#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA17P	650655	genome.wustl.edu	37	16	2415790	2415790	+	RNA	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:2415790A>G	ENST00000469908.1	+	0	646					NR_003574.1				ATP-binding cassette, sub-family A (ABC1), member 17, pseudogene																		AATGACAGCAATGGATCTTTG	0.418																																																	0																																												0			DQ266102		16p13.3	2012-03-14	2010-03-12		ENSG00000238098	ENSG00000238098		"""ATP binding cassette transporters / subfamily A"""	32972	pseudogene	pseudogene						16968533	Standard	NR_003574		Approved		uc002cqc.1		OTTHUMG00000154348		16.37:g.2415790A>G				RNA	SNP	-	NULL	ENST00000469908.1	37	NULL		16																																																																																			ABCA17P	-	-	ENSG00000238098		0.418	ABCA17P-002	KNOWN	basic	processed_transcript	ABCA17P	HGNC	pseudogene	OTTHUMT00000334904.1	-	0.00	40	0	A	NR_003574		2415790	+1	tier1	-	no_errors	ENST00000469908	ensembl	human	known	74_37	rna	41.38	33	24	SNP	0.000	G
ABCA9	10350	genome.wustl.edu	37	17	67016582	67016582	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:67016582T>C	ENST00000340001.4	-	19	2758	c.2547A>G	c.(2545-2547)atA>atG	p.I849M	ABCA9_ENST00000453985.2_Missense_Mutation_p.I849M|ABCA9_ENST00000370732.2_Missense_Mutation_p.I849M|ABCA9-AS1_ENST00000458677.1_RNA	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	849					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GAACTTTTGCTATTGCACAGA	0.418																																																	0													95.0	93.0	94.0					17																	67016582		2203	4300	6503	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.2547A>G	17.37:g.67016582T>C	ENSP00000342216:p.Ile849Met		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I849M	ENST00000340001.4	37	c.2547	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	T	12.78	2.041969	0.35989	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	T;T	0.78595	-1.19;-1.19	5.08	-4.55	0.03441	.	0.619375	0.14471	N	0.317557	T	0.58424	0.2121	L	0.31578	0.945	0.24301	N	0.995126	B;B	0.30914	0.3;0.106	B;B	0.37550	0.253;0.042	T	0.53136	-0.8481	10	0.13470	T	0.59	.	3.9693	0.09446	0.1134:0.4367:0.1218:0.3281	.	849;849	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	M	849;832;849;844	ENSP00000342216:I849M;ENSP00000359767:I849M	ENSP00000342216:I849M	I	-	3	3	ABCA9	64528177	0.078000	0.21339	0.812000	0.32479	0.977000	0.68977	-0.869000	0.04232	-0.476000	0.06842	-0.427000	0.05922	ATA	ABCA9	-	NULL	ENSG00000154258		0.418	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	-	0.00	29	0	T	NM_172386		67016582	-1	tier1	-	no_errors	ENST00000340001	ensembl	human	known	74_37	missense	56.25	7	9	SNP	0.730	C
ADAM9	8754	genome.wustl.edu	37	8	38871570	38871570	+	Intron	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:38871570A>G	ENST00000487273.2	+	4	411				ADAM9_ENST00000481513.1_Missense_Mutation_p.Y114C|ADAM9_ENST00000466936.1_Intron	NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9						activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			CAGGTAATGTATTTTTCTCTT	0.358																																																	0													92.0	93.0	93.0					8																	38871570		2203	4299	6502	SO:0001627	intron_variant	0			U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.333+8A>G	8.37:g.38871570A>G			B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	pfam_Peptidase_M12B_N	p.Y114C	ENST00000487273.2	37	c.341	CCDS6112.1	8	.	.	.	.	.	.	.	.	.	.	A	3.006	-0.204878	0.06180	.	.	ENSG00000168615	ENST00000481513	T	0.17370	2.28	4.85	-2.29	0.06805	.	.	.	.	.	T	0.07052	0.0179	.	.	.	0.24849	N	0.992411	B	0.02656	0.0	B	0.06405	0.002	T	0.39722	-0.9600	7	.	.	.	.	0.6061	0.00753	0.38:0.1345:0.2745:0.2109	.	114	C9J6H5	.	C	114	ENSP00000417066:Y114C	.	Y	+	2	0	ADAM9	38990727	0.000000	0.05858	0.100000	0.21137	0.027000	0.11550	-0.666000	0.05280	-0.145000	0.11294	-0.274000	0.10170	TAT	ADAM9	-	NULL	ENSG00000168615		0.358	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM9	HGNC	protein_coding	OTTHUMT00000357291.2	-	0.00	36	0	A			38871570	+1	tier1	-	no_errors	ENST00000481513	ensembl	human	putative	74_37	missense	50.00	10	10	SNP	0.120	G
ADCYAP1R1	117	genome.wustl.edu	37	7	31121353	31121353	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:31121353C>G	ENST00000304166.4	+	6	601	c.312C>G	c.(310-312)aaC>aaG	p.N104K	ADCYAP1R1_ENST00000409363.1_Intron|ADCYAP1R1_ENST00000396211.2_Missense_Mutation_p.N104K|ADCYAP1R1_ENST00000409489.1_Missense_Mutation_p.N104K	NM_001118.4|NM_001199635.1|NM_001199636.1	NP_001109.2|NP_001186564.1|NP_001186565.1	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1 (pituitary) receptor type I	104					activation of adenylate cyclase activity (GO:0007190)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(1)|large_intestine(4)|liver(2)|lung(24)|ovary(1)|skin(2)|stomach(1)	35						GTGACAGTAACTCCTTAGATC	0.488																																					Ovarian(44;225 1186 2158 11092)												0													156.0	139.0	145.0					7																	31121353		2203	4300	6503	SO:0001583	missense	0				CCDS5433.1, CCDS56480.1, CCDS56481.1	7p14.3	2012-09-20			ENSG00000078549	ENSG00000078549		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	242	protein-coding gene	gene with protein product	"""PACAP receptor 1"""	102981				7902709	Standard	NM_001199635		Approved	PAC1, PACAPR, PAC1R	uc003tcg.3	P41586	OTTHUMG00000023884	ENST00000304166.4:c.312C>G	7.37:g.31121353C>G	ENSP00000306620:p.Asn104Lys		A8K1Y1|B7ZLA7|B8ZZK3|Q17S10	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_PACAP_1_rcpt,prints_GPCR_2_secretin-like	p.N104K	ENST00000304166.4	37	c.312	CCDS5433.1	7	.	.	.	.	.	.	.	.	.	.	C	8.525	0.869740	0.17322	.	.	ENSG00000078549	ENST00000304166;ENST00000396211;ENST00000409489	T;T;T	0.46451	1.2;0.87;0.88	4.7	-0.811	0.10857	GPCR, family 2, extracellular hormone receptor domain (3);	0.871539	0.10325	N	0.688268	T	0.27967	0.0689	L	0.46157	1.445	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.001;0.001;0.004;0.001	T	0.27739	-1.0065	10	0.33940	T	0.23	.	0.6827	0.00878	0.3257:0.3195:0.1594:0.1954	.	104;104;104;104	B7ZLA7;Q17S10;E9PFU5;P41586	.;.;.;PACR_HUMAN	K	104	ENSP00000306620:N104K;ENSP00000379514:N104K;ENSP00000386395:N104K	ENSP00000306620:N104K	N	+	3	2	ADCYAP1R1	31087878	0.681000	0.27614	0.221000	0.23827	0.998000	0.95712	0.094000	0.15107	0.009000	0.14813	0.655000	0.94253	AAC	ADCYAP1R1	-	pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,prints_GPCR_2_PACAP_1_rcpt	ENSG00000078549		0.488	ADCYAP1R1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADCYAP1R1	HGNC	protein_coding	OTTHUMT00000215041.3	-	0.00	62	0	C	NM_001118		31121353	+1	tier1	-	no_errors	ENST00000304166	ensembl	human	known	74_37	missense	29.41	72	30	SNP	0.040	G
AIM1	202	genome.wustl.edu	37	6	106967551	106967551	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:106967551G>A	ENST00000369066.3	+	2	1731	c.1244G>A	c.(1243-1245)aGc>aAc	p.S415N		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GCTGCAGACAGCAAAAGCCTT	0.488																																																	0													90.0	90.0	90.0					6																	106967551		2203	4300	6503	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1244G>A	6.37:g.106967551G>A	ENSP00000358062:p.Ser415Asn		Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.S415N	ENST00000369066.3	37	c.1244	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229796	0.58777	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.76316	-1.01	5.93	3.19	0.36642	.	0.236387	0.30392	N	0.009722	T	0.54224	0.1845	M	0.61703	1.905	0.19300	N	0.999979	B	0.12630	0.006	B	0.08055	0.003	T	0.55673	-0.8104	10	0.72032	D	0.01	.	5.1866	0.15187	0.2328:0.0:0.6243:0.1428	.	415	Q9Y4K1	AIM1_HUMAN	N	823;415	ENSP00000358062:S415N	ENSP00000285105:S823N	S	+	2	0	AIM1	107074244	0.004000	0.15560	0.055000	0.19348	0.029000	0.11900	0.884000	0.28214	0.862000	0.35528	0.655000	0.94253	AGC	AIM1	-	NULL	ENSG00000112297		0.488	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	-	0.00	31	0	G			106967551	+1	tier1	-	no_errors	ENST00000369066	ensembl	human	known	74_37	missense	18.18	18	4	SNP	0.003	A
ANKRD32	84250	genome.wustl.edu	37	5	93990336	93990336	+	Splice_Site	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:93990336A>G	ENST00000265140.5	+	9	1453	c.1034A>G	c.(1033-1035)aAa>aGa	p.K345R		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	345						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TATATGCAGAAAGAAATGAAG	0.313																																																	0													85.0	76.0	79.0					5																	93990336		692	1587	2279	SO:0001630	splice_region_variant	0			AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.1033-1A>G	5.37:g.93990336A>G			B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K345R	ENST00000265140.5	37	c.1034	CCDS4071.2	5	.	.	.	.	.	.	.	.	.	.	A	10.36	1.328352	0.24080	.	.	ENSG00000133302	ENST00000265140	T	0.61392	0.11	4.82	3.57	0.40892	.	0.152789	0.30820	N	0.008809	T	0.47322	0.1439	L	0.50333	1.59	0.25123	N	0.990629	B	0.26635	0.155	B	0.24155	0.051	T	0.47407	-0.9120	10	0.62326	D	0.03	.	7.3168	0.26505	0.8046:0.0:0.0:0.1954	.	345	Q9BQI6	ANR32_HUMAN	R	345	ENSP00000265140:K345R	ENSP00000265140:K345R	K	+	2	0	ANKRD32	94016092	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	1.795000	0.38784	2.148000	0.66965	0.533000	0.62120	AAA	ANKRD32	-	NULL	ENSG00000133302		0.313	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD32	HGNC	protein_coding	OTTHUMT00000241610.1		0.00	60	0	A	NM_032290	Missense_Mutation	93990336	+1			no_errors	ENST00000265140	ensembl	human	known	74_37	missense	10.00	45	5	SNP	1.000	G
