0.908000	0.02827	GTG	GALNT18	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000110328		0.577	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT18	HGNC	protein_coding	OTTHUMT00000385848.1	-	0.00	39	0	C	NM_198516		11314686	-1	tier1	-	no_errors	ENST00000227756	ensembl	human	known	74_37	missense	38.00	31	19	SNP	0.002	T
GAS7	8522	genome.wustl.edu	37	17	9862555	9862555	+	Silent	SNP	C	C	T	rs142589082		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:9862555C>T	ENST00000432992.2	-	5	649	c.489G>A	c.(487-489)tcG>tcA	p.S163S	GAS7_ENST00000542249.1_Silent_p.S99S|GAS7_ENST00000323816.4_Silent_p.S103S|GAS7_ENST00000585266.1_Silent_p.S103S|GAS7_ENST00000580865.1_Silent_p.S23S|GAS7_ENST00000583882.1_Silent_p.S23S|GAS7_ENST00000540214.1_Silent_p.S99S|GAS7_ENST00000396115.2_Silent_p.S99S|GAS7_ENST00000579158.1_Silent_p.S99S|GAS7_ENST00000437099.2_Silent_p.S99S|GAS7_ENST00000578655.1_5'UTR	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	163					actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						TTTTGCTTGGCGATGAGGATC	0.557			T	MLL	AML*						OREG0024172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1	0.000199681	0.0	0.0	5008	,	,		20475	0.0		0.001	False		,,,				2504	0.0							Dom	yes		17	17p	8522	growth arrest-specific 7		L	0								C	,,,	1,4405	2.1+/-5.4	0,1,2202	154.0	118.0	130.0		297,69,309,489	-3.0	1.0	17	dbSNP_134	130	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	GAS7	NM_001130831.1,NM_003644.2,NM_201432.1,NM_201433.1	,,,	0,5,6498	TT,TC,CC		0.0465,0.0227,0.0384	,,,	99/413,23/337,103/417,163/477	9862555	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	0			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.489G>A	17.37:g.9862555C>T		660	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Silent	SNP	pfam_FCH_dom,pfam_WW_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_WW_dom,smart_SH3_domain,smart_WW_dom,smart_FCH_dom,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_WW_dom	p.S163	ENST00000432992.2	37	c.489	CCDS11152.1	17																																																																																			GAS7	-	NULL	ENSG00000007237		0.557	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS7	HGNC	protein_coding	OTTHUMT00000439883.1	-	0.00	54	0	C	NM_003644, NM_201432, NM_201433		9862555	-1	tier1	rs142589082	no_errors	ENST00000432992	ensembl	human	known	74_37	silent	19.64	45	11	SNP	0.961	T
PRSS54	221191	genome.wustl.edu	37	16	58329008	58329008	+	5'Flank	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:58329008G>T	ENST00000219301.4	-	0	0				PRSS54_ENST00000567164.1_5'Flank|PRSS54_ENST00000543437.1_5'Flank	NM_001080492.1	NP_001073961.1	Q6PEW0	PRS54_HUMAN	protease, serine, 54							cytoplasm (GO:0005737)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GGGGACTTACGAGGAGCTAGG	0.512																																																	0																																										SO:0001631	upstream_gene_variant	0			AK058068	CCDS32463.1	16q21	2010-05-07			ENSG00000103023	ENSG00000103023		"""Serine peptidases / Serine peptidases"""	26336	protein-coding gene	gene with protein product	"""cancer/testis antigen 67"""					17521433	Standard	NM_001080492		Approved	FLJ25339, KLKBL4, CT67	uc002enf.3	Q6PEW0			16.37:g.58329008G>T	Exception_encountered		Q96LN9|Q9NT77	RNA	SNP	-	NULL	ENST00000219301.4	37	NULL	CCDS32463.1	16																																																																																			GINS3	-	-	ENSG00000181938		0.512	PRSS54-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS3	HGNC	protein_coding	OTTHUMT00000422556.1	-	0.00	65	0	G	NM_001080492		58329008	+1	tier1	-	no_errors	ENST00000567400	ensembl	human	putative	74_37	rna	13.33	26	4	SNP	0.200	T
GLUD2	2747	genome.wustl.edu	37	X	120182379	120182379	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrX:120182379G>T	ENST00000328078.1	+	1	918	c.841G>T	c.(841-843)Gaa>Taa	p.E281*		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	281					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						CCATGGGATTGAAAACTTCAT	0.443																																																	0													137.0	111.0	120.0					X																	120182379		2203	4300	6503	SO:0001587	stop_gained	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.841G>T	X.37:g.120182379G>T	ENSP00000327589:p.Glu281*		B2R8G0|Q9UDQ4	Nonsense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.E281*	ENST00000328078.1	37	c.841	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	G	28.3	4.910986	0.92178	.	.	ENSG00000182890	ENST00000328078	.	.	.	2.4	1.45	0.22620	.	0.093642	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-17.8403	8.2651	0.31808	0.0:0.2438:0.7562:0.0	.	.	.	.	X	281	.	ENSP00000327589:E281X	E	+	1	0	GLUD2	120010060	1.000000	0.71417	0.735000	0.30896	0.842000	0.47809	6.619000	0.74219	0.255000	0.21593	0.472000	0.43445	GAA	GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_C,smart_Glu/Leu/Phe/Val_DH_C	ENSG00000182890		0.443	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	-	0.00	42	0	G	NM_012084		120182379	+1	tier1	-	no_errors	ENST00000328078	ensembl	human	known	74_37	nonsense	13.51	32	5	SNP	1.000	T
GMPPA	29926	genome.wustl.edu	37	2	220364857	220364857	+	Missense_Mutation	SNP	C	C	G	rs373605931		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr2:220364857C>G	ENST00000358215.3	+	3	424	c.55C>G	c.(55-57)Cct>Gct	p.P19A	AC053503.11_ENST00000429882.1_RNA|GMPPA_ENST00000313597.5_Missense_Mutation_p.P19A|RP11-316O14.1_ENST00000601508.1_RNA|GMPPA_ENST00000373908.1_Missense_Mutation_p.P19A|GMPPA_ENST00000341142.3_Missense_Mutation_p.P19A|GMPPA_ENST00000373917.3_Missense_Mutation_p.P19A	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	19					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		TCGCTTCAGACCTTTGTCTTT	0.582																																																	0													92.0	76.0	81.0					2																	220364857		2203	4300	6503	SO:0001583	missense	0			AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.55C>G	2.37:g.220364857C>G	ENSP00000350949:p.Pro19Ala		A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Missense_Mutation	SNP	pfam_NTP_transferase	p.P19A	ENST00000358215.3	37	c.55	CCDS2441.1	2	.	.	.	.	.	.	.	.	.	.	C	27.1	4.798253	0.90538	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000455657;ENST00000341142	D;D;D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02;-2.02;-2.02	4.1	4.1	0.47936	Nucleotidyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.94152	0.8124	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95899	0.8913	10	0.87932	D	0	-18.4942	16.3026	0.82830	0.0:1.0:0.0:0.0	.	19;19	Q96IJ6-2;Q96IJ6	.;GMPPA_HUMAN	A	19	ENSP00000315925:P19A;ENSP00000363027:P19A;ENSP00000350949:P19A;ENSP00000363016:P19A;ENSP00000392465:P19A;ENSP00000340760:P19A	ENSP00000315925:P19A	P	+	1	0	GMPPA	220073101	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.427000	0.80284	1.997000	0.58415	0.655000	0.94253	CCT	GMPPA	-	pfam_NTP_transferase	ENSG00000144591		0.582	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPPA	HGNC	protein_coding	OTTHUMT00000130230.1	-	0.00	80	0	C	NM_013335		220364857	+1	tier1	-	no_errors	ENST00000313597	ensembl	human	known	74_37	missense	25.81	23	8	SNP	1.000	G
GOLGA8EP	390535	genome.wustl.edu	37	15	23445535	23445535	+	RNA	SNP	A	A	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr15:23445535A>G	ENST00000526079.1	+	0	2355				AC100757.1_ENST00000458911.1_RNA|RN7SL106P_ENST00000488468.2_RNA	NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		AATCTCCTACACAATTCATTT	0.318																																																	0																																												0					15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23445535A>G				RNA	SNP	-	NULL	ENST00000526079.1	37	NULL		15																																																																																			GOLGA8EP	-	-	ENSG00000175676		0.318	GOLGA8EP-002	KNOWN	basic	processed_transcript	GOLGA8EP	HGNC	pseudogene	OTTHUMT00000393312.1	-	0.00	80	0	A	NR_033350.1		23445535	+1	tier1	-	no_errors	ENST00000526079	ensembl	human	known	74_37	rna	80.00	10	40	SNP	0.047	G
GPR37L1	9283	genome.wustl.edu	37	1	202092359	202092359	+	Missense_Mutation	SNP	G	G	A	rs144676177	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:202092359G>A	ENST00000367282.5	+	1	374	c.268G>A	c.(268-270)Ggc>Agc	p.G90S		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	90			G -> D (in dbSNP:rs3795595). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:9539149}.		negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						CCCTAACCCCGGCAAGGATGG	0.647																																																	0													41.0	41.0	41.0					1																	202092359		2203	4300	6503	SO:0001583	missense	0			AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.268G>A	1.37:g.202092359G>A	ENSP00000356251:p.Gly90Ser		B2R7M9|Q5SXP7|Q86VP7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR37_orph,prints_GPCR_Rhodpsn	p.G90S	ENST00000367282.5	37	c.268	CCDS1420.1	1	.	.	.	.	.	.	.	.	.	.	G	5.126	0.208921	0.09757	.	.	ENSG00000170075	ENST00000367282	T	0.79033	-1.23	4.87	3.88	0.44766	.	0.373374	0.22542	N	0.058713	T	0.50051	0.1593	N	0.04508	-0.205	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.32052	-0.9921	10	0.02654	T	1	-25.265	10.0549	0.42239	0.0:0.0:0.6834:0.3166	.	90	O60883	ETBR2_HUMAN	S	90	ENSP00000356251:G90S	ENSP00000356251:G90S	G	+	1	0	GPR37L1	200358982	0.055000	0.20627	0.029000	0.17559	0.739000	0.42172	2.531000	0.45650	2.219000	0.72066	0.462000	0.41574	GGC	GPR37L1	-	NULL	ENSG00000170075		0.647	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37L1	HGNC	protein_coding	OTTHUMT00000087496.2	-	0.00	36	0	G	NM_004767		202092359	+1	tier1	-	no_errors	ENST00000367282	ensembl	human	known	74_37	missense	31.82	30	14	SNP	0.003	A
HIC2	23119	genome.wustl.edu	37	22	21799838	21799839	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr22:21799838_21799839insT	ENST00000443632.2	+	2	1026_1027	c.654_655insT	c.(655-657)tgcfs	p.C219fs	HIC2_ENST00000407598.2_Frame_Shift_Ins_p.C219fs|HIC2_ENST00000407464.2_Frame_Shift_Ins_p.C219fs			Q96JB3	HIC2_HUMAN	hypermethylated in cancer 2	219					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Melanoma(16;0.000465)|Ovarian(15;0.00438)|Colorectal(54;0.0968)	Lung SC(17;0.0262)|all_lung(157;0.205)				GCCGGGCTGTCTGCCCAGCTGG	0.668																																					NSCLC(23;437 858 2282 27947 40366)												0																																										SO:0001589	frameshift_variant	0			AB028943	CCDS13789.1	22q11.21	2013-01-09			ENSG00000169635	ENSG00000169635		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18595	protein-coding gene	gene with protein product		607712				11554746	Standard	NM_015094		Approved	KIAA1020, HRG22, ZBTB30, ZNF907	uc002zur.4	Q96JB3	OTTHUMG00000150781	ENST00000443632.2:c.655dupT	22.37:g.21799839_21799839dupT	ENSP00000387757:p.Cys219fs		Q504T6|Q96KR3|Q9NSM9|Q9UPX9	Frame_Shift_Ins	INS	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C218fs	ENST00000443632.2	37	c.654_655	CCDS13789.1	22																																																																																			HIC2	-	NULL	ENSG00000169635		0.668	HIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIC2	HGNC	protein_coding	OTTHUMT00000320061.2		0.00	8	0	-			21799839	+1	tier1		no_errors	ENST00000407464	ensembl	human	known	74_37	frame_shift_ins	33.33	4	2	INS	0.336:0.369	T
IL23R	149233	genome.wustl.edu	37	1	67724850	67724850	+	3'UTR	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:67724850C>T	ENST00000347310.5	+	0	2100				IL23R_ENST00000371002.1_3'UTR|IL23R_ENST00000473881.1_3'UTR|IL23R_ENST00000395227.1_3'UTR	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor						defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						AGCTGCCTTGCAATCTGAACT	0.343																																																	0													22.0	22.0	22.0					1																	67724850		2131	4270	6401	SO:0001624	3_prime_UTR_variant	0			AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.*39C>T	1.37:g.67724850C>T			C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	RNA	SNP	-	NULL	ENST00000347310.5	37	NULL	CCDS637.1	1																																																																																			IL23R	-	-	ENSG00000162594		0.343	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL23R	HGNC	protein_coding	OTTHUMT00000025199.2	-	0.00	17	0	C	NM_144701		67724850	+1	tier1	-	no_errors	ENST00000473881	ensembl	human	known	74_37	rna	91.30	2	21	SNP	0.000	T
IMPG1	3617	genome.wustl.edu	37	6	76728472	76728472	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:76728472G>T	ENST00000369950.3	-	7	959	c.770C>A	c.(769-771)cCa>cAa	p.P257Q	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CTGGTAATATGGGGACTGGGA	0.547																																					Pancreas(37;839 1141 2599 26037)												0													140.0	129.0	133.0					6																	76728472		2203	4300	6503	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.770C>A	6.37:g.76728472G>T	ENSP00000358966:p.Pro257Gln			Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.P257Q	ENST00000369950.3	37	c.770	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677227	0.47886	.	.	ENSG00000112706	ENST00000369950	T	0.78707	-1.2	6.17	5.19	0.71726	SEA (3);	0.307458	0.28754	N	0.014244	T	0.81861	0.4912	M	0.70275	2.135	0.37108	D	0.90019	D	0.76494	0.999	D	0.72982	0.979	D	0.84956	0.0874	10	0.66056	D	0.02	.	10.535	0.44998	0.1105:0.0:0.8895:0.0	.	257	Q17R60	IMPG1_HUMAN	Q	257	ENSP00000358966:P257Q	ENSP00000358966:P257Q	P	-	2	0	IMPG1	76785192	0.896000	0.30565	0.008000	0.14137	0.658000	0.38924	2.085000	0.41634	1.368000	0.46115	0.655000	0.94253	CCA	IMPG1	-	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	ENSG00000112706		0.547	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	-	0.00	37	0	G	NM_001563		76728472	-1	tier1	-	no_errors	ENST00000369950	ensembl	human	known	74_37	missense	54.55	15	18	SNP	0.212	T
ISL2	64843	genome.wustl.edu	37	15	76632669	76632669	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr15:76632669G>A	ENST00000290759.4	+	4	724	c.564G>A	c.(562-564)acG>acA	p.T188T	RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	188					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						ACAAGCAGACGGAGAAGACGA	0.697																																					GBM(97;953 1391 16164 31496 36951)												0													30.0	32.0	31.0					15																	76632669		2196	4291	6487	SO:0001819	synonymous_variant	0			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.564G>A	15.37:g.76632669G>A			B3KM37	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G101R	ENST00000290759.4	37	c.301	CCDS10290.1	15																																																																																			ISL2	-	NULL	ENSG00000159556		0.697	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL2	HGNC	protein_coding	OTTHUMT00000289779.1	-	0.00	27	0	G			76632669	+1	tier1	-	no_errors	ENST00000558656	ensembl	human	known	74_37	missense	32.00	17	8	SNP	1.000	A
ITGAL	3683	genome.wustl.edu	37	16	30522255	30522255	+	Silent	SNP	G	G	A	rs7201914	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:30522255G>A	ENST00000356798.6	+	23	2853	c.2673G>A	c.(2671-2673)tcG>tcA	p.S891S	ITGAL_ENST00000358164.5_Silent_p.S807S|ITGAL_ENST00000433423.2_Silent_p.S125S	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	891					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GGGGGGACTCGGTTGAATTGC	0.562																																					NSCLC(110;1462 1641 3311 33990 49495)												0													92.0	89.0	90.0					16																	30522255		2197	4300	6497	SO:0001819	synonymous_variant	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2673G>A	16.37:g.30522255G>A			O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.S891	ENST00000356798.6	37	c.2673	CCDS32433.1	16																																																																																			ITGAL	-	pfam_Integrin_alpha-2	ENSG00000005844		0.562	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	-	0.00	41	0	G			30522255	+1	tier1	-	no_errors	ENST00000356798	ensembl	human	known	74_37	silent	16.67	15	3	SNP	0.000	A
ITGB2	3689	genome.wustl.edu	37	21	46320286	46320286	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr21:46320286G>A	ENST00000397850.2	-	8	1298	c.846C>T	c.(844-846)aaC>aaT	p.N282N	ITGB2_ENST00000355153.4_Silent_p.N282N|ITGB2_ENST00000302347.5_Silent_p.N282N|ITGB2_ENST00000397852.1_Silent_p.N282N|ITGB2_ENST00000397857.1_Silent_p.N282N|ITGB2_ENST00000397854.3_Silent_p.N225N			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	282	VWFA.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	AGCGGCCGTCGTTGGGGGTCA	0.632																																																	0													108.0	89.0	95.0					21																	46320286		2203	4300	6503	SO:0001819	synonymous_variant	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.846C>T	21.37:g.46320286G>A			B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.N282	ENST00000397850.2	37	c.846	CCDS13716.1	21																																																																																			ITGB2	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N	ENSG00000160255		0.632	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	-	0.00	75	0	G	NM_000211		46320286	-1	tier1	-	no_errors	ENST00000302347	ensembl	human	known	74_37	silent	9.68	84	9	SNP	0.153	A
JAKMIP3	282973	genome.wustl.edu	37	10	133946999	133946999	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:133946999G>A	ENST00000298622.4	+	3	955	c.817G>A	c.(817-819)Gca>Aca	p.A273T		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	273						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		TGCAGCTGGTGCAGGAGACGC	0.652																																																	0													19.0	22.0	21.0					10																	133946999		1994	4154	6148	SO:0001583	missense	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.817G>A	10.37:g.133946999G>A	ENSP00000298622:p.Ala273Thr		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.A273T	ENST00000298622.4	37	c.817	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977858	0.92982	.	.	ENSG00000188385	ENST00000298622	T	0.11495	2.77	4.63	4.63	0.57726	.	0.144057	0.45126	D	0.000398	T	0.25865	0.0630	L	0.61218	1.895	0.51767	D	0.999939	D	0.63880	0.993	P	0.58520	0.84	T	0.01266	-1.1401	10	0.28530	T	0.3	-14.5558	17.6464	0.88149	0.0:0.0:1.0:0.0	.	273	Q5VZ66	JKIP3_HUMAN	T	273	ENSP00000298622:A273T	ENSP00000298622:A273T	A	+	1	0	JAKMIP3	133796989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.021000	0.70832	2.397000	0.81536	0.655000	0.94253	GCA	JAKMIP3	-	NULL	ENSG00000188385		0.652	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	-	0.00	25	0	G	NM_194303		133946999	+1	tier1	-	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	33.33	16	8	SNP	1.000	A
