#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB1	5243	genome.wustl.edu	37	7	87196171	87196171	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:87196171C>A	ENST00000265724.3	-	7	877	c.460G>T	c.(460-462)Gct>Tct	p.A154S	ABCB1_ENST00000543898.1_Intron	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	154	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CGCATTATAGCATGAAAAAAC	0.423																																																	0													135.0	138.0	137.0					7																	87196171		2203	4300	6503	SO:0001583	missense	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.460G>T	7.37:g.87196171C>A	ENSP00000265724:p.Ala154Ser		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.A154S	ENST00000265724.3	37	c.460	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	C	10.69	1.419874	0.25552	.	.	ENSG00000085563	ENST00000265724	D	0.90004	-2.6	5.91	1.77	0.24775	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.494167	0.23537	N	0.047108	D	0.84083	0.5394	L	0.33710	1.025	0.80722	D	1	B	0.12013	0.005	B	0.31751	0.135	T	0.73678	-0.3907	10	0.18276	T	0.48	-6.7113	15.7006	0.77538	0.4656:0.5344:0.0:0.0	.	154	P08183	MDR1_HUMAN	S	154	ENSP00000265724:A154S	ENSP00000265724:A154S	A	-	1	0	ABCB1	87034107	0.082000	0.21442	0.975000	0.42487	0.914000	0.54420	0.084000	0.14891	0.341000	0.23771	-0.182000	0.12963	GCT	ABCB1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000085563		0.423	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	-	0.00	43	0	C	NM_000927		87196171	-1	tier1	-	no_errors	ENST00000265724	ensembl	human	known	74_37	missense	85.46	33	194	SNP	0.952	A
ABCC6	368	genome.wustl.edu	37	16	16276745	16276745	+	Silent	SNP	G	G	T	rs74315130		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:16276745G>T	ENST00000205557.7	-	16	2015	c.1986C>A	c.(1984-1986)gtC>gtA	p.V662V	ABCC6_ENST00000574094.1_Intron	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	662	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CCACTGGACCGACAACAGCCA	0.632																																																	0													80.0	75.0	77.0					16																	16276745		2197	4300	6497	SO:0001819	synonymous_variant	0			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.1986C>A	16.37:g.16276745G>T			A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.V662	ENST00000205557.7	37	c.1986	CCDS10568.1	16																																																																																			ABCC6	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Multidrug-R_assoc	ENSG00000091262		0.632	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC6	HGNC	protein_coding	OTTHUMT00000252232.2	-	0.00	45	0	G			16276745	-1	tier1	-	no_errors	ENST00000205557	ensembl	human	known	74_37	silent	39.62	32	21	SNP	0.411	T
ABCC9	10060	genome.wustl.edu	37	12	22012598	22012598	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:22012598G>T	ENST00000261201.4	-	20	2426	c.2427C>A	c.(2425-2427)ggC>ggA	p.G809G	ABCC9_ENST00000345162.2_Silent_p.G773G|ABCC9_ENST00000261200.4_Silent_p.G809G|RP11-729I10.2_ENST00000539874.1_RNA	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	809	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TCAGGTTGATGCCCTAGAGAA	0.383																																																	0													159.0	160.0	159.0					12																	22012598		2203	4300	6503	SO:0001819	synonymous_variant	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.2427C>A	12.37:g.22012598G>T			O60707	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.G809	ENST00000261201.4	37	c.2427	CCDS8694.1	12																																																																																			ABCC9	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000069431		0.383	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	13	0	G	NM_005691		22012598	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	silent	39.53	26	17	SNP	0.988	T
ACSM2B	348158	genome.wustl.edu	37	16	20556566	20556566	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:20556566C>A	ENST00000329697.6	-	10	1362	c.1194G>T	c.(1192-1194)aaG>aaT	p.K398N	ACSM2B_ENST00000565322.1_Missense_Mutation_p.K319N|ACSM2B_ENST00000567001.1_Missense_Mutation_p.K398N|ACSM2B_ENST00000565232.1_Missense_Mutation_p.K398N|ACSM2B_ENST00000567288.1_5'UTR	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	398					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						GGACGTTGCCCTTATCATCTA	0.502																																																	0													112.0	93.0	99.0					16																	20556566		2201	4300	6501	SO:0001583	missense	0			AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1194G>T	16.37:g.20556566C>A	ENSP00000327453:p.Lys398Asn		Q86YT1	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.K398N	ENST00000329697.6	37	c.1194	CCDS10586.1	16	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.577899	0.00131	.	.	ENSG00000066813	ENST00000329697	T	0.46063	0.88	3.38	-4.75	0.03239	AMP-dependent synthetase/ligase (1);	1.328340	0.05254	N	0.514497	T	0.17959	0.0431	N	0.13140	0.3	0.20975	N	0.999816	B;B	0.14438	0.01;0.01	B;B	0.19946	0.027;0.027	T	0.17837	-1.0356	10	0.09843	T	0.71	-0.2908	0.8203	0.01110	0.3223:0.158:0.117:0.4027	.	398;398	A8K051;Q68CK6	.;ACS2B_HUMAN	N	398	ENSP00000327453:K398N	ENSP00000327453:K398N	K	-	3	2	ACSM2B	20464067	0.000000	0.05858	0.018000	0.16275	0.008000	0.06430	-2.852000	0.00731	-0.507000	0.06549	-0.251000	0.11542	AAG	ACSM2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066813		0.502	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2B	HGNC	protein_coding	OTTHUMT00000254417.2	-	0.00	34	0	C	NM_182617		20556566	-1	tier1	-	no_errors	ENST00000329697	ensembl	human	known	74_37	missense	56.14	25	32	SNP	0.001	A
ACSS3	79611	genome.wustl.edu	37	12	81472130	81472130	+	Missense_Mutation	SNP	G	G	T	rs554106519		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:81472130G>T	ENST00000548058.1	+	1	1141	c.231G>T	c.(229-231)tgG>tgT	p.W77C	ACSS3_ENST00000261206.3_Missense_Mutation_p.W77C			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	77						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						AGAGGTTCTGGGGCAAAGCTG	0.627																																																	0													42.0	39.0	40.0					12																	81472130		1998	4029	6027	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.231G>T	12.37:g.81472130G>T	ENSP00000449535:p.Trp77Cys		Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.W77C	ENST00000548058.1	37	c.231	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377795	0.61735	.	.	ENSG00000111058	ENST00000548058;ENST00000261206	T;T	0.12255	2.7;2.7	4.92	4.92	0.64577	Acyl-CoA synthase, domain of unknown function DUF3448 (1);	0.000000	0.85682	D	0.000000	T	0.54046	0.1834	H	0.98218	4.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71912	-0.4449	10	0.87932	D	0	-9.5761	15.1518	0.72706	0.0:0.0:1.0:0.0	.	77	Q9H6R3	ACSS3_HUMAN	C	77	ENSP00000449535:W77C;ENSP00000261206:W77C	ENSP00000261206:W77C	W	+	3	0	ACSS3	79996261	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	4.801000	0.62532	2.553000	0.86117	0.655000	0.94253	TGG	ACSS3	-	NULL	ENSG00000111058		0.627	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	19	0	G	NM_024560		81472130	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	missense	80.00	2	8	SNP	1.000	T
ADRA1A	148	genome.wustl.edu	37	8	26627766	26627766	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:26627766C>A	ENST00000380573.3	-	3	2324	c.1301G>T	c.(1300-1302)tGc>tTc	p.C434F	ADRA1A_ENST00000354550.4_Intron|ADRA1A_ENST00000276393.4_Missense_Mutation_p.C434F|ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Intron|ADRA1A_ENST00000380582.3_Intron|ADRA1A_ENST00000519229.1_Intron			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	0					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CCCTACACAGCAGCAGACCTG	0.532																																																	0													161.0	159.0	159.0					8																	26627766		2203	4300	6503	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000380573.3:c.1301G>T	8.37:g.26627766C>A	ENSP00000369947:p.Cys434Phe		Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.C434F	ENST00000380573.3	37	c.1301	CCDS6054.1	8	.	.	.	.	.	.	.	.	.	.	C	23.4	4.412120	0.83340	.	.	ENSG00000120907	ENST00000276393;ENST00000380573	T;T	0.70869	-0.52;-0.52	5.85	5.85	0.93711	.	.	.	.	.	T	0.81744	0.4887	M	0.68952	2.095	0.80722	D	1	D	0.64830	0.994	P	0.58577	0.841	T	0.82729	-0.0313	9	0.87932	D	0	.	19.7757	0.96391	0.0:1.0:0.0:0.0	.	434	P35348	ADA1A_HUMAN	F	434	ENSP00000276393:C434F;ENSP00000369947:C434F	ENSP00000276393:C434F	C	-	2	0	ADRA1A	26683683	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	6.916000	0.75776	2.768000	0.95171	0.655000	0.94253	TGC	ADRA1A	-	NULL	ENSG00000120907		0.532	ADRA1A-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376208.1	-	0.00	80	0	C	NM_033303		26627766	-1	tier1	-	no_errors	ENST00000276393	ensembl	human	known	74_37	missense	83.33	7	35	SNP	1.000	A
ADAM18	8749	genome.wustl.edu	37	8	39502989	39502989	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:39502989G>C	ENST00000265707.5	+	11	1087	c.1042G>C	c.(1042-1044)Gca>Cca	p.A348P	ADAM18_ENST00000541111.1_5'UTR|ADAM18_ENST00000379866.1_Missense_Mutation_p.A324P	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	348	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GAATCATGAAGCAGTGTAAGA	0.313																																																	0													96.0	86.0	89.0					8																	39502989		2203	4300	6503	SO:0001583	missense	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1042G>C	8.37:g.39502989G>C	ENSP00000265707:p.Ala348Pro		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.A348P	ENST00000265707.5	37	c.1042	CCDS6113.1	8	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673176	0.47781	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.09723	2.95;2.95	5.18	4.29	0.51040	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.40554	N	0.001062	T	0.35480	0.0933	M	0.87381	2.88	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.20706	-1.0267	10	0.56958	D	0.05	.	10.7594	0.46256	0.0:0.0:0.8105:0.1894	.	324;348	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	P	348;324;280	ENSP00000265707:A348P;ENSP00000369195:A324P	ENSP00000265707:A348P	A	+	1	0	ADAM18	39622146	0.992000	0.36948	0.902000	0.35471	0.383000	0.30230	1.607000	0.36836	1.365000	0.46057	0.585000	0.79938	GCA	ADAM18	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000168619		0.313	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	-	0.00	31	0	G	NM_014237		39502989	+1	tier1	-	no_errors	ENST00000265707	ensembl	human	known	74_37	missense	22.83	71	21	SNP	0.986	C
AGBL1	123624	genome.wustl.edu	37	15	86791012	86791012	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:86791012G>T	ENST00000441037.2	+	6	594	c.499G>T	c.(499-501)Ggc>Tgc	p.G167C	AGBL1_ENST00000421325.2_Missense_Mutation_p.G167C	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	167					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						GATCCGACGGGGCTTGCTGCT	0.652																																																	0													42.0	43.0	43.0					15																	86791012		2153	4262	6415	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.499G>T	15.37:g.86791012G>T	ENSP00000413001:p.Gly167Cys		A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.G167C	ENST00000441037.2	37	c.499	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	14.77	2.634720	0.47049	.	.	ENSG00000166748	ENST00000441037;ENST00000421325	T	0.56776	0.44	5.16	3.06	0.35304	Armadillo-like helical (1);Armadillo-type fold (1);	.	.	.	.	T	0.57799	0.2078	M	0.65975	2.015	0.58432	D	0.999994	D	0.58620	0.983	P	0.51487	0.671	T	0.61903	-0.6967	9	0.87932	D	0	-0.5476	9.273	0.37684	0.0844:0.0:0.7622:0.1534	.	167	Q96MI9	CBPC4_HUMAN	C	196;167	ENSP00000397173:G167C	ENSP00000397173:G167C	G	+	1	0	AGBL1	84592016	1.000000	0.71417	0.629000	0.29254	0.264000	0.26372	4.894000	0.63206	1.162000	0.42619	0.561000	0.74099	GGC	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.652	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	38	0	G	NM_152336		86791012	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	missense	46.15	21	18	SNP	0.775	T
AEN	64782	genome.wustl.edu	37	15	89169568	89169568	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:89169568G>T	ENST00000332810.3	+	2	279	c.128G>T	c.(127-129)cGg>cTg	p.R43L	AEN_ENST00000379231.3_Missense_Mutation_p.R43L	NM_022767.3	NP_073604.3	Q8WTP8	AEN_HUMAN	apoptosis enhancing nuclease	43					intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			NS(1)|kidney(1)|large_intestine(1)|lung(4)	7						TTCATGGCCCGGAAGGCCTTG	0.627																																																	0													30.0	26.0	27.0					15																	89169568		2200	4299	6499	SO:0001583	missense	0			BC020988	CCDS10344.1	15q26.1	2008-07-15	2008-07-15	2008-07-15	ENSG00000181026	ENSG00000181026			25722	protein-coding gene	gene with protein product		610177	"""interferon stimulated exonuclease gene 20kDa-like 1"""	ISG20L1		18264133, 16171785	Standard	NM_022767		Approved	FLJ12484, FLJ12562	uc002bmt.2	Q8WTP8	OTTHUMG00000148681	ENST00000332810.3:c.128G>T	15.37:g.89169568G>T	ENSP00000331944:p.Arg43Leu		C9J571|Q9BSA5|Q9H9X7	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.R43L	ENST00000332810.3	37	c.128	CCDS10344.1	15	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137963	0.56936	.	.	ENSG00000181026	ENST00000332810;ENST00000379231	T;T	0.19105	2.18;2.17	5.02	2.76	0.32466	.	1.455730	0.04705	N	0.416534	T	0.31327	0.0793	L	0.34521	1.04	0.35695	D	0.815139	D;D	0.56746	0.977;0.961	P;P	0.55303	0.773;0.597	T	0.15350	-1.0440	10	0.46703	T	0.11	-13.8169	11.5712	0.50834	0.1715:0.0:0.8285:0.0	.	43;43	Q8WTP8-2;Q8WTP8	.;AEN_HUMAN	L	43	ENSP00000331944:R43L;ENSP00000368533:R43L	ENSP00000331944:R43L	R	+	2	0	AEN	86970572	0.941000	0.31946	0.999000	0.59377	0.915000	0.54546	1.517000	0.35867	1.104000	0.41587	0.563000	0.77884	CGG	AEN	-	NULL	ENSG00000181026		0.627	AEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEN	HGNC	protein_coding	OTTHUMT00000309071.1	-	0.00	36	0	G	NM_022767		89169568	+1	tier1	-	no_errors	ENST00000379231	ensembl	human	known	74_37	missense	44.83	16	13	SNP	0.953	T
AKAP4	8852	genome.wustl.edu	37	X	49958206	49958206	+	Missense_Mutation	SNP	G	G	C	rs112225746	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:49958206G>C	ENST00000376056.2	-	5	1281	c.1131C>G	c.(1129-1131)tgC>tgG	p.C377W	AKAP4_ENST00000376064.3_Missense_Mutation_p.C377W|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Missense_Mutation_p.C386W					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GGTTCTTCATGCAAGAATCAA	0.453																																																	0													73.0	62.0	66.0					X																	49958206		2203	4300	6503	SO:0001583	missense	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1131C>G	X.37:g.49958206G>C	ENSP00000365224:p.Cys377Trp			Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.C386W	ENST00000376056.2	37	c.1158	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	G	12.10	1.835955	0.32421	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.07567	3.18;3.18;3.18	4.77	2.96	0.34315	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.53938	D	0.000047	T	0.21674	0.0522	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00349	-1.1798	9	.	.	.	-8.2164	7.0604	0.25123	0.2224:0.0:0.7776:0.0	.	386	Q5JQC9	AKAP4_HUMAN	W	377;386;377	ENSP00000365224:C377W;ENSP00000351327:C386W;ENSP00000365232:C377W	.	C	-	3	2	AKAP4	49844946	0.990000	0.36364	0.999000	0.59377	0.952000	0.60782	0.459000	0.21908	0.280000	0.22209	0.468000	0.43344	TGC	AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.453	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	-	0.00	15	0	G	NM_003886		49958206	-1	tier1	-	no_errors	ENST00000358526	ensembl	human	known	74_37	missense	88.89	2	16	SNP	1.000	C
AMBRA1	55626	genome.wustl.edu	37	11	46430144	46430144	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:46430144C>A	ENST00000458649.2	-	17	3740	c.3322G>T	c.(3322-3324)Gcc>Tcc	p.A1108S	AMBRA1_ENST00000528950.1_Missense_Mutation_p.A1079S|AMBRA1_ENST00000298834.3_Missense_Mutation_p.A1048S|AMBRA1_ENST00000533727.1_Missense_Mutation_p.A989S|AMBRA1_ENST00000426438.1_Missense_Mutation_p.A1079S|AMBRA1_ENST00000314845.3_Missense_Mutation_p.A1018S|AMBRA1_ENST00000534300.1_Missense_Mutation_p.A1048S			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	1108					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGCTGAAGGGCCAGAGTCTGG	0.612																																																	0													73.0	65.0	68.0					11																	46430144		2202	4299	6501	SO:0001583	missense	0			AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.3322G>T	11.37:g.46430144C>A	ENSP00000415327:p.Ala1108Ser		A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1108S	ENST00000458649.2	37	c.3322		11	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226791	0.79576	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000458649;ENST00000526545;ENST00000528950	T;T;T;T;T;T;T	0.72394	-0.47;-0.65;-0.25;-0.37;-0.25;-0.34;-0.37	5.38	3.49	0.39957	.	0.248630	0.41938	N	0.000788	T	0.54806	0.1881	N	0.24115	0.695	0.39725	D	0.971528	B;B;B;B;B;B	0.24823	0.004;0.007;0.007;0.009;0.112;0.009	B;B;B;B;B;B	0.17722	0.006;0.007;0.013;0.009;0.019;0.009	T	0.54774	-0.8243	10	0.72032	D	0.01	.	10.4953	0.44775	0.1342:0.7965:0.0:0.0693	.	1108;1079;1048;989;1111;1018	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	S	1018;989;1048;1079;1048;1108;66;1079	ENSP00000318313:A1018S;ENSP00000433372:A989S;ENSP00000431926:A1048S;ENSP00000410899:A1079S;ENSP00000298834:A1048S;ENSP00000415327:A1108S;ENSP00000433945:A1079S	ENSP00000298834:A1048S	A	-	1	0	AMBRA1	46386720	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.942000	0.49018	0.742000	0.32697	-0.339000	0.08088	GCC	AMBRA1	-	NULL	ENSG00000110497		0.612	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	-	0.00	31	0	C	NM_017749		46430144	-1	tier1	-	no_errors	ENST00000458649	ensembl	human	known	74_37	missense	29.69	45	19	SNP	1.000	A
ANAPC4	29945	genome.wustl.edu	37	4	25394002	25394002	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:25394002C>T	ENST00000315368.3	+	10	890	c.748C>T	c.(748-750)Cgg>Tgg	p.R250W	ANAPC4_ENST00000510092.1_Missense_Mutation_p.R250W	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	250					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)	p.R250W(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				TGAAGTAACTCGGATGGCCAG	0.343																																																	1	Substitution - Missense(1)	endometrium(1)											145.0	139.0	141.0					4																	25394002		2202	4300	6502	SO:0001583	missense	0			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.748C>T	4.37:g.25394002C>T	ENSP00000318775:p.Arg250Trp		A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_APC4_metazoa	p.R250W	ENST00000315368.3	37	c.748	CCDS3434.1	4	.	.	.	.	.	.	.	.	.	.	C	19.29	3.799688	0.70567	.	.	ENSG00000053900	ENST00000315368;ENST00000510092	T;T	0.32988	1.43;1.43	5.72	3.95	0.45737	Anaphase-promoting complex subunit 4 long domain (1);	0.048843	0.85682	D	0.000000	T	0.47116	0.1428	L	0.44542	1.39	0.45515	D	0.998475	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.72338	0.9;0.977;0.965	T	0.44498	-0.9324	10	0.66056	D	0.02	-18.2513	14.8946	0.70633	0.2623:0.7377:0.0:0.0	.	250;250;250	Q9UJX5-2;E9PCR4;Q9UJX5	.;.;APC4_HUMAN	W	250	ENSP00000318775:R250W;ENSP00000426654:R250W	ENSP00000318775:R250W	R	+	1	2	ANAPC4	25003100	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	1.847000	0.39299	0.734000	0.32515	0.655000	0.94253	CGG	ANAPC4	-	pirsf_APC4_metazoa	ENSG00000053900		0.343	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANAPC4	HGNC	protein_coding	OTTHUMT00000214986.1		0.00	48	0	C	NM_013367		25394002	+1			no_errors	ENST00000510092	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
ANKRD20A8P	729171	genome.wustl.edu	37	2	95481484	95481484	+	RNA	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:95481484G>A	ENST00000432432.2	-	0	1876					NR_040113.1		Q5CZ79	AN20B_HUMAN	ankyrin repeat domain 20 family, member A8, pseudogene																		GTTCGGCATTGAGCCTTGTAT	0.393																																																	0																																												0					2q11.1	2011-09-16	2010-12-15	2010-12-15	ENSG00000229089	ENSG00000229089			23666	pseudogene	pseudogene			"""ankyrin repeat domain 20B"""	ANKRD20B			Standard	NR_003366		Approved		uc010fhq.2	Q5CZ79	OTTHUMG00000155138		2.37:g.95481484G>A			A6NC18	RNA	SNP	-	NULL	ENST00000432432.2	37	NULL		2																																																																																			ANKRD20A8P	-	-	ENSG00000229089		0.393	ANKRD20A8P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	ANKRD20A8P	HGNC	pseudogene	OTTHUMT00000451404.1	-	0.00	74	0	G			95481484	-1	tier1	-	no_errors	ENST00000432432	ensembl	human	known	74_37	rna	47.52	53	48	SNP	0.592	A
APBA3	9546	genome.wustl.edu	37	19	3751454	3751454	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:3751454C>A	ENST00000316757.3	-	9	1693	c.1493G>T	c.(1492-1494)gGc>gTc	p.G498V	AC005954.4_ENST00000586503.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	498	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CACGCAGAAGCCCAGCTGCTC	0.721																																																	0													26.0	24.0	25.0					19																	3751454		2168	4265	6433	SO:0001583	missense	0			AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.1493G>T	19.37:g.3751454C>A	ENSP00000315136:p.Gly498Val		O60483|Q9UPZ2	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.G498V	ENST00000316757.3	37	c.1493	CCDS12110.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.503116	0.85176	.	.	ENSG00000011132	ENST00000316757	D	0.88896	-2.44	4.7	4.7	0.59300	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	D	0.95746	0.8616	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96883	0.9647	10	0.87932	D	0	.	15.1497	0.72687	0.0:1.0:0.0:0.0	.	498	O96018	APBA3_HUMAN	V	498	ENSP00000315136:G498V	ENSP00000315136:G498V	G	-	2	0	APBA3	3702454	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	5.803000	0.69129	2.165000	0.68154	0.555000	0.69702	GGC	APBA3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000011132		0.721	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA3	HGNC	protein_coding	OTTHUMT00000453634.2	-	0.00	8	0	C			3751454	-1	tier1	-	no_errors	ENST00000316757	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	A
ARC	23237	genome.wustl.edu	37	8	143695284	143695284	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:143695284G>T	ENST00000356613.2	-	1	1549	c.349C>A	c.(349-351)Cgc>Agc	p.R117S	ARC_ENST00000581404.1_5'Flank	NM_015193.4	NP_056008.1	O60936	NOL3_HUMAN	activity-regulated cytoskeleton-associated protein	0					apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|response to hypoxia (GO:0001666)|response to injury involved in regulation of muscle adaptation (GO:0014876)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|sarcoplasm (GO:0016528)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	13	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)				AACACCTCGCGCCACACGTGC	0.682																																																	0													27.0	22.0	24.0					8																	143695284		2200	4300	6500	SO:0001583	missense	0			AF193421	CCDS34950.1	8q24.3	2008-08-01			ENSG00000198576	ENSG00000198576			648	protein-coding gene	gene with protein product		612461				10970730, 17466953	Standard	NM_015193		Approved	KIAA0278, Arg3.1	uc003ywn.2	Q7LC44	OTTHUMG00000134310	ENST00000356613.2:c.349C>A	8.37:g.143695284G>T	ENSP00000349022:p.Arg117Ser		B4DFL0|O60937	Missense_Mutation	SNP	prints_Activity-reg_cytoskelet-assoc	p.R117S	ENST00000356613.2	37	c.349	CCDS34950.1	8	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408492	0.42715	.	.	ENSG00000198576	ENST00000356613	T	0.35236	1.32	4.46	-1.71	0.08133	.	0.104977	0.36444	U	0.002591	T	0.18718	0.0449	N	0.24115	0.695	0.21290	N	0.999734	P	0.41748	0.761	B	0.35240	0.198	T	0.18335	-1.0340	10	0.87932	D	0	-12.2885	9.0194	0.36191	0.0875:0.0:0.1984:0.7141	.	117	Q7LC44	ARC_HUMAN	S	117	ENSP00000349022:R117S	ENSP00000349022:R117S	R	-	1	0	ARC	143692286	0.009000	0.17119	0.256000	0.24389	0.958000	0.62258	-0.278000	0.08490	-0.351000	0.08249	-0.251000	0.11542	CGC	ARC	-	prints_Activity-reg_cytoskelet-assoc	ENSG00000198576		0.682	ARC-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ARC	HGNC	protein_coding	OTTHUMT00000259274.2	-	0.00	15	0	G			143695284	-1	tier1	-	no_errors	ENST00000356613	ensembl	human	known	74_37	missense	38.46	8	5	SNP	0.118	T
ARFGAP1	55738	genome.wustl.edu	37	20	61917478	61917478	+	Intron	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr20:61917478G>C	ENST00000370283.4	+	12	974				ARFGAP1_ENST00000518794.2_Intron|ARFGAP1_ENST00000519273.2_Intron|ARFGAP1_ENST00000370275.4_Silent_p.V327V|ARFGAP1_ENST00000547204.1_Intron|MIR4326_ENST00000582203.1_RNA|ARFGAP1_ENST00000353546.3_Intron|ARFGAP1_ENST00000519604.1_Intron	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					AGCATGTGGTGGGAGCTCTTG	0.637																																																	0																																										SO:0001627	intron_variant	0			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.835-240G>C	20.37:g.61917478G>C			B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Silent	SNP	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.V327	ENST00000370283.4	37	c.981	CCDS13515.1	20																																																																																			ARFGAP1	-	NULL	ENSG00000101199		0.637	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP1	HGNC	protein_coding	OTTHUMT00000080134.3	-	0.00	21	0	G	NM_018209		61917478	+1	tier1	-	no_errors	ENST00000370275	ensembl	human	known	74_37	silent	42.11	11	8	SNP	0.000	C
ARG2	384	genome.wustl.edu	37	14	68113432	68113432	+	Silent	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:68113432G>C	ENST00000261783.3	+	5	774	c.594G>C	c.(592-594)ctG>ctC	p.L198L	ARG2_ENST00000556491.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	198					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	ATATTGGTCTGAGAGACGTGG	0.423																																																	0													194.0	180.0	184.0					14																	68113432		2203	4300	6503	SO:0001819	synonymous_variant	0			D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.594G>C	14.37:g.68113432G>C			B2R690|Q6FHY8	Silent	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	p.L198	ENST00000261783.3	37	c.594	CCDS9785.1	14																																																																																			ARG2	-	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	ENSG00000081181		0.423	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARG2	HGNC	protein_coding	OTTHUMT00000415190.2	-	0.00	95	0	G	NM_001172		68113432	+1	tier1	-	no_errors	ENST00000261783	ensembl	human	known	74_37	silent	43.53	48	37	SNP	0.988	C
ATM	472	genome.wustl.edu	37	11	108117828	108117828	+	Missense_Mutation	SNP	G	G	A	rs529202615	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:108117828G>A	ENST00000452508.2	+	9	1228	c.1039G>A	c.(1039-1041)Gaa>Aaa	p.E347K	ATM_ENST00000278616.4_Missense_Mutation_p.E347K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	347					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAATTTGATTGAATTGATGGC	0.333			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													59.0	60.0	60.0					11																	108117828		2201	4297	6498	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1039G>A	11.37:g.108117828G>A	ENSP00000388058:p.Glu347Lys		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E347K	ENST00000452508.2	37	c.1039	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171635	0.78452	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.68181	-0.31;-0.31;-0.31	5.72	5.72	0.89469	Armadillo-type fold (1);	0.222920	0.44688	D	0.000425	T	0.66886	0.2835	M	0.63843	1.955	0.36594	D	0.87426	P	0.35745	0.518	B	0.35182	0.197	T	0.70081	-0.4970	10	0.33141	T	0.24	.	19.8868	0.96915	0.0:0.0:1.0:0.0	.	347	Q13315	ATM_HUMAN	K	347	ENSP00000435747:E347K;ENSP00000278616:E347K;ENSP00000388058:E347K	ENSP00000278616:E347K	E	+	1	0	ATM	107623038	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.235000	0.78143	2.709000	0.92574	0.655000	0.94253	GAA	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.333	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	28	0	G	NM_000051		108117828	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	44.74	21	17	SNP	1.000	A
ATM	472	genome.wustl.edu	37	11	108117836	108117836	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:108117836G>A	ENST00000452508.2	+	9	1236	c.1047G>A	c.(1045-1047)atG>atA	p.M349I	ATM_ENST00000278616.4_Missense_Mutation_p.M349I			Q13315	ATM_HUMAN	ATM serine/threonine kinase	349					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	TTGAATTGATGGCAGATATCT	0.333			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													60.0	61.0	60.0					11																	108117836		2201	4296	6497	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1047G>A	11.37:g.108117836G>A	ENSP00000388058:p.Met349Ile		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.M349I	ENST00000452508.2	37	c.1047	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093947	0.36952	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.61158	0.13;0.13;0.13	5.72	5.72	0.89469	Armadillo-type fold (1);	0.086790	0.85682	D	0.000000	T	0.56292	0.1975	M	0.62723	1.935	0.35682	D	0.814132	B	0.13145	0.007	B	0.14023	0.01	T	0.59888	-0.7369	10	0.37606	T	0.19	.	15.4869	0.75573	0.0:0.0:0.861:0.139	.	349	Q13315	ATM_HUMAN	I	349	ENSP00000435747:M349I;ENSP00000278616:M349I;ENSP00000388058:M349I	ENSP00000278616:M349I	M	+	3	0	ATM	107623046	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.089000	0.41672	2.709000	0.92574	0.655000	0.94253	ATG	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.333	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	-	0.00	29	0	G	NM_000051		108117836	+1	tier1	-	no_errors	ENST00000278616	ensembl	human	known	74_37	missense	38.24	21	13	SNP	1.000	A
ATP1A3	478	genome.wustl.edu	37	19	42474551	42474551	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:42474551C>A	ENST00000302102.5	-	17	2557	c.2407G>T	c.(2407-2409)Ggc>Tgc	p.G803C	ATP1A3_ENST00000602133.1_Missense_Mutation_p.G773C|ATP1A3_ENST00000545399.1_Missense_Mutation_p.G816C|ATP1A3_ENST00000543770.1_Missense_Mutation_p.G814C	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	803					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						ATGTCAGTGCCCAGATCGATG	0.652																																																	0													101.0	85.0	91.0					19																	42474551		2203	4300	6503	SO:0001583	missense	0				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2407G>T	19.37:g.42474551C>A	ENSP00000302397:p.Gly803Cys		B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.G803C	ENST00000302102.5	37	c.2407	CCDS12594.1	19	.	.	.	.	.	.	.	.	.	.	c	17.27	3.347222	0.61183	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.96041	-3.89;-3.89;-3.89;-3.89	3.82	2.75	0.32379	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.117723	0.56097	N	0.000029	D	0.98118	0.9379	H	0.96398	3.815	0.80722	D	1	D;D;D;D	0.89917	0.992;0.999;1.0;0.999	D;D;D;D	0.97110	0.971;0.999;1.0;0.999	D	0.97669	1.0165	10	0.52906	T	0.07	.	10.56	0.45140	0.1946:0.8053:0.0:0.0	.	816;814;803;803	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	C	803;803;816;773;547;814	ENSP00000302397:G803C;ENSP00000411503:G803C;ENSP00000444688:G816C;ENSP00000437577:G814C	ENSP00000302397:G803C	G	-	1	0	ATP1A3	47166391	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.556000	0.82233	0.946000	0.37632	0.457000	0.33378	GGC	ATP1A3	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000105409		0.652	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	-	0.00	58	0	C	NM_152296		42474551	-1	tier1	-	no_errors	ENST00000302102	ensembl	human	known	74_37	missense	23.73	45	14	SNP	1.000	A
ATP2B2	491	genome.wustl.edu	37	3	10392245	10392245	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:10392245C>A	ENST00000352432.4	-	14	2222	c.2153G>T	c.(2152-2154)cGc>cTc	p.R718L	ATP2B2_ENST00000360273.2_Missense_Mutation_p.R718L|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R704L|ATP2B2_ENST00000383800.4_Missense_Mutation_p.R673L|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R673L			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	718					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CTGGCACTTGCGGATGGCTTC	0.642																																					Ovarian(125;1619 1709 15675 19819 38835)												0													62.0	58.0	59.0					3																	10392245		2203	4300	6503	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2153G>T	3.37:g.10392245C>A	ENSP00000324172:p.Arg718Leu		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.R718L	ENST00000352432.4	37	c.2153	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	15.55	2.866102	0.51588	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.96073	-3.9;-3.9;-3.9;-3.9;-3.9;-3.9	4.18	4.18	0.49190	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.114225	0.56097	D	0.000024	D	0.92795	0.7709	L	0.38838	1.175	0.54753	D	0.999986	B;B;B	0.16603	0.001;0.015;0.018	B;B;B	0.25405	0.005;0.06;0.05	D	0.90574	0.4524	10	0.52906	T	0.07	-14.9218	16.8604	0.86016	0.0:1.0:0.0:0.0	.	653;685;718	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	L	718;673;673;718;704;653;574;718	ENSP00000324172:R718L;ENSP00000373311:R673L;ENSP00000380267:R673L;ENSP00000353414:R718L;ENSP00000344677:R704L;ENSP00000414854:R574L	ENSP00000342954:R718L	R	-	2	0	ATP2B2	10367245	0.069000	0.21087	1.000000	0.80357	0.997000	0.91878	1.079000	0.30766	2.022000	0.59522	0.491000	0.48974	CGC	ATP2B2	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma	ENSG00000157087		0.642	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	35	0	C	NM_001683		10392245	-1	tier1	-	no_errors	ENST00000352432	ensembl	human	known	74_37	missense	95.83	1	23	SNP	1.000	A
ATP5C1	509	genome.wustl.edu	37	10	7848961	7848961	+	3'UTR	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:7848961C>A	ENST00000356708.7	+	0	994				ATP5C1_ENST00000493053.1_3'UTR|ATP5C1_ENST00000335698.4_Intron	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1						ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						CAAGTTCCATCCTCAGACAAG	0.333																																					Melanoma(143;1012 1820 16249 30920 33158)												0													132.0	126.0	128.0					10																	7848961		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.*18C>A	10.37:g.7848961C>A			A8KA31|Q5VYP3|Q6I9V2|Q96AS8	RNA	SNP	-	NULL	ENST00000356708.7	37	NULL	CCDS31142.1	10																																																																																			ATP5C1	-	-	ENSG00000165629		0.333	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP5C1	HGNC	protein_coding	OTTHUMT00000046708.1	-	0.00	68	0	C	NM_005174		7848961	+1	tier1	-	no_errors	ENST00000465936	ensembl	human	known	74_37	rna	41.76	53	38	SNP	1.000	A
ATP8B4	79895	genome.wustl.edu	37	15	50168486	50168486	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:50168486C>A	ENST00000284509.6	-	25	3157	c.3016G>T	c.(3016-3018)Gtc>Ttc	p.V1006F	ATP8B4_ENST00000559829.1_Missense_Mutation_p.V1006F	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	1006						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		TGCACACTGACCACAATGACC	0.458																																																	0													117.0	98.0	104.0					15																	50168486		2196	4295	6491	SO:0001583	missense	0			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.3016G>T	15.37:g.50168486C>A	ENSP00000284509:p.Val1006Phe		Q9H727	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V1006F	ENST00000284509.6	37	c.3016	CCDS32238.1	15	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720165	0.89205	.	.	ENSG00000104043	ENST00000284509	T	0.55413	0.52	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.80544	0.4643	H	0.94264	3.515	0.80722	D	1	B;D	0.69078	0.145;0.997	B;D	0.71414	0.101;0.973	D	0.85408	0.1135	10	0.87932	D	0	.	17.6957	0.88281	0.0:1.0:0.0:0.0	.	84;1006	Q6PG43;Q8TF62	.;AT8B4_HUMAN	F	1006	ENSP00000284509:V1006F	ENSP00000284509:V1006F	V	-	1	0	ATP8B4	47955778	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.770000	0.85390	2.776000	0.95493	0.655000	0.94253	GTC	ATP8B4	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000104043		0.458	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	HGNC	protein_coding	OTTHUMT00000418100.1	-	0.00	33	0	C	NM_024837		50168486	-1	tier1	-	no_errors	ENST00000284509	ensembl	human	known	74_37	missense	51.22	20	21	SNP	1.000	A
ATXN10	25814	genome.wustl.edu	37	22	46136258	46136258	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:46136258G>C	ENST00000252934.5	+	9	1278	c.1013G>C	c.(1012-1014)cGg>cCg	p.R338P	ATXN10_ENST00000381061.4_Missense_Mutation_p.R274P	NM_013236.3	NP_037368.1	Q9UBB4	ATX10_HUMAN	ataxin 10	338					cell death (GO:0008219)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	10		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		GATCTTTTGCGGGTGATTCAT	0.353																																																	0													130.0	124.0	126.0					22																	46136258		2203	4300	6503	SO:0001583	missense	0			AK095309	CCDS14070.1, CCDS54540.1	22q13	2013-02-15	2004-08-12	2004-08-12	ENSG00000130638	ENSG00000130638		"""Ataxins"""	10549	protein-coding gene	gene with protein product		611150	"""spinocerebellar ataxia 10"""	SCA10		9973298	Standard	NM_013236		Approved	E46L, FLJ37990	uc003bgm.2	Q9UBB4	OTTHUMG00000150451	ENST00000252934.5:c.1013G>C	22.37:g.46136258G>C	ENSP00000252934:p.Arg338Pro		A6NLC4|B4DG05|O14998|O15009|Q6I9X4	Missense_Mutation	SNP	pfam_Ataxin-10_domain,superfamily_ARM-type_fold	p.R338P	ENST00000252934.5	37	c.1013	CCDS14070.1	22	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575516	0.45902	.	.	ENSG00000130638	ENST00000381061;ENST00000252934;ENST00000396011;ENST00000435026	T;T;T	0.52057	0.73;0.73;0.68	5.92	4.72	0.59763	Armadillo-type fold (1);	0.336545	0.29956	N	0.010766	T	0.60274	0.2256	L	0.58101	1.795	0.44439	D	0.997365	D;D	0.61080	0.989;0.989	P;P	0.58391	0.838;0.838	T	0.62229	-0.6898	10	0.66056	D	0.02	-10.8837	15.0856	0.72148	0.0792:0.0:0.9208:0.0	.	274;338	A6NLC4;Q9UBB4	.;ATX10_HUMAN	P	274;338;341;90	ENSP00000370449:R274P;ENSP00000252934:R338P;ENSP00000391117:R90P	ENSP00000252934:R338P	R	+	2	0	ATXN10	44514922	0.858000	0.29795	0.964000	0.40570	0.033000	0.12548	1.774000	0.38573	2.818000	0.97014	0.655000	0.94253	CGG	ATXN10	-	superfamily_ARM-type_fold	ENSG00000130638		0.353	ATXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN10	HGNC	protein_coding	OTTHUMT00000318142.2	-	0.00	38	0	G	NM_013236		46136258	+1	tier1	-	no_errors	ENST00000252934	ensembl	human	known	74_37	missense	45.61	31	26	SNP	0.869	C
BAI3	577	genome.wustl.edu	37	6	69665947	69665947	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:69665947G>T	ENST00000370598.1	+	7	2048	c.1227G>T	c.(1225-1227)tgG>tgT	p.W409C		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	409	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				GGAGTTCGTGGAGCCAGTGCT	0.537																																																	0													105.0	92.0	96.0					6																	69665947		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1227G>T	6.37:g.69665947G>T	ENSP00000359630:p.Trp409Cys		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.W409C	ENST00000370598.1	37	c.1227	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535831	0.85812	.	.	ENSG00000135298	ENST00000370598	T	0.77489	-1.1	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.92397	0.7587	H	0.99074	4.42	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92182	0.5752	10	0.19590	T	0.45	.	19.8472	0.96713	0.0:0.0:1.0:0.0	.	409	O60242	BAI3_HUMAN	C	409	ENSP00000359630:W409C	ENSP00000359630:W409C	W	+	3	0	BAI3	69722668	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.869000	0.99810	2.701000	0.92244	0.591000	0.81541	TGG	BAI3	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000135298		0.537	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	42	0	G			69665947	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	48.68	39	37	SNP	1.000	T
BAI3	577	genome.wustl.edu	37	6	70049228	70049228	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:70049228G>T	ENST00000370598.1	+	26	4112	c.3291G>T	c.(3289-3291)gcG>gcT	p.A1097A	BAI3_ENST00000238918.8_Silent_p.A303A|BAI3_ENST00000546190.1_Silent_p.A61A	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1097					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TCAACAGGGCGTCTCTTTGGA	0.473																																																	0													271.0	251.0	258.0					6																	70049228		2203	4300	6503	SO:0001819	synonymous_variant	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3291G>T	6.37:g.70049228G>T			B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.A1097	ENST00000370598.1	37	c.3291	CCDS4968.1	6																																																																																			BAI3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000135298		0.473	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	72	0	G			70049228	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	silent	44.87	43	35	SNP	0.487	T
BANK1	55024	genome.wustl.edu	37	4	102951371	102951371	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:102951371C>T	ENST00000322953.4	+	10	2123	c.1849C>T	c.(1849-1851)Cga>Tga	p.R617*	BANK1_ENST00000428908.1_Nonsense_Mutation_p.R484*|BANK1_ENST00000444316.2_Nonsense_Mutation_p.R587*|RP11-498M5.2_ENST00000505091.1_RNA|BANK1_ENST00000508653.1_Nonsense_Mutation_p.R484*|BANK1_ENST00000504592.1_Nonsense_Mutation_p.R602*	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	617					B cell activation (GO:0042113)			p.R617R(1)		NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		CCCCACACCCCGACCCACAAG	0.368																																																	1	Substitution - coding silent(1)	lung(1)											93.0	99.0	97.0					4																	102951371		2203	4300	6503	SO:0001587	stop_gained	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1849C>T	4.37:g.102951371C>T	ENSP00000320509:p.Arg617*		A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Nonsense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.R617*	ENST00000322953.4	37	c.1849	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	C	37	6.277983	0.97435	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	.	.	.	5.86	3.9	0.45041	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.6353	0.62219	0.3126:0.6874:0.0:0.0	.	.	.	.	X	602;617;484;484;587	.	ENSP00000320509:R617X	R	+	1	2	BANK1	103170394	0.405000	0.25336	0.833000	0.33012	0.864000	0.49448	0.594000	0.24014	1.415000	0.47037	0.591000	0.81541	CGA	BANK1	-	NULL	ENSG00000153064		0.368	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	-	0.00	40	0	C	NM_017935		102951371	+1	tier1	-	no_errors	ENST00000322953	ensembl	human	known	74_37	nonsense	81.82	6	27	SNP	0.568	T
BPIFC	254240	genome.wustl.edu	37	22	32843205	32843205	+	Missense_Mutation	SNP	G	G	T	rs141691558		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:32843205G>T	ENST00000397452.1	-	4	478	c.368C>A	c.(367-369)cCa>cAa	p.P123Q	BPIFC_ENST00000534972.1_5'UTR|BPIFC_ENST00000432451.2_5'UTR|BPIFC_ENST00000300399.3_Missense_Mutation_p.P123Q			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	123						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)	p.P123L(1)									TCACAAAAGTGGAGACTCGAA	0.453																																																	1	Substitution - Missense(1)	skin(1)											129.0	111.0	117.0					22																	32843205		2203	4300	6503	SO:0001583	missense	0			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.368C>A	22.37:g.32843205G>T	ENSP00000380594:p.Pro123Gln		A2RRF1	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.P123Q	ENST00000397452.1	37	c.368	CCDS13906.1	22	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680101	0.47886	.	.	ENSG00000184459	ENST00000397452;ENST00000300399	T;T	0.04706	3.57;3.57	5.87	4.86	0.63082	.	0.127438	0.53938	D	0.000047	T	0.17534	0.0421	M	0.80028	2.48	0.80722	D	1	D	0.58970	0.984	P	0.62184	0.899	T	0.03344	-1.1046	10	0.25751	T	0.34	-8.2249	11.4778	0.50308	0.083:0.0:0.917:0.0	.	123	Q8NFQ6	BPIFC_HUMAN	Q	123	ENSP00000380594:P123Q;ENSP00000300399:P123Q	ENSP00000300399:P123Q	P	-	2	0	BPIFC	31173205	0.988000	0.35896	0.985000	0.45067	0.967000	0.64934	3.078000	0.50096	1.626000	0.50381	0.655000	0.94253	CCA	BPIFC	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000184459		0.453	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BPIFC	HGNC	protein_coding	OTTHUMT00000129029.2	-	0.00	62	0	G	NM_174932		32843205	-1	tier1	-	no_errors	ENST00000300399	ensembl	human	known	74_37	missense	47.76	35	32	SNP	0.998	T
GPR124	25960	genome.wustl.edu	37	8	37702674	37702674	+	IGR	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:37702674C>T	ENST00000412232.2	+	0	5651				BRF2_ENST00000220659.6_Silent_p.E198E|BRF2_ENST00000520601.1_3'UTR	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124						central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			ACAGCATCTTCTCTTTGTCTT	0.498																																																	0													71.0	71.0	71.0					8																	37702674		2203	4300	6503	SO:0001628	intergenic_variant	0			AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182		8.37:g.37702674C>T			A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Silent	SNP	pfam_Znf_TFIIB,superfamily_Cyclin-like,pfscan_Znf_TFIIB	p.E198	ENST00000412232.2	37	c.594	CCDS6097.2	8																																																																																			BRF2	-	superfamily_Cyclin-like	ENSG00000104221		0.498	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF2	HGNC	protein_coding	OTTHUMT00000343331.2	-	0.00	29	0	C			37702674	-1	tier1	-	no_errors	ENST00000220659	ensembl	human	known	74_37	silent	17.91	110	24	SNP	1.000	T
BTG3	10950	genome.wustl.edu	37	21	18981448	18981448	+	Silent	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr21:18981448A>G	ENST00000348354.6	-	2	271	c.15T>C	c.(13-15)atT>atC	p.I5I	BTG3_ENST00000464058.1_5'UTR|BTG3_ENST00000339775.6_Silent_p.I5I	NM_006806.4	NP_006797.3	Q14201	BTG3_HUMAN	BTG family, member 3	5					negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	8				Epithelial(23;0.000283)|all cancers(11;0.0012)|Lung(58;0.0191)|OV - Ovarian serous cystadenocarcinoma(11;0.0206)|COAD - Colon adenocarcinoma(22;0.0315)|LUSC - Lung squamous cell carcinoma(23;0.0703)|Colorectal(24;0.0971)		CAACGGCAGCAATTTCATTCT	0.348																																																	0													65.0	66.0	66.0					21																	18981448		2203	4300	6503	SO:0001819	synonymous_variant	0			D64110	CCDS13569.1, CCDS46636.1	21q21.1	2006-12-16			ENSG00000154640	ENSG00000154640			1132	protein-coding gene	gene with protein product		605674				9632145	Standard	NM_006806		Approved	ANA, tob55	uc002ykk.3	Q14201	OTTHUMG00000074501	ENST00000348354.6:c.15T>C	21.37:g.18981448A>G			D3DSC4|Q53XV1|Q96ET7	Silent	SNP	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.I5	ENST00000348354.6	37	c.15	CCDS13569.1	21																																																																																			BTG3	-	pfam_Anti_prolifrtn,smart_Anti_prolifrtn	ENSG00000154640		0.348	BTG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BTG3	HGNC	protein_coding	OTTHUMT00000158196.1	-	0.00	34	0	A	NM_006806		18981448	-1	tier1	-	no_errors	ENST00000339775	ensembl	human	known	74_37	silent	44.19	24	19	SNP	1.000	G
BTRC	8945	genome.wustl.edu	37	10	103310677	103310678	+	Intron	DEL	TG	TG	-			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:103310677_103310678delTG	ENST00000370187.3	+	14	1967				BTRC_ENST00000393441.4_Intron|BTRC_ENST00000408038.2_Intron|BTRC_ENST00000493877.1_3'UTR	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TACATAACACTGTGGGTAGGAG	0.465																																																	0																																										SO:0001627	intron_variant	0			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1815+29TG>-	10.37:g.103310679_103310680delTG			B5MD49|Q5W141|Q5W142|Q9Y213	RNA	DEL	-	NULL	ENST00000370187.3	37	NULL	CCDS7512.1	10																																																																																			BTRC	-	-	ENSG00000166167		0.465	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	HGNC	protein_coding	OTTHUMT00000049936.1		0.00	47	0	TG	NM_033637		103310678	+1	tier1		no_errors	ENST00000493877	ensembl	human	known	74_37	rna	72.00	7	18	DEL	0.000:0.000	-
C12orf50	160419	genome.wustl.edu	37	12	88390397	88390397	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:88390397G>T	ENST00000298699.2	-	5	496	c.316C>A	c.(316-318)Cct>Act	p.P106T	C12orf50_ENST00000550553.1_Missense_Mutation_p.P106T	NM_152589.1	NP_689802.1	Q8NA57	CL050_HUMAN	chromosome 12 open reading frame 50	106										NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|urinary_tract(2)	34						ATTTCTTCAGGGGTCTTTGTC	0.269																																																	0													91.0	94.0	93.0					12																	88390397		2199	4296	6495	SO:0001583	missense	0			AK093140	CCDS9031.1	12q21.32	2006-02-03				ENSG00000165805			26665	protein-coding gene	gene with protein product						12477932	Standard	NM_152589		Approved	FLJ35821	uc001tam.1	Q8NA57	OTTHUMG00000169869	ENST00000298699.2:c.316C>A	12.37:g.88390397G>T	ENSP00000298699:p.Pro106Thr		Q6P674	Missense_Mutation	SNP	NULL	p.P106T	ENST00000298699.2	37	c.316	CCDS9031.1	12	.	.	.	.	.	.	.	.	.	.	G	13.40	2.227236	0.39399	.	.	ENSG00000165805	ENST00000298699;ENST00000550553;ENST00000551944	T;T	0.34275	1.39;1.37	5.18	2.31	0.28768	.	0.432772	0.22159	N	0.063809	T	0.32615	0.0835	M	0.70595	2.14	0.28452	N	0.916309	P;P	0.42296	0.775;0.51	B;B	0.39660	0.306;0.154	T	0.17289	-1.0374	10	0.33940	T	0.23	.	5.7563	0.18174	0.1812:0.179:0.6398:0.0	.	160;106	G3V208;Q8NA57	.;CL050_HUMAN	T	106;106;160	ENSP00000298699:P106T;ENSP00000448344:P106T	ENSP00000298699:P106T	P	-	1	0	C12orf50	86914528	1.000000	0.71417	0.970000	0.41538	0.954000	0.61252	1.569000	0.36428	0.545000	0.28902	0.563000	0.77884	CCT	C12orf50	-	NULL	ENSG00000165805		0.269	C12orf50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf50	HGNC	protein_coding	OTTHUMT00000406328.1	-	0.00	34	0	G	NM_152589		88390397	-1	tier1	-	no_errors	ENST00000298699	ensembl	human	known	74_37	missense	41.30	27	19	SNP	0.970	T
CFAP54	144535	genome.wustl.edu	37	12	96983278	96983278	+	Missense_Mutation	SNP	C	C	T	rs561342804	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:96983278C>T	ENST00000524981.4	+	23	3172	c.3149C>T	c.(3148-3150)tCg>tTg	p.S1050L	C12orf55_ENST00000554108.2_3'UTR			Q96N23	CL055_HUMAN		0																	TTTGTTGCTTCGCCACTTCAG	0.289													C|||	11	0.00219649	0.0061	0.0014	5008	,	,		17306	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001583	missense	0																														ENST00000524981.4:c.3149C>T	12.37:g.96983278C>T	ENSP00000431759:p.Ser1050Leu			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.S1050L	ENST00000524981.4	37	c.3149		12	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751501	0.31046	.	.	ENSG00000188596	ENST00000524981	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	T	0.36663	0.0975	N	0.22421	0.69	0.23210	N	0.998111	.	.	.	.	.	.	T	0.31586	-0.9938	6	0.51188	T	0.08	.	11.0523	0.47898	0.1432:0.7184:0.1383:0.0	.	.	.	.	L	1050	.	ENSP00000431759:S1050L	S	+	2	0	C12orf63	95507409	0.850000	0.29656	0.959000	0.39883	0.537000	0.34900	2.639000	0.46570	2.733000	0.93635	0.655000	0.94253	TCG	C12orf55	-	NULL	ENSG00000188596		0.289	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	42	0	C			96983278	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	47.69	34	31	SNP	0.061	T
C12orf43	64897	genome.wustl.edu	37	12	121442237	121442237	+	Missense_Mutation	SNP	C	C	A	rs200371786		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:121442237C>A	ENST00000288757.3	-	6	530	c.508G>T	c.(508-510)Gac>Tac	p.D170Y	C12orf43_ENST00000537817.1_Missense_Mutation_p.D171Y|C12orf43_ENST00000539736.1_Missense_Mutation_p.D160Y|C12orf43_ENST00000445832.3_Missense_Mutation_p.D140Y|C12orf43_ENST00000536407.2_Intron|C12orf43_ENST00000366211.2_Missense_Mutation_p.D129Y	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	170										cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TGTAGGATGTCGGACGCCGAC	0.577																																																	0													94.0	108.0	103.0					12																	121442237		2203	4300	6503	SO:0001583	missense	0			AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.508G>T	12.37:g.121442237C>A	ENSP00000288757:p.Asp170Tyr		Q53HF0|Q9H9Z7	Missense_Mutation	SNP	NULL	p.D170Y	ENST00000288757.3	37	c.508	CCDS9210.1	12	.	.	.	.	.	.	.	.	.	.	C	17.73	3.461264	0.63513	.	.	ENSG00000157895	ENST00000445832;ENST00000288757;ENST00000537817;ENST00000366211;ENST00000539736;ENST00000538296;ENST00000535367	T;T;T;T;T	0.61742	0.19;0.17;0.18;0.08;0.17	5.73	5.73	0.89815	.	0.137392	0.64402	D	0.000006	T	0.78566	0.4303	M	0.80847	2.515	0.50313	D	0.999867	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.78314	0.991;0.991;0.989;0.991;0.991	T	0.80587	-0.1316	10	0.87932	D	0	-15.1257	18.8906	0.92399	0.0:1.0:0.0:0.0	.	160;129;171;160;170	G5EA44;F6TFQ5;F5H7W8;B4DWJ9;Q96C57	.;.;.;.;CL043_HUMAN	Y	140;170;171;129;160;108;125	ENSP00000409788:D140Y;ENSP00000288757:D170Y;ENSP00000442224:D171Y;ENSP00000437803:D160Y;ENSP00000442041:D108Y	ENSP00000288757:D170Y	D	-	1	0	C12orf43	119926620	1.000000	0.71417	0.609000	0.28983	0.128000	0.20619	5.809000	0.69172	2.722000	0.93159	0.655000	0.94253	GAC	C12orf43	-	NULL	ENSG00000157895		0.577	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf43	HGNC	protein_coding		-	0.00	50	0	C	NM_022895		121442237	-1	tier1	-	no_errors	ENST00000288757	ensembl	human	known	74_37	missense	53.33	21	24	SNP	0.997	A
C6orf183	389422	genome.wustl.edu	37	6	109575736	109575736	+	RNA	SNP	T	T	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:109575736T>C	ENST00000453496.2	+	0	574							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		ACGGACATCGTGCACCGACGC	0.522																																																	0																																												0					6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109575736T>C				RNA	SNP	-	NULL	ENST00000453496.2	37	NULL		6																																																																																			C6orf183	-	-	ENSG00000243587		0.522	C6orf183-002	KNOWN	basic	processed_transcript	C6orf183	HGNC	polymorphic_pseudogene	OTTHUMT00000257660.2	-	0.00	60	0	T			109575736	+1	tier1	-	no_errors	ENST00000453496	ensembl	human	known	74_37	rna	40.00	27	18	SNP	0.999	C
CACNA1E	777	genome.wustl.edu	37	1	181685207	181685207	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:181685207G>T	ENST00000367573.2	+	10	1257	c.1257G>T	c.(1255-1257)cgG>cgT	p.R419R	CACNA1E_ENST00000360108.3_Silent_p.R419R|CACNA1E_ENST00000358338.5_Silent_p.R370R|CACNA1E_ENST00000367567.4_Silent_p.R26R|CACNA1E_ENST00000367570.1_Silent_p.R419R|CACNA1E_ENST00000526775.1_Silent_p.R419R|CACNA1E_ENST00000357570.5_Silent_p.R370R	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	419					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGAGGAGCCGGACAGAGGCCA	0.507																																																	0													79.0	89.0	86.0					1																	181685207		1956	4152	6108	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1257G>T	1.37:g.181685207G>T			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R419	ENST00000367573.2	37	c.1257	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.507	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	37	0	G	NM_000721		181685207	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	silent	55.36	25	31	SNP	0.981	T
CACNA1E	777	genome.wustl.edu	37	1	181688895	181688895	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:181688895G>A	ENST00000367573.2	+	13	1647	c.1647G>A	c.(1645-1647)gtG>gtA	p.V549V	CACNA1E_ENST00000360108.3_Silent_p.V549V|CACNA1E_ENST00000358338.5_Silent_p.V500V|CACNA1E_ENST00000367567.4_Silent_p.V156V|CACNA1E_ENST00000367570.1_Silent_p.V549V|CACNA1E_ENST00000526775.1_Silent_p.V549V|CACNA1E_ENST00000357570.5_Silent_p.V500V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	549					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGGTCACAGTGGGCAGTATCT	0.507																																																	0													93.0	88.0	90.0					1																	181688895		1985	4171	6156	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1647G>A	1.37:g.181688895G>A			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.V549	ENST00000367573.2	37	c.1647	CCDS55664.1	1																																																																																			CACNA1E	-	pfam_Ion_trans_dom	ENSG00000198216		0.507	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	40	0	G	NM_000721		181688895	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	silent	42.37	34	25	SNP	1.000	A
CALU	813	genome.wustl.edu	37	7	128388853	128388853	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:128388853G>T	ENST00000249364.4	+	2	318	c.216G>T	c.(214-216)agG>agT	p.R72S	CALU_ENST00000542996.2_Missense_Mutation_p.R80S|CALU_ENST00000535623.1_Missense_Mutation_p.R80S|CALU_ENST00000535011.2_Missense_Mutation_p.R72S|CALU_ENST00000479257.1_Missense_Mutation_p.R80S|CALU_ENST00000449187.2_Missense_Mutation_p.R72S|CALU_ENST00000538546.1_Intron	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin	72	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)			kidney(2)|large_intestine(3)|lung(5)	10						GCAAGGAAAGGCTTGGGTAAG	0.418																																																	0													79.0	73.0	75.0					7																	128388853		2203	4300	6503	SO:0001583	missense	0			AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.216G>T	7.37:g.128388853G>T	ENSP00000249364:p.Arg72Ser		B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R80S	ENST00000249364.4	37	c.240	CCDS5805.1	7	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982160	0.74474	.	.	ENSG00000128595	ENST00000542996;ENST00000535623;ENST00000538394;ENST00000537667;ENST00000535011;ENST00000537014;ENST00000249364;ENST00000449187;ENST00000342367;ENST00000479257	T;T;T;T;T;T	0.65916	2.46;-0.18;3.09;2.48;2.46;2.47	6.03	-2.79	0.05841	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.78052	0.4223	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;0.97	D;P	0.91635	0.999;0.847	T	0.79349	-0.1840	10	0.56958	D	0.05	-10.8307	12.7008	0.57032	0.4509:0.0:0.5491:0.0	.	80;72	D6QS48;O43852	.;CALU_HUMAN	S	80;80;72;72;72;72;72;72;72;80	ENSP00000438248:R80S;ENSP00000439139:R80S;ENSP00000442110:R72S;ENSP00000249364:R72S;ENSP00000408838:R72S;ENSP00000420381:R80S	ENSP00000249364:R72S	R	+	3	2	CALU	128176089	0.331000	0.24713	0.984000	0.44739	0.996000	0.88848	-0.173000	0.09854	-0.407000	0.07576	0.655000	0.94253	AGG	CALU	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000128595		0.418	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALU	HGNC	protein_coding	OTTHUMT00000350533.1		0.00	13	0	G	NM_001219		128388853	+1			no_errors	ENST00000479257	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.902	T
CATSPERG	57828	genome.wustl.edu	37	19	38842979	38842979	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:38842979G>A	ENST00000409235.3	+	8	1019	c.904G>A	c.(904-906)Gcc>Acc	p.A302T	CATSPERG_ENST00000215069.4_Missense_Mutation_p.A294T|CATSPERG_ENST00000410018.1_Missense_Mutation_p.A302T	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	302					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						TGACACTATTGCCACCGAGAG	0.542																																																	0													137.0	115.0	121.0					19																	38842979		692	1591	2283	SO:0001583	missense	0			AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.904G>A	19.37:g.38842979G>A	ENSP00000386962:p.Ala302Thr		A6NEG6|Q659E1	Missense_Mutation	SNP	NULL	p.A302T	ENST00000409235.3	37	c.904	CCDS12514.2	19	.	.	.	.	.	.	.	.	.	.	G	14.84	2.654609	0.47467	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410;ENST00000215069	T;T;T;T	0.34859	1.34;1.34;1.34;1.34	5.56	-2.0	0.07433	.	0.569810	0.16872	N	0.196062	T	0.41903	0.1179	M	0.71581	2.175	0.22926	N	0.998552	P;P	0.51351	0.944;0.944	P;P	0.50825	0.651;0.651	T	0.39800	-0.9596	10	0.87932	D	0	-26.9763	8.6499	0.34029	0.0813:0.0:0.4551:0.4636	.	302;302	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	T	302;302;302;294	ENSP00000387057:A302T;ENSP00000386962:A302T;ENSP00000386950:A302T;ENSP00000215069:A294T	ENSP00000215069:A294T	A	+	1	0	CATSPERG	43534819	0.002000	0.14202	0.051000	0.19133	0.150000	0.21749	-0.176000	0.09811	-0.077000	0.12752	0.561000	0.74099	GCC	CATSPERG	-	NULL	ENSG00000099338		0.542	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPERG	HGNC	protein_coding	OTTHUMT00000330204.1	-	0.00	38	0	G	NM_021185		38842979	+1	tier1	-	no_errors	ENST00000409235	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.372	A
CBFA2T3	863	genome.wustl.edu	37	16	88947723	88947723	+	Frame_Shift_Del	DEL	C	C	-	rs200535158		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:88947723delC	ENST00000268679.4	-	9	1774	c.1378delG	c.(1378-1380)gccfs	p.A460fs	RP11-830F9.5_ENST00000562574.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000565053.1_RNA|CBFA2T3_ENST00000448839.1_Frame_Shift_Del_p.A384fs|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000436887.2_Frame_Shift_Del_p.A422fs|CBFA2T3_ENST00000360302.2_Frame_Shift_Del_p.A374fs|CBFA2T3_ENST00000327483.5_Frame_Shift_Del_p.A374fs	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	460					cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		TCGGGACCGGCGGAGCTGCTg	0.736			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0													10.0	11.0	10.0					16																	88947723		2145	4245	6390	SO:0001589	frameshift_variant	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.1378delG	16.37:g.88947723delC	ENSP00000268679:p.Ala460fs		D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Frame_Shift_Del	DEL	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.A460fs	ENST00000268679.4	37	c.1378	CCDS10972.1	16																																																																																			CBFA2T3	-	prints_MTG16	ENSG00000129993		0.736	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	HGNC	protein_coding	OTTHUMT00000269545.2		0.00	21	0	C	NM_005187		88947723	-1	tier1		no_errors	ENST00000268679	ensembl	human	known	74_37	frame_shift_del	35.71	9	5	DEL	0.000	-
CBFA2T3	863	genome.wustl.edu	37	16	88947724	88947724	+	Silent	SNP	G	G	A	rs2272437		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:88947724G>A	ENST00000268679.4	-	9	1773	c.1377C>T	c.(1375-1377)tcC>tcT	p.S459S	RP11-830F9.5_ENST00000562574.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000565053.1_RNA|CBFA2T3_ENST00000448839.1_Silent_p.S383S|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000436887.2_Silent_p.S421S|CBFA2T3_ENST00000360302.2_Silent_p.S373S|CBFA2T3_ENST00000327483.5_Silent_p.S373S	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	459					cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CGGGACCGGCGGAGCTGCTgc	0.736			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0													9.0	11.0	10.0					16																	88947724		2145	4240	6385	SO:0001819	synonymous_variant	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.1377C>T	16.37:g.88947724G>A			D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Silent	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.S459	ENST00000268679.4	37	c.1377	CCDS10972.1	16																																																																																			CBFA2T3	-	prints_MTG16	ENSG00000129993		0.736	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	HGNC	protein_coding	OTTHUMT00000269545.2	-	0.00	22	0	G	NM_005187		88947724	-1	tier1	rs2272437	no_errors	ENST00000268679	ensembl	human	known	74_37	silent	33.33	10	5	SNP	0.009	A
CBWD1	55871	genome.wustl.edu	37	9	121496	121496	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:121496G>A	ENST00000356521.4	-	15	1247	c.1159C>T	c.(1159-1161)Cgt>Tgt	p.R387C	CBWD1_ENST00000382447.4_Missense_Mutation_p.R368C|CBWD1_ENST00000377400.4_Missense_Mutation_p.R339C|CBWD1_ENST00000314367.10_Missense_Mutation_p.R351C|CBWD1_ENST00000475411.1_5'Flank	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	387				RFQ -> HFK (in Ref. 4; AAK14935). {ECO:0000305}.			ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		TCTTGGAAACGTGTTGTCCAC	0.328																																																	0													375.0	377.0	376.0					9																	121496		2203	4299	6502	SO:0001583	missense	0			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.1159C>T	9.37:g.121496G>A	ENSP00000348915:p.Arg387Cys		A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Missense_Mutation	SNP	pfam_CobW/HypB/UreG_dom,pfam_Cbl_biosynth_CobW-like_C,superfamily_P-loop_NTPase,superfamily_Cbl_biosynth_CobW-like_C	p.R387C	ENST00000356521.4	37	c.1159	CCDS6438.1	9	.	.	.	.	.	.	.	.	.	.	.	11.72	1.721795	0.30503	.	.	ENSG00000172785	ENST00000356521;ENST00000377400;ENST00000382447;ENST00000314367	T;T;T;T	0.10099	3.08;3.08;3.08;2.91	3.08	3.08	0.35506	.	0.611324	0.14683	N	0.304622	T	0.07728	0.0194	N	0.08118	0	0.09310	N	1	P;P;P	0.52061	0.903;0.95;0.752	B;P;B	0.46758	0.398;0.526;0.224	T	0.21143	-1.0254	10	0.66056	D	0.02	-0.1117	9.837	0.40975	0.0:0.0:1.0:0.0	.	368;351;387	Q9BRT8-3;Q9BRT8-2;Q9BRT8	.;.;CBWD1_HUMAN	C	387;339;368;351	ENSP00000348915:R387C;ENSP00000366617:R339C;ENSP00000371885:R368C;ENSP00000323433:R351C	ENSP00000323433:R351C	R	-	1	0	CBWD1	111496	0.002000	0.14202	0.038000	0.18304	0.015000	0.08874	0.286000	0.18902	1.732000	0.51606	0.479000	0.44913	CGT	CBWD1	-	NULL	ENSG00000172785		0.328	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1	-	0.00	495	0	G	NM_018491		121496	-1	tier1	-	no_errors	ENST00000356521	ensembl	human	known	74_37	missense	46.75	205	180	SNP	0.388	A
CCDC175	729665	genome.wustl.edu	37	14	59992116	59992116	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:59992116G>T	ENST00000537690.2	-	16	1934	c.1879C>A	c.(1879-1881)Caa>Aaa	p.Q627K	RP11-701B16.2_ENST00000554253.1_RNA|CCDC175_ENST00000281581.4_Missense_Mutation_p.Q627K	NM_001164399.1	NP_001157871.1	P0C221	CC175_HUMAN	coiled-coil domain containing 175	627																	TTGCTTTCTTGATCTCGTAAT	0.333																																																	0													417.0	314.0	345.0					14																	59992116		692	1591	2283	SO:0001583	missense	0				CCDS53898.1	14q23.1	2012-09-24	2012-09-24	2012-09-24	ENSG00000151838	ENSG00000151838			19847	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 38"""	C14orf38			Standard	NM_001164399		Approved		uc021rtw.1	P0C221		ENST00000537690.2:c.1879C>A	14.37:g.59992116G>T	ENSP00000453940:p.Gln627Lys		G3V5J7	Missense_Mutation	SNP	superfamily_Prefoldin	p.Q627K	ENST00000537690.2	37	c.1879	CCDS53898.1	14	.	.	.	.	.	.	.	.	.	.	G	9.585	1.124569	0.20959	.	.	ENSG00000151838	ENST00000555041	.	.	.	4.99	1.77	0.24775	.	0.588976	0.15279	N	0.270761	T	0.22205	0.0535	L	0.27053	0.805	0.09310	N	1	.	.	.	.	.	.	T	0.20338	-1.0278	7	0.16420	T	0.52	-1.1049	6.118	0.20137	0.1062:0.3636:0.5302:0.0	.	.	.	.	K	627	.	ENSP00000281581:Q627K	Q	-	1	0	C14orf38	59061869	0.001000	0.12720	0.015000	0.15790	0.257000	0.26127	0.373000	0.20484	0.718000	0.32166	0.655000	0.94253	CAA	CCDC175	-	NULL	ENSG00000151838		0.333	CCDC175-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC175	HGNC	protein_coding	OTTHUMT00000471273.1	-	0.00	43	0	G	NM_001164399		59992116	-1	tier1	-	no_errors	ENST00000281581	ensembl	human	known	74_37	missense	40.32	37	25	SNP	0.004	T
CD6	923	genome.wustl.edu	37	11	60785799	60785799	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:60785799G>A	ENST00000313421.7	+	12	2062	c.1876G>A	c.(1876-1878)Ggg>Agg	p.G626R	CD6_ENST00000346437.4_Missense_Mutation_p.G553R|CD6_ENST00000452451.2_Intron|CD6_ENST00000352009.5_Intron|CD6_ENST00000344028.5_Missense_Mutation_p.G594R	NM_006725.4	NP_006716.3	P30203	CD6_HUMAN	CD6 molecule	626					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	scavenger receptor activity (GO:0005044)			endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)	18						CACCTCATCCGGGGAGTGGTA	0.627																																					Pancreas(169;904 2017 4767 38890 42505)												0													29.0	28.0	28.0					11																	60785799		2202	4299	6501	SO:0001583	missense	0				CCDS7999.1, CCDS58137.1, CCDS58138.1	11q12.2	2006-03-28	2006-03-28		ENSG00000013725	ENSG00000013725		"""CD molecules"""	1691	protein-coding gene	gene with protein product		186720	"""CD6 antigen"""			9013954	Standard	NM_006725		Approved	Tp120	uc001nqq.3	P30203	OTTHUMG00000167823	ENST00000313421.7:c.1876G>A	11.37:g.60785799G>A	ENSP00000323280:p.Gly626Arg		A4KAD4|A4KAD5|Q9UMF2|Q9Y4K7|Q9Y4K8|Q9Y4K9|Q9Y4L0	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.G626R	ENST00000313421.7	37	c.1876	CCDS7999.1	11	.	.	.	.	.	.	.	.	.	.	G	25.7	4.661793	0.88154	.	.	ENSG00000013725	ENST00000344028;ENST00000346437;ENST00000313421	T;T;T	0.13307	2.81;2.6;3.24	5.44	5.44	0.79542	.	0.798159	0.10650	N	0.649998	T	0.38719	0.1051	M	0.66939	2.045	0.37332	D	0.910014	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.12811	-1.0533	10	0.87932	D	0	.	14.7726	0.69691	0.0:0.0:1.0:0.0	.	626;625	P30203;Q8N4Q7	CD6_HUMAN;.	R	594;553;626	ENSP00000344108:G594R;ENSP00000345566:G553R;ENSP00000323280:G626R	ENSP00000323280:G626R	G	+	1	0	CD6	60542375	1.000000	0.71417	0.946000	0.38457	0.961000	0.63080	4.852000	0.62904	2.561000	0.86390	0.563000	0.77884	GGG	CD6	-	NULL	ENSG00000013725		0.627	CD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD6	HGNC	protein_coding	OTTHUMT00000396449.1	-	0.00	57	0	G	NM_006725		60785799	+1	tier1	-	no_errors	ENST00000313421	ensembl	human	known	74_37	missense	93.33	2	28	SNP	0.998	A