AOC3	8639	genome.wustl.edu	37	17	41004906	41004906	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:41004906C>G	ENST00000308423.2	+	1	1706	c.1546C>G	c.(1546-1548)Ctg>Gtg	p.L516V	AOC3_ENST00000591562.1_5'Flank	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	516					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	AGAGCACACCCTGGGCACGGT	0.542																																					NSCLC(3;192 220 10664 11501 16477)												0													72.0	63.0	66.0					17																	41004906		2203	4300	6503	SO:0001583	missense	0			AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1546C>G	17.37:g.41004906C>G	ENSP00000312326:p.Leu516Val		B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.L516V	ENST00000308423.2	37	c.1546	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	C	14.38	2.518964	0.44866	.	.	ENSG00000131471	ENST00000308423	T	0.04015	3.73	5.26	4.29	0.51040	Copper amine oxidase, C-terminal (3);	0.000000	0.64402	D	0.000003	T	0.18923	0.0454	M	0.75150	2.29	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.02378	-1.1168	10	0.27785	T	0.31	.	13.9543	0.64137	0.0:0.9267:0.0:0.0733	.	516	Q16853	AOC3_HUMAN	V	516	ENSP00000312326:L516V	ENSP00000312326:L516V	L	+	1	2	AOC3	38258432	0.984000	0.35163	0.995000	0.50966	0.132000	0.20833	2.674000	0.46867	1.372000	0.46190	0.655000	0.94253	CTG	AOC3	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000131471		0.542	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1	-	0.00	42	0	C	NM_003734		41004906	+1	tier1	-	no_errors	ENST00000308423	ensembl	human	known	74_37	missense	66.67	6	12	SNP	1.000	G
ARID2	196528	genome.wustl.edu	37	12	46299425	46299425	+	3'UTR	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:46299425A>G	ENST00000334344.6	+	0	6244				ARID2_ENST00000457135.1_3'UTR|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)						chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GAGCCAATATATTTTCACTTA	0.363			"""N, S, F"""		hepatocellular carcinoma																																			Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.*564A>G	12.37:g.46299425A>G			Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	RNA	SNP	-	NULL	ENST00000334344.6	37	NULL	CCDS31783.1	12																																																																																			ARID2	-	-	ENSG00000189079		0.363	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	-	0.00	56	0	A	XM_350875		46299425	+1	tier1	-	no_errors	ENST00000479608	ensembl	human	known	74_37	rna	30.00	28	12	SNP	1.000	G
ARMC3	219681	genome.wustl.edu	37	10	23257303	23257303	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:23257303G>T	ENST00000298032.5	+	8	885	c.801G>T	c.(799-801)atG>atT	p.M267I	ARMC3_ENST00000409983.3_Missense_Mutation_p.M267I|ARMC3_ENST00000409049.3_Missense_Mutation_p.M267I|ARMC3_ENST00000376528.4_Missense_Mutation_p.M4I	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	267						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGGATACTATGGTGCAGATTC	0.373																																																	0													75.0	75.0	75.0					10																	23257303		2203	4300	6503	SO:0001583	missense	0			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.801G>T	10.37:g.23257303G>T	ENSP00000298032:p.Met267Ile		A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.M267I	ENST00000298032.5	37	c.801	CCDS7142.1	10	.	.	.	.	.	.	.	.	.	.	G	2.412	-0.335201	0.05278	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.45668	0.89;0.89;1.53;2.39	5.77	1.66	0.24008	Armadillo-like helical (1);Armadillo-type fold (1);	0.479888	0.26503	N	0.024014	T	0.28797	0.0714	L	0.47716	1.5	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.002	T	0.16512	-1.0400	10	0.18710	T	0.47	-5.7929	5.7032	0.17893	0.1914:0.0:0.5673:0.2413	.	267;267	Q5W041-4;Q5W041	.;ARMC3_HUMAN	I	267;267;203;267;4	ENSP00000298032:M267I;ENSP00000386943:M267I;ENSP00000387288:M267I;ENSP00000365711:M4I	ENSP00000298032:M267I	M	+	3	0	ARMC3	23297309	0.997000	0.39634	0.004000	0.12327	0.003000	0.03518	2.252000	0.43196	0.408000	0.25621	-0.143000	0.13931	ATG	ARMC3	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000165309		0.373	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	HGNC	protein_coding	OTTHUMT00000047197.2	-	0.00	22	0	G	NM_173081		23257303	+1	tier1	-	no_errors	ENST00000298032	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.009	T
ASB15	142685	genome.wustl.edu	37	7	123264623	123264623	+	Splice_Site	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:123264623C>A	ENST00000451558.1	+	10	973	c.452C>A	c.(451-453)gCt>gAt	p.A151D	ASB15_ENST00000275699.3_Splice_Site_p.A151D|RP11-390E23.3_ENST00000422401.1_RNA|ASB15_ENST00000434204.1_Splice_Site_p.A151D|RP11-390E23.3_ENST00000451016.1_RNA|ASB15_ENST00000451215.1_Splice_Site_p.A151D|RP11-390E23.3_ENST00000429396.1_RNA|RP11-390E23.3_ENST00000440504.1_RNA|ASB15_ENST00000540573.1_Splice_Site_p.A151D|RP11-390E23.3_ENST00000418409.1_RNA			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	151					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						CATTTTCAAGCTGTGAAAAAG	0.358																																																	0													99.0	93.0	95.0					7																	123264623		2203	4300	6503	SO:0001630	splice_region_variant	0			AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.452-1C>A	7.37:g.123264623C>A			Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.A151D	ENST00000451558.1	37	c.452	CCDS34742.1	7	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748166	0.69533	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000447789;ENST00000275699	T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.39;-1.49	5.74	5.74	0.90152	Ankyrin repeat-containing domain (4);	0.075160	0.56097	D	0.000037	D	0.94489	0.8226	H	0.98883	4.36	0.80722	D	1	D	0.69078	0.997	D	0.74348	0.983	D	0.96110	0.9076	9	.	.	.	.	19.8775	0.96884	0.0:1.0:0.0:0.0	.	151	Q8WXK1	ASB15_HUMAN	D	151	ENSP00000397655:A151D;ENSP00000390963:A151D;ENSP00000416433:A151D;ENSP00000438643:A151D;ENSP00000401166:A151D;ENSP00000275699:A151D	.	A	+	2	0	ASB15	123051859	1.000000	0.71417	0.999000	0.59377	0.269000	0.26545	7.198000	0.77823	2.873000	0.98535	0.561000	0.74099	GCT	ASB15	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000146809		0.358	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB15	HGNC	protein_coding	OTTHUMT00000347493.1	-	0.00	36	0	C		Missense_Mutation	123264623	+1	tier1	-	no_errors	ENST00000275699	ensembl	human	known	74_37	missense	85.71	3	18	SNP	1.000	A
ATP1A1	476	genome.wustl.edu	37	1	116931580	116931580	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:116931580C>T	ENST00000295598.5	+	7	945	c.693C>T	c.(691-693)ttC>ttT	p.F231F	ATP1A1_ENST00000537345.1_Silent_p.F231F|ATP1A1_ENST00000369496.4_Silent_p.F200F|ATP1A1_ENST00000491156.1_3'UTR	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	231					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	CTCCAGATTTCACAAATGAAA	0.443																																																	0													86.0	90.0	89.0					1																	116931580		2203	4300	6503	SO:0001819	synonymous_variant	0			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.693C>T	1.37:g.116931580C>T			B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.F231	ENST00000295598.5	37	c.693	CCDS887.1	1																																																																																			ATP1A1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000163399		0.443	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1A1	HGNC	protein_coding	OTTHUMT00000033481.5		0.00	19	0	C	NM_001160233		116931580	+1			no_errors	ENST00000295598	ensembl	human	known	74_37	silent	14.29	12	2	SNP	1.000	T
ATP1A1	476	genome.wustl.edu	37	1	116939316	116939316	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:116939316G>T	ENST00000295598.5	+	14	2185	c.1933G>T	c.(1933-1935)Gct>Tct	p.A645S	ATP1A1_ENST00000537345.1_Missense_Mutation_p.A645S|ATP1A1_ENST00000369496.4_Missense_Mutation_p.A614S	NM_000701.7	NP_000692.2	P05023	AT1A1_HUMAN	ATPase, Na+/K+ transporting, alpha 1 polypeptide	645					ATP biosynthetic process (GO:0006754)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|membrane hyperpolarization (GO:0060081)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of glucocorticoid biosynthetic process (GO:0031947)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart contraction (GO:0045823)|positive regulation of striated muscle contraction (GO:0045989)|potassium ion import (GO:0010107)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of sodium ion transport (GO:0002028)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|chaperone binding (GO:0051087)|phosphatase activity (GO:0016791)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(2)|breast(2)|cervix(3)|endometrium(2)|kidney(5)|large_intestine(9)|lung(17)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Ciclopirox(DB01188)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Ethacrynic acid(DB00903)|Hydroflumethiazide(DB00774)|Ouabain(DB01092)|Trichlormethiazide(DB01021)	GGAAGACATTGCTGCCCGCCT	0.493																																																	0													111.0	94.0	100.0					1																	116939316		2203	4300	6503	SO:0001583	missense	0			D00099	CCDS887.1, CCDS53351.1, CCDS53352.1	1p13	2012-10-22			ENSG00000163399	ENSG00000163399	3.6.3.9	"""ATPases / P-type"""	799	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-1"", ""sodium pump subunit alpha-1"", ""sodium-potassium ATPase catalytic subunit alpha-1"""	182310					Standard	NM_000701		Approved		uc001ege.3	P05023	OTTHUMG00000012109	ENST00000295598.5:c.1933G>T	1.37:g.116939316G>T	ENSP00000295598:p.Ala645Ser		B2RBR6|B7Z2T5|B7Z3U6|F5H3A1|Q16689|Q6LDM4|Q9UCN1|Q9UJ20|Q9UJ21	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.A645S	ENST00000295598.5	37	c.1933	CCDS887.1	1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008386	0.93346	.	.	ENSG00000163399	ENST00000295598;ENST00000537345;ENST00000369496	D;D;D	0.94862	-3.54;-3.54;-3.53	5.14	5.14	0.70334	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.000000	0.85682	D	0.000000	D	0.96062	0.8717	L	0.52905	1.665	0.80722	D	1	B;B	0.26445	0.01;0.149	B;P	0.53266	0.311;0.722	D	0.94860	0.8021	10	0.56958	D	0.05	.	18.8017	0.92021	0.0:0.0:1.0:0.0	.	