KALRN	8997	genome.wustl.edu	37	3	124281861	124281861	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr3:124281861G>C	ENST00000393496.1	+	2	384	c.220G>C	c.(220-222)Gtc>Ctc	p.V74L	KALRN_ENST00000360013.3_Missense_Mutation_p.V1701L			O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1701	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GGAGGGTCTGGTCCCCAGCAG	0.657																																																	0													50.0	55.0	53.0					3																	124281861		2071	4205	6276	SO:0001583	missense	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000393496.1:c.220G>C	3.37:g.124281861G>C	ENSP00000377134:p.Val74Leu		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.V1701L	ENST00000393496.1	37	c.5101		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.39|19.39	3.818583|3.818583	0.71028|0.71028	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000360013;ENST00000393496|ENST00000354186	T;T|.	0.70986|.	-0.53;0.49|.	4.54|4.54	4.54|4.54	0.55810|0.55810	Src homology-3 domain (3);|.	0.077693|.	0.51477|.	D|.	0.000095|.	T|T	0.65637|0.65637	0.2710|0.2710	L|L	0.41906|0.41906	1.305|1.305	0.80722|0.80722	D|D	1|1	B;D|.	0.58970|.	0.012;0.984|.	B;D|.	0.65443|.	0.015;0.935|.	T|T	0.62487|0.62487	-0.6844|-0.6844	10|5	0.59425|.	D|.	0.04|.	.|.	17.8689|17.8689	0.88804|0.88804	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	74;1701|.	O60229-5;O60229|.	.;KALRN_HUMAN|.	L|C	1701;74|1669	ENSP00000353109:V1701L;ENSP00000377134:V74L|.	ENSP00000353109:V1701L|.	V|W	+|+	1|3	0|0	KALRN|KALRN	125764551|125764551	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.598000|9.598000	0.98277|0.98277	2.522000|2.522000	0.85027|0.85027	0.655000|0.655000	0.94253|0.94253	GTC|TGG	KALRN	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000160145		0.657	KALRN-002	NOVEL	basic	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000258840.2	-	0.00	38	0	G	NM_003947		124281861	+1	tier1	-	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	36.54	33	19	SNP	1.000	C
KCNT1	57582	genome.wustl.edu	37	9	138662861	138662861	+	Missense_Mutation	SNP	G	G	A	rs141281093	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:138662861G>A	ENST00000263604.3	+	18	1871	c.1871G>A	c.(1870-1872)cGg>cAg	p.R624Q	KCNT1_ENST00000488444.2_Missense_Mutation_p.R624Q|KCNT1_ENST00000486577.2_Missense_Mutation_p.R604Q|KCNT1_ENST00000490355.2_Missense_Mutation_p.R624Q|KCNT1_ENST00000491806.2_Missense_Mutation_p.R610Q|KCNT1_ENST00000487664.1_Missense_Mutation_p.R598Q|KCNT1_ENST00000298480.5_Missense_Mutation_p.R643Q|KCNT1_ENST00000371757.2_Missense_Mutation_p.R643Q			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	624					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GAGGAGAAGCGGAAGAAGAGG	0.662																																																	0								G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	53.0	47.0	49.0		1928	0.2	0.6	9	dbSNP_134	49	4,8596	3.7+/-12.6	0,4,4296	yes	missense	KCNT1	NM_020822.2	43	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	benign	643/1236	138662861	5,13001	2203	4300	6503	SO:0001583	missense	0			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1871G>A	9.37:g.138662861G>A	ENSP00000263604:p.Arg624Gln		B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.R643Q	ENST00000263604.3	37	c.1928		9	.	.	.	.	.	.	.	.	.	.	G	0.179	-1.064151	0.01934	2.27E-4	4.65E-4	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.21191	2.03;2.02;2.02;2.04	3.88	0.174	0.15040	.	0.183165	0.26126	N	0.026193	T	0.04679	0.0127	N	0.00823	-1.155	0.26488	N	0.974989	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.41770	-0.9490	10	0.08599	T	0.76	-13.9017	7.4438	0.27198	0.72:0.0:0.28:0.0	.	610;643;598;624	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	Q	598;643;643;604;610;624;624;624	ENSP00000417851:R598Q;ENSP00000298480:R643Q;ENSP00000360822:R643Q;ENSP00000263604:R624Q	ENSP00000263604:R624Q	R	+	2	0	KCNT1	137802682	1.000000	0.71417	0.607000	0.28956	0.298000	0.27526	2.784000	0.47774	-0.141000	0.11374	-0.373000	0.07131	CGG	KCNT1	-	NULL	ENSG00000107147		0.662	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		-	0.00	50	0	G	NM_020822		138662861	+1	tier1	rs141281093	no_errors	ENST00000298480	ensembl	human	known	74_37	missense	7.69	60	5	SNP	1.000	A
KIAA1279	26128	genome.wustl.edu	37	10	70775906	70775906	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:70775906C>T	ENST00000361983.4	+	7	1702	c.1600C>T	c.(1600-1602)Cat>Tat	p.H534Y		NM_015634.3	NP_056449.1	Q96EK5	KBP_HUMAN	KIAA1279	534					cell differentiation (GO:0030154)|mitochondrial transport (GO:0006839)|nervous system development (GO:0007399)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)	kinesin binding (GO:0019894)			breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	14						ATTCCCTGAGCATATAGGGGA	0.408																																																	0													90.0	87.0	88.0					10																	70775906		2203	4300	6503	SO:0001583	missense	0			BC012180	CCDS7284.1	10q22.1	2008-02-05			ENSG00000198954	ENSG00000198954			23419	protein-coding gene	gene with protein product		609367					Standard	NM_015634		Approved	DKFZP586B0923, TTC20	uc001joy.3	Q96EK5	OTTHUMG00000018363	ENST00000361983.4:c.1600C>T	10.37:g.70775906C>T	ENSP00000354848:p.His534Tyr		A8K5M8|Q9BR89|Q9ULE1|Q9Y428	Missense_Mutation	SNP	pfam_KBP	p.H534Y	ENST00000361983.4	37	c.1600	CCDS7284.1	10	.	.	.	.	.	.	.	.	.	.	C	13.48	2.249663	0.39797	.	.	ENSG00000198954	ENST00000361983	T	0.42513	0.97	5.75	5.75	0.90469	.	0.277325	0.42420	D	0.000711	T	0.23492	0.0568	N	0.08118	0	0.33469	D	0.586007	P	0.41498	0.752	B	0.38655	0.278	T	0.36578	-0.9742	10	0.62326	D	0.03	-16.3477	9.685	0.40094	0.2968:0.5837:0.1195:0.0	.	534	Q96EK5	KBP_HUMAN	Y	534	ENSP00000354848:H534Y	ENSP00000354848:H534Y	H	+	1	0	KIAA1279	70445912	0.994000	0.37717	0.999000	0.59377	0.999000	0.98932	1.867000	0.39499	2.725000	0.93324	0.655000	0.94253	CAT	KIAA1279	-	pfam_KBP	ENSG00000198954		0.408	KIAA1279-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1279	HGNC	protein_coding	OTTHUMT00000048370.1	-	0.00	42	0	C	NM_015634		70775906	+1	tier1	-	no_errors	ENST00000361983	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	T
KIR3DL2	3812	genome.wustl.edu	37	19	55378146	55378146	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr19:55378146G>T	ENST00000326321.3	+	9	1361	c.1328G>T	c.(1327-1329)tGc>tTc	p.C443F	KIR3DL2_ENST00000270442.5_Missense_Mutation_p.C426F|KIR3DL1_ENST00000402254.2_Missense_Mutation_p.C443F|RNU6-222P_ENST00000362438.1_RNA	NM_006737.3	NP_006728.2	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2	443					cellular defense response (GO:0006968)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	23				GBM - Glioblastoma multiforme(193;0.0192)		GTTGTCTCCTGCCCACGAGCA	0.527																																																	0													230.0	227.0	228.0					19																	55378146		2203	4300	6503	SO:0001583	missense	0			L41270	CCDS12906.1, CCDS58677.1	19q13.4	2014-05-22			ENSG00000240403	ENSG00000240403		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6339	protein-coding gene	gene with protein product		604947				7716543, 8662091	Standard	NM_006737		Approved	cl-5, nkat4, nkat4a, nkat4b, CD158K	uc002qho.4	P43630	OTTHUMG00000065935	ENST00000326321.3:c.1328G>T	19.37:g.55378146G>T	ENSP00000325525:p.Cys443Phe		Q13238|Q14947|Q14948|Q92684|Q95366|Q95367|Q95368	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.C443F	ENST00000326321.3	37	c.1328	CCDS12906.1	19	.	.	.	.	.	.	.	.	.	.	G	7.695	0.691952	0.15039	.	.	ENSG00000167633;ENSG00000240403;ENSG00000240403	ENST00000402254;ENST00000326321;ENST00000270442	T;T;T	0.00526	7.12;7.1;6.8	1.01	-2.02	0.07388	.	.	.	.	.	T	0.01092	0.0036	M	0.68317	2.08	0.09310	N	1	D;D;D	0.76494	0.999;0.997;0.997	D;D;D	0.85130	0.997;0.992;0.996	T	0.39418	-0.9615	9	0.46703	T	0.11	.	5.3113	0.15831	0.456:0.0:0.544:0.0	.	426;443;443	Q95366;P43630;F6QF33	.;KI3L2_HUMAN;.	F	443;443;426	ENSP00000384528:C443F;ENSP00000325525:C443F;ENSP00000270442:C426F	ENSP00000384528:C443F	C	+	2	0	KIR3DL1;KIR3DL2	60069958	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.593000	0.05740	-1.116000	0.02969	-0.712000	0.03635	TGC	KIR3DL2	-	NULL	ENSG00000240403		0.527	KIR3DL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIR3DL2	HGNC	protein_coding	OTTHUMT00000141241.1	-	0.00	49	0	G			55378146	+1	tier1	-	no_errors	ENST00000326321	ensembl	human	known	74_37	missense	12.50	35	5	SNP	0.000	T
KLHL33	123103	genome.wustl.edu	37	14	20898614	20898614	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr14:20898614C>T	ENST00000344581.4	-	2	443	c.221G>A	c.(220-222)cGt>cAt	p.R74H		NM_001109997.2	NP_001103467.2	A6NCF5	KLH33_HUMAN	kelch-like family member 33	74												all_cancers(95;0.00123)		Epithelial(56;7.57e-08)|all cancers(55;8.63e-07)	GBM - Glioblastoma multiforme(265;0.0223)|READ - Rectum adenocarcinoma(17;0.193)		GGCCAGGCAACGGGCAGGGCT	0.632																																																	0													43.0	51.0	49.0					14																	20898614		692	1591	2283	SO:0001583	missense	0				CCDS53882.1	14q11.2	2013-10-15	2013-02-22		ENSG00000185271	ENSG00000185271		"""Kelch-like"""	31952	protein-coding gene	gene with protein product			"""kelch-like 33 (Drosophila)"""				Standard	NM_001109997		Approved		uc010tli.2	A6NCF5	OTTHUMG00000170982	ENST00000344581.4:c.221G>A	14.37:g.20898614C>T	ENSP00000341549:p.Arg74His			Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BACK,smart_Kelch_1	p.R74H	ENST00000344581.4	37	c.221	CCDS53882.1	14	.	.	.	.	.	.	.	.	.	.	C	12.60	1.987214	0.35036	.	.	ENSG00000185271	ENST00000344581	T	0.72282	-0.64	4.67	3.75	0.43078	.	0.461817	0.23678	N	0.045641	T	0.58708	0.2141	N	0.22421	0.69	0.21355	N	0.999716	.	.	.	.	.	.	T	0.54715	-0.8252	8	0.66056	D	0.02	.	7.4199	0.27065	0.1993:0.6228:0.1778:0.0	.	.	.	.	H	74	ENSP00000341549:R74H	ENSP00000341549:R74H	R	-	2	0	KLHL33	19968454	0.920000	0.31207	0.997000	0.53966	0.938000	0.57974	2.865000	0.48412	1.131000	0.42111	0.655000	0.94253	CGT	KLHL33	-	NULL	ENSG00000185271		0.632	KLHL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL33	HGNC	protein_coding	OTTHUMT00000411038.1	-	0.00	26	0	C	XM_063481		20898614	-1	tier1	-	no_errors	ENST00000344581	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.651	T
KPNB1	3837	genome.wustl.edu	37	17	45750492	45750492	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:45750492G>T	ENST00000290158.4	+	13	2063	c.1656G>T	c.(1654-1656)ttG>ttT	p.L552F	KPNB1_ENST00000537679.1_Missense_Mutation_p.L336F|KPNB1_ENST00000540627.1_Missense_Mutation_p.L407F|KPNB1_ENST00000535458.2_Missense_Mutation_p.L407F	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	552					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)	p.L552F(1)		breast(1)|ovary(1)|pancreas(1)|skin(1)	4						AAACGACTTTGGTCATCATGG	0.463																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	119.0	121.0					17																	45750492		2203	4300	6503	SO:0001583	missense	0			L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1656G>T	17.37:g.45750492G>T	ENSP00000290158:p.Leu552Phe		B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	pfam_HEAT,pfam_Importin-beta_N,pfam_Armadillo,superfamily_ARM-type_fold,smart_Importin-beta_N,smart_Armadillo,pfscan_HEAT_type_2,pfscan_Importin-beta_N	p.L552F	ENST00000290158.4	37	c.1656	CCDS11513.1	17	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085870	0.36758	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.52	-2.18	0.07037	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.52805	0.1757	L	0.50333	1.59	0.38797	D	0.955109	P;P	0.46784	0.884;0.776	B;B	0.40782	0.34;0.198	T	0.60301	-0.7290	9	0.56958	D	0.05	-16.5928	7.3697	0.26794	0.4933:0.1129:0.3938:0.0	.	336;552	F5H4R7;Q14974	.;IMB1_HUMAN	F	407;552;407;336	ENSP00000438253:L407F;ENSP00000290158:L552F;ENSP00000438964:L407F;ENSP00000445006:L336F	ENSP00000290158:L552F	L	+	3	2	KPNB1	43105491	1.000000	0.71417	0.930000	0.37139	0.990000	0.78478	1.490000	0.35573	-0.010000	0.14271	0.655000	0.94253	TTG	KPNB1	-	superfamily_ARM-type_fold	ENSG00000108424		0.463	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNB1	HGNC	protein_coding	OTTHUMT00000089755.2	-	0.00	66	0	G	NM_002265		45750492	+1	tier1	-	no_errors	ENST00000290158	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.952	T
CCDC18	343099	genome.wustl.edu	37	1	93730253	93730253	+	Intron	SNP	T	T	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:93730253T>C	ENST00000343253.7	+	27	4183				RP4-717I23.3_ENST00000415150.1_RNA|RP4-717I23.3_ENST00000447577.1_RNA|RP4-717I23.3_ENST00000427669.1_RNA|CCDC18_ENST00000557479.1_Intron|RP4-717I23.3_ENST00000429859.1_RNA|RP4-717I23.3_ENST00000602488.1_RNA|RP4-717I23.3_ENST00000457025.1_RNA|RP4-717I23.3_ENST00000455474.1_RNA|RP4-717I23.3_ENST00000413606.1_RNA|CCDC18_ENST00000401026.3_Intron|RP4-717I23.3_ENST00000414430.1_RNA|CCDC18_ENST00000338949.4_Intron|RP4-717I23.3_ENST00000451302.2_RNA|RP4-717I23.3_ENST00000446528.2_RNA|RP4-717I23.3_ENST00000442860.1_RNA|CCDC18_ENST00000334652.5_Intron|RP4-717I23.3_ENST00000424517.3_RNA			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18											breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TCTGGGGCTATATAGATGATT	0.333																																																	0													63.0	58.0	59.0					1																	93730253		1803	4069	5872	SO:0001627	intron_variant	0					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.3682-5T>C	1.37:g.93730253T>C			Q6ZU17	RNA	SNP	-	NULL	ENST00000343253.7	37	NULL		1																																																																																			RP4-717I23.3	-	-	ENSG00000223745		0.333	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC101930643	Clone_based_vega_gene	protein_coding	OTTHUMT00000382327.1	-	0.00	12	0	T	NM_206886		93730253	-1	tier1	-	no_errors	ENST00000414430	ensembl	human	known	74_37	rna	36.36	7	4	SNP	0.112	C
LMOD1	25802	genome.wustl.edu	37	1	201915358	201915358	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:201915358G>A	ENST00000367288.4	-	1	357	c.111C>T	c.(109-111)gaC>gaT	p.D37D		NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	37					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						GGTCCACCACGTCCAGCTCCT	0.612																																																	0													54.0	61.0	59.0					1																	201915358		2021	4166	6187	SO:0001819	synonymous_variant	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.111C>T	1.37:g.201915358G>A			B1APV6|C4AMB1|Q68EN2	Silent	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.D37	ENST00000367288.4	37	c.111	CCDS53457.1	1																																																																																			LMOD1	-	pfam_Tropomodulin	ENSG00000163431		0.612	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	-	0.00	58	0	G			201915358	-1	tier1	-	no_errors	ENST00000367288	ensembl	human	known	74_37	silent	22.45	76	22	SNP	0.963	A
LTBP2	4053	genome.wustl.edu	37	14	74974791	74974791	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr14:74974791G>A	ENST00000261978.4	-	25	4046	c.3660C>T	c.(3658-3660)gaC>gaT	p.D1220D	LTBP2_ENST00000556690.1_Silent_p.D1220D	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1220	Cys-rich.|EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		TGGCACACTCGTCCACATCTA	0.592																																																	0													56.0	47.0	50.0					14																	74974791		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.3660C>T	14.37:g.74974791G>A			Q99907|Q9NS51	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.D1220	ENST00000261978.4	37	c.3660	CCDS9831.1	14																																																																																			LTBP2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000119681		0.592	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	-	0.00	31	0	G	NM_000428		74974791	-1	tier1	-	no_errors	ENST00000261978	ensembl	human	known	74_37	silent	15.62	27	5	SNP	0.995	A
MAGEB6	158809	genome.wustl.edu	37	X	26213137	26213137	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrX:26213137G>T	ENST00000379034.1	+	2	1323	c.1174G>T	c.(1174-1176)Gaa>Taa	p.E392*		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	392	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						ACATCTGTATGAAGACGCTTT	0.517																																																	0													120.0	111.0	114.0					X																	26213137		2202	4300	6502	SO:0001587	stop_gained	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.1174G>T	X.37:g.26213137G>T	ENSP00000368320:p.Glu392*		Q6GS19|Q9H219	Nonsense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E392*	ENST00000379034.1	37	c.1174	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676031	0.67928	.	.	ENSG00000176746	ENST00000379034	.	.	.	3.29	2.39	0.29439	.	0.775202	0.11311	U	0.577083	.	.	.	.	.	.	0.24662	N	0.99346	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	6.8332	0.23921	0.0:0.0:0.7239:0.2761	.	.	.	.	X	392	.	ENSP00000368320:E392X	E	+	1	0	MAGEB6	26123058	0.106000	0.21978	0.036000	0.18154	0.015000	0.08874	0.298000	0.19120	0.738000	0.32606	0.594000	0.82650	GAA	MAGEB6	-	pfscan_MAGE	ENSG00000176746		0.517	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	55	0	G	NM_173523		26213137	+1	tier1	-	no_errors	ENST00000379034	ensembl	human	known	74_37	nonsense	13.33	26	4	SNP	0.037	T
MAGI1	9223	genome.wustl.edu	37	3	65425588	65425589	+	In_Frame_Ins	INS	-	-	TGT	rs374381483|rs139785185		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr3:65425588_65425589insTGT	ENST00000497477.2	-	9	1234_1235	c.1235_1236insACA	c.(1234-1236)cag>caACAg	p.412_412Q>QQ	MAGI1_ENST00000483466.1_In_Frame_Ins_p.412_412Q>QQ|MAGI1_ENST00000330909.8_In_Frame_Ins_p.412_412Q>QQ|MAGI1_ENST00000402939.2_In_Frame_Ins_p.412_412Q>QQ|MAGI1_ENST00000470990.1_5'UTR			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	412	Poly-Gln.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		gctgctgctgctgttgctgctg	0.535											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001652	inframe_insertion	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1233_1235dupACA	3.37:g.65425589_65425591dupTGT	ENSP00000424369:p.Gln421dup	1084	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	In_Frame_Ins	INS	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.416in_frame_insQ	ENST00000497477.2	37	c.1236_1235		3																																																																																			MAGI1	-	NULL	ENSG00000151276		0.535	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2		0.00	61	0	-	NM_004742		65425589	-1	tier1		no_errors	ENST00000402939	ensembl	human	known	74_37	in_frame_ins	14.52	53	9	INS	0.423:0.413	TGT
MALAT1	378938	genome.wustl.edu	37	11	65268480	65268480	+	lincRNA	DEL	T	T	-	rs72004824|rs117197658	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:65268480delT	ENST00000534336.1	+	0	3248				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AGTTTGTGGGTTTTTTTTTTT	0.368																																																	0													83.0	101.0	95.0					11																	65268480		874	1988	2862			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268480delT				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.368	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	36	0	T	NR_002819		65268480	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	5.88	32	2	DEL	0.000	-