CCDC87	55231	genome.wustl.edu	37	11	66358083	66358083	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:66358083C>A	ENST00000333861.3	-	1	2471	c.2404G>T	c.(2404-2406)Ggg>Tgg	p.G802W	CCS_ENST00000533244.1_5'Flank|CCS_ENST00000310190.4_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	802					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						TAGGGCCGCCCCTTGAAGATC	0.542																																																	0													177.0	187.0	184.0					11																	66358083		2200	4295	6495	SO:0001583	missense	0			BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.2404G>T	11.37:g.66358083C>A	ENSP00000328487:p.Gly802Trp		Q8NE76	Missense_Mutation	SNP	pfam_MAP65_Ase1_PRC1	p.G802W	ENST00000333861.3	37	c.2404	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295736	0.60086	.	.	ENSG00000182791	ENST00000333861	T	0.55588	0.51	5.6	5.6	0.85130	.	0.097305	0.41097	D	0.000958	T	0.73040	0.3536	M	0.79475	2.455	0.49915	D	0.999837	D	0.89917	1.0	D	0.97110	1.0	T	0.75855	-0.3170	10	0.72032	D	0.01	.	15.0991	0.72258	0.0:1.0:0.0:0.0	.	802	Q9NVE4	CCD87_HUMAN	W	802	ENSP00000328487:G802W	ENSP00000328487:G802W	G	-	1	0	CCDC87	66114659	1.000000	0.71417	1.000000	0.80357	0.550000	0.35303	4.508000	0.60441	2.639000	0.89480	0.561000	0.74099	GGG	CCDC87	-	pfam_MAP65_Ase1_PRC1	ENSG00000182791		0.542	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	HGNC	protein_coding	OTTHUMT00000393825.1	-	0.00	23	0	C	NM_018219		66358083	-1	tier1	-	no_errors	ENST00000333861	ensembl	human	known	74_37	missense	25.93	20	7	SNP	1.000	A
CDC42BPB	9578	genome.wustl.edu	37	14	103435036	103435036	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:103435036C>A	ENST00000361246.2	-	15	2301	c.2013G>T	c.(2011-2013)cgG>cgT	p.R671R		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CACCCGCTCCCCGGCCTCCTT	0.473																																																	0													63.0	71.0	68.0					14																	103435036		2200	4298	6498	SO:0001819	synonymous_variant	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.2013G>T	14.37:g.103435036C>A				Silent	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.R671	ENST00000361246.2	37	c.2013	CCDS9978.1	14																																																																																			CDC42BPB	-	NULL	ENSG00000198752		0.473	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	-	0.00	14	0	C	NM_006035		103435036	-1	tier1	-	no_errors	ENST00000361246	ensembl	human	known	74_37	silent	39.13	14	9	SNP	0.290	A
CDH2	1000	genome.wustl.edu	37	18	25543357	25543357	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr18:25543357G>T	ENST00000269141.3	-	15	2901	c.2478C>A	c.(2476-2478)gcC>gcA	p.A826A	AC015933.2_ENST00000423367.1_RNA|CDH2_ENST00000399380.3_Silent_p.A795A	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	826					adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.A826A(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CAGGGTGTGGGGCTGCAGATC	0.502																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											80.0	66.0	71.0					18																	25543357		2203	4300	6503	SO:0001819	synonymous_variant	0			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.2478C>A	18.37:g.25543357G>T			A8MWK3|B0YIY6|Q14923|Q8N173	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.A826	ENST00000269141.3	37	c.2478	CCDS11891.1	18																																																																																			CDH2	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000170558		0.502	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH2	HGNC	protein_coding	OTTHUMT00000133246.3	-	0.00	31	0	G	NM_001792		25543357	-1	tier1	-	no_errors	ENST00000269141	ensembl	human	known	74_37	silent	14.29	24	4	SNP	1.000	T
CELF5	60680	genome.wustl.edu	37	19	3285972	3285972	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:3285972G>T	ENST00000292672.2	+	10	1172	c.1135G>T	c.(1135-1137)Gcg>Tcg	p.A379S	CELF5_ENST00000541430.2_Missense_Mutation_p.A354S|CELF5_ENST00000588101.1_3'UTR	NM_021938.3	NP_068757.2	Q8N6W0	CELF5_HUMAN	CUGBP, Elav-like family member 5	379					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			kidney(1)|large_intestine(2)|lung(7)|ovary(2)|skin(1)	13						CACGCCCATCGCGCACAGCGT	0.761																																																	0													12.0	13.0	13.0					19																	3285972		2095	4171	6266	SO:0001583	missense	0			AF248649	CCDS12106.1, CCDS54197.1	19p13	2013-02-12	2010-02-19	2010-02-19		ENSG00000161082		"""RNA binding motif (RRM) containing"""	14058	protein-coding gene	gene with protein product		612680	"""Bruno (Drosophila) -like 5, RNA binding protein"", ""bruno-like 5, RNA binding protein (Drosophila)"""	BRUNOL5		10893231	Standard	NM_001172673		Approved		uc002lxm.3	Q8N6W0		ENST00000292672.2:c.1135G>T	19.37:g.3285972G>T	ENSP00000292672:p.Ala379Ser		D6W614|O75253|Q59GP2|Q86VW6|Q9BZC0|Q9NR86	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A379S	ENST00000292672.2	37	c.1135	CCDS12106.1	19	.	.	.	.	.	.	.	.	.	.	G	12.68	2.009522	0.35415	.	.	ENSG00000161082	ENST00000292672;ENST00000541430;ENST00000334293	T;T;T	0.41758	0.99;1.82;1.63	4.15	4.15	0.48705	.	0.624572	0.15597	N	0.254109	T	0.15089	0.0364	N	0.02539	-0.55	0.27790	N	0.942868	B;B;B	0.29341	0.042;0.242;0.01	B;B;B	0.21546	0.027;0.035;0.012	T	0.13415	-1.0510	10	0.11485	T	0.65	-7.6922	8.2399	0.31654	0.1136:0.0:0.8864:0.0	.	265;354;379	B4DFI3;Q8N6W0-2;Q8N6W0	.;.;CELF5_HUMAN	S	379;354;265	ENSP00000292672:A379S;ENSP00000443498:A354S;ENSP00000335182:A265S	ENSP00000292672:A379S	A	+	1	0	CELF5	3236972	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.830000	0.48136	2.051000	0.60960	0.491000	0.48974	GCG	CELF5	-	NULL	ENSG00000161082		0.761	CELF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELF5	HGNC	protein_coding	OTTHUMT00000452574.1		0.00	14	0	G	NM_021938		3285972	+1			no_errors	ENST00000292672	ensembl	human	known	74_37	missense	60.00	2	3	SNP	1.000	T
CEP85L	387119	genome.wustl.edu	37	6	118786703	118786703	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:118786703C>A	ENST00000368491.3	-	13	2904	c.2283G>T	c.(2281-2283)gaG>gaT	p.E761D	CEP85L_ENST00000368488.5_Missense_Mutation_p.E764D	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	761						centrosome (GO:0005813)|cytoplasm (GO:0005737)											TGTGGTCATTCTCAGTCTCTT	0.358																																																	0													207.0	192.0	196.0					6																	118786703		1936	4143	6079	SO:0001583	missense	0			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.2283G>T	6.37:g.118786703C>A	ENSP00000357477:p.Glu761Asp		A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	NULL	p.E764D	ENST00000368491.3	37	c.2292	CCDS43498.1	6	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303220	0.40795	.	.	ENSG00000111860	ENST00000368491;ENST00000368488	T;T	0.08984	3.03;3.03	5.54	0.493	0.16878	.	0.000000	0.85682	D	0.000000	T	0.03305	0.0096	L	0.32530	0.975	0.36228	D	0.852452	D	0.59767	0.986	P	0.53224	0.721	T	0.16778	-1.0391	10	0.07325	T	0.83	-9.7005	10.5295	0.44969	0.0:0.4329:0.0:0.5671	.	761	Q5SZL2	CF204_HUMAN	D	761;764	ENSP00000357477:E761D;ENSP00000357474:E764D	ENSP00000357474:E764D	E	-	3	2	C6orf204	118893396	0.991000	0.36638	0.998000	0.56505	0.815000	0.46073	0.213000	0.17521	0.087000	0.17167	0.591000	0.81541	GAG	CEP85L	-	NULL	ENSG00000111860		0.358	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP85L	HGNC	protein_coding	OTTHUMT00000041996.2	-	0.00	45	0	C	NM_001042475		118786703	-1	tier1	-	no_errors	ENST00000368488	ensembl	human	known	74_37	missense	55.00	27	33	SNP	0.995	A
CES1P1	51716	genome.wustl.edu	37	16	55806303	55806303	+	RNA	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:55806303G>T	ENST00000571348.1	+	0	605					NR_003276.2		Q9UKY3	CES1P_HUMAN	carboxylesterase 1 pseudogene 1						anatomical structure morphogenesis (GO:0009653)|metabolic process (GO:0008152)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)	carboxylic ester hydrolase activity (GO:0052689)										ACACAGCCCGGGGAACTGGGG	0.587																																																	0																																												0			AF106005		16q12.2	2013-07-10	2010-10-12	2010-10-12	ENSG00000228695	ENSG00000228695			18546	pseudogene	pseudogene			"""carboxylesterase 4-like"", ""carboxylesterase 4, pseudogene"""	CES4		10452915, 20931200	Standard	NR_003276		Approved	PCE-3, CESR, CES1A3	uc010cce.3	Q9UKY3	OTTHUMG00000154668		16.37:g.55806303G>T			A2RRL8|B9ZVS2	RNA	SNP	-	NULL	ENST00000571348.1	37	NULL		16																																																																																			CES1P1	-	-	ENSG00000228695		0.587	CES1P1-003	KNOWN	basic	processed_transcript	CES1P1	HGNC	pseudogene	OTTHUMT00000440035.1	-	0.00	22	0	G	NR_003276		55806303	+1	tier1	-	no_errors	ENST00000571348	ensembl	human	known	74_37	rna	59.68	25	37	SNP	0.970	T
CHMP4C	92421	genome.wustl.edu	37	8	82670388	82670388	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:82670388G>T	ENST00000297265.4	+	4	688	c.495G>T	c.(493-495)atG>atT	p.M165I		NM_152284.3	NP_689497.1	Q96CF2	CHM4C_HUMAN	charged multivesicular body protein 4C	165	Intramolecular interaction with N- terminus. {ECO:0000250}.				abscission (GO:0009838)|cytokinesis checkpoint (GO:0031565)|endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of cytokinesis (GO:0032466)|positive regulation of viral release from host cell (GO:1902188)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Flemming body (GO:0090543)|membrane (GO:0016020)|midbody (GO:0030496)	protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	10						ATGAGTTGATGGCAGAACTTG	0.408																																																	0													103.0	104.0	103.0					8																	82670388		2203	4300	6503	SO:0001583	missense	0			AK000049	CCDS6233.1	8q21.13	2011-09-21	2011-09-21		ENSG00000164695	ENSG00000164695		"""Charged multivesicular body proteins"""	30599	protein-coding gene	gene with protein product	"""Snf7 homologue associated with Alix 3"""	610899	"""chromatin modifying protein 4C"""			12860994 , 14678797	Standard	NM_152284		Approved	MGC22825, Shax3, VPS32C	uc003ycl.3	Q96CF2	OTTHUMG00000164726	ENST00000297265.4:c.495G>T	8.37:g.82670388G>T	ENSP00000297265:p.Met165Ile		B2RBZ1	Missense_Mutation	SNP	pfam_Snf7	p.M165I	ENST00000297265.4	37	c.495	CCDS6233.1	8	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753443	0.69648	.	.	ENSG00000164695	ENST00000297265	T	0.72505	-0.66	6.17	6.17	0.99709	.	0.164355	0.64402	D	0.000002	T	0.81384	0.4811	M	0.85542	2.76	0.80722	D	1	B	0.27229	0.172	B	0.39119	0.291	T	0.78280	-0.2265	10	0.54805	T	0.06	-11.9174	20.8794	0.99867	0.0:0.0:1.0:0.0	.	165	Q96CF2	CHM4C_HUMAN	I	165	ENSP00000297265:M165I	ENSP00000297265:M165I	M	+	3	0	CHMP4C	82832943	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.447000	0.73465	2.941000	0.99782	0.655000	0.94253	ATG	CHMP4C	-	pfam_Snf7	ENSG00000164695		0.408	CHMP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP4C	HGNC	protein_coding	OTTHUMT00000379927.1	-	0.00	14	0	G	NM_152284		82670388	+1	tier1	-	no_errors	ENST00000297265	ensembl	human	known	74_37	missense	52.94	8	9	SNP	1.000	T
CHPF	79586	genome.wustl.edu	37	2	220404662	220404662	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:220404662C>T	ENST00000243776.6	-	4	2019	c.1771G>A	c.(1771-1773)Gca>Aca	p.A591T	CHPF_ENST00000535926.1_Missense_Mutation_p.A429T	NM_024536.5	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	591					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	21		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		GGTGAGGGTGCGGCTGTCTGC	0.647																																																	0													47.0	52.0	51.0					2																	220404662		2203	4299	6502	SO:0001583	missense	0			BC008878	CCDS2443.1, CCDS56169.1	2q35	2014-02-12			ENSG00000123989	ENSG00000123989	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24291	protein-coding gene	gene with protein product	"""chondroitin sulfate synthase 2"""	610405				11230166, 12716890	Standard	NM_024536		Approved	CSS2, CHSY2	uc002vmc.4	Q8IZ52	OTTHUMG00000058929	ENST00000243776.6:c.1771G>A	2.37:g.220404662C>T	ENSP00000243776:p.Ala591Thr		B4DXU0|Q6UXD6|Q7L4G1|Q9H0F8|Q9H618	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.A591T	ENST00000243776.6	37	c.1771	CCDS2443.1	2	.	.	.	.	.	.	.	.	.	.	C	9.917	1.211180	0.22289	.	.	ENSG00000123989	ENST00000243776;ENST00000535926	T;T	0.15487	2.42;2.42	4.62	3.73	0.42828	.	0.362631	0.28647	N	0.014618	T	0.10121	0.0248	N	0.16478	0.41	0.23542	N	0.997452	B	0.30664	0.289	B	0.25987	0.065	T	0.23762	-1.0179	10	0.20519	T	0.43	-7.815	13.4761	0.61310	0.0:0.9232:0.0:0.0768	.	591	Q8IZ52	CHSS2_HUMAN	T	591;429	ENSP00000243776:A591T;ENSP00000445571:A429T	ENSP00000243776:A591T	A	-	1	0	CHPF	220112906	0.354000	0.24912	0.010000	0.14722	0.492000	0.33523	3.773000	0.55333	1.295000	0.44724	0.561000	0.74099	GCA	CHPF	-	pfam_Chond_GalNAc	ENSG00000123989		0.647	CHPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF	HGNC	protein_coding	OTTHUMT00000130268.1		0.00	46	0	C	NM_024536		220404662	-1			no_errors	ENST00000243776	ensembl	human	known	74_37	missense	8.11	34	3	SNP	0.352	T
COG7	91949	genome.wustl.edu	37	16	23464262	23464262	+	Silent	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:23464262A>G	ENST00000307149.5	-	1	239	c.54T>C	c.(52-54)aaT>aaC	p.N18N	CTD-2270L9.4_ENST00000570080.1_lincRNA	NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	18					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		TGAAGGCCGCATTGATCCACT	0.612																																																	0													59.0	57.0	58.0					16																	23464262		2197	4300	6497	SO:0001819	synonymous_variant	0			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.54T>C	16.37:g.23464262A>G			Q6UWU7	Silent	SNP	pfam_COG7	p.N18	ENST00000307149.5	37	c.54	CCDS10610.1	16																																																																																			COG7	-	pfam_COG7	ENSG00000168434		0.612	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	HGNC	protein_coding	OTTHUMT00000211625.1	-	0.00	50	0	A			23464262	-1	tier1	-	no_errors	ENST00000307149	ensembl	human	known	74_37	silent	42.86	12	9	SNP	0.954	G
COL6A5	256076	genome.wustl.edu	37	3	130116450	130116450	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:130116450G>T	ENST00000432398.2	+	9	4086	c.3592G>T	c.(3592-3594)Ggg>Tgg	p.G1198W	COL6A5_ENST00000265379.6_Missense_Mutation_p.G1198W	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1198	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CATAGTGGTTGGGTTTGACAT	0.493																																																	0													25.0	25.0	25.0					3																	130116450		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.3592G>T	3.37:g.130116450G>T	ENSP00000390895:p.Gly1198Trp		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1198W	ENST00000432398.2	37	c.3592		3	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330107	0.24167	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.38077	1.16;1.16	5.25	4.38	0.52667	.	.	.	.	.	T	0.54695	0.1874	M	0.68593	2.085	0.36466	D	0.866989	D	0.89917	1.0	D	0.97110	1.0	T	0.63506	-0.6622	9	0.59425	D	0.04	.	9.4584	0.38769	0.166:0.0:0.834:0.0	.	1198	A8TX70-2	.	W	1198	ENSP00000390895:G1198W;ENSP00000265379:G1198W	ENSP00000265379:G1198W	G	+	1	0	COL6A5	131599140	1.000000	0.71417	0.924000	0.36721	0.210000	0.24377	4.910000	0.63321	1.204000	0.43247	0.561000	0.74099	GGG	COL6A5	-	NULL	ENSG00000172752		0.493	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	22	0	G	NM_153264		130116450	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	91.67	1	11	SNP	0.996	T
COMMD1	150684	genome.wustl.edu	37	2	62363038	62363038	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:62363038G>C	ENST00000311832.5	+	3	567	c.535G>C	c.(535-537)Gaa>Caa	p.E179Q	COMMD1_ENST00000472729.1_3'UTR|AC018462.2_ENST00000421323.1_RNA|AC018462.2_ENST00000425966.2_RNA	NM_152516.2	NP_689729.1	Q8N668	COMD1_HUMAN	copper metabolism (Murr1) domain containing 1	179	COMM. {ECO:0000255|PROSITE- ProRule:PRU00602}.				copper ion homeostasis (GO:0055070)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of protein ubiquitination (GO:0031398)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	Cul2-RING ubiquitin ligase complex (GO:0031462)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			large_intestine(1)|liver(2)|lung(5)|ovary(1)	9	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			GTCAGAGGTAGAAGAAAGTAT	0.413																																																	0													131.0	124.0	126.0					2																	62363038		2203	4300	6503	SO:0001583	missense	0			BC022046	CCDS1869.1	2p15	2004-03-02	2004-02-13	2004-02-18	ENSG00000173163	ENSG00000173163			23024	protein-coding gene	gene with protein product	"""copper metabolism gene MURR1"""	607238	"""chromosome 2 open reading frame 5 (MURR1)"""	C2orf5		9001233, 11809725	Standard	NM_152516		Approved	MURR1, MGC27155	uc002sbp.3	Q8N668	OTTHUMG00000129445	ENST00000311832.5:c.535G>C	2.37:g.62363038G>C	ENSP00000308236:p.Glu179Gln		B4DFQ4|Q96GS0	Missense_Mutation	SNP	pfam_HCaRG	p.E179Q	ENST00000311832.5	37	c.535	CCDS1869.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.14|17.14	3.314024|3.314024	0.60414|0.60414	.|.	.|.	ENSG00000173163|ENSG00000173163	ENST00000311832|ENST00000458337;ENST00000427417;ENST00000444166	T|.	0.07567|.	3.18|.	5.55|5.55	5.55|5.55	0.83447|0.83447	COMM domain (1);|.	0.053583|.	0.85682|.	D|.	0.000000|.	T|T	0.60261|0.60261	0.2255|0.2255	L|L	0.41356|0.41356	1.27|1.27	0.80722|0.80722	D|D	1|1	P|.	0.42296|.	0.775|.	B|.	0.43658|.	0.426|.	T|T	0.54397|0.54397	-0.8300|-0.8300	10|5	0.24483|.	T|.	0.36|.	.|.	15.3677|15.3677	0.74535|0.74535	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	179|.	Q8N668|.	COMD1_HUMAN|.	Q|T	179|26;26;20	ENSP00000308236:E179Q|.	ENSP00000308236:E179Q|.	E|R	+|+	1|2	0|0	COMMD1|COMMD1	62216542|62216542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	4.556000|4.556000	0.60775|0.60775	2.776000|2.776000	0.95493|0.95493	0.579000|0.579000	0.79373|0.79373	GAA|AGA	COMMD1	-	pfam_HCaRG	ENSG00000173163		0.413	COMMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMMD1	HGNC	protein_coding	OTTHUMT00000251607.2	-	0.00	79	0	G	NM_152516		62363038	+1	tier1	-	no_errors	ENST00000311832	ensembl	human	known	74_37	missense	59.26	44	64	SNP	1.000	C
CPXCR1	53336	genome.wustl.edu	37	X	88008707	88008707	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:88008707A>G	ENST00000276127.4	+	3	551	c.292A>G	c.(292-294)Aga>Gga	p.R98G	CPXCR1_ENST00000373111.1_Missense_Mutation_p.R98G	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	98							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CCCCATTCCCAGAAAATTGGT	0.413																																																	0													36.0	33.0	34.0					X																	88008707		2203	4300	6503	SO:0001583	missense	0			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.292A>G	X.37:g.88008707A>G	ENSP00000276127:p.Arg98Gly		B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.R98G	ENST00000276127.4	37	c.292	CCDS14458.1	X	.	.	.	.	.	.	.	.	.	.	A	11.21	1.570516	0.28003	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.27720	1.65;1.65	3.33	3.33	0.38152	.	0.372131	0.19683	N	0.108473	T	0.32823	0.0842	L	0.27053	0.805	0.09310	N	1	D	0.65815	0.995	P	0.61003	0.882	T	0.04242	-1.0966	9	.	.	.	-3.7593	7.3927	0.26919	1.0:0.0:0.0:0.0	.	98	Q8N123	CPXCR_HUMAN	G	98	ENSP00000276127:R98G;ENSP00000362203:R98G	.	R	+	1	2	CPXCR1	87895363	0.849000	0.29639	0.289000	0.24876	0.096000	0.18686	0.807000	0.27140	1.556000	0.49512	0.481000	0.45027	AGA	CPXCR1	-	NULL	ENSG00000147183		0.413	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXCR1	HGNC	protein_coding	OTTHUMT00000057418.1	-	0.00	19	0	A	NM_033048		88008707	+1	tier1	-	no_errors	ENST00000276127	ensembl	human	known	74_37	missense	95.65	1	22	SNP	0.302	G
CROCCP2	84809	genome.wustl.edu	37	1	16945480	16945480	+	lincRNA	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:16945480C>A	ENST00000412962.1	-	0	2039				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CTGCTCCTGCCGGCTCTGGGC	0.632																																																	0																																												0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945480C>A			Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.632	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	-	0.00	140	0	C	NR_026752.1		16945480	-1	tier1	-	no_errors	ENST00000412962	ensembl	human	known	74_37	rna	13.38	136	21	SNP	1.000	A
CR2	1380	genome.wustl.edu	37	1	207641998	207641998	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:207641998G>T	ENST00000367058.3	+	3	761	c.572G>T	c.(571-573)gGa>gTa	p.G191V	CR2_ENST00000367057.3_Missense_Mutation_p.G191V|CR2_ENST00000485707.1_3'UTR|CR2_ENST00000458541.2_Missense_Mutation_p.G191V|CR2_ENST00000367059.3_Missense_Mutation_p.G191V	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	191	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						TTGCTTGTTGGAGAAAAGATC	0.428																																																	0													285.0	264.0	271.0					1																	207641998		2203	4300	6503	SO:0001583	missense	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.572G>T	1.37:g.207641998G>T	ENSP00000356025:p.Gly191Val		C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G191V	ENST00000367058.3	37	c.572	CCDS1478.1	1	.	.	.	.	.	.	.	.	.	.	G	17.84	3.487408	0.63962	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.82	5.82	0.92795	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	D	0.91489	0.7313	H	0.99675	4.695	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.998	D	0.94307	0.7542	9	0.56958	D	0.05	.	15.6087	0.76696	0.0:0.0:1.0:0.0	.	191;191;191	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	V	191	ENSP00000356025:G191V;ENSP00000356024:G191V;ENSP00000356026:G191V;ENSP00000404222:G191V	ENSP00000356024:G191V	G	+	2	0	CR2	205708621	0.999000	0.42202	0.187000	0.23214	0.676000	0.39594	4.927000	0.63440	2.756000	0.94617	0.563000	0.77884	GGA	CR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.428	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	-	0.00	72	0	G	NM_001877		207641998	+1	tier1	-	no_errors	ENST00000367057	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.592	T
CRX	1406	genome.wustl.edu	37	19	48342913	48342913	+	Missense_Mutation	SNP	C	C	A	rs61748454		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:48342913C>A	ENST00000221996.7	+	4	795	c.589C>A	c.(589-591)Ccg>Acg	p.P197T	TPRX2P_ENST00000535362.1_Intron|CRX_ENST00000539067.1_Missense_Mutation_p.P197T	NM_000554.4	NP_000545.1	O43186	CRX_HUMAN	cone-rod homeobox	197					circadian rhythm (GO:0007623)|organ morphogenesis (GO:0009887)|positive regulation of photoreceptor cell differentiation (GO:0046534)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|leucine zipper domain binding (GO:0043522)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|urinary_tract(1)	23		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		GACCTACGCCCCGGCCTCCGC	0.667																																					Pancreas(57;461 1196 22201 40716 47188)												0													59.0	61.0	60.0					19																	48342913		2203	4300	6503	SO:0001583	missense	0			AF024711	CCDS12706.1	19q13.3	2013-01-08				ENSG00000105392		"""Homeoboxes / PRD class"""	2383	protein-coding gene	gene with protein product	"""orthodenticle homeobox 3"""	602225		CORD2		9390563, 9537410	Standard	NM_000554		Approved	CRD, LCA7, OTX3	uc002phq.4	O43186		ENST00000221996.7:c.589C>A	19.37:g.48342913C>A	ENSP00000221996:p.Pro197Thr		Q0QD45	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Otx_TF_C,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P197T	ENST00000221996.7	37	c.589	CCDS12706.1	19	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399426	0.25291	.	.	ENSG00000105392	ENST00000221996;ENST00000539067	D;D	0.85629	-2.01;-2.01	4.36	3.29	0.37713	Transcription factor Otx, C-terminal (1);	0.070717	0.56097	D	0.000024	T	0.75199	0.3817	L	0.36672	1.1	0.35619	D	0.809279	P	0.37914	0.611	B	0.34652	0.187	T	0.73898	-0.3837	10	0.15952	T	0.53	-7.6331	11.8461	0.52385	0.0:0.8214:0.1785:0.0	.	197	O43186	CRX_HUMAN	T	197	ENSP00000221996:P197T;ENSP00000445565:P197T	ENSP00000221996:P197T	P	+	1	0	CRX	53034725	1.000000	0.71417	0.939000	0.37840	0.317000	0.28152	4.433000	0.59929	0.781000	0.33589	0.467000	0.42956	CCG	CRX	-	pfam_Otx_TF_C	ENSG00000105392		0.667	CRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRX	HGNC	protein_coding	OTTHUMT00000409812.4	-	0.00	43	0	C	NM_000554		48342913	+1	tier1	-	no_errors	ENST00000221996	ensembl	human	known	74_37	missense	70.00	6	14	SNP	1.000	A
CSF3R	1441	genome.wustl.edu	37	1	36937913	36937913	+	Missense_Mutation	SNP	C	C	G	rs148747030		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:36937913C>G	ENST00000373106.1	-	8	1470	c.923G>C	c.(922-924)cGc>cCc	p.R308P	CSF3R_ENST00000418048.2_Missense_Mutation_p.R308P|CSF3R_ENST00000373104.1_Missense_Mutation_p.R308P|CSF3R_ENST00000487540.2_5'UTR|CSF3R_ENST00000361632.4_Missense_Mutation_p.R308P|CSF3R_ENST00000440588.2_Missense_Mutation_p.R308P|CSF3R_ENST00000331941.5_Missense_Mutation_p.R308P|CSF3R_ENST00000373103.1_Missense_Mutation_p.R308P|CSF3R_ENST00000338937.5_Missense_Mutation_p.R308P	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	308	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GCGGATGCAGCGTATCTGCAG	0.667																																																	0													47.0	55.0	52.0					1																	36937913		2203	4300	6503	SO:0001583	missense	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.923G>C	1.37:g.36937913C>G	ENSP00000362198:p.Arg308Pro			Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R308P	ENST00000373106.1	37	c.923	CCDS413.1	1	.	.	.	.	.	.	.	.	.	.	C	16.65	3.183077	0.57800	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.60797	0.16;0.16;0.16;0.16;0.16;0.16;0.16;0.16	4.88	3.96	0.45880	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75510	0.3859	M	0.81341	2.54	0.47065	D	0.999304	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.992;0.997;0.992;0.999	T	0.79205	-0.1899	10	0.87932	D	0	-27.3117	12.7007	0.57032	0.0:0.682:0.318:0.0	.	308;308;308;308	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	P	308	ENSP00000362198:R308P;ENSP00000362196:R308P;ENSP00000362195:R308P;ENSP00000355406:R308P;ENSP00000332180:R308P;ENSP00000401588:R308P;ENSP00000345013:R308P;ENSP00000397568:R308P	ENSP00000332180:R308P	R	-	2	0	CSF3R	36710500	0.995000	0.38212	1.000000	0.80357	0.702000	0.40608	3.029000	0.49712	1.260000	0.44134	-0.175000	0.13238	CGC	CSF3R	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000119535		0.667	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2	-	0.00	78	0	C	NM_156039		36937913	-1	tier1	-	no_errors	ENST00000373103	ensembl	human	known	74_37	missense	47.44	41	37	SNP	0.998	G
CSMD3	114788	genome.wustl.edu	37	8	113569036	113569036	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:113569036G>A	ENST00000297405.5	-	25	4434	c.4190C>T	c.(4189-4191)aCa>aTa	p.T1397I	CSMD3_ENST00000455883.2_Missense_Mutation_p.T1293I|CSMD3_ENST00000352409.3_Missense_Mutation_p.T1397I|CSMD3_ENST00000343508.3_Missense_Mutation_p.T1357I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1397	Sushi 7. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCTCTCCCCTGTCATGCACTT	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													111.0	100.0	104.0					8																	113569036		2203	4299	6502	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4190C>T	8.37:g.113569036G>A	ENSP00000297405:p.Thr1397Ile		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T1397I	ENST00000297405.5	37	c.4190	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159757	0.57368	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.11	5.11	0.69529	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.67795	0.2931	L	0.31926	0.97	0.33230	D	0.555766	D;D;P	0.55605	0.966;0.972;0.57	P;P;B	0.60609	0.805;0.877;0.312	T	0.69128	-0.5227	10	0.25106	T	0.35	.	18.7287	0.91726	0.0:0.0:1.0:0.0	.	1293;1397;1357	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	1357;1397;737;1293;1397	ENSP00000345799:T1357I;ENSP00000297405:T1397I;ENSP00000341558:T737I;ENSP00000412263:T1293I;ENSP00000343124:T1397I	ENSP00000297405:T1397I	T	-	2	0	CSMD3	113638212	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	4.508000	0.60441	2.660000	0.90430	0.655000	0.94253	ACA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.438	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	46	0	G	NM_052900		113569036	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	46.15	35	30	SNP	1.000	A
CUX2	23316	genome.wustl.edu	37	12	111749974	111749974	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:111749974G>T	ENST00000261726.6	+	16	2125	c.1971G>T	c.(1969-1971)caG>caT	p.Q657H		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	657					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						TTCTAGAGCAGGCCAAGAAGG	0.627																																																	0													71.0	78.0	76.0					12																	111749974		2045	4188	6233	SO:0001583	missense	0			AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.1971G>T	12.37:g.111749974G>T	ENSP00000261726:p.Gln657His		A7E2Y4	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_Prefoldin,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.Q657H	ENST00000261726.6	37	c.1971	CCDS41837.1	12	.	.	.	.	.	.	.	.	.	.	g	9.168	1.020519	0.19433	.	.	ENSG00000111249	ENST00000261726	T	0.56444	0.46	4.58	1.21	0.21127	.	0.058515	0.64402	D	0.000001	T	0.67896	0.2942	M	0.79926	2.475	0.42515	D	0.992984	D	0.89917	1.0	D	0.83275	0.996	T	0.67110	-0.5753	10	0.66056	D	0.02	-17.3279	7.3045	0.26440	0.5421:0.0:0.4579:0.0	.	657	O14529	CUX2_HUMAN	H	657	ENSP00000261726:Q657H	ENSP00000261726:Q657H	Q	+	3	2	CUX2	110234357	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	1.716000	0.37981	0.390000	0.25115	-0.768000	0.03414	CAG	CUX2	-	NULL	ENSG00000111249		0.627	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUX2	HGNC	protein_coding	OTTHUMT00000404765.1	-	0.00	8	0	G	NM_015267		111749974	+1	tier1	-	no_errors	ENST00000261726	ensembl	human	known	74_37	missense	55.56	8	10	SNP	1.000	T
CXADRP3	440224	genome.wustl.edu	37	18	14478919	14478919	+	lincRNA	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr18:14478919G>T	ENST00000581457.1	-	0	989					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		ACTGATCTGTGCCAATATCTG	0.373																																																	0																																												0					18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478919G>T				RNA	SNP	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			CXADRP3	-	-	ENSG00000265766		0.373	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	HGNC	lincRNA	OTTHUMT00000443008.1	-	0.00	25	0	G	NR_024076		14478919	-1	tier1	-	no_errors	ENST00000581457	ensembl	human	known	74_37	rna	47.06	27	24	SNP	1.000	T
CYP2A13	1553	genome.wustl.edu	37	19	41601712	41601712	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:41601712C>G	ENST00000330436.3	+	9	1351	c.1351C>G	c.(1351-1353)Ctc>Gtc	p.L451V		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	451					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GGAGCTCTTTCTCTTCTTCAC	0.557																																																	0													182.0	167.0	172.0					19																	41601712		2203	4300	6503	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1351C>G	19.37:g.41601712C>G	ENSP00000332679:p.Leu451Val		Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.L451V	ENST00000330436.3	37	c.1351	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	14.93	2.681182	0.47886	.	.	ENSG00000197838	ENST00000330436	T	0.70986	-0.53	4.18	4.18	0.49190	.	0.248638	0.33235	N	0.005130	T	0.72914	0.3520	M	0.76328	2.33	0.34103	D	0.662148	B	0.22746	0.074	B	0.36134	0.218	T	0.80269	-0.1453	10	0.87932	D	0	.	9.9954	0.41896	0.0:0.9002:0.0:0.0998	.	451	Q16696	CP2AD_HUMAN	V	451	ENSP00000332679:L451V	ENSP00000332679:L451V	L	+	1	0	CYP2A13	46293552	0.001000	0.12720	0.987000	0.45799	0.952000	0.60782	-0.048000	0.11944	2.225000	0.72522	0.568000	0.79292	CTC	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000197838		0.557	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	-	0.00	91	0	C	NM_000766		41601712	+1	tier1	-	no_errors	ENST00000330436	ensembl	human	known	74_37	missense	6.67	112	8	SNP	1.000	G
DACH1	1602	genome.wustl.edu	37	13	72131182	72131182	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:72131182T>A	ENST00000359684.2	-	7	1705	c.1706A>T	c.(1705-1707)gAg>gTg	p.E569V	DACH1_ENST00000354591.4_Intron|DACH1_ENST00000313174.7_Intron|DACH1_ENST00000305425.4_Missense_Mutation_p.E517V			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	569					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		CCTTTTTGACTCATGTCCCAT	0.388																																																	0													164.0	148.0	153.0					13																	72131182		1881	4110	5991	SO:0001583	missense	0			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.1706A>T	13.37:g.72131182T>A	ENSP00000352712:p.Glu569Val		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.E569V	ENST00000359684.2	37	c.1706		13	.	.	.	.	.	.	.	.	.	.	T	20.3	3.964306	0.74131	.	.	ENSG00000165659	ENST00000305425;ENST00000359684;ENST00000377826	T;T	0.34859	1.39;1.34	5.77	5.77	0.91146	.	0.468385	0.25875	N	0.027734	T	0.36524	0.0970	L	0.44542	1.39	0.80722	D	1	P	0.37276	0.589	B	0.39027	0.288	T	0.13845	-1.0494	10	0.48119	T	0.1	-0.6427	16.3818	0.83467	0.0:0.0:0.0:1.0	.	515	Q9UI36-2	.	V	517;569;569	ENSP00000304994:E517V;ENSP00000352712:E569V	ENSP00000304994:E517V	E	-	2	0	DACH1	71029183	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.655000	0.83696	2.330000	0.79161	0.528000	0.53228	GAG	DACH1	-	NULL	ENSG00000165659		0.388	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	DACH1	HGNC	protein_coding	OTTHUMT00000045240.1	-	0.00	30	0	T	NM_004392		72131182	-1	tier1	-	no_errors	ENST00000359684	ensembl	human	known	74_37	missense	90.91	2	20	SNP	1.000	A
DAPK1	1612	genome.wustl.edu	37	9	90296515	90296515	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:90296515C>A	ENST00000408954.3	+	20	2533	c.2198C>A	c.(2197-2199)cCt>cAt	p.P733H	DAPK1_ENST00000358077.5_Missense_Mutation_p.P733H|DAPK1_ENST00000491893.1_Missense_Mutation_p.P733H|DAPK1_ENST00000472284.1_Missense_Mutation_p.P733H|DAPK1_ENST00000469640.2_Missense_Mutation_p.P733H	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	733					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						AGGTTCCCACCTTCACCCCTG	0.567									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													35.0	37.0	36.0					9																	90296515		1923	4110	6033	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2198C>A	9.37:g.90296515C>A	ENSP00000386135:p.Pro733His		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.P733H	ENST00000408954.3	37	c.2198	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773626	0.31411	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.15	5.17	5.17	0.71159	.	0.125129	0.34959	N	0.003544	T	0.66733	0.2819	N	0.22421	0.69	0.29301	N	0.868695	B;D;B	0.54601	0.38;0.967;0.38	B;P;B	0.53593	0.259;0.73;0.259	T	0.66368	-0.5941	10	0.62326	D	0.03	.	18.529	0.90984	0.0:1.0:0.0:0.0	.	733;287;733	B7ZLE7;P53355-2;P53355	.;.;DAPK1_HUMAN	H	733	ENSP00000350785:P733H;ENSP00000417076:P733H;ENSP00000418885:P733H;ENSP00000386135:P733H;ENSP00000419026:P733H	ENSP00000350785:P733H	P	+	2	0	DAPK1	89486335	0.959000	0.32827	0.071000	0.20095	0.217000	0.24651	3.918000	0.56432	2.712000	0.92718	0.556000	0.70494	CCT	DAPK1	-	superfamily_P-loop_NTPase	ENSG00000196730		0.567	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	-	0.00	46	0	C	NM_004938		90296515	+1	tier1	-	no_errors	ENST00000469640	ensembl	human	known	74_37	missense	57.14	9	12	SNP	0.521	A
DAPK1	1612	genome.wustl.edu	37	9	90321949	90321949	+	Frame_Shift_Del	DEL	C	C	-			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:90321949delC	ENST00000408954.3	+	26	4298	c.3963delC	c.(3961-3963)gacfs	p.D1321fs	DAPK1_ENST00000358077.5_Frame_Shift_Del_p.D1321fs|DAPK1_ENST00000491893.1_Frame_Shift_Del_p.D1255fs|DAPK1_ENST00000472284.1_Frame_Shift_Del_p.D1321fs|DAPK1_ENST00000469640.2_Frame_Shift_Del_p.D1346fs	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1321	Death. {ECO:0000255|PROSITE- ProRule:PRU00064}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						ACCCGCCCGACCCCCTGGGGA	0.602									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													59.0	67.0	64.0					9																	90321949		2032	4170	6202	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3963delC	9.37:g.90321949delC	ENSP00000386135:p.Asp1321fs		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.L1348fs	ENST00000408954.3	37	c.4038	CCDS43842.1	9																																																																																			DAPK1	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	ENSG00000196730		0.602	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1		0.00	46	0	C	NM_004938		90321949	+1	tier1		no_errors	ENST00000469640	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	0.981	-
DARS2	55157	genome.wustl.edu	37	1	173808541	173808541	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:173808541A>G	ENST00000361951.4	+	10	1604	c.877A>G	c.(877-879)Atc>Gtc	p.I293V	DARS2_ENST00000239457.5_5'UTR	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	293					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	CCAGACTGGGATCCAGAGTTT	0.388																																																	0													137.0	127.0	130.0					1																	173808541		2203	4300	6503	SO:0001583	missense	0			AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.877A>G	1.37:g.173808541A>G	ENSP00000355086:p.Ile293Val			Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_GAD_dom,pfam_NA-bd_OB_tRNA,superfamily_GAD_dom,superfamily_NA-bd_OB-fold,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,prints_Lys-tRNA-synth_II_C,tigrfam_Asp-tRNA-ligase_IIb_bac/mt	p.I293V	ENST00000361951.4	37	c.877	CCDS1311.1	1	.	.	.	.	.	.	.	.	.	.	A	9.715	1.158147	0.21454	.	.	ENSG00000117593	ENST00000361951	T	0.78126	-1.15	5.44	3.13	0.36017	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (D/K/N) (1);	0.048589	0.85682	D	0.000000	T	0.41926	0.1180	N	0.17764	0.52	0.80722	D	1	B	0.09022	0.002	B	0.13407	0.009	T	0.20371	-1.0277	10	0.21014	T	0.42	-11.3271	8.9809	0.35964	0.8464:0.0:0.1536:0.0	.	293	Q6PI48	SYDM_HUMAN	V	293	ENSP00000355086:I293V	ENSP00000355086:I293V	I	+	1	0	DARS2	172075164	1.000000	0.71417	0.855000	0.33649	0.537000	0.34900	5.059000	0.64306	0.383000	0.24910	-0.353000	0.07706	ATC	DARS2	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Asp-tRNA-ligase_IIb_bac/mt	ENSG00000117593		0.388	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARS2	HGNC	protein_coding	OTTHUMT00000084220.1	-	0.00	52	0	A	NM_018122		173808541	+1	tier1	-	no_errors	ENST00000361951	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.996	G
DCAF12L2	340578	genome.wustl.edu	37	X	125299265	125299265	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:125299265C>A	ENST00000360028.2	-	1	669	c.643G>T	c.(643-645)Ggc>Tgc	p.G215C	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.G215C			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	215										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GCCACGGTGCCGTCGCGGGAG	0.642																																																	0													38.0	41.0	40.0					X																	125299265		2203	4298	6501	SO:0001583	missense	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.643G>T	X.37:g.125299265C>A	ENSP00000353128:p.Gly215Cys		B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G215C	ENST00000360028.2	37	c.643	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379966	0.42207	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.64991	-0.13;-0.13	4.53	4.53	0.55603	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.34046	N	0.004318	T	0.76572	0.4006	M	0.76574	2.34	0.46654	D	0.999141	D	0.89917	1.0	D	0.97110	1.0	T	0.77091	-0.2716	10	0.44086	T	0.13	.	12.1893	0.54261	0.0:1.0:0.0:0.0	.	215	Q5VW00	DC122_HUMAN	C	215	ENSP00000441489:G215C;ENSP00000353128:G215C	ENSP00000353128:G215C	G	-	1	0	DCAF12L2	125126946	1.000000	0.71417	0.064000	0.19789	0.002000	0.02628	6.859000	0.75467	2.167000	0.68274	0.544000	0.68410	GGC	DCAF12L2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000198354		0.642	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	-	0.00	67	0	C	NM_001013628		125299265	-1	tier1	-	no_errors	ENST00000360028	ensembl	human	known	74_37	missense	90.70	4	39	SNP	0.961	A
DCDC1	341019	genome.wustl.edu	37	11	30946948	30946948	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:30946948C>A	ENST00000597505.1	-	21	2904	c.2905G>T	c.(2905-2907)Gag>Tag	p.E969*	DCDC1_ENST00000339794.5_Nonsense_Mutation_p.E48*|DCDC1_ENST00000406071.2_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	204					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TTTAAAATCTCAGTGCACCTG	0.378																																																	0													101.0	106.0	104.0					11																	30946948		2202	4299	6501	SO:0001587	stop_gained	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2905G>T	11.37:g.30946948C>A	ENSP00000472625:p.Glu969*		A6PVL6|B7WNX6|Q6ZU04	Nonsense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.E48*	ENST00000597505.1	37	c.142		11	.	.	.	.	.	.	.	.	.	.	C	36	5.656422	0.96724	.	.	ENSG00000170959	ENST00000339794	.	.	.	5.27	3.33	0.38152	.	0.769546	0.11790	N	0.529301	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-5.0639	7.1767	0.25749	0.1674:0.7437:0.0:0.0889	.	.	.	.	X	48	.	ENSP00000341700:E48X	E	-	1	0	DCDC5	30903524	0.241000	0.23857	0.647000	0.29507	0.925000	0.55904	0.412000	0.21131	0.670000	0.31165	0.655000	0.94253	GAG	DCDC1	-	pfscan_Doublecortin_dom	ENSG00000170959		0.378	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	35	0	C	NM_181807		30946948	-1	tier1	-	no_errors	ENST00000339794	ensembl	human	known	74_37	nonsense	68.00	8	17	SNP	0.831	A
DEFB136	613210	genome.wustl.edu	37	8	11831522	11831522	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:11831522C>A	ENST00000382209.2	-	2	160	c.161G>T	c.(160-162)tGc>tTc	p.C54F		NM_001033018.2	NP_001028190.2	Q30KP8	DB136_HUMAN	defensin, beta 136	54					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|large_intestine(1)|lung(4)	7			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.163)		AATATTGTGGCAGAACGCAAT	0.458																																																	0													204.0	204.0	204.0					8																	11831522		1977	4157	6134	SO:0001583	missense	0			DQ012026	CCDS43709.1	8p23.1	2011-07-19			ENSG00000205884	ENSG00000205884		"""Defensins, beta"""	34433	protein-coding gene	gene with protein product						16033865	Standard	NM_001033018		Approved	DEFB137	uc011kxm.2	Q30KP8	OTTHUMG00000158720	ENST00000382209.2:c.161G>T	8.37:g.11831522C>A	ENSP00000371644:p.Cys54Phe		Q4QY36	Missense_Mutation	SNP	NULL	p.C54F	ENST00000382209.2	37	c.161	CCDS43709.1	8	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893492	0.52121	.	.	ENSG00000205884	ENST00000382209	T	0.54675	0.56	4.06	4.06	0.47325	.	0.000000	0.53938	D	0.000044	T	0.69869	0.3159	.	.	.	0.35915	D	0.831351	D	0.89917	1.0	D	0.91635	0.999	T	0.78214	-0.2291	9	0.87932	D	0	1.9829	12.039	0.53442	0.0:1.0:0.0:0.0	.	54	Q30KP8	DB136_HUMAN	F	54	ENSP00000371644:C54F	ENSP00000371644:C54F	C	-	2	0	DEFB136	11868931	0.998000	0.40836	0.469000	0.27204	0.030000	0.12068	1.198000	0.32223	2.551000	0.86045	0.555000	0.69702	TGC	DEFB136	-	NULL	ENSG00000205884		0.458	DEFB136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB136	HGNC	protein_coding	OTTHUMT00000351889.1	-	0.00	32	0	C	NM_001033018		11831522	-1	tier1	-	no_errors	ENST00000382209	ensembl	human	known	74_37	missense	82.61	4	19	SNP	0.557	A
DGKI	9162	genome.wustl.edu	37	7	137172381	137172381	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:137172381C>G	ENST00000288490.5	-	23	2357	c.2357G>C	c.(2356-2358)cGt>cCt	p.R786P	DGKI_ENST00000453654.2_Missense_Mutation_p.R486P|DGKI_ENST00000446122.1_Missense_Mutation_p.R768P|DGKI_ENST00000424189.2_Missense_Mutation_p.R789P	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	786					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TATGTACATACGGCAAGTCTC	0.363																																																	0													151.0	157.0	155.0					7																	137172381		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2357G>C	7.37:g.137172381C>G	ENSP00000288490:p.Arg786Pro		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R786P	ENST00000288490.5	37	c.2357	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	25.0	4.590874	0.86851	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.44083	1.48;0.93;0.97	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.68063	0.2960	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69895	-0.5021	10	0.87932	D	0	.	19.0482	0.93030	0.0:1.0:0.0:0.0	.	486;786	E9PFX6;O75912	.;DGKI_HUMAN	P	486;734;789;786;768	ENSP00000392161:R486P;ENSP00000288490:R786P;ENSP00000399131:R768P	ENSP00000288490:R786P	R	-	2	0	DGKI	136822921	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.102000	0.64572	2.808000	0.96608	0.650000	0.86243	CGT	DGKI	-	NULL	ENSG00000157680		0.363	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	17	0	C	NM_004717		137172381	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	39.13	14	9	SNP	1.000	G
DGKI	9162	genome.wustl.edu	37	7	137284581	137284581	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:137284581C>A	ENST00000288490.5	-	11	1238	c.1238G>T	c.(1237-1239)gGg>gTg	p.G413V	DGKI_ENST00000453654.2_Missense_Mutation_p.G113V|DGKI_ENST00000446122.1_Missense_Mutation_p.G413V|DGKI_ENST00000424189.2_Missense_Mutation_p.G413V	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	413	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ATCTTTTGGCCCTTCCTGAGA	0.388																																																	0													115.0	109.0	111.0					7																	137284581		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1238G>T	7.37:g.137284581C>A	ENSP00000288490:p.Gly413Val		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G413V	ENST00000288490.5	37	c.1238	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633918	0.87660	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.26957	1.7;1.7;1.7	5.83	5.83	0.93111	Diacylglycerol kinase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.63070	0.2480	M	0.91663	3.23	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.70321	-0.4904	10	0.87932	D	0	.	20.1162	0.97934	0.0:1.0:0.0:0.0	.	113;413	E9PFX6;O75912	.;DGKI_HUMAN	V	113;361;413;413;413	ENSP00000392161:G113V;ENSP00000288490:G413V;ENSP00000399131:G413V	ENSP00000288490:G413V	G	-	2	0	DGKI	136935121	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.085000	0.76875	2.757000	0.94681	0.563000	0.77884	GGG	DGKI	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000157680		0.388	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	16	0	C	NM_004717		137284581	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	63.64	8	14	SNP	1.000	A
DHPS	1725	genome.wustl.edu	37	19	12792434	12792434	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:12792434G>T	ENST00000210060.7	-	1	282	c.147C>A	c.(145-147)ttC>ttA	p.F49L	DHPS_ENST00000351660.5_Missense_Mutation_p.F49L|DHPS_ENST00000594424.1_5'Flank|CTD-2192J16.26_ENST00000593554.1_lincRNA|DHPS_ENST00000599481.1_5'Flank	NM_001930.3	NP_001921.1	P49366	DHYS_HUMAN	deoxyhypusine synthase	49					cellular protein metabolic process (GO:0044267)|deoxyhypusine biosynthetic process from spermidine (GO:0050983)|glucose homeostasis (GO:0042593)|peptidyl-lysine modification to peptidyl-hypusine (GO:0008612)|positive regulation of cell proliferation (GO:0008284)|positive regulation of T cell proliferation (GO:0042102)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|translation (GO:0006412)	cytosol (GO:0005829)	deoxyhypusine synthase activity (GO:0034038)			central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)	8						CGGTGGTGCCGAAGGCCTCCA	0.632																																																	0													59.0	60.0	60.0					19																	12792434		2203	4300	6503	SO:0001583	missense	0			U79262	CCDS12276.1, CCDS12277.1, CCDS59354.1	19p13.2	2011-11-24			ENSG00000095059	ENSG00000095059			2869	protein-coding gene	gene with protein product	"""migration-inducing gene 13"""	600944				7673224	Standard	NM_001930		Approved	MIG13	uc002muh.2	P49366		ENST00000210060.7:c.147C>A	19.37:g.12792434G>T	ENSP00000210060:p.Phe49Leu		A8K688|M0R1I5|Q13184|Q13276|Q9UDG0	Missense_Mutation	SNP	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	p.F49L	ENST00000210060.7	37	c.147	CCDS12276.1	19	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223570	0.39300	.	.	ENSG00000095059	ENST00000210060;ENST00000351660	T;T	0.42900	0.96;0.96	5.53	3.38	0.38709	.	0.343803	0.32015	N	0.006708	T	0.28863	0.0716	L	0.33339	1.005	0.38094	D	0.937041	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.18871	0.023;0.002;0.002	T	0.10359	-1.0633	10	0.19590	T	0.45	-11.7203	9.2865	0.37760	0.0813:0.1556:0.7631:0.0	.	49;49;49	Q5J8M5;P49366-2;P49366	.;.;DHYS_HUMAN	L	49	ENSP00000210060:F49L;ENSP00000221303:F49L	ENSP00000210060:F49L	F	-	3	2	DHPS	12653434	0.995000	0.38212	0.598000	0.28837	0.266000	0.26442	2.501000	0.45389	0.691000	0.31592	0.313000	0.20887	TTC	DHPS	-	pfam_Deoxyhypusine_synthase,tigrfam_Deoxyhypusine_synthase	ENSG00000095059		0.632	DHPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHPS	HGNC	protein_coding	OTTHUMT00000462708.1	-	0.00	49	0	G	NM_001930		12792434	-1	tier1	-	no_errors	ENST00000210060	ensembl	human	known	74_37	missense	46.30	29	25	SNP	0.838	T
DHX34	9704	genome.wustl.edu	37	19	47870310	47870310	+	Missense_Mutation	SNP	A	A	G	rs200731942		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:47870310A>G	ENST00000328771.4	+	7	2015	c.1666A>G	c.(1666-1668)Acc>Gcc	p.T556A	DHX34_ENST00000471451.1_3'UTR	NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	556					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.T556A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CAGCCTGGAAACCGCCATCCT	0.612																																																	1	Substitution - Missense(1)	skin(1)											36.0	38.0	37.0					19																	47870310		2203	4287	6490	SO:0001583	missense	0			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1666A>G	19.37:g.47870310A>G	ENSP00000331907:p.Thr556Ala		B4DMY8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T556A	ENST00000328771.4	37	c.1666	CCDS12700.1	19	.	.	.	.	.	.	.	.	.	.	A	8.527	0.870215	0.17322	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.02472	4.28	5.46	5.46	0.80206	Helicase-associated domain (1);	0.000000	0.64402	D	0.000005	T	0.03651	0.0104	L	0.31926	0.97	0.58432	D	0.999997	B	0.33171	0.4	B	0.33196	0.159	T	0.53872	-0.8377	10	0.49607	T	0.09	-21.9691	14.4994	0.67711	1.0:0.0:0.0:0.0	.	556	Q14147	DHX34_HUMAN	A	556;471	ENSP00000331907:T556A	ENSP00000257252:T471A	T	+	1	0	DHX34	52562145	1.000000	0.71417	0.392000	0.26245	0.658000	0.38924	5.824000	0.69279	2.066000	0.61787	0.459000	0.35465	ACC	DHX34	-	superfamily_P-loop_NTPase,smart_Helicase-assoc_dom	ENSG00000134815		0.612	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX34	HGNC	protein_coding	OTTHUMT00000314313.3		0.00	34	0	A	NM_014681		47870310	+1			no_errors	ENST00000328771	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	G
DMD	1756	genome.wustl.edu	37	X	32490336	32490336	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:32490336G>T	ENST00000357033.4	-	22	3100	c.2894C>A	c.(2893-2895)cCt>cAt	p.P965H	DMD_ENST00000378677.2_Missense_Mutation_p.P961H	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	965					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACTAAGTTGAGGTATGGAGAG	0.433																																																	0													180.0	153.0	162.0					X																	32490336		2202	4300	6502	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.2894C>A	X.37:g.32490336G>T	ENSP00000354923:p.Pro965His		E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.P965H	ENST00000357033.4	37	c.2894	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334567	0.60853	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.50548	0.74;0.74	5.2	5.2	0.72013	.	0.000000	0.34879	U	0.003609	T	0.58032	0.2094	L	0.36672	1.1	0.80722	D	1	D;P;D	0.89917	1.0;0.931;1.0	D;P;D	0.91635	0.999;0.814;0.999	T	0.50906	-0.8772	10	0.14252	T	0.57	.	17.9222	0.88970	0.0:0.0:1.0:0.0	.	957;965;961	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	H	957;961;965;965;842	ENSP00000367948:P961H;ENSP00000354923:P965H	ENSP00000354923:P965H	P	-	2	0	DMD	32400257	1.000000	0.71417	0.997000	0.53966	0.015000	0.08874	7.361000	0.79497	2.166000	0.68216	0.544000	0.68410	CCT	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.433	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	-	0.00	32	0	G	NM_004006		32490336	-1	tier1	-	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	86.49	5	32	SNP	1.000	T
DNAH12	201625	genome.wustl.edu	37	3	57431006	57431006	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:57431006G>A	ENST00000351747.2	-	28	4431	c.4251C>T	c.(4249-4251)ctC>ctT	p.L1417L		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	1417	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						ATTGCGATGAGAGCTGCTCTG	0.398																																																	0													59.0	51.0	54.0					3																	57431006		692	1591	2283	SO:0001819	synonymous_variant	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.4251C>T	3.37:g.57431006G>A			A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L1417	ENST00000351747.2	37	c.4251		3																																																																																			DNAH12	-	superfamily_P-loop_NTPase	ENSG00000174844		0.398	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		-	0.00	39	0	G	NM_178504		57431006	-1	tier1	-	no_errors	ENST00000351747	ensembl	human	known	74_37	silent	95.24	2	40	SNP	0.961	A
DNMBP	23268	genome.wustl.edu	37	10	101716195	101716195	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:101716195C>A	ENST00000324109.4	-	4	1127	c.1036G>T	c.(1036-1038)Gcc>Tcc	p.A346S	DNMBP_ENST00000342239.3_Missense_Mutation_p.A346S|DNMBP-AS1_ENST00000434409.1_RNA	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	346					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GGCTCCTCGGCCTCATGGTCA	0.498																																																	0													123.0	122.0	122.0					10																	101716195		2203	4300	6503	SO:0001583	missense	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.1036G>T	10.37:g.101716195C>A	ENSP00000315659:p.Ala346Ser		Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain,prints_p67phox,prints_Spectrin_alpha_SH3	p.A346S	ENST00000324109.4	37	c.1036	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	C	4.295	0.054034	0.08291	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.12361	2.74;2.69	5.82	1.25	0.21368	Src homology-3 domain (1);	0.733613	0.12162	N	0.493912	T	0.07458	0.0188	L	0.27053	0.805	0.09310	N	1	B	0.23937	0.094	B	0.19666	0.026	T	0.42882	-0.9425	10	0.14252	T	0.57	-0.136	3.9954	0.09556	0.0:0.4788:0.1716:0.3496	.	346	Q6XZF7	DNMBP_HUMAN	S	346	ENSP00000344914:A346S;ENSP00000315659:A346S	ENSP00000315659:A346S	A	-	1	0	DNMBP	101706185	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.003000	0.13083	0.188000	0.20168	-0.377000	0.06932	GCC	DNMBP	-	superfamily_SH3_domain	ENSG00000107554		0.498	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	-	0.00	23	0	C	NM_015221		101716195	-1	tier1	-	no_errors	ENST00000342239	ensembl	human	known	74_37	missense	100.00	0	10	SNP	0.000	A
STEAP2-AS1	100874100	genome.wustl.edu	37	7	89748926	89748926	+	RNA	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:89748926C>T	ENST00000478318.2	-	0	424				DPY19L2P4_ENST00000497063.1_RNA|RP5-1121E10.2_ENST00000471553.1_lincRNA					STEAP2 antisense RNA 1																		CGGTGCGGGCCTCCCCCTTCC	0.642																																																	0																																												0					7q21.13	2012-10-12	2012-08-15		ENSG00000227646	ENSG00000227646		"""Long non-coding RNAs"""	40820	non-coding RNA	RNA, long non-coding			"""STEAP2 antisense RNA 1 (non-protein coding)"""				Standard	NR_110029		Approved				OTTHUMG00000065036		7.37:g.89748926C>T				RNA	SNP	-	NULL	ENST00000478318.2	37	NULL		7																																																																																			DPY19L2P4	-	-	ENSG00000235436		0.642	STEAP2-AS1-002	KNOWN	basic	antisense	DPY19L2P4	HGNC	processed_transcript	OTTHUMT00000350909.2		0.00	16	0	C			89748926	+1			no_errors	ENST00000497063	ensembl	human	known	74_37	rna	6.45	115	8	SNP	0.123	T
DPP6	1804	genome.wustl.edu	37	7	154237656	154237656	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:154237656G>T	ENST00000377770.3	+	4	638	c.497G>T	c.(496-498)aGa>aTa	p.R166I	DPP6_ENST00000404039.1_Missense_Mutation_p.R102I|DPP6_ENST00000332007.3_Missense_Mutation_p.R104I|DPP6_ENST00000427557.1_Missense_Mutation_p.R104I|DPP6_ENST00000406326.1_Missense_Mutation_p.R166I|DPP6_ENST00000496611.1_3'UTR			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	166					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GGAACAGTGAGACTGTGGAAT	0.348																																					NSCLC(125;1384 1783 2490 7422 34254)												0													75.0	71.0	72.0					7																	154237656		1834	4089	5923	SO:0001583	missense	0			M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.497G>T	7.37:g.154237656G>T	ENSP00000367001:p.Arg166Ile			Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.R166I	ENST00000377770.3	37	c.497		7	.	.	.	.	.	.	.	.	.	.	G	1.096	-0.662492	0.03454	.	.	ENSG00000130226	ENST00000404039;ENST00000406326;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T;T	0.38887	1.11;1.11;1.11;1.11;1.11	5.2	4.04	0.47022	.	0.445445	0.27797	N	0.017816	T	0.19725	0.0474	.	.	.	0.36171	D	0.848759	B;B;B;B;B	0.13145	0.0;0.0;0.0;0.007;0.0	B;B;B;B;B	0.14023	0.0;0.0;0.0;0.01;0.0	T	0.18429	-1.0337	9	0.02654	T	1	-4.6552	10.4366	0.44439	0.0:0.0:0.1936:0.8064	.	104;104;166;166;102	E9PDL2;P42658-2;P42658;Q8IYG9;E9PF59	.;.;DPP6_HUMAN;.;.	I	102;166;166;104;104	ENSP00000385578:R102I;ENSP00000384393:R166I;ENSP00000367001:R166I;ENSP00000328226:R104I;ENSP00000397303:R104I	ENSP00000328226:R104I	R	+	2	0	DPP6	153868589	1.000000	0.71417	0.991000	0.47740	0.896000	0.52359	2.881000	0.48538	0.902000	0.36520	-0.309000	0.09137	AGA	DPP6	-	NULL	ENSG00000130226		0.348	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	HGNC	protein_coding	OTTHUMT00000322932.1	-	0.00	12	0	G	NM_130797		154237656	+1	tier1	-	no_errors	ENST00000377770	ensembl	human	known	74_37	missense	76.92	3	10	SNP	1.000	T
DVL3	1857	genome.wustl.edu	37	3	183882071	183882071	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:183882071G>A	ENST00000313143.3	+	3	496	c.248G>A	c.(247-249)gGc>gAc	p.G83D	EIF2B5_ENST00000444495.1_Intron|DVL3_ENST00000462665.1_3'UTR|DVL3_ENST00000431765.1_Missense_Mutation_p.G83D	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	83					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			TCAGCTGAGGGCTCACACCCA	0.582																																																	0													83.0	84.0	84.0					3																	183882071		2203	4300	6503	SO:0001583	missense	0			D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.248G>A	3.37:g.183882071G>A	ENSP00000316054:p.Gly83Asp		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled_fam,prints_Dishevelled_3	p.G83D	ENST00000313143.3	37	c.248	CCDS3253.1	3	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785493	0.70337	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765	T;T	0.04654	3.59;3.58	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00080	-1.2110	10	0.62326	D	0.03	-0.853	19.6224	0.95663	0.0:0.0:1.0:0.0	.	83;83	B4E3E5;Q92997	.;DVL3_HUMAN	D	83	ENSP00000316054:G83D;ENSP00000405885:G83D	ENSP00000316054:G83D	G	+	2	0	DVL3	185364765	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.773000	0.75006	2.630000	0.89119	0.655000	0.94253	GGC	DVL3	-	NULL	ENSG00000161202		0.582	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DVL3	HGNC	protein_coding	OTTHUMT00000346184.1	-	0.00	27	0	G	NM_004423		183882071	+1	tier1	-	no_errors	ENST00000313143	ensembl	human	known	74_37	missense	83.75	13	67	SNP	1.000	A
ELMOD1	55531	genome.wustl.edu	37	11	107518316	107518316	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:107518316G>T	ENST00000265840.7	+	7	808	c.543G>T	c.(541-543)ctG>ctT	p.L181L	ELMOD1_ENST00000443271.2_Silent_p.L181L|ELMOD1_ENST00000531234.1_Silent_p.L175L	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	181	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		TTCTGGGACTGTACAATTTGC	0.398																																																	0													108.0	105.0	106.0					11																	107518316		1890	4114	6004	SO:0001819	synonymous_variant	0			AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.543G>T	11.37:g.107518316G>T			B4E167|G5E9S5|Q9NPW3	Silent	SNP	pfam_Engulfment_cell_motility_ELMO	p.L181	ENST00000265840.7	37	c.543	CCDS44723.1	11																																																																																			ELMOD1	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000110675		0.398	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	ELMOD1	HGNC	protein_coding	OTTHUMT00000389406.1	-	0.00	49	0	G	NM_018712		107518316	+1	tier1	-	no_errors	ENST00000265840	ensembl	human	known	74_37	silent	49.32	37	36	SNP	0.997	T
EMR3	84658	genome.wustl.edu	37	19	14740853	14740853	+	Missense_Mutation	SNP	G	G	T	rs550899495		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:14740853G>T	ENST00000253673.5	-	14	1910	c.1810C>A	c.(1810-1812)Cag>Aag	p.Q604K	EMR3_ENST00000443157.2_Missense_Mutation_p.Q478K|EMR3_ENST00000599900.1_Missense_Mutation_p.Q389K|EMR3_ENST00000344373.4_Missense_Mutation_p.Q552K	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	604					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						GTGTTTACCTGCTGGCTGAGG	0.443																																																	0													84.0	76.0	79.0					19																	14740853		2203	4300	6503	SO:0001583	missense	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1810C>A	19.37:g.14740853G>T	ENSP00000253673:p.Gln604Lys			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.Q604K	ENST00000253673.5	37	c.1810	CCDS12315.1	19	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859610	0.51376	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.30182	1.54;1.54;1.54	3.76	3.76	0.43208	GPCR, family 2, secretin-like, conserved site (1);	.	.	.	.	T	0.35008	0.0917	N	0.25094	0.71	0.25854	N	0.98391	P;D;D	0.61080	0.855;0.966;0.989	B;P;P	0.58013	0.443;0.77;0.831	T	0.13202	-1.0518	9	0.34782	T	0.22	.	13.4681	0.61268	0.0:0.0:1.0:0.0	.	478;552;604	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	K	478;604;552	ENSP00000396208:Q478K;ENSP00000253673:Q604K;ENSP00000340758:Q552K	ENSP00000253673:Q604K	Q	-	1	0	EMR3	14601853	0.996000	0.38824	0.993000	0.49108	0.958000	0.62258	2.547000	0.45786	2.091000	0.63221	0.655000	0.94253	CAG	EMR3	-	NULL	ENSG00000131355		0.443	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1	-	0.00	24	0	G	NM_032571		14740853	-1	tier1	-	no_errors	ENST00000253673	ensembl	human	known	74_37	missense	55.17	13	16	SNP	0.993	T
ENPP7	339221	genome.wustl.edu	37	17	77707327	77707327	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:77707327G>C	ENST00000328313.5	+	2	496	c.275G>C	c.(274-276)gGg>gCg	p.G92A		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			GAGAACCACGGGGTGGTTCAC	0.632																																																	0													102.0	94.0	97.0					17																	77707327		2203	4300	6503	SO:0001583	missense	0			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.275G>C	17.37:g.77707327G>C	ENSP00000332656:p.Gly92Ala			Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,superfamily_Alkaline_phosphatase_core	p.G92A	ENST00000328313.5	37	c.275	CCDS11763.1	17	.	.	.	.	.	.	.	.	.	.	G	29.2	4.983097	0.93044	.	.	ENSG00000182156	ENST00000328313	D	0.92965	-3.14	4.76	4.76	0.60689	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.056836	0.64402	D	0.000001	D	0.97192	0.9082	H	0.94503	3.545	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.98583	1.0651	10	0.87932	D	0	-30.3278	17.7516	0.88436	0.0:0.0:1.0:0.0	.	92	Q6UWV6	ENPP7_HUMAN	A	92	ENSP00000332656:G92A	ENSP00000332656:G92A	G	+	2	0	ENPP7	75321922	1.000000	0.71417	0.916000	0.36221	0.971000	0.66376	9.552000	0.98115	2.183000	0.69458	0.491000	0.48974	GGG	ENPP7	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000182156		0.632	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ENPP7	HGNC	protein_coding	OTTHUMT00000437038.1	-	0.00	48	0	G	NM_178543		77707327	+1	tier1	-	no_errors	ENST00000328313	ensembl	human	known	74_37	missense	15.53	135	25	SNP	1.000	C
MIRLET7BHG	400931	genome.wustl.edu	37	22	46493817	46493817	+	Missense_Mutation	SNP	G	G	T	rs149867851		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:46493817G>T	ENST00000381051.2	+	2	64	c.11G>T	c.(10-12)cGt>cTt	p.R4L	FLJ27365_ENST00000360737.3_Missense_Mutation_p.R4L																							ATGTGGCCCCGTCCCAGAGCA	0.627																																																	0													57.0	60.0	59.0					22																	46493817		692	1591	2283	SO:0001583	missense	0																														ENST00000381051.2:c.11G>T	22.37:g.46493817G>T	ENSP00000370439:p.Arg4Leu			Missense_Mutation	SNP	NULL	p.R4L	ENST00000381051.2	37	c.11		22	.	.	.	.	.	.	.	.	.	.	G	3.496	-0.102750	0.06967	.	.	ENSG00000197182	ENST00000381051;ENST00000443490;ENST00000360737	.	.	.	1.93	-3.86	0.04230	.	.	.	.	.	T	0.19446	0.0467	.	.	.	.	.	.	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.09357	-1.0678	6	0.18276	T	0.48	.	2.1526	0.03804	0.1873:0.2646:0.411:0.1372	.	4;4	Q6ZNQ0;B1AKH7	.;.	L	4	.	ENSP00000353966:R4L	R	+	2	0	MIRLET7BHG	44872481	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.661000	0.00400	-3.350000	0.00181	-1.492000	0.00969	CGT	FLJ27365	-	NULL	ENSG00000197182		0.627	FLJ27365-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ENSG00000197182	Uniprot_gn	protein_coding	OTTHUMT00000316783.1	-	0.00	33	0	G			46493817	+1	tier1	-	no_errors	ENST00000435439	ensembl	human	known	74_37	missense	43.75	18	14	SNP	0.000	T
CBFA2T3	863	genome.wustl.edu	37	16	89017215	89017215	+	Intron	SNP	G	G	C	rs113408433		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:89017215G>C	ENST00000268679.4	-	1	548				CBFA2T3_ENST00000436887.2_Intron|RP11-830F9.6_ENST00000378347.2_Missense_Mutation_p.R230P|CBFA2T3_ENST00000448839.1_Intron|CBFA2T3_ENST00000360302.2_Intron	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3						cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CTGTTCACCCGTCCCCTGGAC	0.637			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0																																										SO:0001627	intron_variant	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.151+25849C>G	16.37:g.89017215G>C			D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	NULL	p.R230P	ENST00000268679.4	37	c.689	CCDS10972.1	16	.	.	.	.	.	.	.	.	.	.	-	1.416	-0.574281	0.03882	.	.	ENSG00000205018	ENST00000378347	.	.	.	.	.	.	.	.	.	.	.	T	0.55369	0.1916	.	.	.	0.54753	D	0.999983	.	.	.	.	.	.	T	0.49031	-0.8981	4	0.41790	T	0.15	.	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	rs12928405;rs12931980	.	.	.	P	230	.	ENSP00000367598:R230P	R	+	2	0	AC092384.1	87544716	0.416000	0.25424	0.115000	0.21578	0.116000	0.19942	-0.291000	0.08343	0.064000	0.16427	0.064000	0.15345	CGT	RP11-830F9.6	-	NULL	ENSG00000205018		0.637	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000205018	Clone_based_vega_gene	protein_coding	OTTHUMT00000269545.2	-	0.00	47	0	G	NM_005187		89017215	+1	tier1	rs113408433	no_errors	ENST00000378347	ensembl	human	putative	74_37	missense	23.08	20	6	SNP	0.832	C
DHDDS	79947	genome.wustl.edu	37	1	26793763	26793764	+	Intron	INS	-	-	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:26793763_26793764insA	ENST00000236342.7	+	9	858				DHDDS_ENST00000360009.2_Intron|DHDDS_ENST00000525682.2_Intron|RP3-476K8.3_ENST00000423060.1_RNA|DHDDS_ENST00000526219.1_Intron			Q86SQ9	DHDDS_HUMAN	dehydrodolichyl diphosphate synthase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	transferase activity, transferring alkyl or aryl (other than methyl) groups (GO:0016765)			breast(5)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	15		all_cancers(24;2.04e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.0161)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.166)|LUSC - Lung squamous cell carcinoma(448;0.239)		tccatatcctcaAAAAAAATCC	0.53																																																	0																																										SO:0001627	intron_variant	0			AK023164	CCDS281.1, CCDS282.1, CCDS57984.1, CCDS57983.1	1p35.3	2014-01-28			ENSG00000117682	ENSG00000117682			20603	protein-coding gene	gene with protein product		608172				12591616	Standard	NM_024887		Approved	HDS, FLJ13102, DS, RP59	uc001bmk.3	Q86SQ9	OTTHUMG00000003554	ENST00000236342.7:c.766-1622->A	1.37:g.26793771_26793771dupA			B7Z4B9|B7ZB20|D3DPK7|D3DPK8|D3DPK9|E9KL43|Q5T0A4|Q8NE90|Q9BTG5|Q9BTK3|Q9H905	RNA	INS	-	NULL	ENST00000236342.7	37	NULL	CCDS282.1	1																																																																																			RP3-476K8.3	-	-	ENSG00000225891		0.530	DHDDS-011	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000225891	Clone_based_vega_gene	protein_coding	OTTHUMT00000392504.1		0.00	45	0	-	NM_024887		26793764	-1	tier1		no_errors	ENST00000423060	ensembl	human	known	74_37	rna	10.53	34	4	INS	0.000:0.000	A
AC010970.1	0	genome.wustl.edu	37	Y	10034012	10034012	+	RNA	DEL	T	T	-	rs74404714		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrY:10034012delT	ENST00000516157.2	+	0	32																											CTAGGCGGGCTGCCGAGGGAC	0.687																																																	0																																												0																															Y.37:g.10034012delT				RNA	DEL	-	NULL	ENST00000516157.2	37	NULL		Y																																																																																			AC010970.1	-	-	ENSG00000251966		0.687	AC010970.1-201	NOVEL	basic	miRNA	ENSG00000251966	Clone_based_ensembl_gene	miRNA			0.00	57	0	T			10034012	+1	tier1		no_errors	ENST00000516157	ensembl	human	novel	74_37	rna	50.00	3	3	DEL	0.001	-