645;645	F5H3A1;P05023	.;AT1A1_HUMAN	S	645;645;614	ENSP00000295598:A645S;ENSP00000445306:A645S;ENSP00000358508:A614S	ENSP00000295598:A645S	A	+	1	0	ATP1A1	116740839	1.000000	0.71417	0.996000	0.52242	0.872000	0.50106	9.657000	0.98554	2.665000	0.90641	0.467000	0.42956	GCT	ATP1A1	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000163399		0.493	ATP1A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP1A1	HGNC	protein_coding	OTTHUMT00000033481.5	-	0.00	55	0	G	NM_001160233		116939316	+1	tier1	-	no_errors	ENST00000295598	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176926897	176926897	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:176926897G>T	ENST00000367654.3	-	11	2039	c.1828C>A	c.(1828-1830)Cgc>Agc	p.R610S	ASTN1_ENST00000424564.2_Missense_Mutation_p.R602S|ASTN1_ENST00000367657.3_Missense_Mutation_p.R602S|ASTN1_ENST00000361833.2_Missense_Mutation_p.R602S|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	610	EGF-like 2.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CTGCAGTCGCGCACCGGCCCA	0.552																																																	0													64.0	60.0	61.0					1																	176926897		2203	4300	6503	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.1828C>A	1.37:g.176926897G>T	ENSP00000356626:p.Arg610Ser		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.R610S	ENST00000367654.3	37	c.1828		1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.131534	0.77662	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.17691	2.26;2.67;2.67;2.26	5.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.30885	0.0779	L	0.29908	0.895	0.58432	D	0.999998	D;D;D	0.71674	0.998;0.992;0.992	D;D;D	0.80764	0.994;0.979;0.979	T	0.04708	-1.0932	10	0.66056	D	0.02	-17.9623	16.827	0.85934	0.0:0.0:0.8627:0.1372	.	610;602;602	O14525;O14525-2;B1AJS1	ASTN1_HUMAN;.;.	S	602;602;610;602;602	ENSP00000356629:R602S;ENSP00000354536:R602S;ENSP00000356626:R610S;ENSP00000395041:R602S	ENSP00000354536:R602S	R	-	1	0	ASTN1	175193520	1.000000	0.71417	0.997000	0.53966	0.921000	0.55340	4.579000	0.60936	2.618000	0.88619	0.563000	0.77884	CGC	ASTN1	-	NULL	ENSG00000152092		0.552	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding			0.00	38	0	G	NM_004319		176926897	-1			no_errors	ENST00000367654	ensembl	human	known	74_37	missense	8.11	34	3	SNP	1.000	T
ATP8A1	10396	genome.wustl.edu	37	4	42425657	42425657	+	Silent	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:42425657C>G	ENST00000381668.5	-	34	3420	c.3189G>C	c.(3187-3189)ctG>ctC	p.L1063L	ATP8A1_ENST00000264449.10_Silent_p.L1048L	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	1063					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	CATCAAGGAGCAGAGATGCCA	0.383																																																	0													84.0	74.0	77.0					4																	42425657		2203	4300	6503	SO:0001819	synonymous_variant	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.3189G>C	4.37:g.42425657C>G			Q32M35|Q32M36|Q4W5J7|Q4W5P2	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L1063	ENST00000381668.5	37	c.3189	CCDS3466.1	4																																																																																			ATP8A1	-	tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.383	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	29	0	C	NM_006095		42425657	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	silent	76.19	5	16	SNP	1.000	G
AXIN1	8312	genome.wustl.edu	37	16	396856	396856	+	Missense_Mutation	SNP	G	G	C	rs574168909		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:396856G>C	ENST00000262320.3	-	2	541	c.170C>G	c.(169-171)tCg>tGg	p.S57W	AXIN1_ENST00000354866.3_Missense_Mutation_p.S57W|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	57					activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				AGTGGCCGTCGAAGTCTCACC	0.612											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													39.0	38.0	39.0					16																	396856		2203	4300	6503	SO:0001583	missense	0			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.170C>G	16.37:g.396856G>C	ENSP00000262320:p.Ser57Trp	588	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	pfam_DIX,pfam_RGS_dom,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S57W	ENST00000262320.3	37	c.170	CCDS10405.1	16	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711791	0.48517	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.63096	-0.02;-0.01	5.34	5.34	0.76211	.	0.115297	0.64402	D	0.000010	T	0.79137	0.4395	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.80832	-0.1206	10	0.66056	D	0.02	-11.5976	18.035	0.89298	0.0:0.0:1.0:0.0	.	57;57	O15169-2;O15169	.;AXIN1_HUMAN	W	57	ENSP00000262320:S57W;ENSP00000346935:S57W	ENSP00000262320:S57W	S	-	2	0	AXIN1	336857	1.000000	0.71417	0.716000	0.30569	0.145000	0.21501	9.409000	0.97331	2.522000	0.85027	0.655000	0.94253	TCG	AXIN1	-	NULL	ENSG00000103126		0.612	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXIN1	HGNC	protein_coding	OTTHUMT00000139441.3	-	0.00	28	0	G			396856	-1	tier1	-	no_errors	ENST00000262320	ensembl	human	known	74_37	missense	34.38	21	11	SNP	0.991	C
BCHE	590	genome.wustl.edu	37	3	165548781	165548781	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:165548781A>T	ENST00000264381.3	-	2	207	c.41T>A	c.(40-42)tTt>tAt	p.F14Y	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	14					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AAGAAACCAAAAGAGAAATCT	0.343																																																	0													44.0	40.0	41.0					3																	165548781		2203	4299	6502	SO:0001583	missense	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.41T>A	3.37:g.165548781A>T	ENSP00000264381:p.Phe14Tyr		A8K7P8	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.F14Y	ENST00000264381.3	37	c.41	CCDS3198.1	3	.	.	.	.	.	.	.	.	.	.	A	3.118	-0.181120	0.06380	.	.	ENSG00000114200	ENST00000264381	T	0.67698	-0.28	5.46	4.32	0.51571	Carboxylesterase, type B (1);	1.226500	0.05604	N	0.576974	T	0.51601	0.1684	N	0.14661	0.345	0.25768	N	0.984867	B	0.29378	0.243	B	0.35278	0.199	T	0.39482	-0.9612	10	0.07325	T	0.83	.	10.0389	0.42146	0.921:0.0:0.079:0.0	.	14	P06276	CHLE_HUMAN	Y	14	ENSP00000264381:F14Y	ENSP00000264381:F14Y	F	-	2	0	BCHE	167031475	0.005000	0.15991	0.018000	0.16275	0.358000	0.29455	2.321000	0.43805	2.077000	0.62373	0.460000	0.39030	TTT	BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.343	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	-	0.00	38	0	A			165548781	-1	tier1	-	no_errors	ENST00000264381	ensembl	human	known	74_37	missense	17.78	36	8	SNP	0.007	T
BMP8B	656	genome.wustl.edu	37	1	40230649	40230649	+	Intron	SNP	C	C	T	rs111816339		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:40230649C>T	ENST00000372827.3	-	4	1049				BMP8B_ENST00000397360.2_Silent_p.K235K	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b						cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCCTGGAGTCCTTGGTCCAGC	0.637																																																	0																																										SO:0001627	intron_variant	0			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.674-160G>A	1.37:g.40230649C>T			E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Silent	SNP	pfam_TGF-b_N	p.K235	ENST00000372827.3	37	c.705	CCDS444.1	1																																																																																			BMP8B	-	NULL	ENSG00000116985		0.637	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	HGNC	protein_coding	OTTHUMT00000025641.1	-	0.00	27	0	C	NM_001720		40230649	-1	tier1	rs201039967	no_errors	ENST00000397360	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.000	T
BMPR2	659	genome.wustl.edu	37	2	203420310	203420310	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:203420310A>G	ENST00000374580.4	+	12	2461	c.1922A>G	c.(1921-1923)cAt>cGt	p.H641R	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	641					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						ACAAATCTGCATACCACAAAT	0.458																																																	0													105.0	101.0	102.0					2																	203420310		2203	4300	6503	SO:0001583	missense	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1922A>G	2.37:g.203420310A>G	ENSP00000363708:p.His641Arg		Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H641R	ENST00000374580.4	37	c.1922	CCDS33361.1	2	.	.	.	.	.	.	.	.	.	.	A	11.85	1.762080	0.31228	.	.	ENSG00000204217	ENST00000374580	D	0.88818	-2.43	5.78	4.64	0.57946	.	0.000000	0.64402	D	0.000003	T	0.77445	0.4131	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.71140	-0.4679	10	0.23891	T	0.37	.	9.3353	0.38047	0.8641:0.0:0.1359:0.0	.	641	Q13873	BMPR2_HUMAN	R	641	ENSP00000363708:H641R	ENSP00000363708:H641R	H	+	2	0	BMPR2	203128555	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.480000	0.53172	2.204000	0.70986	0.528000	0.53228	CAT	BMPR2	-	NULL	ENSG00000204217		0.458	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	-	0.00	22	0	A	NM_001204		203420310	+1	tier1	-	no_errors	ENST00000374580	ensembl	human	known	74_37	missense	30.00	7	3	SNP	0.994	G