MAN2B2	23324	genome.wustl.edu	37	4	6578408	6578408	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr4:6578408G>A	ENST00000285599.3	+	2	278	c.242G>A	c.(241-243)cGg>cAg	p.R81Q	MAN2B2_ENST00000504248.1_Missense_Mutation_p.R81Q	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	81					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						GAGTTTTTCCGGCTGTGGTGG	0.617																																																	0													77.0	76.0	76.0					4																	6578408		2203	4300	6503	SO:0001583	missense	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.242G>A	4.37:g.6578408G>A	ENSP00000285599:p.Arg81Gln		Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.R81Q	ENST00000285599.3	37	c.242	CCDS33951.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.30|19.30	3.800898|3.800898	0.70567|0.70567	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000505907|ENST00000285599;ENST00000504248	.|T;T	.|0.73047	.|-0.71;-0.71	3.89|3.89	3.89|3.89	0.44902|0.44902	.|Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	.|0.072952	.|0.56097	.|D	.|0.000034	T|T	0.73171|0.73171	0.3553|0.3553	L|L	0.31804|0.31804	0.96|0.96	0.54753|0.54753	D|D	0.999986|0.999986	.|D;D;P	.|0.89917	.|0.998;1.0;0.87	.|D;D;B	.|0.83275	.|0.958;0.996;0.355	T|T	0.68014|0.68014	-0.5521|-0.5521	5|10	.|0.14656	.|T	.|0.56	-23.9621|-23.9621	14.4206|14.4206	0.67180|0.67180	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|81;81;81	.|E9PCD7;Q9Y2E5;Q9Y2E5-2	.|.;MA2B2_HUMAN;.	S|Q	80|81	.|ENSP00000285599:R81Q;ENSP00000423129:R81Q	.|ENSP00000285599:R81Q	G|R	+|+	1|2	0|0	MAN2B2|MAN2B2	6629309|6629309	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.153000|0.153000	0.21895|0.21895	7.537000|7.537000	0.82033|0.82033	1.678000|1.678000	0.50952|0.50952	0.555000|0.555000	0.69702|0.69702	GGC|CGG	MAN2B2	-	pfam_Glyco_hydro_38_N,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000013288		0.617	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	-	0.00	39	0	G	NM_015274		6578408	+1	tier1	-	no_errors	ENST00000285599	ensembl	human	known	74_37	missense	18.42	31	7	SNP	1.000	A
MAP3K6	9064	genome.wustl.edu	37	1	27685091	27685091	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:27685091G>T	ENST00000493901.1	-	21	2834	c.2595C>A	c.(2593-2595)taC>taA	p.Y865*	MAP3K6_ENST00000357582.2_Nonsense_Mutation_p.Y865*|MAP3K6_ENST00000374040.3_Nonsense_Mutation_p.Y857*	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	865	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GATGGACCTTGTACATACCCA	0.627																																																	0													32.0	35.0	34.0					1																	27685091		2200	4299	6499	SO:0001587	stop_gained	0			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2595C>A	1.37:g.27685091G>T	ENSP00000419591:p.Tyr865*		A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Y865*	ENST00000493901.1	37	c.2595	CCDS299.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.320783|9.320783	0.99135|0.99135	.|.	.|.	ENSG00000142733|ENSG00000142733	ENST00000472410|ENST00000374040;ENST00000493901;ENST00000545447;ENST00000357582	.|.	.|.	.|.	5.23|5.23	3.35|3.35	0.38373|0.38373	.|.	.|.	.|.	.|.	.|.	T|.	0.17619|.	0.0423|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.26292|.	-1.0107|.	3|.	.|0.05436	.|T	.|0.98	.|.	7.6087|7.6087	0.28118|0.28118	0.2602:0.0:0.7398:0.0|0.2602:0.0:0.7398:0.0	.|.	.|.	.|.	.|.	K|X	589|857;865;588;865	.|.	.|ENSP00000350195:Y865X	T|Y	-|-	2|3	0|2	MAP3K6|MAP3K6	27557678|27557678	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	0.899000|0.899000	0.28417|0.28417	1.226000|1.226000	0.43582|0.43582	0.561000|0.561000	0.74099|0.74099	ACA|TAC	MAP3K6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000142733		0.627	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	HGNC	protein_coding	OTTHUMT00000013469.2	-	0.00	44	0	G	NM_004672		27685091	-1	tier1	-	no_errors	ENST00000357582	ensembl	human	known	74_37	nonsense	6.56	57	4	SNP	1.000	T
MAPK8IP3	23162	genome.wustl.edu	37	16	1814194	1814194	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:1814194delA	ENST00000250894.4	+	18	2258	c.2101delA	c.(2101-2103)aagfs	p.K701fs	MAPK8IP3_ENST00000356010.5_Frame_Shift_Del_p.K695fs	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	701					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						TCTGGTGGAGAAGGACCCCAC	0.716																																																	0													34.0	46.0	42.0					16																	1814194		2073	4193	6266	SO:0001589	frameshift_variant	0			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.2101delA	16.37:g.1814194delA	ENSP00000250894:p.Lys701fs		A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Frame_Shift_Del	DEL	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.K701fs	ENST00000250894.4	37	c.2101	CCDS10442.2	16																																																																																			MAPK8IP3	-	NULL	ENSG00000138834		0.716	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2		0.00	27	0	A	NM_001040439		1814194	+1	tier1		no_errors	ENST00000250894	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	1.000	-
MAST2	23139	genome.wustl.edu	37	1	46497918	46497918	+	Missense_Mutation	SNP	C	C	T	rs376892493		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:46497918C>T	ENST00000361297.2	+	25	3539	c.3256C>T	c.(3256-3258)Cgg>Tgg	p.R1086W	MAST2_ENST00000372009.2_Missense_Mutation_p.R1016W	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CCCATCATCCCGGGACTCTTC	0.592																																																	0								C	TRP/ARG	2,4134		0,2,2066	83.0	91.0	88.0		3256	2.5	1.0	1		88	0,8402		0,0,4201	no	missense	MAST2	NM_015112.2	101	0,2,6267	TT,TC,CC		0.0,0.0484,0.016	probably-damaging	1086/1799	46497918	2,12536	2068	4201	6269	SO:0001583	missense	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3256C>T	1.37:g.46497918C>T	ENSP00000354671:p.Arg1086Trp			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.R1086W	ENST00000361297.2	37	c.3256	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658668	0.67586	4.84E-4	0.0	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.71103	-0.54;0.86	4.94	2.53	0.30540	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	D	0.84293	0.5440	M	0.86502	2.82	0.51233	D	0.999913	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.955	D	0.86697	0.1927	10	0.87932	D	0	-20.9025	12.4428	0.55634	0.5674:0.4326:0.0:0.0	.	1016;1086	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	W	1086;1016	ENSP00000354671:R1086W;ENSP00000361079:R1016W	ENSP00000354671:R1086W	R	+	1	2	MAST2	46270505	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.274000	0.43390	1.047000	0.40274	0.561000	0.74099	CGG	MAST2	-	superfamily_PDZ	ENSG00000086015		0.592	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	-	0.00	58	0	C	NM_015112		46497918	+1	tier1	-	no_errors	ENST00000361297	ensembl	human	known	74_37	missense	56.34	31	40	SNP	1.000	T
MBLAC1	255374	genome.wustl.edu	37	7	99725388	99725388	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr7:99725388G>T	ENST00000398075.2	+	2	769	c.370G>T	c.(370-372)Ggg>Tgg	p.G124W	RP11-506M12.1_ENST00000494221.1_RNA	NM_203397.1	NP_981942.1	A4D2B0	MBLC1_HUMAN	metallo-beta-lactamase domain containing 1	124							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|skin(1)	7						CGGGAACTTGGGGCTGTTCCC	0.731																																																	0													10.0	12.0	12.0					7																	99725388		1973	4135	6108	SO:0001583	missense	0			BC031288	CCDS43620.1	7q22	2014-02-12	2009-04-08		ENSG00000214309	ENSG00000214309			22180	protein-coding gene	gene with protein product							Standard	XM_005250250		Approved	MGC49416	uc003utp.3	A4D2B0	OTTHUMG00000154846	ENST00000398075.2:c.370G>T	7.37:g.99725388G>T	ENSP00000381150:p.Gly124Trp		Q8N5X8	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.G124W	ENST00000398075.2	37	c.370	CCDS43620.1	7	.	.	.	.	.	.	.	.	.	.	G	15.60	2.880085	0.51801	.	.	ENSG00000214309	ENST00000398075	T	0.80566	-1.39	4.35	4.35	0.52113	Beta-lactamase-like (2);	0.202037	0.31872	U	0.006931	D	0.83594	0.5288	L	0.45422	1.42	0.41335	D	0.987268	D	0.89917	1.0	D	0.91635	0.999	D	0.83797	0.0234	10	0.62326	D	0.03	.	8.3657	0.32385	0.1055:0.0:0.8945:0.0	.	124	A4D2B0	MBLC1_HUMAN	W	124	ENSP00000381150:G124W	ENSP00000381150:G124W	G	+	1	0	MBLAC1	99563324	1.000000	0.71417	1.000000	0.80357	0.204000	0.24138	3.302000	0.51849	2.440000	0.82611	0.561000	0.74099	GGG	MBLAC1	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000214309		0.731	MBLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBLAC1	HGNC	protein_coding	OTTHUMT00000337353.1	-	0.00	33	0	G	NM_203397		99725388	+1	tier1	-	no_errors	ENST00000398075	ensembl	human	known	74_37	missense	23.53	39	12	SNP	1.000	T
MDC1	9656	genome.wustl.edu	37	6	30671587	30671587	+	Silent	SNP	C	C	T	rs557483176		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:30671587C>T	ENST00000376406.3	-	10	6020	c.5373G>A	c.(5371-5373)gtG>gtA	p.V1791V	MDC1_ENST00000376405.2_Silent_p.V1527V|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1791	Required for nuclear localization (NLS2).		V -> E (in dbSNP:rs28994873).		DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						CTGCTGGTTCCACCTTTTGGA	0.542								Other conserved DNA damage response genes																																									0													114.0	103.0	106.0					6																	30671587		2203	4300	6503	SO:0001819	synonymous_variant	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5373G>A	6.37:g.30671587C>T			A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Silent	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.V1791	ENST00000376406.3	37	c.5373	CCDS34384.1	6																																																																																			MDC1	-	NULL	ENSG00000137337		0.542	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	-	0.00	23	0	C	NM_014641		30671587	-1	tier1	-	no_errors	ENST00000376406	ensembl	human	known	74_37	silent	34.78	15	8	SNP	0.000	T
MESP2	145873	genome.wustl.edu	37	15	90321579	90321579	+	3'UTR	SNP	C	C	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr15:90321579C>G	ENST00000341735.3	+	0	1208				MESP2_ENST00000560219.1_3'UTR|MESP2_ENST00000558723.1_3'UTR	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2						mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			GCCTCGGCTTCCCTCTTTCCA	0.532																																																	0													22.0	24.0	23.0					15																	90321579		1852	4091	5943	SO:0001624	3_prime_UTR_variant	0				CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.*14C>G	15.37:g.90321579C>G			Q7RTU2	RNA	SNP	-	NULL	ENST00000341735.3	37	NULL	CCDS42078.1	15																																																																																			MESP2	-	-	ENSG00000188095		0.532	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESP2	HGNC	protein_coding	OTTHUMT00000416421.1	-	0.00	21	0	C	XM_085261		90321579	+1	tier1	-	no_errors	ENST00000558723	ensembl	human	known	74_37	rna	85.71	2	12	SNP	0.000	G
MGRN1	23295	genome.wustl.edu	37	16	4714709	4714709	+	Splice_Site	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr16:4714709G>A	ENST00000399577.5	+	6	654		c.e6-1		MGRN1_ENST00000415496.1_Splice_Site|MGRN1_ENST00000588994.1_Splice_Site|MGRN1_ENST00000262370.7_Splice_Site|MGRN1_ENST00000586183.1_Splice_Site	NM_001142290.2	NP_001135762.1	O60291	MGRN1_HUMAN	mahogunin ring finger 1, E3 ubiquitin protein ligase						endosome to lysosome transport (GO:0008333)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18						TCTCTCCTCAGCTGAACTTTG	0.582																																																	0													133.0	132.0	133.0					16																	4714709		2155	4265	6420	SO:0001630	splice_region_variant	0			AB011116	CCDS42115.1, CCDS45401.1, CCDS45402.1, CCDS45401.2, CCDS59256.1	16p13	2012-02-23	2012-02-23					"""RING-type (C3HC4) zinc fingers"""	20254	protein-coding gene	gene with protein product		607559	"""mahogunin, ring finger 1"""			9628581	Standard	NM_015246		Approved	KIAA0544, RNF156	uc002cxa.3	O60291		ENST00000399577.5:c.562-1G>A	16.37:g.4714709G>A			A4URL3|A4URL4|Q86W76	Splice_Site	SNP	-	e6-1	ENST00000399577.5	37	c.562-1	CCDS45402.1	16	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750604	0.69533	.	.	ENSG00000102858	ENST00000262370;ENST00000399577;ENST00000415496;ENST00000536343	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1172	0.86692	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MGRN1	4654710	1.000000	0.71417	0.938000	0.37757	0.602000	0.36980	9.657000	0.98554	2.615000	0.88500	0.555000	0.69702	.	MGRN1	-	-	ENSG00000102858		0.582	MGRN1-004	KNOWN	basic|CCDS	protein_coding	MGRN1	HGNC	protein_coding	OTTHUMT00000432060.2	-	0.00	94	0	G		Intron	4714709	+1	tier1	-	no_errors	ENST00000262370	ensembl	human	known	74_37	splice_site	21.43	44	12	SNP	1.000	A
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				STRN3_ENST00000355683.5_Intron|MIR624_ENST00000385217.1_RNA	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																																	0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T			A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	-	0.00	63	0	G	NM_014574		31483858	-1	tier1	-	no_errors	ENST00000385217	ensembl	human	known	74_37	rna	7.79	70	6	SNP	0.001	T
MMP17	4326	genome.wustl.edu	37	12	132335615	132335615	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr12:132335615G>A	ENST00000360564.1	+	10	1710	c.1608G>A	c.(1606-1608)gtG>gtA	p.V536V	MMP17_ENST00000535004.1_Silent_p.V76V|MMP17_ENST00000535291.1_Silent_p.V452V	NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	536					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	CTGCGGGCGTGGACGCGGCAG	0.682																																																	0													25.0	26.0	26.0					12																	132335615		2196	4295	6491	SO:0001819	synonymous_variant	0			X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.1608G>A	12.37:g.132335615G>A			Q14850	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.V536	ENST00000360564.1	37	c.1608	CCDS31927.1	12																																																																																			MMP17	-	NULL	ENSG00000198598		0.682	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP17	HGNC	protein_coding	OTTHUMT00000397757.1	-	0.00	77	0	G	NM_016155		132335615	+1	tier1	-	no_errors	ENST00000360564	ensembl	human	known	74_37	silent	17.95	64	14	SNP	0.000	A
MT-CO1	4512	genome.wustl.edu	37	M	7428	7428	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrM:7428G>A	ENST00000361624.2	+	1	1525	c.1525G>A	c.(1525-1527)Gta>Ata	p.V509I	MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	509					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCGAAGAACCCGTATACATAA	0.453																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1525G>A	M.37:g.7428G>A	ENSP00000354499:p.Val509Ile		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.V509M	ENST00000361624.2	37	c.1525		MT																																																																																			MT-CO1	-	superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	105	0	G	YP_003024028		7428	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	93.42	5	71	SNP	NULL	A
MYCBPAP	84073	genome.wustl.edu	37	17	48597137	48597137	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:48597137G>A	ENST00000323776.5	+	7	1196	c.1034G>A	c.(1033-1035)cGg>cAg	p.R345Q	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.R308Q|MYCBPAP_ENST00000468821.1_3'UTR	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			CACTCCATCCGGGTGGAGACA	0.572																																																	0													54.0	46.0	49.0					17																	48597137		2203	4300	6503	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1034G>A	17.37:g.48597137G>A	ENSP00000323184:p.Arg345Gln			Missense_Mutation	SNP	NULL	p.R345Q	ENST00000323776.5	37	c.1034	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	0.302	-0.973259	0.02215	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.38887	1.11;1.11	5.75	1.77	0.24775	.	0.543895	0.20806	N	0.085327	T	0.12732	0.0309	N	0.01140	-0.99	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.04013	0.001;0.001	T	0.34750	-0.9816	10	0.02654	T	1	-14.4244	10.4996	0.44798	0.5897:0.0:0.4103:0.0	.	308;345	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	Q	345;308	ENSP00000323184:R345Q;ENSP00000397209:R308Q	ENSP00000323184:R345Q	R	+	2	0	MYCBPAP	45952136	0.087000	0.21565	0.488000	0.27440	0.151000	0.21798	0.335000	0.19806	0.123000	0.18342	-0.471000	0.05019	CGG	MYCBPAP	-	NULL	ENSG00000136449		0.572	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	-	0.00	32	0	G	NM_032133		48597137	+1	tier1	-	no_errors	ENST00000323776	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.189	A
NBPF1	55672	genome.wustl.edu	37	1	16902825	16902825	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:16902825G>A	ENST00000430580.2	-	19	2943	c.2056C>T	c.(2056-2058)Ctc>Ttc	p.L686F	NBPF1_ENST00000287968.8_Missense_Mutation_p.L51F|NBPF1_ENST00000432949.1_Missense_Mutation_p.L144F|NBPF1_ENST00000420031.2_5'Flank	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	686						cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TGTTCTTGGAGGTCCTGCCCC	0.582																																																	0																																										SO:0001583	missense	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2056C>T	1.37:g.16902825G>A	ENSP00000474456:p.Leu686Phe		Q8N4E8|Q9C0H0	Missense_Mutation	SNP	pfam_NBPF_dom	p.L144F	ENST00000430580.2	37	c.430		1																																																																																			NBPF1	-	NULL	ENSG00000219481		0.582	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	-	0.00	380	0	G	NM_017940		16902825	-1	tier1	-	no_errors	ENST00000432949	ensembl	human	known	74_37	missense	21.51	270	74	SNP	0.002	A
NCOA3	8202	genome.wustl.edu	37	20	46279834	46279836	+	In_Frame_Del	DEL	CAA	CAA	-	rs2664522|rs147879509|rs397778717|rs3830809		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	CAA	CAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:46279834_46279836delCAA	ENST00000371998.3	+	20	3951_3953	c.3760_3762delCAA	c.(3760-3762)caadel	p.Q1276del	NCOA3_ENST00000371997.3_In_Frame_Del_p.Q1267del|NCOA3_ENST00000372004.3_In_Frame_Del_p.Q1272del|NCOA3_ENST00000341724.6_In_Frame_Del_p.Q1202del			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1276	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						gcagcagcagcaacagcagcagc	0.552																																																	0																																										SO:0001651	inframe_deletion	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3760_3762delCAA	20.37:g.46279834_46279836delCAA	ENSP00000361066:p.Gln1276del		A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	In_Frame_Del	DEL	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.Q1257in_frame_del	ENST00000371998.3	37	c.3760_3762	CCDS13407.1	20																																																																																			NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.552	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1		0.00	32	0	CAA	NM_006534		46279836	+1	tier1		no_errors	ENST00000371998	ensembl	human	known	74_37	in_frame_del	9.80	46	5	DEL	0.527:0.539:0.525	-