EPB41L5	57669	genome.wustl.edu	37	2	120922456	120922456	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:120922456G>A	ENST00000263713.5	+	22	2146	c.1932G>A	c.(1930-1932)gaG>gaA	p.E644E	EPB41L5_ENST00000452780.1_Silent_p.E644E|EPB41L5_ENST00000488691.1_3'UTR|EPB41L5_ENST00000443902.2_Silent_p.E644E	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	644					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						CTCTAACTGAGAATCTAATTG	0.353																																																	0													118.0	112.0	114.0					2																	120922456		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1932G>A	2.37:g.120922456G>A			Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.E644	ENST00000263713.5	37	c.1932	CCDS2130.1	2																																																																																			EPB41L5	-	NULL	ENSG00000115109		0.353	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	-	0.00	40	0	G	NM_020909		120922456	+1	tier1	-	no_errors	ENST00000263713	ensembl	human	known	74_37	silent	85.00	3	17	SNP	1.000	A
EPPK1	83481	genome.wustl.edu	37	8	144947157	144947157	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:144947157G>T	ENST00000525985.1	-	2	336	c.265C>A	c.(265-267)Cgg>Agg	p.R89R				P58107	EPIPL_HUMAN	epiplakin 1	89						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			AGCTGGCCCCGGGCGAGGTCC	0.701																																																	0													10.0	13.0	12.0					8																	144947157		1893	4097	5990	SO:0001819	synonymous_variant	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.265C>A	8.37:g.144947157G>T			Q76E58|Q9NSU9	Silent	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.R89	ENST00000525985.1	37	c.265		8																																																																																			EPPK1	-	pfam_Plectin_repeat,smart_Plectin_repeat	ENSG00000227184		0.701	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1	-	0.00	64	0	G	NM_031308		144947157	-1	tier1	-	no_errors	ENST00000525985	ensembl	human	known	74_37	silent	40.00	51	34	SNP	0.000	T
EVPLL	645027	genome.wustl.edu	37	17	18284783	18284783	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:18284783G>A	ENST00000399134.4	+	3	524	c.166G>A	c.(166-168)Gtg>Atg	p.V56M	RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	56										NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CTTCCTGGACGTGGACAAGGC	0.682																																																	0													53.0	62.0	59.0					17																	18284783		692	1591	2283	SO:0001583	missense	0				CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.166G>A	17.37:g.18284783G>A	ENSP00000382086:p.Val56Met		B4DPD4	Missense_Mutation	SNP	NULL	p.V56M	ENST00000399134.4	37	c.166	CCDS45626.1	17	.	.	.	.	.	.	.	.	.	.	.	8.176	0.792662	0.16258	.	.	ENSG00000214860	ENST00000399134	T	0.32515	1.45	.	.	.	.	.	.	.	.	T	0.18341	0.0440	N	0.20986	0.625	0.22354	N	0.999178	B	0.21147	0.052	B	0.09377	0.004	T	0.19778	-1.0295	8	0.52906	T	0.07	.	6.5164	0.22250	2.0E-4:0.0:0.9998:0.0	.	56	A8MZ36	EVPLL_HUMAN	M	56	ENSP00000382086:V56M	ENSP00000382086:V56M	V	+	1	0	EVPLL	18225508	0.996000	0.38824	0.923000	0.36655	0.054000	0.15201	2.130000	0.42064	0.432000	0.26286	0.074000	0.15403	GTG	EVPLL	-	NULL	ENSG00000214860		0.682	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EVPLL	HGNC	protein_coding	OTTHUMT00000130836.2	-	0.00	81	0	G	NM_001145127		18284783	+1	tier1	-	no_errors	ENST00000399134	ensembl	human	novel	74_37	missense	54.12	39	46	SNP	1.000	A
EXD1	161829	genome.wustl.edu	37	15	41476502	41476502	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:41476502T>G	ENST00000314992.5	-	10	1362	c.1172A>C	c.(1171-1173)aAt>aCt	p.N391T	EXD1_ENST00000458580.2_Missense_Mutation_p.N449T	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	391							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						ATGTTGAGGATTTGTAGCTTG	0.388																																																	0													139.0	142.0	141.0					15																	41476502		2203	4300	6503	SO:0001583	missense	0			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1172A>C	15.37:g.41476502T>G	ENSP00000321029:p.Asn391Thr		A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.N391T	ENST00000314992.5	37	c.1172	CCDS10072.1	15	.	.	.	.	.	.	.	.	.	.	T	8.180	0.793681	0.16327	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.43688	0.94;0.95	5.35	1.65	0.23941	.	1.070270	0.07204	N	0.858014	T	0.22085	0.0532	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.23013	-1.0200	10	0.32370	T	0.25	-17.0419	5.4418	0.16513	0.0:0.1571:0.1476:0.6954	.	449;391;189	B7Z839;Q8NHP7;Q8NHP7-2	.;EXD1_HUMAN;.	T	391;449	ENSP00000321029:N391T;ENSP00000415056:N449T	ENSP00000321029:N391T	N	-	2	0	EXD1	39263794	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.064000	0.14437	0.172000	0.19760	-0.313000	0.08912	AAT	EXD1	-	NULL	ENSG00000178997		0.388	EXD1-001	KNOWN	basic|CCDS	protein_coding	EXD1	HGNC	protein_coding	OTTHUMT00000252553.2	-	0.00	51	0	T	NM_152596		41476502	-1	tier1	-	no_errors	ENST00000314992	ensembl	human	known	74_37	missense	38.71	38	24	SNP	0.001	G
EXOC6B	23233	genome.wustl.edu	37	2	72606863	72606863	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:72606863C>A	ENST00000272427.6	-	19	2247	c.2117G>T	c.(2116-2118)tGt>tTt	p.C706F		NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	706					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						CTTACGTTCACATTCTCTGAC	0.448																																																	0													83.0	81.0	81.0					2																	72606863		2016	4178	6194	SO:0001583	missense	0			AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.2117G>T	2.37:g.72606863C>A	ENSP00000272427:p.Cys706Phe		B8ZZY3	Missense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.C706F	ENST00000272427.6	37	c.2117	CCDS46333.1	2	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134721	0.77662	.	.	ENSG00000144036	ENST00000272427	T	0.29917	1.55	4.73	4.73	0.59995	.	.	.	.	.	T	0.56906	0.2017	M	0.78456	2.415	0.80722	D	1	D	0.62365	0.991	D	0.79784	0.993	T	0.59295	-0.7481	9	0.48119	T	0.1	.	16.4984	0.84251	0.0:1.0:0.0:0.0	.	706	Q9Y2D4	EXC6B_HUMAN	F	706	ENSP00000272427:C706F	ENSP00000272427:C706F	C	-	2	0	EXOC6B	72460371	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.618000	0.83043	2.449000	0.82847	0.558000	0.71614	TGT	EXOC6B	-	pfam_Sec15,pirsf_Sec15	ENSG00000144036		0.448	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6B	HGNC	protein_coding	OTTHUMT00000327558.1	-	0.00	29	0	C	XM_039570		72606863	-1	tier1	-	no_errors	ENST00000272427	ensembl	human	known	74_37	missense	50.00	17	17	SNP	1.000	A
EYS	346007	genome.wustl.edu	37	6	65301594	65301594	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:65301594G>T	ENST00000370621.3	-	26	4692	c.4166C>A	c.(4165-4167)gCa>gAa	p.A1389E	EYS_ENST00000503581.1_Missense_Mutation_p.A1389E|EYS_ENST00000370616.2_Missense_Mutation_p.A1389E			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1389					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGGGGTCCTTGCTCTCCTATC	0.398																																																	0													72.0	71.0	71.0					6																	65301594		692	1591	2283	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.4166C>A	6.37:g.65301594G>T	ENSP00000359655:p.Ala1389Glu		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.A1389E	ENST00000370621.3	37	c.4166		6	.	.	.	.	.	.	.	.	.	.	G	6.833	0.522794	0.13066	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.84516	-1.86;-1.84;-1.84	4.9	1.47	0.22746	.	.	.	.	.	T	0.47600	0.1454	N	0.14661	0.345	0.18873	N	0.999986	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.33701	-0.9858	9	0.31617	T	0.26	.	2.3222	0.04213	0.1213:0.0992:0.2363:0.5431	.	1389;1389	Q5T1H1-1;Q5T1H1	.;EYS_HUMAN	E	1389	ENSP00000424243:A1389E;ENSP00000359655:A1389E;ENSP00000359650:A1389E	ENSP00000359650:A1389E	A	-	2	0	EYS	65358315	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.099000	0.11007	0.174000	0.19809	-0.218000	0.12543	GCA	EYS	-	NULL	ENSG00000188107		0.398	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	37	0	G	XM_294050		65301594	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	54.35	21	25	SNP	0.016	T
FAM172A	83989	genome.wustl.edu	37	5	93217190	93217190	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:93217190G>T	ENST00000395965.3	-	7	914	c.772C>A	c.(772-774)Caa>Aaa	p.Q258K	FAM172A_ENST00000509739.1_Missense_Mutation_p.Q111K|FAM172A_ENST00000505869.1_Missense_Mutation_p.Q148K|FAM172A_ENST00000509163.1_Missense_Mutation_p.Q212K	NM_032042.5	NP_114431.2	Q8WUF8	F172A_HUMAN	family with sequence similarity 172, member A	258						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				endometrium(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9						ATATACAATTGCATCATTTCT	0.299																																																	0													162.0	155.0	157.0					5																	93217190		2203	4299	6502	SO:0001583	missense	0				CCDS4069.1, CCDS54879.1, CCDS54880.1	5q15	2008-06-16	2008-06-16	2008-06-16	ENSG00000113391	ENSG00000113391			25365	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 21"""	C5orf21		11230166	Standard	NM_032042		Approved	DKFZP564D172	uc010jbd.3	Q8WUF8	OTTHUMG00000131329	ENST00000395965.3:c.772C>A	5.37:g.93217190G>T	ENSP00000379294:p.Gln258Lys		B2R7C6|B4DJ14|B4DLG5|Q9H0U8	Missense_Mutation	SNP	pfam_Arb2_domain	p.Q258K	ENST00000395965.3	37	c.772	CCDS4069.1	5	.	.	.	.	.	.	.	.	.	.	G	8.839	0.941725	0.18281	.	.	ENSG00000113391	ENST00000395965;ENST00000505869;ENST00000509739;ENST00000509163	T;T	0.41400	1.0;1.02	4.78	4.78	0.61160	.	0.233772	0.44688	D	0.000433	T	0.27241	0.0668	N	0.14661	0.345	0.51767	D	0.999936	B;B;B;B	0.24920	0.114;0.006;0.005;0.114	B;B;B;B	0.24394	0.033;0.015;0.004;0.053	T	0.08289	-1.0729	10	0.10111	T	0.7	-17.8328	18.1662	0.89727	0.0:0.0:1.0:0.0	.	111;148;258;258	B4DMI0;B4DJ14;Q8WUF8;Q8WUF8-2	.;.;F172A_HUMAN;.	K	258;148;111;212	ENSP00000379294:Q258K;ENSP00000423841:Q212K	ENSP00000379294:Q258K	Q	-	1	0	FAM172A	93242946	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.295000	0.89937	2.350000	0.79820	0.650000	0.86243	CAA	FAM172A	-	NULL	ENSG00000113391		0.299	FAM172A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM172A	HGNC	protein_coding	OTTHUMT00000254100.3	-	0.00	51	0	G	NM_032042		93217190	-1	tier1	-	no_errors	ENST00000395965	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	T
ERICH6	131831	genome.wustl.edu	37	3	150421606	150421606	+	Missense_Mutation	SNP	T	T	A	rs140978408		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:150421606T>A	ENST00000295910.6	-	1	132	c.80A>T	c.(79-81)gAg>gTg	p.E27V	FAM194A_ENST00000491361.1_5'UTR|RP11-103G8.2_ENST00000475393.1_RNA|RP11-103G8.2_ENST00000471093.1_RNA	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctcctcctcctcctctaactc	0.632																																																	0													58.0	56.0	57.0					3																	150421606		2203	4300	6503	SO:0001583	missense	0																														ENST00000295910.6:c.80A>T	3.37:g.150421606T>A	ENSP00000295910:p.Glu27Val			Missense_Mutation	SNP	NULL	p.E27V	ENST00000295910.6	37	c.80	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780671	0.16120	.	.	ENSG00000163645	ENST00000295910;ENST00000474463;ENST00000498386	T;T;T	0.58652	2.55;0.32;2.16	3.0	-4.76	0.03229	.	1.295330	0.05951	N	0.638762	T	0.32010	0.0815	N	0.14661	0.345	0.20873	N	0.999839	B	0.09022	0.002	B	0.08055	0.003	T	0.11470	-1.0586	10	0.48119	T	0.1	5.6736	0.9544	0.01382	0.293:0.1054:0.3302:0.2715	.	27	Q7L0X2	F194A_HUMAN	V	27	ENSP00000295910:E27V;ENSP00000419304:E27V;ENSP00000417780:E27V	ENSP00000295910:E27V	E	-	2	0	FAM194A	151904296	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.479000	0.06567	-1.024000	0.03338	-2.447000	0.00209	GAG	FAM194A	-	NULL	ENSG00000163645		0.632	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1		0.00	14	0	T			150421606	-1			no_errors	ENST00000295910	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.000	A
FAM65B	9750	genome.wustl.edu	37	6	24875925	24875925	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:24875925C>A	ENST00000259698.4	-	2	270	c.95G>T	c.(94-96)cGa>cTa	p.R32L	FAM65B_ENST00000378023.4_Missense_Mutation_p.R32L|FAM65B_ENST00000540914.1_Missense_Mutation_p.R32L|FAM65B_ENST00000510784.2_Missense_Mutation_p.R66L|FAM65B_ENST00000538035.1_Missense_Mutation_p.R61L	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	32					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						TTGCCTGGATCGCCTTTCCTG	0.522																																																	0													36.0	37.0	37.0					6																	24875925		1949	4141	6090	SO:0001583	missense	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.95G>T	6.37:g.24875925C>A	ENSP00000259698:p.Arg32Leu		A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R32L	ENST00000259698.4	37	c.95	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042107	0.93685	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.01902	4.57;4.57;4.57;4.57;4.57	5.45	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.04137	0.0115	L	0.55481	1.735	0.58432	D	0.999997	D;D;D;D	0.61080	0.989;0.979;0.979;0.963	P;P;P;P	0.62298	0.9;0.859;0.859;0.859	T	0.45026	-0.9289	10	0.49607	T	0.09	-11.6279	13.9394	0.64046	0.0:0.9273:0.0:0.0727	.	66;61;32;32	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	L	32;61;32;32;66	ENSP00000259698:R32L;ENSP00000441138:R61L;ENSP00000367262:R32L;ENSP00000438425:R32L;ENSP00000441305:R66L	ENSP00000259698:R32L	R	-	2	0	FAM65B	24983904	1.000000	0.71417	0.971000	0.41717	0.966000	0.64601	7.378000	0.79679	1.291000	0.44653	0.563000	0.77884	CGA	FAM65B	-	NULL	ENSG00000111913		0.522	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2	-	0.00	21	0	C			24875925	-1	tier1	-	no_errors	ENST00000259698	ensembl	human	known	74_37	missense	34.88	28	15	SNP	1.000	A
FAM71D	161142	genome.wustl.edu	37	14	67675093	67675093	+	3'UTR	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:67675093G>A	ENST00000556046.1	+	0	1628							Q8N9W8	FA71D_HUMAN	family with sequence similarity 71, member D							cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)	13		all_hematologic(31;0.0116)		all cancers(60;0.00107)|BRCA - Breast invasive adenocarcinoma(234;0.00993)|OV - Ovarian serous cystadenocarcinoma(108;0.012)		TACATCCAAGGAGATGAAGGA	0.413																																																	0													88.0	82.0	84.0					14																	67675093		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS9778.1	14q23.3	2007-11-20	2007-11-20	2007-11-20		ENSG00000172717			20101	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 54"""	C14orf54			Standard	NM_173526		Approved		uc001xja.2	Q8N9W8		ENST00000556046.1:c.*1143G>A	14.37:g.67675093G>A			Q86VN4	Missense_Mutation	SNP	pfam_DUF3699	p.E363K	ENST00000556046.1	37	c.1087		14																																																																																			FAM71D	-	NULL	ENSG00000172717		0.413	FAM71D-009	KNOWN	not_organism_supported|basic|appris_candidate	nonsense_mediated_decay	FAM71D	HGNC	protein_coding	OTTHUMT00000412390.1	-	0.00	34	0	G	NM_173526		67675093	+1	tier1	-	no_errors	ENST00000311864	ensembl	human	known	74_37	missense	42.50	23	17	SNP	0.003	A
FAM81A	145773	genome.wustl.edu	37	15	59808891	59808891	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:59808891C>A	ENST00000288228.5	+	8	1021	c.834C>A	c.(832-834)gcC>gcA	p.A278A		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	278										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						AGATGTCAGCCAGGCTTGACA	0.453																																																	0													93.0	89.0	90.0					15																	59808891		1909	4127	6036	SO:0001819	synonymous_variant	0				CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.834C>A	15.37:g.59808891C>A				Silent	SNP	superfamily_Ferritin-like_SF	p.A278	ENST00000288228.5	37	c.834	CCDS45269.1	15																																																																																			FAM81A	-	superfamily_Ferritin-like_SF	ENSG00000157470		0.453	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81A	HGNC	protein_coding	OTTHUMT00000415876.1	-	0.00	19	0	C	NM_152450		59808891	+1	tier1	-	no_errors	ENST00000288228	ensembl	human	known	74_37	silent	50.00	7	7	SNP	0.968	A
FAM83B	222584	genome.wustl.edu	37	6	54735047	54735047	+	Start_Codon_SNP	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:54735047G>T	ENST00000306858.7	+	2	119	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	1										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TTGCAAGCATGGAGACCTCAT	0.383																																																	0													125.0	105.0	112.0					6																	54735047		2203	4300	6503	SO:0001582	initiator_codon_variant	0			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.3G>T	6.37:g.54735047G>T	ENSP00000304078:p.Met1Ile		Q2M1P3|Q96DQ2	Missense_Mutation	SNP	pfam_DUF1669	p.M1I	ENST00000306858.7	37	c.3	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	G	24.6	4.548697	0.86127	.	.	ENSG00000168143	ENST00000306858	T	0.10005	2.92	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	.	.	.	0.40588	D	0.981466	D	0.69078	0.997	D	0.75484	0.986	T	0.05750	-1.0866	9	0.87932	D	0	-25.1178	19.1944	0.93681	0.0:0.0:1.0:0.0	.	1	Q5T0W9	FA83B_HUMAN	I	1	ENSP00000304078:M1I	ENSP00000304078:M1I	M	+	3	0	FAM83B	54843006	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.993000	0.93524	2.610000	0.88304	0.591000	0.81541	ATG	FAM83B	-	NULL	ENSG00000168143		0.383	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	HGNC	protein_coding	OTTHUMT00000040994.1		0.00	15	0	G	XM_294139	Missense_Mutation	54735047	+1			no_errors	ENST00000306858	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	T
FANK1	92565	genome.wustl.edu	37	10	127686054	127686054	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:127686054G>T	ENST00000368693.1	+	6	643	c.539G>T	c.(538-540)aGt>aTt	p.S180I	FANK1_ENST00000368695.1_Splice_Site_p.S174I			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	180						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GGCAAGGACAGGTAGGAGGTG	0.423																																																	0													241.0	218.0	226.0					10																	127686054		2203	4300	6503	SO:0001630	splice_region_variant	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.539+1G>T	10.37:g.127686054G>T			Q6UXY9|Q6X7T6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.S180I	ENST00000368693.1	37	c.539	CCDS31309.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.7|20.7	4.026066|4.026066	0.75390|0.75390	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000368695;ENST00000368693;ENST00000368692|ENST00000456942	T;T|.	0.63580|.	-0.05;-0.05|.	5.23|5.23	5.23|5.23	0.72850|0.72850	Ankyrin repeat-containing domain (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59390|0.59390	0.2190|0.2190	L|L	0.41415|0.41415	1.275|1.275	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.91635|.	0.997;0.996;0.999|.	T|T	0.54098|0.54098	-0.8344|-0.8344	10|5	0.62326|.	D|.	0.03|.	-28.4198|-28.4198	14.603|14.603	0.68456|0.68456	0.0:0.0:0.8537:0.1463|0.0:0.0:0.8537:0.1463	.|.	206;180;180|.	Q8TC84-3;Q8TC84-2;Q8TC84|.	.;.;FANK1_HUMAN|.	I|F	174;180;206|75	ENSP00000357684:S174I;ENSP00000357682:S180I|.	ENSP00000357681:S206I|.	S|V	+|+	2|1	0|0	FANK1|FANK1	127676044|127676044	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.968000|0.968000	0.65278|0.65278	6.168000|6.168000	0.71908|0.71908	2.719000|2.719000	0.93026|0.93026	0.655000|0.655000	0.94253|0.94253	AGT|GTC	FANK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000203780		0.423	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		-	0.00	57	0	G	NM_145235	Missense_Mutation	127686054	+1	tier1	-	no_errors	ENST00000368693	ensembl	human	known	74_37	missense	87.80	5	36	SNP	1.000	T
FBN3	84467	genome.wustl.edu	37	19	8161811	8161811	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:8161811G>T	ENST00000600128.1	-	43	5781	c.5367C>A	c.(5365-5367)tgC>tgA	p.C1789*	FBN3_ENST00000270509.2_Nonsense_Mutation_p.C1789*|FBN3_ENST00000601739.1_Nonsense_Mutation_p.C1789*			Q75N90	FBN3_HUMAN	fibrillin 3	1789	EGF-like 27; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GGGTGCACTTGCAGCGGTAGC	0.602																																																	0													77.0	71.0	73.0					19																	8161811		2203	4300	6503	SO:0001587	stop_gained	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5367C>A	19.37:g.8161811G>T	ENSP00000470498:p.Cys1789*		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Nonsense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.C1789*	ENST00000600128.1	37	c.5367	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	45	11.396134	0.99556	.	.	ENSG00000142449	ENST00000270509	.	.	.	3.39	2.33	0.28932	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.6962	0.23201	0.2247:0.0:0.7753:0.0	.	.	.	.	X	1789	.	ENSP00000270509:C1789X	C	-	3	2	FBN3	8067811	0.996000	0.38824	0.452000	0.26994	0.099000	0.18886	1.114000	0.31196	0.508000	0.28173	0.561000	0.74099	TGC	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000142449		0.602	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	20	0	G	NM_032447		8161811	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	nonsense	56.25	7	9	SNP	1.000	T
FCRL3	115352	genome.wustl.edu	37	1	157659609	157659609	+	Missense_Mutation	SNP	C	C	G	rs142711385		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:157659609C>G	ENST00000368184.3	-	10	2080	c.1789G>C	c.(1789-1791)Gcc>Ccc	p.A597P	FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Missense_Mutation_p.A597P	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	597						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					CGGGCCCTGGCGTAATGCAGC	0.532																																																	0													98.0	86.0	90.0					1																	157659609		2203	4300	6503	SO:0001583	missense	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1789G>C	1.37:g.157659609C>G	ENSP00000357167:p.Ala597Pro		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A603P	ENST00000368184.3	37	c.1807	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	C	14.66	2.600424	0.46423	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.50277	0.76;0.75	5.21	0.0143	0.14099	.	1.727090	0.03890	N	0.278507	T	0.18215	0.0437	N	0.14661	0.345	0.09310	N	1	P;P;P	0.52692	0.924;0.949;0.955	P;P;P	0.53006	0.522;0.592;0.715	T	0.05954	-1.0854	10	0.34782	T	0.22	.	1.163	0.01810	0.4356:0.1902:0.0889:0.2854	.	597;502;597	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	P	597	ENSP00000357169:A597P;ENSP00000357167:A597P	ENSP00000292392:A597P	A	-	1	0	FCRL3	155926233	0.022000	0.18835	0.000000	0.03702	0.000000	0.00434	0.170000	0.16663	-0.276000	0.09206	-0.284000	0.09977	GCC	FCRL3	-	NULL	ENSG00000160856		0.532	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	-	0.00	55	0	C	NM_052939		157659609	-1	tier1	-	no_errors	ENST00000492769	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.000	G
FCRL3	115352	genome.wustl.edu	37	1	157665953	157665953	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:157665953G>T	ENST00000368184.3	-	7	1300	c.1009C>A	c.(1009-1011)Cgt>Agt	p.R337S	FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA|FCRL3_ENST00000368186.5_Missense_Mutation_p.R337S	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3	337	Ig-like C2-type 4.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					AACAGGGAACGCTGGGTCTTT	0.512																																																	0													135.0	120.0	125.0					1																	157665953		2203	4300	6503	SO:0001583	missense	0			AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.1009C>A	1.37:g.157665953G>T	ENSP00000357167:p.Arg337Ser		A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R337S	ENST00000368184.3	37	c.1009	CCDS1167.1	1	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482587	0.44147	.	.	ENSG00000160856	ENST00000368186;ENST00000368184;ENST00000292392	T;T	0.12361	2.69;2.69	5.35	1.15	0.20763	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.997465	0.08116	N	0.995495	T	0.07052	0.0179	M	0.68317	2.08	0.09310	N	1	B;B;B	0.25206	0.071;0.12;0.058	B;B;B	0.33690	0.123;0.168;0.155	T	0.44967	-0.9293	10	0.54805	T	0.06	.	4.7392	0.13005	0.2651:0.0:0.5808:0.1541	.	337;242;337	Q96P31;D3DVD1;Q96P31-6	FCRL3_HUMAN;.;.	S	337	ENSP00000357169:R337S;ENSP00000357167:R337S	ENSP00000292392:R337S	R	-	1	0	FCRL3	155932577	0.004000	0.15560	0.002000	0.10522	0.017000	0.09413	0.956000	0.29202	0.634000	0.30469	-0.150000	0.13652	CGT	FCRL3	-	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000160856		0.512	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	HGNC	protein_coding	OTTHUMT00000051419.2	-	0.00	54	0	G	NM_052939		157665953	-1	tier1	-	no_errors	ENST00000492769	ensembl	human	known	74_37	missense	45.71	19	16	SNP	0.000	T
FCRL2	79368	genome.wustl.edu	37	1	157738276	157738276	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:157738276C>A	ENST00000361516.3	-	5	859	c.811G>T	c.(811-813)Ggc>Tgc	p.G271C	FCRL2_ENST00000392274.3_Missense_Mutation_p.G271C|FCRL2_ENST00000469986.1_5'Flank|FCRL2_ENST00000368181.4_Intron	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	271	Ig-like C2-type 3.				cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)	p.G271S(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TAATATTTGCCGGCATCACTC	0.507																																																	1	Substitution - Missense(1)	large_intestine(1)											181.0	180.0	180.0					1																	157738276		2203	4300	6503	SO:0001583	missense	0			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.811G>T	1.37:g.157738276C>A	ENSP00000355157:p.Gly271Cys		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G271C	ENST00000361516.3	37	c.811	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390008	0.42410	.	.	ENSG00000132704	ENST00000361516;ENST00000392274	T;T	0.26810	1.71;1.71	3.89	2.97	0.34412	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.45606	D	0.000346	T	0.54967	0.1891	H	0.99582	4.64	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.57100	-0.7869	10	0.87932	D	0	.	7.6821	0.28520	0.0:0.8815:0.0:0.1185	.	271;271	B4DVJ9;Q96LA5	.;FCRL2_HUMAN	C	271	ENSP00000355157:G271C;ENSP00000376100:G271C	ENSP00000355157:G271C	G	-	1	0	FCRL2	156004900	0.000000	0.05858	0.010000	0.14722	0.005000	0.04900	0.798000	0.27014	0.956000	0.37904	0.655000	0.94253	GGC	FCRL2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000132704		0.507	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	HGNC	protein_coding	OTTHUMT00000051408.2	-	0.00	27	0	C	NM_030764		157738276	-1	tier1	-	no_errors	ENST00000361516	ensembl	human	known	74_37	missense	35.14	24	13	SNP	0.021	A
FES	2242	genome.wustl.edu	37	15	91434332	91434332	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:91434332C>T	ENST00000328850.3	+	11	1583	c.1441C>T	c.(1441-1443)Ctg>Ttg	p.L481L	FES_ENST00000450438.2_Intron|FES_ENST00000444422.2_Intron|FES_ENST00000394300.3_Silent_p.L423L|FES_ENST00000414248.2_Intron|FES_ENST00000394302.1_Intron	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	481	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			TGGGGACTTCCTGGTGCGGGA	0.642																																																	0													100.0	75.0	84.0					15																	91434332		2195	4294	6489	SO:0001819	synonymous_variant	0			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.1441C>T	15.37:g.91434332C>T			B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Silent	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_FCH_dom,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH_dom,pfscan_SH2,pfscan_Prot_kinase_dom	p.L481	ENST00000328850.3	37	c.1441	CCDS10365.1	15																																																																																			FES	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_SH2,smart_SH2,prints_SH2,pfscan_SH2	ENSG00000182511		0.642	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	HGNC	protein_coding	OTTHUMT00000313497.1	-	0.00	41	0	C	NM_002005		91434332	+1	tier1	-	no_errors	ENST00000328850	ensembl	human	known	74_37	silent	41.51	31	22	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152280796	152280796	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:152280796G>T	ENST00000368799.1	-	3	6601	c.6566C>A	c.(6565-6567)gCa>gAa	p.A2189E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2189	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTTTCTGCTTGCACTTCTGGA	0.532									Ichthyosis																																								0													470.0	398.0	423.0					1																	152280796		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6566C>A	1.37:g.152280796G>T	ENSP00000357789:p.Ala2189Glu		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.A2189E	ENST00000368799.1	37	c.6566	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	g	5.459	0.269771	0.10349	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	2.37	-3.76	0.04359	.	.	.	.	.	T	0.00468	0.0015	M	0.76574	2.34	0.09310	N	1	B	0.21225	0.053	B	0.09377	0.004	T	0.53158	-0.8478	9	0.02654	T	1	.	0.3882	0.00406	0.2734:0.199:0.3267:0.201	.	2189	P20930	FILA_HUMAN	E	2189	ENSP00000357789:A2189E	ENSP00000357789:A2189E	A	-	2	0	FLG	150547420	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	0.226000	0.17776	-1.089000	0.03073	0.485000	0.47835	GCA	FLG	-	NULL	ENSG00000143631		0.532	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	193	0	G	NM_002016		152280796	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	33.09	180	89	SNP	0.000	T
FMN1	342184	genome.wustl.edu	37	15	33261476	33261476	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:33261476C>T	ENST00000559047.1	-	5	2425	c.2426G>A	c.(2425-2427)aGa>aAa	p.R809K	SNORD77_ENST00000391113.1_RNA|FMN1_ENST00000334528.9_Missense_Mutation_p.R586K|FMN1_ENST00000561249.1_Missense_Mutation_p.R711K			Q68DA7	FMN1_HUMAN	formin 1	809	Mediates interaction with alpha-catenin. {ECO:0000250}.				actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GAAGGTCTCTCTGTCTGTCTG	0.468																																																	0													424.0	391.0	401.0					15																	33261476		1998	4168	6166	SO:0001583	missense	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2426G>A	15.37:g.33261476C>T	ENSP00000454047:p.Arg809Lys		Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	pfam_FH2_Formin,smart_FH2_Formin,prints_Formin_Cappuccino_subfam	p.R586K	ENST00000559047.1	37	c.1757		15	.	.	.	.	.	.	.	.	.	.	c	17.14	3.313922	0.60414	.	.	ENSG00000248905	ENST00000334528	T	0.50813	0.73	4.59	4.59	0.56863	.	0.000000	0.85682	D	0.000000	T	0.64080	0.2566	L	0.55834	1.745	.	.	.	D	0.76494	0.999	D	0.69142	0.962	T	0.69101	-0.5234	9	0.62326	D	0.03	.	17.6138	0.88063	0.0:1.0:0.0:0.0	.	586	Q68DA7-5	.	K	586	ENSP00000333950:R586K	ENSP00000333950:R586K	R	-	2	0	FMN1	31048768	1.000000	0.71417	0.999000	0.59377	0.838000	0.47535	5.869000	0.69613	2.390000	0.81377	0.550000	0.68814	AGA	FMN1	-	prints_Formin_Cappuccino_subfam	ENSG00000248905		0.468	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1	-	0.00	68	0	C	NM_001103184		33261476	-1	tier1	-	no_errors	ENST00000334528	ensembl	human	known	74_37	missense	41.77	46	33	SNP	1.000	T
FOXD4L1	200350	genome.wustl.edu	37	2	114257058	114257059	+	In_Frame_Ins	INS	-	-	GGC	rs369535331|rs557578751	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:114257058_114257059insGGC	ENST00000306507.5	+	1	398_399	c.225_226insGGC	c.(226-228)ggc>GGCggc	p.76_76G>GG		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	76					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G76C(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						AGCACATCGAGGGCGGCGGCCC	0.708														163	0.0325479	0.0045	0.0403	5008	,	,		10259	0.0942		0.006	False		,,,				2504	0.0286																1	Substitution - Missense(1)	breast(1)																																								SO:0001652	inframe_insertion	0			AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.232_234dupGGC	2.37:g.114257065_114257067dupGGC	ENSP00000302756:p.Gly78dup		B3KWN1|B9EGF3	In_Frame_Ins	INS	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.78in_frame_insG	ENST00000306507.5	37	c.225_226	CCDS2117.1	2																																																																																			FOXD4L1	-	NULL	ENSG00000184492		0.708	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L1	HGNC	protein_coding	OTTHUMT00000254148.1		0.00	61	0	-	NM_012184		114257059	+1	tier1		no_errors	ENST00000306507	ensembl	human	known	74_37	in_frame_ins	50.00	3	3	INS	0.000:0.003	GGC
FREM2	341640	genome.wustl.edu	37	13	39438592	39438592	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:39438592C>G	ENST00000280481.7	+	16	8048	c.7832C>G	c.(7831-7833)cCt>cGt	p.P2611R		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2611					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GAGACATATCCTTACCAGTAC	0.443																																																	0													169.0	157.0	161.0					13																	39438592		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7832C>G	13.37:g.39438592C>G	ENSP00000280481:p.Pro2611Arg		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.P2611R	ENST00000280481.7	37	c.7832	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069222	0.55539	.	.	ENSG00000150893	ENST00000280481	T	0.26660	1.72	5.61	4.77	0.60923	.	0.122959	0.56097	N	0.000033	T	0.56396	0.1982	M	0.88842	2.985	0.80722	D	1	D;D	0.69078	0.997;0.991	D;D	0.71414	0.973;0.939	T	0.66280	-0.5963	10	0.87932	D	0	.	14.2681	0.66135	0.0:0.9285:0.0:0.0715	.	2611;2611	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	R	2611	ENSP00000280481:P2611R	ENSP00000280481:P2611R	P	+	2	0	FREM2	38336592	1.000000	0.71417	0.963000	0.40424	0.249000	0.25844	7.794000	0.85869	1.378000	0.46305	0.650000	0.86243	CCT	FREM2	-	NULL	ENSG00000150893		0.443	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	42	0	C	NM_207361		39438592	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	38.46	40	25	SNP	1.000	G
FSCB	84075	genome.wustl.edu	37	14	44974273	44974273	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:44974273C>G	ENST00000340446.4	-	1	2209	c.1918G>C	c.(1918-1920)Gag>Cag	p.E640Q	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	640	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GGGGCCTCCTCAGCTGGTGGA	0.657																																																	0													1.0	1.0	1.0					14																	44974273		426	1062	1488	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1918G>C	14.37:g.44974273C>G	ENSP00000344579:p.Glu640Gln		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.E640Q	ENST00000340446.4	37	c.1918	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278442	0.23307	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.17213	2.29	4.89	4.0	0.46444	.	.	.	.	.	T	0.33118	0.0852	L	0.57536	1.79	0.09310	N	1	D	0.67145	0.996	D	0.64410	0.925	T	0.07751	-1.0756	9	0.31617	T	0.26	3.3696	11.2185	0.48840	0.0:0.9101:0.0:0.0899	.	640	Q5H9T9	FSCB_HUMAN	Q	640;533	ENSP00000344579:E640Q	ENSP00000344579:E640Q	E	-	1	0	FSCB	44044023	0.000000	0.05858	0.002000	0.10522	0.023000	0.10783	-0.063000	0.11655	1.433000	0.47394	0.505000	0.49811	GAG	FSCB	-	NULL	ENSG00000189139		0.657	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1		0.00	53	0	C	NM_032135		44974273	-1			no_errors	ENST00000340446	ensembl	human	known	74_37	missense	20.34	47	12	SNP	0.006	G
FUNDC2P2	388965	genome.wustl.edu	37	2	84518478	84518478	+	RNA	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:84518478C>T	ENST00000331369.5	+	0	672									FUN14 domain containing 2 pseudogene 2																		TTGAGTCCCTCCTCCTCTTCT	0.498																																																	0																																												0					2p11.2	2010-03-12			ENSG00000182814	ENSG00000182814			17247	pseudogene	pseudogene							Standard	NR_003663		Approved		uc010ffz.1		OTTHUMG00000152875		2.37:g.84518478C>T				RNA	SNP	-	NULL	ENST00000331369.5	37	NULL		2																																																																																			FUNDC2P2	-	-	ENSG00000182814		0.498	FUNDC2P2-001	KNOWN	basic	processed_transcript	FUNDC2P2	HGNC	pseudogene	OTTHUMT00000333681.1	-	0.00	41	0	C	NR_003663		84518478	+1	tier1	-	no_errors	ENST00000331369	ensembl	human	known	74_37	rna	40.91	26	18	SNP	0.256	T
GCDH	2639	genome.wustl.edu	37	19	13008521	13008521	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:13008521G>T	ENST00000222214.5	+	11	1298	c.1087G>T	c.(1087-1089)Gcc>Tcc	p.A363S	GCDH_ENST00000591470.1_Missense_Mutation_p.A363S|GCDH_ENST00000457854.1_Missense_Mutation_p.A363S|GCDH_ENST00000422947.2_Missense_Mutation_p.A319S			Q92947	GCDH_HUMAN	glutaryl-CoA dehydrogenase	363					cellular nitrogen compound metabolic process (GO:0034641)|fatty acid oxidation (GO:0019395)|fatty-acyl-CoA biosynthetic process (GO:0046949)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|tryptophan metabolic process (GO:0006568)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)|flavin adenine dinucleotide binding (GO:0050660)|glutaryl-CoA dehydrogenase activity (GO:0004361)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)	19					Flavin adenine dinucleotide(DB03147)	TCCCAGGGCTGCCCCCGAGAT	0.607																																					GBM(123;875 1636 7726 16444 26754)												0													130.0	140.0	137.0					19																	13008521		2203	4300	6503	SO:0001583	missense	0			AF012342	CCDS12286.1	19p13.2	2010-04-30	2010-04-30			ENSG00000105607	1.3.99.7		4189	protein-coding gene	gene with protein product		608801	"""glutaryl-Coenzyme A dehydrogenase"""			1438360, 8088809	Standard	NM_000159		Approved	ACAD5	uc002mvq.4	Q92947		ENST00000222214.5:c.1087G>T	19.37:g.13008521G>T	ENSP00000222214:p.Ala363Ser		A8K2Z2|O14719	Missense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.A363S	ENST00000222214.5	37	c.1087	CCDS12286.1	19	.	.	.	.	.	.	.	.	.	.	G	7.472	0.646950	0.14516	.	.	ENSG00000105607	ENST00000457854;ENST00000222214;ENST00000422947	D;D;D	0.96104	-3.91;-3.91;-3.91	5.6	0.764	0.18465	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.265926	0.42964	D	0.000639	D	0.88592	0.6478	N	0.25060	0.705	0.33247	D	0.558062	B;B;B;B	0.09022	0.002;0.001;0.0;0.0	B;B;B;B	0.20955	0.032;0.009;0.004;0.002	T	0.81512	-0.0899	10	0.48119	T	0.1	.	4.7716	0.13158	0.6419:0.0:0.2293:0.1287	.	319;199;363;363	B4DK85;B4DUY0;Q92947;Q92947-2	.;.;GCDH_HUMAN;.	S	363;363;319	ENSP00000394872:A363S;ENSP00000222214:A363S;ENSP00000394821:A319S	ENSP00000222214:A363S	A	+	1	0	GCDH	12869521	0.861000	0.29849	0.606000	0.28943	0.010000	0.07245	1.683000	0.37638	0.087000	0.17167	-1.105000	0.02106	GCC	GCDH	-	pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCo_DH/oxidase_C	ENSG00000105607		0.607	GCDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCDH	HGNC	protein_coding	OTTHUMT00000451897.1	-	0.00	47	0	G			13008521	+1	tier1	-	no_errors	ENST00000222214	ensembl	human	known	74_37	missense	10.00	34	4	SNP	0.938	T
GDPD4	220032	genome.wustl.edu	37	11	76954790	76954790	+	Missense_Mutation	SNP	T	T	A	rs202143817		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:76954790T>A	ENST00000376217.2	-	12	1440	c.1190A>T	c.(1189-1191)aAt>aTt	p.N397I	GDPD4_ENST00000315938.4_Missense_Mutation_p.N397I			Q6W3E5	GDPD4_HUMAN	glycerophosphodiester phosphodiesterase domain containing 4	397	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	20						TATACTGATATTGTTTTTAGC	0.418																																																	0													125.0	116.0	119.0					11																	76954790		2200	4292	6492	SO:0001583	missense	0			AY326450	CCDS8249.1	11q13.5	2008-02-05			ENSG00000178795	ENSG00000178795			24849	protein-coding gene	gene with protein product							Standard	NM_182833		Approved	GDE6	uc001oyf.3	Q6W3E5	OTTHUMG00000165136	ENST00000376217.2:c.1190A>T	11.37:g.76954790T>A	ENSP00000365390:p.Asn397Ile		Q7Z5B0	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.N397I	ENST00000376217.2	37	c.1190		11	.	.	.	.	.	.	.	.	.	.	T	18.10	3.548104	0.65311	.	.	ENSG00000178795	ENST00000376217;ENST00000315938	T;T	0.10477	2.87;2.87	4.27	4.27	0.50696	.	0.219154	0.46145	D	0.000315	T	0.28067	0.0692	M	0.65975	2.015	0.38441	D	0.946718	D	0.76494	0.999	D	0.70016	0.967	T	0.05632	-1.0873	10	0.66056	D	0.02	-23.5961	11.1756	0.48596	0.0:0.0:0.0:1.0	.	397	Q6W3E5-2	.	I	397	ENSP00000365390:N397I;ENSP00000320815:N397I	ENSP00000320815:N397I	N	-	2	0	GDPD4	76632438	1.000000	0.71417	0.719000	0.30619	0.107000	0.19398	3.815000	0.55651	1.921000	0.55644	0.533000	0.62120	AAT	GDPD4	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000178795		0.418	GDPD4-002	KNOWN	basic|appris_candidate_longest	protein_coding	GDPD4	HGNC	protein_coding	OTTHUMT00000382075.1		0.00	51	0	T	NM_182833		76954790	-1			no_errors	ENST00000376217	ensembl	human	known	74_37	missense	5.49	86	5	SNP	0.982	A
GLG1	2734	genome.wustl.edu	37	16	74506261	74506261	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:74506261G>C	ENST00000422840.2	-	14	2100	c.2101C>G	c.(2101-2103)Cag>Gag	p.Q701E	GLG1_ENST00000205061.5_Missense_Mutation_p.Q701E|GLG1_ENST00000447066.2_Missense_Mutation_p.Q690E	NM_001145667.1	NP_001139139.1	Q92896	GSLG1_HUMAN	golgi glycoprotein 1	701					blood coagulation (GO:0007596)|bone morphogenesis (GO:0060349)|leukocyte migration (GO:0050900)|negative regulation of protein processing (GO:0010955)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of chondrocyte differentiation (GO:0032330)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(6)|kidney(8)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(1)	57						CAGAAGTTCTGAATTATGGGC	0.423																																																	0													113.0	108.0	110.0					16																	74506261		2198	4300	6498	SO:0001583	missense	0				CCDS32485.1, CCDS45526.1, CCDS45527.1	16q22-q23	2010-02-12	2010-02-12			ENSG00000090863			4316	protein-coding gene	gene with protein product		600753	"""golgi apparatus protein 1"""			8530051, 7531823	Standard	NM_012201		Approved	MG-160, ESL-1, CFR-1	uc002fcx.3	Q92896		ENST00000422840.2:c.2101C>G	16.37:g.74506261G>C	ENSP00000405984:p.Gln701Glu		B7Z8Y4|D3DUJ7|Q13221|Q6P9D1	Missense_Mutation	SNP	pfam_Cys-rich_GLG1_repeat	p.Q701E	ENST00000422840.2	37	c.2101	CCDS45527.1	16	.	.	.	.	.	.	.	.	.	.	G	15.88	2.962483	0.53400	.	.	ENSG00000090863	ENST00000205061;ENST00000447066;ENST00000422840	.	.	.	5.77	5.77	0.91146	.	0.062472	0.64402	D	0.000003	T	0.58018	0.2093	L	0.39245	1.2	0.80722	D	1	B;B;B	0.29766	0.256;0.22;0.136	B;B;B	0.33960	0.173;0.058;0.097	T	0.51482	-0.8700	9	0.19590	T	0.45	.	19.9946	0.97381	0.0:0.0:1.0:0.0	.	701;701;690	Q92896;Q92896-2;B7Z8Y4	GSLG1_HUMAN;.;.	E	701;690;701	.	ENSP00000205061:Q701E	Q	-	1	0	GLG1	73063762	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	9.359000	0.97115	2.728000	0.93425	0.591000	0.81541	CAG	GLG1	-	pfam_Cys-rich_GLG1_repeat	ENSG00000090863		0.423	GLG1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLG1	HGNC	protein_coding	OTTHUMT00000435750.1	-	0.00	88	0	G	NM_012201		74506261	-1	tier1	-	no_errors	ENST00000205061	ensembl	human	known	74_37	missense	46.30	58	50	SNP	1.000	C
GLRA3	8001	genome.wustl.edu	37	4	175565081	175565081	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:175565081C>G	ENST00000274093.3	-	10	1753	c.1251G>C	c.(1249-1251)atG>atC	p.M417I	GLRA3_ENST00000340217.5_Missense_Mutation_p.M402I	NM_006529.2	NP_006520.2	O75311	GLRA3_HUMAN	glycine receptor, alpha 3	417					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			endometrium(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	35		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)|Ivermectin(DB00602)|Lindane(DB00431)	AGACCTTCCTCATTTCATCAG	0.458																																																	0													161.0	138.0	146.0					4																	175565081		2203	4300	6503	SO:0001583	missense	0			AF017724	CCDS3822.1, CCDS43283.1	4q34.1	2012-02-07			ENSG00000145451	ENSG00000145451		"""Ligand-gated ion channels / Glycine receptors"""	4328	protein-coding gene	gene with protein product		600421				9677400	Standard	NM_001042543		Approved		uc003ity.1	O75311	OTTHUMG00000149816	ENST00000274093.3:c.1251G>C	4.37:g.175565081C>G	ENSP00000274093:p.Met417Ile		D3DP44|O75816|Q5D0E3	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A3,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.M417I	ENST00000274093.3	37	c.1251	CCDS3822.1	4	.	.	.	.	.	.	.	.	.	.	C	11.53	1.666174	0.29604	.	.	ENSG00000145451	ENST00000274093;ENST00000340217	D;D	0.83506	-1.73;-1.71	5.98	5.98	0.97165	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.000000	0.85682	D	0.000000	T	0.71525	0.3350	N	0.17345	0.48	0.53688	D	0.999978	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.67027	-0.5774	10	0.06236	T	0.91	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	402;417	O75311-2;O75311	.;GLRA3_HUMAN	I	417;402	ENSP00000274093:M417I;ENSP00000345284:M402I	ENSP00000274093:M417I	M	-	3	0	GLRA3	175801656	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.187000	0.50950	2.838000	0.97847	0.591000	0.81541	ATG	GLRA3	-	superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000145451		0.458	GLRA3-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	GLRA3	HGNC	protein_coding	OTTHUMT00000313427.1	-	0.00	43	0	C			175565081	-1	tier1	-	no_errors	ENST00000274093	ensembl	human	known	74_37	missense	46.30	29	25	SNP	1.000	G
GOLGA6L6	727832	genome.wustl.edu	37	15	20740459	20740461	+	In_Frame_Del	DEL	TCG	TCG	-			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	TCG	TCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:20740459_20740461delTCG	ENST00000427390.2	-	8	1379_1381	c.1289_1291delCGA	c.(1288-1293)gcgaag>gag	p.430_431AK>E		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	430	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctccacatcttcgcctcctgctc	0.552																																																	0										16,452		5,6,223							0.0			1	60,546		25,10,268	no	coding	GOLGA6L6	NM_001145004.1		30,16,491	A1A1,A1R,RR		9.901,3.4188,7.0764				76,998				SO:0001651	inframe_deletion	0			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1289_1291delCGA	15.37:g.20740459_20740461delTCG	ENSP00000398615:p.Ala430_Lys431delinsGlu		D3YTC0	In_Frame_Del	DEL	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.AK430in_frame_delE	ENST00000427390.2	37	c.1291_1289	CCDS45184.1	15																																																																																			GOLGA6L6	-	NULL	ENSG00000215405		0.552	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3		0.00	13	0	TCG	NM_001145004		20740461	-1			no_errors	ENST00000427390	ensembl	human	known	74_37	in_frame_del	22.22	28	8	DEL	0.966:0.963:0.960	0
GREB1L	80000	genome.wustl.edu	37	18	19020304	19020304	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr18:19020304G>T	ENST00000580732.2	+	9	1405	c.1024G>T	c.(1024-1026)Ggc>Tgc	p.G342C	GREB1L_ENST00000424526.1_Missense_Mutation_p.G342C|GREB1L_ENST00000400483.4_Missense_Mutation_p.G342C|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000431264.1_Missense_Mutation_p.G342C|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000269218.6_Missense_Mutation_p.G342C			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	342						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CCCCCAACCTGGCTTAGTTGT	0.433																																																	0													127.0	119.0	121.0					18																	19020304		692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1024G>T	18.37:g.19020304G>T	ENSP00000464162:p.Gly342Cys		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.G342C	ENST00000580732.2	37	c.1024	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440884	0.63067	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.14893	3.21;3.21;2.47;2.47	5.48	5.48	0.80851	.	.	.	.	.	T	0.24044	0.0582	L	0.43923	1.385	0.31764	N	0.633017	P;P	0.47409	0.895;0.895	P;P	0.49301	0.606;0.606	T	0.11227	-1.0596	9	0.87932	D	0	-4.2221	12.655	0.56782	0.0756:0.0:0.9244:0.0	.	342;342	Q9C091;Q9C091-2	GRB1L_HUMAN;.	C	342	ENSP00000412060:G342C;ENSP00000269218:G342C;ENSP00000383331:G342C;ENSP00000393125:G342C	ENSP00000269218:G342C	G	+	1	0	GREB1L	17274302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.225000	0.51246	2.580000	0.87095	0.650000	0.86243	GGC	GREB1L	-	NULL	ENSG00000141449		0.433	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	53	0	G	NM_024935		19020304	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	missense	48.86	44	43	SNP	0.999	T
GRIN2B	2904	genome.wustl.edu	37	12	13716394	13716394	+	Silent	SNP	G	G	A	rs200902451		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:13716394G>A	ENST00000609686.1	-	13	3987	c.3778C>T	c.(3778-3780)Ctg>Ttg	p.L1260L		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1260					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGTTCCTGCAGGGAGTTGTCC	0.597																																																	0													74.0	78.0	77.0					12																	13716394		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3778C>T	12.37:g.13716394G>A			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L1260	ENST00000609686.1	37	c.3778	CCDS8662.1	12																																																																																			GRIN2B	-	pfam_NMDAR2_C	ENSG00000273079		0.597	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	-	0.00	31	0	G			13716394	-1	tier1	-	no_errors	ENST00000609686	ensembl	human	known	74_37	silent	56.76	16	21	SNP	1.000	A
GRM7	2917	genome.wustl.edu	37	3	7188296	7188296	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:7188296C>A	ENST00000357716.4	+	2	951	c.677C>A	c.(676-678)tCg>tAg	p.S226*	GRM7_ENST00000389336.4_Nonsense_Mutation_p.S226*|GRM7_ENST00000403881.1_Nonsense_Mutation_p.S226*|GRM7_ENST00000486284.1_Nonsense_Mutation_p.S226*|GRM7_ENST00000402647.2_Nonsense_Mutation_p.S226*	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	226					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						ACCCTCGCATCGGAAGGAAGT	0.512																																																	0													97.0	94.0	95.0					3																	7188296		2203	4300	6503	SO:0001587	stop_gained	0			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.677C>A	3.37:g.7188296C>A	ENSP00000350348:p.Ser226*		Q8NFS2|Q8NFS3|Q8NFS4	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.S226*	ENST00000357716.4	37	c.677	CCDS43042.1	3	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567668	0.65651	.	.	ENSG00000196277	ENST00000448328;ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	.	.	.	5.87	5.87	0.94306	.	0.124433	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1458	0.93467	0.0:1.0:0.0:0.0	.	.	.	.	X	18;226;226;226;226;226;226;226	.	ENSP00000350348:S226X	S	+	2	0	GRM7	7163296	1.000000	0.71417	0.988000	0.46212	0.422000	0.31414	7.776000	0.85560	2.941000	0.99782	0.655000	0.94253	TCG	GRM7	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3	ENSG00000196277		0.512	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	HGNC	protein_coding	OTTHUMT00000246895.3	-	0.00	39	0	C	NM_000844		7188296	+1	tier1	-	no_errors	ENST00000402647	ensembl	human	known	74_37	nonsense	84.38	5	27	SNP	1.000	A
GRM7	2917	genome.wustl.edu	37	3	7456848	7456848	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:7456848C>A	ENST00000357716.4	+	5	1446	c.1172C>A	c.(1171-1173)aCa>aAa	p.T391K	GRM7_ENST00000389336.4_Missense_Mutation_p.T391K|GRM7_ENST00000403881.1_Missense_Mutation_p.T391K|GRM7_ENST00000486284.1_Missense_Mutation_p.T391K|GRM7_ENST00000402647.2_Missense_Mutation_p.T391K	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	391					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						CGCAAATGCACAGGTAATTTA	0.423																																																	0													84.0	79.0	81.0					3																	7456848		2203	4300	6503	SO:0001583	missense	0			U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1172C>A	3.37:g.7456848C>A	ENSP00000350348:p.Thr391Lys		Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_7,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.T391K	ENST00000357716.4	37	c.1172	CCDS43042.1	3	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600993	0.66332	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492;ENST00000445087	D;D;D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24;-2.24;-2.24	5.81	4.93	0.64822	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88343	0.6411	M	0.81497	2.545	0.51233	D	0.999911	P;P;P	0.42078	0.728;0.77;0.521	B;B;B	0.40410	0.297;0.327;0.328	D	0.89711	0.3912	10	0.72032	D	0.01	.	15.4172	0.74980	0.1401:0.8599:0.0:0.0	.	391;391;391	Q14831-5;Q14831;Q14831-2	.;GRM7_HUMAN;.	K	391;391;391;391;391;391;391;48	ENSP00000350348:T391K;ENSP00000417536:T391K;ENSP00000373987:T391K;ENSP00000385664:T391K;ENSP00000384585:T391K;ENSP00000395035:T48K	ENSP00000350348:T391K	T	+	2	0	GRM7	7431848	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.701000	0.84566	1.585000	0.49928	0.655000	0.94253	ACA	GRM7	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000196277		0.423	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM7	HGNC	protein_coding	OTTHUMT00000246895.3	-	0.00	56	0	C	NM_000844		7456848	+1	tier1	-	no_errors	ENST00000402647	ensembl	human	known	74_37	missense	86.11	5	31	SNP	1.000	A
GRM8	2918	genome.wustl.edu	37	7	126883165	126883165	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:126883165G>A	ENST00000339582.2	-	2	902	c.94C>T	c.(94-96)Cac>Tac	p.H32Y	GRM8_ENST00000358373.3_Missense_Mutation_p.H32Y|GRM8_ENST00000405249.1_Missense_Mutation_p.H32Y|GRM8_ENST00000444921.2_Missense_Mutation_p.H32Y			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	32					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TCCTGGCTGTGAGTTCTTTGC	0.527										HNSCC(24;0.065)																																							0													93.0	91.0	92.0					7																	126883165		2203	4300	6503	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.94C>T	7.37:g.126883165G>A	ENSP00000344173:p.His32Tyr		A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4,pfscan_GPCR_3_C	p.H32Y	ENST00000339582.2	37	c.94	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944085	0.34283	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249;ENST00000457830	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	6.17	6.17	0.99709	.	0.195940	0.43747	D	0.000526	T	0.50274	0.1606	L	0.27053	0.805	0.26492	N	0.97493	P;B	0.35575	0.51;0.002	B;B	0.31547	0.132;0.004	T	0.53041	-0.8494	10	0.48119	T	0.1	.	9.8527	0.41066	0.0709:0.0:0.7894:0.1397	.	32;32	O00222-2;O00222	.;GRM8_HUMAN	Y	32	ENSP00000344173:H32Y;ENSP00000409790:H32Y;ENSP00000351142:H32Y;ENSP00000385731:H32Y;ENSP00000415522:H32Y	ENSP00000344173:H32Y	H	-	1	0	GRM8	126670401	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.800000	0.55537	2.941000	0.99782	0.655000	0.94253	CAC	GRM8	-	prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt_4	ENSG00000179603		0.527	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	-	0.00	22	0	G			126883165	-1	tier1	-	no_errors	ENST00000339582	ensembl	human	known	74_37	missense	41.67	21	15	SNP	1.000	A
GRTP1	79774	genome.wustl.edu	37	13	114009757	114009757	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:114009757C>A	ENST00000375431.4	-	3	295	c.221G>T	c.(220-222)cGt>cTt	p.R74L	GRTP1_ENST00000326039.3_5'Flank|GRTP1-AS1_ENST00000419199.1_RNA|GRTP1-AS1_ENST00000423246.1_RNA|GRTP1_ENST00000375430.4_Missense_Mutation_p.R74L	NM_024719.2	NP_078995.2	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	74	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	14	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GACGCGGGCACGGTGCTCCAG	0.667																																																	0													48.0	45.0	46.0					13																	114009757		2203	4300	6503	SO:0001583	missense	0			AK026127	CCDS9534.2, CCDS66591.1, CCDS73606.1	13q34	2011-11-30			ENSG00000139835	ENSG00000139835			20310	protein-coding gene	gene with protein product						11564724	Standard	NM_001286732		Approved	FLJ22474, TBC1D6	uc001vtn.3	Q5TC63	OTTHUMG00000017381	ENST00000375431.4:c.221G>T	13.37:g.114009757C>A	ENSP00000364580:p.Arg74Leu		B9A6K2|Q2M232|Q5TC64|Q66K26|Q6P659|Q8N528|Q9H695	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R74L	ENST00000375431.4	37	c.221	CCDS9534.2	13	.	.	.	.	.	.	.	.	.	.	C	33	5.196815	0.94960	.	.	ENSG00000139835	ENST00000375431;ENST00000375430	T;T	0.33865	1.39;1.39	4.5	4.5	0.54988	Rab-GAP/TBC domain (4);	0.000000	0.85682	U	0.000000	T	0.75729	0.3889	H	0.98980	4.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86605	0.1869	10	0.87932	D	0	.	16.1597	0.81693	0.0:1.0:0.0:0.0	.	74;74	B9A6K2;Q5TC63	.;GRTP1_HUMAN	L	74	ENSP00000364580:R74L;ENSP00000364579:R74L	ENSP00000364579:R74L	R	-	2	0	GRTP1	113057758	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.539000	0.73856	2.332000	0.79248	0.591000	0.81541	CGT	GRTP1	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000139835		0.667	GRTP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	GRTP1	HGNC	protein_coding	OTTHUMT00000045882.5	-	0.00	52	0	C	NM_024719		114009757	-1	tier1	-	no_errors	ENST00000375430	ensembl	human	known	74_37	missense	95.45	1	21	SNP	1.000	A
PEF1	553115	genome.wustl.edu	37	1	32098083	32098083	+	Intron	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:32098083C>A	ENST00000373703.4	-	4	648				HCRTR1_ENST00000373705.1_Silent_p.G378G|PEF1_ENST00000492061.1_5'Flank	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1						proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		CGTGCCCCGGCCATGACCCGC	0.537																																																	0													54.0	54.0	54.0					1																	32098083		2203	4300	6503	SO:0001627	intron_variant	0				CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.625+12G>T	1.37:g.32098083C>A				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.G378	ENST00000373703.4	37	c.1134	CCDS345.1	1																																																																																			HCRTR1	-	NULL	ENSG00000121764		0.537	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011046.1	-	0.00	42	0	C	NM_012392		32098083	+1	tier1	-	no_errors	ENST00000373705	ensembl	human	known	74_37	silent	46.51	23	20	SNP	0.000	A
HCRTR2	3062	genome.wustl.edu	37	6	55128601	55128601	+	Missense_Mutation	SNP	G	G	T	rs199660644		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:55128601G>T	ENST00000370862.3	+	4	1079	c.743G>T	c.(742-744)cGc>cTc	p.R248L		NM_001526.3	NP_001517.2	O43614	OX2R_HUMAN	hypocretin (orexin) receptor 2	248					circadian sleep/wake cycle process (GO:0022410)|feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|orexin receptor activity (GO:0016499)			breast(3)|endometrium(2)|kidney(1)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	46	Lung NSC(77;0.107)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)			CAAATATTTCGCAAACTCTGG	0.368																																																	0													131.0	108.0	116.0					6																	55128601		2203	4300	6503	SO:0001583	missense	0			AF041245	CCDS4956.1	6p12.1	2012-09-20			ENSG00000137252	ENSG00000137252		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4849	protein-coding gene	gene with protein product		602393				9491897	Standard	NM_001526		Approved	OX2R	uc003pcl.3	O43614	OTTHUMG00000016150	ENST00000370862.3:c.743G>T	6.37:g.55128601G>T	ENSP00000359899:p.Arg248Leu		Q5VTM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Orexin_rcpt_2,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt,prints_GPCR_Rhodpsn,prints_Orexin_rcpt_2,prints_NPY_rcpt	p.R248L	ENST00000370862.3	37	c.743	CCDS4956.1	6	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817003	0.50633	.	.	ENSG00000137252	ENST00000370862	T	0.37752	1.18	5.75	5.75	0.90469	GPCR, rhodopsin-like superfamily (1);	0.050304	0.85682	D	0.000000	T	0.30978	0.0782	L	0.49699	1.58	0.45822	D	0.998693	P;P	0.41102	0.505;0.738	B;P	0.52217	0.434;0.693	T	0.04103	-1.0977	10	0.11182	T	0.66	.	14.1313	0.65255	0.0716:0.0:0.9284:0.0	.	248;248	Q548Y0;O43614	.;OX2R_HUMAN	L	248	ENSP00000359899:R248L	ENSP00000359899:R248L	R	+	2	0	HCRTR2	55236560	1.000000	0.71417	0.999000	0.59377	0.924000	0.55760	4.009000	0.57110	2.721000	0.93114	0.603000	0.83216	CGC	HCRTR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Orexin_rcpt	ENSG00000137252		0.368	HCRTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR2	HGNC	protein_coding	OTTHUMT00000043392.1	-	0.00	38	0	G			55128601	+1	tier1	-	no_errors	ENST00000370862	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.998	T
HECTD4	283450	genome.wustl.edu	37	12	112673435	112673435	+	Silent	SNP	T	T	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:112673435T>A	ENST00000430131.2	-	35	5477	c.4332A>T	c.(4330-4332)ggA>ggT	p.G1444G	HECTD4_ENST00000550722.1_Silent_p.G1720G|HECTD4_ENST00000377560.5_Silent_p.G1694G			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1444					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GCTCCACGTTTCCACAGTCTT	0.587																																																	0													49.0	52.0	51.0					12																	112673435		1966	4163	6129	SO:0001819	synonymous_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4332A>T	12.37:g.112673435T>A			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.G1694	ENST00000430131.2	37	c.5082		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.587	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	27	0	T	NM_173813		112673435	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	44.74	21	17	SNP	0.086	A
HIP1	3092	genome.wustl.edu	37	7	75186055	75186055	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:75186055C>A	ENST00000336926.6	-	17	1668	c.1642G>T	c.(1642-1644)Gag>Tag	p.E548*	HIP1_ENST00000434438.2_Nonsense_Mutation_p.E548*	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	548					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						ACCTGAAGCTCCCGTTGGCTT	0.463			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0													116.0	118.0	117.0					7																	75186055		2203	4300	6503	SO:0001587	stop_gained	0			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.1642G>T	7.37:g.75186055C>A	ENSP00000336747:p.Glu548*		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Nonsense_Mutation	SNP	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.E548*	ENST00000336926.6	37	c.1642	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584585	0.86748	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	.	.	.	5.93	5.93	0.95920	.	0.043952	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-30.1925	17.0504	0.86517	0.0:1.0:0.0:0.0	.	.	.	.	X	548	.	ENSP00000336747:E548X	E	-	1	0	HIP1	75023991	1.000000	0.71417	0.962000	0.40283	0.008000	0.06430	4.528000	0.60580	2.797000	0.96272	0.655000	0.94253	GAG	HIP1	-	NULL	ENSG00000127946		0.463	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	-	0.00	24	0	C	NM_005338		75186055	-1	tier1	-	no_errors	ENST00000336926	ensembl	human	known	74_37	nonsense	66.67	6	12	SNP	0.997	A
HIST1H1A	3024	genome.wustl.edu	37	6	26017517	26017517	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:26017517C>G	ENST00000244573.3	-	1	523	c.444G>C	c.(442-444)aaG>aaC	p.K148N		NM_005325.3	NP_005316.1	Q02539	H11_HUMAN	histone cluster 1, H1a	148					nucleosome assembly (GO:0006334)|spermatogenesis (GO:0007283)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)	p.K148N(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|ovary(3)|prostate(1)	13						TCTTGACGCTCTTTTTGCTAG	0.483																																																	1	Substitution - Missense(1)	cervix(1)											141.0	150.0	147.0					6																	26017517		2203	4300	6503	SO:0001583	missense	0			AF531299	CCDS4569.1	6p22.1	2012-11-16	2006-10-11	2003-02-21	ENSG00000124610	ENSG00000124610		"""Histones / Replication-dependent"""	4715	protein-coding gene	gene with protein product		142709	"""H1 histone family, member 1"", ""histone 1, H1a"""	H1F1		2759094, 12408966	Standard	NM_005325		Approved	H1.1, H1a	uc003nfo.3	Q02539	OTTHUMG00000016413	ENST00000244573.3:c.444G>C	6.37:g.26017517C>G	ENSP00000244573:p.Lys148Asn		Q3MJ34	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.K148N	ENST00000244573.3	37	c.444	CCDS4569.1	6	.	.	.	.	.	.	.	.	.	.	N	6.500	0.460520	0.12342	.	.	ENSG00000124610	ENST00000244573	T	0.14516	2.5	4.31	-1.34	0.09143	.	0.480369	0.19100	N	0.122740	T	0.03871	0.0109	L	0.34521	1.04	0.09310	N	1	P	0.46706	0.883	B	0.41860	0.368	T	0.35847	-0.9772	10	0.59425	D	0.04	-8.0238	9.8946	0.41311	0.0:0.6363:0.0:0.3637	.	148	Q02539	H11_HUMAN	N	148	ENSP00000244573:K148N	ENSP00000244573:K148N	K	-	3	2	HIST1H1A	26125496	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.567000	0.05916	-0.158000	0.11040	-0.192000	0.12808	AAG	HIST1H1A	-	NULL	ENSG00000124610		0.483	HIST1H1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1A	HGNC	protein_coding	OTTHUMT00000043884.1	-	0.00	44	0	C	NM_005325		26017517	-1	tier1	-	no_errors	ENST00000244573	ensembl	human	known	74_37	missense	29.63	56	24	SNP	0.024	G
HIST1H2BE	8344	genome.wustl.edu	37	6	26184245	26184245	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:26184245C>T	ENST00000356530.3	+	1	288	c.222C>T	c.(220-222)atC>atT	p.I74I		NM_003523.2	NP_003514.2	P62807	H2B1C_HUMAN	histone cluster 1, H2be	74					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(1)	4						TCGAGCGCATCGCCGGCGAGG	0.607																																																	0													115.0	113.0	114.0					6																	26184245		2203	4300	6503	SO:0001819	synonymous_variant	0			Z80780	CCDS4588.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000197697	ENSG00000274290		"""Histones / Replication-dependent"""	4753	protein-coding gene	gene with protein product		602805	"""H2B histone family, member H"", ""histone 1, H2be"""	H2BFH		9119399, 12408966	Standard	NM_003523		Approved	H2B/h, H2B.h	uc003ngt.3	P62807	OTTHUMG00000014427	ENST00000356530.3:c.222C>T	6.37:g.26184245C>T			P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.I74	ENST00000356530.3	37	c.222	CCDS4588.1	6																																																																																			HIST1H2BE	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000197697		0.607	HIST1H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BE	HGNC	protein_coding	OTTHUMT00000040090.1	-	0.00	98	0	C	NM_003523		26184245	+1	tier1	-	no_errors	ENST00000356530	ensembl	human	known	74_37	silent	41.76	53	38	SNP	1.000	T
HLA-DPB1	3115	genome.wustl.edu	37	6	33048746	33048746	+	Intron	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:33048746C>A	ENST00000418931.2	+	2	480				HLA-DPB1_ENST00000471184.1_Intron|HLA-DPB1_ENST00000535465.1_3'UTR|HLA-DPA1_ENST00000419277.1_5'Flank	NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						GGTCCCAGGGCAGCCCCGCGG	0.697																																																	0													8.0	9.0	9.0					6																	33048746		1489	2661	4150	SO:0001627	intron_variant	0				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.364+34C>A	6.37:g.33048746C>A			A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	RNA	SNP	-	NULL	ENST00000418931.2	37	NULL	CCDS4765.1	6																																																																																			HLA-DPB1	-	-	ENSG00000223865		0.697	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DPB1	HGNC	protein_coding	OTTHUMT00000076106.2	-	0.00	33	0	C	NM_002121		33048746	+1	tier1	-	no_errors	ENST00000478189	ensembl	human	known	74_37	rna	48.57	18	17	SNP	0.000	A
HMCN1	83872	genome.wustl.edu	37	1	186135324	186135324	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:186135324G>A	ENST00000271588.4	+	99	15557	c.15328G>A	c.(15328-15330)Gaa>Aaa	p.E5110K	HMCN1_ENST00000367492.2_Missense_Mutation_p.E5110K	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5110	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGATGAGGATGAATGTGCAGC	0.443																																																	0													77.0	69.0	72.0					1																	186135324		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15328G>A	1.37:g.186135324G>A	ENSP00000271588:p.Glu5110Lys		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.E5110K	ENST00000271588.4	37	c.15328	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.508619	0.96386	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.98849	-5.18;-5.18	5.44	5.44	0.79542	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99420	0.9795	H	0.94734	3.575	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.98600	1.0658	10	0.87932	D	0	.	19.2594	0.93961	0.0:0.0:1.0:0.0	.	5110	Q96RW7	HMCN1_HUMAN	K	5110	ENSP00000271588:E5110K;ENSP00000356462:E5110K	ENSP00000271588:E5110K	E	+	1	0	HMCN1	184401947	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	9.731000	0.98807	2.556000	0.86216	0.650000	0.86243	GAA	HMCN1	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000143341		0.443	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	55	0	G	NM_031935		186135324	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	33.85	43	22	SNP	1.000	A
HOXD3	3232	genome.wustl.edu	37	2	177034035	177034035	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:177034035G>T	ENST00000468418.3	+	3	2283	c.193G>T	c.(193-195)Ggt>Tgt	p.G65C	HOXD3_ENST00000410016.1_Missense_Mutation_p.G65C|HOXD3_ENST00000249440.3_Missense_Mutation_p.G65C			P31249	HXD3_HUMAN	homeobox D3	65					anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|embryonic skeletal system morphogenesis (GO:0048704)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron differentiation (GO:0045666)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(11)|prostate(1)|upper_aerodigestive_tract(2)	23			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		TGACTATCCAGGTTCTGCCTG	0.617																																																	0													72.0	72.0	72.0					2																	177034035		2203	4300	6503	SO:0001583	missense	0				CCDS2270.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128652	ENSG00000128652		"""Homeoboxes / ANTP class : HOXL subclass"""	5137	protein-coding gene	gene with protein product		142980	"""homeo box D3"""	HOX4A, HOX4, HOX1D		1973146, 1358459	Standard	NM_006898		Approved		uc002ukt.1	P31249	OTTHUMG00000132517	ENST00000468418.3:c.193G>T	2.37:g.177034035G>T	ENSP00000424734:p.Gly65Cys		Q99955|Q9BSC5	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G65C	ENST00000468418.3	37	c.193	CCDS2270.1	2	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472673	0.43942	.	.	ENSG00000128652	ENST00000432796;ENST00000468418;ENST00000410016;ENST00000249440	D;D;D	0.89810	-2.57;-2.57;-2.57	5.48	3.66	0.41972	.	0.142993	0.64402	D	0.000004	D	0.89298	0.6675	L	0.55481	1.735	0.33371	D	0.573537	D	0.67145	0.996	P	0.54372	0.75	D	0.90883	0.4755	10	0.66056	D	0.02	.	8.9753	0.35932	0.2286:0.0:0.7714:0.0	.	65	P31249	HXD3_HUMAN	C	65	ENSP00000424734:G65C;ENSP00000386498:G65C;ENSP00000249440:G65C	ENSP00000249440:G65C	G	+	1	0	HOXD3	176742281	0.008000	0.16893	0.709000	0.30452	0.986000	0.74619	0.111000	0.15458	0.773000	0.33404	0.655000	0.94253	GGT	HOXD3	-	NULL	ENSG00000128652		0.617	HOXD3-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	HOXD3	HGNC	protein_coding	OTTHUMT00000334246.4	-	0.00	47	0	G			177034035	+1	tier1	-	no_errors	ENST00000249440	ensembl	human	known	74_37	missense	88.89	4	32	SNP	0.945	T