BRDT	676	genome.wustl.edu	37	1	92470076	92470076	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:92470076G>A	ENST00000362005.3	+	18	2912	c.2494G>A	c.(2494-2496)Gca>Aca	p.A832T	BRDT_ENST00000399546.2_Missense_Mutation_p.A832T|BRDT_ENST00000402388.1_Missense_Mutation_p.A832T|BRDT_ENST00000394530.3_Missense_Mutation_p.A786T|BRDT_ENST00000370389.2_Missense_Mutation_p.A759T	NM_001242805.1	NP_001229734	Q58F21	BRDT_HUMAN	bromodomain, testis-specific	832					cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|histone displacement (GO:0001207)|male meiosis (GO:0007140)|male meiosis I (GO:0007141)|mRNA processing (GO:0006397)|positive regulation of transcription during meiosis (GO:0051039)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(24)|ovary(1)|prostate(4)|skin(2)|stomach(2)|urinary_tract(2)	56		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		ATTTAGAAAAGCAGCCATAGA	0.373																																																	0													81.0	89.0	87.0					1																	92470076		2202	4298	6500	SO:0001583	missense	0			AF019085	CCDS735.1, CCDS55615.1, CCDS55616.1, CCDS72820.1	1p22.1	2010-12-23			ENSG00000137948	ENSG00000137948			1105	protein-coding gene	gene with protein product	"""cancer/testis antigen 9"""	602144				9367677	Standard	NM_001726		Approved	BRD6, CT9	uc010osz.2	Q58F21	OTTHUMG00000010113	ENST00000362005.3:c.2494G>A	1.37:g.92470076G>A	ENSP00000354568:p.Ala832Thr		A6NF68|B7Z811|B7Z890|B7ZAX7|D3DT32|O14789|Q05DQ4|Q6P5T1|Q7Z4A6|Q8IWI6	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.A832T	ENST00000362005.3	37	c.2494	CCDS735.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.029829	0.93575	.	.	ENSG00000137948	ENST00000362005;ENST00000370389;ENST00000399546;ENST00000394530;ENST00000402388	T;T;T;T;T	0.09350	3.02;2.99;3.02;3.04;3.02	5.49	5.49	0.81192	.	0.126644	0.35555	N	0.003131	T	0.18800	0.0451	M	0.76328	2.33	0.47341	D	0.999399	D;D;D;D	0.58268	0.964;0.964;0.982;0.964	P;P;P;P	0.52554	0.563;0.563;0.702;0.563	T	0.00819	-1.1553	10	0.87932	D	0	-19.6259	18.1405	0.89638	0.0:0.0:1.0:0.0	.	786;786;836;832	B7ZAX7;B7Z811;B7Z890;Q58F21	.;.;.;BRDT_HUMAN	T	832;759;832;786;832	ENSP00000354568:A832T;ENSP00000359416:A759T;ENSP00000387822:A832T;ENSP00000378038:A786T;ENSP00000384051:A832T	ENSP00000354568:A832T	A	+	1	0	BRDT	92242664	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.324000	0.72896	2.579000	0.87056	0.484000	0.47621	GCA	BRDT	-	NULL	ENSG00000137948		0.373	BRDT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRDT	HGNC	protein_coding	OTTHUMT00000027980.2	-	0.00	45	0	G	NM_207189		92470076	+1	tier1	-	no_errors	ENST00000362005	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	A
C17orf58	284018	genome.wustl.edu	37	17	65989212	65989213	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:65989212_65989213insA	ENST00000449250.2	-	2	239_240	c.50_51insT	c.(49-51)atgfs	p.M17fs	RP11-855A2.5_ENST00000580729.1_lincRNA|C17orf58_ENST00000334461.7_Frame_Shift_Ins_p.M17fs|C17orf58_ENST00000536693.1_Frame_Shift_Ins_p.M17fs			Q2M2W7	CQ058_HUMAN	chromosome 17 open reading frame 58	17										lung(2)	2	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCAGGGCTAACATGTGGACTCG	0.554																																																	0																																										SO:0001589	frameshift_variant	0			AK026583	CCDS42375.1, CCDS45765.1	17q24.2	2012-10-11			ENSG00000186665	ENSG00000186665			27568	protein-coding gene	gene with protein product						12477932	Standard	NM_181656		Approved		uc002jgi.4	Q2M2W7	OTTHUMG00000179782	ENST00000449250.2:c.51dupT	17.37:g.65989213_65989213dupA	ENSP00000402020:p.Met17fs		A8MQV2	Frame_Shift_Ins	INS	superfamily_TIMP-like_OB-fold	p.M17fs	ENST00000449250.2	37	c.51_50	CCDS45765.1	17																																																																																			C17orf58	-	superfamily_TIMP-like_OB-fold	ENSG00000186665		0.554	C17orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf58	HGNC	protein_coding	OTTHUMT00000448104.1		0.00	47	0	-	NM_181656		65989213	-1	tier1		no_errors	ENST00000449250	ensembl	human	known	74_37	frame_shift_ins	68.25	20	43	INS	0.000:0.176	A
C9orf64	84267	genome.wustl.edu	37	9	86570359	86570359	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:86570359C>T	ENST00000376344.3	-	2	750	c.534G>A	c.(532-534)gcG>gcA	p.A178A	C9orf64_ENST00000314700.1_Silent_p.A37A|C9orf64_ENST00000376340.2_Silent_p.A37A	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	178										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						TTAACTTCTGCGCACTATTCT	0.433																																																	0													67.0	63.0	64.0					9																	86570359		2203	4300	6503	SO:0001819	synonymous_variant	0			AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.534G>A	9.37:g.86570359C>T			B2RPI6|Q8N2B1|Q9BT18	Silent	SNP	pfam_DUF2419	p.A178	ENST00000376344.3	37	c.534	CCDS6666.2	9																																																																																			C9orf64	-	pfam_DUF2419	ENSG00000165118		0.433	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf64	HGNC	protein_coding	OTTHUMT00000052865.1		0.00	41	0	C	NM_032307		86570359	-1			no_errors	ENST00000376344	ensembl	human	known	74_37	silent	11.76	15	2	SNP	0.223	T
CA10	56934	genome.wustl.edu	37	17	49825063	49825063	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:49825063C>T	ENST00000285273.4	-	5	1506	c.395G>A	c.(394-396)cGa>cAa	p.R132Q	CA10_ENST00000442502.2_Missense_Mutation_p.R132Q|CA10_ENST00000340813.6_Missense_Mutation_p.R138Q|CA10_ENST00000451037.2_Missense_Mutation_p.R132Q|CA10_ENST00000570565.1_Missense_Mutation_p.R57Q|CA10_ENST00000571918.1_5'UTR	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X	132					brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	AAAGTGTAGTCGGATCTCCTC	0.532																																																	0													160.0	144.0	149.0					17																	49825063		2203	4300	6503	SO:0001583	missense	0			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.395G>A	17.37:g.49825063C>T	ENSP00000285273:p.Arg132Gln		B2R7J0|B4DGL6	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.R138Q	ENST00000285273.4	37	c.413	CCDS32684.1	17	.	.	.	.	.	.	.	.	.	.	c	28.5	4.928911	0.92389	.	.	ENSG00000154975	ENST00000442502;ENST00000285273;ENST00000451037;ENST00000340813	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	5.72	5.72	0.89469	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	T	0.77798	0.4184	L	0.35593	1.075	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.905	D;D;P	0.75020	0.985;0.985;0.455	T	0.74293	-0.3712	9	.	.	.	.	19.2318	0.93843	0.0:1.0:0.0:0.0	.	132;138;57	Q9NS85;Q68D28;B4DGL6	CAH10_HUMAN;.;.	Q	132;132;132;138	ENSP00000390666:R132Q;ENSP00000285273:R132Q;ENSP00000405388:R132Q;ENSP00000340363:R138Q	.	R	-	2	0	CA10	47180062	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.745000	0.85046	2.865000	0.98341	0.655000	0.94253	CGA	CA10	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000154975		0.532	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CA10	HGNC	protein_coding	OTTHUMT00000437480.1	-	0.00	97	0	C	NM_020178		49825063	-1	tier1	-	no_errors	ENST00000340813	ensembl	human	known	74_37	missense	13.56	51	8	SNP	1.000	T
CACNA1I	8911	genome.wustl.edu	37	22	40045758	40045760	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr22:40045758_40045760delAGG	ENST00000402142.3	+	10	1820_1822	c.1820_1822delAGG	c.(1819-1824)aaggag>aag	p.E613del	CACNA1I_ENST00000401624.1_In_Frame_Del_p.E613del|CACNA1I_ENST00000400164.3_In_Frame_Del_p.E578del|CACNA1I_ENST00000407673.1_In_Frame_Del_p.E578del|CACNA1I_ENST00000404898.1_In_Frame_Del_p.E578del|CACNA1I_ENST00000336649.4_In_Frame_Del_p.E619del	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	613	Poly-Glu.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GAACTggggaaggaggaggagga	0.709																																																	0									,	60,4048		5,50,1999					,	3.5	1.0			22	153,7947		7,139,3904	no	coding,coding	CACNA1I	NM_021096.3,NM_001003406.1	,	12,189,5903	A1A1,A1R,RR		1.8889,1.4606,1.7448	,	,		213,11995				SO:0001651	inframe_deletion	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.1820_1822delAGG	22.37:g.40045767_40045769delAGG	ENSP00000385019:p.Glu613del		B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	In_Frame_Del	DEL	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.E617in_frame_del	ENST00000402142.3	37	c.1838_1840	CCDS46710.1	22																																																																																			CACNA1I	-	NULL	ENSG00000100346		0.709	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1		0.00	91	0	AGG	NM_001003406		40045760	+1			no_errors	ENST00000336649	ensembl	human	known	74_37	in_frame_del	6.42	102	7	DEL	1.000:1.000:1.000	0
CASP6	839	genome.wustl.edu	37	4	110624546	110624546	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:110624546G>A	ENST00000265164.2	-	1	83	c.6C>T	c.(4-6)agC>agT	p.S2S	CASP6_ENST00000352981.3_Silent_p.S2S|CASP6_ENST00000505486.1_Silent_p.S2S	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	2					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		CCGAGGCCGAGCTCATTGCAG	0.726																																																	0													24.0	30.0	28.0					4																	110624546		2201	4296	6497	SO:0001819	synonymous_variant	0			U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.6C>T	4.37:g.110624546G>A			Q9BQE7	Silent	SNP	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.S2	ENST00000265164.2	37	c.6	CCDS3684.1	4																																																																																			CASP6	-	NULL	ENSG00000138794		0.726	CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP6	HGNC	protein_coding	OTTHUMT00000254866.1	-	0.00	34	0	G	NM_001226		110624546	-1	tier1	-	no_errors	ENST00000265164	ensembl	human	known	74_37	silent	50.00	18	18	SNP	0.189	A