NFKB2	4791	genome.wustl.edu	37	10	104161038	104161038	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:104161038C>T	ENST00000369966.3	+	19	2423	c.2173C>T	c.(2173-2175)Cga>Tga	p.R725*	NFKB2_ENST00000428099.1_Nonsense_Mutation_p.R725*|NFKB2_ENST00000189444.6_Nonsense_Mutation_p.R725*	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	725			Missing (in truncated form EB308).|Missing (in truncated form LB40).|Missing (in truncated form p80HT).		extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	GAAGGACACCCGAAGCAGCTT	0.607			T	IGH@	B-NHL																																			Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	0													75.0	82.0	80.0					10																	104161038		2066	4206	6272	SO:0001587	stop_gained	0			X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.2173C>T	10.37:g.104161038C>T	ENSP00000358983:p.Arg725*		A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Nonsense_Mutation	SNP	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death_domain,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like_dom,smart_IPT,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD,prints_NF_Rel_Dor,prints_Ankyrin_rpt	p.R725*	ENST00000369966.3	37	c.2173	CCDS41564.1	10	.	.	.	.	.	.	.	.	.	.	c	36	5.858527	0.97036	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	.	.	.	4.39	2.32	0.28847	.	0.836040	0.09996	N	0.729060	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	8.5998	0.33738	0.17:0.6647:0.1654:0.0	.	.	.	.	X	725	.	ENSP00000189444:R725X	R	+	1	2	NFKB2	104151028	0.001000	0.12720	0.096000	0.21009	0.620000	0.37586	1.028000	0.30128	1.169000	0.42739	0.550000	0.68814	CGA	NFKB2	-	NULL	ENSG00000077150		0.607	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKB2	HGNC	protein_coding	OTTHUMT00000050080.2	-	0.00	36	0	C			104161038	+1	tier1	-	no_errors	ENST00000369966	ensembl	human	known	74_37	nonsense	20.00	24	6	SNP	0.003	T
NOTCH1	4851	genome.wustl.edu	37	9	139399766	139399766	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:139399766A>G	ENST00000277541.6	-	25	4657	c.4582T>C	c.(4582-4584)Tgc>Cgc	p.C1528R		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1528					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CCTTACTTGCACTGGCCTTCC	0.622			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													18.0	21.0	20.0					9																	139399766		2116	4241	6357	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.4582T>C	9.37:g.139399766A>G	ENSP00000277541:p.Cys1528Arg		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.C1528R	ENST00000277541.6	37	c.4582	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	A	15.73	2.920754	0.52653	.	.	ENSG00000148400	ENST00000277541	D	0.84589	-1.87	4.08	4.08	0.47627	Notch domain (4);	0.000000	0.85682	U	0.000000	D	0.92704	0.7681	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93636	0.6960	10	0.87932	D	0	.	12.2243	0.54451	1.0:0.0:0.0:0.0	.	1528	P46531	NOTC1_HUMAN	R	1528	ENSP00000277541:C1528R	ENSP00000277541:C1528R	C	-	1	0	NOTCH1	138519587	1.000000	0.71417	1.000000	0.80357	0.362000	0.29581	8.629000	0.90983	1.479000	0.48272	0.472000	0.43445	TGC	NOTCH1	-	superfamily_Notch_dom,smart_Notch_dom,pirsf_Notch,pfscan_Notch_dom	ENSG00000148400		0.622	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	18	0	A	NM_017617		139399766	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	73.91	6	17	SNP	1.000	G
NPAS2	4862	genome.wustl.edu	37	2	101549417	101549417	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr2:101549417A>G	ENST00000335681.5	+	4	512	c.227A>G	c.(226-228)aAg>aGg	p.K76R	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Missense_Mutation_p.K141R	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	76					cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAAGACTGGAAGCCTTCATTC	0.388																																																	0													100.0	90.0	93.0					2																	101549417		2203	4300	6503	SO:0001583	missense	0			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.227A>G	2.37:g.101549417A>G	ENSP00000338283:p.Lys76Arg		Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.K141R	ENST00000335681.5	37	c.422	CCDS2048.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	27.9|27.9	4.876593|4.876593	0.91664|0.91664	.|.	.|.	ENSG00000170485|ENSG00000170485	ENST00000335681;ENST00000542504;ENST00000451740|ENST00000427413	T;T|.	0.08370|.	3.11;3.1|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Helix-loop-helix DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.72112|0.72112	0.3420|0.3420	M|M	0.65320|0.65320	2|2	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.71331|0.71331	-0.4625|-0.4625	10|5	0.87932|.	D|.	0|.	.|.	15.9057|15.9057	0.79427|0.79427	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	141;76|.	F5H027;Q99743|.	.;NPAS2_HUMAN|.	R|G	76;141;62|142	ENSP00000338283:K76R;ENSP00000438428:K141R|.	ENSP00000338283:K76R|.	K|S	+|+	2|1	0|0	NPAS2|NPAS2	100915849|100915849	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.824000|8.824000	0.92023|0.92023	2.138000|2.138000	0.66242|0.66242	0.533000|0.533000	0.62120|0.62120	AAG|AGC	NPAS2	-	superfamily_bHLH_dom,prints_Nuc_translocat	ENSG00000170485		0.388	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	-	0.00	19	0	A			101549417	+1	tier1	-	no_errors	ENST00000542504	ensembl	human	known	74_37	missense	61.11	7	11	SNP	1.000	G
NPR1	4881	genome.wustl.edu	37	1	153655047	153655047	+	Silent	SNP	C	C	T	rs201584708		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:153655047C>T	ENST00000368680.3	+	5	1717	c.1245C>T	c.(1243-1245)ccC>ccT	p.P415P		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	415					body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	ATATGGATCCCGAGAATGGTG	0.532																																					Pancreas(141;1349 1870 15144 15830 40702)												0													115.0	92.0	100.0					1																	153655047		2203	4300	6503	SO:0001819	synonymous_variant	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.1245C>T	1.37:g.153655047C>T			B0ZBF0|Q5SR08|Q6P4Q3	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.P415	ENST00000368680.3	37	c.1245	CCDS1051.1	1																																																																																			NPR1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000169418		0.532	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1	-	0.00	57	0	C	NM_000906		153655047	+1	tier1	rs201584708	no_errors	ENST00000368680	ensembl	human	known	74_37	silent	11.46	85	11	SNP	0.919	T
ODF3L1	161753	genome.wustl.edu	37	15	76019672	76019672	+	Nonsense_Mutation	SNP	C	C	T	rs372700633		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr15:76019672C>T	ENST00000332145.2	+	4	839	c.616C>T	c.(616-618)Cga>Tga	p.R206*	DNM1P35_ENST00000501931.1_RNA	NM_175881.3	NP_787077.1	Q8IXM7	OD3L1_HUMAN	outer dense fiber of sperm tails 3-like 1	206										kidney(1)|lung(1)	2						CACGTACGCCCGACCTGAGCC	0.627																																																	0													96.0	78.0	84.0					15																	76019672		2197	4294	6491	SO:0001587	stop_gained	0			BC039862	CCDS10285.1	15q23	2008-02-05			ENSG00000182950	ENSG00000182950			28735	protein-coding gene	gene with protein product							Standard	NM_175881		Approved	MGC48986	uc002bax.1	Q8IXM7	OTTHUMG00000142837	ENST00000332145.2:c.616C>T	15.37:g.76019672C>T	ENSP00000329584:p.Arg206*			Nonsense_Mutation	SNP	pfam_SHIPPO-rpt	p.R206*	ENST00000332145.2	37	c.616	CCDS10285.1	15	.	.	.	.	.	.	.	.	.	.	.	15.07	2.724715	0.48833	.	.	ENSG00000182950	ENST00000332145	.	.	.	4.68	1.3	0.21679	.	0.000000	0.47093	D	0.000250	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-24.3818	10.454	0.44539	0.4937:0.5063:0.0:0.0	.	.	.	.	X	206	.	ENSP00000329584:R206X	R	+	1	2	ODF3L1	73806727	0.002000	0.14202	0.073000	0.20177	0.007000	0.05969	0.037000	0.13840	0.440000	0.26502	0.561000	0.74099	CGA	ODF3L1	-	NULL	ENSG00000182950		0.627	ODF3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3L1	HGNC	protein_coding	OTTHUMT00000286473.1	-	0.00	35	0	C	NM_175881		76019672	+1	tier1	-	no_errors	ENST00000332145	ensembl	human	known	74_37	nonsense	62.50	15	25	SNP	0.486	T
NTRK3	4916	genome.wustl.edu	37	15	88420209	88420209	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr15:88420209G>A	ENST00000360948.2	-	19	2638	c.2477C>T	c.(2476-2478)gCt>gTt	p.A826V	NTRK3_ENST00000357724.2_Missense_Mutation_p.A818V|NTRK3_ENST00000394480.2_Missense_Mutation_p.A812V|NTRK3_ENST00000557856.1_Missense_Mutation_p.A804V|NTRK3_ENST00000355254.2_Missense_Mutation_p.A812V	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	826	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CTTCCCCAAAGCATGGAGGAT	0.537			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													168.0	133.0	145.0					15																	88420209		2201	4299	6500	SO:0001583	missense	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.2477C>T	15.37:g.88420209G>A	ENSP00000354207:p.Ala826Val		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A826V	ENST00000360948.2	37	c.2477	CCDS32322.1	15	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423584	0.25639	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254	T;T;T;T	0.74737	-0.87;-0.84;-0.85;-0.87	5.71	4.79	0.61399	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66742	0.2820	L	0.29908	0.895	0.80722	D	1	B;P;B	0.42296	0.228;0.775;0.228	B;B;B	0.41412	0.091;0.356;0.091	T	0.69614	-0.5098	10	0.52906	T	0.07	.	15.4274	0.75065	0.0:0.1396:0.8604:0.0	.	804;812;826	B7Z4C5;Q16288-3;Q16288	.;.;NTRK3_HUMAN	V	812;826;818;812	ENSP00000377990:A812V;ENSP00000354207:A826V;ENSP00000350356:A818V;ENSP00000347397:A812V	ENSP00000347397:A812V	A	-	2	0	NTRK3	86221213	0.899000	0.30636	0.058000	0.19502	0.003000	0.03518	4.606000	0.61126	1.411000	0.46957	-0.175000	0.13238	GCT	NTRK3	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000140538		0.537	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	66	0	G			88420209	-1	tier1	-	no_errors	ENST00000360948	ensembl	human	known	74_37	missense	14.04	49	8	SNP	0.905	A
OPN4	94233	genome.wustl.edu	37	10	88422152	88422152	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:88422152G>A	ENST00000241891.5	+	8	1384	c.1217G>A	c.(1216-1218)cGg>cAg	p.R406Q	OPN4_ENST00000372071.2_Missense_Mutation_p.R417Q	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	406					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						ATCTCCATACGGAGGCGCCAG	0.672																																																	0													36.0	24.0	28.0					10																	88422152		2187	4284	6471	SO:0001583	missense	0			AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1217G>A	10.37:g.88422152G>A	ENSP00000241891:p.Arg406Gln		B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Opsin	p.R417Q	ENST00000241891.5	37	c.1250	CCDS7376.1	10	.	.	.	.	.	.	.	.	.	.	G	11.09	1.537242	0.27475	.	.	ENSG00000122375	ENST00000372071;ENST00000241891;ENST00000443292	T;T;T	0.34859	1.34;1.34;1.34	5.39	3.52	0.40303	.	0.375026	0.24960	N	0.034236	T	0.32971	0.0847	M	0.72118	2.19	0.09310	N	1	B;B;B	0.24132	0.059;0.059;0.098	B;B;B	0.14578	0.005;0.005;0.011	T	0.23368	-1.0190	10	0.33940	T	0.23	.	7.0635	0.25139	0.1442:0.0:0.7175:0.1383	.	417;406;417	C9JWU6;Q9UHM6;Q9UHM6-2	.;OPN4_HUMAN;.	Q	417;406;417	ENSP00000361141:R417Q;ENSP00000241891:R406Q;ENSP00000393132:R417Q	ENSP00000241891:R406Q	R	+	2	0	OPN4	88412132	0.000000	0.05858	0.185000	0.23176	0.499000	0.33736	0.611000	0.24268	0.638000	0.30545	0.655000	0.94253	CGG	OPN4	-	NULL	ENSG00000122375		0.672	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN4	HGNC	protein_coding	OTTHUMT00000049158.2	-	0.00	89	0	G	NM_033282		88422152	+1	tier1	-	no_errors	ENST00000372071	ensembl	human	known	74_37	missense	16.67	55	11	SNP	0.005	A
OR51F2	119694	genome.wustl.edu	37	11	4842865	4842865	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:4842865G>T	ENST00000322110.5	+	1	315	c.250G>T	c.(250-252)Gac>Tac	p.D84Y	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTCAGCCACAGACCTGAGCTT	0.473																																																	0													188.0	179.0	182.0					11																	4842865		2201	4298	6499	SO:0001583	missense	0			BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.250G>T	11.37:g.4842865G>T	ENSP00000323952:p.Asp84Tyr		Q6IFI1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D84Y	ENST00000322110.5	37	c.250	CCDS31361.1	11	.	.	.	.	.	.	.	.	.	.	G	18.63	3.665411	0.67700	.	.	ENSG00000176925	ENST00000322110	T	0.68025	-0.3	4.43	4.43	0.53597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000666	D	0.87233	0.6126	H	0.99668	4.69	0.42417	D	0.992624	D	0.60575	0.988	P	0.53518	0.728	D	0.93361	0.6727	10	0.87932	D	0	.	16.1233	0.81375	0.0:0.0:1.0:0.0	.	84	Q8NH61	O51F2_HUMAN	Y	84	ENSP00000323952:D84Y	ENSP00000323952:D84Y	D	+	1	0	OR51F2	4799441	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.145000	0.64839	2.461000	0.83175	0.561000	0.74099	GAC	OR51F2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000176925		0.473	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51F2	HGNC	protein_coding	OTTHUMT00000142181.1	-	0.00	50	0	G	NM_001004753		4842865	+1	tier1	-	no_errors	ENST00000322110	ensembl	human	known	74_37	missense	34.52	55	29	SNP	1.000	T
OR51G2	81282	genome.wustl.edu	37	11	4936276	4936276	+	Silent	SNP	A	A	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:4936276A>G	ENST00000322013.3	-	1	646	c.618T>C	c.(616-618)ttT>ttC	p.F206F	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001005238.1	NP_001005238.1	Q8NGK0	O51G2_HUMAN	olfactory receptor, family 51, subfamily G, member 2	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|large_intestine(9)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGACGATGACAAACATGCCGT	0.507																																																	0													132.0	108.0	116.0					11																	4936276		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065794	CCDS31365.1	11p15.4	2012-08-09			ENSG00000176893	ENSG00000176893		"""GPCR / Class A : Olfactory receptors"""	15198	protein-coding gene	gene with protein product							Standard	NM_001005238		Approved		uc001lzr.1	Q8NGK0	OTTHUMG00000066501	ENST00000322013.3:c.618T>C	11.37:g.4936276A>G			Q6IFH7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F206	ENST00000322013.3	37	c.618	CCDS31365.1	11																																																																																			OR51G2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000176893		0.507	OR51G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G2	HGNC	protein_coding	OTTHUMT00000142174.1	-	0.00	39	0	A	NM_001005238		4936276	-1	tier1	-	no_errors	ENST00000322013	ensembl	human	known	74_37	silent	28.07	41	16	SNP	0.996	G
OR4A16	81327	genome.wustl.edu	37	11	55110876	55110876	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:55110876T>C	ENST00000314721.2	+	1	250	c.200T>C	c.(199-201)aTg>aCg	p.M67T		NM_001005274.1	NP_001005274.1	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A, member 16	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	51						TTGTCACTTATGGATGCCATA	0.453																																																	0													190.0	175.0	180.0					11																	55110876		2201	4296	6497	SO:0001583	missense	0			AB065519	CCDS31499.1	11q11	2012-08-09			ENSG00000181961	ENSG00000181961		"""GPCR / Class A : Olfactory receptors"""	15153	protein-coding gene	gene with protein product							Standard	NM_001005274		Approved	OR4A16Q	uc010rie.2	Q8NH70	OTTHUMG00000166710	ENST00000314721.2:c.200T>C	11.37:g.55110876T>C	ENSP00000325128:p.Met67Thr		Q6IFL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M67T	ENST00000314721.2	37	c.200	CCDS31499.1	11	.	.	.	.	.	.	.	.	.	.	t	2.261	-0.369258	0.05069	.	.	ENSG00000181961	ENST00000314721	T	0.03065	4.06	2.57	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03136	0.0092	N	0.20807	0.61	0.21445	N	0.999682	B	0.10296	0.003	B	0.13407	0.009	T	0.39014	-0.9634	9	0.56958	D	0.05	.	8.6087	0.33789	0.0:0.0:0.0:1.0	.	67	Q8NH70	O4A16_HUMAN	T	67	ENSP00000325128:M67T	ENSP00000325128:M67T	M	+	2	0	OR4A16	54867452	0.000000	0.05858	0.977000	0.42913	0.005000	0.04900	0.040000	0.13905	1.186000	0.42985	0.346000	0.21813	ATG	OR4A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181961		0.453	OR4A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A16	HGNC	protein_coding	OTTHUMT00000391160.1	-	0.00	40	0	T	NM_001005274		55110876	+1	tier1	-	no_errors	ENST00000314721	ensembl	human	known	74_37	missense	13.21	46	7	SNP	0.966	C
PAPD7	11044	genome.wustl.edu	37	5	6755014	6755014	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:6755014C>A	ENST00000230859.6	+	13	1714	c.1585C>A	c.(1585-1587)Cac>Aac	p.H529N		NM_001171805.1|NM_001171806.1|NM_006999.4	NP_001165276.1|NP_001165277.1|NP_008930.1	Q5XG87	PAPD7_HUMAN	PAP associated domain containing 7	759					double-strand break repair (GO:0006302)|mitotic chromosome condensation (GO:0007076)|response to drug (GO:0042493)|sister chromatid cohesion (GO:0007062)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|SMC family protein binding (GO:0043221)			cervix(1)|endometrium(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GAGGAAAAAACACACACACAC	0.657																																					NSCLC(7;212 333 5667 23379 46547)												0													29.0	31.0	30.0					5																	6755014		2202	4300	6502	SO:0001583	missense	0			AF089896	CCDS3871.1	5p15	2010-11-18	2010-01-19	2010-01-19	ENSG00000112941	ENSG00000112941			16705	protein-coding gene	gene with protein product	"""topoisomerase-related function protein 4-1"", ""polymerase (DNA-directed) sigma"", ""DNA polymerase kappa"", ""TUTase5"""	605198	"""polymerase (DNA directed) sigma"""	POLS		10066793, 10926539	Standard	NM_006999		Approved	POLK, TRF4, LAK-1, TRF4-1	uc003jdx.1	Q5XG87	OTTHUMG00000090457	ENST00000230859.6:c.1585C>A	5.37:g.6755014C>A	ENSP00000230859:p.His529Asn		A8K1E2|M1JCE6|O43289|Q17RZ1|Q9Y6C1	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Nucleotidyltransferase	p.H529N	ENST00000230859.6	37	c.1585	CCDS3871.1	5	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940508	0.52972	.	.	ENSG00000112941	ENST00000230859	T	0.33216	1.42	4.96	4.96	0.65561	.	0.000000	0.64402	D	0.000017	T	0.16727	0.0402	N	0.19112	0.55	0.31730	N	0.637111	P;P	0.43826	0.818;0.818	B;B	0.32090	0.14;0.14	T	0.20806	-1.0264	10	0.72032	D	0.01	-12.2819	10.9635	0.47399	0.0:0.912:0.0:0.088	.	528;529	B7ZLL4;Q5XG87	.;PAPD7_HUMAN	N	529	ENSP00000230859:H529N	ENSP00000230859:H529N	H	+	1	0	PAPD7	6808014	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	2.917000	0.48821	2.458000	0.83093	0.655000	0.94253	CAC	PAPD7	-	NULL	ENSG00000112941		0.657	PAPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPD7	HGNC	protein_coding	OTTHUMT00000206904.1	-	0.00	30	0	C	NM_006999		6755014	+1	tier1	-	no_errors	ENST00000230859	ensembl	human	known	74_37	missense	63.64	4	7	SNP	1.000	A