HSP90AA4P	3323	genome.wustl.edu	37	4	190395328	190395328	+	RNA	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:190395328C>A	ENST00000378770.1	+	0	608							Q58FG1	HS904_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 4, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)										AAATATTTTCCGTGAGATGTT	0.388																																																	0																																												0					4q35.2	2011-04-15	2011-04-15	2006-02-24	ENSG00000205100	ENSG00000205100			5255	pseudogene	pseudogene			"""heat shock 90kD protein 1, alpha-like 2"", ""heat shock 90kDa protein 1, alpha-like 2"""	HSPCAL2		1740332, 16269234	Standard	NG_003014		Approved			Q58FG1	OTTHUMG00000160204		4.37:g.190395328C>A				RNA	SNP	-	NULL	ENST00000378770.1	37	NULL		4																																																																																			HSP90AA4P	-	-	ENSG00000205100		0.388	HSP90AA4P-002	KNOWN	basic	processed_transcript	HSP90AA4P	HGNC	pseudogene	OTTHUMT00000359634.1	-	0.00	31	0	C	NG_003014		190395328	+1	tier1	-	no_errors	ENST00000378770	ensembl	human	known	74_37	rna	40.00	24	16	SNP	0.995	A
HYDIN	54768	genome.wustl.edu	37	16	70874024	70874024	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:70874024C>A	ENST00000393567.2	-	76	13136	c.12986G>T	c.(12985-12987)gGg>gTg	p.G4329V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4329					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGGGGCATCCCAGCTTGATA	0.473																																																	0													4.0	4.0	4.0					16																	70874024		1482	3630	5112	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12986G>T	16.37:g.70874024C>A	ENSP00000377197:p.Gly4329Val		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.G4329V	ENST00000393567.2	37	c.12986	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339089	0.81911	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.01099	5.34	5.59	5.59	0.84812	.	0.000000	0.33534	U	0.004815	T	0.05686	0.0149	M	0.73598	2.24	0.80722	D	1	P	0.46277	0.875	P	0.56514	0.8	T	0.48246	-0.9052	10	0.30854	T	0.27	.	19.1717	0.93580	0.0:1.0:0.0:0.0	.	4328	F8WD23	.	V	4329;4328	ENSP00000377197:G4329V	ENSP00000313052:G4328V	G	-	2	0	HYDIN	69431525	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.007000	0.63984	2.634000	0.89283	0.505000	0.49811	GGG	HYDIN	-	NULL	ENSG00000157423		0.473	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	30	0	C			70874024	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	48.72	20	19	SNP	1.000	A
HYDIN	54768	genome.wustl.edu	37	16	70891651	70891651	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:70891651G>T	ENST00000393567.2	-	72	12402	c.12252C>A	c.(12250-12252)atC>atA	p.I4084I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4084					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGTTCAGAGAGATGAGAGGTT	0.483																																																	0													183.0	206.0	198.0					16																	70891651		2012	4199	6211	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.12252C>A	16.37:g.70891651G>T			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_P-loop_NTPase,superfamily_PapD-like	p.I4084	ENST00000393567.2	37	c.12252	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.483	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	-	0.00	77	0	G			70891651	-1	tier1	-	no_errors	ENST00000393567	ensembl	human	putative	74_37	silent	24.04	79	25	SNP	0.992	T
IL12RB1	3594	genome.wustl.edu	37	19	18170809	18170809	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:18170809G>T	ENST00000600835.2	-	17	2176	c.1878C>A	c.(1876-1878)ggC>ggA	p.G626G	IL12RB1_ENST00000593993.2_Silent_p.G626G			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	626					cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						CAGTCCTCTCGCCTTTGTCCC	0.597																																																	0													43.0	44.0	44.0					19																	18170809		1981	4155	6136	SO:0001819	synonymous_variant	0			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1878C>A	19.37:g.18170809G>T			A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G626	ENST00000600835.2	37	c.1878	CCDS54232.1	19																																																																																			IL12RB1	-	NULL	ENSG00000096996		0.597	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB1	HGNC	protein_coding	OTTHUMT00000466525.3	-	0.00	25	0	G			18170809	-1	tier1	-	no_errors	ENST00000593993	ensembl	human	known	74_37	silent	36.84	24	14	SNP	0.000	T
IGSF23	147710	genome.wustl.edu	37	19	45127033	45127033	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:45127033C>A	ENST00000402988.1	+	2	171	c.155C>A	c.(154-156)cCa>cAa	p.P52Q		NM_001205280.1	NP_001192209.1	A1L1A6	IGS23_HUMAN	immunoglobulin superfamily, member 23	52	Ig-like.					integral component of membrane (GO:0016021)											AAGACATTCCCAGCTGCTATC	0.532																																																	0																																										SO:0001583	missense	0				CCDS54277.1	19q13.31	2013-01-11			ENSG00000216588	ENSG00000216588		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	40040	protein-coding gene	gene with protein product							Standard	NM_001205280		Approved		uc021uvj.1	A1L1A6	OTTHUMG00000151531	ENST00000402988.1:c.155C>A	19.37:g.45127033C>A	ENSP00000385592:p.Pro52Gln			Missense_Mutation	SNP	pfscan_Ig-like_dom	p.P52Q	ENST00000402988.1	37	c.155	CCDS54277.1	19	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197369	0.38806	.	.	ENSG00000216588	ENST00000402988	T	0.51325	0.71	3.21	1.05	0.20165	.	.	.	.	.	T	0.51449	0.1675	M	0.70275	2.135	0.09310	N	1	.	.	.	.	.	.	T	0.48843	-0.8999	7	0.87932	D	0	-5.4354	5.5903	0.17297	0.0:0.7398:0.0:0.2602	.	.	.	.	Q	52	ENSP00000385592:P52Q	ENSP00000385592:P52Q	P	+	2	0	IGSF23	49818873	0.015000	0.18098	0.016000	0.15963	0.156000	0.22039	0.914000	0.28624	0.390000	0.25115	0.561000	0.74099	CCA	IGSF23	-	pfscan_Ig-like_dom	ENSG00000216588		0.532	IGSF23-003	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IGSF23	HGNC	protein_coding	OTTHUMT00000323031.1	-	0.00	69	0	C	NM_001205280		45127033	+1	tier1	-	no_errors	ENST00000402988	ensembl	human	known	74_37	missense	87.23	6	41	SNP	0.015	A
IL1RAPL1	11141	genome.wustl.edu	37	X	29301329	29301329	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:29301329C>A	ENST00000378993.1	+	3	1030	c.357C>A	c.(355-357)gtC>gtA	p.V119V	IL1RAPL1_ENST00000302196.4_Silent_p.V119V	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	119	Ig-like C2-type 1.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						ACGCCTGTGTCATCAGGTATC	0.438																																																	0													75.0	66.0	69.0					X																	29301329		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.357C>A	X.37:g.29301329C>A			A0AVG4|Q9UJ53	Silent	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.V119	ENST00000378993.1	37	c.357	CCDS14218.1	X																																																																																			IL1RAPL1	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000169306		0.438	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	-	0.00	17	0	C	NM_014271		29301329	+1	tier1	-	no_errors	ENST00000302196	ensembl	human	known	74_37	silent	92.59	2	25	SNP	0.989	A
IL1RAPL2	26280	genome.wustl.edu	37	X	104992962	104992962	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:104992962A>C	ENST00000372582.1	+	9	1814	c.1058A>C	c.(1057-1059)tAt>tCt	p.Y353S	IL1RAPL2_ENST00000485671.1_3'UTR|IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.Y353S	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	353					central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						GATTTAATCTATAAAATTGAG	0.383																																																	0													85.0	76.0	79.0					X																	104992962		2203	4300	6503	SO:0001583	missense	0			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1058A>C	X.37:g.104992962A>C	ENSP00000361663:p.Tyr353Ser		Q2M3U3|Q9NZN0	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom,prints_IL-1_rcpt_II-typ	p.Y353S	ENST00000372582.1	37	c.1058	CCDS14517.1	X	.	.	.	.	.	.	.	.	.	.	A	16.55	3.155348	0.57259	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.03663	3.85;3.85	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000008	T	0.07954	0.0199	M	0.83483	2.645	0.80722	D	1	B	0.27498	0.18	B	0.20577	0.03	T	0.08764	-1.0706	10	0.25751	T	0.34	.	14.2521	0.66026	1.0:0.0:0.0:0.0	.	353	Q9NP60	IRPL2_HUMAN	S	353	ENSP00000361663:Y353S;ENSP00000344976:Y353S	ENSP00000344976:Y353S	Y	+	2	0	IL1RAPL2	104879618	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.003000	0.76310	1.964000	0.57103	0.481000	0.45027	TAT	IL1RAPL2	-	NULL	ENSG00000189108		0.383	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL2	HGNC	protein_coding	OTTHUMT00000057785.1	-	0.00	40	0	A	NM_017416		104992962	+1	tier1	-	no_errors	ENST00000344799	ensembl	human	known	74_37	missense	93.62	3	44	SNP	1.000	C
IMPG1	3617	genome.wustl.edu	37	6	76640719	76640719	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:76640719G>T	ENST00000369950.3	-	15	2383	c.2194C>A	c.(2194-2196)Cct>Act	p.P732T	IMPG1_ENST00000369963.3_3'UTR|Y_RNA_ENST00000363170.1_RNA	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TTTGTGCCAGGGCCACAGAGG	0.547																																					Pancreas(37;839 1141 2599 26037)												0													122.0	107.0	112.0					6																	76640719		2203	4300	6503	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.2194C>A	6.37:g.76640719G>T	ENSP00000358966:p.Pro732Thr			Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.P732T	ENST00000369950.3	37	c.2194	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	G	11.13	1.546734	0.27652	.	.	ENSG00000112706	ENST00000369950;ENST00000369952	T;T	0.20069	2.1;2.18	5.45	-0.41	0.12374	.	0.232244	0.29159	N	0.012974	T	0.03608	0.0103	L	0.43923	1.385	0.09310	N	1	P	0.39094	0.659	B	0.31101	0.124	T	0.33727	-0.9857	10	0.42905	T	0.14	.	0.9289	0.01331	0.1814:0.2213:0.3562:0.2411	.	732	Q17R60	IMPG1_HUMAN	T	732;93	ENSP00000358966:P732T;ENSP00000358968:P93T	ENSP00000358966:P732T	P	-	1	0	IMPG1	76697439	0.985000	0.35326	0.000000	0.03702	0.006000	0.05464	2.963000	0.49184	0.011000	0.14865	0.461000	0.40582	CCT	IMPG1	-	NULL	ENSG00000112706		0.547	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	-	0.00	44	0	G	NM_001563		76640719	-1	tier1	-	no_errors	ENST00000369950	ensembl	human	known	74_37	missense	34.78	30	16	SNP	0.000	T
INHBE	83729	genome.wustl.edu	37	12	57850479	57850479	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:57850479C>T	ENST00000266646.2	+	2	1117	c.901C>T	c.(901-903)Ctc>Ttc	p.L301F	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	301					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						CGTCTTCAGCCTCCTCAAAGC	0.587											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(191;1808 2166 15720 36624 50371)												0													119.0	88.0	98.0					12																	57850479		2203	4300	6503	SO:0001583	missense	0				CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.901C>T	12.37:g.57850479C>T	ENSP00000266646:p.Leu301Phe	1026		Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaC,prints_Inhibin_asu	p.L301F	ENST00000266646.2	37	c.901	CCDS8939.1	12	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966183	0.74131	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	T;T	0.67171	-0.25;-0.25	4.79	4.79	0.61399	Transforming growth factor-beta, C-terminal (3);	0.222920	0.39020	N	0.001482	T	0.79417	0.4442	M	0.80183	2.485	0.47374	D	0.999407	D	0.56287	0.975	D	0.63283	0.913	T	0.81430	-0.0936	10	0.72032	D	0.01	-10.4502	11.274	0.49155	0.0:0.9119:0.0:0.0881	.	301	P58166	INHBE_HUMAN	F	246;301	ENSP00000450212:L246F;ENSP00000266646:L301F	ENSP00000266646:L301F	L	+	1	0	INHBE	56136746	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.892000	0.69790	2.653000	0.90120	0.655000	0.94253	CTC	INHBE	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000139269		0.587	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBE	HGNC	protein_coding	OTTHUMT00000406773.1	-	0.00	18	0	C	NM_031479		57850479	+1	tier1	-	no_errors	ENST00000266646	ensembl	human	known	74_37	missense	41.67	13	10	SNP	1.000	T
INPP5F	22876	genome.wustl.edu	37	10	121565957	121565957	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:121565957C>T	ENST00000361976.2	+	12	1571	c.1405C>T	c.(1405-1407)Caa>Taa	p.Q469*		NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	778	5-phosphatase.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		CAACGTGGTCCAAGCTGCCAT	0.413																																																	0													100.0	97.0	98.0					10																	121565957		2203	4300	6503	SO:0001587	stop_gained	0			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1405C>T	10.37:g.121565957C>T	ENSP00000354519:p.Gln469*		A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Nonsense_Mutation	SNP	pfam_Syja_N,pfam_Inositol_phosphatase,pfscan_Syja_N	p.Q469*	ENST00000361976.2	37	c.1405	CCDS7616.1	10	.	.	.	.	.	.	.	.	.	.	C	40	8.025039	0.98616	.	.	ENSG00000198825	ENST00000361976	.	.	.	5.5	5.5	0.81552	.	0.123586	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.0005	19.425	0.94737	0.0:1.0:0.0:0.0	.	.	.	.	X	469	.	ENSP00000354519:Q469X	Q	+	1	0	INPP5F	121555947	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.678000	0.84035	2.584000	0.87258	0.563000	0.77884	CAA	INPP5F	-	pfscan_Syja_N	ENSG00000198825		0.413	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	HGNC	protein_coding	OTTHUMT00000050679.1	-	0.00	47	0	C	NM_014937		121565957	+1	tier1	-	no_errors	ENST00000361976	ensembl	human	known	74_37	nonsense	87.50	3	21	SNP	1.000	T
ITGAD	3681	genome.wustl.edu	37	16	31426246	31426246	+	Silent	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:31426246C>G	ENST00000389202.2	+	18	2266	c.2217C>G	c.(2215-2217)ccC>ccG	p.P739P		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	739					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TGAGAGAGCCCATCCCCTCCC	0.562																																																	0													139.0	119.0	126.0					16																	31426246		2197	4300	6497	SO:0001819	synonymous_variant	0			U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.2217C>G	16.37:g.31426246C>G			Q15575|Q15576	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.P739	ENST00000389202.2	37	c.2217	CCDS32438.1	16																																																																																			ITGAD	-	pfam_Integrin_alpha-2	ENSG00000156886		0.562	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	HGNC	protein_coding	OTTHUMT00000432836.1	-	0.00	41	0	C	NM_005353		31426246	+1	tier1	-	no_errors	ENST00000389202	ensembl	human	known	74_37	silent	44.44	25	20	SNP	0.102	G
ITK	3702	genome.wustl.edu	37	5	156679678	156679678	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:156679678C>A	ENST00000422843.3	+	17	2005	c.1853C>A	c.(1852-1854)tCa>tAa	p.S618*	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	618					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	ATTGCAGAATCAGGACTTTAG	0.498			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													98.0	102.0	101.0					5																	156679678		2203	4300	6503	SO:0001587	stop_gained	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1853C>A	5.37:g.156679678C>A	ENSP00000398655:p.Ser618*		B2R752|Q32ML7	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.S618*	ENST00000422843.3	37	c.1853	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.828882	0.97869	.	.	ENSG00000113263	ENST00000422843	.	.	.	5.69	0.601	0.17529	.	0.860725	0.10397	N	0.679619	.	.	.	.	.	.	0.29614	N	0.84674	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	6.1581	0.20348	0.0:0.5452:0.2535:0.2013	.	.	.	.	X	618	.	ENSP00000398655:S618X	S	+	2	0	ITK	156612256	0.008000	0.16893	0.137000	0.22149	0.941000	0.58515	0.079000	0.14782	0.078000	0.16900	0.561000	0.74099	TCA	ITK	-	NULL	ENSG00000113263		0.498	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	37	0	C			156679678	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	nonsense	100.00	0	14	SNP	0.388	A
JAKMIP1	152789	genome.wustl.edu	37	4	6050609	6050610	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:6050609_6050610CC>AA	ENST00000409021.3	-	16	2451_2452	c.2002_2003GG>TT	c.(2002-2004)GGa>TTa	p.G668L	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.G483L	NM_001099433.1	NP_001092903.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	0					cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						AAGCACAGTTCCAGCTTGGATT	0.465																																																	0																																										SO:0001583	missense	0			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000409021.3:c.2002_2003delinsAA	4.37:g.6050609_6050610delinsAA	ENSP00000386711:p.Gly668Leu		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation|Nonsense_Mutation	SNP	NULL	p.G668V|p.G668*	ENST00000409021.3	37	c.2003|c.2002	CCDS47005.1	4																																																																																			JAKMIP1	-	NULL	ENSG00000152969		0.465	JAKMIP1-003	KNOWN	basic|CCDS	protein_coding	JAKMIP1	HGNC	protein_coding	OTTHUMT00000329747.1	-	0.00	54|56	0	C	NM_144720		6050609|6050610	-1	tier1	-	no_errors	ENST00000409021	ensembl	human	known	74_37	missense|nonsense	86.21|85.71	4	25|24	SNP	1.000|0.991	A
JMJD6	23210	genome.wustl.edu	37	17	74714728	74714728	+	3'UTR	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:74714728C>T	ENST00000397625.4	-	0	1409				JMJD6_ENST00000445478.2_Intron|JMJD6_ENST00000585429.1_Missense_Mutation_p.D386N	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6						cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						CTCCCCTTGTCTGCAGGACTG	0.612																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.*83G>A	17.37:g.74714728C>T			B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.D386N	ENST00000397625.4	37	c.1156	CCDS42384.1	17																																																																																			JMJD6	-	NULL	ENSG00000070495		0.612	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD6	HGNC	protein_coding	OTTHUMT00000403211.1	-	0.00	30	0	C	NM_015167		74714728	-1	tier1	-	no_errors	ENST00000585429	ensembl	human	putative	74_37	missense	20.00	40	10	SNP	0.004	T
JMJD6	23210	genome.wustl.edu	37	17	74714927	74714927	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:74714927C>G	ENST00000397625.4	-	6	1210	c.1096G>C	c.(1096-1098)Gag>Cag	p.E366Q	JMJD6_ENST00000445478.2_Missense_Mutation_p.E366Q|JMJD6_ENST00000585429.1_Silent_p.P319P	NM_015167.2	NP_055982.2	Q6NYC1	JMJD6_HUMAN	jumonji domain containing 6	366					cell surface receptor signaling pathway (GO:0007166)|erythrocyte development (GO:0048821)|heart development (GO:0007507)|histone H3-R2 demethylation (GO:0070078)|histone H4-R3 demethylation (GO:0070079)|kidney development (GO:0001822)|lung development (GO:0030324)|macrophage activation (GO:0042116)|mRNA processing (GO:0006397)|peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine (GO:0018395)|recognition of apoptotic cell (GO:0043654)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|RNA splicing (GO:0008380)|sprouting angiogenesis (GO:0002040)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone demethylase activity (H3-R2 specific) (GO:0033746)|histone demethylase activity (H4-R3 specific) (GO:0033749)|identical protein binding (GO:0042802)|iron ion binding (GO:0005506)|peptidyl-lysine 5-dioxygenase activity (GO:0070815)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			endometrium(2)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|skin(2)	16						CCATCGCCCTCGGATCCAGAC	0.567																																																	0													73.0	77.0	76.0					17																	74714927		2116	4226	6342	SO:0001583	missense	0			AB011157	CCDS42383.1, CCDS42384.1	17q25	2007-11-20	2007-02-16	2007-02-16	ENSG00000070495	ENSG00000070495			19355	protein-coding gene	gene with protein product		604914	"""phosphatidylserine receptor"""	PTDSR		11877474	Standard	NM_015167		Approved	PTDSR1, KIAA0585	uc002jsn.1	Q6NYC1	OTTHUMG00000169267	ENST00000397625.4:c.1096G>C	17.37:g.74714927C>G	ENSP00000380750:p.Glu366Gln		B3KMN8|B4DGX1|Q86VY0|Q8IUM5|Q9Y4E2	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.E366Q	ENST00000397625.4	37	c.1096	CCDS42384.1	17	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706870	0.89018	.	.	ENSG00000070495	ENST00000445478;ENST00000397625	.	.	.	6.02	6.02	0.97574	.	0.048136	0.85682	D	0.000000	T	0.73321	0.3572	M	0.63843	1.955	0.80722	D	1	P;D	0.56521	0.929;0.976	P;P	0.56343	0.535;0.796	T	0.65994	-0.6033	9	0.22109	T	0.4	-28.8538	20.5407	0.99260	0.0:1.0:0.0:0.0	.	366;366	Q6NYC1;Q6NYC1-3	JMJD6_HUMAN;.	Q	366	.	ENSP00000380750:E366Q	E	-	1	0	JMJD6	72226522	1.000000	0.71417	0.945000	0.38365	0.885000	0.51271	7.298000	0.78815	2.865000	0.98341	0.655000	0.94253	GAG	JMJD6	-	NULL	ENSG00000070495		0.567	JMJD6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD6	HGNC	protein_coding	OTTHUMT00000403211.1	-	0.00	61	0	C	NM_015167		74714927	-1	tier1	-	no_errors	ENST00000445478	ensembl	human	known	74_37	missense	29.77	92	39	SNP	1.000	G
KANK1	23189	genome.wustl.edu	37	9	734666	734666	+	Intron	DEL	A	A	-	rs77731420		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:734666delA	ENST00000382303.1	+	11	3897				KANK1_ENST00000382297.2_Intron|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Intron	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1						negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		accctgtctcaaaaaaaaaaT	0.423																																																	0																																										SO:0001627	intron_variant	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3246-82A>-	9.37:g.734666delA			A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	RNA	DEL	-	NULL	ENST00000382303.1	37	NULL	CCDS34976.1	9																																																																																			KANK1	-	-	ENSG00000107104		0.423	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2		0.00	33	0	A	NM_015158		734666	+1	tier1		no_errors	ENST00000489369	ensembl	human	known	74_37	rna	25.00	12	4	DEL	0.002	-
KDELC1	79070	genome.wustl.edu	37	13	103443452	103443452	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:103443452C>A	ENST00000376004.4	-	6	1218	c.882G>T	c.(880-882)acG>acT	p.T294T	KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	294						endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					AGGGAGGACCCGTGTTAGCTT	0.478																																																	0													76.0	79.0	78.0					13																	103443452		2203	4300	6503	SO:0001819	synonymous_variant	0			BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.882G>T	13.37:g.103443452C>A			Q53HL3|Q9BVD2	Silent	SNP	pfam_LipoPS_modifying,pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,smart_LipoPS_modifying,pfscan_Filamin/ABP280_repeat-like	p.T294	ENST00000376004.4	37	c.882	CCDS9504.1	13																																																																																			KDELC1	-	pfam_LipoPS_modifying,smart_LipoPS_modifying	ENSG00000134901		0.478	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC1	HGNC	protein_coding	OTTHUMT00000045699.1	-	0.00	19	0	C			103443452	-1	tier1	-	no_errors	ENST00000376004	ensembl	human	known	74_37	silent	82.35	3	14	SNP	0.192	A
KIAA1324L	222223	genome.wustl.edu	37	7	86577054	86577054	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:86577054G>C	ENST00000450689.2	-	3	680	c.495C>G	c.(493-495)gaC>gaG	p.D165E	KIAA1324L_ENST00000444627.1_Missense_Mutation_p.D165E|KIAA1324L_ENST00000416314.1_Intron	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	165						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					TGTTACAGCCGTCTGGCCTGC	0.433																																																	0													74.0	61.0	65.0					7																	86577054		692	1591	2283	SO:0001583	missense	0			AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.495C>G	7.37:g.86577054G>C	ENSP00000413445:p.Asp165Glu		A4D1C9|B4DJV3|Q17RI6|Q96DP2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt_N_dom	p.D165E	ENST00000450689.2	37	c.495	CCDS47632.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.745|8.745	0.919786|0.919786	0.17982|0.17982	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000450689;ENST00000444627;ENST00000398276;ENST00000425689|ENST00000423294	T;T;T;T|.	0.29655|.	1.56;1.56;1.56;1.56|.	5.82|5.82	-3.31|-3.31	0.04988|0.04988	.|.	1.175590|.	0.07355|.	U|.	0.883016|.	T|T	0.42562|0.42562	0.1208|0.1208	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B|.	0.12630|.	0.006|.	B|.	0.12156|.	0.007|.	T|T	0.22208|0.22208	-1.0223|-1.0223	10|5	0.05436|.	T|.	0.98|.	.|.	9.5906|9.5906	0.39543|0.39543	0.3057:0.1068:0.5875:0.0|0.3057:0.1068:0.5875:0.0	.|.	165|.	A8MWY0|.	K132L_HUMAN|.	E|G	165;165;51;51|126	ENSP00000413445:D165E;ENSP00000397377:D165E;ENSP00000381325:D51E;ENSP00000410045:D51E|.	ENSP00000381325:D51E|.	D|R	-|-	3|1	2|2	KIAA1324L|KIAA1324L	86414990|86414990	0.925000|0.925000	0.31364|0.31364	0.943000|0.943000	0.38184|0.38184	0.990000|0.990000	0.78478|0.78478	0.001000|0.001000	0.13038|0.13038	-0.584000|-0.584000	0.05913|0.05913	-0.225000|-0.225000	0.12378|0.12378	GAC|CGG	KIAA1324L	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000164659		0.433	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1324L	HGNC	protein_coding	OTTHUMT00000333372.3	-	0.00	17	0	G	NM_152748		86577054	-1	tier1	-	no_errors	ENST00000450689	ensembl	human	known	74_37	missense	47.83	12	11	SNP	0.988	C
KIF13B	23303	genome.wustl.edu	37	8	28981543	28981543	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:28981543C>A	ENST00000524189.1	-	27	3388	c.3350G>T	c.(3349-3351)cGt>cTt	p.R1117L	CTD-2647L4.1_ENST00000523661.1_RNA	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1117					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TTTCCTACCACGTTTACTGAC	0.363																																																	0													159.0	138.0	145.0					8																	28981543		1847	4095	5942	SO:0001583	missense	0			AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.3350G>T	8.37:g.28981543C>A	ENSP00000427900:p.Arg1117Leu		B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1117L	ENST00000524189.1	37	c.3350	CCDS55217.1	8	.	.	.	.	.	.	.	.	.	.	C	9.903	1.207391	0.22205	.	.	ENSG00000197892	ENST00000524189	T	0.75821	-0.97	5.14	-4.63	0.03359	.	0.486110	0.24592	N	0.037214	T	0.48589	0.1508	N	0.08118	0	0.80722	D	1	B	0.16603	0.018	B	0.26094	0.066	T	0.04281	-1.0963	10	0.36615	T	0.2	.	9.6747	0.40034	0.0:0.1468:0.518:0.3351	.	1117	F8VPJ2	.	L	1117	ENSP00000427900:R1117L	ENSP00000427900:R1117L	R	-	2	0	KIF13B	29037462	0.683000	0.27633	0.985000	0.45067	0.443000	0.32047	0.220000	0.17660	-0.469000	0.06911	-1.326000	0.01283	CGT	KIF13B	-	NULL	ENSG00000197892		0.363	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	HGNC	protein_coding	OTTHUMT00000376878.1		0.00	33	0	C			28981543	-1			no_errors	ENST00000524189	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.960	A
KIF17	57576	genome.wustl.edu	37	1	20990952	20990952	+	3'UTR	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:20990952G>C	ENST00000247986.2	-	0	3525				KIF17_ENST00000400463.3_3'UTR|DDOST_ENST00000375048.3_5'Flank|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_3'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17						ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCTTCCCAGGGCTGAGGGAGC	0.657																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.*125C>G	1.37:g.20990952G>C			A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	RNA	SNP	-	NULL	ENST00000247986.2	37	NULL	CCDS213.1	1																																																																																			KIF17	-	-	ENSG00000117245		0.657	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1	-	0.00	19	0	G	NM_020816		20990952	-1	tier1	-	no_errors	ENST00000477167	ensembl	human	known	74_37	rna	43.48	13	10	SNP	0.077	C
KIR3DX1	90011	genome.wustl.edu	37	19	55053772	55053772	+	Intron	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:55053772G>T	ENST00000335056.3	+	7	1037				KIR3DX1_ENST00000482404.1_Intron			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1							extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		ACCTGCATATGCTCACTGGAC	0.468																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0													145.0	139.0	141.0					19																	55053772		2060	4202	6262	SO:0001627	intron_variant	0			BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.1000-813G>T	19.37:g.55053772G>T			B7WNL0|Q8N0S4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.C347F	ENST00000335056.3	37	c.1040		19																																																																																			KIR3DX1	-	NULL	ENSG00000104970		0.468	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	HGNC	protein_coding	OTTHUMT00000140800.2	-	0.00	61	0	G	NR_026716		55053772	+1	tier1	-	no_errors	ENST00000221567	ensembl	human	known	74_37	missense	44.00	28	22	SNP	0.000	T
KNDC1	85442	genome.wustl.edu	37	10	135015190	135015190	+	Missense_Mutation	SNP	G	G	T	rs138733656		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:135015190G>T	ENST00000304613.3	+	17	3196	c.3175G>T	c.(3175-3177)Ggg>Tgg	p.G1059W	KNDC1_ENST00000368572.2_Missense_Mutation_p.G1061W|KNDC1_ENST00000368571.2_Missense_Mutation_p.G994W			Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND) containing 1	1059					cerebellar granule cell differentiation (GO:0021707)|positive regulation of protein phosphorylation (GO:0001934)|regulation of dendrite morphogenesis (GO:0048814)|small GTPase mediated signal transduction (GO:0007264)	dendrite (GO:0030425)|guanyl-nucleotide exchange factor complex (GO:0032045)|neuronal cell body (GO:0043025)	protein serine/threonine kinase activity (GO:0004674)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			NS(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(27)|ovary(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	60		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GCCAGCTGGCGGGGCCTCAGA	0.687																																																	0													26.0	32.0	30.0					10																	135015190		2202	4299	6501	SO:0001583	missense	0			AK074179	CCDS7674.1	10q26.3	2004-09-14	2004-04-07		ENSG00000171798	ENSG00000171798			29374	protein-coding gene	gene with protein product			"""RasGEF domain family, member 2"""	RASGEF2, C10orf23		11214970	Standard	NM_152643		Approved	KIAA1768, bB439H18.3, FLJ25027	uc001llz.1	Q76NI1	OTTHUMG00000019303	ENST00000304613.3:c.3175G>T	10.37:g.135015190G>T	ENSP00000304437:p.Gly1059Trp		B0QZC5|Q5T233|Q6ZNH8|Q8TEE5|Q96LV7|Q9C095	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_Kinase-like_dom,smart_KIND,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.G1061W	ENST00000304613.3	37	c.3181	CCDS7674.1	10	.	.	.	.	.	.	.	.	.	.	G	13.59	2.283255	0.40394	.	.	ENSG00000171798	ENST00000304613;ENST00000368572;ENST00000368571	T;T;T	0.11712	2.75;2.75;2.75	3.35	-0.811	0.10857	.	1.969230	0.02647	N	0.105940	T	0.25344	0.0616	L	0.54323	1.7	0.09310	N	1	D;D;D	0.76494	0.999;0.998;0.998	D;D;P	0.74674	0.984;0.937;0.902	T	0.13124	-1.0521	10	0.87932	D	0	-3.586	3.8956	0.09138	0.4536:0.1832:0.3632:0.0	.	1059;994;1059	Q76NI1-4;Q76NI1-2;Q76NI1	.;.;VKIND_HUMAN	W	1059;1061;994	ENSP00000304437:G1059W;ENSP00000357561:G1061W;ENSP00000357560:G994W	ENSP00000304437:G1059W	G	+	1	0	KNDC1	134865180	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.014000	0.12656	-0.287000	0.09064	0.313000	0.20887	GGG	KNDC1	-	NULL	ENSG00000171798		0.687	KNDC1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	KNDC1	HGNC	protein_coding	OTTHUMT00000277044.3	-	0.00	20	0	G	NM_152643		135015190	+1	tier1	-	no_errors	ENST00000368572	ensembl	human	known	74_37	missense	61.11	7	11	SNP	0.000	T
KRTAP5-11	440051	genome.wustl.edu	37	11	71293036	71293036	+	3'UTR	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:71293036G>T	ENST00000398530.1	-	0	885				KRTAP5-11_ENST00000526239.1_5'UTR|AP000867.1_ENST00000343767.3_3'UTR	NM_001005405.2	NP_001005405.1	Q6L8G4	KR511_HUMAN	keratin associated protein 5-11							keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						AGCCCAGGAGGACCCAGAATC	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB126080	CCDS41685.1	11q13.4	2008-11-06			ENSG00000204571	ENSG00000204571		"""Keratin associated proteins"""	23606	protein-coding gene	gene with protein product						15144888	Standard	NM_001005405		Approved	KRTAP5.11, KRTAP5-6	uc001oqu.3	Q6L8G4	OTTHUMG00000057586	ENST00000398530.1:c.*377C>A	11.37:g.71293036G>T				RNA	SNP	-	NULL	ENST00000398530.1	37	NULL	CCDS41685.1	11																																																																																			KRTAP5-11	-	-	ENSG00000204571		0.498	KRTAP5-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-11	HGNC	protein_coding	OTTHUMT00000127969.1	-	0.00	11	0	G	NM_001005405		71293036	-1	tier1	-	no_errors	ENST00000526239	ensembl	human	known	74_37	rna	64.10	14	25	SNP	0.000	T
LAMA5	3911	genome.wustl.edu	37	20	60895671	60895671	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr20:60895671C>A	ENST00000252999.3	-	50	6769	c.6703G>T	c.(6703-6705)Gtg>Ttg	p.V2235L		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2235	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TGCTCCAGCACCTCCAGCTGC	0.716																																																	0													11.0	15.0	13.0					20																	60895671		2159	4265	6424	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.6703G>T	20.37:g.60895671C>A	ENSP00000252999:p.Val2235Leu		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.V2235L	ENST00000252999.3	37	c.6703	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	-	5.509	0.278883	0.10458	.	.	ENSG00000130702	ENST00000252999	T	0.09255	3.0	4.23	-5.61	0.02489	Laminin I (1);	1.458410	0.04662	N	0.408983	T	0.08582	0.0213	L	0.29908	0.895	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.37526	-0.9702	10	0.27785	T	0.31	.	12.5698	0.56331	0.0:0.7768:0.0:0.2232	.	2235	O15230	LAMA5_HUMAN	L	2235	ENSP00000252999:V2235L	ENSP00000252999:V2235L	V	-	1	0	LAMA5	60329066	0.000000	0.05858	0.007000	0.13788	0.006000	0.05464	-1.134000	0.03228	-0.787000	0.04510	-0.293000	0.09583	GTG	LAMA5	-	pfam_Laminin_I	ENSG00000130702		0.716	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	22	0	C	NM_005560		60895671	-1	tier1	-	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.000	A
LCP1	3936	genome.wustl.edu	37	13	46718648	46718648	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:46718648C>A	ENST00000398576.2	-	14	1570	c.1182G>T	c.(1180-1182)acG>acT	p.T394T	LCP1_ENST00000435666.2_5'Flank|LCP1_ENST00000323076.2_Silent_p.T394T			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	394	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		GCTCTTCTCTCGTCTCACCTA	0.393			T	BCL6	NHL																																			Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0													123.0	110.0	115.0					13																	46718648		2203	4300	6503	SO:0001819	synonymous_variant	0			M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1182G>T	13.37:g.46718648C>A			B2R613|B4DUA0|Q5TBN4	Silent	SNP	pfam_CH-domain,pfam_EF_hand_dom,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.T394	ENST00000398576.2	37	c.1182	CCDS9403.1	13																																																																																			LCP1	-	superfamily_CH-domain,pfscan_CH-domain	ENSG00000136167		0.393	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	HGNC	protein_coding	OTTHUMT00000044800.3	-	0.00	54	0	C	NM_002298		46718648	-1	tier1	-	no_errors	ENST00000323076	ensembl	human	known	74_37	silent	38.24	42	26	SNP	0.005	A
LDHAL6CP	121498	genome.wustl.edu	37	12	63397777	63397777	+	lincRNA	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:63397777C>G	ENST00000552996.1	-	0	1070				LDHAL6CP_ENST00000550738.1_RNA																							AGGTGCACGCCGAGAAAAGGG	0.433																																																	0																																												0																															12.37:g.63397777C>G				RNA	SNP	-	NULL	ENST00000552996.1	37	NULL		12																																																																																			LDHAL6CP	-	-	ENSG00000250517		0.433	RP11-848D3.5-001	KNOWN	basic	lincRNA	LDHAL6CP	HGNC	lincRNA	OTTHUMT00000406731.1	-	0.00	26	0	C			63397777	+1	tier1	-	no_errors	ENST00000550738	ensembl	human	known	74_37	rna	51.52	15	17	SNP	1.000	G
LILRB1	10859	genome.wustl.edu	37	19	55144634	55144634	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:55144634C>G	ENST00000396331.1	+	8	1483	c.1126C>G	c.(1126-1128)Caa>Gaa	p.Q376E	LILRB1_ENST00000427581.2_Missense_Mutation_p.Q412E|LILRB1_ENST00000396332.4_Missense_Mutation_p.Q376E|LILRB1_ENST00000396327.3_Missense_Mutation_p.Q376E|LILRB1_ENST00000396315.1_Missense_Mutation_p.Q376E|LILRB1_ENST00000324602.7_Missense_Mutation_p.Q376E|LILRB1_ENST00000448689.1_Missense_Mutation_p.Q376E|LILRB1_ENST00000434867.2_Missense_Mutation_p.Q376E|LILRB1_ENST00000418536.2_Missense_Mutation_p.Q376E|LILRB1_ENST00000396321.2_Missense_Mutation_p.Q376E|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396317.1_Missense_Mutation_p.Q376E	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1	376	Ig-like C2-type 4.				cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		GTACCAATCTCAAAAATACCA	0.552										HNSCC(37;0.09)																																							0													118.0	128.0	125.0					19																	55144634		2203	4300	6503	SO:0001583	missense	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1126C>G	19.37:g.55144634C>G	ENSP00000379622:p.Gln376Glu		A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q376E	ENST00000396331.1	37	c.1126	CCDS42617.1	19	.	.	.	.	.	.	.	.	.	.	C	1.344	-0.593404	0.03771	.	.	ENSG00000104972	ENST00000396321;ENST00000418536;ENST00000448689;ENST00000396331;ENST00000396327;ENST00000324602;ENST00000434867;ENST00000396332;ENST00000427581;ENST00000396317;ENST00000396315	T;T;T;T;T;T;T;T;T;T;T	0.02890	4.12;4.12;4.12;4.12;4.12;4.12;4.12;4.12;4.12;4.12;4.12	2.08	-4.09	0.03951	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	7.226840	0.00881	N	0.002135	T	0.03305	0.0096	L	0.44542	1.39	0.09310	N	1	B;B;B;B;B	0.26845	0.021;0.026;0.161;0.001;0.019	B;B;B;B;B	0.29440	0.045;0.062;0.102;0.007;0.102	T	0.43458	-0.9390	10	0.33141	T	0.24	.	4.6663	0.12668	0.0:0.4993:0.3216:0.1792	.	376;376;376;376;376	A8MVE2;Q8NHL6-3;A2IXV4;Q8NHL6-2;Q8NHL6	.;.;.;.;LIRB1_HUMAN	E	376;376;376;376;376;376;376;376;412;376;376	ENSP00000379614:Q376E;ENSP00000391514:Q376E;ENSP00000409968:Q376E;ENSP00000379622:Q376E;ENSP00000379618:Q376E;ENSP00000315997:Q376E;ENSP00000405243:Q376E;ENSP00000379623:Q376E;ENSP00000395004:Q412E;ENSP00000379610:Q376E;ENSP00000379608:Q376E	ENSP00000315997:Q376E	Q	+	1	0	LILRB1	59836446	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.754000	0.01816	-0.345000	0.08325	0.205000	0.17691	CAA	LILRB1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000104972		0.552	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	-	0.00	66	0	C			55144634	+1	tier1	-	no_errors	ENST00000324602	ensembl	human	known	74_37	missense	6.10	77	5	SNP	0.000	G
LILRB1	10859	genome.wustl.edu	37	19	55147341	55147341	+	Intron	SNP	A	A	G	rs201477561		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:55147341A>G	ENST00000396331.1	+	14	2007				LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000396327.3_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000462628.1_3'UTR|LILRB1_ENST00000396317.1_Intron|AC009892.10_ENST00000456337.1_3'UTR	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		TAAATGAACCACCCCGGTCCC	0.607										HNSCC(37;0.09)																																							0																																										SO:0001627	intron_variant	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1650+281A>G	19.37:g.55147341A>G			A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	RNA	SNP	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			LILRB1	-	-	ENSG00000104972		0.607	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	-	0.00	24	0	A			55147341	+1	tier1	rs201477561	no_errors	ENST00000462628	ensembl	human	known	74_37	rna	16.67	35	7	SNP	0.001	G
UPK3B	80761	genome.wustl.edu	37	7	76178978	76178978	+	Intron	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:76178978G>C	ENST00000419923.2	+	4	1393				UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				TGTACGGTGAGCCCCAGGGAG	0.726																																																	0																																										SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.960+34205G>C	7.37:g.76178978G>C			A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			AC004980.7	-	-	ENSG00000205485		0.726	UPK3B-201	KNOWN	basic|CCDS	protein_coding	LOC100133091	Clone_based_vega_gene	protein_coding		-	0.00	16	0	G	NM_030570		76178978	+1	tier1	-	no_errors	ENST00000418663	ensembl	human	known	74_37	rna	81.25	3	13	SNP	0.918	C
LINC01410	103352539	genome.wustl.edu	37	9	66466602	66466602	+	lincRNA	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:66466602C>T	ENST00000424345.1	+	0	1235																											tcctcggggccaagagaattt	0.448																																																	0																																												0																															9.37:g.66466602C>T				RNA	SNP	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			RP11-262H14.1	-	-	ENSG00000238113		0.448	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	Clone_based_vega_gene	lincRNA	OTTHUMT00000128851.1	-	0.00	8	0	C			66466602	+1	tier1	-	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	50.00	5	5	SNP	0.008	T
RP11-435B5.5	0	genome.wustl.edu	37	1	143394128	143394128	+	lincRNA	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:143394128C>A	ENST00000428624.1	+	0	2417				RP11-435B5.4_ENST00000423249.1_lincRNA																							TAGGACTCAACAGAAAATATA	0.393																																																	0																																												0																															1.37:g.143394128C>A				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.393	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	173	0	C			143394128	+1	tier1	-	no_errors	ENST00000415543	ensembl	human	known	74_37	rna	10.93	268	33	SNP	0.000	A
LOXHD1	125336	genome.wustl.edu	37	18	44125297	44125297	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr18:44125297C>G	ENST00000398722.4	-	16	2767	c.2768G>C	c.(2767-2769)gGc>gCc	p.G923A	LOXHD1_ENST00000300591.6_Missense_Mutation_p.G90A|LOXHD1_ENST00000582408.1_Missense_Mutation_p.G90A|LOXHD1_ENST00000536736.1_Missense_Mutation_p.G1201A|LOXHD1_ENST00000579038.1_5'UTR|LOXHD1_ENST00000441893.2_Missense_Mutation_p.G134A|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G995A			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	923	PLAT 7. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						ATCCTGTGTGCCAAAGAGTGT	0.468																																																	0													257.0	205.0	221.0					18																	44125297		692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2768G>C	18.37:g.44125297C>G	ENSP00000381707:p.Gly923Ala		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.G1201A	ENST00000398722.4	37	c.3602		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.59|14.59	2.580460|2.580460	0.46006|0.46006	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111;ENST00000420097|ENST00000441551	T;T;T;T;T|.	0.72725|.	-0.68;-0.68;-0.68;-0.68;-0.68|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88168|0.88168	0.6364|0.6364	H|H	0.95294|0.95294	3.65|3.65	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.91635|.	0.999;0.999;0.999|.	D|D	0.90962|0.90962	0.4813|0.4813	10|5	0.87932|.	D|.	0|.	.|.	19.976|19.976	0.97309|0.97309	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1201;134;923|.	F5GZB4;F8WA52;Q8IVV2-2|.	.;.;.|.	A|C	90;923;1201;134;923;103;103|1181	ENSP00000300591:G90A;ENSP00000381707:G923A;ENSP00000444586:G1201A;ENSP00000409062:G134A;ENSP00000440060:G103A|.	ENSP00000300591:G90A|.	G|W	-|-	2|3	0|0	LOXHD1|LOXHD1	42379295|42379295	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.850000|0.850000	0.48378|0.48378	7.258000|7.258000	0.78371|0.78371	2.713000|2.713000	0.92767|0.92767	0.655000|0.655000	0.94253|0.94253	GGC|TGG	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	ENSG00000167210		0.468	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	77	0	C	NM_144612		44125297	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	80.49	8	33	SNP	1.000	G
LPCAT2	54947	genome.wustl.edu	37	16	55616969	55616969	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:55616969G>C	ENST00000262134.5	+	14	1778	c.1594G>C	c.(1594-1596)Gaa>Caa	p.E532Q		NM_017839.4	NP_060309.2	Q7L5N7	PCAT2_HUMAN	lysophosphatidylcholine acyltransferase 2	532					glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	12						AGTCAGCCCTGAAAAGCATGA	0.408																																																	0													74.0	75.0	75.0					16																	55616969		2198	4300	6498	SO:0001583	missense	0			AK000488	CCDS10753.1	16q12.2	2013-01-10	2007-12-17	2007-12-17	ENSG00000087253	ENSG00000087253		"""EF-hand domain containing"""	26032	protein-coding gene	gene with protein product		612040	"""acyltransferase like 1"""	AYTL1		16704971	Standard	NM_017839		Approved	FLJ20481	uc002eie.4	Q7L5N7	OTTHUMG00000133238	ENST00000262134.5:c.1594G>C	16.37:g.55616969G>C	ENSP00000262134:p.Glu532Gln		A3KBM1|Q6MZJ6|Q9NX23	Missense_Mutation	SNP	pfam_EF_hand_dom,pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.E532Q	ENST00000262134.5	37	c.1594	CCDS10753.1	16	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144627	0.57044	.	.	ENSG00000087253	ENST00000262134	T	0.74421	-0.84	6.06	6.06	0.98353	.	0.419971	0.26414	N	0.024510	T	0.54532	0.1864	N	0.08118	0	0.47183	D	0.99934	B	0.17465	0.022	B	0.13407	0.009	T	0.53114	-0.8484	10	0.52906	T	0.07	-28.0843	9.9351	0.41545	0.0723:0.1401:0.7876:0.0	.	532	Q7L5N7	PCAT2_HUMAN	Q	532	ENSP00000262134:E532Q	ENSP00000262134:E532Q	E	+	1	0	LPCAT2	54174470	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	5.159000	0.64923	2.885000	0.99019	0.579000	0.79373	GAA	LPCAT2	-	NULL	ENSG00000087253		0.408	LPCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT2	HGNC	protein_coding	OTTHUMT00000256977.2	-	0.00	34	0	G	NM_017839		55616969	+1	tier1	-	no_errors	ENST00000262134	ensembl	human	known	74_37	missense	41.38	17	12	SNP	0.994	C
LRP1B	53353	genome.wustl.edu	37	2	141816620	141816620	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:141816620T>A	ENST00000389484.3	-	9	2211	c.1240A>T	c.(1240-1242)Aga>Tga	p.R414*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	414					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAAAGATGTCTAACCTATAAA	0.308										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													71.0	74.0	73.0					2																	141816620		2202	4292	6494	SO:0001587	stop_gained	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1240A>T	2.37:g.141816620T>A	ENSP00000374135:p.Arg414*		Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R414*	ENST00000389484.3	37	c.1240	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	47	13.119373	0.99721	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.83	5.83	0.93111	.	0.507764	0.20176	U	0.097631	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	16.194	0.82011	0.0:0.0:0.0:1.0	.	.	.	.	X	414;352	.	ENSP00000374135:R414X	R	-	1	2	LRP1B	141533090	0.985000	0.35326	1.000000	0.80357	0.773000	0.43773	2.024000	0.41049	2.225000	0.72522	0.460000	0.39030	AGA	LRP1B	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt	ENSG00000168702		0.308	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	16	0	T	NM_018557		141816620	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	nonsense	70.00	3	7	SNP	0.956	A
LRRC37A3	374819	genome.wustl.edu	37	17	62856576	62856576	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:62856576C>G	ENST00000584306.1	-	11	4218	c.3688G>C	c.(3688-3690)Gcc>Ccc	p.A1230P	LRRC37A3_ENST00000334962.5_Missense_Mutation_p.A207P|LRRC37A3_ENST00000400877.3_Missense_Mutation_p.A268P|LRRC37A3_ENST00000339474.5_Missense_Mutation_p.A348P|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.A1230P	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1230						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						GTGTAGACGGCGTTTCCCGCT	0.567																																																	0													40.0	53.0	49.0					17																	62856576		2202	4296	6498	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.3688G>C	17.37:g.62856576C>G	ENSP00000464535:p.Ala1230Pro		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A1230P	ENST00000584306.1	37	c.3688	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	13.11	2.139967	0.37728	.	.	ENSG00000176809	ENST00000339474;ENST00000400877;ENST00000334962;ENST00000319651	T;T;T;T	0.59083	2.71;1.48;1.48;0.29	2.23	-3.08	0.05347	.	.	.	.	.	T	0.33498	0.0865	N	0.08118	0	0.09310	N	1	B;D	0.54397	0.008;0.966	B;P	0.47673	0.007;0.554	T	0.20338	-1.0278	9	0.72032	D	0.01	.	0.2954	0.00265	0.4099:0.2095:0.1502:0.2304	.	348;1230	B4DG20;O60309	.;L37A3_HUMAN	P	311;268;207;1230	ENSP00000344298:A311P;ENSP00000383674:A268P;ENSP00000335617:A207P;ENSP00000325713:A1230P	ENSP00000325713:A1230P	A	-	1	0	LRRC37A3	60287038	0.000000	0.05858	0.001000	0.08648	0.083000	0.17756	-0.829000	0.04415	-0.994000	0.03463	-1.054000	0.02325	GCC	LRRC37A3	-	NULL	ENSG00000176809		0.567	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	-	0.00	61	0	C	NM_199340		62856576	-1	tier1	-	no_errors	ENST00000319651	ensembl	human	known	74_37	missense	29.55	62	26	SNP	0.001	G
LRRC4B	94030	genome.wustl.edu	37	19	51021614	51021614	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:51021614G>C	ENST00000599957.1	-	3	1553	c.1356C>G	c.(1354-1356)aaC>aaG	p.N452K	LRRC4B_ENST00000389201.3_Missense_Mutation_p.N452K			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	452	Ig-like C2-type.				positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CGGCCGAGACGTTGAGCGTGG	0.706																																																	0													41.0	47.0	45.0					19																	51021614		2121	4215	6336	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.1356C>G	19.37:g.51021614G>C	ENSP00000471502:p.Asn452Lys		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N452K	ENST00000599957.1	37	c.1356	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759496	0.49468	.	.	ENSG00000131409	ENST00000389201	T	0.64618	-0.11	3.45	3.45	0.39498	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	U	0.000000	T	0.70011	0.3175	L	0.45470	1.425	0.45261	D	0.998263	D	0.89917	1.0	D	0.97110	1.0	T	0.66496	-0.5909	10	0.26408	T	0.33	.	12.7732	0.57434	0.0:0.0:1.0:0.0	.	452	Q9NT99	LRC4B_HUMAN	K	452	ENSP00000373853:N452K	ENSP00000373853:N452K	N	-	3	2	LRRC4B	55713426	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.523000	0.22925	1.934000	0.56057	0.462000	0.41574	AAC	LRRC4B	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000131409		0.706	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1	-	0.00	48	0	G	NM_001080457		51021614	-1	tier1	-	no_errors	ENST00000389201	ensembl	human	known	74_37	missense	68.89	14	31	SNP	1.000	C
LRRC63	220416	genome.wustl.edu	37	13	46808427	46808427	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:46808427G>T	ENST00000595396.1	+	4	933	c.933G>T	c.(931-933)atG>atT	p.M311I	LRRC63_ENST00000446175.1_Missense_Mutation_p.M311I|snoU13_ENST00000459016.1_RNA			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	311										lung(1)|ovary(1)	2						TAACAGCCATGACCAACCTGG	0.388																																																	0																																										SO:0001583	missense	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.933G>T	13.37:g.46808427G>T	ENSP00000469337:p.Met311Ile		Q5TBN0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.M311I	ENST00000595396.1	37	c.933		13	.	.	.	.	.	.	.	.	.	.	G	17.29	3.352765	0.61293	.	.	ENSG00000173988	ENST00000378805;ENST00000446175	T;T	0.01265	5.08;5.13	5.14	-0.31	0.12765	.	0.377447	0.23090	N	0.052057	T	0.01353	0.0044	L	0.56769	1.78	0.09310	N	1	B	0.26744	0.158	B	0.23419	0.046	T	0.47548	-0.9109	10	0.16420	T	0.52	-13.1321	2.936	0.05815	0.2988:0.0:0.376:0.3252	.	311	Q05C16	LRC63_HUMAN	I	311	ENSP00000368082:M311I;ENSP00000408828:M311I	ENSP00000368082:M311I	M	+	3	0	LRRC63	45706428	0.476000	0.25901	0.026000	0.17262	0.918000	0.54935	0.877000	0.28106	0.186000	0.20125	0.467000	0.42956	ATG	LRRC63	-	NULL	ENSG00000173988		0.388	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	HGNC	protein_coding	OTTHUMT00000463266.1	-	0.00	39	0	G	XM_001718341		46808427	+1	tier1	-	no_errors	ENST00000446175	ensembl	human	known	74_37	missense	48.33	31	29	SNP	0.011	T
MAB21L2	10586	genome.wustl.edu	37	4	151504491	151504491	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:151504491G>A	ENST00000317605.4	+	1	1415	c.310G>A	c.(310-312)Gat>Aat	p.D104N	RP11-1336O20.2_ENST00000507934.1_RNA|LRBA_ENST00000507224.1_Intron|LRBA_ENST00000357115.3_Intron|LRBA_ENST00000510413.1_Intron|LRBA_ENST00000503716.1_5'Flank|LRBA_ENST00000535741.1_Intron	NM_006439.4	NP_006430.1	Q9Y586	MB212_HUMAN	mab-21-like 2 (C. elegans)	104					camera-type eye development (GO:0043010)|embryonic body morphogenesis (GO:0010172)|eye development (GO:0001654)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	21	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.159)		CAAACTGAGCGATGGGCGGAA	0.612																																																	0													92.0	87.0	89.0					4																	151504491		2203	4300	6503	SO:0001583	missense	0			AF155219	CCDS3774.1	4q31.3	2013-10-22	2001-11-28		ENSG00000181541	ENSG00000181541			6758	protein-coding gene	gene with protein product		604357	"""mab-21 (C. elegans)-like 2"""				Standard	NM_006439		Approved		uc003ilw.3	Q9Y586	OTTHUMG00000161442	ENST00000317605.4:c.310G>A	4.37:g.151504491G>A	ENSP00000324701:p.Asp104Asn		B3KP37|Q9HBA7	Missense_Mutation	SNP	pfam_Mab-21_dom,pfscan_Ricin_B_lectin	p.D104N	ENST00000317605.4	37	c.310	CCDS3774.1	4	.	.	.	.	.	.	.	.	.	.	G	29.3	4.991819	0.93106	.	.	ENSG00000181541	ENST00000317605	T	0.19394	2.15	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.52354	0.1729	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.43278	-0.9401	10	0.32370	T	0.25	-12.3304	20.2985	0.98592	0.0:0.0:1.0:0.0	.	104	Q9Y586	MB212_HUMAN	N	104	ENSP00000324701:D104N	ENSP00000324701:D104N	D	+	1	0	MAB21L2	151723941	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.793000	0.96121	0.655000	0.94253	GAT	MAB21L2	-	pfam_Mab-21_dom	ENSG00000181541		0.612	MAB21L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L2	HGNC	protein_coding	OTTHUMT00000364937.1	-	0.00	32	0	G	NM_006439		151504491	+1	tier1	-	no_errors	ENST00000317605	ensembl	human	known	74_37	missense	57.69	11	15	SNP	1.000	A
MAGEB6	158809	genome.wustl.edu	37	X	26212334	26212334	+	Missense_Mutation	SNP	A	A	C	rs143802048	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:26212334A>C	ENST00000379034.1	+	2	520	c.371A>C	c.(370-372)tAt>tCt	p.Y124S		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	124	Ser-rich.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GGCTCAAAATATGATGTGGCT	0.552													.|||	342	0.090596	0.0242	0.0706	3775	,	,		12620	0.0794		0.0646	False		,,,				2504	0.1186																0								C	SER/TYR	21,3809		1,4,15,1626,553	85.0	77.0	80.0		371	-1.5	0.0	X	dbSNP_134	80	81,6624		6,7,62,2414,1789	no	missense	MAGEB6	NM_173523.2	144	7,11,77,4040,2342	CC,CA,C,AA,A		1.2081,0.5483,0.9682	benign	124/408	26212334	102,10433	2199	4278	6477	SO:0001583	missense	0			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.371A>C	X.37:g.26212334A>C	ENSP00000368320:p.Tyr124Ser		Q6GS19|Q9H219	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.Y124S	ENST00000379034.1	37	c.371	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.460724	0.00171	0.005483	0.012081	ENSG00000176746	ENST00000379034	T	0.01629	4.72	1.23	-1.47	0.08772	.	.	.	.	.	T	0.00468	0.0015	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42292	-0.9460	9	0.02654	T	1	.	2.6776	0.05084	0.2703:0.469:0.0:0.2607	.	124	Q8N7X4	MAGB6_HUMAN	S	124	ENSP00000368320:Y124S	ENSP00000368320:Y124S	Y	+	2	0	MAGEB6	26122255	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.070000	0.03440	-1.353000	0.02191	-2.567000	0.00172	TAT	MAGEB6	-	pfam_Melanoma_ass_antigen_N	ENSG00000176746		0.552	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	-	0.00	29	0	A	NM_173523		26212334	+1	tier1	rs143802048	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	87.88	4	29	SNP	0.000	C
MAGEL2	54551	genome.wustl.edu	37	15	23889959	23889959	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:23889959C>T	ENST00000532292.1	-	1	1216	c.1122G>A	c.(1120-1122)agG>agA	p.R374R		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	257	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GACCCAGGGCCCTGGAGGTGC	0.647																																																	0													22.0	23.0	23.0					15																	23889959		1859	4099	5958	SO:0001819	synonymous_variant	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1122G>A	15.37:g.23889959C>T				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.R374	ENST00000532292.1	37	c.1122		15	.	.	.	.	.	.	.	.	.	.	C	0.524	-0.860758	0.02610	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.94	2.07	0.26955	.	.	.	.	.	T	0.31544	0.0800	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.20571	-1.0271	4	.	.	.	.	6.1354	0.20230	0.0:0.7729:0.0:0.2271	.	.	.	.	E	406	.	.	G	-	2	0	MAGEL2	21441052	0.001000	0.12720	0.001000	0.08648	0.030000	0.12068	0.478000	0.22212	0.635000	0.30488	0.655000	0.94253	GGG	MAGEL2	-	NULL	ENSG00000254585		0.647	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	12	0	C	NM_019066		23889959	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	silent	35.71	9	5	SNP	0.001	T
MAGI2	9863	genome.wustl.edu	37	7	77797398	77797398	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:77797398C>A	ENST00000354212.4	-	15	2684	c.2431G>T	c.(2431-2433)Ggc>Tgc	p.G811C	MAGI2_ENST00000419488.1_Missense_Mutation_p.G797C|MAGI2_ENST00000522391.1_Missense_Mutation_p.G811C	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	811	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCGGCTGAGCCCATGGCAATG	0.458																																																	0													96.0	92.0	93.0					7																	77797398		2203	4300	6503	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2431G>T	7.37:g.77797398C>A	ENSP00000346151:p.Gly811Cys		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.G811C	ENST00000354212.4	37	c.2431	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304645	0.81136	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.56275	0.47;0.58;0.58	5.96	5.96	0.96718	PDZ/DHR/GLGF (4);	0.000000	0.37261	U	0.002175	T	0.81795	0.4898	H	0.95294	3.65	0.80722	D	1	D;D;D	0.89917	0.99;1.0;0.997	P;D;P	0.72982	0.873;0.979;0.873	D	0.86332	0.1699	10	0.87932	D	0	.	19.4074	0.94653	0.0:1.0:0.0:0.0	.	811;797;811	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	C	797;811;811;811	ENSP00000405766:G797C;ENSP00000346151:G811C;ENSP00000428389:G811C	ENSP00000346151:G811C	G	-	1	0	MAGI2	77635334	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.586000	0.60984	2.831000	0.97527	0.650000	0.86243	GGC	MAGI2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000187391		0.458	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	-	0.00	75	0	C	NM_012301		77797398	-1	tier1	-	no_errors	ENST00000354212	ensembl	human	known	74_37	missense	48.05	40	37	SNP	1.000	A
MALAT1	378938	genome.wustl.edu	37	11	65266761	65266761	+	lincRNA	SNP	C	C	G	rs574680301		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:65266761C>G	ENST00000534336.1	+	0	1529				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TAAAAGGTTTCTAAAACATGA	0.313													C|||	1	0.000199681	0.0	0.0	5008	,	,		16669	0.0		0.0	False		,,,				2504	0.001																0													21.0	22.0	22.0					11																	65266761		873	1987	2860			0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266761C>G				RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.313	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	0.00	53	0	C	NR_002819		65266761	+1	tier1	-	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.000	G
MARCH1	55016	genome.wustl.edu	37	4	164533852	164533852	+	Intron	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:164533852G>T	ENST00000503008.1	-	5	1219				MARCH1_ENST00000339875.5_Intron|MARCH1_ENST00000274056.7_Intron|MARCH1_ENST00000514618.1_Missense_Mutation_p.P194Q	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GTTTTCACACGGCTTATTATT	0.423																																																	0																																										SO:0001627	intron_variant	0			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.242+613C>A	4.37:g.164533852G>T			D3DP29|Q9NWR0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.P194Q	ENST00000503008.1	37	c.581	CCDS54814.1	4	.	.	.	.	.	.	.	.	.	.	G	3.995	-0.003740	0.07773	.	.	ENSG00000145416	ENST00000514618	T	0.27557	1.66	6.06	0.251	0.15540	.	.	.	.	.	T	0.30103	0.0754	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29088	-1.0023	6	0.87932	D	0	.	6.154	0.20328	0.1738:0.0:0.5038:0.3224	.	.	.	.	Q	194	ENSP00000421322:P194Q	ENSP00000421322:P194Q	P	-	2	0	MARCH1	164753302	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.535000	0.23114	-0.298000	0.08921	-0.751000	0.03497	CCG	MARCH1	-	NULL	ENSG00000145416		0.423	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	HGNC	protein_coding	OTTHUMT00000364493.2	-	0.00	51	0	G	NM_017923		164533852	-1	tier1	-	no_errors	ENST00000514618	ensembl	human	novel	74_37	missense	31.94	49	23	SNP	0.000	T
MARVELD2	153562	genome.wustl.edu	37	5	68715944	68715944	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:68715944G>T	ENST00000325631.5	+	2	806	c.732G>T	c.(730-732)ggG>ggT	p.G244G	MARVELD2_ENST00000413223.2_Intron	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	244	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		GTATGTATGGGGGCTATTACT	0.468																																																	0													204.0	181.0	189.0					5																	68715944		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.732G>T	5.37:g.68715944G>T			A1BQX0|A1BQX1|A8KA97|Q96NM9	Silent	SNP	pfam_Occludin_RNApol2_elong_fac_ELL,pfam_Marvel	p.G244	ENST00000325631.5	37	c.732	CCDS34175.1	5																																																																																			MARVELD2	-	pfam_Marvel	ENSG00000152939		0.468	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MARVELD2	HGNC	protein_coding	OTTHUMT00000369583.1	-	0.00	85	0	G	NM_144724		68715944	+1	tier1	-	no_errors	ENST00000325631	ensembl	human	known	74_37	silent	81.48	10	44	SNP	0.998	T
MCL1	4170	genome.wustl.edu	37	1	150550893	150550893	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:150550893T>G	ENST00000369026.2	-	2	822	c.763A>C	c.(763-765)Agc>Cgc	p.S255R	MCL1_ENST00000307940.3_Intron|MCL1_ENST00000464132.1_5'UTR	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	255					apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			ACGCCGTCGCTGAAAACATGG	0.453																																																	0													112.0	113.0	113.0					1																	150550893		2203	4300	6503	SO:0001583	missense	0			BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.763A>C	1.37:g.150550893T>G	ENSP00000358022:p.Ser255Arg		B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Missense_Mutation	SNP	pfam_Blc2_fam,pfscan_Bcl2-like,prints_Apop_reg_Mc1,prints_Blc2_fam	p.S255R	ENST00000369026.2	37	c.763	CCDS957.1	1	.	.	.	.	.	.	.	.	.	.	T	15.23	2.770682	0.49680	.	.	ENSG00000143384	ENST00000369026;ENST00000439749	T	0.03920	3.76	5.01	5.01	0.66863	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (3);Apoptosis regulator, Bcl-2, BH1 motif, conserved site (1);	0.399797	0.30437	N	0.009630	T	0.01523	0.0049	N	0.20574	0.59	0.80722	D	1	B	0.17038	0.02	B	0.18263	0.021	T	0.51671	-0.8676	10	0.21014	T	0.42	-2.8222	13.7112	0.62670	0.0:0.0:0.0:1.0	.	255	Q07820	MCL1_HUMAN	R	255;184	ENSP00000358022:S255R	ENSP00000358022:S255R	S	-	1	0	MCL1	148817517	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.275000	0.58927	2.103000	0.63969	0.533000	0.62120	AGC	MCL1	-	pfam_Blc2_fam,pfscan_Bcl2-like,prints_Apop_reg_Mc1,prints_Blc2_fam	ENSG00000143384		0.453	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCL1	HGNC	protein_coding	OTTHUMT00000084402.1	-	0.00	41	0	T	NM_021960		150550893	-1	tier1	-	no_errors	ENST00000369026	ensembl	human	known	74_37	missense	35.29	22	12	SNP	1.000	G
MEOX1	4222	genome.wustl.edu	37	17	41738714	41738714	+	Silent	SNP	T	T	A	rs367782056		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:41738714T>A	ENST00000318579.4	-	1	608	c.189A>T	c.(187-189)tcA>tcT	p.S63S	MEOX1_ENST00000329168.3_Silent_p.S63S|MEOX1_ENST00000393661.2_5'UTR|MEOX1_ENST00000549132.1_Missense_Mutation_p.Q34L	NM_001040002.1|NM_004527.3	NP_001035091.1|NP_004518.1	P50221	MEOX1_HUMAN	mesenchyme homeobox 1	63					multicellular organismal development (GO:0007275)|somite specification (GO:0001757)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0753)		GGCAGGAGGCTGAGAAGTCAG	0.647																																																	0													51.0	55.0	54.0					17																	41738714		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11466.1, CCDS11467.1, CCDS42343.1	17q21.31	2014-07-15	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	7013	protein-coding gene	gene with protein product		600147	"""mesenchyme homeo box 1"""			7987315	Standard	NM_013999		Approved	MOX1	uc002idz.3	P50221	OTTHUMG00000170513	ENST00000318579.4:c.189A>T	17.37:g.41738714T>A			A8K524|A8MWF9|Q15069	Missense_Mutation	SNP	superfamily_Homeodomain-like,pfscan_Homeobox_dom	p.Q34L	ENST00000318579.4	37	c.101	CCDS11466.1	17	.	.	.	.	.	.	.	.	.	.	T	10.30	1.312324	0.23908	.	.	ENSG00000005102	ENST00000549132	.	.	.	4.68	-9.36	0.00629	.	.	.	.	.	T	0.47820	0.1466	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60021	-0.7344	5	0.87932	D	0	-31.3287	1.2626	0.02004	0.3509:0.1025:0.1592:0.3874	.	.	.	.	L	34	.	ENSP00000449049:Q34L	Q	-	2	0	MEOX1	39094240	0.000000	0.05858	0.519000	0.27824	0.952000	0.60782	-3.120000	0.00595	-1.943000	0.01039	-0.313000	0.08912	CAG	MEOX1	-	NULL	ENSG00000005102		0.647	MEOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX1	HGNC	protein_coding	OTTHUMT00000409452.1	-	0.00	54	0	T			41738714	-1	tier1	-	no_errors	ENST00000549132	ensembl	human	known	74_37	missense	54.55	30	36	SNP	0.394	A
METTL3	56339	genome.wustl.edu	37	14	21971933	21971933	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:21971933G>T	ENST00000298717.4	-	2	343	c.192C>A	c.(190-192)agC>agA	p.S64R	METTL3_ENST00000538267.1_Missense_Mutation_p.S64R	NM_019852.3	NP_062826.2	Q86U44	MTA70_HUMAN	methyltransferase like 3	64					circadian rhythm (GO:0007623)|gene expression (GO:0010467)|mRNA destabilization (GO:0061157)|mRNA methylation (GO:0080009)|mRNA processing (GO:0006397)|RNA methylation (GO:0001510)|stem cell maintenance (GO:0019827)	MIS complex (GO:0036396)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA (2'-O-methyladenosine-N6-)-methyltransferase activity (GO:0016422)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(95;0.000628)		Epithelial(56;6.61e-06)	GBM - Glioblastoma multiforme(265;0.0146)		CTGAAGCTGTGCTGGGCTTAG	0.517																																																	0													156.0	147.0	150.0					14																	21971933		2203	4300	6503	SO:0001583	missense	0			AF014837	CCDS32044.1	14q11.1	2012-06-12			ENSG00000165819	ENSG00000165819	2.1.1.62		17563	protein-coding gene	gene with protein product	"""N6-adenosine-methyltransferase 70 kDa subunit"""	612472					Standard	XM_006720206		Approved	Spo8, M6A, MT-A70	uc001wbc.3	Q86U44	OTTHUMG00000168825	ENST00000298717.4:c.192C>A	14.37:g.21971933G>T	ENSP00000298717:p.Ser64Arg		O14736|Q86V05|Q9HB32	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.S64R	ENST00000298717.4	37	c.192	CCDS32044.1	14	.	.	.	.	.	.	.	.	.	.	G	12.69	2.015063	0.35511	.	.	ENSG00000165819	ENST00000298717;ENST00000538267;ENST00000440691	T;T	0.29142	1.58;1.58	5.49	-0.624	0.11552	.	0.000000	0.85682	D	0.000000	T	0.17023	0.0409	N	0.14661	0.345	0.48087	D	0.999585	P;P;B	0.47677	0.899;0.514;0.063	B;P;B	0.44518	0.367;0.452;0.016	T	0.04593	-1.0940	10	0.21540	T	0.41	-17.4594	10.3312	0.43823	0.5011:0.0:0.4989:0.0	.	64;64;64	B4E2F6;B4DTN4;Q86U44	.;.;MTA70_HUMAN	R	64	ENSP00000298717:S64R;ENSP00000442316:S64R	ENSP00000298717:S64R	S	-	3	2	METTL3	21041773	1.000000	0.71417	0.996000	0.52242	0.981000	0.71138	0.681000	0.25320	-0.043000	0.13513	-0.140000	0.14226	AGC	METTL3	-	NULL	ENSG00000165819		0.517	METTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL3	HGNC	protein_coding	OTTHUMT00000401227.1		0.00	36	0	G	NM_019852		21971933	-1			no_errors	ENST00000298717	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.985	T