CAST	831	genome.wustl.edu	37	5	96098065	96098065	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:96098065C>T	ENST00000341926.3	+	23	1834	c.1672C>T	c.(1672-1674)Cgt>Tgt	p.R558C	CAST_ENST00000504465.1_Missense_Mutation_p.R486C|CAST_ENST00000511782.1_Missense_Mutation_p.R544C|CAST_ENST00000508608.1_Missense_Mutation_p.R604C|CAST_ENST00000359176.4_Missense_Mutation_p.R622C|CAST_ENST00000509903.1_Missense_Mutation_p.R523C|CAST_ENST00000508579.1_Missense_Mutation_p.R273C|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000395813.1_Missense_Mutation_p.R641C|CAST_ENST00000338252.3_Missense_Mutation_p.R545C|CAST_ENST00000515663.1_Missense_Mutation_p.R281C|CAST_ENST00000508830.1_Missense_Mutation_p.R641C|ERAP1_ENST00000296754.3_3'UTR|CAST_ENST00000325674.7_Missense_Mutation_p.R606C|CAST_ENST00000395812.2_Missense_Mutation_p.R600C|CAST_ENST00000511049.1_Missense_Mutation_p.R544C|CAST_ENST00000309190.5_Missense_Mutation_p.R536C|CAST_ENST00000510756.1_Missense_Mutation_p.R619C			P20810	ICAL_HUMAN	calpastatin	558					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		AGCCCCACCCCGTGATACCTC	0.438																																																	0													43.0	46.0	45.0					5																	96098065		2203	4300	6503	SO:0001583	missense	0			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.1672C>T	5.37:g.96098065C>T	ENSP00000339914:p.Arg558Cys		B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	pfam_Prot_inh_calpain	p.R641C	ENST00000341926.3	37	c.1921		5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.69|19.69	3.874190|3.874190	0.72180|0.72180	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000510500|ENST00000338252;ENST00000508830;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508579;ENST00000515663	T|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.18960|0.18016	2.18|2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24;2.24	4.32|4.32	4.32|4.32	0.51571|0.51571	.|.	.|0.507974	.|0.23213	.|N	.|0.050648	T|T	0.25754|0.25754	0.0627|0.0627	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;P;D;P;D;P;P;D;P;D;P;P	.|0.76494	.|0.977;0.972;0.964;0.991;0.964;0.931;0.977;0.949;0.999;0.782;0.949;0.989;0.949;0.965;0.843;0.949	.|P;P;P;P;P;P;P;P;P;P;P;P;P;B;B;P	.|0.59424	.|0.66;0.708;0.571;0.849;0.571;0.512;0.629;0.495;0.857;0.512;0.529;0.764;0.597;0.42;0.378;0.495	T|T	0.00664|0.00664	-1.1620|-1.1620	7|10	0.45353|0.72032	T|D	0.12|0.01	-8.4219|-8.4219	12.5955|12.5955	0.56468|0.56468	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|486;604;281;309;281;544;523;536;517;558;606;600;622;619;641;545	.|E9PDE4;B7Z468;E7EQA0;Q86YM9;E7EPY6;E7EVY3;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2	.|.;.;.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.	L|C	315|545;641;641;622;606;600;619;604;558;544;536;558;486;523;544;273;281	ENSP00000424160:P315L|ENSP00000343421:R545C;ENSP00000425721:R641C;ENSP00000379158:R641C;ENSP00000352098:R622C;ENSP00000320319:R606C;ENSP00000379157:R600C;ENSP00000422176:R619C;ENSP00000422677:R604C;ENSP00000339914:R558C;ENSP00000421130:R544C;ENSP00000312523:R536C;ENSP00000422325:R558C;ENSP00000425670:R486C;ENSP00000426946:R523C;ENSP00000423638:R544C;ENSP00000425787:R273C;ENSP00000422929:R281C	ENSP00000432878:P300L|ENSP00000312523:R536C	P|R	+|+	2|1	0|0	CAST|CAST	96123821|96123821	0.022000|0.022000	0.18835|0.18835	0.605000|0.605000	0.28930|0.28930	0.432000|0.432000	0.31715|0.31715	3.287000|3.287000	0.51732|0.51732	2.692000|2.692000	0.91855|0.91855	0.655000|0.655000	0.94253|0.94253	CCG|CGT	CAST	-	pfam_Prot_inh_calpain	ENSG00000153113		0.438	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	-	0.00	38	0	C	NM_173062		96098065	+1	tier1	-	no_errors	ENST00000395813	ensembl	human	known	74_37	missense	26.19	31	11	SNP	0.581	T
CASZ1	54897	genome.wustl.edu	37	1	10715742	10715742	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:10715742G>A	ENST00000377022.3	-	9	1946	c.1629C>T	c.(1627-1629)caC>caT	p.H543H	CASZ1_ENST00000344008.5_Silent_p.H543H|RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	543					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		TCCCATTGAGGTGGCAGCCGT	0.642																																																	0													136.0	97.0	111.0					1																	10715742		2203	4299	6502	SO:0001819	synonymous_variant	0			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.1629C>T	1.37:g.10715742G>A			Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H543	ENST00000377022.3	37	c.1629	CCDS41246.1	1																																																																																			CASZ1	-	NULL	ENSG00000130940		0.642	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	-	0.00	58	0	G	NM_017766		10715742	-1	tier1	-	no_errors	ENST00000377022	ensembl	human	known	74_37	silent	34.88	28	15	SNP	1.000	A
CCDC88C	440193	genome.wustl.edu	37	14	91804354	91804354	+	Missense_Mutation	SNP	T	T	C	rs572844946	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:91804354T>C	ENST00000389857.6	-	10	1131	c.1045A>G	c.(1045-1047)Atg>Gtg	p.M349V		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	349					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CCTACCTCCATGCGGGCCTTG	0.622													T|||	2	0.000399361	0.0015	0.0	5008	,	,		18993	0.0		0.0	False		,,,				2504	0.0																0													49.0	53.0	52.0					14																	91804354		2056	4190	6246	SO:0001583	missense	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1045A>G	14.37:g.91804354T>C	ENSP00000374507:p.Met349Val		Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.M349V	ENST00000389857.6	37	c.1045	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	T	4.773	0.143716	0.09134	.	.	ENSG00000015133	ENST00000389857	T	0.10668	2.85	5.36	4.2	0.49525	.	0.000000	0.64402	U	0.000014	T	0.03095	0.0091	N	0.00801	-1.175	0.80722	D	1	B	0.23316	0.083	B	0.28139	0.086	T	0.36504	-0.9745	10	0.02654	T	1	-42.4265	11.1506	0.48455	0.0:0.0725:0.0:0.9275	.	349	Q9P219	DAPLE_HUMAN	V	349	ENSP00000374507:M349V	ENSP00000374507:M349V	M	-	1	0	CCDC88C	90874107	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.660000	0.54496	0.880000	0.35969	0.459000	0.35465	ATG	CCDC88C	-	pfam_Hook-related_fam	ENSG00000015133		0.622	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	-	0.00	38	0	T	XM_029353		91804354	-1	tier1	-	no_errors	ENST00000389857	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	C
CD22	933	genome.wustl.edu	37	19	35827012	35827012	+	Missense_Mutation	SNP	G	G	T	rs202213388		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:35827012G>T	ENST00000085219.5	+	4	552	c.486G>T	c.(484-486)ttG>ttT	p.L162F	CD22_ENST00000341773.6_Missense_Mutation_p.L162F|CD22_ENST00000536635.2_Missense_Mutation_p.L162F|CD22_ENST00000544992.2_Missense_Mutation_p.L162F|CD22_ENST00000270311.6_Missense_Mutation_p.L42F|CD22_ENST00000419549.2_Intron|CD22_ENST00000594250.1_Missense_Mutation_p.L162F	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	162	Ig-like C2-type 1.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TGACCTGCTTGCTGAATTTCT	0.527																																					Ovarian(42;1009 1133 23674 26041)												0													103.0	109.0	107.0					19																	35827012		2203	4300	6503	SO:0001583	missense	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.486G>T	19.37:g.35827012G>T	ENSP00000085219:p.Leu162Phe		F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L162F	ENST00000085219.5	37	c.486	CCDS12457.1	19	.	.	.	.	.	.	.	.	.	.	G	2.162	-0.391976	0.04932	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000270311	T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1	4.39	-0.694	0.11294	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	2.201130	0.01875	N	0.037518	T	0.76169	0.3950	L	0.27053	0.805	0.29437	N	0.859417	D;B;B;B	0.56521	0.976;0.307;0.16;0.021	P;B;B;B	0.58454	0.839;0.047;0.044;0.008	T	0.64166	-0.6471	10	0.48119	T	0.1	.	3.8017	0.08761	0.3472:0.2026:0.4502:0.0	.	162;162;162;162	F5GYU4;F5H7U3;P20273;P20273-2	.;.;CD22_HUMAN;.	F	162;162;162;162;42	ENSP00000085219:L162F;ENSP00000442279:L162F;ENSP00000339349:L162F;ENSP00000441237:L162F;ENSP00000270311:L42F	ENSP00000085219:L162F	L	+	3	2	CD22	40518852	0.000000	0.05858	0.221000	0.23827	0.734000	0.41952	-1.174000	0.03105	0.123000	0.18342	0.561000	0.74099	TTG	CD22	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000012124		0.527	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1		0.00	42	0	G	NM_001771		35827012	+1			no_errors	ENST00000085219	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.116	T
CD83	9308	genome.wustl.edu	37	6	14131847	14131847	+	Missense_Mutation	SNP	G	G	A	rs147342996		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:14131847G>A	ENST00000379153.3	+	3	421	c.250G>A	c.(250-252)Gcc>Acc	p.A84T		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	84	Ig-like V-type.				defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				TTCTTTCGACGCCCCCAATGA	0.542																																																	0													129.0	120.0	123.0					6																	14131847		2203	4300	6503	SO:0001583	missense	0			Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.250G>A	6.37:g.14131847G>A	ENSP00000368450:p.Ala84Thr		Q5THX9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.A84T	ENST00000379153.3	37	c.250	CCDS4532.1	6	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365692	0.61513	.	.	ENSG00000112149	ENST00000379153	T	0.63744	-0.06	5.39	3.52	0.40303	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.687206	0.14432	N	0.319979	T	0.36744	0.0978	M	0.65498	2.005	0.09310	N	1	B	0.18863	0.031	B	0.18871	0.023	T	0.29150	-1.0021	10	0.29301	T	0.29	-0.3608	7.8185	0.29274	0.2047:0.0:0.7953:0.0	.	84	Q01151	CD83_HUMAN	T	84	ENSP00000368450:A84T	ENSP00000368450:A84T	A	+	1	0	CD83	14239826	0.001000	0.12720	0.002000	0.10522	0.001000	0.01503	1.033000	0.30191	0.696000	0.31696	-0.345000	0.07892	GCC	CD83	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000112149		0.542	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD83	HGNC	protein_coding	OTTHUMT00000039916.1		0.00	62	0	G			14131847	+1			no_errors	ENST00000379153	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.003	A
CDH4	1002	genome.wustl.edu	37	20	60498649	60498649	+	Silent	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:60498649C>A	ENST00000360469.5	+	10	1603	c.1515C>A	c.(1513-1515)ccC>ccA	p.P505P	CDH4_ENST00000543233.1_Silent_p.P431P	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	505	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			ACGAGGCTCCCTACTTCCCCT	0.622																																																	0													81.0	70.0	74.0					20																	60498649		2203	4300	6503	SO:0001819	synonymous_variant	0			L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1515C>A	20.37:g.60498649C>A			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.P505	ENST00000360469.5	37	c.1515	CCDS13488.1	20																																																																																			CDH4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000179242		0.622	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	-	0.00	37	0	C	NM_001794		60498649	+1	tier1	-	no_errors	ENST00000360469	ensembl	human	known	74_37	silent	14.29	30	5	SNP	0.997	A