PCDH8	5100	genome.wustl.edu	37	13	53418936	53418936	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr13:53418936G>A	ENST00000377942.3	-	3	3175	c.2972C>T	c.(2971-2973)aCg>aTg	p.T991M	PCDH8_ENST00000338862.4_Missense_Mutation_p.T894M	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	991					cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		AGGCAGTGACGTGCTCTTACA	0.607																																					GBM(36;25 841 9273 49207)												0													169.0	101.0	124.0					13																	53418936		2203	4300	6503	SO:0001583	missense	0			AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.2972C>T	13.37:g.53418936G>A	ENSP00000367177:p.Thr991Met		B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T991M	ENST00000377942.3	37	c.2972	CCDS9438.1	13	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901958	0.72754	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.54279	0.64;0.58	5.95	5.95	0.96441	.	0.000000	0.45361	D	0.000363	T	0.66208	0.2766	L	0.36672	1.1	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.939	T	0.66093	-0.6009	10	0.66056	D	0.02	.	20.3747	0.98911	0.0:0.0:1.0:0.0	.	894;991	O95206-2;O95206	.;PCDH8_HUMAN	M	991;894;517;834	ENSP00000367177:T991M;ENSP00000341350:T894M	ENSP00000341350:T894M	T	-	2	0	PCDH8	52316937	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.310000	0.78947	2.817000	0.96982	0.563000	0.77884	ACG	PCDH8	-	NULL	ENSG00000136099		0.607	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH8	HGNC	protein_coding	OTTHUMT00000045108.2	-	0.00	43	0	G	NM_002590		53418936	-1	tier1	-	no_errors	ENST00000377942	ensembl	human	known	74_37	missense	96.88	1	31	SNP	1.000	A
PDZD2	23037	genome.wustl.edu	37	5	32108657	32108657	+	3'UTR	SNP	T	T	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:32108657T>C	ENST00000438447.1	+	0	9324				CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000282493.3_3'UTR|PDZD2_ENST00000513490.1_3'UTR			O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						ATGTCACACCTAAGAGGACAA	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.*416T>C	5.37:g.32108657T>C			Q9BXD4	RNA	SNP	-	NULL	ENST00000438447.1	37	NULL	CCDS34137.1	5																																																																																			PDZD2	-	-	ENSG00000133401		0.408	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	-	0.00	24	0	T			32108657	+1	tier1	-	no_errors	ENST00000397559	ensembl	human	known	74_37	rna	85.71	1	6	SNP	0.000	C
PCDHB7	56129	genome.wustl.edu	37	5	140554656	140554656	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:140554656A>G	ENST00000231137.3	+	1	2414	c.2240A>G	c.(2239-2241)tAc>tGc	p.Y747C	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	747					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCCCAGAGCTACCAGTATGAG	0.607																																																	0													88.0	136.0	120.0					5																	140554656		2203	4300	6503	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2240A>G	5.37:g.140554656A>G	ENSP00000231137:p.Tyr747Cys		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y747C	ENST00000231137.3	37	c.2240	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	A	16.89	3.248378	0.59103	.	.	ENSG00000113212	ENST00000231137	T	0.16743	2.32	4.29	4.29	0.51040	.	.	.	.	.	T	0.55337	0.1914	H	0.96662	3.86	0.38419	D	0.94614	D	0.89917	1.0	D	0.85130	0.997	T	0.73914	-0.3832	9	0.87932	D	0	.	13.4674	0.61263	1.0:0.0:0.0:0.0	.	747	Q9Y5E2	PCDB7_HUMAN	C	747	ENSP00000231137:Y747C	ENSP00000231137:Y747C	Y	+	2	0	PCDHB7	140534840	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	3.864000	0.56024	1.707000	0.51288	0.369000	0.22263	TAC	PCDHB7	-	NULL	ENSG00000113212		0.607	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	100	0	A	NM_018940		140554656	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	missense	94.59	4	70	SNP	1.000	G
PHF20	51230	genome.wustl.edu	37	20	34505482	34505482	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:34505482G>A	ENST00000374012.3	+	13	2031	c.1902G>A	c.(1900-1902)gtG>gtA	p.V634V	PHF20_ENST00000439301.1_3'UTR			Q9BVI0	PHF20_HUMAN	PHD finger protein 20	634					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					ATGTGGATGTGACCACCAACC	0.488																																																	0													152.0	115.0	128.0					20																	34505482		2203	4300	6503	SO:0001819	synonymous_variant	0			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.1902G>A	20.37:g.34505482G>A			A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	Silent	SNP	pfam_DUF3776,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_C2H2	p.V634	ENST00000374012.3	37	c.1902	CCDS13268.1	20																																																																																			PHF20	-	NULL	ENSG00000025293		0.488	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	HGNC	protein_coding	OTTHUMT00000078949.2	-	0.00	74	0	G	NM_016436		34505482	+1	tier1	-	no_errors	ENST00000374012	ensembl	human	known	74_37	silent	70.33	26	64	SNP	0.999	A
PI4KAP2	375133	genome.wustl.edu	37	22	21829514	21829517	+	RNA	DEL	TGTC	TGTC	-	rs113567369|rs57294418	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	TGTC	TGTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr22:21829514_21829517delTGTC	ENST00000450651.1	-	0	1821_1824							A4QPH2	PI4P2_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2						phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(3)|urinary_tract(1)	4						AGAGCTTGATTGTCTGGCCGCGAA	0.564														3270	0.652955	0.8162	0.5865	5008	,	,		11476	0.4454		0.8708	False		,,,				2504	0.4693																0										3028,976		1236,556,210						2.4	1.0		dbSNP_132	21	6139,1303		2723,693,305	no	intergenic				3959,1249,515	A1A1,A1R,RR		17.5087,24.3756,19.9109				9167,2279						0					22q11.21	2014-03-20	2007-08-14		ENSG00000183506	ENSG00000183506			33577	pseudogene	pseudogene							Standard	NR_003700		Approved		uc011aie.1	A4QPH2	OTTHUMG00000150827		22.37:g.21829514_21829517delTGTC			Q6ICJ0|Q6ZT68|Q8WUK7	RNA	DEL	-	NULL	ENST00000450651.1	37	NULL		22																																																																																			PI4KAP2	-	-	ENSG00000183506		0.564	PI4KAP2-005	KNOWN	basic	processed_transcript	PI4KAP2	HGNC	pseudogene	OTTHUMT00000334908.1		0.00	40	0	TGTC			21829517	-1	tier1		no_errors	ENST00000450651	ensembl	human	known	74_37	rna	50.00	8	8	DEL	1.000:1.000:1.000:1.000	-
PIP5K1B	8395	genome.wustl.edu	37	9	71439055	71439055	+	Intron	SNP	C	C	T	rs541206174		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:71439055C>T	ENST00000265382.3	+	4	374				PIP5K1B_ENST00000541509.1_Intron|RP11-203L2.4_ENST00000442103.1_RNA	NM_003558.2	NP_003549.1	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			breast(1)|large_intestine(2)|stomach(1)	4				Lung(182;0.133)		CCCAAGATTCCGTGTACATTC	0.363													C|||	1	0.000199681	0.0	0.0	5008	,	,		19948	0.001		0.0	False		,,,				2504	0.0																0													405.0	385.0	391.0					9																	71439055		876	1991	2867	SO:0001627	intron_variant	0			U78579	CCDS6624.1, CCDS65063.1	9q13	2008-02-05			ENSG00000107242	ENSG00000107242			8995	protein-coding gene	gene with protein product		602745				9177790, 8841185	Standard	NM_003558		Approved	STM7, MSS4	uc004agu.4	O14986	OTTHUMG00000019976	ENST00000265382.3:c.69+1456C>T	9.37:g.71439055C>T			A8K9L9|B4DIG7|P78518|P78519|Q5T5K6|Q5T5K8|Q5T5K9|Q5VZ00|Q7KYT5|Q8NHQ5|Q92749	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.P38L	ENST00000265382.3	37	c.113	CCDS6624.1	9																																																																																			PIP5K1B	-	NULL	ENSG00000107242		0.363	PIP5K1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP5K1B	HGNC	protein_coding	OTTHUMT00000052561.2	-	0.00	51	0	C	NM_003558		71439055	+1	tier1	-	no_errors	ENST00000478500	ensembl	human	known	74_37	missense	52.94	24	27	SNP	0.000	T
PKD2	5311	genome.wustl.edu	37	4	88929174	88929176	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr4:88929174_88929176delGAG	ENST00000237596.2	+	1	355_357	c.289_291delGAG	c.(289-291)gagdel	p.E102del		NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		CTTCGAGGCCgaggaggaggagg	0.739																																																	0										18,82,2250		6,0,6,18,46,1099						-3.4	0.9			2	8,117,4707		2,0,4,14,89,2307	no	codingComplex	PKD2	NM_000297.3		8,0,10,32,135,3406	A1A1,A1A2,A1R,A2A2,A2R,RR		2.5869,4.2553,3.1328				26,199,6957				SO:0001651	inframe_deletion	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.289_291delGAG	4.37:g.88929183_88929185delGAG	ENSP00000237596:p.Glu102del		Q8TB08|Q9P0T6|Q9Y3X8	In_Frame_Del	DEL	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_hand_dom,prints_PKD_2,prints_PKD_1	p.E100in_frame_del	ENST00000237596.2	37	c.289_291	CCDS3627.1	4																																																																																			PKD2	-	NULL	ENSG00000118762		0.739	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4		0.00	22	0	GAG	NM_000297		88929176	+1	tier1		no_errors	ENST00000237596	ensembl	human	known	74_37	in_frame_del	12.50	14	2	DEL	1.000:1.000:1.000	-
PLCB3	5331	genome.wustl.edu	37	11	64033845	64033845	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:64033845G>T	ENST00000540288.1	+	28	3428	c.3325G>T	c.(3325-3327)Gcc>Tcc	p.A1109S	PLCB3_ENST00000325234.5_Missense_Mutation_p.A1042S|PLCB3_ENST00000279230.6_Missense_Mutation_p.A1109S	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	1109				REKKELQKILDRKRHNSISEAKMRDKHKKEA -> SWPSWP RSVRSSGRGSPRRSAGACWARCRRG (in Ref. 2; CAA85776). {ECO:0000305}.	inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CATCTCGGAGGCCAAGATGAG	0.627																																																	0													80.0	85.0	83.0					11																	64033845		2201	4297	6498	SO:0001583	missense	0			Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.3325G>T	11.37:g.64033845G>T	ENSP00000443631:p.Ala1109Ser		A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,pfam_PLC-beta_CS,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.A1109S	ENST00000540288.1	37	c.3325	CCDS8064.1	11	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570218	0.86542	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.50001	0.76;0.76;0.76	4.87	4.87	0.63330	PLC-beta, C-terminal (1);	2.592480	0.01170	N	0.006840	T	0.72358	0.3450	M	0.65498	2.005	0.52501	D	0.999953	D;D	0.89917	1.0;0.994	D;D	0.85130	0.997;0.96	T	0.54077	-0.8347	10	0.27785	T	0.31	.	16.798	0.85607	0.0:0.0:1.0:0.0	.	1042;1109	G5E960;Q01970	.;PLCB3_HUMAN	S	1109;1109;1042	ENSP00000279230:A1109S;ENSP00000443631:A1109S;ENSP00000324660:A1042S	ENSP00000279230:A1109S	A	+	1	0	PLCB3	63790421	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.329000	0.79170	2.269000	0.75478	0.555000	0.69702	GCC	PLCB3	-	pirsf_PLC-beta,pfam_PLC-beta_C	ENSG00000149782		0.627	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	PLCB3	HGNC	protein_coding	OTTHUMT00000396405.1	-	0.00	17	0	G			64033845	+1	tier1	-	no_errors	ENST00000279230	ensembl	human	known	74_37	missense	42.11	11	8	SNP	1.000	T
PLEKHA6	22874	genome.wustl.edu	37	1	204237354	204237354	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:204237354C>T	ENST00000272203.3	-	4	505	c.189G>A	c.(187-189)gcG>gcA	p.A63A	PLEKHA6_ENST00000414478.1_Silent_p.A63A	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	63	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.							p.A63A(1)		breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			AGAGCCAGCCCGCCTTGGTGA	0.602																																																	1	Substitution - coding silent(1)	lung(1)											111.0	94.0	100.0					1																	204237354		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.189G>A	1.37:g.204237354C>T			A7MD51|Q5VTI6	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A63	ENST00000272203.3	37	c.189	CCDS1444.1	1																																																																																			PLEKHA6	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000143850		0.602	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	-	0.00	40	0	C	NM_014935		204237354	-1	tier1	-	no_errors	ENST00000272203	ensembl	human	known	74_37	silent	15.58	65	12	SNP	0.295	T
PLEKHG3	26030	genome.wustl.edu	37	14	65197520	65197520	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr14:65197520C>T	ENST00000394691.1	+	6	717	c.570C>T	c.(568-570)tcC>tcT	p.S190S	PLEKHG3_ENST00000247226.7_Silent_p.S134S			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	190	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		CTCCCAGCTCCGTGGCCGCCC	0.642																																																	0													39.0	40.0	40.0					14																	65197520		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.570C>T	14.37:g.65197520C>T			A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S190	ENST00000394691.1	37	c.570		14																																																																																			PLEKHG3	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000126822		0.642	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	PLEKHG3	HGNC	protein_coding	OTTHUMT00000412028.1	-	0.00	42	0	C	NM_015549		65197520	+1	tier1	-	no_errors	ENST00000394691	ensembl	human	known	74_37	silent	31.88	47	22	SNP	0.002	T
POLR2H	5437	genome.wustl.edu	37	3	184086034	184086034	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr3:184086034C>T	ENST00000456318.1	+	6	1454	c.405C>T	c.(403-405)ttC>ttT	p.F135F	POLR2H_ENST00000443489.1_Silent_p.F71F|POLR2H_ENST00000430783.1_Silent_p.F107F|EIF2B5_ENST00000444495.1_Intron|POLR2H_ENST00000438240.1_Silent_p.F99F|POLR2H_ENST00000296223.3_Silent_p.F135F|POLR2H_ENST00000429568.1_Nonsense_Mutation_p.R157*|POLR2H_ENST00000452961.1_Silent_p.F99F	NM_001278699.1	NP_001265628.1	P52434	RPAB3_HUMAN	polymerase (RNA) II (DNA directed) polypeptide H	135					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of type I interferon production (GO:0032481)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase II, core complex (GO:0005665)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TGCATGGATTCGAGGTGGACT	0.557																																																	0													125.0	118.0	120.0					3																	184086034		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3264.1, CCDS63861.1, CCDS63862.1, CCDS63859.1, CCDS63860.1	3q28	2013-01-21			ENSG00000163882	ENSG00000163882		"""RNA polymerase subunits"""	9195	protein-coding gene	gene with protein product		606023					Standard	NM_001278698		Approved	RPB8	uc003fok.2	P52434	OTTHUMG00000156746	ENST00000456318.1:c.405C>T	3.37:g.184086034C>T			C9J413|C9JBJ6|C9JCU7|C9JUA8|P53802|Q969R0	Nonsense_Mutation	SNP	pfam_RNA_pol_Rpb8,superfamily_NA-bd_OB-fold,smart_RNA_pol_Rpb8	p.R157*	ENST00000456318.1	37	c.469	CCDS3264.1	3	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474050	0.63737	.	.	ENSG00000163882	ENST00000429568	.	.	.	5.74	-0.534	0.11883	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.945	10.1302	0.42674	0.0:0.2858:0.0:0.7142	.	.	.	.	X	157	.	ENSP00000415536:R157X	R	+	1	2	POLR2H	185568728	0.902000	0.30710	0.999000	0.59377	0.956000	0.61745	-0.106000	0.10890	0.125000	0.18397	-1.154000	0.01816	CGA	POLR2H	-	NULL	ENSG00000163882		0.557	POLR2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2H	HGNC	protein_coding	OTTHUMT00000345558.1	-	0.00	51	0	C	NM_006232		184086034	+1	tier1	-	no_errors	ENST00000429568	ensembl	human	novel	74_37	nonsense	28.57	65	26	SNP	0.987	T
POTEA	340441	genome.wustl.edu	37	8	43152432	43152432	+	RNA	SNP	G	G	A	rs376823659|rs370204067	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr8:43152432G>A	ENST00000522175.2	+	0	420							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CTGACAGGCCGTACAATGCCA	0.373													g|||	3	0.000599042	0.0	0.0	5008	,	,		19441	0.001		0.001	False		,,,				2504	0.001																0								G	ILE/VAL,ILE/VAL	0,4398		0,0,2199	92.0	90.0	90.0		418,418	-2.7	0.0	8		90	2,8594	2.2+/-6.3	0,2,4296	no	missense,missense	POTEA	NM_001002920.1,NM_001005365.2	29,29	0,2,6495	AA,AG,GG		0.0233,0.0,0.0154	benign,benign	140/453,140/499	43152432	2,12992	2199	4298	6497			0			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43152432G>A			A6ND17|A6ND71|Q6S8J6	RNA	SNP	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			POTEA	-	-	ENSG00000188877		0.373	POTEA-003	KNOWN	basic	processed_transcript	POTEA	HGNC	pseudogene	OTTHUMT00000383492.1	-	0.00	126	0	G	NM_001002920		43152432	+1	tier1	-	no_errors	ENST00000522175	ensembl	human	known	74_37	rna	12.33	128	18	SNP	0.842	A
PRDM2	7799	genome.wustl.edu	37	1	14107528	14107528	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:14107528G>T	ENST00000235372.7	+	8	4094	c.3238G>T	c.(3238-3240)Gca>Tca	p.A1080S	PRDM2_ENST00000503842.1_Intron|PRDM2_ENST00000343137.4_Missense_Mutation_p.A879S|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.A1080S|PRDM2_ENST00000413440.1_Missense_Mutation_p.A879S	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	1080					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		TCCTCTCTCCGCAATATCATC	0.468																																																	0													52.0	47.0	49.0					1																	14107528		2203	4300	6503	SO:0001583	missense	0			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.3238G>T	1.37:g.14107528G>T	ENSP00000235372:p.Ala1080Ser		B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_SET_dom,pfscan_Znf_C2H2	p.A1080S	ENST00000235372.7	37	c.3238	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	G	5.812	0.334125	0.11013	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.01446	5.0;4.88;4.88;4.88	5.97	5.97	0.96955	.	0.441759	0.26601	N	0.023462	T	0.04452	0.0122	L	0.44542	1.39	0.38824	D	0.955707	D;D;D	0.58970	0.973;0.973;0.984	P;P;P	0.54346	0.565;0.565;0.749	T	0.58629	-0.7603	10	0.07813	T	0.8	.	18.9918	0.92796	0.0:0.0:1.0:0.0	.	938;1080;1080	Q5THJ0;Q13029;Q13029-2	.;PRDM2_HUMAN;.	S	1080;1080;1080;879;879	ENSP00000235372:A1080S;ENSP00000312352:A1080S;ENSP00000411103:A879S;ENSP00000341621:A879S	ENSP00000235372:A1080S	A	+	1	0	PRDM2	13980115	1.000000	0.71417	0.965000	0.40720	0.108000	0.19459	5.354000	0.66040	2.837000	0.97791	0.655000	0.94253	GCA	PRDM2	-	pirsf_RIZ_retinblastoma-bd_prot	ENSG00000116731		0.468	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	HGNC	protein_coding	OTTHUMT00000021792.2	-	0.00	39	0	G	NM_012231		14107528	+1	tier1	-	no_errors	ENST00000235372	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.992	T