MICAL1	64780	genome.wustl.edu	37	6	109767598	109767598	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:109767598A>T	ENST00000358807.3	-	19	2633	c.2322T>A	c.(2320-2322)agT>agA	p.S774R	MICAL1_ENST00000358577.3_Missense_Mutation_p.S688R|MICAL1_ENST00000368952.4_Missense_Mutation_p.S793R	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	774					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		TGCTATTCTCACTTGGTGTGG	0.627																																																	0													56.0	67.0	63.0					6																	109767598		2189	4294	6483	SO:0001583	missense	0			AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.2322T>A	6.37:g.109767598A>T	ENSP00000351664:p.Ser774Arg		B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.S793R	ENST00000358807.3	37	c.2379	CCDS5076.1	6	.	.	.	.	.	.	.	.	.	.	A	11.35	1.614269	0.28712	.	.	ENSG00000135596	ENST00000358807;ENST00000368952;ENST00000358577;ENST00000368957;ENST00000335266	T;T;T	0.51325	0.71;0.72;0.71	4.89	-9.78	0.00496	.	2.332770	0.01199	N	0.007524	T	0.09905	0.0243	L	0.29908	0.895	0.09310	N	1	B;P;B	0.34757	0.086;0.467;0.112	B;B;B	0.29176	0.014;0.099;0.024	T	0.05750	-1.0866	9	.	.	.	.	5.5368	0.17016	0.1252:0.3633:0.4113:0.1002	.	793;688;774	B7Z3R5;Q8TDZ2-2;Q8TDZ2	.;.;MICA1_HUMAN	R	774;793;688;298;30	ENSP00000351664:S774R;ENSP00000357948:S793R;ENSP00000351385:S688R	.	S	-	3	2	MICAL1	109874291	0.000000	0.05858	0.000000	0.03702	0.154000	0.21943	-1.088000	0.03379	-1.976000	0.00996	-0.411000	0.06167	AGT	MICAL1	-	NULL	ENSG00000135596		0.627	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL1	HGNC	protein_coding	OTTHUMT00000041759.2	-	0.00	50	0	A	NM_022765		109767598	-1	tier1	-	no_errors	ENST00000368952	ensembl	human	known	74_37	missense	46.15	42	36	SNP	0.000	T
RP11-123M6.2	0	genome.wustl.edu	37	14	101318813	101318813	+	RNA	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:101318813G>T	ENST00000554041.1	-	0	143				MIR770_ENST00000390219.1_RNA																							GGGGCCTCAGGGGTCTGCTCT	0.597																																																	0													39.0	40.0	40.0					14																	101318813		1568	3582	5150			0																															14.37:g.101318813G>T				RNA	SNP	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			MIR770	-	-	ENSG00000211574		0.597	RP11-123M6.2-001	KNOWN	basic	antisense	MIR770	HGNC	antisense	OTTHUMT00000414687.1	-	0.00	18	0	G			101318813	+1	tier1	-	no_errors	ENST00000390219	ensembl	human	known	74_37	rna	38.71	19	12	SNP	0.924	T
MKRN3	7681	genome.wustl.edu	37	15	23811871	23811871	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:23811871C>A	ENST00000314520.3	+	1	1418	c.942C>A	c.(940-942)tgC>tgA	p.C314*	MKRN3_ENST00000564592.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568945.1_Intron|MKRN3_ENST00000568252.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	314					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GTGGCATCTGCATGGAGGTTG	0.498																																																	0													119.0	101.0	107.0					15																	23811871		2203	4300	6503	SO:0001587	stop_gained	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.942C>A	15.37:g.23811871C>A	ENSP00000313881:p.Cys314*			Nonsense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.C314*	ENST00000314520.3	37	c.942	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	C	41	8.815878	0.98964	.	.	ENSG00000179455	ENST00000314520	.	.	.	4.07	3.16	0.36331	.	0.101223	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.177	0.42943	0.0:0.9012:0.0:0.0988	.	.	.	.	X	314	.	ENSP00000313881:C314X	C	+	3	2	MKRN3	21362964	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.670000	0.37502	1.314000	0.45095	-0.140000	0.14226	TGC	MKRN3	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000179455		0.498	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	-	0.00	32	0	C	NM_005664		23811871	+1	tier1	-	no_errors	ENST00000314520	ensembl	human	known	74_37	nonsense	57.50	17	23	SNP	1.000	A
MKX	283078	genome.wustl.edu	37	10	28023695	28023695	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:28023695G>C	ENST00000375790.5	-	5	960	c.528C>G	c.(526-528)caC>caG	p.H176Q	MKX_ENST00000419761.1_Missense_Mutation_p.H176Q			Q8IYA7	MKX_HUMAN	mohawk homeobox	176					collagen fibril organization (GO:0030199)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|positive regulation of collagen biosynthetic process (GO:0032967)|tendon cell differentiation (GO:0035990)|tendon sheath development (GO:0002932)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)|skin(2)	16						CTTCGTTCATGTGGGTTCTTG	0.473																																																	0													111.0	111.0	111.0					10																	28023695		2203	4300	6503	SO:0001583	missense	0			BC036207	CCDS7156.1	10p12.1	2011-06-20	2006-03-31	2006-03-31	ENSG00000150051	ENSG00000150051		"""Homeoboxes / TALE class"""	23729	protein-coding gene	gene with protein product		601332	"""chromosome 10 open reading frame 48"", ""iroquois homeobox protein-like 1"""	C10orf48, IRXL1		16408284	Standard	NM_173576		Approved	MGC39616	uc001itx.4	Q8IYA7	OTTHUMG00000017862	ENST00000375790.5:c.528C>G	10.37:g.28023695G>C	ENSP00000364946:p.His176Gln		B3KWM5	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.H176Q	ENST00000375790.5	37	c.528	CCDS7156.1	10	.	.	.	.	.	.	.	.	.	.	G	9.011	0.982412	0.18889	.	.	ENSG00000150051	ENST00000375790;ENST00000419761	T;T	0.62788	0.0;0.0	5.71	4.81	0.61882	.	0.206886	0.52532	D	0.000072	T	0.45236	0.1332	L	0.33485	1.01	0.31208	N	0.698948	B	0.09022	0.002	B	0.06405	0.002	T	0.42155	-0.9468	10	0.08599	T	0.76	-25.5113	9.4284	0.38595	0.2025:0.0:0.7975:0.0	.	176	Q8IYA7	MKX_HUMAN	Q	176	ENSP00000364946:H176Q;ENSP00000400896:H176Q	ENSP00000364946:H176Q	H	-	3	2	MKX	28063701	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	1.482000	0.35486	1.431000	0.47355	0.558000	0.71614	CAC	MKX	-	NULL	ENSG00000150051		0.473	MKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKX	HGNC	protein_coding	OTTHUMT00000047332.3	-	0.00	56	0	G	NM_173576		28023695	-1	tier1	-	no_errors	ENST00000375790	ensembl	human	known	74_37	missense	43.14	29	22	SNP	1.000	C
MROH7	374977	genome.wustl.edu	37	1	55118958	55118958	+	Missense_Mutation	SNP	G	G	A	rs531104510	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:55118958G>A	ENST00000421030.2	+	3	644	c.359G>A	c.(358-360)cGc>cAc	p.R120H	MROH7_ENST00000409996.1_Intron|MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.R120H|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000395690.2_Missense_Mutation_p.R120H|MROH7_ENST00000545244.1_Intron|MROH7_ENST00000339553.5_Missense_Mutation_p.R120H|MROH7_ENST00000472987.1_3'UTR	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	120						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											TCACAGGGGCGCCTCTGTCCA	0.567													G|||	2	0.000399361	0.0	0.0	5008	,	,		18327	0.001		0.0	False		,,,				2504	0.001																0													107.0	105.0	106.0					1																	55118958		1971	4170	6141	SO:0001583	missense	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.359G>A	1.37:g.55118958G>A	ENSP00000396622:p.Arg120His		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R120H	ENST00000421030.2	37	c.359	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	G	5.475	0.272741	0.10349	.	.	ENSG00000184313	ENST00000421030;ENST00000414867;ENST00000339553;ENST00000395690	T;T;T	0.02472	4.81;4.28;4.28	3.58	1.66	0.24008	.	3.081050	0.01441	N	0.015064	T	0.01870	0.0059	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.40270	-0.9572	10	0.28530	T	0.3	.	6.1569	0.20342	0.2323:0.5689:0.1988:0.0	.	120;120;120	F8W8P2;Q68CQ1;Q68CQ1-4	.;HEAT8_HUMAN;.	H	120	ENSP00000396622:R120H;ENSP00000343211:R120H;ENSP00000379044:R120H	ENSP00000343211:R120H	R	+	2	0	HEATR8	54891546	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.044000	0.13992	0.477000	0.27464	-1.610000	0.00802	CGC	MROH7-TTC4	-	NULL	ENSG00000271723		0.567	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	HGNC	protein_coding	OTTHUMT00000346978.1	-	0.00	21	0	G	NM_198547		55118958	+1	tier1	-	no_errors	ENST00000414150	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.000	A
MTCH1	23787	genome.wustl.edu	37	6	36938400	36938400	+	Intron	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:36938400G>A	ENST00000373627.5	-	9	1079				MTCH1_ENST00000538808.1_Intron|MTCH1_ENST00000471737.1_Intron|MTCH1_ENST00000373616.5_Intron	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CAGTGGGAAGGAAGGACAGCT	0.602																																																	0													101.0	76.0	84.0					6																	36938400		2203	4300	6503	SO:0001627	intron_variant	0			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.954+22C>T	6.37:g.36938400G>A			A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	RNA	SNP	-	NULL	ENST00000373627.5	37	NULL		6																																																																																			MTCH1	-	-	ENSG00000137409		0.602	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	MTCH1	HGNC	protein_coding	OTTHUMT00000040396.1	-	0.00	13	0	G	NM_014341		36938400	-1	tier1	-	no_errors	ENST00000492754	ensembl	human	known	74_37	rna	37.50	15	9	SNP	0.000	A
MTMR3	8897	genome.wustl.edu	37	22	30414035	30414035	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:30414035C>T	ENST00000401950.2	+	16	2136	c.1794C>T	c.(1792-1794)acC>acT	p.T598T	MTMR3_ENST00000351488.3_Silent_p.T598T|MTMR3_ENST00000333027.3_Silent_p.T598T|MTMR3_ENST00000323630.5_Silent_p.T462T|MTMR3_ENST00000406629.1_Silent_p.T598T|CTA-85E5.10_ENST00000429350.1_RNA|CTA-85E5.10_ENST00000453743.2_RNA	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	598					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CCCCAGGCACCAGCCCTGATG	0.627																																																	0													92.0	70.0	77.0					22																	30414035		2203	4300	6503	SO:0001819	synonymous_variant	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.1794C>T	22.37:g.30414035C>T			A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.T598	ENST00000401950.2	37	c.1794	CCDS13870.1	22																																																																																			MTMR3	-	NULL	ENSG00000100330		0.627	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	-	0.00	64	0	C	NM_021090		30414035	+1	tier1	-	no_errors	ENST00000401950	ensembl	human	known	74_37	silent	28.30	38	15	SNP	0.993	T
MTRR	4552	genome.wustl.edu	37	5	7897311	7897311	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:7897311C>T	ENST00000264668.2	+	14	2014	c.1984C>T	c.(1984-1986)Cag>Tag	p.Q662*	MTRR_ENST00000440940.2_Nonsense_Mutation_p.Q635*	NM_002454.2|NM_024010.2	NP_002445.2|NP_076915.2	Q9UBK8	MTRR_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase reductase	662					cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|DNA methylation (GO:0006306)|folic acid metabolic process (GO:0046655)|methionine biosynthetic process (GO:0009086)|methionine metabolic process (GO:0006555)|methylation (GO:0032259)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	[methionine synthase] reductase activity (GO:0030586)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, oxidizing metal ions, NAD or NADP as acceptor (GO:0016723)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(14)|ovary(1)|prostate(3)|stomach(1)	31					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)	TCATGGCCAGCAGGTGGCGAG	0.512																																																	0													112.0	107.0	109.0					5																	7897311		2203	4300	6503	SO:0001587	stop_gained	0			AF025794	CCDS3874.1, CCDS47190.1	5p15.31	2011-05-12			ENSG00000124275	ENSG00000124275	1.16.1.8		7473	protein-coding gene	gene with protein product		602568				9501215	Standard	NM_024010		Approved	cblE	uc003jed.3	Q9UBK8	OTTHUMG00000090477	ENST00000264668.2:c.1984C>T	5.37:g.7897311C>T	ENSP00000264668:p.Gln662*		O60471|Q32MA9|Q7Z4M8	Nonsense_Mutation	SNP	pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.Q662*	ENST00000264668.2	37	c.1984	CCDS3874.1	5	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769401	0.69992	.	.	ENSG00000124275	ENST00000264668;ENST00000440940	.	.	.	5.4	2.43	0.29744	.	0.635226	0.17304	N	0.179121	.	.	.	.	.	.	0.29925	N	0.822387	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-11.5318	17.9029	0.88910	0.0:0.4671:0.5329:0.0	.	.	.	.	X	662;635	.	ENSP00000264668:Q662X	Q	+	1	0	MTRR	7950311	0.969000	0.33509	0.214000	0.23707	0.126000	0.20510	1.791000	0.38744	0.235000	0.21160	-0.795000	0.03280	CAG	MTRR	-	pfam_OxRdtase_FAD/NAD-bd	ENSG00000124275		0.512	MTRR-001	KNOWN	basic|CCDS	protein_coding	MTRR	HGNC	protein_coding	OTTHUMT00000206931.1		0.00	40	0	C			7897311	+1			no_errors	ENST00000264668	ensembl	human	known	74_37	nonsense	5.26	72	4	SNP	0.315	T
MTUS2	23281	genome.wustl.edu	37	13	30072650	30072650	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:30072650G>C	ENST00000380808.2	+	7	927	c.711G>C	c.(709-711)aaG>aaC	p.K237N	MTUS2_ENST00000431530.3_Missense_Mutation_p.K1268N|MTUS2_ENST00000400542.3_3'UTR|MTUS2_ENST00000542829.1_Missense_Mutation_p.K147N	NM_015233.5	NP_056048.1	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1258						cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGCAAGAAAAGAAGATTCTTG	0.433																																																	0													88.0	94.0	92.0					13																	30072650		1923	4128	6051	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000380808.2:c.711G>C	13.37:g.30072650G>C	ENSP00000370186:p.Lys237Asn		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.K1268N	ENST00000380808.2	37	c.3804	CCDS41874.1	13	.	.	.	.	.	.	.	.	.	.	G	17.04	3.288070	0.59976	.	.	ENSG00000132938	ENST00000431530;ENST00000380808;ENST00000542829;ENST00000417109	T;T;T	0.79653	-1.29;-1.29;-1.29	5.16	3.43	0.39272	.	0.179827	0.47093	D	0.000242	D	0.85969	0.5821	M	0.64997	1.995	0.46317	D	0.998982	D;D	0.76494	0.999;0.999	D;D	0.72338	0.966;0.977	D	0.84316	0.0513	9	.	.	.	.	10.5014	0.44808	0.1562:0.0:0.8438:0.0	.	237;1258	Q5JR59-3;Q5JR59	.;MTUS2_HUMAN	N	1268;237;147;194	ENSP00000392057:K1268N;ENSP00000370186:K237N;ENSP00000445403:K147N	.	K	+	3	2	MTUS2	28970650	1.000000	0.71417	0.996000	0.52242	0.892000	0.51952	1.908000	0.39907	0.749000	0.32854	0.655000	0.94253	AAG	MTUS2	-	NULL	ENSG00000132938		0.433	MTUS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044335.2	-	0.00	10	0	G	XM_166270		30072650	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	58.06	13	18	SNP	1.000	C
LINC01317	104355287	genome.wustl.edu	37	2	33952528	33952528	+	lincRNA	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:33952528G>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							GGCAGGCCACGAAGGTCTCCA	0.642																																																	0																																												0																															2.37:g.33952528G>T				RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.642	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	-	0.00	25	0	G			33952528	-1	tier1	-	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	61.11	21	33	SNP	1.000	T
MYCBP2	23077	genome.wustl.edu	37	13	77673124	77673124	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:77673124G>A	ENST00000544440.2	-	56	8068	c.8051C>T	c.(8050-8052)tCt>tTt	p.S2684F	MYCBP2_ENST00000407578.2_Missense_Mutation_p.S2722F|MYCBP2_ENST00000360084.5_Missense_Mutation_p.S207F|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.S2684F|MYCBP2_ENST00000482517.1_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TGGTTTAGAAGATGTTGAGAT	0.388																																																	0													114.0	113.0	114.0					13																	77673124		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.8051C>T	13.37:g.77673124G>A	ENSP00000444596:p.Ser2684Phe			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S2722F	ENST00000544440.2	37	c.8165		13	.	.	.	.	.	.	.	.	.	.	G	2.864	-0.235417	0.05983	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440;ENST00000360084	T;T;T;T	0.47528	1.6;1.6;1.6;0.84	5.46	4.56	0.56223	.	0.374958	0.26696	N	0.022980	T	0.27524	0.0676	N	0.19112	0.55	0.23568	N	0.997392	P;B;B	0.44380	0.834;0.0;0.0	B;B;B	0.40285	0.325;0.001;0.0	T	0.14227	-1.0480	10	0.07990	T	0.79	.	9.2524	0.37562	0.076:0.1469:0.7771:0.0	.	70;2684;2684	Q9UG08;O75592-2;O75592	.;.;MYCB2_HUMAN	F	2684;2722;2684;207	ENSP00000349892:S2684F;ENSP00000384288:S2722F;ENSP00000444596:S2684F;ENSP00000353197:S207F	ENSP00000349892:S2684F	S	-	2	0	MYCBP2	76571125	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	5.228000	0.65310	2.570000	0.86706	0.563000	0.77884	TCT	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.388	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	70	0	G	NM_015057		77673124	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	70.73	11	29	SNP	0.531	A
MYF6	4618	genome.wustl.edu	37	12	81102703	81102704	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:81102703_81102704insA	ENST00000228641.3	+	3	915_916	c.693_694insA	c.(694-696)aaafs	p.K232fs		NM_002469.2	NP_002460.1	P23409	MYF6_HUMAN	myogenic factor 6 (herculin)	232					muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|somitogenesis (GO:0001756)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|skin(1)	26						CGGAGGAACGCAAACTCCCCTG	0.535																																																	0																																										SO:0001589	frameshift_variant	0				CCDS9019.1	12q21	2013-05-21				ENSG00000111046		"""Basic helix-loop-helix proteins"""	7566	protein-coding gene	gene with protein product	"""muscle-specific regulatory factor 4"""	159991				8978788	Standard	NM_002469		Approved	MRF4, bHLHc4	uc001szf.2	P23409		ENST00000228641.3:c.696dupA	12.37:g.81102706_81102706dupA	ENSP00000228641:p.Lys232fs		B2R898|Q53X80|Q6FHI9	Frame_Shift_Ins	INS	pfam_Basic,pfam_bHLH_dom,superfamily_bHLH_dom,smart_Basic,smart_bHLH_dom,pfscan_bHLH_dom	p.L232fs	ENST00000228641.3	37	c.693_694	CCDS9019.1	12																																																																																			MYF6	-	NULL	ENSG00000111046		0.535	MYF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF6	HGNC	protein_coding	OTTHUMT00000407756.1		0.00	65	0	-	NM_002469		81102704	+1	tier1		no_errors	ENST00000228641	ensembl	human	known	74_37	frame_shift_ins	41.86	50	36	INS	1.000:1.000	A
MYH13	8735	genome.wustl.edu	37	17	10219245	10219245	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:10219245A>T	ENST00000418404.3	-	27	3999	c.3836T>A	c.(3835-3837)aTg>aAg	p.M1279K	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.M1279K			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1279					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						TGCTTTCTGCATGTTCAGATC	0.512																																																	0													241.0	236.0	237.0					17																	10219245		2013	4170	6183	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.3836T>A	17.37:g.10219245A>T	ENSP00000404570:p.Met1279Lys		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M1279K	ENST00000418404.3	37	c.3836	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	A	13.89	2.373370	0.42105	.	.	ENSG00000006788	ENST00000252172	T	0.79845	-1.31	4.27	3.17	0.36434	Myosin tail (1);	.	.	.	.	T	0.71484	0.3345	L	0.43152	1.355	0.28750	N	0.901479	B	0.11235	0.004	B	0.23275	0.045	T	0.65685	-0.6108	9	0.87932	D	0	.	4.0128	0.09631	0.6396:0.0:0.3604:0.0	.	1279	Q9UKX3	MYH13_HUMAN	K	1279	ENSP00000252172:M1279K	ENSP00000252172:M1279K	M	-	2	0	MYH13	10159970	0.001000	0.12720	1.000000	0.80357	0.951000	0.60555	1.252000	0.32874	1.687000	0.51057	0.450000	0.29827	ATG	MYH13	-	pfam_Myosin_tail,superfamily_Prefoldin	ENSG00000006788		0.512	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	70	0	A	NM_003802		10219245	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	49.15	30	29	SNP	0.998	T
MYLK	4638	genome.wustl.edu	37	3	123419172	123419172	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:123419172T>C	ENST00000475616.1	-	15	3142	c.3143A>G	c.(3142-3144)aAg>aGg	p.K1048R	MYLK_ENST00000360304.3_Missense_Mutation_p.K1048R|MYLK_ENST00000359169.1_Missense_Mutation_p.K1048R|MYLK_ENST00000346322.5_Missense_Mutation_p.K979R|MYLK_ENST00000360772.3_Missense_Mutation_p.K1048R|MYLK_ENST00000510775.1_5'Flank			Q15746	MYLK_HUMAN	myosin light chain kinase	1048	6 X 12 AA approximate tandem repeats.			KPM -> EAH (in Ref. 1; CAA59685 and 8; BAB21504). {ECO:0000305}.	actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GCCCATGGGCTTCAGGGTCTC	0.542																																																	0													214.0	222.0	219.0					3																	123419172		2203	4300	6503	SO:0001583	missense	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.3143A>G	3.37:g.123419172T>C	ENSP00000418335:p.Lys1048Arg		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K1048R	ENST00000475616.1	37	c.3143	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	T	7.032	0.560862	0.13498	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.68624	-0.34;-0.29;-0.34;-0.29;-0.29	5.64	4.47	0.54385	.	.	.	.	.	T	0.75102	0.3804	M	0.77103	2.36	0.09310	N	0.999997	D;P;D;B;D;B	0.62365	0.982;0.804;0.98;0.136;0.991;0.166	P;B;P;B;P;B	0.56434	0.763;0.371;0.718;0.068;0.798;0.047	T	0.64188	-0.6466	9	0.24483	T	0.36	.	9.799	0.40753	0.0:0.0:0.1731:0.8269	.	1048;126;979;1048;979;1048	Q15746-6;Q15746-7;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	R	1048;1048;1048;979;1048	ENSP00000354004:K1048R;ENSP00000353452:K1048R;ENSP00000352088:K1048R;ENSP00000320622:K979R;ENSP00000418335:K1048R	ENSP00000320622:K979R	K	-	2	0	MYLK	124901862	0.364000	0.24997	0.028000	0.17463	0.089000	0.18198	1.434000	0.34958	0.952000	0.37798	0.379000	0.24179	AAG	MYLK	-	NULL	ENSG00000065534		0.542	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	-	0.00	48	0	T	NM_053025		123419172	-1	tier1	-	no_errors	ENST00000360304	ensembl	human	known	74_37	missense	59.26	11	16	SNP	0.003	C
NAA11	84779	genome.wustl.edu	37	4	80246777	80246777	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:80246777G>T	ENST00000286794.4	-	1	427	c.255C>A	c.(253-255)ggC>ggA	p.G85G	NAA11_ENST00000513733.1_5'Flank	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	85	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						TCTGGGCCAGGCCGAGGCGCC	0.572																																																	0													59.0	64.0	62.0					4																	80246777		2161	4269	6430	SO:0001819	synonymous_variant	0				CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.255C>A	4.37:g.80246777G>T			Q66K19|Q6P479	Silent	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.G85	ENST00000286794.4	37	c.255	CCDS47084.1	4																																																																																			NAA11	-	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000156269		0.572	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA11	HGNC	protein_coding	OTTHUMT00000362922.1	-	0.00	36	0	G			80246777	-1	tier1	-	no_errors	ENST00000286794	ensembl	human	known	74_37	silent	40.74	16	11	SNP	1.000	T
NCAPH	23397	genome.wustl.edu	37	2	97008912	97008912	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:97008912G>T	ENST00000240423.4	+	5	508	c.465G>T	c.(463-465)gcG>gcT	p.A155A	NCAPH_ENST00000455200.1_Silent_p.A144A|NCAPH_ENST00000427946.1_Silent_p.A19A	NM_001281710.1|NM_001281711.1|NM_015341.3	NP_001268639.1|NP_001268640.1|NP_056156.2	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	155					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(717;0.0221)				AGGTGGCTGCGGGTACTCTGG	0.483																																																	0													92.0	77.0	82.0					2																	97008912		2203	4300	6503	SO:0001819	synonymous_variant	0			BC024211	CCDS2021.1, CCDS62960.1	2q11.2	2008-02-05	2006-09-04	2006-09-04	ENSG00000121152	ENSG00000121152			1112	protein-coding gene	gene with protein product		602332	"""barren (Drosophila) homolog"", ""barren homolog (Drosophila)"", ""barren homolog 1 (Drosophila)"""	BRRN1		9417923	Standard	NM_015341		Approved	CAP-H, hCAP-H	uc002svz.1	Q15003	OTTHUMG00000130451	ENST00000240423.4:c.465G>T	2.37:g.97008912G>T			B4E189|Q8TB87	Silent	SNP	pfam_Condensin_barren_su2,pirsf_Condensin_barren_su2	p.A155	ENST00000240423.4	37	c.465	CCDS2021.1	2																																																																																			NCAPH	-	pfam_Condensin_barren_su2,pirsf_Condensin_barren_su2	ENSG00000121152		0.483	NCAPH-001	KNOWN	basic|CCDS	protein_coding	NCAPH	HGNC	protein_coding	OTTHUMT00000252842.2	-	0.00	42	0	G	NM_015341		97008912	+1	tier1	-	no_errors	ENST00000240423	ensembl	human	known	74_37	silent	42.55	27	20	SNP	0.608	T
NCOA3	8202	genome.wustl.edu	37	20	46256687	46256687	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr20:46256687G>T	ENST00000371998.3	+	8	934	c.743G>T	c.(742-744)tGt>tTt	p.C248F	NCOA3_ENST00000341724.6_Missense_Mutation_p.C248F|NCOA3_ENST00000497292.1_3'UTR|NCOA3_ENST00000371997.3_Missense_Mutation_p.C248F|NCOA3_ENST00000372004.3_Missense_Mutation_p.C248F			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	248					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TGTATGATCTGTGTGGCACGC	0.358																																																	0													140.0	140.0	140.0					20																	46256687		2203	4300	6503	SO:0001583	missense	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.743G>T	20.37:g.46256687G>T	ENSP00000361066:p.Cys248Phe		A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.C248F	ENST00000371998.3	37	c.743	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924289	0.92319	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997;ENST00000542882	T;T;T;T	0.03094	4.06;4.28;4.28;4.05	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	M	0.79475	2.455	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.80764	0.986;0.971;0.986;0.986;0.994;0.986	T	0.00064	-1.2152	10	0.87932	D	0	-18.5907	19.8905	0.96928	0.0:0.0:1.0:0.0	.	248;248;252;248;248;248	A8K0W8;Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;.;NCOA3_HUMAN	F	248;248;248;248;248;14	ENSP00000342123:C248F;ENSP00000361073:C248F;ENSP00000361066:C248F;ENSP00000361065:C248F	ENSP00000345671:C248F	C	+	2	0	NCOA3	45690094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.692000	0.91855	0.655000	0.94253	TGT	NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.358	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1	-	0.00	22	0	G	NM_006534		46256687	+1	tier1	-	no_errors	ENST00000371998	ensembl	human	known	74_37	missense	51.52	16	17	SNP	1.000	T
NDC80	10403	genome.wustl.edu	37	18	2590098	2590098	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr18:2590098G>T	ENST00000261597.4	+	10	1134	c.952G>T	c.(952-954)Gag>Tag	p.E318*		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	318	Interaction with NEK2 and ZWINT.|Interaction with SMC1A.|Interaction with the N-terminus of CDCA1.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						GAGCAATTTGGAGTCTCATTC	0.388																																																	0													72.0	67.0	68.0					18																	2590098		2203	4300	6503	SO:0001587	stop_gained	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.952G>T	18.37:g.2590098G>T	ENSP00000261597:p.Glu318*		Q6PJX2	Nonsense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E318*	ENST00000261597.4	37	c.952	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	39	7.767159	0.98477	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	.	.	.	5.79	5.79	0.91817	.	0.093573	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	-16.3729	20.024	0.97514	0.0:0.0:1.0:0.0	.	.	.	.	X	318	.	ENSP00000261597:E318X	E	+	1	0	NDC80	2580098	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.725000	0.74752	2.718000	0.92993	0.655000	0.94253	GAG	NDC80	-	NULL	ENSG00000080986		0.388	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	-	0.00	36	0	G	NM_006101		2590098	+1	tier1	-	no_errors	ENST00000261597	ensembl	human	known	74_37	nonsense	30.77	36	16	SNP	1.000	T
NDUFC1	4717	genome.wustl.edu	37	4	140216938	140216938	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:140216938G>A	ENST00000544855.1	-	3	844	c.15C>T	c.(13-15)gcC>gcT	p.A5A	NDUFC1_ENST00000394223.1_Silent_p.A5A|NDUFC1_ENST00000539002.1_Silent_p.A5A|NDUFC1_ENST00000505036.1_Silent_p.A5A|NDUFC1_ENST00000394228.1_Silent_p.A5A|NDUFC1_ENST00000265500.4_Silent_p.A5A|NDUFC1_ENST00000539387.1_Silent_p.A5A|NDUFC1_ENST00000507764.1_5'UTR	NM_001184986.1	NP_001171915.1	O43677	NDUC1_HUMAN	NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1, 6kDa	5					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|upper_aerodigestive_tract(1)	2	all_hematologic(180;0.162)					GACGCAGCAAGGCGGACGGCG	0.692											OREG0016331	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													15.0	15.0	15.0					4																	140216938		2168	4267	6435	SO:0001819	synonymous_variant	0			AF047184	CCDS3746.1	4q31.1	2011-07-04	2002-08-29		ENSG00000109390	ENSG00000109390		"""Mitochondrial respiratory chain complex / Complex I"""	7705	protein-coding gene	gene with protein product	"""complex I KFYI subunit"""	603844	"""NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1 (6kD, KFYI)"""			9425316, 9763677	Standard	NM_001184986		Approved	KFYI	uc021xsa.1	O43677	OTTHUMG00000133387	ENST00000544855.1:c.15C>T	4.37:g.140216938G>A		1654	A8K532|Q3MIJ9	Silent	SNP	NULL	p.A5	ENST00000544855.1	37	c.15	CCDS3746.1	4																																																																																			NDUFC1	-	NULL	ENSG00000109390		0.692	NDUFC1-204	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFC1	HGNC	protein_coding	OTTHUMT00000257237.1		0.00	13	0	G	NM_002494		140216938	-1			no_errors	ENST00000265500	ensembl	human	known	74_37	silent	85.71	1	6	SNP	0.000	A
NEGR1	257194	genome.wustl.edu	37	1	72241972	72241972	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:72241972T>G	ENST00000357731.5	-	3	657	c.418A>C	c.(418-420)Aag>Cag	p.K140Q	NEGR1_ENST00000306821.3_Missense_Mutation_p.K12Q|NEGR1_ENST00000467479.1_5'UTR|NEGR1_ENST00000434200.1_Missense_Mutation_p.K138Q	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	140	Ig-like C2-type 2.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		TCATATATCTTAGGAGGAACT	0.363																																																	0													79.0	74.0	75.0					1																	72241972		2203	4300	6503	SO:0001583	missense	0			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.418A>C	1.37:g.72241972T>G	ENSP00000350364:p.Lys140Gln		Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K140Q	ENST00000357731.5	37	c.418	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	T	18.59	3.656412	0.67586	.	.	ENSG00000172260	ENST00000357731;ENST00000306821;ENST00000434200	T;T;T	0.68025	-0.3;-0.3;-0.3	5.97	5.97	0.96955	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	N	0.17838	0.53	0.80722	D	1	P;B	0.38048	0.616;0.387	P;B	0.51016	0.656;0.241	T	0.55927	-0.8063	10	0.22706	T	0.39	-12.2104	15.4434	0.75208	0.0:0.0:0.0:1.0	.	138;140	B4DI94;Q7Z3B1	.;NEGR1_HUMAN	Q	140;12;138	ENSP00000350364:K140Q;ENSP00000305938:K12Q;ENSP00000413294:K138Q	ENSP00000305938:K12Q	K	-	1	0	NEGR1	72014560	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.338000	0.79269	2.288000	0.76882	0.533000	0.62120	AAG	NEGR1	-	pfam_Ig_I-set,pfscan_Ig-like_dom	ENSG00000172260		0.363	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	HGNC	protein_coding	OTTHUMT00000026722.4	-	0.00	32	0	T	NM_173808		72241972	-1	tier1	-	no_errors	ENST00000357731	ensembl	human	known	74_37	missense	60.00	12	18	SNP	1.000	G
NELL2	4753	genome.wustl.edu	37	12	45059341	45059341	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:45059341C>T	ENST00000429094.2	-	13	1874	c.1370G>A	c.(1369-1371)tGt>tAt	p.C457Y	NELL2_ENST00000551601.1_Missense_Mutation_p.C456Y|NELL2_ENST00000549027.1_Missense_Mutation_p.C456Y|NELL2_ENST00000452445.2_Missense_Mutation_p.C457Y|NELL2_ENST00000395487.2_Missense_Mutation_p.C456Y|NELL2_ENST00000437801.2_Missense_Mutation_p.C507Y|NELL2_ENST00000333837.4_Missense_Mutation_p.C480Y	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	457	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)	p.C507F(1)|p.C457F(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GGTGTTGACACACATTGTATT	0.413																																																	2	Substitution - Missense(2)	lung(2)											88.0	85.0	86.0					12																	45059341		2203	4300	6503	SO:0001583	missense	0			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1370G>A	12.37:g.45059341C>T	ENSP00000390680:p.Cys457Tyr		B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.C507Y	ENST00000429094.2	37	c.1520	CCDS8746.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.257237|4.257237	0.80246|0.80246	.|.	.|.	ENSG00000184613|ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684|ENST00000550313	D;D;D;D;D;D;D|.	0.99445|.	-5.76;-5.76;-5.12;-5.76;-5.76;-5.91;-5.12|.	5.28|5.28	5.28|5.28	0.74379|0.74379	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91503|0.91503	0.7317|0.7317	H|H	0.99225|0.99225	4.475|4.475	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.998;1.0;0.999;0.997;0.999;1.0|.	D;D;D;D;D;D|.	0.83275|.	0.972;0.996;0.974;0.996;0.983;0.996|.	D|D	0.95149|0.95149	0.8271|0.8271	10|5	0.87932|.	D|.	0|.	-9.8824|-9.8824	18.9014|18.9014	0.92444|0.92444	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	480;507;456;457;457;456|.	B7Z2U7;B7Z9U3;F8VVB6;B3KTI3;Q99435;Q96JS2|.	.;.;.;.;NELL2_HUMAN;.|.	Y|M	456;457;456;457;456;480;507;456|201	ENSP00000378866:C456Y;ENSP00000390680:C457Y;ENSP00000449332:C456Y;ENSP00000394612:C457Y;ENSP00000447927:C456Y;ENSP00000327988:C480Y;ENSP00000416341:C507Y|.	ENSP00000327988:C480Y|.	C|V	-|-	2|1	0|0	NELL2|NELL2	43345608|43345608	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.702000|0.702000	0.40608|0.40608	7.484000|7.484000	0.81180|0.81180	2.452000|2.452000	0.82932|0.82932	0.650000|0.650000	0.86243|0.86243	TGT|GTG	NELL2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000184613		0.413	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL2	HGNC	protein_coding	OTTHUMT00000404180.1		0.00	24	0	C	NM_006159		45059341	-1			no_errors	ENST00000437801	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
NINJ1	4814	genome.wustl.edu	37	9	95888702	95888702	+	Silent	SNP	G	G	A	rs140825165	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:95888702G>A	ENST00000375446.4	-	2	364	c.294C>T	c.(292-294)ctC>ctT	p.L98L	NINJ1_ENST00000489274.1_5'Flank	NM_004148.3	NP_004139.2	Q92982	NINJ1_HUMAN	ninjurin 1	98					cell adhesion (GO:0007155)|hyaloid vascular plexus regression (GO:1990384)|nervous system development (GO:0007399)|positive regulation of cell-matrix adhesion (GO:0001954)|tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|upper_aerodigestive_tract(1)	4						CAAGGAAGATGAGCAGCACCC	0.647													.|||	7	0.00139776	0.0	0.0	5008	,	,		14732	0.0		0.0	False		,,,				2504	0.0072																0													73.0	69.0	70.0					9																	95888702		2202	4300	6502	SO:0001819	synonymous_variant	0			U91512	CCDS6703.1	9q22	2008-07-21			ENSG00000131669	ENSG00000131669			7824	protein-coding gene	gene with protein product	"""nerve injury-induced protein-1"""	602062				8780658	Standard	NM_004148		Approved	NIN1	uc004atg.4	Q92982	OTTHUMG00000020242	ENST00000375446.4:c.294C>T	9.37:g.95888702G>A			Q6GU89|Q8WUV5|Q9BT07	Silent	SNP	pfam_Ninjurin	p.L98	ENST00000375446.4	37	c.294	CCDS6703.1	9																																																																																			NINJ1	-	pfam_Ninjurin	ENSG00000131669		0.647	NINJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NINJ1	HGNC	protein_coding	OTTHUMT00000053123.2	-	0.00	26	0	G	NM_004148		95888702	-1	tier1	-	no_errors	ENST00000375446	ensembl	human	known	74_37	silent	92.86	1	13	SNP	1.000	A
NIPBL	25836	genome.wustl.edu	37	5	37014784	37014784	+	Splice_Site	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:37014784G>T	ENST00000282516.8	+	22	5059		c.e22-1		NIPBL_ENST00000448238.2_Splice_Site	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)						brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TTTCATTCTAGATTGACCAGG	0.308																																																	0													120.0	132.0	128.0					5																	37014784		2203	4298	6501	SO:0001630	splice_region_variant	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.4561-1G>T	5.37:g.37014784G>T			Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Splice_Site	SNP	-	e21-1	ENST00000282516.8	37	c.4561-1	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621318	0.46736	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	.	.	.	4.83	4.83	0.62350	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2733	0.90074	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NIPBL	37050541	1.000000	0.71417	1.000000	0.80357	0.296000	0.27459	9.245000	0.95431	2.393000	0.81446	0.591000	0.81541	.	NIPBL	-	-	ENSG00000164190		0.308	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	-	0.00	24	0	G	NM_015384	Intron	37014784	+1	tier1	-	no_errors	ENST00000282516	ensembl	human	known	74_37	splice_site	30.95	29	13	SNP	1.000	T
NOL12	79159	genome.wustl.edu	37	22	38083951	38083951	+	Nonsense_Mutation	SNP	G	G	T	rs376416869		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:38083951G>T	ENST00000359114.4	+	2	188	c.118G>T	c.(118-120)Gag>Tag	p.E40*	NOL12_ENST00000493862.1_3'UTR	NM_024313.2	NP_077289.1	Q9UGY1	NOL12_HUMAN	nucleolar protein 12	40						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	8	Melanoma(58;0.0574)					GCGGAAGGTCGAGCGAAAGAA	0.572																																																	0													29.0	25.0	27.0					22																	38083951		2197	4283	6480	SO:0001587	stop_gained	0			Z83844	CCDS13955.1	22q13.1	2012-05-02			ENSG00000256872	ENSG00000273899			28585	protein-coding gene	gene with protein product						12477932	Standard	NM_024313		Approved	MGC3731, Nop25, RRP17	uc003atp.3	Q9UGY1	OTTHUMG00000150660	ENST00000359114.4:c.118G>T	22.37:g.38083951G>T	ENSP00000352021:p.Glu40*			Nonsense_Mutation	SNP	pfam_Nucleolar_protein_12	p.E40*	ENST00000359114.4	37	c.118	CCDS13955.1	22	.	.	.	.	.	.	.	.	.	.	G	37	6.259694	0.97421	.	.	ENSG00000256872	ENST00000359114	.	.	.	5.63	5.63	0.86233	.	0.049300	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-8.7876	17.8572	0.88769	0.0:0.0:1.0:0.0	.	.	.	.	X	40	.	ENSP00000352021:E40X	E	+	1	0	Z83844.2	36413897	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	6.832000	0.75329	2.644000	0.89710	0.643000	0.83706	GAG	NOL12	-	pfam_Nucleolar_protein_12	ENSG00000100101		0.572	NOL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL12	HGNC	protein_coding	OTTHUMT00000319476.1	-	0.00	36	0	G	NM_024313		38083951	+1	tier1	-	no_errors	ENST00000359114	ensembl	human	known	74_37	nonsense	45.45	30	25	SNP	1.000	T
NOTCH3	4854	genome.wustl.edu	37	19	15285174	15285174	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:15285174C>A	ENST00000263388.2	-	25	4516	c.4441G>T	c.(4441-4443)Gac>Tac	p.D1481Y		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1481					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CAGCGGCCGTCGGCAAAGTGG	0.687																																																	0													12.0	12.0	12.0					19																	15285174		2134	4174	6308	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.4441G>T	19.37:g.15285174C>A	ENSP00000263388:p.Asp1481Tyr		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.D1481Y	ENST00000263388.2	37	c.4441	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528136	0.64860	.	.	ENSG00000074181	ENST00000263388	D	0.95103	-3.61	4.93	3.9	0.45041	Notch domain (4);	.	.	.	.	D	0.96790	0.8952	M	0.80183	2.485	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	D	0.96848	0.9623	9	0.87932	D	0	.	12.2	0.54319	0.0:0.9151:0.0:0.0849	.	1481	Q9UM47	NOTC3_HUMAN	Y	1481	ENSP00000263388:D1481Y	ENSP00000263388:D1481Y	D	-	1	0	NOTCH3	15146174	1.000000	0.71417	0.024000	0.17045	0.622000	0.37654	7.668000	0.83897	1.088000	0.41272	0.491000	0.48974	GAC	NOTCH3	-	pirsf_Notch,pfam_Notch_dom,superfamily_Notch_dom,smart_Notch_dom,pfscan_Notch_dom	ENSG00000074181		0.687	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	31	0	C	NM_000435		15285174	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	36.84	24	14	SNP	0.996	A
NPAP1	23742	genome.wustl.edu	37	15	24922115	24922115	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:24922115C>A	ENST00000329468.2	+	1	1575	c.1101C>A	c.(1099-1101)caC>caA	p.H367Q		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	367	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GAGACCTACACACCTTGGAGA	0.547																																																	0													55.0	50.0	52.0					15																	24922115		2203	4300	6503	SO:0001583	missense	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1101C>A	15.37:g.24922115C>A	ENSP00000333735:p.His367Gln			Missense_Mutation	SNP	NULL	p.H367Q	ENST00000329468.2	37	c.1101	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	6.375	0.437347	0.12104	.	.	ENSG00000185823	ENST00000329468	T	0.05649	3.41	2.07	-0.0477	0.13842	.	2.384450	0.01806	N	0.033179	T	0.03608	0.0103	N	0.22421	0.69	0.09310	N	1	B	0.33940	0.433	B	0.25405	0.06	T	0.31833	-0.9929	10	0.10377	T	0.69	.	2.3769	0.04344	0.3244:0.4861:0.0:0.1894	.	367	Q9NZP6	CO002_HUMAN	Q	367	ENSP00000333735:H367Q	ENSP00000333735:H367Q	H	+	3	2	C15orf2	22473208	0.002000	0.14202	0.000000	0.03702	0.019000	0.09904	0.128000	0.15810	-0.002000	0.14469	0.491000	0.48974	CAC	NPAP1	-	NULL	ENSG00000185823		0.547	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	-	0.00	18	0	C	NM_018958		24922115	+1	tier1	-	no_errors	ENST00000329468	ensembl	human	known	74_37	missense	42.86	12	9	SNP	0.000	A
NRK	203447	genome.wustl.edu	37	X	105125725	105125725	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:105125725C>G	ENST00000243300.9	+	4	508	c.205C>G	c.(205-207)Cga>Gga	p.R69G	NRK_ENST00000428173.2_Missense_Mutation_p.R69G|NRK_ENST00000536164.1_Missense_Mutation_p.R69G	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	69	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.R69*(2)		breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						AATAGGAAGGCGAGTGAGAGT	0.333										HNSCC(51;0.14)																																							2	Substitution - Nonsense(2)	large_intestine(2)											79.0	67.0	71.0					X																	105125725		1803	4021	5824	SO:0001583	missense	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.205C>G	X.37:g.105125725C>G	ENSP00000434830:p.Arg69Gly		Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.R69G	ENST00000243300.9	37	c.205		X	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570494	0.28003	.	.	ENSG00000123572	ENST00000243300;ENST00000428173;ENST00000536164	T;T;T	0.66099	-0.19;-0.19;-0.19	3.97	2.14	0.27477	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.32002	N	0.006739	T	0.68007	0.2954	L	0.42581	1.335	0.58432	D	0.999993	D	0.89917	1.0	D	0.85130	0.997	T	0.65261	-0.6211	10	0.59425	D	0.04	.	8.207	0.31461	0.4329:0.5671:0.0:0.0	.	69	Q7Z2Y5	NRK_HUMAN	G	69	ENSP00000434830:R69G;ENSP00000438378:R69G;ENSP00000438785:R69G	ENSP00000434830:R69G	R	+	1	2	NRK	105012381	0.287000	0.24315	0.750000	0.31169	0.987000	0.75469	0.065000	0.14466	0.278000	0.22164	-0.293000	0.09583	CGA	NRK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000123572		0.333	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	-	0.00	52	0	C	NM_198465		105125725	+1	tier1	-	no_errors	ENST00000428173	ensembl	human	known	74_37	missense	83.33	9	45	SNP	0.704	G
NRXN1	9378	genome.wustl.edu	37	2	50280637	50280637	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:50280637C>A	ENST00000406316.2	-	20	5286	c.3810G>T	c.(3808-3810)ctG>ctT	p.L1270L	NRXN1_ENST00000406859.3_Silent_p.L1270L|NRXN1_ENST00000401710.1_Silent_p.L288L|NRXN1_ENST00000402717.3_Silent_p.L1292L|NRXN1_ENST00000405472.3_Silent_p.L1292L|NRXN1_ENST00000342183.5_Silent_p.L235L|NRXN1_ENST00000404971.1_Silent_p.L1340L|NRXN1_ENST00000401669.2_Silent_p.L1300L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1270	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CATTGTAGTACAGCCCAGAGA	0.498																																																	0													93.0	89.0	91.0					2																	50280637		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3810G>T	2.37:g.50280637C>A			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.L1292	ENST00000406316.2	37	c.3876	CCDS54360.1	2																																																																																			NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000179915		0.498	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	44	0	C			50280637	-1	tier1	-	no_errors	ENST00000402717	ensembl	human	known	74_37	silent	31.76	57	27	SNP	1.000	A
NRXN3	9369	genome.wustl.edu	37	14	80328302	80328302	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:80328302G>T	ENST00000557594.1	+	6	2862	c.1909G>T	c.(1909-1911)Gtg>Ttg	p.V637L	NRXN3_ENST00000556003.1_3'UTR|NRXN3_ENST00000554719.1_Missense_Mutation_p.V1061L|NRXN3_ENST00000335750.5_Missense_Mutation_p.V1061L|NRXN3_ENST00000281127.7_Missense_Mutation_p.V432L|NRXN3_ENST00000428277.2_Missense_Mutation_p.V459L	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	637					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.V459M(1)|p.V1061M(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GGAGTATTACGTGTAAACATG	0.498																																																	2	Substitution - Missense(2)	prostate(2)											90.0	91.0	91.0					14																	80328302		2203	4300	6503	SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1909G>T	14.37:g.80328302G>T	ENSP00000451672:p.Val637Leu		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.V1061L	ENST00000557594.1	37	c.3181		14	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910537	0.52439	.	.	ENSG00000021645	ENST00000330071;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.81247	-1.47;-1.47;-0.0;0.42;0.17	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.88959	0.6579	M	0.61703	1.905	0.42993	D	0.994494	D;D;D;B	0.76494	0.999;0.992;0.998;0.142	D;P;D;B	0.80764	0.993;0.882;0.994;0.076	D	0.86783	0.1980	9	.	.	.	.	20.6525	0.99598	0.0:0.0:1.0:0.0	.	459;432;637;1061	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	L	1643;1061;1061;637;432;459	ENSP00000451648:V1061L;ENSP00000338349:V1061L;ENSP00000451672:V637L;ENSP00000281127:V432L;ENSP00000394426:V459L	.	V	+	1	0	NRXN3	79398055	1.000000	0.71417	0.987000	0.45799	0.728000	0.41692	9.869000	0.99810	2.890000	0.99128	0.585000	0.79938	GTG	NRXN3	-	NULL	ENSG00000021645		0.498	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	10	0	G	NM_001105250		80328302	+1	tier1	-	no_errors	ENST00000335750	ensembl	human	known	74_37	missense	36.36	7	4	SNP	1.000	T
NUAK2	81788	genome.wustl.edu	37	1	205275371	205275371	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:205275371C>G	ENST00000367157.3	-	5	761	c.635G>C	c.(634-636)aGc>aCc	p.S212T		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			ATAGAGGGGGCTCCCACAGAA	0.552																																																	0													108.0	105.0	106.0					1																	205275371		2203	4300	6503	SO:0001583	missense	0			AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.635G>C	1.37:g.205275371C>G	ENSP00000356125:p.Ser212Thr			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S212T	ENST00000367157.3	37	c.635	CCDS1453.1	1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.933817	0.92458	.	.	ENSG00000163545	ENST00000367157	T	0.12672	2.66	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000051	T	0.18045	0.0433	N	0.02345	-0.59	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	T	0.52533	-0.8563	10	0.87932	D	0	.	19.5148	0.95159	0.0:1.0:0.0:0.0	.	212	Q9H093	NUAK2_HUMAN	T	212	ENSP00000356125:S212T	ENSP00000356125:S212T	S	-	2	0	NUAK2	203541994	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	7.818000	0.86416	2.702000	0.92279	0.655000	0.94253	AGC	NUAK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000163545		0.552	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK2	HGNC	protein_coding	OTTHUMT00000090390.1	-	0.00	51	0	C	NM_030952		205275371	-1	tier1	-	no_errors	ENST00000367157	ensembl	human	known	74_37	missense	86.67	4	26	SNP	1.000	G
NUCB2	4925	genome.wustl.edu	37	11	17333611	17333611	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:17333611G>T	ENST00000529010.1	+	10	1075	c.856G>T	c.(856-858)Gat>Tat	p.D286Y	NUCB2_ENST00000458064.2_Missense_Mutation_p.D286Y|NUCB2_ENST00000323688.6_Missense_Mutation_p.D286Y	NM_005013.2	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2	286	Asp/Glu-rich (acidic).|Binds to necdin. {ECO:0000250}.					cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TGAAGAGGATGATATGGTAGA	0.284																																																	0													128.0	125.0	126.0					11																	17333611		1799	4057	5856	SO:0001583	missense	0			AF052642	CCDS41623.1	11p15.1	2013-01-10						"""EF-hand domain containing"""	8044	protein-coding gene	gene with protein product		608020				7811391	Standard	NM_005013		Approved	NEFA	uc001mmw.3	P80303		ENST00000529010.1:c.856G>T	11.37:g.17333611G>T	ENSP00000436455:p.Asp286Tyr		A8K642|D3DQX5|Q8NFT5	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.D286Y	ENST00000529010.1	37	c.856	CCDS41623.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.3|23.3	4.393869|4.393869	0.83011|0.83011	.|.	.|.	ENSG00000070081|ENSG00000070081	ENST00000323688;ENST00000529010;ENST00000458064|ENST00000527580	D;D;D|.	0.84589|.	-1.87;-1.87;-1.87|.	5.63|5.63	4.71|4.71	0.59529|0.59529	EF-hand-like domain (1);|.	0.044629|.	0.85682|.	N|.	0.000000|.	T|.	0.69620|.	0.3131|.	L|L	0.58354|0.58354	1.805|1.805	0.80722|0.80722	D|D	1|1	B;D|.	0.89917|.	0.157;1.0|.	B;D|.	0.81914|.	0.079;0.995|.	T|.	0.67440|.	-0.5670|.	10|.	0.87932|.	D|.	0|.	-12.1861|-12.1861	15.0058|15.0058	0.71510|0.71510	0.0694:0.0:0.9306:0.0|0.0694:0.0:0.9306:0.0	.|.	286;286|.	E7EV42;P80303|.	.;NUCB2_HUMAN|.	Y|L	286|93	ENSP00000320168:D286Y;ENSP00000436455:D286Y;ENSP00000408702:D286Y|.	ENSP00000320168:D286Y|.	D|X	+|+	1|2	0|2	NUCB2|NUCB2	17290187|17290187	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.682000|2.682000	0.91365|0.91365	0.650000|0.650000	0.86243|0.86243	GAT|TGA	NUCB2	-	NULL	ENSG00000070081		0.284	NUCB2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUCB2	HGNC	protein_coding	OTTHUMT00000387614.2	-	0.00	77	0	G	NM_005013		17333611	+1	tier1	-	no_errors	ENST00000323688	ensembl	human	known	74_37	missense	90.35	11	103	SNP	1.000	T
NUTM2A	728118	genome.wustl.edu	37	10	88994911	88994911	+	IGR	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:88994911G>A	ENST00000381707.2	+	0	3290				NUTM2A-AS1_ENST00000451940.2_RNA|NUTM2A-AS1_ENST00000456104.1_RNA|NUTM2A_ENST00000381689.4_Silent_p.*630*	NM_001099338.1	NP_001092808.1	Q8IVF1	NTM2A_HUMAN	NUT family member 2A																		GACAGATGCTGAGGAAGCCCT	0.622																																																	0																																										SO:0001628	intergenic_variant	0				CCDS44452.1	10q23.2	2013-03-15	2013-03-14	2013-03-14	ENSG00000184923	ENSG00000184923			23438	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member A"""	FAM22A			Standard	NM_001099338		Approved		uc001kek.3	Q8IVF1	OTTHUMG00000018670		10.37:g.88994911G>A			A6NMX5|C9JDI1|Q5VZW1	Silent	SNP	NULL	p.*630	ENST00000381707.2	37	c.1889	CCDS44452.1	10																																																																																			NUTM2A	-	NULL	ENSG00000184923		0.622	NUTM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM2A	HGNC	protein_coding	OTTHUMT00000049198.2	-	0.00	96	0	G	NM_001099338		88994911	+1	tier1	-	no_errors	ENST00000381689	ensembl	human	novel	74_37	silent	86.54	7	45	SNP	0.004	A
OBP2A	29991	genome.wustl.edu	37	9	138439805	138439805	+	Silent	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:138439805G>C	ENST00000539850.1	+	4	392	c.366G>C	c.(364-366)ctG>ctC	p.L122L	OBP2A_ENST00000340780.3_Silent_p.L122L|OBP2A_ENST00000342114.4_Missense_Mutation_p.A78P|OBP2A_ENST00000371776.1_Silent_p.L122L			Q9NY56	OBP2A_HUMAN	odorant binding protein 2A	122					response to stimulus (GO:0050896)|sensory perception of chemical stimulus (GO:0007606)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			endometrium(1)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		GTGGGGGCCTGCGCTACATGG	0.612																																																	0													43.0	39.0	41.0					9																	138439805		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ251029	CCDS6992.1	9q34	2014-01-22			ENSG00000122136	ENSG00000122136		"""Lipocalins"""	23380	protein-coding gene	gene with protein product		164320					Standard	NM_014582		Approved	hOBPIIa, OBP, LCN13	uc004cgb.3	Q9NY56	OTTHUMG00000020909	ENST00000539850.1:c.366G>C	9.37:g.138439805G>C			Q5T8A3|Q9NY50|Q9NY53|Q9NY54|Q9NY55	Missense_Mutation	SNP	superfamily_Calycin-like	p.A78P	ENST00000539850.1	37	c.232	CCDS6992.1	9	.	.	.	.	.	.	.	.	.	.	g	7.919	0.738083	0.15574	.	.	ENSG00000122136	ENST00000342114	T	0.09723	2.95	2.25	-1.05	0.10036	.	.	.	.	.	T	0.05914	0.0154	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39057	-0.9632	8	0.37606	T	0.19	2.0E-4	2.8242	0.05480	0.3257:0.2474:0.4269:0.0	.	78	Q5T8A4	.	P	78	ENSP00000340950:A78P	ENSP00000340950:A78P	A	+	1	0	OBP2A	137579626	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.155000	0.03163	-0.249000	0.09569	-0.401000	0.06369	GCG	OBP2A	-	NULL	ENSG00000122136		0.612	OBP2A-006	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	OBP2A	HGNC	protein_coding	OTTHUMT00000397904.1	-	0.00	15	0	G	NM_014582		138439805	+1	tier1	-	no_errors	ENST00000342114	ensembl	human	known	74_37	missense	83.33	2	10	SNP	0.000	C
OBSCN	84033	genome.wustl.edu	37	1	228470840	228470840	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:228470840G>T	ENST00000422127.1	+	32	8636	c.8592G>T	c.(8590-8592)aaG>aaT	p.K2864N	OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.K2864N|OBSCN_ENST00000359599.6_Missense_Mutation_p.K1711N|OBSCN_ENST00000570156.2_Missense_Mutation_p.K3293N	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	2864	Ig-like 28.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGGACAGGAAGGCCATCCGCA	0.662																																																	0													19.0	25.0	23.0					1																	228470840		2127	4204	6331	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.8592G>T	1.37:g.228470840G>T	ENSP00000409493:p.Lys2864Asn		Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.K2864N	ENST00000422127.1	37	c.8592	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	g	19.15	3.771977	0.69992	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599;ENST00000366706;ENST00000366704	T;T;T	0.68624	-0.34;-0.34;-0.34	5.61	-0.157	0.13387	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.068477	0.56097	D	0.000033	T	0.76321	0.3971	M	0.73962	2.25	0.80722	D	1	P;D;D	0.69078	0.81;0.977;0.997	P;P;D	0.83275	0.863;0.787;0.996	T	0.72786	-0.4188	10	0.19590	T	0.45	.	12.0829	0.53682	0.4185:0.0:0.5815:0.0	.	2864;2864;2864	Q5VST9;Q5VST9-2;Q5VST9-3	OBSCN_HUMAN;.;.	N	2864;2864;1711;563;270	ENSP00000284548:K2864N;ENSP00000409493:K2864N;ENSP00000352613:K1711N	ENSP00000284548:K2864N	K	+	3	2	OBSCN	226537463	0.954000	0.32549	0.956000	0.39512	0.667000	0.39255	0.047000	0.14056	0.060000	0.16281	-0.144000	0.13903	AAG	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154358		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		-	0.00	37	0	G	NM_052843		228470840	+1	tier1	-	no_errors	ENST00000422127	ensembl	human	known	74_37	missense	61.90	8	13	SNP	0.986	T
OGDHL	55753	genome.wustl.edu	37	10	50951964	50951964	+	Intron	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:50951964C>A	ENST00000374103.4	-	14	1947				OGDHL_ENST00000419399.1_Intron|OGDHL_ENST00000432695.1_Intron	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like						glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CTCTTGCATCCCAACCAATCT	0.577																																																	0																																										SO:0001627	intron_variant	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1861+75G>T	10.37:g.50951964C>A			A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	RNA	SNP	-	NULL	ENST00000374103.4	37	NULL	CCDS7234.1	10																																																																																			OGDHL	-	-	ENSG00000197444		0.577	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	-	0.00	11	0	C	NM_018245		50951964	-1	tier1	-	no_errors	ENST00000496884	ensembl	human	known	74_37	rna	91.67	1	11	SNP	0.002	A
OR2J2	26707	genome.wustl.edu	37	6	29142185	29142185	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:29142185G>T	ENST00000377167.2	+	1	875	c.773G>T	c.(772-774)tGc>tTc	p.C258F		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						CCAGTCATGTGCATGTATCTC	0.438																																																	0													119.0	110.0	113.0					6																	29142185		1918	4135	6053	SO:0001583	missense	0				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.773G>T	6.37:g.29142185G>T	ENSP00000366372:p.Cys258Phe		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C258F	ENST00000377167.2	37	c.773	CCDS43434.1	6	.	.	.	.	.	.	.	.	.	.	G	0.060	-1.227350	0.01518	.	.	ENSG00000204700	ENST00000377167	T	0.00014	9.21	2.0	0.0199	0.14123	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00012	0.0000	N	0.00151	-1.98	0.09310	N	1	B	0.16802	0.019	B	0.21917	0.037	T	0.50250	-0.8850	9	0.29301	T	0.29	.	0.2384	0.00189	0.309:0.203:0.2817:0.2063	.	258	O76002	OR2J2_HUMAN	F	258	ENSP00000366372:C258F	ENSP00000366372:C258F	C	+	2	0	OR2J2	29250164	0.000000	0.05858	0.935000	0.37517	0.539000	0.34962	0.033000	0.13754	0.167000	0.19631	0.205000	0.17691	TGC	OR2J2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204700		0.438	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	HGNC	protein_coding	OTTHUMT00000076131.2	-	0.00	67	0	G			29142185	+1	tier1	-	no_errors	ENST00000377167	ensembl	human	known	74_37	missense	48.45	50	47	SNP	0.005	T
OR12D3	81797	genome.wustl.edu	37	6	29342679	29342679	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:29342679C>T	ENST00000396806.3	-	1	389	c.386G>A	c.(385-387)cGc>cAc	p.R129H	OR5V1_ENST00000377154.1_Intron	NM_030959.2	NP_112221.1	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D, member 3	129						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)	23						GACAGTGTAGCGAAGAGGATT	0.493																																																	0													57.0	58.0	58.0					6																	29342679		1510	2709	4219	SO:0001583	missense	0				CCDS4658.1	6p22.1	2013-09-24			ENSG00000112462	ENSG00000112462		"""GPCR / Class A : Olfactory receptors"""	13963	protein-coding gene	gene with protein product							Standard	NM_030959		Approved	hs6M1-27	uc003nme.3	Q9UGF7	OTTHUMG00000031051	ENST00000396806.3:c.386G>A	6.37:g.29342679C>T	ENSP00000380023:p.Arg129His		A2BDZ1|Q5SQI8|Q6IF23	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R129H	ENST00000396806.3	37	c.386	CCDS4658.1	6	.	.	.	.	.	.	.	.	.	.	C	1.727	-0.495175	0.04322	.	.	ENSG00000112462	ENST00000377143;ENST00000396806	T	0.02258	4.37	4.18	0.195	0.15151	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00300	0.0009	N	0.10837	0.055	0.09310	N	0.999999	B	0.18461	0.028	B	0.12837	0.008	T	0.43458	-0.9390	9	0.02654	T	1	-4.4748	4.5294	0.11997	0.1465:0.4338:0.0:0.4197	.	129	Q9UGF7	O12D3_HUMAN	H	129	ENSP00000380023:R129H	ENSP00000366348:R129H	R	-	2	0	OR12D3	29450658	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.173000	0.09854	-0.187000	0.10516	0.195000	0.17529	CGC	OR12D3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000112462		0.493	OR12D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR12D3	HGNC	protein_coding	OTTHUMT00000076056.3	-	0.00	29	0	C			29342679	-1	tier1	-	no_errors	ENST00000396806	ensembl	human	known	74_37	missense	35.29	33	18	SNP	0.349	T
OR2T2	401992	genome.wustl.edu	37	1	248617052	248617052	+	Silent	SNP	G	G	T	rs200152335		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:248617052G>T	ENST00000342927.3	+	1	976	c.954G>T	c.(952-954)gcG>gcT	p.A318A		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	318						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCAGGGTGGCGACTGTGATCA	0.552																																																	0													55.0	60.0	58.0					1																	248617052		2199	4299	6498	SO:0001819	synonymous_variant	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.954G>T	1.37:g.248617052G>T			B2RNM1|B9EH01	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A318	ENST00000342927.3	37	c.954	CCDS31116.1	1																																																																																			OR2T2	-	NULL	ENSG00000196240		0.552	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	-	0.00	58	0	G	NM_001004136		248617052	+1	tier1	-	no_errors	ENST00000342927	ensembl	human	known	74_37	silent	77.78	8	28	SNP	0.001	T
OR5T2	219464	genome.wustl.edu	37	11	56000131	56000131	+	Silent	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:56000131G>C	ENST00000313264.4	-	1	606	c.531C>G	c.(529-531)ccC>ccG	p.P177P		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TGTAGACTCTGGGTGACATGC	0.448																																																	0													202.0	171.0	182.0					11																	56000131		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.531C>G	11.37:g.56000131G>C			B9EGX5|Q6IFC8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P177	ENST00000313264.4	37	c.531	CCDS31523.1	11																																																																																			OR5T2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181718		0.448	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	-	0.00	71	0	G	NM_001004746		56000131	-1	tier1	-	no_errors	ENST00000313264	ensembl	human	known	74_37	silent	41.59	66	47	SNP	0.002	C
OR6C65	403282	genome.wustl.edu	37	12	55794493	55794493	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:55794493C>T	ENST00000379665.2	+	1	280	c.181C>T	c.(181-183)Ctc>Ttc	p.L61F		NM_001005518.1	NP_001005518.1	A6NJZ3	O6C65_HUMAN	olfactory receptor, family 6, subfamily C, member 65	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(3)|lung(9)	15						GTATTTCTTCCTCAGGAATTT	0.318																																																	0													53.0	53.0	53.0					12																	55794493		2203	4299	6502	SO:0001583	missense	0				CCDS31821.1	12q13.2	2013-09-23			ENSG00000205328	ENSG00000205328		"""GPCR / Class A : Olfactory receptors"""	31295	protein-coding gene	gene with protein product							Standard	NM_001005518		Approved		uc010spl.2	A6NJZ3	OTTHUMG00000169955	ENST00000379665.2:c.181C>T	12.37:g.55794493C>T	ENSP00000368986:p.Leu61Phe		B2RNH9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L61F	ENST00000379665.2	37	c.181	CCDS31821.1	12	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133828	0.37630	.	.	ENSG00000205328	ENST00000379665	T	0.14391	2.51	3.84	2.94	0.34122	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31531	U	0.007495	T	0.39332	0.1074	H	0.98027	4.13	0.28023	N	0.934447	D	0.57571	0.98	P	0.52957	0.714	T	0.50180	-0.8858	10	0.72032	D	0.01	.	6.8169	0.23835	0.0:0.7022:0.0:0.2978	.	61	A6NJZ3	O6C65_HUMAN	F	61	ENSP00000368986:L61F	ENSP00000368986:L61F	L	+	1	0	OR6C65	54080760	0.998000	0.40836	0.862000	0.33874	0.524000	0.34500	1.183000	0.32041	0.951000	0.37770	0.424000	0.28305	CTC	OR6C65	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000205328		0.318	OR6C65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C65	HGNC	protein_coding	OTTHUMT00000406674.1	-	0.00	21	0	C			55794493	+1	tier1	-	no_errors	ENST00000379665	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.972	T
OR8K5	219453	genome.wustl.edu	37	11	55927473	55927473	+	Missense_Mutation	SNP	G	G	C	rs267602995		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:55927473G>C	ENST00000313447.1	-	1	320	c.321C>G	c.(319-321)ttC>ttG	p.F107L		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CACTGATAATGAACATAAGGA	0.418																																																	0													89.0	88.0	88.0					11																	55927473		2201	4295	6496	SO:0001583	missense	0			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.321C>G	11.37:g.55927473G>C	ENSP00000323853:p.Phe107Leu		Q6IFB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F107L	ENST00000313447.1	37	c.321	CCDS31521.1	11	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840892	0.32513	.	.	ENSG00000181752	ENST00000313447	T	0.01871	4.59	3.88	-1.8	0.07907	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000015	T	0.03564	0.0102	N	0.12961	0.28	0.09310	N	0.999999	D	0.76494	0.999	D	0.79784	0.993	T	0.36720	-0.9736	10	0.49607	T	0.09	.	9.1876	0.37180	0.6029:0.0:0.3971:0.0	.	107	Q8NH50	OR8K5_HUMAN	L	107	ENSP00000323853:F107L	ENSP00000323853:F107L	F	-	3	2	OR8K5	55684049	0.000000	0.05858	0.165000	0.22776	0.309000	0.27889	-0.421000	0.07053	-0.210000	0.10140	-0.268000	0.10319	TTC	OR8K5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181752		0.418	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	HGNC	protein_coding	OTTHUMT00000391543.1	-	0.00	27	0	G	NM_001004058		55927473	-1	tier1	-	no_errors	ENST00000313447	ensembl	human	known	74_37	missense	50.00	23	23	SNP	0.026	C
OR6T1	219874	genome.wustl.edu	37	11	123814164	123814164	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:123814164G>A	ENST00000321252.2	-	1	416	c.382C>T	c.(382-384)Cga>Tga	p.R128*		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CGGAGTGGTCGGCAGATTGCC	0.542																																																	0													80.0	69.0	72.0					11																	123814164		2202	4299	6501	SO:0001587	stop_gained	0			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.382C>T	11.37:g.123814164G>A	ENSP00000325203:p.Arg128*		Q6IFE7	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R128*	ENST00000321252.2	37	c.382	CCDS31700.1	11	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684802	0.68157	.	.	ENSG00000181499	ENST00000321252	.	.	.	3.85	-0.914	0.10497	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-18.9543	12.1228	0.53902	0.0:0.0:0.2495:0.7505	.	.	.	.	X	128	.	ENSP00000325203:R128X	R	-	1	2	OR6T1	123319374	0.000000	0.05858	0.006000	0.13384	0.956000	0.61745	-2.279000	0.01159	-0.404000	0.07610	0.563000	0.77884	CGA	OR6T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181499		0.542	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6T1	HGNC	protein_coding	OTTHUMT00000387264.1	-	0.00	41	0	G	NM_001005187		123814164	-1	tier1	-	no_errors	ENST00000321252	ensembl	human	known	74_37	nonsense	60.24	33	50	SNP	0.001	A
OVCH1	341350	genome.wustl.edu	37	12	29617440	29617440	+	Splice_Site	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:29617440C>A	ENST00000318184.5	-	18	2124	c.2125G>T	c.(2125-2127)Gat>Tat	p.D709Y	OVCH1-AS1_ENST00000549411.1_Intron|OVCH1-AS1_ENST00000551108.1_Intron	NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	709	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					ATATGCTTACCTGCACTGATG	0.458																																																	0													43.0	42.0	42.0					12																	29617440		1924	4133	6057	SO:0001630	splice_region_variant	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.2125+1G>T	12.37:g.29617440C>A				Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,smart_Peptidase_S1,smart_CUB_dom,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.D709Y	ENST00000318184.5	37	c.2125		12	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884122	0.51908	.	.	ENSG00000187950	ENST00000318184	D	0.89123	-2.47	2.97	2.97	0.34412	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.89774	0.6812	L	0.36672	1.1	0.30273	N	0.79205	D	0.76494	0.999	D	0.64144	0.922	D	0.84909	0.0847	8	.	.	.	.	12.1861	0.54239	0.0:1.0:0.0:0.0	.	709	Q7RTY7	OVCH1_HUMAN	Y	709	ENSP00000326708:D709Y	.	D	-	1	0	OVCH1	29508707	0.994000	0.37717	0.282000	0.24776	0.086000	0.17979	1.476000	0.35420	1.956000	0.56807	0.655000	0.94253	GAT	OVCH1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000187950		0.458	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	-	0.00	36	0	C	NM_183378	Missense_Mutation	29617440	-1	tier1	-	no_errors	ENST00000318184	ensembl	human	known	74_37	missense	57.69	22	30	SNP	0.993	A
OTOGL	283310	genome.wustl.edu	37	12	80615872	80615872	+	Splice_Site	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:80615872C>T	ENST00000547103.1	+	6	315	c.309C>T	c.(307-309)atC>atT	p.I103I	OTOGL_ENST00000458043.2_Splice_Site_p.I103I			Q3ZCN5	OTOGL_HUMAN	otogelin-like	103					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCTTTTCAGTCCCAAACATGG	0.358																																																	0													90.0	86.0	88.0					12																	80615872		1829	4076	5905	SO:0001630	splice_region_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.308-1C>T	12.37:g.80615872C>T			F8W0C3|Q495U8|Q8N8G5|Q8NC28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.I103	ENST00000547103.1	37	c.309		12																																																																																			OTOGL	-	NULL	ENSG00000165899		0.358	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	-	0.00	12	0	C	NM_173591	Silent	80615872	+1	tier1	-	no_errors	ENST00000458043	ensembl	human	known	74_37	silent	48.28	15	14	SNP	0.892	T