CELF1	10658	genome.wustl.edu	37	11	47496971	47496971	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:47496971T>C	ENST00000358597.3	-	10	1105	c.1106A>G	c.(1105-1107)tAt>tGt	p.Y369C	CELF1_ENST00000310513.5_Missense_Mutation_p.Y365C|CELF1_ENST00000361904.3_Missense_Mutation_p.Y366C|CELF1_ENST00000532048.1_Missense_Mutation_p.Y395C|CELF1_ENST00000539455.1_5'UTR|CELF1_ENST00000395290.2_Missense_Mutation_p.Y368C|CELF1_ENST00000395292.2_Missense_Mutation_p.Y366C|CELF1_ENST00000531165.1_Missense_Mutation_p.Y397C			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	369					embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						AGCAGCAGCATATTGCTGGAT	0.562																																					Pancreas(163;1949 1966 9906 43218 43785)												0													89.0	83.0	85.0					11																	47496971		2201	4298	6499	SO:0001583	missense	0			U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.1106A>G	11.37:g.47496971T>C	ENSP00000351409:p.Tyr369Cys		B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y395C	ENST00000358597.3	37	c.1184	CCDS31482.1	11	.	.	.	.	.	.	.	.	.	.	T	24.8	4.565805	0.86439	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048	T;T;T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46;-0.46;-0.46	5.4	5.4	0.78164	.	0.122741	0.56097	D	0.000027	D	0.82783	0.5112	M	0.82823	2.61	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999;0.998	D;D;D;D;D;D	0.79784	0.993;0.993;0.987;0.987;0.993;0.971	D	0.85631	0.1270	10	0.72032	D	0.01	-7.9254	15.4282	0.75072	0.0:0.0:0.0:1.0	.	368;397;395;365;366;369	F8W940;G5EA30;Q92879-4;Q92879-2;Q92879-3;Q92879	.;.;.;.;.;CELF1_HUMAN	C	368;369;366;365;366;397;395	ENSP00000378705:Y368C;ENSP00000351409:Y369C;ENSP00000378706:Y366C;ENSP00000308386:Y365C;ENSP00000354639:Y366C;ENSP00000436864:Y397C;ENSP00000435926:Y395C	ENSP00000308386:Y365C	Y	-	2	0	CELF1	47453547	1.000000	0.71417	0.980000	0.43619	0.994000	0.84299	8.040000	0.89188	2.051000	0.60960	0.455000	0.32223	TAT	CELF1	-	NULL	ENSG00000149187		0.562	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF1	HGNC	protein_coding	OTTHUMT00000398352.1	-	0.00	38	0	T	NM_006560		47496971	-1	tier1	-	no_errors	ENST00000532048	ensembl	human	known	74_37	missense	42.86	20	15	SNP	1.000	C
CEP170	9859	genome.wustl.edu	37	1	243288181	243288182	+	3'UTR	INS	-	-	TT	rs200011360|rs572223491		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:243288181_243288182insTT	ENST00000366542.1	-	0	6375_6376				CEP170_ENST00000468254.1_5'UTR|CEP170_ENST00000366544.1_3'UTR|CEP170_ENST00000366543.1_3'UTR	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa							centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GTTCATTTACCTTTTTTTTTTT	0.248																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.*1570->AA	1.37:g.243288190_243288191dupTT			O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	RNA	INS	-	NULL	ENST00000366542.1	37	NULL	CCDS44339.1	1																																																																																			CEP170	-	-	ENSG00000143702		0.248	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2		0.00	31	0	-	NM_014812		243288182	-1	tier1		no_errors	ENST00000468254	ensembl	human	known	74_37	rna	12.00	22	3	INS	0.000:0.001	TT
CHEK2P2	646096	genome.wustl.edu	37	15	20490509	20490509	+	RNA	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:20490509G>A	ENST00000555186.1	+	0	489					NR_038836.1				checkpoint kinase 2 pseudogene 2																		TTCAGCTCTGGACCTTGTCAA	0.443																																																	0																																												0					15q11.1	2011-11-11			ENSG00000259156	ENSG00000259156			43578	pseudogene	pseudogene							Standard	NR_038836		Approved		uc001ytf.1		OTTHUMG00000171660		15.37:g.20490509G>A				RNA	SNP	-	NULL	ENST00000555186.1	37	NULL		15																																																																																			CHEK2P2	-	-	ENSG00000259156		0.443	CHEK2P2-002	KNOWN	basic	processed_transcript	CHEK2P2	HGNC	pseudogene	OTTHUMT00000414654.1	-	0.00	424	0	G	NR_038836		20490509	+1	tier1	-	no_errors	ENST00000555186	ensembl	human	known	74_37	rna	16.89	246	50	SNP	1.000	A
CHTOP	26097	genome.wustl.edu	37	1	153610909	153610909	+	Silent	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:153610909A>G	ENST00000368694.3	+	3	516	c.204A>G	c.(202-204)gcA>gcG	p.A68A	CHTOP_ENST00000368687.1_Silent_p.A43A|CHTOP_ENST00000368686.1_Silent_p.A28A|CHTOP_ENST00000403433.1_Silent_p.A68A|CHTOP_ENST00000495554.1_3'UTR|CHTOP_ENST00000368690.3_Silent_p.A68A	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	68					mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						TCCAGGCAGCATTAAAACTTA	0.512																																																	0													65.0	64.0	64.0					1																	153610909		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.204A>G	1.37:g.153610909A>G			D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Silent	SNP	NULL	p.A68	ENST00000368694.3	37	c.204	CCDS1048.1	1																																																																																			CHTOP	-	NULL	ENSG00000160679		0.512	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHTOP	HGNC	protein_coding	OTTHUMT00000089967.1		0.00	34	0	A	NM_015607		153610909	+1			no_errors	ENST00000368694	ensembl	human	known	74_37	silent	15.62	27	5	SNP	0.995	G
CLEC4G	339390	genome.wustl.edu	37	19	7794380	7794380	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:7794380G>T	ENST00000328853.5	-	9	822	c.754C>A	c.(754-756)Cag>Aag	p.Q252K	CLEC4G_ENST00000598081.1_5'Flank	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	252	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						GGCTCTCCCTGGTTCCAGTGG	0.607																																					Esophageal Squamous(146;540 1807 3349 19438 30853)												0													50.0	44.0	46.0					19																	7794380		2203	4300	6503	SO:0001583	missense	0			AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.754C>A	19.37:g.7794380G>T	ENSP00000327599:p.Gln252Lys			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.Q252K	ENST00000328853.5	37	c.754	CCDS12185.1	19	.	.	.	.	.	.	.	.	.	.	g	3.487	-0.104601	0.06967	.	.	ENSG00000182566	ENST00000328853;ENST00000381308	T	0.16324	2.35	5.46	-10.9	0.00192	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	5.024930	0.00508	N	0.000165	T	0.06371	0.0164	N	0.25201	0.72	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.37549	-0.9701	10	0.06365	T	0.9	.	0.7956	0.01065	0.2131:0.279:0.1515:0.3564	.	252	Q6UXB4	CLC4G_HUMAN	K	252;136	ENSP00000327599:Q252K	ENSP00000327599:Q252K	Q	-	1	0	CLEC4G	7700380	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.173000	0.00572	-1.771000	0.01293	-0.730000	0.03578	CAG	CLEC4G	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	ENSG00000182566		0.607	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4G	HGNC	protein_coding	OTTHUMT00000461989.1	-	0.00	28	0	G	NM_198492		7794380	-1	tier1	-	no_errors	ENST00000328853	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.000	T
CLIC1	1192	genome.wustl.edu	37	6	31704068	31704068	+	Missense_Mutation	SNP	C	C	G	rs147567766	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:31704068C>G	ENST00000375780.2	-	2	582	c.10G>C	c.(10-12)Gaa>Caa	p.E4Q	CLIC1_ENST00000375784.3_Missense_Mutation_p.E4Q|CLIC1_ENST00000375779.2_Missense_Mutation_p.E4Q|CLIC1_ENST00000395892.1_Missense_Mutation_p.E4Q			O00299	CLIC1_HUMAN	chloride intracellular channel 1	4	Required for insertion into the membrane.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|platelet aggregation (GO:0070527)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of mitochondrial membrane potential (GO:0051881)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|brush border (GO:0005903)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)|skin(1)	7						TGCGGTTGTTCTTCAGCCATG	0.602																																																	0													134.0	104.0	115.0					6																	31704068		1511	2709	4220	SO:0001583	missense	0			U93205	CCDS4719.1	6p21.3	2012-09-26			ENSG00000213719	ENSG00000213719		"""Ion channels / Chloride channels : Intracellular"""	2062	protein-coding gene	gene with protein product		602872				9139710	Standard	NM_001288		Approved	NCC27, p64CLCP	uc003nwr.3	O00299	OTTHUMG00000031103	ENST00000375780.2:c.10G>C	6.37:g.31704068C>G	ENSP00000364935:p.Glu4Gln		Q15089|Q502X1	Missense_Mutation	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.E4Q	ENST00000375780.2	37	c.10	CCDS4719.1	6	.	.	.	.	.	.	.	.	.	.	C	14.23	2.473400	0.43942	.	.	ENSG00000213719	ENST00000375784;ENST00000375779;ENST00000375780;ENST00000395892	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	4.53	4.53	0.55603	Thioredoxin-like fold (1);	0.232085	0.35235	U	0.003350	T	0.04272	0.0118	N	0.08118	0	0.40641	D	0.981949	P	0.37525	0.598	B	0.31614	0.133	T	0.24190	-1.0167	10	0.10377	T	0.69	-9.5843	12.6218	0.56607	0.0:1.0:0.0:0.0	.	4	O00299	CLIC1_HUMAN	Q	4	ENSP00000364940:E4Q;ENSP00000364934:E4Q;ENSP00000364935:E4Q;ENSP00000379229:E4Q	ENSP00000364934:E4Q	E	-	1	0	CLIC1	31812047	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.425000	0.44723	2.353000	0.79882	0.591000	0.81541	GAA	CLIC1	-	NULL	ENSG00000213719		0.602	CLIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC1	HGNC	protein_coding	OTTHUMT00000076167.3		0.00	33	0	C	NM_001288		31704068	-1			no_errors	ENST00000375779	ensembl	human	known	74_37	missense	6.00	46	3	SNP	1.000	G
CLIC3	9022	genome.wustl.edu	37	9	139890207	139890207	+	Silent	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:139890207C>G	ENST00000494426.1	-	2	295	c.36G>C	c.(34-36)gcG>gcC	p.A12A	CLIC3_ENST00000480181.1_5'Flank	NM_004669.2	NP_004660.2	O95833	CLIC3_HUMAN	chloride intracellular channel 3	12	GST N-terminal.|Required for insertion into the membrane. {ECO:0000250}.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|signal transduction (GO:0007165)	chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			lung(1)|skin(1)	2	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGTCCTCACTCGCCTGGGTGG	0.697																																																	0													24.0	21.0	22.0					9																	139890207		2165	4264	6429	SO:0001819	synonymous_variant	0			AF102166	CCDS7021.1	9q34.3	2012-09-26			ENSG00000169583	ENSG00000169583		"""Ion channels / Chloride channels : Intracellular"""	2064	protein-coding gene	gene with protein product		606533				9880541	Standard	NM_004669		Approved		uc004ckj.1	O95833	OTTHUMG00000020954	ENST00000494426.1:c.36G>C	9.37:g.139890207C>G			Q5SPZ7	Silent	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel	p.A12	ENST00000494426.1	37	c.36	CCDS7021.1	9																																																																																			CLIC3	-	superfamily_Thioredoxin-like_fold	ENSG00000169583		0.697	CLIC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC3	HGNC	protein_coding	OTTHUMT00000055173.2	-	0.00	28	0	C	NM_004669		139890207	-1	tier1	-	no_errors	ENST00000494426	ensembl	human	known	74_37	silent	72.73	9	24	SNP	0.914	G