PRRC2B	84726	genome.wustl.edu	37	9	134321903	134321903	+	Silent	SNP	C	C	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:134321903C>G	ENST00000357304.4	+	6	784	c.729C>G	c.(727-729)tcC>tcG	p.S243S	PRRC2B_ENST00000372249.1_5'Flank|PRRC2B_ENST00000458550.1_Silent_p.S243S|PRRC2B_ENST00000405995.1_Silent_p.S243S	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	243							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GAGCCCCCTCCTCGGCATGTA	0.597																																																	0													51.0	51.0	51.0					9																	134321903		1948	4139	6087	SO:0001819	synonymous_variant	0			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.729C>G	9.37:g.134321903C>G			O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	pfam_BAT2_N	p.S243	ENST00000357304.4	37	c.729	CCDS48044.1	9																																																																																			PRRC2B	-	NULL	ENSG00000130723		0.597	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		-	0.00	61	0	C			134321903	+1	tier1	-	no_errors	ENST00000357304	ensembl	human	known	74_37	silent	12.94	74	11	SNP	1.000	G
QRSL1	55278	genome.wustl.edu	37	6	107096922	107096922	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:107096922T>G	ENST00000369046.4	+	5	507	c.403T>G	c.(403-405)Ttt>Gtt	p.F135V	QRSL1_ENST00000369044.1_Missense_Mutation_p.F135V	NM_018292.4	NP_060762.3			glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1											endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		AGATGGTGTATTTGGACCAGT	0.368																																					NSCLC(192;2127 2142 11668 26277 49545)												0													71.0	72.0	71.0					6																	107096922		2203	4300	6503	SO:0001583	missense	0			AK001851	CCDS5057.1	6q21	2014-08-04			ENSG00000130348	ENSG00000130348			21020	protein-coding gene	gene with protein product	"""glutamyl-tRNA(Gln) amidotransferase, subunit A"""					11230166, 19805282	Standard	NM_018292		Approved	GatA, FLJ10989, FLJ12189, DKFZP564C1278, FLJ13447	uc003prm.3	Q9H0R6	OTTHUMG00000015301	ENST00000369046.4:c.403T>G	6.37:g.107096922T>G	ENSP00000358042:p.Phe135Val			Missense_Mutation	SNP	pfam_Amidase,superfamily_Amidase_dom,tigrfam_GatA	p.F135V	ENST00000369046.4	37	c.403	CCDS5057.1	6	.	.	.	.	.	.	.	.	.	.	T	31	5.070975	0.93950	.	.	ENSG00000130348	ENST00000369046;ENST00000369044	T;T	0.58060	0.36;0.36	5.6	5.6	0.85130	.	0.048117	0.85682	D	0.000000	T	0.70185	0.3195	M	0.84511	2.7	0.80722	D	1	D;D	0.69078	0.997;0.99	D;P	0.71656	0.974;0.894	T	0.76266	-0.3022	10	0.72032	D	0.01	-24.3455	16.0832	0.81020	0.0:0.0:0.0:1.0	.	135;135	Q9H0R6;Q9H0R6-2	GATA_HUMAN;.	V	135	ENSP00000358042:F135V;ENSP00000358040:F135V	ENSP00000358040:F135V	F	+	1	0	QRSL1	107203615	1.000000	0.71417	0.965000	0.40720	0.930000	0.56654	7.655000	0.83696	2.257000	0.74773	0.528000	0.53228	TTT	QRSL1	-	pfam_Amidase,superfamily_Amidase_dom,tigrfam_GatA	ENSG00000130348		0.368	QRSL1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	QRSL1	HGNC	protein_coding	OTTHUMT00000041667.1	-	0.00	23	0	T	NM_018292		107096922	+1	tier1	-	no_errors	ENST00000369046	ensembl	human	known	74_37	missense	86.21	4	25	SNP	0.998	G
REXO1	57455	genome.wustl.edu	37	19	1823683	1823683	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr19:1823683C>T	ENST00000170168.4	-	4	2212	c.2118G>A	c.(2116-2118)gcG>gcA	p.A706A	CTB-31O20.4_ENST00000587741.1_RNA|CTB-31O20.4_ENST00000590531.1_RNA|CTB-31O20.4_ENST00000593201.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	706						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGCAAGCTCGCCGATGCCC	0.741																																																	0													11.0	10.0	10.0					19																	1823683		2150	4247	6397	SO:0001819	synonymous_variant	0			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.2118G>A	19.37:g.1823683C>T			Q9ULT2	Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.A706	ENST00000170168.4	37	c.2118	CCDS32866.1	19																																																																																			REXO1	-	NULL	ENSG00000079313		0.741	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	-	0.00	17	0	C	NM_020695		1823683	-1	tier1	-	no_errors	ENST00000170168	ensembl	human	known	74_37	silent	62.50	3	5	SNP	0.998	T
RCN3	57333	genome.wustl.edu	37	19	50031852	50031852	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr19:50031852C>T	ENST00000270645.3	+	2	570	c.123C>T	c.(121-123)agC>agT	p.S41S	RCN3_ENST00000593644.1_3'UTR	NM_020650.2	NP_065701.2	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	41						endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		CCCCCCTGAGCGACGCTCCCC	0.652																																																	0													64.0	66.0	66.0					19																	50031852		2203	4300	6503	SO:0001819	synonymous_variant	0			AY195859	CCDS12771.1	19q13.33	2013-01-10				ENSG00000142552		"""EF-hand domain containing"""	21145	protein-coding gene	gene with protein product							Standard	NM_020650		Approved	RLP49	uc002poj.3	Q96D15		ENST00000270645.3:c.123C>T	19.37:g.50031852C>T			Q9HBZ8	Silent	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.S41	ENST00000270645.3	37	c.123	CCDS12771.1	19																																																																																			RCN3	-	NULL	ENSG00000142552		0.652	RCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN3	HGNC	protein_coding	OTTHUMT00000465261.1	-	0.00	33	0	C	NM_020650		50031852	+1	tier1	-	no_errors	ENST00000270645	ensembl	human	known	74_37	silent	95.45	1	21	SNP	0.998	T
RMND1	55005	genome.wustl.edu	37	6	151742424	151742424	+	Silent	SNP	A	A	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:151742424A>T	ENST00000367303.4	-	9	1157	c.1035T>A	c.(1033-1035)tcT>tcA	p.S345S	RMND1_ENST00000336451.3_Silent_p.S134S	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	345					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		CTTCTTCATGAGATAGTTTCA	0.323																																																	0													76.0	81.0	80.0					6																	151742424		2202	4300	6502	SO:0001819	synonymous_variant	0			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.1035T>A	6.37:g.151742424A>T			A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Silent	SNP	pfam_DUF155	p.S345	ENST00000367303.4	37	c.1035	CCDS5232.1	6																																																																																			RMND1	-	pfam_DUF155	ENSG00000155906		0.323	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND1	HGNC	protein_coding	OTTHUMT00000042718.2	-	0.00	47	0	A	NM_017909		151742424	-1	tier1	-	no_errors	ENST00000367303	ensembl	human	known	74_37	silent	31.82	30	14	SNP	1.000	T
RNLS	55328	genome.wustl.edu	37	10	90122339	90122339	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:90122339C>T	ENST00000331772.4	-	5	692	c.670G>A	c.(670-672)Gtc>Atc	p.V224I	RNLS_ENST00000371947.3_Missense_Mutation_p.V224I|RNLS_ENST00000466945.1_5'UTR|RNLS_ENST00000437752.1_Missense_Mutation_p.V141I	NM_001031709.2	NP_001026879.2	Q5VYX0	RNLS_HUMAN	renalase, FAD-dependent amine oxidase	224					cardiac left ventricle morphogenesis (GO:0003214)|dopamine metabolic process (GO:0042417)|epinephrine metabolic process (GO:0042414)|heart contraction (GO:0060047)|norepinephrine metabolic process (GO:0042415)|phosphate ion homeostasis (GO:0055062)|regulation of systemic arterial blood pressure (GO:0003073)|response to epinephrine (GO:0071871)|response to ischemia (GO:0002931)|response to norepinephrine (GO:0071873)|response to salt (GO:1902074)	extracellular space (GO:0005615)	oxidoreductase activity (GO:0016491)			breast(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7						TCAATGGAGACGAAGCGTATG	0.438																																																	0													161.0	152.0	155.0					10																	90122339		2203	4300	6503	SO:0001583	missense	0			BC005364	CCDS7388.1, CCDS31239.1	10q23.31	2009-04-22	2009-04-22	2009-04-22	ENSG00000184719	ENSG00000184719			25641	protein-coding gene	gene with protein product		609360	"""chromosome 10 open reading frame 59"""	C10orf59		15841207, 17565281	Standard	NM_001031709		Approved	FLJ11218, renalase	uc001kfe.3	Q5VYX0	OTTHUMG00000018692	ENST00000331772.4:c.670G>A	10.37:g.90122339C>T	ENSP00000332530:p.Val224Ile		Q9BS33|Q9NUP8	Missense_Mutation	SNP	pfam_Amino_oxidase	p.V224I	ENST00000331772.4	37	c.670	CCDS31239.1	10	.	.	.	.	.	.	.	.	.	.	C	4.990	0.183841	0.09495	.	.	ENSG00000184719	ENST00000371947;ENST00000437752;ENST00000331772	D;T;D	0.92752	-3.1;1.05;-3.1	6.07	-5.8	0.02347	Amine oxidase (1);	0.340228	0.33895	N	0.004446	T	0.67107	0.2858	N	0.00633	-1.31	0.22903	N	0.99858	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.06405	0.002;0.001;0.001	T	0.68477	-0.5398	10	0.08837	T	0.75	.	11.0038	0.47622	0.0:0.1627:0.0871:0.7502	.	141;224;224	B4DJW3;Q5VYX0;Q5VYX0-2	.;RNLS_HUMAN;.	I	224;141;224	ENSP00000361015:V224I;ENSP00000387577:V141I;ENSP00000332530:V224I	ENSP00000332530:V224I	V	-	1	0	RNLS	90112319	1.000000	0.71417	0.971000	0.41717	0.981000	0.71138	0.628000	0.24522	-0.669000	0.05289	-0.998000	0.02512	GTC	RNLS	-	pfam_Amino_oxidase	ENSG00000184719		0.438	RNLS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RNLS	HGNC	protein_coding	OTTHUMT00000049250.1	-	0.00	47	0	C	NM_018363		90122339	-1	tier1	-	no_errors	ENST00000331772	ensembl	human	known	74_37	missense	44.68	26	21	SNP	0.966	T
RPS10P7	376693	genome.wustl.edu	37	1	201489719	201489719	+	lincRNA	DEL	A	A	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:201489719delA	ENST00000441932.1	+	0	1889				RP11-134G8.7_ENST00000454651.1_RNA	NR_026667.1				ribosomal protein S10 pseudogene 7																		ACTTACAGTCAAAAAAAaaaa	0.423																																																	0																																												0					1q32.1	2010-06-16				ENSG00000223396			36423	pseudogene	pseudogene						19123937	Standard	NR_026667		Approved		uc010ppt.3				1.37:g.201489719delA				RNA	DEL	-	NULL	ENST00000441932.1	37	NULL		1																																																																																			RPS10P7	-	-	ENSG00000223396		0.423	RPS10P7-001	KNOWN	basic	lincRNA	RPS10P7	HGNC	lincRNA	OTTHUMT00000087024.1		0.00	13	0	A	NR_026667		201489719	+1	tier1		no_errors	ENST00000441932	ensembl	human	known	74_37	rna	30.00	7	3	DEL	0.056	-
SARS	6301	genome.wustl.edu	37	1	109774243	109774243	+	Intron	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:109774243G>A	ENST00000234677.2	+	6	666				SARS_ENST00000369923.4_Intron	NM_006513.3	NP_006504.2	P49591	SYSC_HUMAN	seryl-tRNA synthetase						gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|RNA binding (GO:0003723)|serine-tRNA ligase activity (GO:0004828)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	17		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0301)|Lung(183;0.0677)|COAD - Colon adenocarcinoma(174;0.116)|Epithelial(280;0.233)	L-Serine(DB00133)	CTGTGTCTCTGCTCCTCTAGG	0.532																																																	0													127.0	119.0	122.0					1																	109774243		2203	4300	6503	SO:0001627	intron_variant	0			BC009390	CCDS795.1	1p13.3	2011-07-01			ENSG00000031698	ENSG00000031698	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	10537	protein-coding gene	gene with protein product	"""serine tRNA ligase 1, cytoplasmic"""	607529				9431993	Standard	NM_006513		Approved	SERS	uc001dwu.2	P49591	OTTHUMG00000011726	ENST00000234677.2:c.592-10G>A	1.37:g.109774243G>A			B2R6Y9|Q5T5C8|Q9NSE3	RNA	SNP	-	NULL	ENST00000234677.2	37	NULL	CCDS795.1	1																																																																																			SARS	-	-	ENSG00000031698		0.532	SARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARS	HGNC	protein_coding	OTTHUMT00000032394.2	-	0.00	58	0	G	NM_006513		109774243	+1	tier1	-	no_errors	ENST00000471705	ensembl	human	known	74_37	rna	50.00	16	16	SNP	0.376	A
SCUBE1	80274	genome.wustl.edu	37	22	43600129	43600129	+	Silent	SNP	G	G	A	rs375344449		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr22:43600129G>A	ENST00000360835.4	-	22	2967	c.2841C>T	c.(2839-2841)ttC>ttT	p.F947F		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	947					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CCAGCACGTCGAAGAGGGCCT	0.577																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	138.0	124.0	129.0		2841	-6.0	0.9	22		129	0,8600		0,0,4300	no	coding-synonymous	SCUBE1	NM_173050.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		947/989	43600129	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2841C>T	22.37:g.43600129G>A			Q5R336	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.F947	ENST00000360835.4	37	c.2841	CCDS14048.1	22																																																																																			SCUBE1	-	NULL	ENSG00000159307		0.577	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	-	0.00	21	0	G	NM_173050		43600129	-1	tier1	-	no_errors	ENST00000360835	ensembl	human	known	74_37	silent	37.84	23	14	SNP	0.961	A
SEC31B	25956	genome.wustl.edu	37	10	102259267	102259267	+	Intron	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:102259267G>T	ENST00000370345.3	-	12	1583				SEC31B_ENST00000494350.1_5'UTR	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)						protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		TTTCTGATGTGAAAAGCAGCT	0.398																																																	0													137.0	132.0	134.0					10																	102259267		2203	4300	6503	SO:0001627	intron_variant	0			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.1485+13C>A	10.37:g.102259267G>T			B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	RNA	SNP	-	NULL	ENST00000370345.3	37	NULL	CCDS7495.1	10																																																																																			SEC31B	-	-	ENSG00000075826		0.398	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	HGNC	protein_coding	OTTHUMT00000051198.1	-	0.00	40	0	G	NM_015490		102259267	-1	tier1	-	no_errors	ENST00000494350	ensembl	human	known	74_37	rna	15.22	38	7	SNP	0.001	T
SGK223	157285	genome.wustl.edu	37	8	8233763	8233763	+	Splice_Site	SNP	C	C	T	rs375344955		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr8:8233763C>T	ENST00000520004.1	-	3	2420	c.2156G>A	c.(2155-2157)cGg>cAg	p.R719Q	SGK223_ENST00000330777.4_Splice_Site_p.R719Q			Q86YV5	SG223_HUMAN		721							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.R719Q(1)									TGGTACTCACCGCGACTTTGG	0.552																																					GBM(34;731 755 10259 33573 33867)												1	Substitution - Missense(1)	lung(1)						C	GLN/ARG	0,3886		0,0,1943	83.0	92.0	89.0		2156	5.4	1.0	8		89	1,8261		0,1,4130	no	missense-near-splice	SGK223	NM_001080826.1	43	0,1,6073	TT,TC,CC		0.0121,0.0,0.0082	probably-damaging	719/1403	8233763	1,12147	1943	4131	6074	SO:0001630	splice_region_variant	0																														ENST00000520004.1:c.2156+1G>A	8.37:g.8233763C>T			Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.R719Q	ENST00000520004.1	37	c.2156	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810400	0.70797	0.0	1.21E-4	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.62364	0.03;0.03	5.42	5.42	0.78866	.	0.445889	0.21694	N	0.070526	T	0.64670	0.2619	N	0.19112	0.55	0.36020	D	0.83864	D	0.89917	1.0	D	0.79108	0.992	T	0.66999	-0.5781	9	.	.	.	.	12.5858	0.56416	0.0:0.9195:0.0:0.0805	.	719	Q86YV5	SG223_HUMAN	Q	719	ENSP00000330930:R719Q;ENSP00000428054:R719Q	.	R	-	2	0	AC068353.1	8271173	0.992000	0.36948	0.986000	0.45419	0.477000	0.33069	2.700000	0.47085	2.725000	0.93324	0.655000	0.94253	CGG	SGK223	-	NULL	ENSG00000182319		0.552	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1	-	0.00	63	0	C		Missense_Mutation	8233763	-1	tier1	-	no_errors	ENST00000330777	ensembl	human	known	74_37	missense	32.95	58	29	SNP	0.995	T
SHE	126669	genome.wustl.edu	37	1	154473951	154473951	+	Silent	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:154473951G>A	ENST00000304760.2	-	1	638	c.552C>T	c.(550-552)ccC>ccT	p.P184P	TDRD10_ENST00000368482.4_5'Flank|TDRD10_ENST00000368480.3_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	184										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TGTCCAGCTCGGGCCCCAGgg	0.592																																																	0													104.0	96.0	99.0					1																	154473951		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.552C>T	1.37:g.154473951G>A			Q8TEQ5	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.P184	ENST00000304760.2	37	c.552	CCDS30877.1	1																																																																																			SHE	-	NULL	ENSG00000169291		0.592	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	HGNC	protein_coding	OTTHUMT00000087910.2	-	0.00	60	0	G	NM_001010846		154473951	-1	tier1	-	no_errors	ENST00000304760	ensembl	human	known	74_37	silent	17.20	77	16	SNP	0.769	A
SLC16A13	201232	genome.wustl.edu	37	17	6942095	6942095	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:6942095C>T	ENST00000308027.6	+	3	1276	c.968C>T	c.(967-969)cCa>cTa	p.P323L		NM_201566.2	NP_963860.1	Q7RTY0	MOT13_HUMAN	solute carrier family 16, member 13	323						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						GCTCTGGCCCCACTGGCCTTC	0.602																																																	0													65.0	71.0	69.0					17																	6942095		2203	4300	6503	SO:0001583	missense	0			BN000145	CCDS11085.1	17p13.1	2013-07-18	2013-07-18		ENSG00000174327	ENSG00000174327		"""Solute carriers"""	31037	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 13"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 13"""				Standard	NM_201566		Approved	MCT13	uc002geh.3	Q7RTY0	OTTHUMG00000102089	ENST00000308027.6:c.968C>T	17.37:g.6942095C>T	ENSP00000309751:p.Pro323Leu		A3KMG3|A5PKU5|Q2VP92	Missense_Mutation	SNP	pfam_MFS,pfam_Atg22-like,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P323L	ENST00000308027.6	37	c.968	CCDS11085.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.548389	0.86127	.	.	ENSG00000174327	ENST00000308027	T	0.61040	0.14	5.85	5.85	0.93711	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.166803	0.53938	D	0.000045	T	0.78071	0.4226	M	0.80982	2.52	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.79864	-0.1623	10	0.72032	D	0.01	.	17.6674	0.88207	0.0:1.0:0.0:0.0	.	323	Q7RTY0	MOT13_HUMAN	L	323	ENSP00000309751:P323L	ENSP00000309751:P323L	P	+	2	0	SLC16A13	6882819	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	7.260000	0.78391	2.767000	0.95098	0.557000	0.71058	CCA	SLC16A13	-	pfam_MFS,pfam_Atg22-like,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000174327		0.602	SLC16A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A13	HGNC	protein_coding	OTTHUMT00000219923.2	-	0.00	35	0	C			6942095	+1	tier1	-	no_errors	ENST00000308027	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	T