AKAP2	11217	genome.wustl.edu	37	9	112898644	112898644	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:112898644G>C	ENST00000259318.7	+	2	334	c.127G>C	c.(127-129)Gaa>Caa	p.E43Q	PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.E274Q|AKAP2_ENST00000510514.5_Missense_Mutation_p.E274Q|AKAP2_ENST00000374525.1_Missense_Mutation_p.E132Q|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.E274Q|AKAP2_ENST00000434623.2_Missense_Mutation_p.E132Q|AKAP2_ENST00000555236.1_Missense_Mutation_p.E274Q	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	43										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						TGATCACCACGAATCCCTGGA	0.498																																																	0													179.0	155.0	163.0					9																	112898644		2203	4300	6503	SO:0001583	missense	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.127G>C	9.37:g.112898644G>C	ENSP00000259318:p.Glu43Gln		B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.E274Q	ENST00000259318.7	37	c.820	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880272	0.91740	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.57436	1.72;1.73;1.72;1.73;1.0;0.42;0.4;1.04	6.17	6.17	0.99709	.	0.064065	0.64402	D	0.000011	T	0.74061	0.3667	M	0.70275	2.135	0.58432	D	0.999993	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.985;0.999;0.992;0.999;0.997;0.999;0.999;0.998	T	0.74061	-0.3786	10	0.87932	D	0	-31.4694	19.8676	0.96824	0.0:0.0:1.0:0.0	.	43;132;126;132;133;274;274;92	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	Q	274;274;274;274;132;132;92;43	ENSP00000363654:E274Q;ENSP00000305861:E274Q;ENSP00000451476:E274Q;ENSP00000421522:E274Q;ENSP00000404782:E132Q;ENSP00000363649:E132Q;ENSP00000419268:E92Q;ENSP00000259318:E43Q	ENSP00000259318:E43Q	E	+	1	0	PALM2-AKAP2;AKAP2	111938465	1.000000	0.71417	0.404000	0.26397	0.902000	0.53008	6.097000	0.71452	2.941000	0.99782	0.655000	0.94253	GAA	PALM2-AKAP2	-	NULL	ENSG00000157654		0.498	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	-	0.00	40	0	G	NM_001004065		112898644	+1	tier1	-	no_errors	ENST00000374530	ensembl	human	known	74_37	missense	85.71	4	24	SNP	0.988	C
PAPPA	5069	genome.wustl.edu	37	9	118982241	118982241	+	Silent	SNP	G	G	T	rs140997586		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:118982241G>T	ENST00000328252.3	+	5	2313	c.1944G>T	c.(1942-1944)acG>acT	p.T648T	PAPPA_ENST00000534838.1_Intron	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	648					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ACTCCTTCACGCCCAATCAAG	0.592																																																	0													105.0	101.0	102.0					9																	118982241		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1944G>T	9.37:g.118982241G>T			B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.T648	ENST00000328252.3	37	c.1944	CCDS6813.1	9																																																																																			PAPPA	-	pfam_Peptidase_M43	ENSG00000182752		0.592	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	-	0.00	28	0	G	NM_002581		118982241	+1	tier1	-	no_errors	ENST00000328252	ensembl	human	known	74_37	silent	83.33	3	15	SNP	0.995	T
PAXIP1	22976	genome.wustl.edu	37	7	154785468	154785468	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:154785468C>T	ENST00000404141.1	-	3	382	c.228G>A	c.(226-228)gtG>gtA	p.V76V	PAXIP1_ENST00000397192.1_Silent_p.V76V|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	76	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CGGACAGAATCACCCAAGAAG	0.358																																																	0													81.0	72.0	74.0					7																	154785468		1807	4074	5881	SO:0001819	synonymous_variant	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.228G>A	7.37:g.154785468C>T			O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Silent	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.V76	ENST00000404141.1	37	c.228	CCDS47753.1	7																																																																																			PAXIP1	-	superfamily_BRCT_dom,pfscan_BRCT_dom	ENSG00000157212		0.358	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	-	0.00	17	0	C	NM_007349		154785468	-1	tier1	-	no_errors	ENST00000397192	ensembl	human	known	74_37	silent	81.82	2	9	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	56106232	56106232	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:56106232C>A	ENST00000320301.6	-	6	881	c.487G>T	c.(487-489)Ggt>Tgt	p.G163C	PCDH15_ENST00000414778.1_Missense_Mutation_p.G168C|PCDH15_ENST00000361849.3_Missense_Mutation_p.G163C|PCDH15_ENST00000395438.1_Missense_Mutation_p.G163C|AC013737.1_ENST00000583830.1_RNA|PCDH15_ENST00000395442.1_Missense_Mutation_p.G163C|PCDH15_ENST00000437009.1_Missense_Mutation_p.G163C|PCDH15_ENST00000373965.2_Missense_Mutation_p.G163C|PCDH15_ENST00000395430.1_Missense_Mutation_p.G163C|PCDH15_ENST00000395445.1_Missense_Mutation_p.G163C|PCDH15_ENST00000373955.1_Missense_Mutation_p.G163C|PCDH15_ENST00000395432.2_Missense_Mutation_p.G163C|PCDH15_ENST00000395446.1_Missense_Mutation_p.G163C|PCDH15_ENST00000395440.1_Missense_Mutation_p.G163C|PCDH15_ENST00000395433.1_Missense_Mutation_p.G141C|PCDH15_ENST00000373957.3_Missense_Mutation_p.G141C|PCDH15_ENST00000409834.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ATTGTGGTACCAACTGGAGTG	0.333										HNSCC(58;0.16)																																							0													147.0	150.0	149.0					10																	56106232		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.487G>T	10.37:g.56106232C>A	ENSP00000322604:p.Gly163Cys		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G163C	ENST00000320301.6	37	c.487	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411639	0.83340	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42;1.42;1.76;1.42;1.42;1.42;1.42;1.42;1.42;1.42	5.35	5.35	0.76521	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.72095	0.3418	H	0.98218	4.175	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.83671	0.0166	9	0.87932	D	0	.	17.8392	0.88710	0.0:1.0:0.0:0.0	.	141;163;163;168;163;163;163;163;163;163;163;168;163;141;163	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	C	163;168;163;163;163;163;163;163;163;163;141;141;163;163;168;163;163	ENSP00000363076:G163C;ENSP00000410304:G168C;ENSP00000378826:G163C;ENSP00000378832:G163C;ENSP00000378833:G163C;ENSP00000378829:G163C;ENSP00000378827:G163C;ENSP00000378820:G163C;ENSP00000354950:G163C;ENSP00000378821:G141C;ENSP00000363068:G141C;ENSP00000322604:G163C;ENSP00000378818:G163C;ENSP00000412628:G163C;ENSP00000363066:G163C	ENSP00000322604:G163C	G	-	1	0	PCDH15	55776238	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.137000	0.77295	2.514000	0.84764	0.650000	0.86243	GGT	PCDH15	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000150275		0.333	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	48	0	C	NM_033056		56106232	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	87.88	4	29	SNP	1.000	A
PCDHA2	56146	genome.wustl.edu	37	5	140176748	140176748	+	Silent	SNP	G	G	A	rs146821058	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140176748G>A	ENST00000526136.1	+	1	2199	c.2199G>A	c.(2197-2199)gcG>gcA	p.A733A	PCDHA2_ENST00000520672.2_Silent_p.A733A|PCDHA2_ENST00000378132.1_Silent_p.A733A|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	733					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCGCGCGCGCCAGGAAAGC	0.677																																																	0													47.0	50.0	49.0					5																	140176748		2203	4299	6502	SO:0001819	synonymous_variant	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.2199G>A	5.37:g.140176748G>A			O75287|Q9BTV3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A733	ENST00000526136.1	37	c.2199	CCDS54914.1	5																																																																																			PCDHA2	-	NULL	ENSG00000204969		0.677	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	-	0.00	51	0	G	NM_018905		140176748	+1	tier1	-	no_errors	ENST00000526136	ensembl	human	known	74_37	silent	40.32	37	25	SNP	0.022	A
PCDHA9	9752	genome.wustl.edu	37	5	140229769	140229769	+	Silent	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140229769G>C	ENST00000532602.1	+	1	2722	c.1689G>C	c.(1687-1689)ccG>ccC	p.P563P	PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000378122.3_Silent_p.P563P|PCDHA5_ENST00000529859.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	563	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAATGCGCCGGCGCTGCTGA	0.692																																					Melanoma(55;1800 1972 14909)												0													60.0	65.0	63.0					5																	140229769		2196	4268	6464	SO:0001819	synonymous_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1689G>C	5.37:g.140229769G>C			O15053|Q2M3S5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P563	ENST00000532602.1	37	c.1689	CCDS54920.1	5																																																																																			PCDHA9	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204961		0.692	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	-	0.00	92	0	G	NM_031857		140229769	+1	tier1	-	no_errors	ENST00000532602	ensembl	human	known	74_37	silent	53.33	42	48	SNP	0.005	C
PCDHAC2	56134	genome.wustl.edu	37	5	140347251	140347251	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140347251G>T	ENST00000289269.5	+	1	1432	c.900G>T	c.(898-900)acG>acT	p.T300T	PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	300	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGCTACACGTCGGACCGGG	0.582																																					Melanoma(190;638 2083 3390 11909 52360)												0													41.0	41.0	41.0					5																	140347251		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.900G>T	5.37:g.140347251G>T			Q2M3V1|Q9Y5F4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T300	ENST00000289269.5	37	c.900	CCDS4242.1	5																																																																																			PCDHAC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000243232		0.582	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	-	0.00	20	0	G	NM_018899		140347251	+1	tier1	-	no_errors	ENST00000289269	ensembl	human	known	74_37	silent	60.87	9	14	SNP	0.005	T
PCDHB6	56130	genome.wustl.edu	37	5	140531971	140531971	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140531971G>T	ENST00000231136.1	+	1	2133	c.2133G>T	c.(2131-2133)ctG>ctT	p.L711L	PCDHB6_ENST00000543635.1_Silent_p.L575L	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	711					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGGTGCGGCTGTGCAGGAGGA	0.667																																																	0													74.0	88.0	83.0					5																	140531971		2200	4293	6493	SO:0001819	synonymous_variant	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2133G>T	5.37:g.140531971G>T			B2R8R9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L711	ENST00000231136.1	37	c.2133	CCDS4248.1	5																																																																																			PCDHB6	-	NULL	ENSG00000113211		0.667	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	-	0.00	138	0	G	NM_018939		140531971	+1	tier1	-	no_errors	ENST00000231136	ensembl	human	known	74_37	silent	40.30	80	54	SNP	0.998	T
PCDHB7	56129	genome.wustl.edu	37	5	140554449	140554449	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140554449C>A	ENST00000231137.3	+	1	2207	c.2033C>A	c.(2032-2034)cCg>cAg	p.P678Q	PCDHB8_ENST00000239444.2_5'Flank	NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	678					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGCGGCCCCGGACCAGGCC	0.697																																																	0													51.0	83.0	72.0					5																	140554449		2193	4289	6482	SO:0001583	missense	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.2033C>A	5.37:g.140554449C>A	ENSP00000231137:p.Pro678Gln		A1L3Y8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P678Q	ENST00000231137.3	37	c.2033	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	C	8.045	0.764700	0.15914	.	.	ENSG00000113212	ENST00000231137	T	0.51325	0.71	3.77	-7.04	0.01578	.	.	.	.	.	T	0.26557	0.0649	L	0.45051	1.395	0.09310	N	1	B	0.20671	0.047	B	0.20577	0.03	T	0.34079	-0.9843	9	0.10377	T	0.69	.	2.0138	0.03493	0.4134:0.2457:0.237:0.1038	.	678	Q9Y5E2	PCDB7_HUMAN	Q	678	ENSP00000231137:P678Q	ENSP00000231137:P678Q	P	+	2	0	PCDHB7	140534633	0.000000	0.05858	0.000000	0.03702	0.215000	0.24574	-5.501000	0.00117	-1.163000	0.02793	0.449000	0.29647	CCG	PCDHB7	-	NULL	ENSG00000113212		0.697	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	-	0.00	116	0	C	NM_018940		140554449	+1	tier1	-	no_errors	ENST00000231137	ensembl	human	known	74_37	missense	38.84	74	47	SNP	0.000	A
PCDHB13	56123	genome.wustl.edu	37	5	140594187	140594187	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140594187C>A	ENST00000341948.4	+	1	679	c.492C>A	c.(490-492)ggC>ggA	p.G164G		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	164	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAGATGTAGGCCAAAACAATA	0.468																																																	0													72.0	74.0	73.0					5																	140594187		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.492C>A	5.37:g.140594187C>A			A8K9V6	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G164	ENST00000341948.4	37	c.492	CCDS4255.1	5																																																																																			PCDHB13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000187372		0.468	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB13	HGNC	protein_coding	OTTHUMT00000251810.1	-	0.00	35	0	C	NM_018933		140594187	+1	tier1	-	no_errors	ENST00000341948	ensembl	human	known	74_37	silent	48.98	25	24	SNP	0.003	A
PCDHGC5	56097	genome.wustl.edu	37	5	140869552	140869552	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:140869552G>T	ENST00000252087.1	+	1	745	c.745G>T	c.(745-747)Gtg>Ttg	p.V249L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	249	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTCTACGTGTGGGAATCCC	0.547																																																	0													174.0	177.0	176.0					5																	140869552		2203	4300	6503	SO:0001583	missense	0			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.745G>T	5.37:g.140869552G>T	ENSP00000252087:p.Val249Leu		Q9Y5C2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V249L	ENST00000252087.1	37	c.745	CCDS4263.1	5	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885917	0.33348	.	.	ENSG00000240764	ENST00000252087	T	0.01745	4.66	6.08	6.08	0.98989	Cadherin (3);Cadherin-like (1);	0.000000	0.51477	D	0.000099	T	0.04227	0.0117	M	0.62209	1.925	0.48830	D	0.999717	P;P	0.46987	0.864;0.888	B;P	0.46825	0.393;0.528	T	0.12811	-1.0533	10	0.87932	D	0	.	10.6434	0.45606	0.1427:0.0:0.8573:0.0	.	249;249	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	L	249	ENSP00000252087:V249L	ENSP00000252087:V249L	V	+	1	0	PCDHGC5	140849736	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	6.794000	0.75135	2.890000	0.99128	0.655000	0.94253	GTG	PCDHGC5	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000240764		0.547	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	HGNC	protein_coding	OTTHUMT00000251819.1	-	0.00	53	0	G	NM_018929		140869552	+1	tier1	-	no_errors	ENST00000252087	ensembl	human	known	74_37	missense	43.18	25	19	SNP	1.000	T
PCNT	5116	genome.wustl.edu	37	21	47775526	47775526	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr21:47775526G>T	ENST00000359568.5	+	12	2028	c.1921G>T	c.(1921-1923)Gaa>Taa	p.E641*	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	641	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GGAACCCTCTGAAGGGCACAG	0.652																																																	0													39.0	34.0	35.0					21																	47775526		2203	4300	6503	SO:0001587	stop_gained	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1921G>T	21.37:g.47775526G>T	ENSP00000352572:p.Glu641*		O43152|Q7Z7C9	Nonsense_Mutation	SNP	pfam_PACT_domain	p.E641*	ENST00000359568.5	37	c.1921	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	36	5.973729	0.97162	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	.	.	.	3.91	3.02	0.34903	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	7.5789	0.27952	0.1241:0.0:0.8759:0.0	.	.	.	.	X	641;628	.	ENSP00000338675:E628X	E	+	1	0	PCNT	46599954	0.016000	0.18221	0.001000	0.08648	0.003000	0.03518	1.838000	0.39211	0.748000	0.32831	0.491000	0.48974	GAA	PCNT	-	NULL	ENSG00000160299		0.652	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	29	0	G	NM_006031		47775526	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	nonsense	51.61	15	16	SNP	0.002	T
PCNT	5116	genome.wustl.edu	37	21	47775529	47775529	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr21:47775529G>A	ENST00000359568.5	+	12	2031	c.1924G>A	c.(1924-1926)Ggg>Agg	p.G642R	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	642	Glu-rich.				brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					ACCCTCTGAAGGGCACAGCCA	0.647																																																	0													38.0	33.0	35.0					21																	47775529		2203	4300	6503	SO:0001583	missense	0			AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.1924G>A	21.37:g.47775529G>A	ENSP00000352572:p.Gly642Arg		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.G642R	ENST00000359568.5	37	c.1924	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	4.075	0.011883	0.07912	.	.	ENSG00000160299	ENST00000359568;ENST00000337772	T	0.01359	4.98	4.19	2.2	0.27929	.	.	.	.	.	T	0.01320	0.0043	L	0.36672	1.1	0.09310	N	1	B;B	0.15141	0.007;0.012	B;B	0.13407	0.009;0.004	T	0.48468	-0.9033	9	0.17369	T	0.5	.	5.1606	0.15058	0.1205:0.3007:0.5788:0.0	.	524;642	O95613-2;O95613	.;PCNT_HUMAN	R	642;629	ENSP00000352572:G642R	ENSP00000338675:G629R	G	+	1	0	PCNT	46599957	0.002000	0.14202	0.001000	0.08648	0.004000	0.04260	1.166000	0.31834	0.747000	0.32809	0.491000	0.48974	GGG	PCNT	-	NULL	ENSG00000160299		0.647	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	-	0.00	26	0	G	NM_006031		47775529	+1	tier1	-	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	46.67	16	14	SNP	0.000	A
PCSK5	5125	genome.wustl.edu	37	9	78547359	78547359	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:78547359C>G	ENST00000545128.1	+	2	795	c.257C>G	c.(256-258)tCg>tGg	p.S86W	PCSK5_ENST00000376767.3_Missense_Mutation_p.S86W|PCSK5_ENST00000376752.4_Missense_Mutation_p.S86W	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	86					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)	p.S86*(3)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TCAGTTATCTCGAGCAGAGGG	0.453																																																	3	Substitution - Nonsense(3)	lung(3)											95.0	87.0	90.0					9																	78547359		2203	4300	6503	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.257C>G	9.37:g.78547359C>G	ENSP00000446280:p.Ser86Trp		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.S86W	ENST00000545128.1	37	c.257	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	c	17.99	3.523461	0.64747	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	T;T;T	0.50001	0.76;0.76;0.76	5.89	5.89	0.94794	.	.	.	.	.	T	0.71804	0.3383	M	0.81341	2.54	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.67725	0.953;0.899	T	0.73811	-0.3865	9	0.72032	D	0.01	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	86;86	Q92824-2;B1AMG5	.;.	W	86	ENSP00000446280:S86W;ENSP00000365958:S86W;ENSP00000365943:S86W	ENSP00000365943:S86W	S	+	2	0	PCSK5	77737179	1.000000	0.71417	0.967000	0.41034	0.604000	0.37047	5.740000	0.68629	2.793000	0.96121	0.561000	0.74099	TCG	PCSK5	-	superfamily_Prot_inh_propept	ENSG00000099139		0.453	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	50	0	C			78547359	+1	tier1	-	no_errors	ENST00000545128	ensembl	human	known	74_37	missense	87.18	5	34	SNP	0.999	G
PEX5L	51555	genome.wustl.edu	37	3	179519471	179519471	+	3'UTR	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:179519471C>T	ENST00000467460.1	-	0	2356				PEX5L_ENST00000476138.1_3'UTR|PEX5L_ENST00000392649.3_3'UTR|PEX5L_ENST00000472994.1_3'UTR|RP11-494H4.3_ENST00000602704.1_lincRNA|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000468741.1_3'UTR|PEX5L_ENST00000263962.8_3'UTR|PEX5L_ENST00000485199.1_3'UTR	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TGGGCATTGTCCACAGGAATT	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.*145G>A	3.37:g.179519471C>T			B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	RNA	SNP	-	NULL	ENST00000467460.1	37	NULL	CCDS3236.1	3																																																																																			PEX5L	-	-	ENSG00000114757		0.333	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	-	0.00	48	0	C	NM_016559		179519471	-1	tier1	-	no_errors	ENST00000467440	ensembl	human	known	74_37	rna	24.09	104	33	SNP	0.099	T
PHF2	5253	genome.wustl.edu	37	9	96438978	96438979	+	Frame_Shift_Ins	INS	-	-	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:96438978_96438979insG	ENST00000359246.4	+	21	3302_3303	c.2935_2936insG	c.(2935-2937)accfs	p.T979fs	PHF2_ENST00000375376.4_Frame_Shift_Ins_p.T210fs	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	979	Ser/Thr-rich.			ST -> PA (in Ref. 1; AAD21791). {ECO:0000305}.	liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		caccacctccacctccaccacg	0.649																																																	0																																										SO:0001589	frameshift_variant	0			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	Exception_encountered	9.37:g.96438978_96438979insG	ENSP00000352185:p.Thr979fs		Q4VXG0|Q8N3K2|Q9Y6N4	Frame_Shift_Ins	INS	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.T979fs	ENST00000359246.4	37	c.2935_2936	CCDS35069.1	9																																																																																			PHF2	-	NULL	ENSG00000197724		0.649	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF2	HGNC	protein_coding	OTTHUMT00000053162.1		0.00	45	0	-	NM_005392		96438979	+1	tier1		no_errors	ENST00000359246	ensembl	human	known	74_37	frame_shift_ins	14.29	18	3	INS	0.993:1.000	G
PHF21B	112885	genome.wustl.edu	37	22	45309806	45309806	+	Missense_Mutation	SNP	C	C	G	rs368576969		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:45309806C>G	ENST00000313237.5	-	5	877	c.727G>C	c.(727-729)Gag>Cag	p.E243Q	PHF21B_ENST00000396103.3_Missense_Mutation_p.E201Q|PHF21B_ENST00000404079.2_Missense_Mutation_p.E189Q|PHF21B_ENST00000447824.3_Missense_Mutation_p.E189Q|PHF21B_ENST00000403565.1_Missense_Mutation_p.E39Q	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	243							zinc ion binding (GO:0008270)	p.E243*(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GCCGTGCTCTCGGGCTGCGTC	0.627																																																	1	Substitution - Nonsense(1)	lung(1)											82.0	82.0	82.0					22																	45309806		2203	4300	6503	SO:0001583	missense	0			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.727G>C	22.37:g.45309806C>G	ENSP00000324403:p.Glu243Gln		B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E243Q	ENST00000313237.5	37	c.727	CCDS14061.1	22	.	.	.	.	.	.	.	.	.	.	C	20.5	3.994424	0.74703	.	.	ENSG00000056487	ENST00000403565;ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000414269;ENST00000420689	T;T;T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52;0.52;0.52	4.7	3.65	0.41850	.	0.097338	0.42821	D	0.000651	T	0.43144	0.1234	L	0.50333	1.59	0.33299	D	0.564561	B;B;B;P;B	0.37824	0.23;0.398;0.277;0.609;0.145	B;B;B;B;B	0.33799	0.09;0.17;0.082;0.157;0.055	T	0.56860	-0.7909	10	0.25751	T	0.34	-18.0576	13.3834	0.60783	0.0:0.9223:0.0:0.0777	.	189;201;189;243;39	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2;B1AHC5	.;.;.;PF21B_HUMAN;.	Q	39;243;201;189;189;39;189	ENSP00000385053:E39Q;ENSP00000324403:E243Q;ENSP00000379410:E201Q;ENSP00000385105:E189Q;ENSP00000388619:E189Q;ENSP00000401091:E39Q;ENSP00000401294:E189Q	ENSP00000324403:E243Q	E	-	1	0	PHF21B	43688470	0.995000	0.38212	0.991000	0.47740	0.958000	0.62258	2.269000	0.43346	2.437000	0.82529	0.655000	0.94253	GAG	PHF21B	-	NULL	ENSG00000056487		0.627	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	HGNC	protein_coding	OTTHUMT00000321731.2	-	0.00	68	0	C	NM_138415		45309806	-1	tier1	-	no_errors	ENST00000313237	ensembl	human	known	74_37	missense	37.63	58	35	SNP	0.992	G
PIK3R6	146850	genome.wustl.edu	37	17	8736255	8736255	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:8736255C>T	ENST00000311434.9	-	9	992	c.753G>A	c.(751-753)ctG>ctA	p.L251L	PIK3R6_ENST00000434064.2_5'UTR	NM_001010855.2	NP_001010855.1	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6	251					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of MAP kinase activity (GO:0043406)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)										AAATCTCCTCCAGCCTCTCTA	0.697																																																	0													29.0	36.0	34.0					17																	8736255		1965	4135	6100	SO:0001819	synonymous_variant	0			AK091819	CCDS73985.1	17p13.1	2013-01-31	2008-02-04	2008-02-04	ENSG00000174083	ENSG00000276231			27101	protein-coding gene	gene with protein product		611462	"""chromosome 17 open reading frame 38"""	C17orf38		16476736	Standard	NM_001010855		Approved	FLJ34500, HsT41028, p87PIKAP	uc002glq.1	Q5UE93	OTTHUMG00000132861	ENST00000311434.9:c.753G>A	17.37:g.8736255C>T			Q658R3	Silent	SNP	pfam_PI3K_1B_gamma_p101_su	p.L251	ENST00000311434.9	37	c.753		17																																																																																			PIK3R6	-	pfam_PI3K_1B_gamma_p101_su	ENSG00000174083		0.697	PIK3R6-201	KNOWN	basic|appris_principal	protein_coding	PIK3R6	HGNC	protein_coding		-	0.00	62	0	C	NM_001010855		8736255	-1	tier1	-	no_errors	ENST00000311434	ensembl	human	known	74_37	silent	46.15	21	18	SNP	1.000	T
CAPZA3	93661	genome.wustl.edu	37	12	18889200	18889200	+	5'Flank	SNP	T	T	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:18889200T>A	ENST00000317658.3	+	0	0				PLCZ1_ENST00000447925.2_Missense_Mutation_p.K28N|PLCZ1_ENST00000435379.1_Missense_Mutation_p.K28N|RP11-361I14.2_ENST00000536931.1_RNA|PLCZ1_ENST00000539875.1_Missense_Mutation_p.K30N|PLCZ1_ENST00000266505.7_Missense_Mutation_p.K30N	NM_033328.2	NP_201585.1	Q96KX2	CAZA3_HUMAN	capping protein (actin filament) muscle Z-line, alpha 3						actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cortical cytoskeleton (GO:0030863)|F-actin capping protein complex (GO:0008290)|membrane (GO:0016020)|nucleus (GO:0005634)|WASH complex (GO:0071203)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)	19	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				GAATATCTAATTTTTCAAGTA	0.358																																																	0													89.0	91.0	90.0					12																	18889200		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AB053259	CCDS8681.1	12p12.3	2008-02-05			ENSG00000177938	ENSG00000177938			24205	protein-coding gene	gene with protein product		608722				12029070	Standard	NM_033328		Approved	Gsg3, CAPPA3	uc001rdy.3	Q96KX2	OTTHUMG00000169001		12.37:g.18889200T>A	Exception_encountered		Q969J0	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.K30N	ENST00000317658.3	37	c.90	CCDS8681.1	12	.	.	.	.	.	.	.	.	.	.	T	14.33	2.502942	0.44558	.	.	ENSG00000139151	ENST00000266505;ENST00000447925;ENST00000435379;ENST00000539875;ENST00000539072	T;T;T;T;T	0.50548	0.74;0.74;1.62;1.61;0.74	5.5	2.82	0.32997	EF-hand-like domain (1);	0.000000	0.64402	D	0.000005	T	0.37210	0.0995	L	0.61218	1.895	0.80722	D	1	P	0.38535	0.635	B	0.30495	0.116	T	0.17623	-1.0363	10	0.33940	T	0.23	.	8.4798	0.33036	0.0:0.1854:0.0:0.8146	.	30	Q86YW0	PLCZ1_HUMAN	N	30;28;28;30;50	ENSP00000266505:K30N;ENSP00000402358:K28N;ENSP00000400504:K28N;ENSP00000445026:K30N;ENSP00000438629:K50N	ENSP00000266505:K30N	K	-	3	2	PLCZ1	18780467	0.998000	0.40836	0.994000	0.49952	0.934000	0.57294	0.767000	0.26575	0.933000	0.37291	0.260000	0.18958	AAA	PLCZ1	-	NULL	ENSG00000139151		0.358	CAPZA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401902.1	-	0.00	64	0	T	NM_033328		18889200	-1	tier1	-	no_errors	ENST00000266505	ensembl	human	known	74_37	missense	48.65	38	36	SNP	0.994	A
PLEKHG5	57449	genome.wustl.edu	37	1	6534123	6534123	+	Missense_Mutation	SNP	C	C	A	rs527341275	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:6534123C>A	ENST00000400915.3	-	8	775	c.709G>T	c.(709-711)Gcc>Tcc	p.A237S	PLEKHG5_ENST00000377725.1_Missense_Mutation_p.A181S|PLEKHG5_ENST00000544978.1_Missense_Mutation_p.A181S|PLEKHG5_ENST00000340850.5_Missense_Mutation_p.A181S|PLEKHG5_ENST00000400913.1_Missense_Mutation_p.A181S|PLEKHG5_ENST00000377728.3_Missense_Mutation_p.A181S|PLEKHG5_ENST00000535355.1_Missense_Mutation_p.A250S|PLEKHG5_ENST00000377740.3_Missense_Mutation_p.A258S|PLEKHG5_ENST00000377732.1_Missense_Mutation_p.A218S|PLEKHG5_ENST00000537245.1_Missense_Mutation_p.A260S|PLEKHG5_ENST00000377748.1_Missense_Mutation_p.A258S|PLEKHG5_ENST00000377737.2_Missense_Mutation_p.A181S	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	237					apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		CGCTCCAGGGCGGGGGGCCCG	0.687																																																	0													15.0	17.0	16.0					1																	6534123		2198	4298	6496	SO:0001583	missense	0			AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.709G>T	1.37:g.6534123C>A	ENSP00000383706:p.Ala237Ser		B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.A260S	ENST00000400915.3	37	c.778	CCDS41241.1	1	.	.	.	.	.	.	.	.	.	.	c	4.707	0.131479	0.08981	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377740;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	T;T;T;T;T;T;T;T;T;T;T;T	0.66638	-0.21;-0.22;-0.22;-0.2;-0.18;-0.19;-0.22;-0.22;-0.2;-0.22;-0.22;-0.22	3.87	-0.639	0.11497	.	0.633028	0.13953	N	0.351363	T	0.47985	0.1475	L	0.38531	1.155	0.09310	N	1	B;B;B;B;B	0.16396	0.017;0.001;0.005;0.009;0.002	B;B;B;B;B	0.17098	0.011;0.01;0.008;0.017;0.008	T	0.25328	-1.0135	10	0.23302	T	0.38	-2.2229	4.4071	0.11414	0.1615:0.5474:0.0:0.2911	.	250;181;258;258;237	F5GZ21;O94827-4;Q5SY18;O94827-2;O94827	.;.;.;.;PKHG5_HUMAN	S	258;181;181;237;258;218;181;181;250;181;87;260;181	ENSP00000366977:A258S;ENSP00000344570:A181S;ENSP00000383704:A181S;ENSP00000383706:A237S;ENSP00000366969:A258S;ENSP00000366961:A218S;ENSP00000366957:A181S;ENSP00000366954:A181S;ENSP00000441445:A250S;ENSP00000366966:A181S;ENSP00000439625:A260S;ENSP00000437710:A181S	ENSP00000344570:A181S	A	-	1	0	PLEKHG5	6456710	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.400000	0.02504	-0.326000	0.08564	0.500000	0.49745	GCC	PLEKHG5	-	NULL	ENSG00000171680		0.687	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	HGNC	protein_coding	OTTHUMT00000002631.1	-	0.00	34	0	C	NM_020631		6534123	-1	tier1	-	no_errors	ENST00000537245	ensembl	human	known	74_37	missense	42.31	15	11	SNP	0.097	A
PLXND1	23129	genome.wustl.edu	37	3	129288754	129288754	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:129288754C>G	ENST00000324093.4	-	20	3975	c.3797G>C	c.(3796-3798)gGg>gCg	p.G1266A	PLXND1_ENST00000393239.1_Missense_Mutation_p.G1266A	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1266					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CTCGCTGCCCCCCAGCTGCAG	0.587																																					Ovarian(97;366 1484 3738 22084 39045)												0													91.0	77.0	82.0					3																	129288754		2203	4300	6503	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3797G>C	3.37:g.129288754C>G	ENSP00000317128:p.Gly1266Ala		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G1266A	ENST00000324093.4	37	c.3797	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600630	0.28534	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.33865	1.45;1.39	3.94	3.94	0.45596	.	0.726583	0.12525	N	0.461327	T	0.21674	0.0522	L	0.31294	0.92	0.52501	D	0.999959	P	0.38535	0.635	B	0.27608	0.081	T	0.04976	-1.0914	10	0.15499	T	0.54	.	12.1235	0.53905	0.0:0.827:0.173:0.0	.	1266	Q9Y4D7	PLXD1_HUMAN	A	1266	ENSP00000317128:G1266A;ENSP00000376931:G1266A	ENSP00000317128:G1266A	G	-	2	0	PLXND1	130771444	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.301000	0.65727	2.052000	0.61016	0.467000	0.42956	GGG	PLXND1	-	NULL	ENSG00000004399		0.587	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	-	0.00	17	0	C	NM_015103		129288754	-1	tier1	-	no_errors	ENST00000324093	ensembl	human	known	74_37	missense	77.78	2	7	SNP	0.993	G
PLS1	5357	genome.wustl.edu	37	3	142395088	142395088	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:142395088G>A	ENST00000337777.3	+	5	667	c.454G>A	c.(454-456)Gat>Aat	p.D152N	PLS1_ENST00000457734.2_Missense_Mutation_p.D152N|PLS1_ENST00000497002.1_Missense_Mutation_p.D152N|RN7SKP25_ENST00000362449.1_RNA	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	152	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GAATCCCAATGATGATAGTCT	0.413																																																	0													199.0	180.0	187.0					3																	142395088		2203	4300	6503	SO:0001583	missense	0			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.454G>A	3.37:g.142395088G>A	ENSP00000336831:p.Asp152Asn		A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF_hand_dom,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.D152N	ENST00000337777.3	37	c.454	CCDS3125.1	3	.	.	.	.	.	.	.	.	.	.	G	8.626	0.892591	0.17613	.	.	ENSG00000120756	ENST00000457734;ENST00000476044;ENST00000337777;ENST00000497002	D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72	5.94	5.06	0.68205	Calponin homology domain (5);	0.138957	0.64402	D	0.000005	D	0.90974	0.7162	L	0.31845	0.965	0.35598	D	0.807672	B	0.06786	0.001	B	0.10450	0.005	D	0.86366	0.1720	10	0.02654	T	1	-18.2095	17.1615	0.86804	0.0:0.1264:0.8736:0.0	.	152	Q14651	PLSI_HUMAN	N	152;73;152;152	ENSP00000387890:D152N;ENSP00000417481:D73N;ENSP00000336831:D152N;ENSP00000418700:D152N	ENSP00000336831:D152N	D	+	1	0	PLS1	143877778	1.000000	0.71417	0.038000	0.18304	0.430000	0.31655	6.099000	0.71466	1.501000	0.48654	-0.310000	0.09108	GAT	PLS1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000120756		0.413	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	HGNC	protein_coding	OTTHUMT00000354435.1	-	0.00	38	0	G	NM_002670		142395088	+1	tier1	-	no_errors	ENST00000337777	ensembl	human	known	74_37	missense	18.06	59	13	SNP	0.463	A
POLE	5426	genome.wustl.edu	37	12	133201572	133201572	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:133201572C>A	ENST00000320574.5	-	48	6709	c.6666G>T	c.(6664-6666)ctG>ctT	p.L2222L	POLE_ENST00000535270.1_Silent_p.L2195L	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	2222					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)	p.L2222L(2)		NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CGCGGCACTTCAGGCAGACCT	0.657								DNA polymerases (catalytic subunits)																																									2	Substitution - coding silent(2)	lung(2)											49.0	50.0	50.0					12																	133201572		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.6666G>T	12.37:g.133201572C>A			Q13533|Q86VH9	Silent	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.L2222	ENST00000320574.5	37	c.6666	CCDS9278.1	12																																																																																			POLE	-	NULL	ENSG00000177084		0.657	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	30	0	C	NM_006231		133201572	-1	tier1	-	no_errors	ENST00000320574	ensembl	human	known	74_37	silent	51.72	14	15	SNP	0.236	A
POLR1C	9533	genome.wustl.edu	37	6	43484854	43484854	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:43484854G>T	ENST00000372389.3	+	1	95	c.7G>T	c.(7-9)Gct>Tct	p.A3S	RP3-337H4.9_ENST00000607571.1_RNA|POLR1C_ENST00000372344.2_Missense_Mutation_p.A3S|YIPF3_ENST00000506469.1_5'Flank|YIPF3_ENST00000372422.2_5'Flank|POLR1C_ENST00000304004.3_Missense_Mutation_p.A3S	NM_203290.2	NP_976035.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide C, 30kDa	3					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5	all_cancers(18;3.79e-05)|Lung NSC(15;0.00217)|all_lung(25;0.00536)		Colorectal(64;0.00245)|all cancers(41;0.00511)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0711)			GAAGATGGCGGCTTCTCAGGC	0.607																																																	0													107.0	114.0	112.0					6																	43484854		2203	4300	6503	SO:0001583	missense	0			AF008442	CCDS4901.1	6p21.1	2013-01-21			ENSG00000171453	ENSG00000171453		"""RNA polymerase subunits"""	20194	protein-coding gene	gene with protein product		610060				11042152, 12446911	Standard	NM_203290		Approved	RPA40, RPA39, RPA5, RPAC1	uc003ovn.3	O15160	OTTHUMG00000014739	ENST00000372389.3:c.7G>T	6.37:g.43484854G>T	ENSP00000361465:p.Ala3Ser		O75395|Q5JTE3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_insert,pfam_RBP11-like_dimer,superfamily_RBP11-like_dimer,superfamily_DNA-dir_RNA_pol_insert,smart_DNA-dir_RNA_pol_RpoA/D/Rpb3	p.A3S	ENST00000372389.3	37	c.7	CCDS4901.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.24|15.24	2.774002|2.774002	0.49786|0.49786	.|.	.|.	ENSG00000171453|ENSG00000171453	ENST00000372389;ENST00000372344;ENST00000304004|ENST00000423780	D;D;T|.	0.82803|.	-1.64;-1.65;-0.67|.	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	0.278897|.	0.33875|.	N|.	0.004462|.	T|T	0.57301|0.57301	0.2044|0.2044	L|L	0.40543|0.40543	1.245|1.245	0.50171|0.50171	D|D	0.999851|0.999851	B;B|.	0.13594|.	0.008;0.005|.	B;B|.	0.17722|.	0.019;0.005|.	T|T	0.54098|0.54098	-0.8344|-0.8344	10|5	0.37606|.	T|.	0.19|.	-18.0815|-18.0815	18.7674|18.7674	0.91879|0.91879	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	3;3|.	O15160-2;O15160|.	.;RPAC1_HUMAN|.	S|V	3|2	ENSP00000361465:A3S;ENSP00000361419:A3S;ENSP00000307212:A3S|.	ENSP00000307212:A3S|.	A|G	+|+	1|2	0|0	POLR1C|POLR1C	43592832|43592832	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.127000|0.127000	0.20565|0.20565	4.984000|4.984000	0.63838|0.63838	2.527000|2.527000	0.85204|0.85204	0.558000|0.558000	0.71614|0.71614	GCT|GGC	POLR1C	-	NULL	ENSG00000171453		0.607	POLR1C-008	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1C	HGNC	protein_coding	OTTHUMT00000040652.3	-	0.00	31	0	G	NM_004875		43484854	+1	tier1	-	no_errors	ENST00000372389	ensembl	human	known	74_37	missense	58.00	21	29	SNP	1.000	T
PPP1CA	5499	genome.wustl.edu	37	11	67168163	67168163	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:67168163C>A	ENST00000376745.4	-	3	563	c.415G>T	c.(415-417)Gag>Tag	p.E139*	PPP1CA_ENST00000532446.1_5'UTR|PPP1CA_ENST00000358239.4_Nonsense_Mutation_p.E95*|PPP1CA_ENST00000312989.7_Nonsense_Mutation_p.E150*	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	139					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			CACTCACACTCATCGTAGAAA	0.547																																																	0													78.0	72.0	74.0					11																	67168163		2200	4295	6495	SO:0001587	stop_gained	0				CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.415G>T	11.37:g.67168163C>A	ENSP00000365936:p.Glu139*		A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Nonsense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.E150*	ENST00000376745.4	37	c.448	CCDS8160.1	11	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629819	0.87660	.	.	ENSG00000172531	ENST00000312989;ENST00000451458;ENST00000376745;ENST00000358239;ENST00000527663	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.9305	0.86189	0.0:1.0:0.0:0.0	.	.	.	.	X	150;236;139;95;139	.	ENSP00000326031:E150X	E	-	1	0	PPP1CA	66924739	1.000000	0.71417	1.000000	0.80357	0.706000	0.40770	7.795000	0.85887	2.270000	0.75569	0.563000	0.77884	GAG	PPP1CA	-	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000172531		0.547	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1CA	HGNC	protein_coding	OTTHUMT00000395487.1	-	0.00	31	0	C	NM_002708		67168163	-1	tier1	-	no_errors	ENST00000312989	ensembl	human	known	74_37	nonsense	16.00	105	20	SNP	1.000	A
PRIM2	5558	genome.wustl.edu	37	6	57372336	57372336	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:57372336C>A	ENST00000607273.1	+	8	829	c.742C>A	c.(742-744)Cct>Act	p.P248T	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	248					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AAGACTTCAGCCTCTGCTCAA	0.418																																																	0													136.0	122.0	126.0					6																	57372336		1925	4150	6075	SO:0001583	missense	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.742C>A	6.37:g.57372336C>A	ENSP00000475738:p.Pro248Thr		Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Missense_Mutation	SNP	pfam_DNA_primase_lsu_euk/arc	p.P248T	ENST00000607273.1	37	c.742		6																																																																																			PRIM2	-	pfam_DNA_primase_lsu_euk/arc	ENSG00000146143		0.418	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	PRIM2	HGNC	protein_coding		-	0.00	67	0	C	NM_000947		57372336	+1	tier1	-	no_errors	ENST00000607273	ensembl	human	known	74_37	missense	15.29	72	13	SNP	1.000	A
PRKCB	5579	genome.wustl.edu	37	16	24135161	24135161	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:24135161C>A	ENST00000321728.7	+	9	1099	c.924C>A	c.(922-924)gcC>gcA	p.A308A	PRKCB_ENST00000303531.7_Silent_p.A308A	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	308					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TGCAGAGGGCCAAGATCAGTC	0.493																																																	0													89.0	82.0	85.0					16																	24135161		2197	4300	6497	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.924C>A	16.37:g.24135161C>A			C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.A308	ENST00000321728.7	37	c.924	CCDS10618.1	16																																																																																			PRKCB	-	pirsf_Protein_kinase_C_a/b/g	ENSG00000166501		0.493	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	-	0.00	89	0	C	NM_212535		24135161	+1	tier1	-	no_errors	ENST00000303531	ensembl	human	known	74_37	silent	38.27	50	31	SNP	1.000	A
PROSER1	80209	genome.wustl.edu	37	13	39586248	39586248	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:39586248G>A	ENST00000352251.3	-	12	3517	c.2684C>T	c.(2683-2685)gCg>gTg	p.A895V	PROSER1_ENST00000350125.3_Missense_Mutation_p.A873V|PROSER1_ENST00000484434.3_5'UTR	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	895																	CTGCGCAGCCGCATTATGCTG	0.453																																																	0													142.0	147.0	145.0					13																	39586248		2203	4300	6503	SO:0001583	missense	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.2684C>T	13.37:g.39586248G>A	ENSP00000332034:p.Ala895Val		A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NULL	p.A895V	ENST00000352251.3	37	c.2684	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	G	19.68	3.873707	0.72180	.	.	ENSG00000120685	ENST00000352251;ENST00000350125	T;T	0.39787	1.07;1.06	5.88	5.88	0.94601	.	.	.	.	.	T	0.50803	0.1637	N	0.19112	0.55	0.52099	D	0.999941	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.986	T	0.42732	-0.9434	8	.	.	.	-29.0992	18.8203	0.92094	0.0:0.0:1.0:0.0	.	873;895	A6NJ97;Q86XN7	.;PRSR1_HUMAN	V	895;873	ENSP00000332034:A895V;ENSP00000339123:A873V	.	A	-	2	0	PROSER1	38484248	1.000000	0.71417	0.956000	0.39512	0.030000	0.12068	7.759000	0.85235	2.782000	0.95742	0.655000	0.94253	GCG	PROSER1	-	NULL	ENSG00000120685		0.453	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	-	0.00	28	0	G	NM_025138		39586248	-1	tier1	-	no_errors	ENST00000352251	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	A
PRR15	222171	genome.wustl.edu	37	7	29606258	29606258	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:29606258G>T	ENST00000319694.2	+	2	1025	c.313G>T	c.(313-315)Gcc>Tcc	p.A105S	AC007255.8_ENST00000450540.2_RNA|AC007255.8_ENST00000447171.1_RNA	NM_175887.2	NP_787083.1	Q8IV56	PRR15_HUMAN	proline rich 15	105					multicellular organismal development (GO:0007275)					endometrium(1)|lung(1)|skin(1)	3						GAAAGTGCGCGCCACGCTGCT	0.637																																																	0													8.0	9.0	9.0					7																	29606258		2187	4287	6474	SO:0001583	missense	0			BC029131	CCDS5421.1	7p15.1	2006-08-21			ENSG00000176532	ENSG00000176532			22310	protein-coding gene	gene with protein product						12477932	Standard	NM_175887		Approved		uc003tac.1	Q8IV56	OTTHUMG00000128555	ENST00000319694.2:c.313G>T	7.37:g.29606258G>T	ENSP00000317836:p.Ala105Ser			Missense_Mutation	SNP	NULL	p.A105S	ENST00000319694.2	37	c.313	CCDS5421.1	7	.	.	.	.	.	.	.	.	.	.	G	18.53	3.644598	0.67358	.	.	ENSG00000176532	ENST00000319694	T	0.56444	0.46	4.99	4.99	0.66335	.	0.167110	0.40554	N	0.001073	T	0.63426	0.2510	L	0.41632	1.29	0.44603	D	0.997579	D	0.76494	0.999	D	0.68765	0.96	T	0.64219	-0.6459	10	0.49607	T	0.09	-18.3826	15.7838	0.78286	0.0:0.0:1.0:0.0	.	105	Q8IV56	PRR15_HUMAN	S	105	ENSP00000317836:A105S	ENSP00000317836:A105S	A	+	1	0	PRR15	29572783	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	3.835000	0.55805	2.324000	0.78689	0.313000	0.20887	GCC	PRR15	-	NULL	ENSG00000176532		0.637	PRR15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR15	HGNC	protein_coding	OTTHUMT00000250402.2	-	0.00	27	0	G	NM_175887		29606258	+1	tier1	-	no_errors	ENST00000319694	ensembl	human	known	74_37	missense	76.92	3	10	SNP	1.000	T
PRR23A	729627	genome.wustl.edu	37	3	138724356	138724356	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:138724356G>T	ENST00000383163.2	-	1	754	c.755C>A	c.(754-756)cCg>cAg	p.P252Q	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	252	Pro-rich.									endometrium(3)|kidney(1)|lung(7)	11						AGGGCGTTTCGGGAGCGGCGG	0.647																																																	0													14.0	15.0	15.0					3																	138724356		692	1591	2283	SO:0001583	missense	0				CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.755C>A	3.37:g.138724356G>T	ENSP00000372649:p.Pro252Gln			Missense_Mutation	SNP	pfam_UPF0572	p.P252Q	ENST00000383163.2	37	c.755	CCDS46923.1	3	.	.	.	.	.	.	.	.	.	.	G	10.83	1.460950	0.26248	.	.	ENSG00000206260	ENST00000383163	.	.	.	3.23	1.42	0.22433	.	0.858023	0.09951	N	0.734649	T	0.56804	0.2010	M	0.68952	2.095	0.09310	N	1	D	0.71674	0.998	D	0.71414	0.973	T	0.39603	-0.9606	9	0.87932	D	0	.	5.3783	0.16178	0.2662:0.0:0.7338:0.0	.	252	A6NEV1	PR23A_HUMAN	Q	252	.	ENSP00000372649:P252Q	P	-	2	0	PRR23A	140207046	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.865000	0.27940	0.398000	0.25338	0.591000	0.81541	CCG	PRR23A	-	pfam_UPF0572	ENSG00000206260		0.647	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23A	HGNC	protein_coding	OTTHUMT00000361503.1	-	0.00	41	0	G	NM_001134659		138724356	-1	tier1	-	no_errors	ENST00000383163	ensembl	human	known	74_37	missense	70.93	25	61	SNP	0.000	T
PPT2	9374	genome.wustl.edu	37	6	32119803	32119803	+	5'Flank	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:32119803G>A	ENST00000324816.6	+	0	0				PPT2-EGFL8_ENST00000422437.1_5'Flank|PPT2_ENST00000445576.2_5'Flank|PPT2_ENST00000375143.2_5'Flank|PPT2_ENST00000361568.2_5'Flank|PPT2_ENST00000375137.2_5'Flank|PRRT1_ENST00000375152.2_Intron|PRRT1_ENST00000467780.1_5'Flank|PRRT1_ENST00000375150.2_Intron|PPT2_ENST00000395523.1_5'Flank|PPT2_ENST00000437001.2_5'Flank|PRRT1_ENST00000211413.5_5'Flank			Q9UMR5	PPT2_HUMAN	palmitoyl-protein thioesterase 2						cellular protein modification process (GO:0006464)|macromolecule depalmitoylation (GO:0098734)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	palmitoyl hydrolase activity (GO:0098599)|palmitoyl-(protein) hydrolase activity (GO:0008474)|thiolester hydrolase activity (GO:0016790)			NS(1)|endometrium(2)|large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	17						AGGCGAGGGAGGGGGAGCGCT	0.672																																																	0																																										SO:0001631	upstream_gene_variant	0			AF020543	CCDS4740.1, CCDS4742.1	6p21.3	2012-07-02			ENSG00000221988	ENSG00000221988	3.1.2.22		9326	protein-coding gene	gene with protein product		603298				9341199, 10051407	Standard	NM_138717		Approved		uc003nzw.3	Q9UMR5	OTTHUMG00000031257		6.37:g.32119803G>A	Exception_encountered		A2ABC9|A2ABD1|A2ARM7|A2BFH7|A2BFH9|A2BFI2|A8K9L4|B0S868|G8JLE1|O14799|Q0P6K0|Q5JP13|Q5JP14|Q5JQF0|Q5SSX4|Q5SSX5|Q5SSX6|Q5STJ4|Q5STJ5|Q5STJ6|Q6FI80|Q99945	RNA	SNP	-	NULL	ENST00000324816.6	37	NULL	CCDS4742.1	6																																																																																			PRRT1	-	-	ENSG00000204314		0.672	PPT2-207	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076552.4	-	0.00	24	0	G	NM_138717		32119803	-1	tier1	-	no_errors	ENST00000486917	ensembl	human	known	74_37	rna	68.18	7	15	SNP	0.578	A
PRRT3	285368	genome.wustl.edu	37	3	9991025	9991025	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:9991025C>T	ENST00000412055.1	-	2	904	c.775G>A	c.(775-777)Gag>Aag	p.E259K	PRRT3_ENST00000411976.2_Missense_Mutation_p.E259K|PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	259	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						TACACCACCTCAACTGGGGGT	0.617																																																	0													42.0	49.0	47.0					3																	9991025		2108	4258	6366	SO:0001583	missense	0			AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.775G>A	3.37:g.9991025C>T	ENSP00000392511:p.Glu259Lys		Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	NULL	p.E259K	ENST00000412055.1	37	c.775	CCDS43049.1	3	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709991	0.30322	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.20738	2.33;2.05	3.62	2.72	0.32119	.	0.336327	0.21689	N	0.070618	T	0.12178	0.0296	N	0.24115	0.695	0.24412	N	0.994652	B;B	0.30709	0.291;0.015	B;B	0.31191	0.125;0.018	T	0.21143	-1.0254	9	.	.	.	-15.1133	7.5074	0.27553	0.0:0.8792:0.0:0.1208	.	259;259	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	K	259	ENSP00000392511:E259K;ENSP00000404512:E259K	.	E	-	1	0	PRRT3	9966025	0.139000	0.22563	0.026000	0.17262	0.031000	0.12232	0.533000	0.23082	1.070000	0.40811	0.650000	0.86243	GAG	PRRT3	-	NULL	ENSG00000163704		0.617	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT3	HGNC	protein_coding	OTTHUMT00000339322.1	-	0.00	25	0	C	NM_207351		9991025	-1	tier1	-	no_errors	ENST00000295984	ensembl	human	known	74_37	missense	82.35	3	14	SNP	0.729	T
PRSS35	167681	genome.wustl.edu	37	6	84233745	84233745	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:84233745T>A	ENST00000369700.3	+	2	762	c.585T>A	c.(583-585)agT>agA	p.S195R	PRSS35_ENST00000536636.1_Missense_Mutation_p.S195R	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	195	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GGAATAAAAGTGGAGGCAAGA	0.488																																																	0													83.0	89.0	87.0					6																	84233745		2203	4300	6503	SO:0001583	missense	0			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.585T>A	6.37:g.84233745T>A	ENSP00000358714:p.Ser195Arg		A8K7B3|Q9BQP6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.S195R	ENST00000369700.3	37	c.585	CCDS4999.1	6	.	.	.	.	.	.	.	.	.	.	T	4.157	0.027667	0.08054	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	D;D	0.88509	-2.39;-2.39	5.65	-11.3	0.00108	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (2);	0.247108	0.40728	N	0.001036	T	0.44519	0.1297	N	0.11154	0.105	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.51810	-0.8658	10	0.28530	T	0.3	-13.3568	2.3399	0.04257	0.1618:0.3538:0.1579:0.3266	.	195	Q8N3Z0	PRS35_HUMAN	R	195	ENSP00000440870:S195R;ENSP00000358714:S195R	ENSP00000358714:S195R	S	+	3	2	PRSS35	84290464	0.000000	0.05858	0.001000	0.08648	0.131000	0.20780	-1.707000	0.01893	-1.540000	0.01730	-0.464000	0.05259	AGT	PRSS35	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	ENSG00000146250		0.488	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	HGNC	protein_coding	OTTHUMT00000041352.1	-	0.00	39	0	T	NM_153362		84233745	+1	tier1	-	no_errors	ENST00000369700	ensembl	human	known	74_37	missense	44.74	21	17	SNP	0.001	A
PSPH	5723	genome.wustl.edu	37	7	56087300	56087300	+	Missense_Mutation	SNP	C	C	T	rs75395437		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:56087300C>T	ENST00000395471.3	-	5	1073	c.268G>A	c.(268-270)Ggc>Agc	p.G90S	PSPH_ENST00000459834.1_Intron|PSPH_ENST00000275605.3_Missense_Mutation_p.G90S			P78330	SERB_HUMAN	phosphoserine phosphatase	90					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TACCTTATGCCGGGGGTCAGG	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13158	0.0		0.0	False		,,,				2504	0.0																0													47.0	42.0	43.0					7																	56087300		2203	4300	6503	SO:0001583	missense	0			Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.268G>A	7.37:g.56087300C>T	ENSP00000378854:p.Gly90Ser		B2RCR5|Q7Z3S5	Missense_Mutation	SNP	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	p.G90S	ENST00000395471.3	37	c.268	CCDS5522.1	7	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574214	0.65878	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.88818	-2.43;-2.43;-2.43	5.03	4.15	0.48705	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93259	0.7852	M	0.79805	2.47	0.80722	D	1	D;P	0.76494	0.999;0.921	P;P	0.61940	0.896;0.668	D	0.93579	0.6911	10	0.72032	D	0.01	-14.6976	12.7176	0.57123	0.0:0.9198:0.0:0.0802	.	90;90	Q53EY1;P78330	.;SERB_HUMAN	S	90	ENSP00000275605:G90S;ENSP00000378854:G90S;ENSP00000398653:G90S	ENSP00000275605:G90S	G	-	1	0	PSPH	56054794	1.000000	0.71417	0.778000	0.31720	0.277000	0.26821	5.698000	0.68302	1.121000	0.41925	-0.216000	0.12614	GGC	PSPH	-	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	ENSG00000146733		0.572	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PSPH	HGNC	protein_coding	OTTHUMT00000343304.1		0.00	45	0	C	NM_004577		56087300	-1			no_errors	ENST00000275605	ensembl	human	known	74_37	missense	13.50	205	32	SNP	0.998	T
PTCHD2	57540	genome.wustl.edu	37	1	11580782	11580782	+	Missense_Mutation	SNP	G	G	T	rs527845484		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:11580782G>T	ENST00000294484.6	+	10	2377	c.2239G>T	c.(2239-2241)Gcc>Tcc	p.A747S	PTCHD2_ENST00000389575.3_Missense_Mutation_p.A747S	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	747					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CCTGGTGTTCGCCAGCCGGCT	0.667																																																	0													33.0	38.0	37.0					1																	11580782		1940	4138	6078	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2239G>T	1.37:g.11580782G>T	ENSP00000294484:p.Ala747Ser		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.A747S	ENST00000294484.6	37	c.2239	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782371	0.90282	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.90844	-2.74;-2.74	5.77	5.77	0.91146	.	0.097175	0.64402	D	0.000001	D	0.93822	0.8024	L	0.54323	1.7	0.49130	D	0.999757	D	0.69078	0.997	D	0.63877	0.919	D	0.93775	0.7078	10	0.62326	D	0.03	-38.8504	18.9865	0.92773	0.0:0.0:1.0:0.0	.	747	Q9P2K9	PTHD2_HUMAN	S	747	ENSP00000294484:A747S;ENSP00000374226:A747S	ENSP00000294484:A747S	A	+	1	0	PTCHD2	11503369	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.693000	0.74582	2.724000	0.93272	0.561000	0.74099	GCC	PTCHD2	-	pfam_Patched	ENSG00000204624		0.667	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	22	0	G	XM_052561		11580782	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	52.63	9	10	SNP	1.000	T
PTGDR2	11251	genome.wustl.edu	37	11	60620689	60620689	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:60620689G>A	ENST00000332539.4	-	2	618	c.507C>T	c.(505-507)ttC>ttT	p.F169F	RP11-804A23.4_ENST00000538705.1_RNA	NM_004778.2	NP_004769.2	Q9Y5Y4	PD2R2_HUMAN	prostaglandin D2 receptor 2	169					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|calcium-mediated signaling (GO:0019722)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|prostaglandin D receptor activity (GO:0004956)|prostaglandin F receptor activity (GO:0004958)|prostaglandin J receptor activity (GO:0001785)									Indomethacin(DB00328)|Sulindac(DB00605)	TGGTGTCCCGGAACACGAAAT	0.647																																																	0													42.0	43.0	43.0					11																	60620689		2203	4299	6502	SO:0001819	synonymous_variant	0			AF118265	CCDS7994.1	11q12-q13.3	2012-08-08	2011-11-11	2011-11-11		ENSG00000183134		"""CD molecules"", ""GPCR / Class A : Prostanoid receptors"""	4502	protein-coding gene	gene with protein product	"""chemoattractant receptor homologous molecule expressed on T helper type 2 cells"""	604837	"""G protein-coupled receptor 44"""	GPR44		10036181	Standard	NM_004778		Approved	CRTH2, CD294, DP2	uc001nqc.2	Q9Y5Y4		ENST00000332539.4:c.507C>T	11.37:g.60620689G>A			O94765|Q4QRI6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt,prints_Anphylx_rcpt	p.F169	ENST00000332539.4	37	c.507	CCDS7994.1	11																																																																																			PTGDR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Anphylx_rcpt	ENSG00000183134		0.647	PTGDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDR2	HGNC	protein_coding	OTTHUMT00000396328.1	-	0.00	39	0	G	NM_004778		60620689	-1	tier1	-	no_errors	ENST00000332539	ensembl	human	known	74_37	silent	80.00	4	16	SNP	1.000	A
PYCRL	65263	genome.wustl.edu	37	8	144688255	144688255	+	Missense_Mutation	SNP	G	G	A	rs375718982		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:144688255G>A	ENST00000220966.6	-	5	684	c.655C>T	c.(655-657)Cgc>Tgc	p.R219C	PYCRL_ENST00000495276.1_5'UTR|PYCRL_ENST00000377579.3_Missense_Mutation_p.R70C|RP11-661A12.14_ENST00000606452.1_lincRNA	NM_023078.3	NP_075566.2	Q53H96	P5CR3_HUMAN	pyrroline-5-carboxylate reductase-like	207					L-proline biosynthetic process (GO:0055129)		pyrroline-5-carboxylate reductase activity (GO:0004735)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)		L-Proline(DB00172)	GCAGCGATGCGGTGGGCCAGG	0.662																																																	0								G	CYS/ARG	0,4400		0,0,2200	24.0	22.0	23.0		655	5.4	1.0	8		23	1,8591		0,1,4295	no	missense	PYCRL	NM_023078.3	180	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	219/287	144688255	1,12991	2200	4296	6496	SO:0001583	missense	0			AF086378	CCDS6407.2	8q24.3	2011-09-30	2011-09-30	2011-09-30	ENSG00000104524	ENSG00000104524			25846	protein-coding gene	gene with protein product							Standard	NM_023078		Approved	FLJ13852	uc003yyy.3	Q53H96	OTTHUMG00000157010	ENST00000220966.6:c.655C>T	8.37:g.144688255G>A	ENSP00000220966:p.Arg219Cys		B3KMB5|B4DVT6|H0Y6C3|Q8N3N9|Q96HX4|Q9H896	Missense_Mutation	SNP	superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	p.R219C	ENST00000220966.6	37	c.655	CCDS6407.2	8	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213593	0.79352	0.0	1.16E-4	ENSG00000104524	ENST00000220966;ENST00000377579;ENST00000433751	D;D;D	0.85088	-1.94;-1.94;-1.94	5.42	5.42	0.78866	6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.184155	0.48767	D	0.000170	D	0.91945	0.7449	M	0.93197	3.39	0.49582	D	0.999803	D;D	0.76494	0.999;0.997	P;P	0.53146	0.714;0.719	D	0.93684	0.7001	10	0.87932	D	0	-38.6651	13.6448	0.62275	0.0:0.0:0.8446:0.1554	.	219;207	D3DWK4;Q53H96	.;P5CR3_HUMAN	C	219;70;194	ENSP00000220966:R219C;ENSP00000366802:R70C;ENSP00000404493:R194C	ENSP00000220966:R219C	R	-	1	0	PYCRL	144759398	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	3.422000	0.52749	2.553000	0.86117	0.561000	0.74099	CGC	PYCRL	-	superfamily_6-PGluconate_DH_C-like,pirsf_Pyrroline-COOH_reductase,tigrfam_Pyrroline-COOH_reductase	ENSG00000104524		0.662	PYCRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYCRL	HGNC	protein_coding	OTTHUMT00000347081.2	-	0.00	92	0	G	NM_023078		144688255	-1	tier1	-	no_errors	ENST00000220966	ensembl	human	known	74_37	missense	41.10	43	30	SNP	1.000	A
RABGGTB	5876	genome.wustl.edu	37	1	76253024	76253024	+	Intron	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:76253024A>G	ENST00000319942.3	+	2	74				SNORD45A_ENST00000384512.1_RNA|RABGGTB_ENST00000535300.1_Intron|RABGGTB_ENST00000370826.3_Intron|SNORD45C_ENST00000383893.1_RNA|RABGGTB_ENST00000496055.1_Intron|SNORD45B_ENST00000364617.1_RNA	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						gcgatcttctacctcagcctc	0.428																																																	0																																										SO:0001627	intron_variant	0			U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.4-158A>G	1.37:g.76253024A>G			Q92697	RNA	SNP	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																			RABGGTB	-	-	ENSG00000137955		0.428	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1	-	0.00	15	0	A	NM_004582		76253024	+1	tier1	-	no_errors	ENST00000471759	ensembl	human	known	74_37	rna	40.91	13	9	SNP	0.002	G
RADIL	55698	genome.wustl.edu	37	7	4874577	4874577	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:4874577C>A	ENST00000399583.3	-	4	1264	c.1077G>T	c.(1075-1077)gcG>gcT	p.A359A	RADIL_ENST00000538469.1_Silent_p.A119A|RADIL_ENST00000536091.1_Silent_p.A359A	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	359	FHA.				multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GCTGGGCCTGCGCGGGGTCCT	0.746																																																	0													9.0	12.0	11.0					7																	4874577		1855	4073	5928	SO:0001819	synonymous_variant	0			AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.1077G>T	7.37:g.4874577C>A			A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Missense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.A358S	ENST00000399583.3	37	c.1072	CCDS43544.1	7																																																																																			RADIL	-	NULL	ENSG00000157927		0.746	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RADIL	HGNC	protein_coding	OTTHUMT00000323769.2	-	0.00	23	0	C	NM_018059		4874577	-1	tier1	-	no_errors	ENST00000445392	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.001	A
RAET1K	646024	genome.wustl.edu	37	6	150321319	150321319	+	RNA	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:150321319G>C	ENST00000533735.1	-	0	899					NR_024045.1				retinoic acid early transcript 1K pseudogene																		CCTGGGGTCAGAGAGGGTGGT	0.582																																																	0																																												0			AF425244		6q25.1	2012-01-10			ENSG00000218358	ENSG00000218358			16797	pseudogene	pseudogene						11827464	Standard	NR_024045		Approved		uc003qnq.3		OTTHUMG00000015815		6.37:g.150321319G>C				RNA	SNP	-	NULL	ENST00000533735.1	37	NULL		6																																																																																			RAET1K	-	-	ENSG00000218358		0.582	RAET1K-002	KNOWN	basic	processed_transcript	RAET1K	HGNC	pseudogene	OTTHUMT00000390882.1	-	0.00	90	0	G			150321319	-1	tier1	-	no_errors	ENST00000533735	ensembl	human	known	74_37	rna	10.87	82	10	SNP	0.000	C
RALYL	138046	genome.wustl.edu	37	8	85774568	85774568	+	Missense_Mutation	SNP	C	C	T	rs527942610		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:85774568C>T	ENST00000521268.1	+	6	1556	c.451C>T	c.(451-453)Cgt>Tgt	p.R151C	RALYL_ENST00000522455.1_Missense_Mutation_p.R151C|RALYL_ENST00000521376.1_Missense_Mutation_p.R62C|RALYL_ENST00000518566.1_Missense_Mutation_p.R140C|RALYL_ENST00000521695.1_Missense_Mutation_p.R151C|RALYL_ENST00000523850.1_Missense_Mutation_p.R78C|RALYL_ENST00000517638.1_Missense_Mutation_p.R164C	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	151							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R151G(4)		endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						TCCACCTCCCCGTGCAGTAAT	0.502													C|||	1	0.000199681	0.0	0.0	5008	,	,		15921	0.0		0.001	False		,,,				2504	0.0																4	Substitution - Missense(4)	lung(4)											56.0	56.0	56.0					8																	85774568		1909	4128	6037	SO:0001583	missense	0				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.451C>T	8.37:g.85774568C>T	ENSP00000430367:p.Arg151Cys		B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.R151C	ENST00000521268.1	37	c.451	CCDS55253.1	8	.	.	.	.	.	.	.	.	.	.	C	19.35	3.810460	0.70797	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850;ENST00000521376	T;T;T;T;T;T;T	0.23754	2.59;2.59;2.59;2.53;2.58;2.13;1.89	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	M	0.75264	2.295	0.54753	D	0.999986	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	P;D;D;D;D	0.87578	0.899;0.997;0.998;0.997;0.997	T	0.55692	-0.8101	10	0.59425	D	0.04	-3.6618	19.1979	0.93696	0.0:1.0:0.0:0.0	.	140;151;78;164;151	B3KT61;B3KSX3;Q86SE5-2;G3V129;Q86SE5	.;.;.;.;RALYL_HUMAN	C	151;151;151;140;164;78;62	ENSP00000430394:R151C;ENSP00000428667:R151C;ENSP00000430367:R151C;ENSP00000430065:R140C;ENSP00000430128:R164C;ENSP00000428807:R78C;ENSP00000428310:R62C	ENSP00000430128:R164C	R	+	1	0	RALYL	85937123	0.997000	0.39634	0.670000	0.29842	0.457000	0.32468	4.017000	0.57167	2.599000	0.87857	0.551000	0.68910	CGT	RALYL	-	pirsf_hnRNP_C_Raly	ENSG00000184672		0.502	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	-	0.00	51	0	C			85774568	+1	tier1	-	no_errors	ENST00000521268	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.997	T
RASGRP3	25780	genome.wustl.edu	37	2	33764169	33764169	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:33764169C>A	ENST00000403687.3	+	12	1910	c.1170C>A	c.(1168-1170)acC>acA	p.T390T	RASGRP3_ENST00000402538.3_Silent_p.T390T|RASGRP3_ENST00000407811.1_Silent_p.T389T	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	390					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					AGCAGCCTACCTCCCCTACGA	0.468																																																	0													33.0	31.0	32.0					2																	33764169		1838	4090	5928	SO:0001819	synonymous_variant	0			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1170C>A	2.37:g.33764169C>A			D6W583|O94931|Q53SD7	Silent	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.T390	ENST00000403687.3	37	c.1170	CCDS46256.1	2																																																																																			RASGRP3	-	superfamily_Ras_GEF_dom	ENSG00000152689		0.468	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	RASGRP3	HGNC	protein_coding	OTTHUMT00000325462.2	-	0.00	24	0	C	NM_015376		33764169	+1	tier1	-	no_errors	ENST00000402538	ensembl	human	known	74_37	silent	50.00	21	21	SNP	1.000	A
RBMXL3	139804	genome.wustl.edu	37	X	114424215	114424215	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:114424215G>T	ENST00000424776.3	+	1	253	c.211G>T	c.(211-213)Ggc>Tgc	p.G71C	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	71	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						AGATATGAACGGCAAGTACCT	0.592																																																	0													51.0	50.0	50.0					X																	114424215		692	1591	2283	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.211G>T	X.37:g.114424215G>T	ENSP00000417451:p.Gly71Cys		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G71C	ENST00000424776.3	37	c.211	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	13.77	2.335686	0.41398	.	.	ENSG00000175718	ENST00000424776	D	0.82344	-1.6	0.555	0.555	0.17247	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.	.	.	.	D	0.91734	0.7386	M	0.92122	3.275	0.52501	D	0.999959	D	0.89917	1.0	D	0.91635	0.999	D	0.91946	0.5567	8	0.87932	D	0	.	.	.	.	.	71	Q8N7X1	RMXL3_HUMAN	C	71	ENSP00000417451:G71C	ENSP00000417451:G71C	G	+	1	0	RBMXL3	114330471	1.000000	0.71417	0.008000	0.14137	0.004000	0.04260	6.263000	0.72521	0.513000	0.28278	0.292000	0.19580	GGC	RBMXL3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000175718		0.592	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	11	0	G	NM_001145346		114424215	+1	tier1	-	no_errors	ENST00000424776	ensembl	human	known	74_37	missense	100.00	0	13	SNP	1.000	T
REXO1L1P	254958	genome.wustl.edu	37	8	86575214	86575214	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:86575214C>A	ENST00000379010.2	-	1	512	c.513G>T	c.(511-513)acG>acT	p.T171T		NM_172239.4	NP_758439.4														endometrium(1)|lung(4)	5						AGCACGACTCCGTCACCATCT	0.672																																																	0													1.0	1.0	1.0					8																	86575214		186	807	993	SO:0001819	synonymous_variant	0																														ENST00000379010.2:c.513G>T	8.37:g.86575214C>A				Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.T171	ENST00000379010.2	37	c.513		8																																																																																			REXO1L1	-	NULL	ENSG00000205176		0.672	REXO1L1-001	PUTATIVE	basic|appris_principal	protein_coding	REXO1L1	HGNC	protein_coding	OTTHUMT00000381106.1	-	0.00	97	0	C			86575214	-1	tier1	-	no_errors	ENST00000379010	ensembl	human	putative	74_37	silent	25.97	57	20	SNP	0.000	A
RFTN1	23180	genome.wustl.edu	37	3	16419499	16419499	+	Silent	SNP	G	G	T	rs371329309		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:16419499G>T	ENST00000334133.4	-	5	824	c.552C>A	c.(550-552)acC>acA	p.T184T	RFTN1_ENST00000432519.1_Silent_p.T148T	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	184					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						TGGCATCCTCGGTGCTGTTGG	0.567																																																	0													78.0	72.0	74.0					3																	16419499		2203	4300	6503	SO:0001819	synonymous_variant	0			D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.552C>A	3.37:g.16419499G>T			Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Silent	SNP	NULL	p.T184	ENST00000334133.4	37	c.552	CCDS33712.1	3																																																																																			RFTN1	-	NULL	ENSG00000131378		0.567	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFTN1	HGNC	protein_coding	OTTHUMT00000346908.1	-	0.00	20	0	G	NM_015150		16419499	-1	tier1	-	no_errors	ENST00000334133	ensembl	human	known	74_37	silent	91.67	1	11	SNP	0.000	T
RFX8	731220	genome.wustl.edu	37	2	102029526	102029526	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:102029526C>G	ENST00000376826.2	-	11	907	c.908G>C	c.(907-909)cGa>cCa	p.R303P	RFX8_ENST00000428343.1_Missense_Mutation_p.R190P			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						CAATACCATTCGCATAGTCTA	0.408																																																	0													141.0	114.0	122.0					2																	102029526		692	1591	2283	SO:0001583	missense	0			AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.908G>C	2.37:g.102029526C>G	ENSP00000366022:p.Arg303Pro		B4DQ32	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.R303P	ENST00000376826.2	37	c.908		2	.	.	.	.	.	.	.	.	.	.	C	12.00	1.805315	0.31961	.	.	ENSG00000196460	ENST00000376826;ENST00000428343	D;T	0.82255	-1.59;0.08	5.72	2.59	0.31030	.	.	.	.	.	D	0.82870	0.5131	L	0.38175	1.15	0.22366	N	0.999162	D;D	0.59767	0.98;0.986	P;P	0.59948	0.866;0.806	T	0.71002	-0.4718	9	0.66056	D	0.02	.	6.6525	0.22969	0.0:0.6527:0.0:0.3473	.	190;303	Q6ZV50-3;Q6ZV50	.;RFX8_HUMAN	P	303;190	ENSP00000366022:R303P;ENSP00000401536:R190P	ENSP00000366022:R303P	R	-	2	0	RFX8	101395958	0.270000	0.24152	0.212000	0.23672	0.053000	0.15095	0.405000	0.21015	0.207000	0.20607	0.650000	0.86243	CGA	RFX8	-	NULL	ENSG00000196460		0.408	RFX8-201	KNOWN	basic|appris_principal	protein_coding	RFX8	HGNC	protein_coding		-	0.00	30	0	C	NM_001145664		102029526	-1	tier1	-	no_errors	ENST00000376826	ensembl	human	known	74_37	missense	74.24	17	49	SNP	0.658	G