CMYA5	202333	genome.wustl.edu	37	5	79095254	79095254	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:79095254G>C	ENST00000446378.2	+	13	12056	c.12025G>C	c.(12025-12027)Gtg>Ctg	p.V4009L	CTC-431G16.2_ENST00000421252.2_RNA	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	4009	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TCCAGCCAGAGTGGGCATCCT	0.448																																																	0													139.0	129.0	132.0					5																	79095254		2010	4183	6193	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.12025G>C	5.37:g.79095254G>C	ENSP00000394770:p.Val4009Leu		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.V4009L	ENST00000446378.2	37	c.12025	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925778	0.52759	.	.	ENSG00000164309	ENST00000446378	T	0.74002	-0.8	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.80592	0.4652	L	0.58428	1.81	0.39989	D	0.975016	D	0.67145	0.996	D	0.65323	0.934	T	0.81385	-0.0957	9	0.59425	D	0.04	.	8.1392	0.31073	0.1799:0.0:0.8201:0.0	.	4009	Q8N3K9	CMYA5_HUMAN	L	4009	ENSP00000394770:V4009L	ENSP00000394770:V4009L	V	+	1	0	CMYA5	79131010	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	3.119000	0.50422	2.941000	0.99782	0.655000	0.94253	GTG	CMYA5	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000164309		0.448	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	79	0	G	NM_153610		79095254	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	missense	36.49	47	27	SNP	1.000	C
CNKSR1	10256	genome.wustl.edu	37	1	26508862	26508862	+	Missense_Mutation	SNP	C	C	T	rs148174101		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:26508862C>T	ENST00000374253.5	+	5	527	c.488C>T	c.(487-489)gCg>gTg	p.A163V	CNKSR1_ENST00000361530.6_Missense_Mutation_p.A163V|CNKSR1_ENST00000531191.1_5'UTR|CNKSR1_ENST00000480348.2_Intron	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	163	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		GATGGTCCAGCGGCTGAGAAG	0.632																																					NSCLC(180;1396 2109 28270 30756 34275)												0								C	VAL/ALA	2,4404	4.2+/-10.8	0,2,2201	54.0	55.0	54.0		488	0.9	0.0	1	dbSNP_134	54	0,8600		0,0,4300	no	missense	CNKSR1	NM_006314.2	64	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	163/714	26508862	2,13004	2203	4300	6503	SO:0001583	missense	0			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.488C>T	1.37:g.26508862C>T	ENSP00000363371:p.Ala163Val		B1AMW9|O95381	Missense_Mutation	SNP	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.A163V	ENST00000374253.5	37	c.488		1	.	.	.	.	.	.	.	.	.	.	C	0.005	-2.124638	0.00342	4.54E-4	0.0	ENSG00000142675	ENST00000361530;ENST00000374253	T;T	0.12774	2.65;2.65	4.27	0.915	0.19366	CRIC domain (1);	0.392438	0.25683	N	0.028997	T	0.04048	0.0113	N	0.05383	-0.06	0.25833	N	0.984149	B;B	0.13145	0.007;0.007	B;B	0.10450	0.005;0.005	T	0.40156	-0.9578	10	0.02654	T	1	-7.2848	2.7344	0.05236	0.2933:0.4317:0.0:0.275	.	163;163	Q969H4;Q53GM7	CNKR1_HUMAN;.	V	163	ENSP00000354609:A163V;ENSP00000363371:A163V	ENSP00000354609:A163V	A	+	2	0	CNKSR1	26381449	0.003000	0.15002	0.045000	0.18777	0.002000	0.02628	-0.016000	0.12613	0.365000	0.24400	-0.254000	0.11334	GCG	CNKSR1	-	NULL	ENSG00000142675		0.632	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	HGNC	protein_coding	OTTHUMT00000089943.2		0.00	65	0	C	NM_006314		26508862	+1			no_errors	ENST00000374253	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.187	T
CNN2	1265	genome.wustl.edu	37	19	1037969	1037970	+	3'UTR	DEL	TT	TT	-	rs60469398|rs112890956		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:1037969_1037970delTT	ENST00000263097.4	+	0	1363_1364				CNN2_ENST00000565096.2_3'UTR|ABCA7_ENST00000263094.6_5'Flank|CNN2_ENST00000562958.2_3'UTR|CNN2_ENST00000348419.3_3'UTR|AC011558.5_ENST00000585757.1_RNA|CNN2_ENST00000606983.1_3'UTR	NM_004368.2	NP_004359.1	Q99439	CNN2_HUMAN	calponin 2						actomyosin structure organization (GO:0031032)|cellular response to mechanical stimulus (GO:0071260)|cytoskeleton organization (GO:0007010)|hemopoiesis (GO:0030097)|negative regulation of cell migration (GO:0030336)|negative regulation of phagocytosis (GO:0050765)|positive regulation of gene expression (GO:0010628)|regulation of actin filament-based process (GO:0032970)|regulation of cell proliferation (GO:0042127)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|stress fiber (GO:0001725)	actin binding (GO:0003779)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTTTTCATCTTTTTTTTTTTT	0.515																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D83735	CCDS12053.1, CCDS12054.1	19p13.3	2011-02-18			ENSG00000064666	ENSG00000064666			2156	protein-coding gene	gene with protein product		602373				8889829	Standard	NM_004368		Approved		uc002lqu.3	Q99439		ENST00000263097.4:c.*71TT>-	19.37:g.1037979_1037980delTT			A5D8U8|A6NFI4|D6W5X9|Q92578	RNA	DEL	-	NULL	ENST00000263097.4	37	NULL	CCDS12053.1	19																																																																																			CNN2	-	-	ENSG00000064666		0.515	CNN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN2	HGNC	protein_coding	OTTHUMT00000420293.3		0.00	22	0	TT	NM_004368		1037970	+1	tier1		no_errors	ENST00000606983	ensembl	human	known	74_37	rna	28.57	10	4	DEL	0.000:0.000	-
CNTNAP5	129684	genome.wustl.edu	37	2	125284959	125284959	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:125284959C>A	ENST00000431078.1	+	10	1936	c.1572C>A	c.(1570-1572)gaC>gaA	p.D524E		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	524	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGCCCAAGGACCTCATTTCAG	0.438																																																	0													140.0	134.0	136.0					2																	125284959		1877	4106	5983	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.1572C>A	2.37:g.125284959C>A	ENSP00000399013:p.Asp524Glu		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.D524E	ENST00000431078.1	37	c.1572	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137197	0.56936	.	.	ENSG00000155052	ENST00000431078	D	0.88741	-2.42	5.67	2.92	0.33932	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.48286	D	0.000195	D	0.93291	0.7862	M	0.85859	2.78	0.36208	D	0.851145	D	0.89917	1.0	D	0.80764	0.994	D	0.92984	0.6409	10	0.42905	T	0.14	.	7.9328	0.29912	0.0:0.6959:0.0:0.3041	.	524	Q8WYK1	CNTP5_HUMAN	E	524	ENSP00000399013:D524E	ENSP00000399013:D524E	D	+	3	2	CNTNAP5	125001429	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.397000	0.34543	0.765000	0.33221	0.650000	0.86243	GAC	CNTNAP5	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000155052		0.438	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	86	0	C			125284959	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	48.39	32	30	SNP	1.000	A
CR1L	1379	genome.wustl.edu	37	1	207872577	207872577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:207872577G>T	ENST00000508064.2	+	8	1246	c.1186G>T	c.(1186-1188)Gga>Tga	p.G396*	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	396	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TGTTTTGGCTGGAATGGAAAG	0.408											OREG0014195	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													265.0	237.0	246.0					1																	207872577		1873	4104	5977	SO:0001587	stop_gained	0			AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1186G>T	1.37:g.207872577G>T	ENSP00000421736:p.Gly396*	2170	Q32MC9|Q8NEU7	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G396*	ENST00000508064.2	37	c.1186	CCDS44310.1	1	.	.	.	.	.	.	.	.	.	.	.	18.12	3.553310	0.65425	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	.	.	.	1.65	0.695	0.18070	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	3.9879	0.09524	0.2305:0.0:0.7695:0.0	.	.	.	.	X	396	.	ENSP00000434864:G340X	G	+	1	0	CR1L	205939200	0.100000	0.21855	0.001000	0.08648	0.574000	0.36063	1.961000	0.40432	0.263000	0.21812	0.291000	0.19559	GGA	CR1L	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000197721		0.408	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1L	HGNC	protein_coding	OTTHUMT00000390247.1	-	0.00	225	0	G	XM_114735		207872577	+1	tier1	-	no_errors	ENST00000508064	ensembl	human	known	74_37	nonsense	43.64	93	72	SNP	0.001	T
CRYBB1	1414	genome.wustl.edu	37	22	27008042	27008042	+	Missense_Mutation	SNP	G	G	A	rs144372140		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr22:27008042G>A	ENST00000215939.2	-	3	423	c.293C>T	c.(292-294)gCg>gTg	p.A98V		NM_001887.3	NP_001878.1	P53674	CRBB1_HUMAN	crystallin, beta B1	98	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)	p.A98V(1)		breast(1)|endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(3)|skin(2)|urinary_tract(4)	31						TCACGGTCCCGCGGAGACAAT	0.582																																																	1	Substitution - Missense(1)	prostate(1)						G	VAL/ALA	0,4406		0,0,2203	86.0	78.0	81.0		293	2.6	0.4	22	dbSNP_134	81	1,8599	1.2+/-3.3	0,1,4299	no	missense	CRYBB1	NM_001887.3	64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	98/253	27008042	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS13840.1	22q12.1	2008-06-10			ENSG00000100122	ENSG00000100122			2397	protein-coding gene	gene with protein product		600929				8575764, 12360425	Standard	NM_001887		Approved		uc003acy.1	P53674	OTTHUMG00000150980	ENST00000215939.2:c.293C>T	22.37:g.27008042G>A	ENSP00000215939:p.Ala98Val			Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.A98V	ENST00000215939.2	37	c.293	CCDS13840.1	22	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150284	0.37923	0.0	1.16E-4	ENSG00000100122	ENST00000215939	T	0.75154	-0.91	3.7	2.64	0.31445	Beta/gamma crystallin (5);Gamma-crystallin-related (1);	0.280420	0.34959	N	0.003543	T	0.55832	0.1945	N	0.14661	0.345	0.19775	N	0.999956	B	0.25955	0.138	B	0.15052	0.012	T	0.53486	-0.8432	10	0.72032	D	0.01	.	11.9302	0.52843	0.0:0.1774:0.8226:0.0	.	98	P53674	CRBB1_HUMAN	V	98	ENSP00000215939:A98V	ENSP00000215939:A98V	A	-	2	0	CRYBB1	25338042	0.881000	0.30235	0.431000	0.26735	0.619000	0.37552	2.186000	0.42593	0.703000	0.31848	0.491000	0.48974	GCG	CRYBB1	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	ENSG00000100122		0.582	CRYBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYBB1	HGNC	protein_coding	OTTHUMT00000320767.1	-	0.00	72	0	G	NM_001887		27008042	-1	tier1	rs144372140	no_errors	ENST00000215939	ensembl	human	known	74_37	missense	17.46	52	11	SNP	0.749	A