SLIT2	9353	genome.wustl.edu	37	4	20543179	20543179	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr4:20543179C>G	ENST00000504154.1	+	20	2332	c.2080C>G	c.(2080-2082)Cca>Gca	p.P694A	SLIT2_ENST00000503837.1_Missense_Mutation_p.P690A|SLIT2_ENST00000503823.1_Missense_Mutation_p.P686A|SLIT2_ENST00000273739.5_Missense_Mutation_p.P698A	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	694	LRRCT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ATGTCAAAAACCATACTTCCT	0.433																																																	0													115.0	105.0	109.0					4																	20543179		2203	4300	6503	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2080C>G	4.37:g.20543179C>G	ENSP00000422591:p.Pro694Ala		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.P694A	ENST00000504154.1	37	c.2080	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404853	0.83230	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.83163	-1.69;-1.69;-1.61;-1.65	5.91	5.91	0.95273	Cysteine-rich flanking region, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.94574	0.8252	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95378	0.8470	10	0.72032	D	0.01	.	20.2896	0.98541	0.0:1.0:0.0:0.0	.	686;694	O94813-3;O94813	.;SLIT2_HUMAN	A	686;694;698;690;690	ENSP00000427548:P686A;ENSP00000422591:P694A;ENSP00000273739:P698A;ENSP00000422261:P690A	ENSP00000273739:P698A	P	+	1	0	SLIT2	20152277	1.000000	0.71417	0.918000	0.36340	0.903000	0.53119	7.484000	0.81180	2.794000	0.96219	0.655000	0.94253	CCA	SLIT2	-	pfam_Cys-rich_flank_reg_C,smart_Cys-rich_flank_reg_C	ENSG00000145147		0.433	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	-	0.00	65	0	C			20543179	+1	tier1	-	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	22.22	49	14	SNP	1.000	G
SPINK5	11005	genome.wustl.edu	37	5	147499615	147499615	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr5:147499615T>A	ENST00000256084.7	+	25	2399	c.2357T>A	c.(2356-2358)cTc>cAc	p.L786H	SPINK5_ENST00000359874.3_Missense_Mutation_p.L786H|SPINK5_ENST00000398454.1_Missense_Mutation_p.L786H	NM_006846.3	NP_006837.2	Q9NQ38	ISK5_HUMAN	serine peptidase inhibitor, Kazal type 5	786	Kazal-like 12. {ECO:0000255|PROSITE- ProRule:PRU00798}.				anagen (GO:0042640)|epidermal cell differentiation (GO:0009913)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|hair cell differentiation (GO:0035315)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of proteolysis (GO:0045861)|negative regulation of serine-type peptidase activity (GO:1902572)|regulation of cell adhesion (GO:0030155)|regulation of T cell differentiation (GO:0045580)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(8)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGGAAAACTCATCTGCACT	0.378																																																	0													78.0	69.0	72.0					5																	147499615		1845	4093	5938	SO:0001583	missense	0			AJ228139	CCDS43382.1, CCDS47300.1, CCDS47301.1	5q31-q32	2014-09-17	2005-08-17		ENSG00000133710	ENSG00000133710		"""Serine peptidase inhibitors, Kazal type"""	15464	protein-coding gene	gene with protein product	"""lymphoepithelial Kazal-type-related inhibitor"""	605010	"""serine protease inhibitor, Kazal type 5"""			10419450	Standard	NM_001127698		Approved	VAKTI, LEKTI, LETKI, NETS, NS, FLJ21544, FLJ97536, FLJ97596, FLJ99794, DKFZp686K19184	uc003loy.2	Q9NQ38	OTTHUMG00000134305	ENST00000256084.7:c.2357T>A	5.37:g.147499615T>A	ENSP00000256084:p.Leu786His		A8MYE8|B7WPB7|D6REN5|O75770|Q3LX95|Q3LX96|Q3LX97|Q96PP2|Q96PP3	Missense_Mutation	SNP	pfam_Kazal_dom,smart_Kazal_dom	p.L786H	ENST00000256084.7	37	c.2357	CCDS43382.1	5	.	.	.	.	.	.	.	.	.	.	T	18.01	3.527866	0.64860	.	.	ENSG00000133710	ENST00000398454;ENST00000359874;ENST00000508733;ENST00000256084	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	5.56	5.56	0.83823	Proteinase inhibitor I1, Kazal (1);	0.000000	0.44902	D	0.000403	T	0.26085	0.0636	M	0.77486	2.375	0.22754	N	0.998774	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;1.0	T	0.22382	-1.0218	10	0.15499	T	0.54	-13.4938	12.402	0.55418	0.0:0.0:0.0:1.0	.	767;786;786;786	B4DWS3;Q9NQ38-3;Q9NQ38;Q9NQ38-2	.;.;ISK5_HUMAN;.	H	786;786;767;786	ENSP00000381472:L786H;ENSP00000352936:L786H;ENSP00000421519:L767H;ENSP00000256084:L786H	ENSP00000256084:L786H	L	+	2	0	SPINK5	147479808	0.950000	0.32346	0.128000	0.21923	0.929000	0.56500	4.060000	0.57477	2.253000	0.74438	0.455000	0.32223	CTC	SPINK5	-	pfam_Kazal_dom,smart_Kazal_dom	ENSG00000133710		0.378	SPINK5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPINK5	HGNC	protein_coding	OTTHUMT00000259215.2	-	0.00	32	0	T	NM_001127698		147499615	+1	tier1	-	no_errors	ENST00000359874	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.406	A
SULF1	23213	genome.wustl.edu	37	8	70541903	70541903	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr8:70541903C>T	ENST00000260128.4	+	19	2990	c.2273C>T	c.(2272-2274)cCg>cTg	p.P758L	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000419716.3_Missense_Mutation_p.P758L|SULF1_ENST00000402687.4_Missense_Mutation_p.P758L|SULF1_ENST00000458141.2_Missense_Mutation_p.P758L	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	758					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CAGACAGCCCCGTTCTGGAAC	0.522																																																	0													143.0	133.0	137.0					8																	70541903		2203	4300	6503	SO:0001583	missense	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2273C>T	8.37:g.70541903C>T	ENSP00000260128:p.Pro758Leu		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.P758L	ENST00000260128.4	37	c.2273	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	C	28.9	4.961626	0.92791	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	4.75	4.75	0.60458	Alkaline-phosphatase-like, core domain (1);	0.055118	0.85682	D	0.000000	T	0.32912	0.0845	M	0.86502	2.82	0.80722	D	1	D	0.76494	0.999	P	0.54544	0.755	T	0.39881	-0.9592	10	0.87932	D	0	.	17.9404	0.89025	0.0:1.0:0.0:0.0	.	758	Q8IWU6	SULF1_HUMAN	L	758	ENSP00000403040:P758L;ENSP00000260128:P758L;ENSP00000385704:P758L;ENSP00000390315:P758L	ENSP00000260128:P758L	P	+	2	0	SULF1	70704457	1.000000	0.71417	0.949000	0.38748	0.929000	0.56500	7.622000	0.83099	2.440000	0.82611	0.655000	0.94253	CCG	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.522	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	29	0	C	NM_015170		70541903	+1	tier1	-	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	25.45	41	14	SNP	1.000	T
SYCP2	10388	genome.wustl.edu	37	20	58453093	58453093	+	Silent	SNP	G	G	T	rs368288363		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:58453093G>T	ENST00000357552.3	-	32	3174	c.2949C>A	c.(2947-2949)tcC>tcA	p.S983S	SYCP2_ENST00000371001.2_Silent_p.S983S			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	983					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CCTTTTCCAAGGATGATCCTG	0.269																																																	0													80.0	83.0	82.0					20																	58453093		2203	4296	6499	SO:0001819	synonymous_variant	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2949C>A	20.37:g.58453093G>T			A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Silent	SNP	NULL	p.S983	ENST00000357552.3	37	c.2949	CCDS13482.1	20																																																																																			SYCP2	-	NULL	ENSG00000196074		0.269	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	-	0.00	71	0	G	NM_014258		58453093	-1	tier1	-	no_errors	ENST00000357552	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.090	T
SYN3	8224	genome.wustl.edu	37	22	32992674	32992674	+	Missense_Mutation	SNP	C	C	T	rs139005191		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr22:32992674C>T	ENST00000358763.2	-	7	1002	c.760G>A	c.(760-762)Gct>Act	p.A254T	SYN3_ENST00000332840.5_Missense_Mutation_p.A254T	NM_001135774.1	NP_001129246.1	O14994	SYN3_HUMAN	synapsin III	254	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CCCATTCCAGCGTGGGCATGT	0.527																																																	0								C	THR/ALA,THR/ALA,THR/ALA	0,4406		0,0,2203	179.0	129.0	146.0		757,760,760	4.0	1.0	22	dbSNP_134	146	4,8596	3.7+/-12.6	0,4,4296	yes	missense,missense,missense	SYN3	NM_001135774.1,NM_003490.3,NM_133633.2	58,58,58	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	possibly-damaging,possibly-damaging,possibly-damaging	253/580,254/581,254/445	32992674	4,13002	2203	4300	6503	SO:0001583	missense	0			AF046873	CCDS13908.1	22q12.3	2008-05-14			ENSG00000185666	ENSG00000185666			11496	protein-coding gene	gene with protein product		602705				9539796	Standard	NM_003490		Approved		uc003amx.3	O14994	OTTHUMG00000031004	ENST00000358763.2:c.760G>A	22.37:g.32992674C>T	ENSP00000351614:p.Ala254Thr		B1B1F9	Missense_Mutation	SNP	pfam_Synapsin_ATP-bd_dom,pfam_Synapsin_pre-ATP-grasp_dom,pfam_Synapsin_P_site,pfam_ATP-grasp_RimK-type,superfamily_PreATP-grasp_dom,prints_Synapsin	p.A254T	ENST00000358763.2	37	c.760	CCDS13908.1	22	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228765	0.58777	0.0	4.65E-4	ENSG00000185666	ENST00000358763;ENST00000332840;ENST00000390686	T;T	0.32023	1.47;1.47	5.05	4.02	0.46733	Synapsin, conserved site (1);ATP-grasp fold, subdomain 1 (1);Synapsin, ATP-binding domain (1);	0.069168	0.56097	D	0.000022	T	0.28333	0.0700	M	0.70275	2.135	0.45806	D	0.998684	P;P;P	0.38420	0.63;0.63;0.63	B;B;B	0.30943	0.122;0.122;0.122	T	0.16247	-1.0409	10	0.51188	T	0.08	.	9.9117	0.41411	0.0:0.9018:0.0:0.0982	.	253;254;254	Q17R54;B1B1F9;O14994	.;.;SYN3_HUMAN	T	254	ENSP00000351614:A254T;ENSP00000330219:A254T	ENSP00000330219:A254T	A	-	1	0	SYN3	31322674	0.980000	0.34600	0.997000	0.53966	0.996000	0.88848	2.547000	0.45786	2.340000	0.79590	0.655000	0.94253	GCT	SYN3	-	pfam_Synapsin_ATP-bd_dom,pfam_ATP-grasp_RimK-type	ENSG00000185666		0.527	SYN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYN3	HGNC	protein_coding	OTTHUMT00000075892.4	-	0.00	52	0	C			32992674	-1	tier1	rs139005191	no_errors	ENST00000332840	ensembl	human	known	74_37	missense	7.58	61	5	SNP	0.992	T
TCF3	6929	genome.wustl.edu	37	19	1632397	1632397	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr19:1632397C>A	ENST00000262965.5	-	4	497	c.153G>T	c.(151-153)gaG>gaT	p.E51D	TCF3_ENST00000588136.1_Missense_Mutation_p.E51D|TCF3_ENST00000453954.2_5'Flank|TCF3_ENST00000395423.3_Intron|TCF3_ENST00000344749.5_Missense_Mutation_p.E51D	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0	CTNNB1-binding. {ECO:0000250}.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGGCCGGTCCTCAAGACCTG	0.622			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																			Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	0													12.0	13.0	13.0					19																	1632397		2197	4299	6496	SO:0001583	missense	0			M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.153G>T	19.37:g.1632397C>A	ENSP00000262965:p.Glu51Asp		Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.E51D	ENST00000262965.5	37	c.153	CCDS12074.1	19	.	.	.	.	.	.	.	.	.	.	c	6.412	0.444048	0.12164	.	.	ENSG00000071564	ENST00000262965;ENST00000344749;ENST00000453954	T;T	0.49720	0.77;0.77	3.79	3.79	0.43588	.	.	.	.	.	T	0.48660	0.1512	L	0.33339	1.005	0.31913	N	0.614387	B;D	0.64830	0.096;0.994	B;D	0.70716	0.05;0.97	T	0.48186	-0.9057	9	0.15499	T	0.54	.	5.5768	0.17228	0.2134:0.6784:0.0:0.1082	.	51;51	P15923-2;P15923	.;TFE2_HUMAN	D	51	ENSP00000262965:E51D;ENSP00000344375:E51D	ENSP00000262965:E51D	E	-	3	2	TCF3	1583397	0.995000	0.38212	1.000000	0.80357	0.945000	0.59286	0.220000	0.17660	2.072000	0.62099	0.537000	0.68136	GAG	TCF3	-	NULL	ENSG00000071564		0.622	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCF3	HGNC	protein_coding	OTTHUMT00000449367.1	-	0.00	30	0	C	NM_003200		1632397	-1	tier1	-	no_errors	ENST00000262965	ensembl	human	known	74_37	missense	34.78	15	8	SNP	1.000	A
TDRD1	56165	genome.wustl.edu	37	10	115986888	115986888	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr10:115986888T>G	ENST00000251864.2	+	23	3386	c.3233T>G	c.(3232-3234)tTc>tGc	p.F1078C	TDRD1_ENST00000369282.1_Intron|TDRD1_ENST00000422662.1_Intron|TDRD1_ENST00000369280.1_Intron|TDRD1_ENST00000369281.2_Missense_Mutation_p.F964C	NM_198795.1	NP_942090.1	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1078					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TTAAAAAATTTCATGTTGAAT	0.299																																																	0													37.0	37.0	37.0					10																	115986888		2203	4299	6502	SO:0001583	missense	0			AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000251864.2:c.3233T>G	10.37:g.115986888T>G	ENSP00000251864:p.Phe1078Cys		A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	pfam_Tudor,pfam_Znf_MYND,smart_Tudor,pfscan_Tudor,pfscan_Znf_MYND	p.F1078C	ENST00000251864.2	37	c.3233	CCDS7588.1	10	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024762	0.54683	.	.	ENSG00000095627	ENST00000251864;ENST00000369281	T;T	0.19105	3.08;2.17	6.07	4.94	0.65067	.	0.681568	0.14150	N	0.338066	T	0.31575	0.0801	L	0.47716	1.5	0.80722	D	1	D;D;D;D	0.67145	0.993;0.993;0.996;0.996	P;P;P;P	0.56216	0.628;0.628;0.794;0.794	T	0.01488	-1.1342	10	0.54805	T	0.06	-1.2753	9.4178	0.38532	0.0:0.0807:0.0:0.9193	.	1078;964;1078;964	Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	TDRD1_HUMAN;.;.;.	C	1078;964	ENSP00000251864:F1078C;ENSP00000358287:F964C	ENSP00000251864:F1078C	F	+	2	0	TDRD1	115976878	0.121000	0.22262	0.964000	0.40570	0.767000	0.43475	3.112000	0.50368	1.134000	0.42165	0.528000	0.53228	TTC	TDRD1	-	NULL	ENSG00000095627		0.299	TDRD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD1	HGNC	protein_coding		-	0.00	45	0	T			115986888	+1	tier1	-	no_errors	ENST00000251864	ensembl	human	known	74_37	missense	35.09	37	20	SNP	0.973	G
TDRD9	122402	genome.wustl.edu	37	14	104488603	104488603	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr14:104488603C>T	ENST00000409874.4	+	24	2590	c.2542C>T	c.(2542-2544)Cat>Tat	p.H848Y	TDRD9_ENST00000339063.5_Missense_Mutation_p.H848Y	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	848					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ACTCAGCGTTCATTCTGCAGA	0.453																																																	0													81.0	68.0	72.0					14																	104488603		2203	4300	6503	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.2542C>T	14.37:g.104488603C>T	ENSP00000387303:p.His848Tyr		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H848Y	ENST00000409874.4	37	c.2542	CCDS9987.2	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.011|0.011	-1.727261|-1.727261	0.00694|0.00694	.|.	.|.	ENSG00000156414|ENSG00000156414	ENST00000409874;ENST00000339063|ENST00000557332	T;T|.	0.03330|.	3.97;3.98|.	5.6|5.6	4.71|4.71	0.59529|0.59529	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.62648|0.62648	0.2445|0.2445	L|L	0.50333|0.50333	1.59|1.59	0.46542|0.46542	D|D	0.999097|0.999097	B;B|.	0.25105|.	0.118;0.091|.	B;B|.	0.18263|.	0.021;0.021|.	T|T	0.60409|0.60409	-0.7269|-0.7269	10|5	0.33141|.	T|.	0.24|.	.|.	14.4623|14.4623	0.67459|0.67459	0.0:0.9292:0.0:0.0708|0.0:0.9292:0.0:0.0708	.|.	848;848|.	Q8NDG6-2;Q8NDG6|.	.;TDRD9_HUMAN|.	Y|L	848|574	ENSP00000387303:H848Y;ENSP00000343545:H848Y|.	ENSP00000343545:H848Y|.	H|S	+|+	1|2	0|0	TDRD9|TDRD9	103558356|103558356	0.972000|0.972000	0.33761|0.33761	0.020000|0.020000	0.16555|0.16555	0.082000|0.082000	0.17680|0.17680	2.824000|2.824000	0.48088|0.48088	1.375000|1.375000	0.46248|0.46248	0.650000|0.650000	0.86243|0.86243	CAT|TCA	TDRD9	-	NULL	ENSG00000156414		0.453	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3	-	0.00	54	0	C	NM_153046		104488603	+1	tier1	-	no_errors	ENST00000409874	ensembl	human	known	74_37	missense	8.54	75	7	SNP	0.624	T
TMEM161A	54929	genome.wustl.edu	37	19	19232141	19232141	+	Missense_Mutation	SNP	G	G	T	rs376515835		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr19:19232141G>T	ENST00000162044.9	-	9	954	c.890C>A	c.(889-891)cCg>cAg	p.P297Q	TMEM161A_ENST00000587583.2_Missense_Mutation_p.P272Q|TMEM161A_ENST00000450333.2_Missense_Mutation_p.P194Q	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	297					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			CTCCCCAAACGGCGGCTGGTG	0.627																																																	0													22.0	26.0	25.0					19																	19232141		2184	4274	6458	SO:0001583	missense	0			BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.890C>A	19.37:g.19232141G>T	ENSP00000162044:p.Pro297Gln		B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	pfam_Transmembrane_161A/B	p.P297Q	ENST00000162044.9	37	c.890	CCDS12393.1	19	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229493	0.79688	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.74427	0.3715	M	0.71581	2.175	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.994	D;D;D	0.72982	0.965;0.979;0.948	T	0.70898	-0.4747	9	0.16896	T	0.51	-11.5018	13.438	0.61094	0.0:0.0:1.0:0.0	.	194;194;297	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	Q	194;297	.	ENSP00000162044:P297Q	P	-	2	0	TMEM161A	19093141	1.000000	0.71417	0.281000	0.24762	0.010000	0.07245	6.848000	0.75409	2.257000	0.74773	0.591000	0.81541	CCG	TMEM161A	-	pfam_Transmembrane_161A/B	ENSG00000064545		0.627	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161A	HGNC	protein_coding	OTTHUMT00000460089.2	-	0.00	65	0	G	NM_017814		19232141	-1	tier1	-	no_errors	ENST00000162044	ensembl	human	known	74_37	missense	8.75	73	7	SNP	0.976	T
TOP1MT	116447	genome.wustl.edu	37	8	144399896	144399897	+	Frame_Shift_Ins	INS	-	-	C	rs200378024		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr8:144399896_144399897insC	ENST00000329245.4	-	10	1360_1361	c.1326_1327insG	c.(1324-1329)acgcgcfs	p.R443fs	TOP1MT_ENST00000523676.1_Frame_Shift_Ins_p.R345fs|TOP1MT_ENST00000521193.1_Frame_Shift_Ins_p.R345fs|TOP1MT_ENST00000519148.1_Frame_Shift_Ins_p.R345fs|AC087793.1_ENST00000585120.1_RNA	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	443					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GGCTCACCGCGCGTCAGGGCCC	0.693																																																	0																																										SO:0001589	frameshift_variant	0			AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.1327dupG	8.37:g.144399897_144399897dupC	ENSP00000328835:p.Arg443fs		B7ZAR5|E7ES89|Q86ST4|Q86V82	Frame_Shift_Ins	INS	pfam_TopoI_DNA-bd_euk,pfam_TopoI_cat_euk,superfamily_TopoI_DNA-bd_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk,prints_TopoI	p.R442fs	ENST00000329245.4	37	c.1327_1326	CCDS6400.1	8																																																																																			TOP1MT	-	pfam_TopoI_cat_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk	ENSG00000184428		0.693	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1MT	HGNC	protein_coding	OTTHUMT00000381247.3		0.00	46	0	-	NM_052963		144399897	-1	tier1		no_errors	ENST00000329245	ensembl	human	known	74_37	frame_shift_ins	44.83	48	39	INS	0.199:0.214	C
TP53	7157	genome.wustl.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	C	rs28934574		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:7577094G>C	ENST00000269305.4	-	8	1033	c.844C>G	c.(844-846)Cgg>Ggg	p.R282G	TP53_ENST00000420246.2_Missense_Mutation_p.R282G|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R282G|TP53_ENST00000445888.2_Missense_Mutation_p.R282G|TP53_ENST00000455263.2_Missense_Mutation_p.R282G	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	GRCh37	CM056413|CM920678	TP53	M	rs28934574						83.0	71.0	75.0					17																	7577094		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>G	17.37:g.7577094G>C	ENSP00000269305:p.Arg282Gly		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R282G	ENST00000269305.4	37	c.844	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743784	0.69418	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89968	3.075	0.58432	D	0.999997	P;D;P;P	0.89917	0.826;1.0;0.856;0.483	P;D;P;P	0.79108	0.751;0.992;0.839;0.591	D	0.98579	1.0649	10	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	.	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	G	282;282;282;282;282;271;150	ENSP00000352610:R282G;ENSP00000269305:R282G;ENSP00000398846:R282G;ENSP00000391127:R282G;ENSP00000391478:R282G;ENSP00000425104:R150G	ENSP00000269305:R282G	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	52	0	G	NM_000546		7577094	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	100.00	0	36	SNP	0.997	C