RHBDF1	64285	genome.wustl.edu	37	16	109825	109825	+	Splice_Site	SNP	C	C	A	rs376515962		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:109825C>A	ENST00000262316.6	-	14	1865		c.e14-1			NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				TGGTGCAGATCTGGGTCACAA	0.582																																																	0													156.0	120.0	132.0					16																	109825		2203	4300	6503	SO:0001630	splice_region_variant	0			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.1723-1G>T	16.37:g.109825C>A			Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Splice_Site	SNP	-	e13-1	ENST00000262316.6	37	c.1723-1	CCDS32344.1	16	.	.	.	.	.	.	.	.	.	.	c	16.63	3.176211	0.57692	.	.	ENSG00000007384	ENST00000262316	.	.	.	5.37	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1387	0.72590	0.0:0.8582:0.1418:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RHBDF1	49825	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.755000	0.85180	1.254000	0.44035	0.650000	0.86243	.	RHBDF1	-	-	ENSG00000007384		0.582	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDF1	HGNC	protein_coding	OTTHUMT00000134178.2	-	0.00	31	0	C	NM_022450	Intron	109825	-1	tier1	-	no_errors	ENST00000262316	ensembl	human	known	74_37	splice_site	43.90	23	18	SNP	1.000	A
RHBDF1	64285	genome.wustl.edu	37	16	112579	112579	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:112579C>G	ENST00000262316.6	-	7	1052	c.910G>C	c.(910-912)Ggg>Cgg	p.G304R	RHBDF1_ENST00000454039.2_Missense_Mutation_p.G304R	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	304					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				TCCAGGGCCCCGCCGGTGAGG	0.657																																																	0													85.0	99.0	94.0					16																	112579		2203	4300	6503	SO:0001583	missense	0			BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.910G>C	16.37:g.112579C>G	ENSP00000262316:p.Gly304Arg		Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	pfam_Rhomboid_SP,pfam_Peptidase_S54_rhomboid_dom	p.G304R	ENST00000262316.6	37	c.910	CCDS32344.1	16	.	.	.	.	.	.	.	.	.	.	.	13.52	2.260983	0.39995	.	.	ENSG00000007384	ENST00000262316;ENST00000454039	T;T	0.64618	-0.11;-0.11	4.77	3.8	0.43715	.	0.286793	0.39407	N	0.001369	T	0.56746	0.2006	N	0.14661	0.345	0.31312	N	0.68709	D;D;P	0.89917	0.999;1.0;0.512	D;D;B	0.75020	0.948;0.985;0.425	T	0.55405	-0.8146	10	0.16420	T	0.52	-27.7592	7.3238	0.26542	0.1694:0.7461:0.0:0.0845	.	304;327;304	F5GWL4;B4E3Q0;Q96CC6	.;.;RHDF1_HUMAN	R	304	ENSP00000262316:G304R;ENSP00000392133:G304R	ENSP00000262316:G304R	G	-	1	0	RHBDF1	52579	1.000000	0.71417	0.212000	0.23672	0.454000	0.32378	4.120000	0.57897	1.201000	0.43203	0.462000	0.41574	GGG	RHBDF1	-	pfam_Rhomboid_SP	ENSG00000007384		0.657	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDF1	HGNC	protein_coding	OTTHUMT00000134178.2	-	0.00	50	0	C	NM_022450		112579	-1	tier1	-	no_errors	ENST00000262316	ensembl	human	known	74_37	missense	55.36	25	31	SNP	0.811	G
RHOJ	57381	genome.wustl.edu	37	14	63757700	63757700	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:63757700G>T	ENST00000316754.3	+	5	1065	c.603G>T	c.(601-603)aaG>aaT	p.K201N		NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J	201					actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.K201N(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		AGAAAAAGAAGAAACGCTGTT	0.488																																																	1	Substitution - Missense(1)	large_intestine(1)											118.0	113.0	115.0					14																	63757700		2203	4300	6503	SO:0001583	missense	0			AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	ENST00000316754.3:c.603G>T	14.37:g.63757700G>T	ENSP00000316729:p.Lys201Asn		Q96KC1	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K201N	ENST00000316754.3	37	c.603	CCDS9757.1	14	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975900	0.74360	.	.	ENSG00000126785	ENST00000316754	T	0.69806	-0.43	5.73	3.89	0.44902	.	0.301618	0.29389	N	0.012294	T	0.71863	0.3390	L	0.52011	1.625	0.80722	D	1	D	0.53885	0.963	P	0.56648	0.803	T	0.74765	-0.3554	10	0.66056	D	0.02	.	12.7212	0.57144	0.1351:0.0:0.8649:0.0	.	201	Q9H4E5	RHOJ_HUMAN	N	201	ENSP00000316729:K201N	ENSP00000316729:K201N	K	+	3	2	RHOJ	62827453	1.000000	0.71417	0.987000	0.45799	0.758000	0.43043	2.815000	0.48018	1.429000	0.47314	0.561000	0.74099	AAG	RHOJ	-	superfamily_P-loop_NTPase	ENSG00000126785		0.488	RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOJ	HGNC	protein_coding	OTTHUMT00000276975.3		0.00	29	0	G			63757700	+1			no_errors	ENST00000316754	ensembl	human	known	74_37	missense	5.56	33	2	SNP	0.997	T
RIBC2	26150	genome.wustl.edu	37	22	45821879	45821879	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:45821879G>C	ENST00000342894.3	+	5	922	c.508G>C	c.(508-510)Gac>Cac	p.D170H	RIBC2_ENST00000466226.1_3'UTR|RIBC2_ENST00000538017.1_Missense_Mutation_p.D238H			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	170						nucleus (GO:0005634)				NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		AGAACAAGAGGACAACTTGGC	0.577																																																	0													147.0	134.0	139.0					22																	45821879		2203	4300	6503	SO:0001583	missense	0			AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332	ENST00000342894.3:c.508G>C	22.37:g.45821879G>C	ENSP00000342529:p.Asp170His		Q6ICD0|Q9Y413	Missense_Mutation	SNP	pfam_RIB43A	p.D238H	ENST00000342894.3	37	c.712		22	.	.	.	.	.	.	.	.	.	.	G	17.43	3.386617	0.61956	.	.	ENSG00000128408	ENST00000342894;ENST00000538017	T;T	0.26660	1.72;1.72	4.53	4.53	0.55603	.	0.320719	0.28983	N	0.013508	T	0.50684	0.1630	.	.	.	0.48087	D	0.999589	D	0.76494	0.999	D	0.69479	0.964	T	0.53114	-0.8484	9	0.48119	T	0.1	-14.0107	17.0274	0.86451	0.0:0.0:1.0:0.0	.	170	Q9H4K1	RIBC2_HUMAN	H	170;238	ENSP00000342529:D170H;ENSP00000444196:D238H	ENSP00000342529:D170H	D	+	1	0	RIBC2	44200543	1.000000	0.71417	0.936000	0.37596	0.328000	0.28507	6.552000	0.73914	2.320000	0.78422	0.655000	0.94253	GAC	RIBC2	-	pfam_RIB43A	ENSG00000128408		0.577	RIBC2-001	KNOWN	basic	protein_coding	RIBC2	HGNC	protein_coding	OTTHUMT00000322250.1	-	0.00	29	0	G	NM_015653		45821879	+1	tier1	-	no_errors	ENST00000538017	ensembl	human	known	74_37	missense	41.18	10	7	SNP	0.952	C
RNF17	56163	genome.wustl.edu	37	13	25367319	25367319	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr13:25367319C>A	ENST00000255324.5	+	10	1127	c.1075C>A	c.(1075-1077)Cca>Aca	p.P359T	RNF17_ENST00000381921.1_Missense_Mutation_p.P359T|RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000255325.6_Missense_Mutation_p.P359T	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	359					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TGAAGCACCACCACCTCCTTT	0.398																																																	0													188.0	175.0	179.0					13																	25367319		2203	4300	6503	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.1075C>A	13.37:g.25367319C>A	ENSP00000255324:p.Pro359Thr		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.P359T	ENST00000255324.5	37	c.1075	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361640	0.01235	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000255325;ENST00000255326	T;T;T	0.17054	3.58;3.58;2.3	4.0	0.293	0.15742	.	1.533890	0.03580	N	0.230039	T	0.09113	0.0225	N	0.14661	0.345	0.09310	N	1	B;B;B	0.28933	0.051;0.051;0.228	B;B;B	0.24394	0.016;0.016;0.053	T	0.26430	-1.0103	10	0.14656	T	0.56	3.4256	5.0916	0.14711	0.0:0.3554:0.4231:0.2215	.	359;359;359	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	T	359;359;218;360;359	ENSP00000255324:P359T;ENSP00000371346:P359T;ENSP00000255325:P360T	ENSP00000255324:P359T	P	+	1	0	RNF17	24265319	0.000000	0.05858	0.000000	0.03702	0.497000	0.33675	-0.582000	0.05814	0.010000	0.14839	-0.142000	0.14014	CCA	RNF17	-	NULL	ENSG00000132972		0.398	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	-	0.00	37	0	C	NM_031994		25367319	+1	tier1	-	no_errors	ENST00000255324	ensembl	human	known	74_37	missense	39.58	29	19	SNP	0.000	A
RNF213	57674	genome.wustl.edu	37	17	78261934	78261934	+	Silent	SNP	G	G	T	rs148613334		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:78261934G>T	ENST00000582970.1	+	4	725	c.582G>T	c.(580-582)ccG>ccT	p.P194P	RNF213_ENST00000456466.1_Silent_p.P194P|RNF213_ENST00000508628.2_Silent_p.P243P|RNF213_ENST00000319921.4_Silent_p.P194P	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	194					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			AGAGCAGCCCGCAATTCCAGG	0.692																																																	0													32.0	32.0	32.0					17																	78261934		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.582G>T	17.37:g.78261934G>T			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.P194	ENST00000582970.1	37	c.582	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.692	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1		0.00	8	0	G	NM_020914		78261934	+1			no_errors	ENST00000582970	ensembl	human	known	74_37	silent	10.64	42	5	SNP	0.000	T
RNF5	6048	genome.wustl.edu	37	6	32147865	32147865	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:32147865C>T	ENST00000375094.3	+	5	565	c.407C>T	c.(406-408)aCc>aTc	p.T136I	AGPAT1_ENST00000375104.2_5'Flank|AGPAT1_ENST00000336984.6_5'Flank|AGPAT1_ENST00000395497.1_5'Flank|RNF5_ENST00000427134.2_Missense_Mutation_p.T136I|AGPAT1_ENST00000490711.1_5'Flank	NM_006913.3	NP_008844.1	Q99942	RNF5_HUMAN	ring finger protein 5, E3 ubiquitin protein ligase	136					cellular protein catabolic process (GO:0044257)|ER-associated misfolded protein catabolic process (GO:0071712)|negative regulation of autophagy (GO:0010507)|protein destabilization (GO:0031648)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|regulation of autophagic vacuole assembly (GO:2000785)|response to bacterium (GO:0009617)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T136I(3)		endometrium(1)|lung(7)|urinary_tract(2)	10						TTTTTCACCACCGTCTTCAAT	0.557																																																	3	Substitution - Missense(3)	lung(3)											151.0	153.0	152.0					6																	32147865		1511	2709	4220	SO:0001583	missense	0			U89336	CCDS4745.1	6p21.31	2013-01-09	2012-02-23			ENSG00000204308		"""RING-type (C3HC4) zinc fingers"""	10068	protein-coding gene	gene with protein product		602677	"""ring finger protein 5"""			9533025	Standard	NM_006913		Approved	NG2, G16, RING5, RMA1	uc031snv.1	Q99942	OTTHUMG00000031093	ENST00000375094.3:c.407C>T	6.37:g.32147865C>T	ENSP00000364235:p.Thr136Ile		A2BFI6|B2R4K3|Q0VDB7|Q9UMQ2	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.T136I	ENST00000375094.3	37	c.407	CCDS4745.1	6	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403896	0.83230	.	.	ENSG00000204308	ENST00000375094;ENST00000427134	D;D	0.93604	-3.25;-3.25	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	D	0.86723	0.6001	L	0.47716	1.5	0.58432	D	0.999999	B	0.33345	0.409	B	0.27715	0.082	D	0.86266	0.1658	10	0.37606	T	0.19	-2.0092	16.9524	0.86249	0.0:1.0:0.0:0.0	.	136	Q99942	RNF5_HUMAN	I	136	ENSP00000364235:T136I;ENSP00000407656:T136I	ENSP00000364235:T136I	T	+	2	0	RNF5	32255843	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	6.897000	0.75671	2.666000	0.90696	0.655000	0.94253	ACC	RNF5	-	NULL	ENSG00000204308		0.557	RNF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF5	HGNC	protein_coding	OTTHUMT00000076133.2		0.00	22	0	C	NM_006913		32147865	+1			no_errors	ENST00000427134	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
RRN3P1	730092	genome.wustl.edu	37	16	21817466	21817466	+	RNA	SNP	G	G	A	rs545875379		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:21817466G>A	ENST00000546471.1	-	0	1592							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		AGCTTGAGTAGTTTTTCAATA	0.259													.|||	1	0.000199681	0.0	0.0	5008	,	,		18584	0.001		0.0	False		,,,				2504	0.0																0																																												0					16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21817466G>A			A8K6T4|B3KWX9|O75704	RNA	SNP	-	NULL	ENST00000546471.1	37	NULL		16																																																																																			RRN3P1	-	-	ENSG00000248124		0.259	RRN3P1-002	KNOWN	basic	processed_transcript	RRN3P1	HGNC	pseudogene	OTTHUMT00000409035.1	-	0.00	49	0	G	NR_003370		21817466	-1	tier1	-	no_errors	ENST00000546471	ensembl	human	known	74_37	rna	10.47	77	9	SNP	1.000	A
SCARB2	950	genome.wustl.edu	37	4	77095377	77095377	+	Missense_Mutation	SNP	G	G	A	rs148588727		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:77095377G>A	ENST00000264896.2	-	7	1263	c.914C>T	c.(913-915)aCg>aTg	p.T305M	SCARB2_ENST00000452464.2_Missense_Mutation_p.T162M	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	305					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			ATTGTCTGACGTATTGGCTAA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		19102	0.001		0.0	False		,,,				2504	0.0																0													134.0	138.0	137.0					4																	77095377		2203	4300	6503	SO:0001583	missense	0			D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.914C>T	4.37:g.77095377G>A	ENSP00000264896:p.Thr305Met		B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	pfam_CD36,superfamily_NA-bd_OB-fold,prints_LimpII,prints_CD36,prints_CD36_antigen	p.T305M	ENST00000264896.2	37	c.914	CCDS3577.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	10.30	1.311367	0.23821	.	.	ENSG00000138760	ENST00000264896;ENST00000452464	T;T	0.73047	-0.71;-0.71	5.5	1.12	0.20585	.	0.986023	0.08330	N	0.962491	T	0.67221	0.2870	L	0.31065	0.9	0.09310	N	1	D;P	0.61697	0.99;0.916	P;P	0.58873	0.847;0.671	T	0.54906	-0.8223	10	0.62326	D	0.03	.	1.19	0.01863	0.1471:0.2486:0.2528:0.3515	.	162;305	E7EM68;Q14108	.;SCRB2_HUMAN	M	305;162	ENSP00000264896:T305M;ENSP00000399154:T162M	ENSP00000264896:T305M	T	-	2	0	SCARB2	77314401	0.000000	0.05858	0.780000	0.31762	0.059000	0.15707	-0.032000	0.12266	0.243000	0.21327	-0.176000	0.13171	ACG	SCARB2	-	pfam_CD36,prints_LimpII	ENSG00000138760		0.463	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARB2	HGNC	protein_coding	OTTHUMT00000252403.1		0.00	20	0	G	NM_005506		77095377	-1			no_errors	ENST00000264896	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.001	A
SEL1L2	80343	genome.wustl.edu	37	20	13830032	13830032	+	IGR	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr20:13830032C>A	ENST00000284951.5	-	0	2224				SEL1L2_ENST00000486903.1_5'Flank			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						GAGCGGGAAACTGCAGCGGAC	0.493																																																	0																																										SO:0001628	intergenic_variant	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910		20.37:g.13830032C>A			B4DXX5	RNA	SNP	-	NULL	ENST00000284951.5	37	NULL		20																																																																																			SEL1L2	-	-	ENSG00000101251		0.493	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	-	0.00	44	0	C	NM_025229		13830032	-1	tier1	-	no_errors	ENST00000482196	ensembl	human	known	74_37	rna	82.35	6	28	SNP	0.001	A
SERPINA4	5267	genome.wustl.edu	37	14	95030234	95030234	+	Missense_Mutation	SNP	G	G	A	rs539993882		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:95030234G>A	ENST00000557004.1	+	2	836	c.415G>A	c.(415-417)Gtg>Atg	p.V139M	SERPINA4_ENST00000555095.1_Missense_Mutation_p.V139M|SERPINA4_ENST00000298841.5_Missense_Mutation_p.V139M|SERPINA5_ENST00000553780.1_Intron			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	139					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		GGAAACACGCGTGGGCAGTGC	0.557													G|||	1	0.000199681	0.0	0.0	5008	,	,		19729	0.0		0.001	False		,,,				2504	0.0																0													113.0	102.0	106.0					14																	95030234		2203	4300	6503	SO:0001583	missense	0			L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.415G>A	14.37:g.95030234G>A	ENSP00000450838:p.Val139Met		Q53XB5|Q86TR9|Q96BZ5	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V139M	ENST00000557004.1	37	c.415	CCDS9927.1	14	.	.	.	.	.	.	.	.	.	.	G	6.399	0.441658	0.12164	.	.	ENSG00000100665	ENST00000557004;ENST00000555095;ENST00000298841	D;D;D	0.84223	-1.82;-1.82;-1.82	4.38	-3.1	0.05315	Serpin domain (3);	0.750429	0.11442	N	0.563675	T	0.56470	0.1987	N	0.03000	-0.44	0.24394	N	0.994731	B;B	0.32507	0.373;0.123	B;B	0.23150	0.044;0.036	T	0.54715	-0.8252	10	0.13853	T	0.58	.	6.853	0.24024	0.5656:0.1934:0.241:0.0	.	139;139	B2R815;P29622	.;KAIN_HUMAN	M	139	ENSP00000450838:V139M;ENSP00000451172:V139M;ENSP00000298841:V139M	ENSP00000298841:V139M	V	+	1	0	SERPINA4	94099987	0.000000	0.05858	0.060000	0.19600	0.031000	0.12232	-0.933000	0.03959	-0.303000	0.08856	-0.244000	0.11960	GTG	SERPINA4	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000100665		0.557	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA4	HGNC	protein_coding	OTTHUMT00000410718.1	-	0.00	35	0	G	NM_006215		95030234	+1	tier1	-	no_errors	ENST00000298841	ensembl	human	known	74_37	missense	41.07	33	23	SNP	0.016	A
SETBP1	26040	genome.wustl.edu	37	18	42456562	42456562	+	Intron	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr18:42456562G>A	ENST00000282030.5	+	3	836				SETBP1_ENST00000426838.4_Silent_p.K191K	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1							nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AAGTCTGGAAGAGAAGAGGAG	0.498									Schinzel-Giedion syndrome																																								0													76.0	74.0	75.0					18																	42456562		692	1591	2283	SO:0001627	intron_variant	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.540+7314G>A	18.37:g.42456562G>A			A6H8W5|Q6P6C3|Q9UEF3	Silent	SNP	NULL	p.K191	ENST00000282030.5	37	c.573	CCDS11923.2	18																																																																																			SETBP1	-	NULL	ENSG00000152217		0.498	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	93	0	G	NM_001130110		42456562	+1	tier1	-	no_errors	ENST00000426838	ensembl	human	known	74_37	silent	87.72	7	50	SNP	0.000	A
SEZ6L2	26470	genome.wustl.edu	37	16	29909173	29909173	+	Splice_Site	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:29909173C>G	ENST00000308713.5	-	2	739		c.e2+1		ASPHD1_ENST00000308748.5_5'Flank|ASPHD1_ENST00000483405.1_5'Flank|SEZ6L2_ENST00000562159.1_Splice_Site|SEZ6L2_ENST00000346932.5_Splice_Site|SEZ6L2_ENST00000537485.1_Intron|SEZ6L2_ENST00000350527.3_Splice_Site	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2						adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGGGGCCTCACCTGGCAGGTA	0.652																																																	0													79.0	89.0	86.0					16																	29909173		2197	4300	6497	SO:0001630	splice_region_variant	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.211+1G>C	16.37:g.29909173C>G			B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Splice_Site	SNP	-	e2+1	ENST00000308713.5	37	c.211+1	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658404	0.47467	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.678	0.85284	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEZ6L2	29816674	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	4.491000	0.60326	2.211000	0.71520	0.462000	0.41574	.	SEZ6L2	-	-	ENSG00000174938		0.652	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	-	0.00	21	0	C	NM_012410	Intron	29909173	-1	tier1	-	no_errors	ENST00000308713	ensembl	human	known	74_37	splice_site	47.83	12	11	SNP	1.000	G
SHANK2	22941	genome.wustl.edu	37	11	70332808	70332808	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:70332808C>G	ENST00000423696.2	-	15	2489	c.2453G>C	c.(2452-2454)gGc>gCc	p.G818A	SHANK2_ENST00000449833.2_Missense_Mutation_p.G602A|SHANK2_ENST00000409161.1_Missense_Mutation_p.G601A|SHANK2_ENST00000338508.4_Missense_Mutation_p.G1198A			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	818					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ATTCCCGGGGCCGGCTGTGCC	0.682																																																	0													22.0	29.0	26.0					11																	70332808		2194	4291	6485	SO:0001583	missense	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2453G>C	11.37:g.70332808C>G	ENSP00000394536:p.Gly818Ala		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.G1198A	ENST00000423696.2	37	c.3593		11	.	.	.	.	.	.	.	.	.	.	C	1.156	-0.645105	0.03531	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73	4.64	4.64	0.57946	.	5.182010	0.03842	N	0.270853	T	0.41743	0.1172	L	0.40543	1.245	0.32036	N	0.598936	B;B;B	0.31351	0.133;0.32;0.11	B;B;B	0.32393	0.062;0.145;0.067	T	0.33085	-0.9882	10	0.05620	T	0.96	.	13.147	0.59467	0.0:0.8402:0.1597:0.0	.	818;1197;602	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	A	602;601;476;1198;818;836;821	ENSP00000399423:G602A;ENSP00000386491:G601A;ENSP00000402944:G476A;ENSP00000345193:G1198A;ENSP00000394536:G818A;ENSP00000294018:G821A	ENSP00000294018:G821A	G	-	2	0	SHANK2	70010456	0.862000	0.29867	0.808000	0.32385	0.064000	0.16182	1.357000	0.34090	2.125000	0.65367	0.561000	0.74099	GGC	SHANK2	-	NULL	ENSG00000162105		0.682	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		-	0.00	46	0	C	NM_012309		70332808	-1	tier1	-	no_errors	ENST00000338508	ensembl	human	known	74_37	missense	10.49	145	17	SNP	0.739	G
SHROOM4	57477	genome.wustl.edu	37	X	50350728	50350729	+	In_Frame_Ins	INS	-	-	TCC	rs6614552|rs375199494|rs143151534		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:50350728_50350729insTCC	ENST00000289292.7	-	6	3696_3697	c.3413_3414insGGA	c.(3412-3414)gaa>gaGGAa	p.1138_1138E>EE	SHROOM4_ENST00000376020.2_In_Frame_Ins_p.1138_1138E>EE|SHROOM4_ENST00000460112.3_In_Frame_Ins_p.1022_1022E>EE			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1138	Glu-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cttcttcttcttcctcctcctc	0.559														968	0.256424	0.1286	0.1614	3775	,	,		11689	0.1885		0.2127	False		,,,				2504	0.2883																0																																										SO:0001652	inframe_insertion	0			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3411_3413dupGGA	X.37:g.50350735_50350737dupTCC	ENSP00000289292:p.Glu1151dup		A7E2X9|D6RFW0|Q96LA0	In_Frame_Ins	INS	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.1142in_frame_insE	ENST00000289292.7	37	c.3414_3413	CCDS35277.1	X																																																																																			SHROOM4	-	NULL	ENSG00000158352		0.559	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4		0.00	9	0	-	NM_020717		50350729	-1	tier1		no_errors	ENST00000289292	ensembl	human	known	74_37	in_frame_ins	44.44	5	4	INS	0.000:0.000	TCC
SLC17A4	10050	genome.wustl.edu	37	6	25773853	25773853	+	Missense_Mutation	SNP	C	C	G	rs374082636		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:25773853C>G	ENST00000377905.4	+	8	1057	c.938C>G	c.(937-939)gCg>gGg	p.A313G	SLC17A4_ENST00000397076.2_Missense_Mutation_p.A83G|SLC17A4_ENST00000439485.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	313					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						ACCATTATGGCGTACACACCA	0.403																																																	0													144.0	127.0	133.0					6																	25773853		2203	4300	6503	SO:0001583	missense	0			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.938C>G	6.37:g.25773853C>G	ENSP00000367137:p.Ala313Gly		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A313G	ENST00000377905.4	37	c.938	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214587	0.58452	.	.	ENSG00000146039	ENST00000377905;ENST00000397076	T;T	0.59502	0.28;0.26	5.34	2.53	0.30540	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.141630	0.06543	N	0.743461	T	0.45657	0.1353	L	0.46614	1.455	0.09310	N	1	D;P	0.55385	0.971;0.636	P;B	0.54460	0.753;0.439	T	0.34030	-0.9845	10	0.87932	D	0	.	5.6993	0.17873	0.1593:0.6665:0.0:0.1742	.	83;313	E7EU17;Q9Y2C5	.;S17A4_HUMAN	G	313;83	ENSP00000367137:A313G;ENSP00000380266:A83G	ENSP00000367137:A313G	A	+	2	0	SLC17A4	25881832	0.000000	0.05858	0.000000	0.03702	0.077000	0.17291	0.450000	0.21762	0.730000	0.32425	0.655000	0.94253	GCG	SLC17A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146039		0.403	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1	-	0.00	67	0	C			25773853	+1	tier1	-	no_errors	ENST00000377905	ensembl	human	known	74_37	missense	23.08	100	30	SNP	0.001	G
SLC22A1	6580	genome.wustl.edu	37	6	160575942	160575942	+	Splice_Site	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:160575942G>C	ENST00000366963.4	+	9	1645	c.1498G>C	c.(1498-1500)Gcg>Ccg	p.A500P	SLC22A1_ENST00000457470.2_Intron|SLC22A1_ENST00000324965.4_Intron	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	500					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CATTTTGTTTGGTAAGATTTT	0.493																																																	0													148.0	121.0	130.0					6																	160575942		2203	4300	6503	SO:0001630	splice_region_variant	0			U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1498+1G>C	6.37:g.160575942G>C			A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.A500P	ENST00000366963.4	37	c.1498	CCDS5274.1	6	.	.	.	.	.	.	.	.	.	.	G	17.32	3.361018	0.61403	.	.	ENSG00000175003	ENST00000366963	T	0.63913	-0.07	5.43	5.43	0.79202	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.446506	0.22160	N	0.063787	T	0.77751	0.4177	M	0.88704	2.975	0.80722	D	1	P	0.44877	0.845	P	0.59424	0.857	T	0.81197	-0.1042	10	0.72032	D	0.01	.	16.1783	0.81884	0.0:0.0:1.0:0.0	.	500	O15245	S22A1_HUMAN	P	500	ENSP00000355930:A500P	ENSP00000355930:A500P	A	+	1	0	SLC22A1	160495932	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	4.825000	0.62708	2.523000	0.85059	0.655000	0.94253	GCG	SLC22A1	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000175003		0.493	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A1	HGNC	protein_coding	OTTHUMT00000042938.2	-	0.00	84	0	G		Missense_Mutation	160575942	+1	tier1	-	no_errors	ENST00000366963	ensembl	human	known	74_37	missense	48.72	40	38	SNP	1.000	C
SLC6A19	340024	genome.wustl.edu	37	5	1221849	1221849	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:1221849C>A	ENST00000304460.10	+	12	1791	c.1735C>A	c.(1735-1737)Ccg>Acg	p.P579T		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	579					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GATCTCCTACCCGAACTGGGT	0.567																																																	0													114.0	103.0	107.0					5																	1221849		2203	4300	6503	SO:0001583	missense	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1735C>A	5.37:g.1221849C>A	ENSP00000305302:p.Pro579Thr		A8K446	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.P579T	ENST00000304460.10	37	c.1735	CCDS34130.1	5	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733358	0.48939	.	.	ENSG00000174358	ENST00000304460	D	0.86769	-2.17	4.73	4.73	0.59995	.	0.158475	0.56097	D	0.000024	D	0.95554	0.8555	H	0.95079	3.62	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	D	0.97151	0.9831	10	0.87932	D	0	.	17.6827	0.88248	0.0:1.0:0.0:0.0	.	579	Q695T7	S6A19_HUMAN	T	579	ENSP00000305302:P579T	ENSP00000305302:P579T	P	+	1	0	SLC6A19	1274849	1.000000	0.71417	0.780000	0.31762	0.010000	0.07245	6.480000	0.73604	2.197000	0.70478	0.561000	0.74099	CCG	SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000174358		0.567	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	-	0.00	38	0	C	XM_291120		1221849	+1	tier1	-	no_errors	ENST00000304460	ensembl	human	known	74_37	missense	52.46	29	32	SNP	1.000	A
SLC6A9	6536	genome.wustl.edu	37	1	44476525	44476525	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:44476525C>T	ENST00000360584.2	-	3	470	c.279G>A	c.(277-279)aaG>aaA	p.K93K	SLC6A9_ENST00000372306.3_Silent_p.K20K|SLC6A9_ENST00000372310.3_Silent_p.K20K|SLC6A9_ENST00000372307.3_5'UTR|SLC6A9_ENST00000357730.2_Silent_p.K39K|SLC6A9_ENST00000492434.2_5'UTR|SLC6A9_ENST00000537678.1_Intron|SLC6A9_ENST00000475075.2_Intron	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9	93					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	TCTGGTCCCTCTTGGTGGCCT	0.612																																																	0													187.0	152.0	164.0					1																	44476525		2203	4300	6503	SO:0001819	synonymous_variant	0			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.279G>A	1.37:g.44476525C>T			A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_glycine_GLY1	p.K93	ENST00000360584.2	37	c.279	CCDS41317.1	1																																																																																			SLC6A9	-	prints_Na/ntran_symport_glycine_GLY1	ENSG00000196517		0.612	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	SLC6A9	HGNC	protein_coding	OTTHUMT00000022825.2	-	0.00	62	0	C	NM_201649		44476525	-1	tier1	-	no_errors	ENST00000360584	ensembl	human	known	74_37	silent	8.82	62	6	SNP	1.000	T
SLCO1C1	53919	genome.wustl.edu	37	12	20876174	20876174	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:20876174C>A	ENST00000266509.2	+	9	1540	c.1172C>A	c.(1171-1173)gCc>gAc	p.A391D	SLCO1C1_ENST00000540354.1_Missense_Mutation_p.A342D|SLCO1C1_ENST00000545604.1_Missense_Mutation_p.A391D|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.A273D|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.A391D	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	391					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TCCTCCAGGGCCAACTTTGTG	0.448																																																	0													148.0	128.0	135.0					12																	20876174		2203	4300	6503	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1172C>A	12.37:g.20876174C>A	ENSP00000266509:p.Ala391Asp		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.A391D	ENST00000266509.2	37	c.1172	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.984434	0.74474	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.61158	0.13;0.13;0.13;0.13;0.13	4.54	4.54	0.55810	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.107618	0.64402	D	0.000004	T	0.81716	0.4881	M	0.94021	3.485	0.51482	D	0.999929	D;D;D;D	0.69078	0.997;0.976;0.979;0.976	D;D;D;D	0.69654	0.962;0.965;0.948;0.965	D	0.87072	0.2160	10	0.72032	D	0.01	.	17.8397	0.88712	0.0:1.0:0.0:0.0	.	273;342;391;391	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	D	391;342;391;391;273	ENSP00000444149:A391D;ENSP00000438665:A342D;ENSP00000266509:A391D;ENSP00000370964:A391D;ENSP00000444527:A273D	ENSP00000266509:A391D	A	+	2	0	SLCO1C1	20767441	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	5.459000	0.66685	2.510000	0.84645	0.561000	0.74099	GCC	SLCO1C1	-	pfam_OA_transporter,pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000139155		0.448	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	-	0.00	64	0	C	NM_017435		20876174	+1	tier1	-	no_errors	ENST00000381552	ensembl	human	known	74_37	missense	41.94	36	26	SNP	1.000	A
SMARCAL1	50485	genome.wustl.edu	37	2	217280027	217280027	+	Silent	SNP	G	G	A	rs530505647		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:217280027G>A	ENST00000357276.4	+	3	930	c.600G>A	c.(598-600)tcG>tcA	p.S200S	AC098820.2_ENST00000457694.1_RNA|SMARCAL1_ENST00000358207.5_Silent_p.S200S	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	200					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCTCCCCTTCGGGGCAGAACA	0.522									Schimke Immuno-Osseous Dysplasia				G|||	1	0.000199681	0.0	0.0	5008	,	,		18945	0.001		0.0	False		,,,				2504	0.0																0													71.0	71.0	71.0					2																	217280027		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.600G>A	2.37:g.217280027G>A			A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S200	ENST00000357276.4	37	c.600	CCDS2403.1	2																																																																																			SMARCAL1	-	NULL	ENSG00000138375		0.522	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	HGNC	protein_coding	OTTHUMT00000256671.2	-	0.00	24	0	G			217280027	+1	tier1	-	no_errors	ENST00000357276	ensembl	human	known	74_37	silent	41.18	30	21	SNP	0.000	A
SMG8	55181	genome.wustl.edu	37	17	57289759	57289759	+	Missense_Mutation	SNP	G	G	T	rs369051063		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:57289759G>T	ENST00000543872.2	+	3	2081	c.1817G>T	c.(1816-1818)cGa>cTa	p.R606L	SMG8_ENST00000580498.1_3'UTR|SMG8_ENST00000300917.5_Missense_Mutation_p.R606L|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	606					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						AGCCGAGCTCGATCTACTGGT	0.413																																																	0													103.0	110.0	108.0					17																	57289759		2203	4300	6503	SO:0001583	missense	0			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.1817G>T	17.37:g.57289759G>T	ENSP00000438748:p.Arg606Leu		Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	pfam_Smg8/Smg9	p.R606L	ENST00000543872.2	37	c.1817	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	G	18.20	3.570689	0.65765	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.41065	1.01;1.01	5.77	5.77	0.91146	.	0.105207	0.64402	D	0.000003	T	0.62756	0.2454	L	0.59436	1.845	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.59429	-0.7456	10	0.46703	T	0.11	-11.132	18.9741	0.92728	0.0:0.0:1.0:0.0	.	606	Q8ND04	SMG8_HUMAN	L	606	ENSP00000300917:R606L;ENSP00000438748:R606L	ENSP00000300917:R606L	R	+	2	0	SMG8	54644541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.777000	0.99008	2.729000	0.93468	0.655000	0.94253	CGA	SMG8	-	pfam_Smg8/Smg9	ENSG00000167447		0.413	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	-	0.00	38	0	G	NM_018149		57289759	+1	tier1	-	no_errors	ENST00000300917	ensembl	human	known	74_37	missense	48.21	28	27	SNP	1.000	T
SMYD5	10322	genome.wustl.edu	37	2	73441790	73441790	+	Intron	SNP	C	C	T	rs373447658		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:73441790C>T	ENST00000389501.4	+	1	141				SMYD5_ENST00000474652.1_3'UTR	NM_006062.2	NP_006053.2	Q6GMV2	SMYD5_HUMAN	SMYD family member 5								metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13						GCTGCTGTATCCCTGGAACGG	0.627																																																	0																																										SO:0001627	intron_variant	0			U50383	CCDS33221.2	2p12	2007-02-09	2003-05-14	2003-05-16	ENSG00000135632	ENSG00000135632		"""Zinc fingers, MYND-type"""	16258	protein-coding gene	gene with protein product			"""retinoic acid induced 15"""	RAI15		8754834	Standard	NM_006062		Approved	RRG1, NN8-4AG, ZMYND23	uc002siw.2	Q6GMV2	OTTHUMG00000150482	ENST00000389501.4:c.96+300C>T	2.37:g.73441790C>T			D6W5H3|Q13558	RNA	SNP	-	NULL	ENST00000389501.4	37	NULL	CCDS33221.2	2																																																																																			SMYD5	-	-	ENSG00000135632		0.627	SMYD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD5	HGNC	protein_coding	OTTHUMT00000318301.1	-	0.00	40	0	C	NM_006062		73441790	+1	tier1	-	no_errors	ENST00000474652	ensembl	human	known	74_37	rna	62.96	20	34	SNP	0.000	T
SMYD1	150572	genome.wustl.edu	37	2	88383991	88383991	+	Missense_Mutation	SNP	G	G	T	rs368545680		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:88383991G>T	ENST00000419482.2	+	2	379	c.294G>T	c.(292-294)aaG>aaT	p.K98N	SMYD1_ENST00000468008.1_3'UTR|SMYD1_ENST00000438570.1_Splice_Site_p.K98N|MIR4780_ENST00000584268.1_RNA|SMYD1_ENST00000444564.2_Missense_Mutation_p.K98N	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	98	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GATATGGGAAGGTGCCCAATG	0.522																																																	0													88.0	75.0	79.0					2																	88383991		2203	4300	6503	SO:0001583	missense	0			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.294G>T	2.37:g.88383991G>T	ENSP00000393453:p.Lys98Asn		A0AV30|A6NE13	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.K98N	ENST00000419482.2	37	c.294	CCDS33240.1	2	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773884	0.49786	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000438570	T;T	0.13778	2.56;2.56	5.63	1.75	0.24633	SET domain (2);	0.000000	0.85682	D	0.000000	T	0.19765	0.0475	L	0.42245	1.32	0.47183	D	0.999347	D;P	0.59767	0.986;0.941	P;B	0.54372	0.75;0.386	T	0.00423	-1.1748	10	0.56958	D	0.05	-29.9783	11.187	0.48662	0.277:0.0:0.723:0.0	.	98;98	Q8NB12;C9JUP3	SMYD1_HUMAN;.	N	98	ENSP00000393453:K98N;ENSP00000407888:K98N	ENSP00000393453:K98N	K	+	3	2	SMYD1	88165106	1.000000	0.71417	0.998000	0.56505	0.578000	0.36192	0.764000	0.26532	0.043000	0.15746	-1.347000	0.01240	AAG	SMYD1	-	pfam_SET_dom,smart_SET_dom	ENSG00000115593		0.522	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	HGNC	protein_coding	OTTHUMT00000338229.2	-	0.00	37	0	G	XM_097915		88383991	+1	tier1	-	no_errors	ENST00000419482	ensembl	human	known	74_37	missense	53.49	20	23	SNP	1.000	T
SNHG14	104472715	genome.wustl.edu	37	15	25432588	25432588	+	RNA	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:25432588G>A	ENST00000424208.1	+	0	723				SNORD115-11_ENST00000363616.1_RNA|SNORD115-10_ENST00000365073.1_RNA|SNHG14_ENST00000414175.1_RNA|SNORD115-9_ENST00000362912.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		CTGAAGCTCAGGCCCTTCCTG	0.637																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25432588G>A				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.637	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	42	0	G			25432588	+1	tier1	-	no_errors	ENST00000424208	ensembl	human	known	74_37	rna	40.00	36	24	SNP	0.000	A
SNHG14	104472715	genome.wustl.edu	37	15	25463800	25463800	+	RNA	SNP	A	A	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr15:25463800A>C	ENST00000424208.1	+	0	2994				SNHG14_ENST00000365067.1_RNA|SNHG14_ENST00000453082.2_RNA|SNORD115-27_ENST00000364430.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		TCCTGAAGAGAGGTGATGACT	0.532																																																	0													401.0	411.0	408.0					15																	25463800		876	1989	2865			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25463800A>C				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.532	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	86	0	A			25463800	+1	tier1	-	no_errors	ENST00000365067	ensembl	human	known	74_37	rna	45.00	44	36	SNP	0.406	C
SNX17	9784	genome.wustl.edu	37	2	27599346	27599346	+	Splice_Site	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:27599346G>C	ENST00000233575.2	+	14	1480	c.1258G>C	c.(1258-1260)Gag>Cag	p.E420Q	ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000537606.1_Splice_Site_p.E395Q|SNX17_ENST00000542478.1_Splice_Site_p.E206Q|SNX17_ENST00000543024.1_Splice_Site_p.E206Q	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	420	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTTCCCCAGGAGTCACCTGA	0.547																																																	0													153.0	144.0	147.0					2																	27599346		2203	4300	6503	SO:0001630	splice_region_variant	0			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1258-1G>C	2.37:g.27599346G>C			B4DQM7|Q53HN7|Q6IAS3	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,superfamily_FERM_central,smart_Phox,pfscan_Phox,pfscan_Ras-assoc	p.E420Q	ENST00000233575.2	37	c.1258	CCDS1750.1	2	.	.	.	.	.	.	.	.	.	.	G	14.43	2.534245	0.45073	.	.	ENSG00000115234	ENST00000233575;ENST00000543024;ENST00000537606;ENST00000542478	T;T;T;T	0.33438	1.85;1.41;1.43;1.41	5.36	5.36	0.76844	.	0.088945	0.85682	D	0.000000	T	0.25306	0.0615	L	0.32530	0.975	0.58432	D	0.99999	P;B;P;P	0.43633	0.759;0.005;0.759;0.813	B;B;B;B	0.37943	0.143;0.002;0.143;0.261	T	0.01810	-1.1269	9	.	.	.	-18.607	17.8169	0.88637	0.0:0.0:1.0:0.0	.	395;408;400;420	B4DQM7;B4DTB8;B4DQ37;Q15036	.;.;.;SNX17_HUMAN	Q	420;206;395;206	ENSP00000233575:E420Q;ENSP00000441779:E206Q;ENSP00000439208:E395Q;ENSP00000442567:E206Q	.	E	+	1	0	SNX17	27452850	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.914000	0.92735	2.797000	0.96272	0.561000	0.74099	GAG	SNX17	-	NULL	ENSG00000115234		0.547	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	HGNC	protein_coding	OTTHUMT00000215024.1	-	0.00	49	0	G	NM_014748	Missense_Mutation	27599346	+1	tier1	-	no_errors	ENST00000233575	ensembl	human	known	74_37	missense	57.89	31	44	SNP	1.000	C
SNX20	124460	genome.wustl.edu	37	16	50707505	50707505	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:50707505G>C	ENST00000330943.4	-	4	934	c.763C>G	c.(763-765)Cag>Gag	p.Q255E	RP11-401P9.5_ENST00000570241.2_RNA|SNX20_ENST00000300590.3_Intron|RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000423026.2_Intron	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	255					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						TGCAGGCGCTGCAGGGCCCTC	0.741																																																	0													10.0	11.0	11.0					16																	50707505		2113	4139	6252	SO:0001583	missense	0			AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.763C>G	16.37:g.50707505G>C	ENSP00000332062:p.Gln255Glu		A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.Q255E	ENST00000330943.4	37	c.763	CCDS10745.1	16	.	.	.	.	.	.	.	.	.	.	G	11.19	1.564845	0.27915	.	.	ENSG00000167208	ENST00000330943	T	0.59772	0.24	5.78	3.81	0.43845	.	0.471169	0.23215	N	0.050629	T	0.44787	0.1310	L	0.44542	1.39	0.09310	N	0.999993	B	0.06786	0.001	B	0.04013	0.001	T	0.28267	-1.0049	10	0.27082	T	0.32	-24.5733	7.3127	0.26483	0.1451:0.2885:0.5664:0.0	.	255	Q7Z614	SNX20_HUMAN	E	255	ENSP00000332062:Q255E	ENSP00000332062:Q255E	Q	-	1	0	SNX20	49265006	0.035000	0.19736	0.531000	0.27976	0.941000	0.58515	1.900000	0.39828	0.766000	0.33244	0.561000	0.74099	CAG	SNX20	-	NULL	ENSG00000167208		0.741	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX20	HGNC	protein_coding	OTTHUMT00000256879.2	-	0.00	29	0	G	NM_153337		50707505	-1	tier1	-	no_errors	ENST00000330943	ensembl	human	known	74_37	missense	45.45	18	15	SNP	0.495	C
SOCS5	9655	genome.wustl.edu	37	2	46986133	46986133	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:46986133G>C	ENST00000306503.5	+	2	636	c.464G>C	c.(463-465)cGc>cCc	p.R155P	SOCS5_ENST00000394861.2_Missense_Mutation_p.R155P	NM_014011.4	NP_054730.1	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	155					cell growth (GO:0016049)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|JAK-STAT cascade (GO:0007259)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of signal transduction (GO:0009968)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)		receptor tyrosine kinase binding (GO:0030971)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(9)|ovary(2)	22		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			AGAGAGAGGCGCTACGGCGTA	0.463																																																	0													76.0	72.0	73.0					2																	46986133		2203	4300	6503	SO:0001583	missense	0			AB014571	CCDS1830.1	2p21	2013-02-14			ENSG00000171150	ENSG00000171150		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16852	protein-coding gene	gene with protein product		607094				9734811, 11230166	Standard	NM_014011		Approved	KIAA0671, SOCS-5, CIS6, CISH6, Cish5	uc002rvf.3	O75159	OTTHUMG00000128852	ENST00000306503.5:c.464G>C	2.37:g.46986133G>C	ENSP00000305133:p.Arg155Pro		Q53SD4|Q8IYZ4	Missense_Mutation	SNP	pfam_SOCS,pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.R155P	ENST00000306503.5	37	c.464	CCDS1830.1	2	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784978	0.49997	.	.	ENSG00000171150	ENST00000306503;ENST00000394861	T;T	0.36157	1.27;1.27	5.31	4.43	0.53597	.	0.055265	0.64402	D	0.000001	T	0.49270	0.1547	L	0.32530	0.975	0.58432	D	0.999999	D	0.76494	0.999	D	0.85130	0.997	T	0.49523	-0.8931	10	0.46703	T	0.11	-18.2638	15.8562	0.78979	0.0:0.1359:0.8641:0.0	.	155	O75159	SOCS5_HUMAN	P	155	ENSP00000305133:R155P;ENSP00000378330:R155P	ENSP00000305133:R155P	R	+	2	0	SOCS5	46839637	1.000000	0.71417	0.885000	0.34714	0.580000	0.36256	9.369000	0.97156	1.469000	0.48083	0.655000	0.94253	CGC	SOCS5	-	pfam_SOCS	ENSG00000171150		0.463	SOCS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS5	HGNC	protein_coding	OTTHUMT00000250791.2	-	0.00	39	0	G			46986133	+1	tier1	-	no_errors	ENST00000306503	ensembl	human	known	74_37	missense	36.36	35	20	SNP	0.999	C
SOX30	11063	genome.wustl.edu	37	5	157075856	157075856	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:157075856C>T	ENST00000265007.6	-	2	1357	c.1016G>A	c.(1015-1017)cGa>cAa	p.R339Q	SOX30_ENST00000519442.1_Missense_Mutation_p.R34Q|SOX30_ENST00000311371.5_Missense_Mutation_p.R339Q	NM_178424.1	NP_848511.1	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30	339					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to corticosteroid (GO:0031960)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	23	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTTCATGGGTCGCTTCACATG	0.458																																					Esophageal Squamous(31;525 799 19355 21125 41744)												0													168.0	148.0	155.0					5																	157075856		2203	4300	6503	SO:0001583	missense	0			AB022083	CCDS4339.1, CCDS4340.1	5q33	2010-10-21			ENSG00000039600	ENSG00000039600		"""SRY (sex determining region Y)-boxes"""	30635	protein-coding gene	gene with protein product		606698				15019997, 11678506	Standard	NM_178424		Approved		uc003lxb.1	O94993	OTTHUMG00000130247	ENST00000265007.6:c.1016G>A	5.37:g.157075856C>T	ENSP00000265007:p.Arg339Gln		O94995|Q8IYX6	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R339Q	ENST00000265007.6	37	c.1016	CCDS4339.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.194808	0.94960	.	.	ENSG00000039600	ENST00000311371;ENST00000265007;ENST00000519442	D;D;D	0.99298	-5.71;-5.71;-5.71	5.72	5.72	0.89469	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.64402	D	0.000015	D	0.99548	0.9838	M	0.90309	3.105	0.48395	D	0.999649	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	D	0.98479	1.0604	10	0.87932	D	0	.	19.8724	0.96855	0.0:1.0:0.0:0.0	.	34;339;339	B4DXW7;O94993-2;O94993	.;.;SOX30_HUMAN	Q	339;339;34	ENSP00000309343:R339Q;ENSP00000265007:R339Q;ENSP00000427984:R34Q	ENSP00000265007:R339Q	R	-	2	0	SOX30	157008434	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.448000	0.73469	2.694000	0.91930	0.555000	0.69702	CGA	SOX30	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000039600		0.458	SOX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SOX30	HGNC	protein_coding	OTTHUMT00000252571.2	-	0.00	67	0	C	NM_007017		157075856	-1	tier1	-	no_errors	ENST00000265007	ensembl	human	known	74_37	missense	53.23	29	33	SNP	1.000	T
SP140L	93349	genome.wustl.edu	37	2	231249995	231249995	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:231249995C>G	ENST00000415673.2	+	9	846	c.760C>G	c.(760-762)Ctg>Gtg	p.L254V	SP140L_ENST00000396563.4_Missense_Mutation_p.L254V|SP140L_ENST00000243810.6_Missense_Mutation_p.L254V|SP140L_ENST00000444636.1_Missense_Mutation_p.L254V	NM_138402.4	NP_612411.4	Q9H930	SP14L_HUMAN	SP140 nuclear body protein-like	254						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|skin(1)	20						GAACATGAATCTGAAAGACCT	0.448																																																	0													107.0	107.0	107.0					2																	231249995		1873	4108	5981	SO:0001583	missense	0			BC004921	CCDS46538.1	2q37.1	2013-01-28			ENSG00000185404	ENSG00000185404		"""Zinc fingers, PHD-type"""	25105	protein-coding gene	gene with protein product						12477932	Standard	NM_138402		Approved		uc010fxm.1	Q9H930	OTTHUMG00000153730	ENST00000415673.2:c.760C>G	2.37:g.231249995C>G	ENSP00000397911:p.Leu254Val		Q2M375|Q4ZG65|Q9BSP3	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.L254V	ENST00000415673.2	37	c.760	CCDS46538.1	2	.	.	.	.	.	.	.	.	.	.	C	4.475	0.088019	0.08583	.	.	ENSG00000185404	ENST00000444636;ENST00000415673;ENST00000243810;ENST00000396563	D;T;D;D	0.83837	-1.5;-1.11;-1.5;-1.77	2.24	1.32	0.21799	.	.	.	.	.	D	0.85936	0.5813	L	0.61218	1.895	0.09310	N	1	D;D	0.76494	0.999;0.988	D;P	0.73708	0.981;0.835	T	0.72962	-0.4132	9	0.21540	T	0.41	.	6.0085	0.19559	0.3071:0.6929:0.0:0.0	.	254;254	Q9H930-2;Q9H930-4	.;.	V	254	ENSP00000395195:L254V;ENSP00000397911:L254V;ENSP00000243810:L254V;ENSP00000379811:L254V	ENSP00000243810:L254V	L	+	1	2	SP140L	230958239	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.848000	0.27710	0.477000	0.27464	-0.282000	0.10007	CTG	SP140L	-	NULL	ENSG00000185404		0.448	SP140L-009	KNOWN	basic|appris_principal|CCDS	protein_coding	SP140L	HGNC	protein_coding	OTTHUMT00000374538.1	-	0.00	25	0	C	NM_138402		231249995	+1	tier1	-	no_errors	ENST00000415673	ensembl	human	known	74_37	missense	50.00	28	28	SNP	0.001	G
SPAG17	200162	genome.wustl.edu	37	1	118584486	118584486	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:118584486G>T	ENST00000336338.5	-	21	3059	c.2994C>A	c.(2992-2994)gtC>gtA	p.V998V		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	998						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTTGGATCTTGACTTGTTCTT	0.393																																																	0													341.0	342.0	342.0					1																	118584486		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2994C>A	1.37:g.118584486G>T			Q8NAZ1|Q9NT21	Silent	SNP	NULL	p.V998	ENST00000336338.5	37	c.2994	CCDS899.1	1																																																																																			SPAG17	-	NULL	ENSG00000155761		0.393	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	-	0.00	88	0	G	NM_206996		118584486	-1	tier1	-	no_errors	ENST00000336338	ensembl	human	known	74_37	silent	44.23	58	46	SNP	0.000	T
SPECC1L	23384	genome.wustl.edu	37	22	24718230	24718230	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:24718230A>G	ENST00000314328.9	+	5	1567	c.1282A>G	c.(1282-1284)Acc>Gcc	p.T428A	SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.T428A|SPECC1L_ENST00000437398.1_Missense_Mutation_p.T428A|SPECC1L_ENST00000416735.1_Intron|SPECC1L_ENST00000541492.1_Missense_Mutation_p.T428A	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	428					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						ACAGCAGATTACCCAGGAACT	0.453																																																	0													88.0	95.0	93.0					22																	24718230		2203	4300	6503	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.1282A>G	22.37:g.24718230A>G	ENSP00000325785:p.Thr428Ala		B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_bHLH_dom,smart_CH-domain,pfscan_CH-domain	p.T428A	ENST00000314328.9	37	c.1282	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	A	15.04	2.715753	0.48622	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492	T;T;T;T	0.03358	3.96;3.96;3.96;3.96	4.97	3.87	0.44632	.	0.044296	0.85682	D	0.000000	T	0.08935	0.0221	L	0.51422	1.61	0.54753	D	0.999987	D;B	0.61080	0.989;0.128	P;B	0.56434	0.798;0.039	T	0.10245	-1.0638	10	0.42905	T	0.14	-27.3552	10.813	0.46557	0.8589:0.0:0.0:0.1411	.	428;428	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	A	456;428;428;428;428	ENSP00000393363:T428A;ENSP00000405671:T428A;ENSP00000325785:T428A;ENSP00000439633:T428A	ENSP00000325785:T428A	T	+	1	0	SPECC1L	23048230	1.000000	0.71417	0.995000	0.50966	0.637000	0.38172	4.289000	0.59013	2.007000	0.58848	0.402000	0.26972	ACC	SPECC1L	-	NULL	ENSG00000100014		0.453	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	-	0.00	26	0	A	NM_015330		24718230	+1	tier1	-	no_errors	ENST00000314328	ensembl	human	known	74_37	missense	58.82	14	20	SNP	1.000	G
SPI1	6688	genome.wustl.edu	37	11	47380277	47380278	+	Intron	DEL	CA	CA	-	rs3832728	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:47380277_47380278delCA	ENST00000378538.3	-	4	716				SPI1_ENST00000227163.4_Intron|SPI1_ENST00000533968.1_Frame_Shift_Del_p.C204fs|SPI1_ENST00000533030.1_Intron	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene						anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		ggcaaacatgcacacacacaca	0.614																																																	0																																										SO:0001627	intron_variant	0			X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.493+116TG>-	11.37:g.47380287_47380288delCA				Frame_Shift_Del	DEL	NULL	p.C204fs	ENST00000378538.3	37	c.611_610	CCDS7933.2	11																																																																																			SPI1	-	NULL	ENSG00000066336		0.614	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPI1	HGNC	protein_coding	OTTHUMT00000316571.1		0.00	25	0	CA	NM_003120		47380278	-1	tier1		no_errors	ENST00000533968	ensembl	human	putative	74_37	frame_shift_del	9.09	20	2	DEL	0.001:0.001	-
SPTBN4	57731	genome.wustl.edu	37	19	41025381	41025381	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:41025381G>T	ENST00000352632.3	+	16	3063	c.2977G>T	c.(2977-2979)Gtg>Ttg	p.V993L	SPTBN4_ENST00000595535.1_Missense_Mutation_p.V993L|SPTBN4_ENST00000344104.3_Missense_Mutation_p.V993L|SPTBN4_ENST00000598249.1_Missense_Mutation_p.V993L|SPTBN4_ENST00000338932.3_Missense_Mutation_p.V993L			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	993					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGAGAACCACGTGCTGGAGGT	0.667																																																	0													26.0	32.0	30.0					19																	41025381		2202	4298	6500	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.2977G>T	19.37:g.41025381G>T	ENSP00000263373:p.Val993Leu		E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.V993L	ENST00000352632.3	37	c.2977	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	10.44	1.349599	0.24426	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	T;T;T	0.75704	-0.91;-0.96;-0.95	4.49	3.39	0.38822	.	0.130623	0.32593	U	0.005897	T	0.38585	0.1046	N	0.01048	-1.04	0.80722	D	1	B;B	0.10296	0.003;0.002	B;B	0.10450	0.004;0.005	T	0.38650	-0.9651	10	0.11485	T	0.65	.	7.0681	0.25164	0.0:0.2636:0.5762:0.1602	.	993;993	Q9H254;Q71S06	SPTN4_HUMAN;.	L	993	ENSP00000263373:V993L;ENSP00000340345:V993L;ENSP00000340741:V993L	ENSP00000340345:V993L	V	+	1	0	SPTBN4	45717221	0.952000	0.32445	0.997000	0.53966	0.985000	0.73830	2.496000	0.45346	2.337000	0.79520	0.462000	0.41574	GTG	SPTBN4	-	pirsf_Spectrin_bsu,smart_Spectrin/alpha-actinin	ENSG00000160460		0.667	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	-	0.00	62	0	G			41025381	+1	tier1	-	no_errors	ENST00000352632	ensembl	human	known	74_37	missense	54.90	23	28	SNP	0.999	T
STON1-GTF2A1L	286749	genome.wustl.edu	37	2	49003595	49003595	+	3'UTR	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:49003595G>T	ENST00000463040.1	+	0	345				STON1-GTF2A1L_ENST00000402114.2_3'UTR					STON1-GTF2A1L readthrough											NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(22)|liver(2)|lung(49)|ovary(3)|pancreas(1)|prostate(4)|skin(4)	91		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			ctaggagcatgtgaactcaaa	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF026169	CCDS1840.1, CCDS56118.1, CCDS56119.1	2p16.3	2009-09-17			ENSG00000068781	ENSG00000068781			30651	other	readthrough	"""stoned B/TFIIA alpha/beta like factor"""					10364255, 11159353	Standard	NM_172311		Approved	SALF	uc010yol.2		OTTHUMG00000152037	ENST00000463040.1:c.*342G>T	2.37:g.49003595G>T				RNA	SNP	-	NULL	ENST00000463040.1	37	NULL		2																																																																																			STON1-GTF2A1L	-	-	ENSG00000068781		0.388	STON1-GTF2A1L-005	PUTATIVE	basic|exp_conf	processed_transcript	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000325207.1	-	0.00	10	0	G			49003595	+1	tier1	-	no_errors	ENST00000463040	ensembl	human	putative	74_37	rna	57.69	11	15	SNP	0.001	T
SYCN	342898	genome.wustl.edu	37	19	39694850	39694850	+	Silent	SNP	G	G	A	rs374627027	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:39694850G>A	ENST00000318438.6	-	1	56	c.45C>T	c.(43-45)tcC>tcT	p.S15S		NM_001080468.2	NP_001073937.1	Q0VAF6	SYCN_HUMAN	syncollin	15					exocytosis (GO:0006887)	secretory granule membrane (GO:0030667)				endometrium(1)|kidney(1)	2	all_cancers(60;7.32e-07)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|all_epithelial(25;8.97e-07)|Ovarian(47;0.0454)		Epithelial(26;1.34e-25)|all cancers(26;9.31e-23)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CGCAAGGCACGGAGGCAAGGG	0.716																																																	0													10.0	10.0	10.0					19																	39694850		1861	3941	5802	SO:0001819	synonymous_variant	0			BC039541	CCDS46070.1	19q13.2	2008-02-05	2005-05-26			ENSG00000179751			18442	protein-coding gene	gene with protein product			"""insulin synthesis associated 1"""	INSSA1		11839820	Standard	NM_001080468		Approved	SYL, FLJ27441	uc002okr.2	Q0VAF6		ENST00000318438.6:c.45C>T	19.37:g.39694850G>A				Silent	SNP	NULL	p.S15	ENST00000318438.6	37	c.45	CCDS46070.1	19																																																																																			SYCN	-	NULL	ENSG00000179751		0.716	SYCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCN	HGNC	protein_coding	OTTHUMT00000463830.1	-	0.00	15	0	G			39694850	-1	tier1	-	no_errors	ENST00000318438	ensembl	human	known	74_37	silent	40.00	12	8	SNP	0.003	A
SUV420H2	84787	genome.wustl.edu	37	19	55858816	55858816	+	Nonstop_Mutation	SNP	G	G	T	rs557988704	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:55858816G>T	ENST00000255613.3	+	9	1636	c.1388G>T	c.(1387-1389)tGa>tTa	p.*463L		NM_032701.3	NP_116090.2	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2 (Drosophila)	0					histone H4-K20 trimethylation (GO:0034773)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	4	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		GAAGAGCTGTGACAGGCCGGA	0.667																																																	0													9.0	9.0	9.0					19																	55858816		1968	3866	5834	SO:0001578	stop_lost	0			BC005842	CCDS12922.1	19q13.42	2011-07-01			ENSG00000133247	ENSG00000133247		"""Chromatin-modifying enzymes / K-methyltransferases"""	28405	protein-coding gene	gene with protein product		613198				12477932	Standard	NM_032701		Approved	MGC2705, KMT5C	uc002qkj.4	Q86Y97	OTTHUMG00000150483	ENST00000255613.3:c.1388G>T	19.37:g.55858816G>T	ENSP00000255613:p.*463Leuext*33		Q8WZ10|Q9BRZ6	Nonstop_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.*463L	ENST00000255613.3	37	c.1388	CCDS12922.1	19	.	.	.	.	.	.	.	.	.	.	g	0.586	-0.835040	0.02713	.	.	ENSG00000133247	ENST00000255613	.	.	.	3.14	3.14	0.36123	.	.	.	.	.	.	.	.	.	.	.	0.21915	N	0.999477	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3118	0.21169	0.1344:0.0:0.8656:0.0	.	.	.	.	L	463	.	.	X	+	2	2	SUV420H2	60550628	0.773000	0.28580	0.075000	0.20258	0.033000	0.12548	2.405000	0.44548	2.066000	0.61787	0.563000	0.77884	TGA	SUV420H2	-	NULL	ENSG00000133247		0.667	SUV420H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H2	HGNC	protein_coding	OTTHUMT00000318309.2	-	0.00	17	0	G	NM_032701		55858816	+1	tier1	-	no_errors	ENST00000255613	ensembl	human	known	74_37	nonstop	66.67	4	8	SNP	0.019	T
SYNE2	23224	genome.wustl.edu	37	14	64421498	64421498	+	Missense_Mutation	SNP	G	G	A	rs370175849		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr14:64421498G>A	ENST00000344113.4	+	8	864	c.652G>A	c.(652-654)Gcc>Acc	p.A218T	SYNE2_ENST00000554584.1_Missense_Mutation_p.A218T|SYNE2_ENST00000341472.5_Missense_Mutation_p.A218T|SYNE2_ENST00000358025.3_Missense_Mutation_p.A218T|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000356081.3_Missense_Mutation_p.A218T	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	218	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GGCTTTTTTGGCCATCATTCA	0.388																																																	0								G	THR/ALA,THR/ALA	1,3765		0,1,1882	160.0	139.0	145.0		652,652	3.8	0.8	14		145	0,8258		0,0,4129	no	missense,missense	SYNE2	NM_015180.4,NM_182914.2	58,58	0,1,6011	AA,AG,GG		0.0,0.0266,0.0083	probably-damaging,probably-damaging	218/6886,218/6908	64421498	1,12023	1883	4129	6012	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.652G>A	14.37:g.64421498G>A	ENSP00000341781:p.Ala218Thr		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A218T	ENST00000344113.4	37	c.652	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	11.52	1.663350	0.29515	2.66E-4	0.0	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000341472;ENST00000356081;ENST00000554584;ENST00000261678	D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84	4.73	3.82	0.43975	Calponin homology domain (5);	0.127728	0.34411	N	0.003995	D	0.98235	0.9416	H	0.94385	3.53	0.80722	D	1	D;P;D	0.89917	0.962;0.952;1.0	P;P;D	0.87578	0.784;0.678;0.998	D	0.99110	1.0846	10	0.72032	D	0.01	.	14.4834	0.67599	0.0:0.0:0.8517:0.1483	.	218;218;218	Q8WXH0;Q8WXH0-2;Q8WXH0-8	SYNE2_HUMAN;.;.	T	218	ENSP00000350719:A218T;ENSP00000341781:A218T;ENSP00000344528:A218T;ENSP00000348382:A218T;ENSP00000452570:A218T	ENSP00000261678:A218T	A	+	1	0	SYNE2	63491251	1.000000	0.71417	0.818000	0.32626	0.001000	0.01503	4.459000	0.60102	1.095000	0.41419	-0.188000	0.12872	GCC	SYNE2	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000054654		0.388	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	18	0	G	NM_182914		64421498	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	63.16	7	12	SNP	1.000	A
SYT3	84258	genome.wustl.edu	37	19	51133168	51133168	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:51133168C>G	ENST00000338916.4	-	3	1568	c.935G>C	c.(934-936)gGc>gCc	p.G312A	SYT3_ENST00000544769.1_Missense_Mutation_p.G312A|SYT3_ENST00000600079.1_Missense_Mutation_p.G312A|SYT3_ENST00000593901.1_Missense_Mutation_p.G312A	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	312	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CTGGTCCGAGCCATAGAGGTA	0.672																																																	0													84.0	81.0	82.0					19																	51133168		2203	4300	6503	SO:0001583	missense	0			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.935G>C	19.37:g.51133168C>G	ENSP00000340914:p.Gly312Ala		Q8N5Z1|Q8N640	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.G312A	ENST00000338916.4	37	c.935	CCDS12798.1	19	.	.	.	.	.	.	.	.	.	.	C	14.09	2.433109	0.43224	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	T;T	0.07444	3.19;3.19	4.67	4.67	0.58626	C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.169680	0.39146	U	0.001444	T	0.04998	0.0134	N	0.11651	0.15	0.40981	D	0.984777	B	0.16802	0.019	B	0.10450	0.005	T	0.37820	-0.9689	10	0.42905	T	0.14	.	10.4299	0.44400	0.0:0.9068:0.0:0.0932	.	312	Q9BQG1	SYT3_HUMAN	A	312	ENSP00000340914:G312A;ENSP00000438883:G312A	ENSP00000340914:G312A	G	-	2	0	SYT3	55824980	0.957000	0.32711	0.997000	0.53966	0.803000	0.45373	0.269000	0.18589	2.301000	0.77427	0.655000	0.94253	GGC	SYT3	-	superfamily_C2_dom,prints_Synaptotagmin	ENSG00000213023		0.672	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	-	0.00	69	0	C	NM_032298		51133168	-1	tier1	-	no_errors	ENST00000338916	ensembl	human	known	74_37	missense	42.86	36	27	SNP	1.000	G
TANGO6	79613	genome.wustl.edu	37	16	69007950	69007950	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:69007950C>T	ENST00000261778.1	+	15	2733	c.2721C>T	c.(2719-2721)gaC>gaT	p.D907D		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	907						integral component of membrane (GO:0016021)											TGCTGTCAGACGTCTATCCTG	0.458																																																	0													73.0	71.0	72.0					16																	69007950		1921	4130	6051	SO:0001819	synonymous_variant	0				CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.2721C>T	16.37:g.69007950C>T			Q569F9|Q9H9K1	Silent	SNP	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.D907	ENST00000261778.1	37	c.2721	CCDS45516.1	16																																																																																			TANGO6	-	superfamily_ARM-type_fold	ENSG00000103047		0.458	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	HGNC	protein_coding	OTTHUMT00000433471.2	-	0.00	38	0	C	XM_928235.2		69007950	+1	tier1	-	no_errors	ENST00000261778	ensembl	human	known	74_37	silent	40.00	42	28	SNP	0.566	T
TASP1	55617	genome.wustl.edu	37	20	13539707	13539707	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr20:13539707C>A	ENST00000337743.4	-	8	743	c.623G>T	c.(622-624)aGg>aTg	p.R208M	TASP1_ENST00000539805.1_Intron|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	208					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						TGTGTCCACCCTTTCTGCCAG	0.289																																																	0													172.0	169.0	170.0					20																	13539707		2203	4300	6503	SO:0001583	missense	0			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.623G>T	20.37:g.13539707C>A	ENSP00000338624:p.Arg208Met		B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	pfam_Peptidase_T2	p.R208M	ENST00000337743.4	37	c.623	CCDS13116.1	20	.	.	.	.	.	.	.	.	.	.	C	13.44	2.238547	0.39598	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	D;D	0.89196	-2.48;-2.48	5.64	4.7	0.59300	.	0.186388	0.56097	D	0.000029	D	0.83751	0.5322	L	0.52126	1.63	0.80722	D	1	B;B	0.32203	0.36;0.235	B;B	0.29176	0.077;0.099	T	0.81479	-0.0914	10	0.48119	T	0.1	-10.8003	8.5722	0.33576	0.0:0.8267:0.0:0.1733	.	208;185	Q9H6P5;Q5JWM4	TASP1_HUMAN;.	M	185;208;185	ENSP00000338624:R208M;ENSP00000400580:R185M	ENSP00000338624:R208M	R	-	2	0	TASP1	13487707	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.929000	0.48916	1.379000	0.46325	0.591000	0.81541	AGG	TASP1	-	pfam_Peptidase_T2	ENSG00000089123		0.289	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TASP1	HGNC	protein_coding	OTTHUMT00000078041.2	-	0.00	38	0	C	NM_017714		13539707	-1	tier1	-	no_errors	ENST00000337743	ensembl	human	known	74_37	missense	86.21	4	25	SNP	1.000	A
TASP1	55617	genome.wustl.edu	37	20	13539717	13539717	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr20:13539717G>C	ENST00000337743.4	-	8	733	c.613C>G	c.(613-615)Ctg>Gtg	p.L205V	TASP1_ENST00000539805.1_Intron|TASP1_ENST00000480436.1_5'UTR	NM_017714.2	NP_060184.2	Q9H6P5	TASP1_HUMAN	taspase, threonine aspartase, 1	205					positive regulation of transcription, DNA-templated (GO:0045893)		threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|large_intestine(11)|liver(1)|lung(11)|stomach(2)|urinary_tract(2)	31						CTTTCTGCCAGCTCTAGTTTC	0.299																																																	0													169.0	165.0	167.0					20																	13539717		2203	4300	6503	SO:0001583	missense	0			AK000219	CCDS13116.1	20p12	2005-10-15	2005-10-15	2005-10-15	ENSG00000089123	ENSG00000089123	3.4.25.-		15859	protein-coding gene	gene with protein product		608270	"""chromosome 20 open reading frame 13"""	C20orf13		14636557	Standard	XR_430268		Approved	FLJ20212, dJ585I14.2	uc002woi.3	Q9H6P5	OTTHUMG00000031904	ENST00000337743.4:c.613C>G	20.37:g.13539717G>C	ENSP00000338624:p.Leu205Val		B7Z690|B7Z963|Q5TDU9|Q9BQN0|Q9NQ08|Q9NTS6|Q9NXJ2	Missense_Mutation	SNP	pfam_Peptidase_T2	p.L205V	ENST00000337743.4	37	c.613	CCDS13116.1	20	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141309	0.57044	.	.	ENSG00000089123	ENST00000378157;ENST00000337743;ENST00000455532	D;D	0.92647	-3.08;-2.86	5.64	4.67	0.58626	.	0.069884	0.64402	D	0.000014	D	0.88522	0.6459	L	0.40543	1.245	0.80722	D	1	P;B	0.37423	0.594;0.168	B;B	0.39876	0.312;0.179	D	0.85652	0.1283	10	0.25106	T	0.35	-2.1754	13.4684	0.61268	0.0:0.0:0.8421:0.1579	.	205;182	Q9H6P5;Q5JWM4	TASP1_HUMAN;.	V	182;205;182	ENSP00000338624:L205V;ENSP00000400580:L182V	ENSP00000338624:L205V	L	-	1	2	TASP1	13487717	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.748000	0.47483	1.335000	0.45486	0.591000	0.81541	CTG	TASP1	-	pfam_Peptidase_T2	ENSG00000089123		0.299	TASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TASP1	HGNC	protein_coding	OTTHUMT00000078041.2	-	0.00	39	0	G	NM_017714		13539717	-1	tier1	-	no_errors	ENST00000337743	ensembl	human	known	74_37	missense	82.76	5	24	SNP	1.000	C
TBC1D26	353149	genome.wustl.edu	37	17	15641610	15641610	+	Missense_Mutation	SNP	A	A	G	rs202131240		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:15641610A>G	ENST00000437605.2	+	7	546	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	TBC1D26_ENST00000579428.1_Missense_Mutation_p.Y99C|AC005324.6_ENST00000434017.1_RNA|AC005324.6_ENST00000580194.1_RNA|ZNF286A_ENST00000413242.2_3'UTR|AC005324.6_ENST00000433873.1_RNA	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	99							Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CAAAGAGTATACAAAGTCATT	0.527																																																	0													94.0	90.0	91.0					17																	15641610		1953	4139	6092	SO:0001583	missense	0				CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.296A>G	17.37:g.15641610A>G	ENSP00000410111:p.Tyr99Cys		A8K929|Q4G172	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Y99C	ENST00000437605.2	37	c.296	CCDS42265.1	17	.	.	.	.	.	.	.	.	.	.	a	6.884	0.532498	0.13127	.	.	ENSG00000214946	ENST00000437605	T	0.40756	1.02	1.44	-0.0271	0.13927	Rab-GAP/TBC domain (2);	0.436109	0.22940	U	0.053784	T	0.48943	0.1528	L	0.58583	1.82	0.19945	N	0.999948	D;D	0.76494	0.999;0.981	D;D	0.67231	0.95;0.914	T	0.36601	-0.9741	10	0.52906	T	0.07	.	3.1782	0.06576	0.6204:0.0:0.0:0.3796	.	99;99	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	C	99	ENSP00000410111:Y99C	ENSP00000410111:Y99C	Y	+	2	0	TBC1D26	15582335	0.952000	0.32445	0.008000	0.14137	0.029000	0.11900	1.676000	0.37565	-0.258000	0.09446	0.338000	0.21704	TAC	TBC1D26	-	superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000214946		0.527	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D26	HGNC	protein_coding			0.00	65	0	A	NM_178571		15641610	+1			no_errors	ENST00000437605	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.413	G
TBC1D16	125058	genome.wustl.edu	37	17	77916004	77916004	+	Splice_Site	SNP	G	G	T	rs368445644		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:77916004G>T	ENST00000310924.2	-	11	2025	c.1910C>A	c.(1909-1911)aCg>aAg	p.T637K	TBC1D16_ENST00000576768.1_Splice_Site_p.T262K|TBC1D16_ENST00000340848.7_Splice_Site_p.T275K	NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	637							Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GAAGTAGTCCGTCTGTGGAGG	0.627																																					Ovarian(14;397 562 4850 31922 49378)												0													51.0	35.0	40.0					17																	77916004		2197	4299	6496	SO:0001630	splice_region_variant	0			AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.1909-1C>A	17.37:g.77916004G>T			B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.T637K	ENST00000310924.2	37	c.1910	CCDS11766.1	17	.	.	.	.	.	.	.	.	.	.	G	19.09	3.760112	0.69763	.	.	ENSG00000167291	ENST00000340848;ENST00000310924	T;T	0.21543	2.0;2.0	4.7	4.7	0.59300	Rab-GAP/TBC domain (3);	0.166361	0.52532	D	0.000066	T	0.50463	0.1617	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.58451	-0.7634	10	0.72032	D	0.01	-23.0241	17.6225	0.88086	0.0:0.0:1.0:0.0	.	637;637;275	Q8TBP0;B9A6L7;Q8N3Z4	TBC16_HUMAN;.;.	K	275;637	ENSP00000341517:T275K;ENSP00000309794:T637K	ENSP00000309794:T637K	T	-	2	0	TBC1D16	75530599	1.000000	0.71417	0.985000	0.45067	0.249000	0.25844	9.088000	0.94132	2.141000	0.66446	0.484000	0.47621	ACG	TBC1D16	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000167291		0.627	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D16	HGNC	protein_coding	OTTHUMT00000437145.1	-	0.00	12	0	G	NM_019020	Missense_Mutation	77916004	-1	tier1	-	no_errors	ENST00000310924	ensembl	human	known	74_37	missense	75.00	13	39	SNP	1.000	T
TBX22	50945	genome.wustl.edu	37	X	79282340	79282340	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:79282340C>A	ENST00000373294.5	+	5	799	c.771C>A	c.(769-771)acC>acA	p.T257T	TBX22_ENST00000373296.3_Silent_p.T257T|TBX22_ENST00000373291.1_Silent_p.T137T|TBX22_ENST00000442340.1_Silent_p.T137T	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	257					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTGAGTTCACCACAGTAACGG	0.473																																																	0													98.0	75.0	83.0					X																	79282340		2203	4300	6503	SO:0001819	synonymous_variant	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.771C>A	X.37:g.79282340C>A			Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.T257	ENST00000373294.5	37	c.771	CCDS14445.1	X																																																																																			TBX22	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	ENSG00000122145		0.473	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	-	0.00	26	0	C	NM_016954		79282340	+1	tier1	-	no_errors	ENST00000373294	ensembl	human	known	74_37	silent	94.44	1	17	SNP	1.000	A
TENM4	26011	genome.wustl.edu	37	11	78383285	78383286	+	Missense_Mutation	DNP	CC	CC	AA	rs368379990		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:78383285_78383286CC>AA	ENST00000278550.7	-	31	6047_6048	c.5585_5586GG>TT	c.(5584-5586)cGG>cTT	p.R1862L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1862					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CGTACAGAATCCGAAGGGTGAA	0.554																																																	0																																										SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5585_5586delinsAA	11.37:g.78383285_78383286delinsAA	ENSP00000278550:p.Arg1862Leu		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent|Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R1862|p.R1862L	ENST00000278550.7	37	c.5586|c.5585	CCDS44688.1	11																																																																																			TENM4	-	NULL	ENSG00000149256		0.554	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	38	0	C			78383285|78383286	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	silent|missense	24.60|23.85	94|99	31	SNP	0.996|0.999	A
TFAM	7019	genome.wustl.edu	37	10	60148569	60148570	+	Frame_Shift_Ins	INS	-	-	A	rs544132101|rs140210748|rs78912196		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:60148569_60148570insA	ENST00000487519.1	+	4	957_958	c.431_432insA	c.(430-435)acaaaafs	p.TK144fs	TFAM_ENST00000373895.3_Frame_Shift_Ins_p.TK144fs|TFAM_ENST00000373899.3_3'UTR	NM_001270782.1|NM_003201.2	NP_001257711.1|NP_003192.1	Q00059	TFAM_HUMAN	transcription factor A, mitochondrial	144					DNA-dependent DNA replication (GO:0006261)|gene expression (GO:0010467)|mitochondrial respiratory chain complex assembly (GO:0033108)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|mitochondrial light strand promoter sense binding (GO:0070363)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						AAAGCTATGACAAAAAAAAAAG	0.267																																																	0																																										SO:0001589	frameshift_variant	0			BC018628	CCDS7253.1, CCDS59217.1	10q21	2010-09-24			ENSG00000108064	ENSG00000108064			11741	protein-coding gene	gene with protein product		600438		TCF6, TCF6L2		7789991	Standard	NM_003201		Approved		uc001jkf.4	Q00059	OTTHUMG00000018270	ENST00000487519.1:c.441dupA	10.37:g.60148579_60148579dupA	ENSP00000420588:p.Thr144fs		A8MRB2|A9QXC6|B5BU05|Q5U0C6	Frame_Shift_Ins	INS	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E148fs	ENST00000487519.1	37	c.431_432	CCDS7253.1	10																																																																																			TFAM	-	superfamily_HMG_box_dom	ENSG00000108064		0.267	TFAM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAM	HGNC	protein_coding	OTTHUMT00000048146.1		0.00	31	0	-	NM_003201		60148570	+1	tier1		no_errors	ENST00000487519	ensembl	human	known	74_37	frame_shift_ins	11.54	23	3	INS	0.006:0.006	A
TFF3	7033	genome.wustl.edu	37	21	43735501	43735501	+	Missense_Mutation	SNP	G	G	C	rs561102941		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr21:43735501G>C	ENST00000518498.1	-	1	260	c.26C>G	c.(25-27)cCg>cGg	p.P9R	TFF3_ENST00000489676.1_5'Flank|TFF3_ENST00000291525.10_Missense_Mutation_p.P45R			Q07654	TFF3_HUMAN	trefoil factor 3 (intestinal)	0					defense response (GO:0006952)|digestion (GO:0007586)|response to peptide hormone (GO:0043434)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				cervix(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						CGTGGGCTCCGGGACGCAGCT	0.612																																																	0													147.0	123.0	131.0					21																	43735501		2203	4300	6503	SO:0001583	missense	0			AF432265	CCDS33565.1, CCDS33565.2	21q22.3	2006-05-16			ENSG00000160180	ENSG00000160180			11757	protein-coding gene	gene with protein product		600633				7718582, 9043862	Standard	NM_003226		Approved	HITF, ITF	uc002zav.3	Q07654	OTTHUMG00000086798	ENST00000518498.1:c.26C>G	21.37:g.43735501G>C	ENSP00000430690:p.Pro9Arg		E9PBB5|Q96NX0|Q9UDA5	Missense_Mutation	SNP	pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,prints_P_trefoil_chordata	p.P45R	ENST00000518498.1	37	c.134	CCDS33565.2	21	.	.	.	.	.	.	.	.	.	.	g	9.934	1.215522	0.22373	.	.	ENSG00000160180	ENST00000518498;ENST00000291525	T;T	0.54675	0.79;0.56	3.86	-3.32	0.04973	.	3.117360	0.01627	U	0.023332	T	0.29652	0.0740	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.04551	-1.0943	6	.	.	.	.	0.7931	0.01061	0.2778:0.3354:0.2171:0.1698	.	.	.	.	R	9;45	ENSP00000430690:P9R;ENSP00000291525:P45R	.	P	-	2	0	TFF3	42608570	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.720000	0.25896	-0.355000	0.08199	-0.119000	0.15052	CCG	TFF3	-	NULL	ENSG00000160180		0.612	TFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFF3	HGNC	protein_coding	OTTHUMT00000195358.2	-	0.00	88	0	G	NM_003226		43735501	-1	tier1	-	no_errors	ENST00000291525	ensembl	human	known	74_37	missense	54.67	34	41	SNP	0.000	C
TMEM39A	55254	genome.wustl.edu	37	3	119156763	119156763	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:119156763C>T	ENST00000319172.5	-	6	1183	c.763G>A	c.(763-765)Gcc>Acc	p.A255T	TMEM39A_ENST00000486159.1_5'Flank	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	255						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		ATGGGTGTGGCATTATTAAAC	0.483																																																	0													93.0	89.0	91.0					3																	119156763		2203	4300	6503	SO:0001583	missense	0			BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.763G>A	3.37:g.119156763C>T	ENSP00000326063:p.Ala255Thr		D3DN80|Q53FN4|Q53GI1|Q6PKB5	Missense_Mutation	SNP	pfam_Uncharacterised_TMEM39	p.A255T	ENST00000319172.5	37	c.763	CCDS2987.1	3	.	.	.	.	.	.	.	.	.	.	C	9.712	1.157424	0.21454	.	.	ENSG00000176142	ENST00000319172;ENST00000491685	T	0.43294	0.95	5.5	2.73	0.32206	.	0.411718	0.29307	N	0.012524	T	0.16085	0.0387	N	0.04636	-0.2	0.31366	N	0.680749	B	0.02656	0.0	B	0.01281	0.0	T	0.20571	-1.0271	10	0.11485	T	0.65	-0.0358	5.4248	0.16419	0.0:0.5475:0.1471:0.3054	.	255	Q9NV64	TM39A_HUMAN	T	255;101	ENSP00000326063:A255T	ENSP00000326063:A255T	A	-	1	0	TMEM39A	120639453	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	0.831000	0.27476	0.280000	0.22209	0.650000	0.86243	GCC	TMEM39A	-	pfam_Uncharacterised_TMEM39	ENSG00000176142		0.483	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM39A	HGNC	protein_coding	OTTHUMT00000354941.3	-	0.00	46	0	C	NM_018266		119156763	-1	tier1	-	no_errors	ENST00000319172	ensembl	human	known	74_37	missense	96.43	1	27	SNP	0.988	T
TMPRSS5	80975	genome.wustl.edu	37	11	113569745	113569745	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:113569745C>A	ENST00000299882.5	-	4	358	c.210G>T	c.(208-210)ctG>ctT	p.L70L	TMPRSS5_ENST00000536856.1_5'UTR|TMPRSS5_ENST00000538955.1_Silent_p.L26L|TMPRSS5_ENST00000544476.1_Silent_p.L26L|TMPRSS5_ENST00000545579.1_Silent_p.L61L|TMPRSS5_ENST00000540540.1_5'UTR|TMPRSS5_ENST00000544634.1_Silent_p.L70L	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	70					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		GACACAGATACAGCACTTTAG	0.542																																																	0													40.0	43.0	42.0					11																	113569745		2011	4188	6199	SO:0001819	synonymous_variant	0			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.210G>T	11.37:g.113569745C>A				Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L70	ENST00000299882.5	37	c.210	CCDS44735.1	11																																																																																			TMPRSS5	-	NULL	ENSG00000166682		0.542	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1	-	0.00	38	0	C	NM_030770		113569745	-1	tier1	-	no_errors	ENST00000299882	ensembl	human	known	74_37	silent	69.05	13	29	SNP	0.998	A
TMPRSS6	164656	genome.wustl.edu	37	22	37485698	37485698	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr22:37485698C>A	ENST00000346753.3	-	7	899	c.783G>T	c.(781-783)ctG>ctT	p.L261L	TMPRSS6_ENST00000406856.1_Silent_p.L252L|TMPRSS6_ENST00000406725.1_Silent_p.L252L|TMPRSS6_ENST00000381792.2_Silent_p.L252L|TMPRSS6_ENST00000442782.2_Silent_p.L261L	NM_153609.2	NP_705837.1	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	261	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|intracellular signal transduction (GO:0035556)|iron ion homeostasis (GO:0055072)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(5)|central_nervous_system(4)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)	40						GCGTCCACTCCAGCCGGAGTT	0.677																																																	0													25.0	26.0	26.0					22																	37485698		2203	4300	6503	SO:0001819	synonymous_variant	0			AY055383	CCDS13941.1, CCDS74856.1, CCDS74857.1	22q13.1	2010-04-13			ENSG00000187045	ENSG00000187045		"""Serine peptidases / Transmembrane"""	16517	protein-coding gene	gene with protein product		609862					Standard	NM_001289000		Approved	FLJ30744	uc003aqs.1	Q8IU80	OTTHUMG00000150541	ENST00000346753.3:c.783G>T	22.37:g.37485698C>A			B0QYB4|B0QYB7|B0QYB8|Q5TI06|Q6ICC2|Q6UXD8|Q8IUE2|Q8IXV8	Silent	SNP	pirsf_Pept_S1A_matriptase-2,pfam_Peptidase_S1,pfam_LDrepeatLR_classA_rpt,pfam_SEA_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.L252	ENST00000346753.3	37	c.756	CCDS13941.1	22																																																																																			TMPRSS6	-	pirsf_Pept_S1A_matriptase-2,superfamily_CUB_dom	ENSG00000187045		0.677	TMPRSS6-003	NOVEL	basic|CCDS	protein_coding	TMPRSS6	HGNC	protein_coding	OTTHUMT00000318822.1	-	0.00	97	0	C	NM_153609		37485698	-1	tier1	-	no_errors	ENST00000381792	ensembl	human	known	74_37	silent	49.32	37	36	SNP	0.869	A
TP53	7157	genome.wustl.edu	37	17	7577114	7577114	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:7577114C>A	ENST00000269305.4	-	8	1013	c.824G>T	c.(823-825)tGt>tTt	p.C275F	TP53_ENST00000455263.2_Missense_Mutation_p.C275F|TP53_ENST00000420246.2_Missense_Mutation_p.C275F|TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.C275F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.C275F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	275	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7887414}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C275Y(53)|p.C275F(37)|p.0?(8)|p.C275fs*70(3)|p.?(2)|p.C275S(2)|p.C275fs*20(1)|p.L265_K305del41(1)|p.R273_C275delRVC(1)|p.F270_D281del12(1)|p.V274_P278del(1)|p.A276fs*29(1)|p.S269fs*21(1)|p.C275fs*67(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGACAGGCACAAACACGCAC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	115	Substitution - Missense(92)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(2)	lung(14)|large_intestine(13)|breast(13)|upper_aerodigestive_tract(12)|central_nervous_system(10)|haematopoietic_and_lymphoid_tissue(10)|ovary(7)|urinary_tract(6)|stomach(5)|oesophagus(5)|bone(5)|liver(5)|skin(3)|pancreas(2)|NS(2)|prostate(2)|biliary_tract(1)	GRCh37	CM076568|CM951234	TP53	M							71.0	61.0	64.0					17																	7577114		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.824G>T	17.37:g.7577114C>A	ENSP00000269305:p.Cys275Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C275F	ENST00000269305.4	37	c.824	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536533	0.85812	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92738	3.34	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.97110	0.993;1.0;0.993;0.993	D	0.96317	0.9233	10	0.87932	D	0	-17.2181	15.662	0.77193	0.0:1.0:0.0:0.0	.	275;275;275;275	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	F	275;275;275;275;275;264;143	ENSP00000352610:C275F;ENSP00000269305:C275F;ENSP00000398846:C275F;ENSP00000391127:C275F;ENSP00000391478:C275F;ENSP00000425104:C143F	ENSP00000269305:C275F	C	-	2	0	TP53	7517839	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	TGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	313	0	C	NM_000546		7577114	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	47.38	190	172	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577547	7577547	+	Missense_Mutation	SNP	C	C	A	rs121912656|rs397516437		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:7577547C>A	ENST00000269305.4	-	7	923	c.734G>T	c.(733-735)gGc>gTc	p.G245V	TP53_ENST00000455263.2_Missense_Mutation_p.G245V|TP53_ENST00000420246.2_Missense_Mutation_p.G245V|TP53_ENST00000413465.2_Missense_Mutation_p.G245V|TP53_ENST00000445888.2_Missense_Mutation_p.G245V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.G245V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245D(104)|p.G245V(66)|p.G245A(8)|p.0?(8)|p.?(5)|p.G152V(4)|p.G244_M246>V(3)|p.G152D(3)|p.G245N(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.G245E(1)|p.C242_M246>L(1)|p.G245fs*2(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.C238_M246delCNSSCMGGM(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCGGTTCATGCCGCCCATGCA	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	219	Substitution - Missense(191)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	large_intestine(37)|lung(32)|oesophagus(23)|breast(22)|ovary(18)|upper_aerodigestive_tract(16)|haematopoietic_and_lymphoid_tissue(15)|liver(9)|prostate(7)|stomach(6)|central_nervous_system(6)|skin(6)|biliary_tract(5)|urinary_tract(5)|bone(5)|pancreas(4)|cervix(1)|vulva(1)|endometrium(1)	GRCh37	CM010464|CM900209	TP53	M	rs121912656						151.0	113.0	126.0					17																	7577547		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.734G>T	17.37:g.7577547C>A	ENSP00000269305:p.Gly245Val		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G245V	ENST00000269305.4	37	c.734	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563102	0.86335	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99900	-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62;-7.62	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99898	0.9951	M	0.91920	3.255	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;0.999;1.0;1.0;1.0;1.0	D	0.96045	0.9027	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	.	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	V	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245V;ENSP00000352610:G245V;ENSP00000269305:G245V;ENSP00000398846:G245V;ENSP00000391127:G245V;ENSP00000391478:G245V;ENSP00000425104:G113V;ENSP00000423862:G152V	ENSP00000269305:G245V	G	-	2	0	TP53	7518272	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	208	0	C	NM_000546		7577547	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	47.20	132	118	SNP	1.000	A
TRAPPC12	51112	genome.wustl.edu	37	2	3425669	3425669	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:3425669G>T	ENST00000324266.5	+	4	1377	c.1182G>T	c.(1180-1182)agG>agT	p.R394S	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.R394S	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	394					vesicle-mediated transport (GO:0016192)												GAAACTGGAGGGCAGCAGTGG	0.592																																																	0													45.0	43.0	43.0					2																	3425669		2203	4300	6503	SO:0001583	missense	0			BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1182G>T	2.37:g.3425669G>T	ENSP00000324318:p.Arg394Ser		B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R394S	ENST00000324266.5	37	c.1182	CCDS1652.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.84|19.84	3.901198|3.901198	0.72754|0.72754	.|.	.|.	ENSG00000171853|ENSG00000171853	ENST00000441983|ENST00000382110;ENST00000304601;ENST00000324266	.|T;T	.|0.55052	.|0.54;0.54	4.72|4.72	2.89|2.89	0.33648|0.33648	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67711|0.67711	0.2922|0.2922	M|M	0.81942|0.81942	2.565|2.565	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.997;0.998	.|P;D	.|0.68621	.|0.889;0.959	T|T	0.67975|0.67975	-0.5531|-0.5531	5|10	.|0.48119	.|T	.|0.1	.|.	8.0792|8.0792	0.30735|0.30735	0.2527:0.0:0.7473:0.0|0.2527:0.0:0.7473:0.0	.|.	.|377;394	.|E7ENL7;Q8WVT3	.|.;TPC12_HUMAN	V|S	74|394;377;394	.|ENSP00000371544:R394S;ENSP00000324318:R394S	.|ENSP00000303612:R377S	G|R	+|+	2|3	0|2	TTC15|TTC15	3404676|3404676	0.997000|0.997000	0.39634|0.39634	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	0.291000|0.291000	0.18994|0.18994	1.208000|1.208000	0.43306|0.43306	0.563000|0.563000	0.77884|0.77884	GGG|AGG	TRAPPC12	-	NULL	ENSG00000171853		0.592	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAPPC12	HGNC	protein_coding	OTTHUMT00000206693.2	-	0.00	24	0	G	NM_016030		3425669	+1	tier1	-	no_errors	ENST00000324266	ensembl	human	known	74_37	missense	38.24	21	13	SNP	1.000	T
TRIM67	440730	genome.wustl.edu	37	1	231349582	231349582	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:231349582G>T	ENST00000366653.5	+	9	2145	c.2145G>T	c.(2143-2145)aaG>aaT	p.K715N	TRIM67_ENST00000449018.3_Missense_Mutation_p.K653N|TRIM67_ENST00000366652.2_Missense_Mutation_p.K715N|TRIM67_ENST00000444294.3_Missense_Mutation_p.K713N			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	715	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				GCGTGTGCAAGGGGGCCACCG	0.582																																																	0													100.0	108.0	105.0					1																	231349582		2080	4204	6284	SO:0001583	missense	0			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.2145G>T	1.37:g.231349582G>T	ENSP00000355613:p.Lys715Asn		Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.K715N	ENST00000366653.5	37	c.2145	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.862178	0.51482	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.69806	-0.43;-0.43;-0.43;-0.43	5.33	1.0	0.19881	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.72028	0.3410	M	0.72118	2.19	0.51012	D	0.999907	D	0.55385	0.971	P	0.61722	0.893	T	0.67608	-0.5627	10	0.16896	T	0.51	.	8.5631	0.33523	0.4764:0.0:0.5236:0.0	.	715	Q6ZTA4	TRI67_HUMAN	N	713;715;653;715	ENSP00000412124:K713N;ENSP00000355612:K715N;ENSP00000400163:K653N;ENSP00000355613:K715N	ENSP00000355612:K715N	K	+	3	2	TRIM67	229416205	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	2.730000	0.47335	0.252000	0.21531	-0.254000	0.11334	AAG	TRIM67	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000119283		0.582	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	-	0.00	44	0	G	NM_001004342		231349582	+1	tier1	-	no_errors	ENST00000366652	ensembl	human	known	74_37	missense	30.00	7	3	SNP	1.000	T
TRIML2	205860	genome.wustl.edu	37	4	189026335	189026335	+	Splice_Site	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:189026335C>A	ENST00000512729.1	-	1	412	c.38G>T	c.(37-39)aGg>aTg	p.R13M	TRIML2_ENST00000326754.3_Splice_Site_p.R13M|TRIML2_ENST00000502707.1_5'Flank|TRIML2_ENST00000536972.1_Splice_Site_p.R63M	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	13					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GACTCTTACCCTGTAATTCTC	0.458																																																	0													375.0	342.0	353.0					4																	189026335		2203	4300	6503	SO:0001630	splice_region_variant	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.39+1G>T	4.37:g.189026335C>A			B7Z6J6	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.R13M	ENST00000512729.1	37	c.38	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695766	0.30052	.	.	ENSG00000179046	ENST00000512729;ENST00000326754;ENST00000536972	T;T;T	0.64260	0.3;-0.09;0.27	4.96	3.24	0.37175	.	0.309920	0.24022	N	0.042273	T	0.65491	0.2696	L	0.39898	1.24	0.32722	N	0.510209	D;D;D	0.76494	0.999;0.992;0.992	D;P;P	0.64042	0.921;0.754;0.754	T	0.70332	-0.4901	10	0.48119	T	0.1	.	8.2233	0.31554	0.0:0.8109:0.0:0.1891	.	63;13;13	B7Z6J6;B7ZLC3;Q8N7C3	.;.;TRIMM_HUMAN	M	13;13;63	ENSP00000422581:R13M;ENSP00000317498:R13M;ENSP00000441236:R63M	ENSP00000317498:R13M	R	-	2	0	TRIML2	189263329	0.992000	0.36948	0.844000	0.33320	0.090000	0.18270	0.017000	0.13399	0.786000	0.33708	0.655000	0.94253	AGG	TRIML2	-	NULL	ENSG00000179046		0.458	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	-	0.00	49	0	C	NM_173553	Missense_Mutation	189026335	-1	tier1	-	no_errors	ENST00000512729	ensembl	human	known	74_37	missense	44.62	36	29	SNP	0.978	A
TSPEAR	54084	genome.wustl.edu	37	21	45950950	45950950	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr21:45950950C>A	ENST00000323084.4	-	4	674	c.609G>T	c.(607-609)cgG>cgT	p.R203R	TSPEAR_ENST00000397916.1_Silent_p.R135R	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	203	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						TGGCTCTCCTCCGGCTGCCGA	0.587																																																	0													73.0	59.0	64.0					21																	45950950		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.609G>T	21.37:g.45950950C>A				Silent	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_EAR	p.R203	ENST00000323084.4	37	c.609	CCDS13712.1	21																																																																																			TSPEAR	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000175894		0.587	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	-	0.00	44	0	C	NM_144991		45950950	-1	tier1	-	no_errors	ENST00000323084	ensembl	human	known	74_37	silent	33.33	38	19	SNP	0.995	A
TTN	7273	genome.wustl.edu	37	2	179540441	179540441	+	Intron	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:179540441G>T	ENST00000591111.1	-	145	33640				TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Silent_p.V11498V|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGAGGAGGGACCTTCTTTT	0.413																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33415+206C>A	2.37:g.179540441G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V11498	ENST00000591111.1	37	c.34494		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	19	0	G	NM_133378		179540441	-1	tier1	-	no_errors	ENST00000589042	ensembl	human	putative	74_37	silent	75.00	2	6	SNP	0.847	T
TTN	7273	genome.wustl.edu	37	2	179579779	179579779	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:179579779C>A	ENST00000591111.1	-	88	25407	c.25183G>T	c.(25183-25185)Gaa>Taa	p.E8395*	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.E8712*|TTN_ENST00000342992.6_Nonsense_Mutation_p.E7468*			Q8WZ42	TITIN_HUMAN	titin	12568	Ig-like 66.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTGATATTCCCCAATGTCT	0.453																																																	0													262.0	254.0	256.0					2																	179579779		2011	4177	6188	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.25183G>T	2.37:g.179579779C>A	ENSP00000465570:p.Glu8395*		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E7468*	ENST00000591111.1	37	c.22402		2	.	.	.	.	.	.	.	.	.	.	C	59	35.827047	0.99983	.	.	ENSG00000155657	ENST00000342992	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2963	0.98556	0.0:1.0:0.0:0.0	.	.	.	.	X	7468	.	ENSP00000343764:E7468X	E	-	1	0	TTN	179288024	0.327000	0.24678	0.997000	0.53966	0.435000	0.31806	1.884000	0.39668	2.813000	0.96785	0.655000	0.94253	GAA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	27	0	C	NM_133378		179579779	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	nonsense	91.67	2	22	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179470053	179470053	+	Intron	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:179470053C>A	ENST00000591111.1	-	230	49183				TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAACAGTAACAAAGTCATAA	0.368																																																	0													29.0	27.0	27.0					2																	179470053		1861	4095	5956	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48959-31G>T	2.37:g.179470053C>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.368	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	35	0	C	NM_133378		179470053	+1	tier1	-	no_errors	ENST00000419746	ensembl	human	known	74_37	rna	88.00	3	22	SNP	0.000	A
TTN	7273	genome.wustl.edu	37	2	179631333	179631333	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:179631333C>T	ENST00000591111.1	-	41	9702	c.9478G>A	c.(9478-9480)Gag>Aag	p.E3160K	TTN_ENST00000342175.6_Missense_Mutation_p.E3114K|TTN_ENST00000359218.5_Missense_Mutation_p.E3114K|TTN_ENST00000460472.2_Missense_Mutation_p.E3114K|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E3160K|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E3160K|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E3160K			Q8WZ42	TITIN_HUMAN	titin	13492					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGCTGTTTCTCAATGACCTGT	0.373																																																	0													85.0	76.0	79.0					2																	179631333		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.9478G>A	2.37:g.179631333C>T	ENSP00000465570:p.Glu3160Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E3160K	ENST00000591111.1	37	c.9478		2	.	.	.	.	.	.	.	.	.	.	C	18.75	3.690784	0.68271	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.06768	3.26;3.26;3.26;3.26;3.26	5.7	5.7	0.88788	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37598	0.1009	M	0.87971	2.92	0.41188	D	0.986283	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.87578	0.996;0.996;0.996;0.996;0.998	T	0.30851	-0.9964	9	0.87932	D	0	.	19.8277	0.96624	0.0:1.0:0.0:0.0	.	3114;3114;3114;3160;3160	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	K	3160;3114;3114;3114;3114;3160	ENSP00000343764:E3160K;ENSP00000434586:E3114K;ENSP00000340554:E3114K;ENSP00000352154:E3114K;ENSP00000354117:E3160K	ENSP00000340554:E3114K	E	-	1	0	TTN	179339578	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.485000	0.81204	2.695000	0.91970	0.591000	0.81541	GAG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.373	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	19	0	C	NM_133378		179631333	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	75.00	4	12	SNP	1.000	T
TUBB8	347688	genome.wustl.edu	37	10	93704	93704	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr10:93704T>C	ENST00000309812.4	-	4	690	c.628A>G	c.(628-630)Ata>Gta	p.I210V	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Missense_Mutation_p.I138V|TUBB8_ENST00000413237.3_5'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	210					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TTGGAACATATGTCATACAGA	0.542																																					Pancreas(192;2041 3010 9013 18103)												0													80.0	75.0	76.0					10																	93704		2203	4300	6503	SO:0001583	missense	0			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.628A>G	10.37:g.93704T>C	ENSP00000311042:p.Ile210Val		Q5SQX9|Q8WZ78	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.I210V	ENST00000309812.4	37	c.628	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	T	9.561	1.118463	0.20877	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.71222	-0.55	.	.	.	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.64402	U	0.000008	D	0.82788	0.5113	M	0.91510	3.215	0.29757	N	0.83584	B;D	0.71674	0.001;0.998	B;D	0.97110	0.002;1.0	T	0.75448	-0.3314	9	0.87932	D	0	.	4.5487	0.12098	0.0:6.0E-4:0.0:0.9994	.	173;210	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	V	138;176;173;210	ENSP00000403895:I138V	ENSP00000272035:I176V	I	-	1	0	RP11-631M21.2	83704	1.000000	0.71417	0.102000	0.21198	0.103000	0.19146	5.418000	0.66429	0.103000	0.17682	0.102000	0.15555	ATA	TUBB8	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Delta_tubulin	ENSG00000173876		0.542	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	-	0.00	102	0	T	NM_177987		93704	-1	tier1	-	no_errors	ENST00000309812	ensembl	human	known	74_37	missense	49.53	54	53	SNP	1.000	C
TULP1	7287	genome.wustl.edu	37	6	35471401	35471401	+	Missense_Mutation	SNP	G	G	C	rs551519696		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:35471401G>C	ENST00000229771.6	-	13	1337	c.1258C>G	c.(1258-1260)Cgc>Ggc	p.R420G	TULP1_ENST00000322263.4_Missense_Mutation_p.R367G	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	420			R -> P (in RP14; no effect on RPE phagocytosis). {ECO:0000269|PubMed:9462750}.		dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						ACGGTCATGCGCCGGGGGCCA	0.657																																					GBM(55;1027 1091 11115 23439)												0													21.0	22.0	22.0					6																	35471401		2200	4298	6498	SO:0001583	missense	0			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1258C>G	6.37:g.35471401G>C	ENSP00000229771:p.Arg420Gly		O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C	p.R420G	ENST00000229771.6	37	c.1258	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084782	0.76642	.	.	ENSG00000112041	ENST00000229771;ENST00000322263	D;D	0.97089	-4.24;-4.24	5.16	4.25	0.50352	Tubby, C-terminal (4);	0.244007	0.36034	N	0.002834	D	0.98185	0.9400	M	0.90198	3.095	0.42382	D	0.99249	D;D	0.67145	0.991;0.996	P;P	0.62649	0.785;0.905	D	0.98737	1.0715	10	0.87932	D	0	-26.481	12.6768	0.56899	0.0:0.0:0.6319:0.3681	.	367;420	O00294-2;O00294	.;TULP1_HUMAN	G	420;367	ENSP00000229771:R420G;ENSP00000319414:R367G	ENSP00000229771:R420G	R	-	1	0	TULP1	35579379	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.650000	0.54424	2.398000	0.81561	0.491000	0.48974	CGC	TULP1	-	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C	ENSG00000112041		0.657	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	HGNC	protein_coding	OTTHUMT00000040307.2	-	0.00	29	0	G			35471401	-1	tier1	-	no_errors	ENST00000229771	ensembl	human	known	74_37	missense	51.52	16	17	SNP	1.000	C
TULP4	56995	genome.wustl.edu	37	6	158922786	158922786	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr6:158922786G>A	ENST00000367097.3	+	13	3448	c.2091G>A	c.(2089-2091)tcG>tcA	p.S697S	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	697					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		TCCACAGCTCGGCTCAGGCTA	0.537																																																	0													133.0	116.0	122.0					6																	158922786		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.2091G>A	6.37:g.158922786G>A			Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Silent	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S697	ENST00000367097.3	37	c.2091	CCDS34561.1	6																																																																																			TULP4	-	NULL	ENSG00000130338		0.537	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	-	0.00	47	0	G	NM_020245		158922786	+1	tier1	-	no_errors	ENST00000367097	ensembl	human	known	74_37	silent	51.16	21	22	SNP	1.000	A
UGGT1	56886	genome.wustl.edu	37	2	128877948	128877948	+	Silent	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:128877948G>T	ENST00000259253.6	+	9	938	c.891G>T	c.(889-891)ctG>ctT	p.L297L	RN7SL206P_ENST00000580933.1_RNA|UGGT1_ENST00000375990.3_Silent_p.L273L	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	297					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						ACCCCGACCTGGAGGGACAGT	0.393																																																	0													128.0	132.0	131.0					2																	128877948		2203	4300	6503	SO:0001819	synonymous_variant	0			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.891G>T	2.37:g.128877948G>T			Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Silent	SNP	pfam_UDP-g_GGtrans	p.L297	ENST00000259253.6	37	c.891	CCDS2154.1	2																																																																																			UGGT1	-	NULL	ENSG00000136731		0.393	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	-	0.00	49	0	G	NM_020120		128877948	+1	tier1	-	no_errors	ENST00000259253	ensembl	human	known	74_37	silent	85.71	3	18	SNP	0.943	T
UGGT1	56886	genome.wustl.edu	37	2	128914889	128914889	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr2:128914889G>T	ENST00000259253.6	+	22	2371	c.2324G>T	c.(2323-2325)cGg>cTg	p.R775L	UGGT1_ENST00000375990.3_Missense_Mutation_p.R751L	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	775					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CCTTCTGGACGGCAGTTACTG	0.388																																																	0													153.0	142.0	146.0					2																	128914889		2203	4300	6503	SO:0001583	missense	0			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.2324G>T	2.37:g.128914889G>T	ENSP00000259253:p.Arg775Leu		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans	p.R775L	ENST00000259253.6	37	c.2324	CCDS2154.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.641417	0.96704	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.29655	1.56;1.56	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	M	0.84082	2.675	0.80722	D	1	P;B	0.36438	0.553;0.238	B;B	0.37650	0.255;0.069	T	0.40776	-0.9545	9	.	.	.	.	20.2406	0.98372	0.0:0.0:1.0:0.0	.	751;775	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	L	751;775	ENSP00000365158:R751L;ENSP00000259253:R775L	.	R	+	2	0	UGGT1	128631359	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.188000	0.94921	2.857000	0.98124	0.650000	0.86243	CGG	UGGT1	-	NULL	ENSG00000136731		0.388	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	-	0.00	107	0	G	NM_020120		128914889	+1	tier1	-	no_errors	ENST00000259253	ensembl	human	known	74_37	missense	81.25	12	52	SNP	1.000	T
UGT2B15	7366	genome.wustl.edu	37	4	69535727	69535727	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:69535727C>T	ENST00000338206.5	-	1	619	c.610G>A	c.(610-612)Gat>Aat	p.D204N		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	204					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	ATCATTTGATCACTTAATTCT	0.348																																																	0													120.0	124.0	122.0					4																	69535727		2203	4296	6499	SO:0001583	missense	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.610G>A	4.37:g.69535727C>T	ENSP00000341045:p.Asp204Asn		A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D204N	ENST00000338206.5	37	c.610	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	c	16.68	3.190255	0.58017	.	.	ENSG00000196620	ENST00000338206	T	0.66815	-0.23	2.79	2.79	0.32731	.	0.000000	0.64402	U	0.000003	T	0.81555	0.4847	M	0.87682	2.9	0.30516	N	0.768939	D	0.76494	0.999	D	0.77557	0.99	T	0.80228	-0.1469	10	0.66056	D	0.02	.	11.3195	0.49412	0.0:1.0:0.0:0.0	.	204	P54855	UDB15_HUMAN	N	204	ENSP00000341045:D204N	ENSP00000341045:D204N	D	-	1	0	UGT2B15	69218322	0.995000	0.38212	0.030000	0.17652	0.625000	0.37756	5.074000	0.64401	1.536000	0.49237	0.442000	0.29010	GAT	UGT2B15	-	pfam_UDP_glucos_trans	ENSG00000196620		0.348	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	-	0.00	72	0	C	NM_001076		69535727	-1	tier1	-	no_errors	ENST00000338206	ensembl	human	known	74_37	missense	33.70	61	31	SNP	0.998	T
UGT8	7368	genome.wustl.edu	37	4	115585172	115585172	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:115585172G>T	ENST00000310836.6	+	3	1366	c.844G>T	c.(844-846)Ggt>Tgt	p.G282C	UGT8_ENST00000394511.3_Missense_Mutation_p.G282C	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	282					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		ATGGGTAAATGGTGCTAATGA	0.398																																																	0													174.0	160.0	165.0					4																	115585172		2203	4300	6503	SO:0001583	missense	0			AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.844G>T	4.37:g.115585172G>T	ENSP00000311648:p.Gly282Cys		B3KXU7|O00196	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.G282C	ENST00000310836.6	37	c.844	CCDS3705.1	4	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091824	0.76756	.	.	ENSG00000174607	ENST00000310836;ENST00000394511	T;T	0.59906	0.23;0.23	5.65	4.81	0.61882	.	0.196730	0.56097	D	0.000036	T	0.66557	0.2801	L	0.52573	1.65	0.49213	D	0.999766	D	0.55385	0.971	P	0.61874	0.895	T	0.68953	-0.5273	10	0.87932	D	0	.	10.6111	0.45423	0.1461:0.0:0.8539:0.0	.	282	Q16880	CGT_HUMAN	C	282	ENSP00000311648:G282C;ENSP00000378019:G282C	ENSP00000311648:G282C	G	+	1	0	UGT8	115804621	1.000000	0.71417	0.981000	0.43875	0.997000	0.91878	5.204000	0.65180	1.393000	0.46605	0.655000	0.94253	GGT	UGT8	-	pfam_UDP_glucos_trans	ENSG00000174607		0.398	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT8	HGNC	protein_coding	OTTHUMT00000256426.2	-	0.00	32	0	G	NM_003360		115585172	+1	tier1	-	no_errors	ENST00000310836	ensembl	human	known	74_37	missense	40.00	27	18	SNP	1.000	T
UNC13B	10497	genome.wustl.edu	37	9	35398978	35398978	+	Silent	SNP	G	G	T	rs573780841		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr9:35398978G>T	ENST00000378495.3	+	32	3996	c.3774G>T	c.(3772-3774)gcG>gcT	p.A1258A	UNC13B_ENST00000396787.1_Silent_p.A1270A|UNC13B_ENST00000378496.4_Silent_p.A1258A|UNC13B_ENST00000481299.1_3'UTR	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1258					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GGGCCTCAGCGGCTCAGGATG	0.562																																																	0													77.0	78.0	78.0					9																	35398978		2203	4300	6503	SO:0001819	synonymous_variant	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.3774G>T	9.37:g.35398978G>T			Q5VYM8	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.A1258	ENST00000378495.3	37	c.3774	CCDS6579.1	9																																																																																			UNC13B	-	NULL	ENSG00000198722		0.562	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	-	0.00	48	0	G	NM_006377		35398978	+1	tier1	-	no_errors	ENST00000378496	ensembl	human	known	74_37	silent	80.95	4	17	SNP	1.000	T
UQCRC2	7385	genome.wustl.edu	37	16	21964769	21964769	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:21964769T>A	ENST00000268379.4	+	1	789	c.25T>A	c.(25-27)Tct>Act	p.S9T	UQCRC2_ENST00000561553.1_Missense_Mutation_p.S9T	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	9					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		CAGAGCCGGCTCTTTCTCGGT	0.577																																					Colon(123;450 1645 12841 25393 45623)												0													52.0	53.0	52.0					16																	21964769		2198	4300	6498	SO:0001583	missense	0			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.25T>A	16.37:g.21964769T>A	ENSP00000268379:p.Ser9Thr		B3KSN4|Q9BQ05	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.S9T	ENST00000268379.4	37	c.25	CCDS10601.1	16	.	.	.	.	.	.	.	.	.	.	T	13.95	2.390513	0.42410	.	.	ENSG00000140740	ENST00000268379	T	0.11495	2.77	5.51	0.133	0.14766	.	0.414083	0.30177	N	0.010222	T	0.09949	0.0244	M	0.65975	2.015	0.20638	N	0.999879	B	0.09022	0.002	B	0.04013	0.001	T	0.29852	-0.9998	10	0.24483	T	0.36	-5.0925	5.6728	0.17731	0.4892:0.0:0.1407:0.3701	.	9	P22695	QCR2_HUMAN	T	9	ENSP00000268379:S9T	ENSP00000268379:S9T	S	+	1	0	UQCRC2	21872270	0.006000	0.16342	0.637000	0.29366	0.674000	0.39518	-0.145000	0.10265	0.077000	0.16863	0.533000	0.62120	TCT	UQCRC2	-	NULL	ENSG00000140740		0.577	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	HGNC	protein_coding	OTTHUMT00000254466.1	-	0.00	29	0	T	NM_003366		21964769	+1	tier1	-	no_errors	ENST00000268379	ensembl	human	known	74_37	missense	64.71	12	22	SNP	0.622	A
USP2	9099	genome.wustl.edu	37	11	119243625	119243625	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr11:119243625G>A	ENST00000260187.2	-	2	860	c.566C>T	c.(565-567)gCc>gTc	p.A189V	RP11-334E6.3_ENST00000530918.2_RNA|USP2_ENST00000455332.2_Intron	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	189	Necessary for interaction with MDM4.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		AGGGCAGCTGGCTGTCTGGTA	0.637																																																	0													65.0	68.0	67.0					11																	119243625		2199	4295	6494	SO:0001583	missense	0			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.566C>T	11.37:g.119243625G>A	ENSP00000260187:p.Ala189Val		B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.A189V	ENST00000260187.2	37	c.566	CCDS8422.1	11	.	.	.	.	.	.	.	.	.	.	G	21.7	4.183847	0.78677	.	.	ENSG00000036672	ENST00000260187;ENST00000530918	T	0.20069	2.1	5.52	5.52	0.82312	.	0.460130	0.23928	N	0.043179	T	0.23649	0.0572	N	0.24115	0.695	0.80722	D	1	P	0.52316	0.952	P	0.49477	0.612	T	0.01205	-1.1419	10	0.59425	D	0.04	-7.7575	16.6032	0.84821	0.0:0.0:1.0:0.0	.	189	O75604	UBP2_HUMAN	V	189;159	ENSP00000260187:A189V	ENSP00000260187:A189V	A	-	2	0	USP2	118748835	1.000000	0.71417	0.996000	0.52242	0.493000	0.33554	5.068000	0.64364	2.578000	0.87016	0.655000	0.94253	GCC	USP2	-	NULL	ENSG00000036672		0.637	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP2	HGNC	protein_coding	OTTHUMT00000388361.2		0.00	26	0	G	NM_171997		119243625	-1			no_errors	ENST00000260187	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
VN1R4	317703	genome.wustl.edu	37	19	53770337	53770337	+	Silent	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:53770337G>C	ENST00000311170.4	-	1	635	c.582C>G	c.(580-582)ctC>ctG	p.L194L	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	194					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		CCCAGAGCATGAGCCCCAGAC	0.537										HNSCC(26;0.072)																																							0													48.0	48.0	48.0					19																	53770337		2198	4300	6498	SO:0001819	synonymous_variant	0			AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.582C>G	19.37:g.53770337G>C			Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Silent	SNP	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.L194	ENST00000311170.4	37	c.582	CCDS33099.1	19																																																																																			VN1R4	-	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000228567		0.537	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R4	HGNC	protein_coding	OTTHUMT00000464287.1		0.00	55	0	G	NM_173857		53770337	-1			no_errors	ENST00000311170	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.962	C
WASH6P	653440	genome.wustl.edu	37	X	155252325	155252325	+	RNA	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chrX:155252325C>T	ENST00000461007.1	+	0	1333				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CTCAGGACAGCGGGTGTCAGC	0.627																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252325C>T			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.627	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	-	0.00	58	0	C	NG_008380		155252325	+1	tier1	-	no_errors	ENST00000340131	ensembl	human	known	74_37	rna	27.27	32	12	SNP	0.078	T
WDR66	144406	genome.wustl.edu	37	12	122437781	122437781	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr12:122437781G>C	ENST00000288912.4	+	20	4020	c.3166G>C	c.(3166-3168)Ggt>Cgt	p.G1056R		NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	1056							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		TGAGGTGCTCGGTTATACCAA	0.448																																					Esophageal Squamous(85;849 1794 49757 52143)												0													103.0	96.0	98.0					12																	122437781		1892	4127	6019	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.3166G>C	12.37:g.122437781G>C	ENSP00000288912:p.Gly1056Arg		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G1056R	ENST00000288912.4	37	c.3166	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400105	0.62177	.	.	ENSG00000158023	ENST00000288912	T	0.06142	3.34	5.31	5.31	0.75309	.	0.055969	0.64402	D	0.000001	T	0.21186	0.0510	M	0.84433	2.695	0.80722	D	1	P	0.50156	0.932	P	0.49953	0.627	T	0.01643	-1.1305	10	0.72032	D	0.01	.	17.7641	0.88471	0.0:0.0:1.0:0.0	.	1056	Q8TBY9	WDR66_HUMAN	R	1056	ENSP00000288912:G1056R	ENSP00000288912:G1056R	G	+	1	0	WDR66	120922164	1.000000	0.71417	0.121000	0.21740	0.397000	0.30659	6.637000	0.74304	2.487000	0.83934	0.655000	0.94253	GGT	WDR66	-	NULL	ENSG00000158023		0.448	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	-	0.00	24	0	G	NM_144668		122437781	+1	tier1	-	no_errors	ENST00000288912	ensembl	human	known	74_37	missense	53.12	15	17	SNP	0.897	C
WWC1	23286	genome.wustl.edu	37	5	167881043	167881043	+	Missense_Mutation	SNP	G	G	A	rs201870717	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr5:167881043G>A	ENST00000265293.4	+	18	3098	c.2596G>A	c.(2596-2598)Gga>Aga	p.G866R	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Missense_Mutation_p.G866R	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	866	Glu-rich.|Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ggaggaggagggagaagagga	0.547																																																	0													115.0	110.0	112.0					5																	167881043		2202	4300	6502	SO:0001583	missense	0			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2596G>A	5.37:g.167881043G>A	ENSP00000265293:p.Gly866Arg		B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.G866R	ENST00000265293.4	37	c.2596	CCDS4366.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.150|8.150	0.787138|0.787138	0.16189|0.16189	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000393895;ENST00000524228|ENST00000265293;ENST00000521089;ENST00000524038	.|T;T;T	.|0.48836	.|0.8;0.8;0.8	4.51|4.51	4.51|4.51	0.55191|0.55191	.|.	1.098670|1.098670	0.07053|0.07053	N|N	0.832242|0.832242	T|T	0.35364|0.35364	0.0929|0.0929	N|N	0.08118|0.08118	0|0	0.22521|0.22521	N|N	0.999023|0.999023	.|B;B	.|0.30526	.|0.283;0.097	.|B;B	.|0.38428	.|0.273;0.049	T|T	0.26780|0.26780	-1.0093|-1.0093	6|10	.|0.17832	.|T	.|0.49	.|.	13.0909|13.0909	0.59166|0.59166	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|866;866	.|Q8IX03-2;Q8IX03	.|.;KIBRA_HUMAN	E|R	827;642|866;866;192	.|ENSP00000265293:G866R;ENSP00000427772:G866R;ENSP00000428084:G192R	.|ENSP00000265293:G866R	G|G	+|+	2|1	0|0	WWC1|WWC1	167813621|167813621	0.560000|0.560000	0.26570|0.26570	0.022000|0.022000	0.16811|0.16811	0.001000|0.001000	0.01503|0.01503	3.871000|3.871000	0.56077|0.56077	2.234000|2.234000	0.73211|0.73211	0.544000|0.544000	0.68410|0.68410	GGG|GGA	WWC1	-	NULL	ENSG00000113645		0.547	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	HGNC	protein_coding	OTTHUMT00000252791.2		0.00	32	0	G	NM_015238		167881043	+1			no_errors	ENST00000265293	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.441	A
XKR4	114786	genome.wustl.edu	37	8	56436366	56436366	+	Silent	SNP	C	C	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr8:56436366C>G	ENST00000327381.6	+	3	1633	c.1533C>G	c.(1531-1533)gcC>gcG	p.A511A	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	511						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			TGTATTATGCCTTCTTTCATC	0.522																																																	0													101.0	87.0	92.0					8																	56436366		2203	4300	6503	SO:0001819	synonymous_variant	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1533C>G	8.37:g.56436366C>G			Q96PZ8	Silent	SNP	pfam_Transport_prot_XK	p.A511	ENST00000327381.6	37	c.1533	CCDS34893.1	8																																																																																			XKR4	-	pfam_Transport_prot_XK	ENSG00000206579		0.522	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	-	0.00	26	0	C	NM_052898		56436366	+1	tier1	-	no_errors	ENST00000327381	ensembl	human	known	74_37	silent	48.57	18	17	SNP	1.000	G
ZNF701	55762	genome.wustl.edu	37	19	53091854	53091854	+	IGR	SNP	G	G	T	rs536959291		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:53091854G>T	ENST00000540331.1	+	0	5538				ZNF137P_ENST00000597158.1_RNA	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		AGCCAGGGACGGCTCTTCCTC	0.403																																					NSCLC(89;451 1475 9611 20673 52284)												0																																										SO:0001628	intergenic_variant	0			AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72			19.37:g.53091854G>T			A2RRM8|B9EGF2|F5GZM6|Q66K42	RNA	SNP	-	NULL	ENST00000540331.1	37	NULL	CCDS54311.1	19																																																																																			ZNF137P	-	-	ENSG00000123870		0.403	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF137P	HGNC	protein_coding	OTTHUMT00000463467.1	-	0.00	16	0	G	NM_018260		53091854	+1	tier1	-	no_errors	ENST00000597158	ensembl	human	known	74_37	rna	23.81	16	5	SNP	0.158	T
ZNF200	7752	genome.wustl.edu	37	16	3283513	3283513	+	Silent	SNP	C	C	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:3283513C>T	ENST00000431561.3	-	2	855	c.243G>A	c.(241-243)caG>caA	p.Q81Q	ZNF200_ENST00000396868.3_Silent_p.Q81Q|ZNF200_ENST00000396871.4_Silent_p.Q81Q|ZNF200_ENST00000396870.4_Silent_p.Q81Q|ZNF200_ENST00000414144.2_Silent_p.Q81Q|ZNF200_ENST00000575948.1_Silent_p.Q81Q	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	81					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						CACCTCTGTTCTGAAGGCTTG	0.453																																																	0													88.0	93.0	92.0					16																	3283513		2197	4300	6497	SO:0001819	synonymous_variant	0			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.243G>A	16.37:g.3283513C>T			D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q81	ENST00000431561.3	37	c.243	CCDS10497.1	16																																																																																			ZNF200	-	NULL	ENSG00000010539		0.453	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF200	HGNC	protein_coding	OTTHUMT00000437545.1		0.00	46	0	C			3283513	-1			no_errors	ENST00000414144	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.962	T
ZNF415	55786	genome.wustl.edu	37	19	53619674	53619674	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:53619674C>A	ENST00000500065.4	-	3	361	c.28G>T	c.(28-30)Gac>Tac	p.D10Y	ZNF415_ENST00000599261.1_Missense_Mutation_p.D10Y|ZNF415_ENST00000594011.1_Missense_Mutation_p.D10Y|ZNF415_ENST00000601493.1_Intron|ZNF415_ENST00000595813.1_Missense_Mutation_p.D10Y|ZNF415_ENST00000596683.1_5'UTR|ZNF415_ENST00000455735.2_5'UTR|ZNF415_ENST00000448501.1_5'UTR|ZNF415_ENST00000600574.1_Missense_Mutation_p.D10Y|ZNF415_ENST00000243643.4_Missense_Mutation_p.D10Y|ZNF415_ENST00000597748.1_Missense_Mutation_p.D10Y|ZNF415_ENST00000440291.1_5'UTR|ZNF415_ENST00000597503.1_Missense_Mutation_p.D10Y|ZNF415_ENST00000421033.1_5'UTR|ZNF415_ENST00000601215.1_Intron|ZNF415_ENST00000595193.1_Missense_Mutation_p.D10Y	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		ATGGCCACGTCCCTGAATGTC	0.393																																																	0													108.0	105.0	106.0					19																	53619674		2203	4300	6503	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.28G>T	19.37:g.53619674C>A	ENSP00000439435:p.Asp10Tyr		F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D10Y	ENST00000500065.4	37	c.28	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	C	11.64	1.698673	0.30142	.	.	ENSG00000170954	ENST00000243643;ENST00000500065	T;T	0.12039	2.72;2.72	2.94	2.94	0.34122	.	.	.	.	.	T	0.41719	0.1171	M	0.91038	3.17	0.39682	D	0.970914	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.918	T	0.51702	-0.8672	9	0.87932	D	0	.	9.4872	0.38937	0.0:1.0:0.0:0.0	.	10;10	F5H287;Q09FC8-5	.;.	Y	10	ENSP00000243643:D10Y;ENSP00000439435:D10Y	ENSP00000243643:D10Y	D	-	1	0	ZNF415	58311486	0.940000	0.31905	0.026000	0.17262	0.524000	0.34500	4.135000	0.57997	1.658000	0.50742	0.455000	0.32223	GAC	ZNF415	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000170954		0.393	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	-	0.00	31	0	C	NM_018355		53619674	-1	tier1	-	no_errors	ENST00000243643	ensembl	human	known	74_37	missense	54.24	27	32	SNP	0.132	A
ZNF425	155054	genome.wustl.edu	37	7	148800755	148800755	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr7:148800755C>A	ENST00000378061.2	-	4	2340	c.2208G>T	c.(2206-2208)gcG>gcT	p.A736A		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	736					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GGGTCTTGAGCGCCCCCACGT	0.577																																																	0													61.0	54.0	57.0					7																	148800755		2203	4300	6503	SO:0001819	synonymous_variant	0			AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.2208G>T	7.37:g.148800755C>A			B3KPM1|Q08AG3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.A736	ENST00000378061.2	37	c.2208	CCDS34773.1	7																																																																																			ZNF425	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204947		0.577	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF425	HGNC	protein_coding	OTTHUMT00000352726.1	-	0.00	31	0	C	XM_088140		148800755	-1	tier1	-	no_errors	ENST00000378061	ensembl	human	known	74_37	silent	77.27	5	17	SNP	0.000	A
ZNF445	353274	genome.wustl.edu	37	3	44491967	44491967	+	Silent	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr3:44491967C>A	ENST00000396077.2	-	6	1139	c.792G>T	c.(790-792)ctG>ctT	p.L264L	ZNF445_ENST00000425708.2_Silent_p.L264L	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	264	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TATAATTCTCCAGCATCACAT	0.493																																																	0													141.0	122.0	129.0					3																	44491967		2203	4300	6503	SO:0001819	synonymous_variant	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.792G>T	3.37:g.44491967C>A			Q3MJD1	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L264	ENST00000396077.2	37	c.792	CCDS2713.1	3																																																																																			ZNF445	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000185219		0.493	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2	-	0.00	62	0	C	NM_181489		44491967	-1	tier1	-	no_errors	ENST00000396077	ensembl	human	known	74_37	silent	78.26	10	36	SNP	1.000	A
ZNF500	26048	genome.wustl.edu	37	16	4803036	4803036	+	Missense_Mutation	SNP	C	C	A	rs142409847		TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr16:4803036C>A	ENST00000219478.6	-	6	1083	c.784G>T	c.(784-786)Ggc>Tgc	p.G262C	RP11-127I20.7_ENST00000588099.1_RNA|ZNF500_ENST00000545009.1_Missense_Mutation_p.G262C|ZNF500_ENST00000591026.1_5'UTR			O60304	ZN500_HUMAN	zinc finger protein 500	262					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CCATCACCGCCGTCCTCCAAC	0.587																																																	0													39.0	46.0	43.0					16																	4803036		2191	4292	6483	SO:0001583	missense	0			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.784G>T	16.37:g.4803036C>A	ENSP00000219478:p.Gly262Cys		A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.G262C	ENST00000219478.6	37	c.784	CCDS32383.1	16	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162661	0.38217	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.07114	3.31;3.22	4.04	3.08	0.35506	Krueppel-associated box (1);	.	.	.	.	T	0.05410	0.0143	N	0.14661	0.345	0.09310	N	1	B;B	0.30326	0.276;0.276	B;B	0.26517	0.07;0.07	T	0.36480	-0.9746	9	0.59425	D	0.04	.	9.1061	0.36698	0.0:0.8891:0.0:0.1109	.	262;262	B4DNN9;O60304	.;ZN500_HUMAN	C	262	ENSP00000445714:G262C;ENSP00000219478:G262C	ENSP00000219478:G262C	G	-	1	0	ZNF500	4743037	0.001000	0.12720	0.048000	0.18961	0.011000	0.07611	1.284000	0.33249	0.694000	0.31654	0.655000	0.94253	GGC	ZNF500	-	NULL	ENSG00000103199		0.587	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF500	HGNC	protein_coding	OTTHUMT00000432461.1	-	0.00	37	0	C	XM_085507		4803036	-1	tier1	-	no_errors	ENST00000219478	ensembl	human	known	74_37	missense	57.78	19	26	SNP	0.000	A
ZNF528	84436	genome.wustl.edu	37	19	52919741	52919741	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:52919741G>A	ENST00000360465.3	+	7	2062	c.1636G>A	c.(1636-1638)Gag>Aag	p.E546K	ZNF528_ENST00000391788.2_3'UTR	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	546					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E546*(1)		breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TCATACTGGAGAGAGGCCTTA	0.388																																																	1	Substitution - Nonsense(1)	lung(1)											90.0	81.0	84.0					19																	52919741		2203	4300	6503	SO:0001583	missense	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.1636G>A	19.37:g.52919741G>A	ENSP00000353652:p.Glu546Lys		B3KPN4|Q86T88|Q96JK0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E546K	ENST00000360465.3	37	c.1636	CCDS33091.1	19	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649136	0.67358	.	.	ENSG00000167555	ENST00000360465	T	0.24350	1.86	1.84	1.84	0.25277	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44871	0.1314	M	0.65320	2	0.31072	N	0.712911	D	0.69078	0.997	D	0.78314	0.991	T	0.49072	-0.8977	9	0.72032	D	0.01	.	10.648	0.45632	0.0:0.0:1.0:0.0	.	546	Q3MIS6	ZN528_HUMAN	K	546	ENSP00000353652:E546K	ENSP00000353652:E546K	E	+	1	0	ZNF528	57611553	0.986000	0.35501	0.392000	0.26245	0.033000	0.12548	1.745000	0.38278	0.991000	0.38814	0.563000	0.77884	GAG	ZNF528	-	pfscan_Znf_C2H2	ENSG00000167555		0.388	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	-	0.00	35	0	G	NM_032423		52919741	+1	tier1	-	no_errors	ENST00000360465	ensembl	human	known	74_37	missense	56.86	22	29	SNP	1.000	A
ZNF578	147660	genome.wustl.edu	37	19	52954467	52954467	+	5'Flank	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:52954467G>T	ENST00000421239.2	+	0	0				ZNF534_ENST00000301085.4_Missense_Mutation_p.R100L|ZNF534_ENST00000432303.2_Missense_Mutation_p.R57L	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		TGGGACGCGCGCGTCTTCAGG	0.532																																																	0													2.0	2.0	2.0					19																	52954467		663	1511	2174	SO:0001631	upstream_gene_variant	0			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468		19.37:g.52954467G>T	Exception_encountered		B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R100L	ENST00000421239.2	37	c.299	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	G	9.225	1.034271	0.19590	.	.	ENSG00000198633	ENST00000301085;ENST00000432303	T;T	0.01335	5.55;5.0	0.536	-0.668	0.11392	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.09310	N	1	B;D	0.52996	0.044;0.957	B;B	0.39590	0.024;0.304	T	0.49707	-0.8911	7	0.72032	D	0.01	.	.	.	.	.	57;100	Q1T7F6;Q1T7F5	.;.	L	100;57	ENSP00000301085:R100L;ENSP00000409421:R57L	ENSP00000301085:R100L	R	+	2	0	ZNF534	57646279	0.009000	0.17119	0.020000	0.16555	0.319000	0.28217	-0.837000	0.04377	-0.341000	0.08376	0.205000	0.17691	CGC	ZNF534	-	NULL	ENSG00000198633		0.532	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF534	HGNC	protein_coding	OTTHUMT00000344298.3	-	0.00	24	0	G	NM_152472		52954467	+1	tier1	-	no_errors	ENST00000301085	ensembl	human	putative	74_37	missense	64.71	18	33	SNP	0.028	T
ZNF551	90233	genome.wustl.edu	37	19	58198238	58198238	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:58198238A>G	ENST00000282296.5	+	3	780	c.595A>G	c.(595-597)Act>Gct	p.T199A	AC003006.7_ENST00000599221.1_Intron|ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.T183A|AC003006.7_ENST00000594684.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ACACGAAGCCACTCCCAGTGG	0.493																																																	0													52.0	56.0	54.0					19																	58198238		2203	4300	6503	SO:0001583	missense	0			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.595A>G	19.37:g.58198238A>G	ENSP00000282296:p.Thr199Ala		B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T199A	ENST00000282296.5	37	c.595	CCDS12959.2	19	.	.	.	.	.	.	.	.	.	.	A	4.404	0.074629	0.08485	.	.	ENSG00000204519	ENST00000356715;ENST00000282296;ENST00000359821	.	.	.	1.92	-0.371	0.12525	Zinc finger, C2H2 (1);	.	.	.	.	T	0.38639	0.1048	L	0.60067	1.865	0.09310	N	1	B	0.19706	0.038	B	0.18561	0.022	T	0.39722	-0.9600	8	0.66056	D	0.02	.	3.7402	0.08527	0.3683:0.4735:0.1582:0.0	.	199	Q7Z340	ZN551_HUMAN	A	199;183;93	.	ENSP00000282296:T183A	T	+	1	0	ZNF551	62890050	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.124000	0.01318	-0.174000	0.10743	0.454000	0.30748	ACT	ZNF551	-	pfscan_Znf_C2H2	ENSG00000204519		0.493	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF551	HGNC	protein_coding	OTTHUMT00000466803.2	-	0.00	18	0	A	NM_138347		58198238	+1	tier1	-	no_errors	ENST00000282296	ensembl	human	known	74_37	missense	66.67	8	16	SNP	0.000	G
ZNF595	152687	genome.wustl.edu	37	4	53332	53332	+	5'UTR	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr4:53332G>A	ENST00000509152.2	+	0	135				ZNF595_ENST00000526473.2_5'UTR|ZNF595_ENST00000339368.6_3'UTR			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TGTGACCTGAGGGTATTGGAC	0.622																																																	0													116.0	129.0	125.0					4																	53332		1324	2309	3633	SO:0001623	5_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.-51G>A	4.37:g.53332G>A				RNA	SNP	-	NULL	ENST00000509152.2	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.622	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	ZNF595	HGNC	protein_coding	OTTHUMT00000357817.2	-	0.00	345	0	G	NM_182524		53332	+1	tier1	-	no_errors	ENST00000339368	ensembl	human	known	74_37	rna	15.89	180	34	SNP	0.000	A
ZNF729	100287226	genome.wustl.edu	37	19	22499579	22499579	+	Silent	SNP	G	G	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:22499579G>A	ENST00000601693.1	+	4	3478	c.3360G>A	c.(3358-3360)acG>acA	p.T1120T	ZNF729_ENST00000357491.6_Silent_p.T1092T			A6NN14	ZN729_HUMAN	zinc finger protein 729	1120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						CAACCCTTACGAAACATAAGA	0.368																																																	0																																										SO:0001819	synonymous_variant	0				CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3360G>A	19.37:g.22499579G>A			M0QY45	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T1120	ENST00000601693.1	37	c.3360	CCDS59368.1	19																																																																																			ZNF729	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196350		0.368	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF729	HGNC	protein_coding	OTTHUMT00000464396.1	-	0.00	34	0	G	XM_496301		22499579	+1	tier1	-	no_errors	ENST00000601693	ensembl	human	novel	74_37	silent	53.85	18	21	SNP	0.000	A
ZNF599	148103	genome.wustl.edu	37	19	35258224	35258224	+	Missense_Mutation	SNP	C	C	G	rs74834692	byFrequency	TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:35258224C>G	ENST00000329285.8	-	3	611	c.238G>C	c.(238-240)Gca>Cca	p.A80P	ZNF599_ENST00000588760.1_Missense_Mutation_p.A80P|ZNF599_ENST00000587354.2_Missense_Mutation_p.A80P	NM_001007248.2	NP_001007249.1	Q96NL3	ZN599_HUMAN	zinc finger protein 599	80	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|skin(1)	24	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			CACCAACCTGCGCAGGTGCTT	0.552																																																	0													83.0	66.0	72.0					19																	35258224		2203	4300	6503	SO:0001583	missense	0			AK055225	CCDS32991.1	19q13.13	2013-01-08				ENSG00000153896		"""Zinc fingers, C2H2-type"", ""-"""	26408	protein-coding gene	gene with protein product							Standard	NM_001007248		Approved	FLJ30663	uc010edn.1	Q96NL3		ENST00000329285.8:c.238G>C	19.37:g.35258224C>G	ENSP00000333802:p.Ala80Pro		Q569K0|Q5PRG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A80P	ENST00000329285.8	37	c.238	CCDS32991.1	19	.	.	.	.	.	.	.	.	.	.	T	0	-2.640249	0.00112	.	.	ENSG00000153896	ENST00000392231;ENST00000329285;ENST00000379196	T	0.21734	1.99	2.55	-5.11	0.02901	Krueppel-associated box (1);	.	.	.	.	T	0.03136	0.0092	N	0.00332	-1.63	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05225	-1.0898	9	0.02654	T	1	.	3.6096	0.08055	0.0834:0.3732:0.2247:0.3186	.	80	Q96NL3	ZN599_HUMAN	P	79;80;74	ENSP00000333802:A80P	ENSP00000333802:A80P	A	-	1	0	ZNF599	39950064	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.820000	0.00358	-4.385000	0.00052	-2.558000	0.00175	GCA	ZNF599	-	pfscan_Krueppel-associated_box	ENSG00000153896		0.552	ZNF599-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF599	HGNC	protein_coding	OTTHUMT00000460648.2	-	0.00	39	0	C	XM_086046		35258224	-1	tier1	-	no_errors	ENST00000329285	ensembl	human	known	74_37	missense	59.46	15	22	SNP	0.000	G
ZNF750	79755	genome.wustl.edu	37	17	80789738	80789738	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr17:80789738G>T	ENST00000269394.3	-	2	1426	c.593C>A	c.(592-594)tCg>tAg	p.S198*	ZNF750_ENST00000572562.1_Intron|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000355528.4_Intron|TBCD_ENST00000539345.2_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	198					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			GTGGAAGGCCGACTTGGTGTG	0.582																																																	0													58.0	61.0	60.0					17																	80789738		2203	4300	6503	SO:0001587	stop_gained	0			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.593C>A	17.37:g.80789738G>T	ENSP00000269394:p.Ser198*		Q9H899	Nonsense_Mutation	SNP	NULL	p.S198*	ENST00000269394.3	37	c.593	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	G	41	8.932089	0.99008	.	.	ENSG00000141579	ENST00000269394	.	.	.	5.66	4.7	0.59300	.	0.090866	0.48767	D	0.000171	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-25.3689	13.5441	0.61693	0.0748:0.0:0.9252:0.0	.	.	.	.	X	198	.	.	S	-	2	0	ZNF750	78383027	1.000000	0.71417	0.979000	0.43373	0.286000	0.27126	6.784000	0.75084	1.398000	0.46701	0.655000	0.94253	TCG	ZNF750	-	NULL	ENSG00000141579		0.582	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	-	0.00	24	0	G	NM_024702		80789738	-1	tier1	-	no_errors	ENST00000269394	ensembl	human	known	74_37	nonsense	76.47	4	13	SNP	0.998	T
ZNF780A	284323	genome.wustl.edu	37	19	40581754	40581754	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr19:40581754C>A	ENST00000595687.2	-	6	804	c.595G>T	c.(595-597)Ggg>Tgg	p.G199W	ZNF780A_ENST00000455521.1_Missense_Mutation_p.G200W|ZNF780A_ENST00000450241.2_Missense_Mutation_p.G165W|ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000340963.5_Missense_Mutation_p.G199W|AC005614.5_ENST00000595508.1_RNA|ZNF780A_ENST00000594395.1_Missense_Mutation_p.G200W	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AAGGCTTTCCCACACTCCTTA	0.378																																																	0													87.0	85.0	86.0					19																	40581754		2203	4300	6503	SO:0001583	missense	0			AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.595G>T	19.37:g.40581754C>A	ENSP00000472189:p.Gly199Trp		E9PB48|Q6ZN87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G200W	ENST00000595687.2	37	c.598	CCDS33026.2	19	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393321	0.62066	.	.	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	T;T	0.37411	1.2;1.2	1.92	0.811	0.18739	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.59362	0.2188	M	0.89414	3.03	0.34935	D	0.749759	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65335	-0.6193	9	0.87932	D	0	.	6.1569	0.20342	0.0:0.8209:0.0:0.1791	.	200;199	E9PB48;O75290	.;Z780A_HUMAN	W	199;200;199	ENSP00000400997:G200W;ENSP00000341507:G199W	ENSP00000341507:G199W	G	-	1	0	ZNF780A	45273594	0.652000	0.27349	0.195000	0.23364	0.762000	0.43233	1.182000	0.32029	0.124000	0.18369	0.305000	0.20034	GGG	ZNF780A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197782		0.378	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF780A	HGNC	protein_coding	OTTHUMT00000470066.1	-	0.00	57	0	C	NM_001010880		40581754	-1	tier1	-	no_errors	ENST00000455521	ensembl	human	known	74_37	missense	43.24	42	32	SNP	1.000	A
ZRANB2	9406	genome.wustl.edu	37	1	71535064	71535065	+	Intron	INS	-	-	T			TCGA-LN-A49Y-01A-11D-A27G-09	TCGA-LN-A49Y-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	554d5940-81b2-4d30-8f95-ca4680d23b18	78f201b5-47a9-4fcc-bff1-a93fa936ed65	g.chr1:71535064_71535065insT	ENST00000370920.3	-	8	985				ZRANB2_ENST00000477096.1_5'Flank|ZRANB2_ENST00000254821.6_Intron|MIR186_ENST00000384988.1_RNA|ZRANB2-AS1_ENST00000450461.1_RNA|ZRANB2-AS1_ENST00000426999.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						ACATGGAACGATTTTTTTTTTC	0.376																																																	0																																										SO:0001627	intron_variant	0			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.684-19->A	1.37:g.71535074_71535074dupT			D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	RNA	INS	-	NULL	ENST00000370920.3	37	NULL	CCDS659.1	1																																																																																			ZRANB2	-	-	ENSG00000132485		0.376	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1		0.00	43	0	-	NM_203350		71535065	-1	tier1		no_errors	ENST00000487510	ensembl	human	known	74_37	rna	8.51	43	4	INS	0.991:1.000	T