TRIM17	51127	genome.wustl.edu	37	1	228596974	228596974	+	Missense_Mutation	SNP	T	T	G	rs201224780		TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr1:228596974T>G	ENST00000366697.2	-	5	1738	c.782A>C	c.(781-783)aAg>aCg	p.K261T	TRIM11_ENST00000284551.6_5'Flank|TRIM17_ENST00000295033.3_Missense_Mutation_p.K261T|TRIM17_ENST00000456946.2_Missense_Mutation_p.K261T|RP11-245P10.4_ENST00000436779.1_RNA|TRIM11_ENST00000366699.3_5'Flank|TRIM17_ENST00000366698.2_Missense_Mutation_p.K261T			Q9Y577	TRI17_HUMAN	tripartite motif containing 17	261					protein autoubiquitination (GO:0051865)	intracellular (GO:0005622)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	10		Prostate(94;0.0724)				CACGTTGTTCTTCCTCCGGTG	0.617																																																	0													80.0	84.0	83.0					1																	228596974		2203	4300	6503	SO:0001583	missense	0			AF156271	CCDS1571.1, CCDS44327.1	1q42	2013-01-09	2011-01-25	2001-11-30	ENSG00000162931	ENSG00000162931		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13430	protein-coding gene	gene with protein product	"""ring finger protein 16"", ""RING finger protein terf"", ""testis RING finger protein"""	606123	"""tripartite motif-containing 17"""	RNF16		9792805, 10894938	Standard	NM_016102		Approved	terf, RBCC	uc001hsv.3	Q9Y577	OTTHUMG00000039974	ENST00000366697.2:c.782A>C	1.37:g.228596974T>G	ENSP00000355658:p.Lys261Thr		B4DVJ2|Q5VST8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K261T	ENST00000366697.2	37	c.782	CCDS1571.1	1	.	.	.	.	.	.	.	.	.	.	T	0.524	-0.860853	0.02610	.	.	ENSG00000162931	ENST00000366697;ENST00000366698;ENST00000295033;ENST00000456946;ENST00000479800	T;T;T;T;T	0.03468	3.92;3.92;3.92;3.92;3.92	3.34	-0.393	0.12438	.	0.751547	0.11017	N	0.608820	T	0.02494	0.0076	L	0.45581	1.43	0.25349	N	0.988882	P;B	0.44044	0.825;0.156	B;B	0.32465	0.146;0.037	T	0.42932	-0.9422	10	0.22109	T	0.4	.	2.383	0.04358	0.2552:0.2701:0.0:0.4747	.	261;261	Q9Y577-2;Q9Y577	.;TRI17_HUMAN	T	261;261;261;261;234	ENSP00000355658:K261T;ENSP00000355659:K261T;ENSP00000295033:K261T;ENSP00000403312:K261T;ENSP00000430468:K234T	ENSP00000295033:K261T	K	-	2	0	TRIM17	226663597	0.442000	0.25633	0.471000	0.27229	0.012000	0.07955	0.118000	0.15605	-0.087000	0.12528	0.379000	0.24179	AAG	TRIM17	-	NULL	ENSG00000162931		0.617	TRIM17-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM17	HGNC	protein_coding	OTTHUMT00000096439.2	-	0.00	50	0	T	NM_016102		228596974	-1	tier1	-	no_errors	ENST00000295033	ensembl	human	known	74_37	missense	25.30	61	21	SNP	0.614	G
TUBBP5	643224	genome.wustl.edu	37	9	141044707	141044707	+	RNA	DEL	A	A	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:141044707delA	ENST00000503395.1	+	0	143									tubulin, beta pseudogene 5																		GTCCGGTGTGAAGACAGGGAG	0.706											OREG0019635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141044707delA		1661		RNA	DEL	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.706	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1		0.00	11	0	A	NR_027156		141044707	+1	tier1		no_errors	ENST00000503395	ensembl	human	known	74_37	rna	16.67	25	5	DEL	0.504	-
UBASH3B	84959	genome.wustl.edu	37	11	122667713	122667713	+	Silent	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr11:122667713G>T	ENST00000284273.5	+	9	1704	c.1329G>T	c.(1327-1329)gtG>gtT	p.V443V		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	443	Protein tyrosine phosphatase. {ECO:0000250}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		CCATCACTGTGTTTGGATGCA	0.488																																																	0													170.0	147.0	155.0					11																	122667713		2202	4299	6501	SO:0001819	synonymous_variant	0			AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.1329G>T	11.37:g.122667713G>T			Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Silent	SNP	pfam_His_Pase_superF_clade-1,pfam_SH3_domain,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_SH3_domain,superfamily_RNA_ligase/cNuc_Pdiesterase,smart_UBA/transl_elong_EF1B_N_euk,smart_SH3_domain,pfscan_SH3_domain,pfscan_UBA/transl_elong_EF1B_N_euk	p.V443	ENST00000284273.5	37	c.1329	CCDS31694.1	11																																																																																			UBASH3B	-	pfam_His_Pase_superF_clade-1	ENSG00000154127		0.488	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBASH3B	HGNC	protein_coding	OTTHUMT00000387499.1	-	0.00	64	0	G	NM_032873		122667713	+1	tier1	-	no_errors	ENST00000284273	ensembl	human	known	74_37	silent	16.67	20	4	SNP	1.000	T
UBQLN1	29979	genome.wustl.edu	37	9	86294848	86294848	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr9:86294848T>C	ENST00000376395.4	-	4	1076	c.553A>G	c.(553-555)Atg>Gtg	p.M185V	UBQLN1_ENST00000257468.7_Missense_Mutation_p.M185V	NM_013438.4|NM_053067.2	NP_038466.2|NP_444295.1	Q9UMX0	UBQL1_HUMAN	ubiquilin 1	185					cellular response to hypoxia (GO:0071456)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|regulation of protein ubiquitination (GO:0031396)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|protein complex (GO:0043234)	kinase binding (GO:0019900)			breast(4)|endometrium(2)|kidney(4)|large_intestine(6)|lung(10)|prostate(1)	27						TGGACCATCATTTCAGGGTTA	0.448																																					Melanoma(186;1284 2073 12755 14558 18426)												0													173.0	166.0	168.0					9																	86294848		2203	4300	6503	SO:0001583	missense	0			AF176069	CCDS6663.1, CCDS6664.1	9q22	2013-02-12			ENSG00000135018	ENSG00000135018		"""Ubiquilin family"""	12508	protein-coding gene	gene with protein product		605046				9303440, 10807547	Standard	NM_013438		Approved	DSK2, PLIC-1, XDRP1, DA41	uc004amv.3	Q9UMX0	OTTHUMG00000020104	ENST00000376395.4:c.553A>G	9.37:g.86294848T>C	ENSP00000365576:p.Met185Val		Q5T6J5|Q5T6J9|Q8IXS9|Q8N2Q3|Q9H0T8|Q9H3R4|Q9HAZ5	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,pfam_UBA/Ts_N,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.M185V	ENST00000376395.4	37	c.553	CCDS6663.1	9	.	.	.	.	.	.	.	.	.	.	T	14.91	2.676306	0.47886	.	.	ENSG00000135018	ENST00000376395;ENST00000257468	D;D	0.84370	-1.84;-1.84	5.69	5.69	0.88448	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	D	0.84379	0.5459	L	0.57536	1.79	0.51233	D	0.999913	B;B	0.31752	0.338;0.209	B;B	0.38755	0.281;0.073	T	0.83099	-0.0129	10	0.44086	T	0.13	.	12.2011	0.54326	0.1275:0.0:0.0:0.8725	.	185;185	Q9UMX0-2;Q9UMX0	.;UBQL1_HUMAN	V	185	ENSP00000365576:M185V;ENSP00000257468:M185V	ENSP00000257468:M185V	M	-	1	0	UBQLN1	85484668	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.066000	0.64351	2.170000	0.68504	0.528000	0.53228	ATG	UBQLN1	-	smart_STI1_HS-bd	ENSG00000135018		0.448	UBQLN1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	UBQLN1	HGNC	protein_coding	OTTHUMT00000052834.1	-	0.00	64	0	T	NM_013438		86294848	-1	tier1	-	no_errors	ENST00000376395	ensembl	human	known	74_37	missense	72.22	20	52	SNP	1.000	C
USP32	84669	genome.wustl.edu	37	17	58289386	58289386	+	Splice_Site	SNP	C	C	G	rs200946847	byFrequency	TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr17:58289386C>G	ENST00000300896.4	-	19	2372	c.2178G>C	c.(2176-2178)aaG>aaC	p.K726N	USP32_ENST00000592339.1_Splice_Site_p.K396N	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	726					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			GAGACTTACCCTTGTGTCTAT	0.313																																																	0													68.0	67.0	67.0					17																	58289386		2203	4298	6501	SO:0001630	splice_region_variant	0			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.2179+1G>C	17.37:g.58289386C>G			Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_EF_hand_dom,smart_Pept_C19_DUSP,pfscan_EF_hand_dom,pfscan_Peptidase_C19/C67,prints_Recoverin	p.K726N	ENST00000300896.4	37	c.2178	CCDS32697.1	17	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064037	0.55432	.	.	ENSG00000170832	ENST00000300896	T	0.49139	0.79	4.93	1.82	0.25136	.	0.091385	0.85682	D	0.000000	T	0.28200	0.0696	L	0.29908	0.895	0.80722	D	1	B	0.33379	0.41	B	0.26969	0.075	T	0.03784	-1.1004	10	0.30854	T	0.27	.	7.4583	0.27280	0.0:0.4866:0.0:0.5134	.	726	Q8NFA0	UBP32_HUMAN	N	726	ENSP00000300896:K726N	ENSP00000300896:K726N	K	-	3	2	USP32	55644168	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.986000	0.49370	0.210000	0.20664	0.655000	0.94253	AAG	USP32	-	NULL	ENSG00000170832		0.313	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	-	0.00	43	0	C	NM_032582	Missense_Mutation	58289386	-1	tier1	-	no_errors	ENST00000300896	ensembl	human	known	74_37	missense	10.53	51	6	SNP	1.000	G
USP51	158880	genome.wustl.edu	37	X	55514608	55514608	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chrX:55514608delA	ENST00000500968.3	-	2	847	c.765delT	c.(763-765)tttfs	p.F255fs	USP51_ENST00000586165.1_Intron	NM_201286.3	NP_958443.1	Q70EK9	UBP51_HUMAN	ubiquitin specific peptidase 51	255					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	30						TGAAGCAGCCAAAAAAGACAC	0.423																																																	0													123.0	113.0	116.0					X																	55514608		2203	4300	6503	SO:0001589	frameshift_variant	0			BF741256	CCDS14370.1	Xp11	2009-03-19	2005-08-08		ENSG00000247746	ENSG00000247746		"""Ubiquitin-specific peptidases"""	23086	protein-coding gene	gene with protein product			"""ubiquitin specific protease 51"""			12838346	Standard	NM_201286		Approved		uc004dun.2	Q70EK9	OTTHUMG00000021656	ENST00000500968.3:c.765delT	X.37:g.55514608delA	ENSP00000423333:p.Phe255fs		Q8IWJ8	Frame_Shift_Del	DEL	pfam_Peptidase_C19/C67,pfam_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.F255fs	ENST00000500968.3	37	c.765	CCDS14370.1	X																																																																																			USP51	-	pfam_Znf_UBP,pfscan_Znf_UBP	ENSG00000247746		0.423	USP51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP51	HGNC	protein_coding	OTTHUMT00000056871.2		0.00	47	0	A	NM_201286		55514608	-1	tier1		no_errors	ENST00000500968	ensembl	human	known	74_37	frame_shift_del	7.14	26	2	DEL	0.999	-
VPS18	57617	genome.wustl.edu	37	15	41192273	41192273	+	Silent	SNP	C	C	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr15:41192273C>T	ENST00000220509.5	+	4	1596	c.1257C>T	c.(1255-1257)ccC>ccT	p.P419P	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	419					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GAGAGCGGCCCGACTGCCTGG	0.622																																																	0													63.0	69.0	67.0					15																	41192273		2203	4300	6503	SO:0001819	synonymous_variant	0			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.1257C>T	15.37:g.41192273C>T			Q8TCG0|Q96DI3|Q9H268	Silent	SNP	pfam_Pep3_Vps18,pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold	p.P419	ENST00000220509.5	37	c.1257	CCDS10069.1	15																																																																																			VPS18	-	pfam_Pep3_Vps18,superfamily_ARM-type_fold	ENSG00000104142		0.622	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	HGNC	protein_coding	OTTHUMT00000252443.2	-	0.00	68	0	C			41192273	+1	tier1	-	no_errors	ENST00000220509	ensembl	human	known	74_37	silent	23.40	36	11	SNP	0.102	T
WBSCR27	155368	genome.wustl.edu	37	7	73256371	73256371	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr7:73256371G>A	ENST00000297873.4	-	2	149	c.100C>T	c.(100-102)Cgc>Tgc	p.R34C		NM_152559.2	NP_689772.2	Q8N6F8	WBS27_HUMAN	Williams Beuren syndrome chromosome region 27	34										NS(1)|central_nervous_system(1)|lung(2)|prostate(1)	5		Lung NSC(55;0.159)				GGAGCCCAGCGGTCATAGAAA	0.617																																																	0													61.0	57.0	58.0					7																	73256371		2203	4300	6503	SO:0001583	missense	0			AF534110	CCDS5561.1	7q11.23	2004-07-05			ENSG00000165171	ENSG00000165171			19068	protein-coding gene	gene with protein product		612546					Standard	NM_152559		Approved		uc003tzj.2	Q8N6F8	OTTHUMG00000130033	ENST00000297873.4:c.100C>T	7.37:g.73256371G>A	ENSP00000297873:p.Arg34Cys			Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase	p.R34C	ENST00000297873.4	37	c.100	CCDS5561.1	7	.	.	.	.	.	.	.	.	.	.	G	7.573	0.667198	0.14710	.	.	ENSG00000165171	ENST00000297873	T	0.36157	1.27	4.57	-4.39	0.03611	.	0.866326	0.10521	N	0.665032	T	0.20780	0.0500	L	0.40543	1.245	0.09310	N	1	B;B	0.15930	0.015;0.003	B;B	0.06405	0.002;0.001	T	0.25710	-1.0124	10	0.56958	D	0.05	0.3145	0.2835	0.00248	0.2501:0.2573:0.2441:0.2485	.	34;34	B4DWM3;Q8N6F8	.;WBS27_HUMAN	C	34	ENSP00000297873:R34C	ENSP00000297873:R34C	R	-	1	0	WBSCR27	72894307	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.072000	0.03434	-1.283000	0.02393	-0.314000	0.08810	CGC	WBSCR27	-	pfam_UbiE/COQ5_MeTrFase	ENSG00000165171		0.617	WBSCR27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR27	HGNC	protein_coding	OTTHUMT00000252312.1	-	0.00	65	0	G	NM_152559		73256371	-1	tier1	-	no_errors	ENST00000297873	ensembl	human	known	74_37	missense	43.08	37	28	SNP	0.005	A
WDR60	55112	genome.wustl.edu	37	7	158695219	158695219	+	Silent	SNP	T	T	C			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr7:158695219T>C	ENST00000407559.3	+	10	1448	c.1290T>C	c.(1288-1290)atT>atC	p.I430I		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	430					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		ATGAAAGGATTGGCGAGTTAT	0.378																																																	0													128.0	121.0	123.0					7																	158695219		1837	4093	5930	SO:0001819	synonymous_variant	0				CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.1290T>C	7.37:g.158695219T>C			Q9NW58	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.I430	ENST00000407559.3	37	c.1290	CCDS47757.1	7																																																																																			WDR60	-	NULL	ENSG00000126870		0.378	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR60	HGNC	protein_coding	OTTHUMT00000322668.1	-	0.00	27	0	T	NM_018051		158695219	+1	tier1	-	no_errors	ENST00000407559	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.962	C
ZBTB2	57621	genome.wustl.edu	37	6	151687546	151687546	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr6:151687546C>G	ENST00000325144.4	-	3	795	c.655G>C	c.(655-657)Gag>Cag	p.E219Q		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		AGATTGGTCTCCTCCCCGGGA	0.557																																																	0													97.0	88.0	91.0					6																	151687546		2203	4300	6503	SO:0001583	missense	0			BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.655G>C	6.37:g.151687546C>G	ENSP00000323183:p.Glu219Gln		A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E219Q	ENST00000325144.4	37	c.655	CCDS5231.1	6	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058070	0.55325	.	.	ENSG00000181472	ENST00000325144	T	0.05025	3.51	5.76	5.76	0.90799	.	0.048080	0.85682	D	0.000000	T	0.08670	0.0215	N	0.24115	0.695	0.58432	D	0.999991	D	0.63880	0.993	D	0.70227	0.968	T	0.50136	-0.8863	10	0.22706	T	0.39	-47.365	19.976	0.97309	0.0:1.0:0.0:0.0	.	219	Q8N680	ZBTB2_HUMAN	Q	219	ENSP00000323183:E219Q	ENSP00000323183:E219Q	E	-	1	0	ZBTB2	151729239	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.574000	0.67424	2.713000	0.92767	0.655000	0.94253	GAG	ZBTB2	-	NULL	ENSG00000181472		0.557	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB2	HGNC	protein_coding	OTTHUMT00000042715.1	-	0.00	23	0	C	NM_020861		151687546	-1	tier1	-	no_errors	ENST00000325144	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	G
ZMYND8	23613	genome.wustl.edu	37	20	45927652	45927652	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49V-01A-11D-A247-09	TCGA-LN-A49V-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	334db6d4-d008-4e0f-8307-4bb31e042d20	58bf59e3-00d3-405a-bfc9-902bcb778779	g.chr20:45927652G>T	ENST00000311275.7	-	4	467	c.214C>A	c.(214-216)Cca>Aca	p.P72T	ZMYND8_ENST00000262975.4_Missense_Mutation_p.P72T|ZMYND8_ENST00000360911.3_Intron|ZMYND8_ENST00000468376.2_Intron|ZMYND8_ENST00000396281.4_Intron|ZMYND8_ENST00000446994.2_Intron|ZMYND8_ENST00000355972.4_Missense_Mutation_p.P72T|ZMYND8_ENST00000372023.3_Intron|ZMYND8_ENST00000458360.2_Intron|ZMYND8_ENST00000536340.1_Missense_Mutation_p.P99T|ZMYND8_ENST00000461685.1_Missense_Mutation_p.P92T|ZMYND8_ENST00000540497.1_Intron|ZMYND8_ENST00000471951.2_Missense_Mutation_p.P92T|ZMYND8_ENST00000352431.2_Missense_Mutation_p.P92T	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	72					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GTGGTGAGTGGCTGCTTCATA	0.448																																																	0													133.0	129.0	130.0					20																	45927652		2203	4300	6503	SO:0001583	missense	0			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.214C>A	20.37:g.45927652G>T	ENSP00000312237:p.Pro72Thr		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	pfam_DUF3544,pfam_Bromodomain,pfam_PWWP_dom,pfam_Znf_PHD-finger,pfam_Znf_MYND,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.P99T	ENST00000311275.7	37	c.295		20	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735710	0.89482	.	.	ENSG00000101040	ENST00000311275;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000536340;ENST00000355972;ENST00000461685	T;T;T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04;1.04;1.04	6.11	6.11	0.99139	Zinc finger, FYVE/PHD-type (1);	0.054084	0.85682	N	0.000000	T	0.55641	0.1933	L	0.29908	0.895	0.80722	D	1	D;D;D;D;P;D;D;D	0.89917	1.0;0.999;0.997;0.999;0.683;0.999;1.0;1.0	D;D;D;D;B;D;D;D	0.91635	0.998;0.941;0.991;0.957;0.256;0.957;0.999;0.998	T	0.44205	-0.9343	9	.	.	.	-12.696	20.7342	0.99715	0.0:0.0:1.0:0.0	.	99;92;92;72;92;92;72;92	F5H0X3;Q569J9;Q9ULU4-7;Q9ULU4-9;Q9ULU4-12;Q9ULU4-13;Q9ULU4;Q9ULU4-8	.;.;.;.;.;.;PKCB1_HUMAN;.	T	72;72;92;92;99;72;92	ENSP00000312237:P72T;ENSP00000262975:P72T;ENSP00000420095:P92T;ENSP00000335537:P92T;ENSP00000439800:P99T;ENSP00000348246:P72T;ENSP00000418210:P92T	.	P	-	1	0	ZMYND8	45361059	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.906000	0.99361	0.655000	0.94253	CCA	ZMYND8	-	superfamily_Znf_FYVE_PHD	ENSG00000101040		0.448	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	HGNC	protein_coding	OTTHUMT00000079596.2	-	0.00	69	0	G	NM_183047		45927652	-1	tier1	-	no_errors	ENST00000536340	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