CSF2RA	1438	genome.wustl.edu	37	X	1409389	1409389	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chrX:1409389C>G	ENST00000381524.3	+	7	819	c.633C>G	c.(631-633)gaC>gaG	p.D211E	CSF2RA_ENST00000417535.2_Missense_Mutation_p.D211E|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000432318.2_Missense_Mutation_p.D211E|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381509.3_Missense_Mutation_p.D211E|CSF2RA_ENST00000361536.3_Missense_Mutation_p.D211E|CSF2RA_ENST00000381529.3_Missense_Mutation_p.D211E|BX649553.4_ENST00000580687.1_RNA|CSF2RA_ENST00000501036.2_Missense_Mutation_p.D78E|CSF2RA_ENST00000355432.3_Missense_Mutation_p.D211E|CSF2RA_ENST00000381500.1_Missense_Mutation_p.D211E|CSF2RA_ENST00000355805.2_Missense_Mutation_p.D211E			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	211					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CACTTTTGGACACAAAGAAAA	0.398																																					Esophageal Squamous(131;723 1707 25334 40494 41806)												0													231.0	240.0	237.0					X																	1409389		2203	4296	6499	SO:0001583	missense	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.633C>G	X.37:g.1409389C>G	ENSP00000370935:p.Asp211Glu		A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.D211E	ENST00000381524.3	37	c.633	CCDS35191.1	X	.	.	.	.	.	.	.	.	.	.	.	0.468	-0.886032	0.02511	.	.	ENSG00000198223	ENST00000381529;ENST00000432318;ENST00000361536;ENST00000381507;ENST00000501036;ENST00000381524;ENST00000412290;ENST00000381509;ENST00000355805;ENST00000355432;ENST00000417535;ENST00000381500	D;D;D;D;D;D;D;D;D;D;D	0.96200	-3.94;-3.94;-1.64;-1.64;-3.94;-1.64;-3.94;-1.64;-1.64;-3.94;-1.64	1.57	-0.761	0.11038	Interleukin-6 receptor alpha chain, binding (1);	12.080100	0.00424	U	0.000069	D	0.86201	0.5876	.	.	.	0.09310	N	1	B;B;B;P;B;B	0.36837	0.342;0.04;0.033;0.571;0.026;0.032	B;B;B;B;B;B	0.37422	0.249;0.046;0.018;0.194;0.02;0.033	T	0.82997	-0.0179	9	0.02654	T	1	.	2.6567	0.05014	0.0:0.4138:0.3444:0.2418	.	211;211;211;211;211;211	P15509-2;A7J003;P15509-3;P15509-6;P15509-5;P15509	.;.;.;.;.;CSF2R_HUMAN	E	211;211;211;211;78;211;211;211;211;211;211;211	ENSP00000370940:D211E;ENSP00000416437:D211E;ENSP00000354836:D211E;ENSP00000440491:D78E;ENSP00000370935:D211E;ENSP00000410667:D211E;ENSP00000370920:D211E;ENSP00000348058:D211E;ENSP00000347606:D211E;ENSP00000394227:D211E;ENSP00000370911:D211E	ENSP00000347606:D211E	D	+	3	2	CSF2RA	1369389	0.000000	0.05858	0.000000	0.03702	0.205000	0.24178	-4.008000	0.00315	-0.066000	0.12998	0.280000	0.19369	GAC	CSF2RA	-	pfam_IL-6_rcpt_alpha-bd	ENSG00000198223		0.398	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	-	0.00	102	0	C			1409389	+1	tier1	-	no_errors	ENST00000417535	ensembl	human	known	74_37	missense	16.47	71	14	SNP	0.000	G
CTAGE6	340307	genome.wustl.edu	37	7	143453646	143453646	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:143453646T>C	ENST00000470691.2	-	1	1143	c.1106A>G	c.(1105-1107)gAa>gGa	p.E369G	RNU6-267P_ENST00000516714.1_RNA	NM_178561.4	NP_848656.2	Q86UF2	CTGE6_HUMAN	CTAGE family, member 6	369						integral component of membrane (GO:0016021)						Melanoma(164;0.0903)					ATATATGTTTTCTGATTGCAA	0.294																																																	0													32.0	26.0	27.0					7																	143453646		1859	4085	5944	SO:0001583	missense	0			BC043153	CCDS64790.1	7q35	2013-05-22	2013-02-25	2013-02-25	ENSG00000271321	ENSG00000271321			28644	protein-coding gene	gene with protein product			"""CTAGE family, member 6, pseudogene"""	CTAGE6P		12477932	Standard	NM_178561		Approved	MGC41943	uc003wdk.4	Q86UF2	OTTHUMG00000157770	ENST00000470691.2:c.1106A>G	7.37:g.143453646T>C	ENSP00000474388:p.Glu369Gly		A4FU29|Q3ZCM5	Missense_Mutation	SNP	superfamily_tRNA-bd_arm	p.E369G	ENST00000470691.2	37	c.1106		7																																																																																			CTAGE6	-	NULL	ENSG00000271321		0.294	CTAGE6-001	KNOWN	basic|appris_principal	protein_coding	CTAGE6	HGNC	protein_coding	OTTHUMT00000349580.2	-	0.00	378	0	T	NM_178561		143453646	-1	tier1	-	no_errors	ENST00000470691	ensembl	human	known	74_37	missense	6.36	206	14	SNP	0.022	C
CYBRD1	79901	genome.wustl.edu	37	2	172378944	172378944	+	5'UTR	SNP	A	A	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:172378944A>C	ENST00000321348.4	+	0	87				CYBRD1_ENST00000375252.3_5'Flank|CYBRD1_ENST00000409484.1_Intron|CYBRD1_ENST00000468308.1_3'UTR	NM_024843.3	NP_079119.3	Q53TN4	CYBR1_HUMAN	cytochrome b reductase 1						cellular iron ion homeostasis (GO:0006879)|response to iron ion (GO:0010039)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)|oxidoreductase activity, oxidizing metal ions (GO:0016722)			endometrium(1)|kidney(1)|large_intestine(3)|liver(2)|lung(3)	10						CCGCAGGCGGAGACAGCCCCA	0.721																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK027115	CCDS2244.1, CCDS46449.1, CCDS58736.1	2q31	2013-03-14			ENSG00000071967	ENSG00000071967		"""Cytochrome b genes"""	20797	protein-coding gene	gene with protein product	"""ferric-chelate reductase 3"", ""cytochrome b561 family, member A2"""	605745				11230685	Standard	NM_001127383		Approved	DCYTB, FLJ23462, FRRS3, CYB561A2	uc002ugy.4	Q53TN4	OTTHUMG00000132260	ENST00000321348.4:c.-112A>C	2.37:g.172378944A>C			B2RE79|B4DWD7|Q6KC16|Q6KC17|Q6P147|Q6ZR51|Q9H0Q8|Q9H5G5	RNA	SNP	-	NULL	ENST00000321348.4	37	NULL	CCDS2244.1	2																																																																																			CYBRD1	-	-	ENSG00000071967		0.721	CYBRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBRD1	HGNC	protein_coding	OTTHUMT00000255344.2	-	0.00	28	0	A	NM_024843		172378944	+1	tier1	-	no_errors	ENST00000468308	ensembl	human	known	74_37	rna	55.56	8	10	SNP	0.190	C
CYP11B2	1585	genome.wustl.edu	37	8	143998573	143998573	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:143998573C>T	ENST00000323110.2	-	2	299	c.297G>A	c.(295-297)aaG>aaA	p.K99K		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	99					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	CCTGTTGCAGCTTCTCCACAT	0.597									Familial Hyperaldosteronism type I																																								0													194.0	152.0	166.0					8																	143998573		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.297G>A	8.37:g.143998573C>T			B0ZBE4|Q16726	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.K99	ENST00000323110.2	37	c.297	CCDS6393.1	8																																																																																			CYP11B2	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000179142		0.597	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1	-	0.00	26	0	C			143998573	-1	tier1	-	no_errors	ENST00000323110	ensembl	human	known	74_37	silent	9.62	47	5	SNP	0.105	T
DDX4	54514	genome.wustl.edu	37	5	55110956	55110956	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:55110956C>T	ENST00000505374.1	+	20	2035	c.1943C>T	c.(1942-1944)tCg>tTg	p.S648L	DDX4_ENST00000353507.5_Missense_Mutation_p.S614L|DDX4_ENST00000354991.5_Missense_Mutation_p.S614L|DDX4_ENST00000511853.1_Missense_Mutation_p.S499L|DDX4_ENST00000514278.2_Missense_Mutation_p.S628L	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	648	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				GATCTTGAATCGGATAACCAT	0.358																																																	0													164.0	161.0	162.0					5																	55110956		2203	4300	6503	SO:0001583	missense	0			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.1943C>T	5.37:g.55110956C>T	ENSP00000424838:p.Ser648Leu		A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S648L	ENST00000505374.1	37	c.1943	CCDS3969.1	5	.	.	.	.	.	.	.	.	.	.	C	9.581	1.123697	0.20959	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000354991;ENST00000511853	D;D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26;-3.26	5.54	4.67	0.58626	Helicase, C-terminal (1);	0.290764	0.33419	N	0.004937	D	0.90813	0.7115	L	0.55017	1.72	0.20563	N	0.999886	B;B;B;D	0.55385	0.184;0.318;0.287;0.971	B;B;B;P	0.44359	0.103;0.048;0.103;0.447	D	0.84758	0.0760	10	0.48119	T	0.1	-6.356	9.3327	0.38032	0.1433:0.7841:0.0:0.0726	.	628;499;614;648	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	L	614;628;648;614;499	ENSP00000334167:S614L;ENSP00000425359:S628L;ENSP00000424838:S648L;ENSP00000347087:S614L;ENSP00000423123:S499L	ENSP00000334167:S614L	S	+	2	0	DDX4	55146713	0.953000	0.32496	0.864000	0.33941	0.002000	0.02628	2.597000	0.46214	1.349000	0.45751	-0.258000	0.10820	TCG	DDX4	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000152670		0.358	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	HGNC	protein_coding	OTTHUMT00000214147.2	-	0.00	91	0	C	NM_024415		55110956	+1	tier1	-	no_errors	ENST00000505374	ensembl	human	known	74_37	missense	31.73	71	33	SNP	0.288	T
DDX54	79039	genome.wustl.edu	37	12	113601889	113601891	+	In_Frame_Del	DEL	CCT	CCT	-			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:113601889_113601891delCCT	ENST00000306014.5	-	15	1946_1948	c.1919_1921delAGG	c.(1918-1923)gaggcg>gcg	p.E640del	DDX54_ENST00000314045.7_In_Frame_Del_p.E640del|DDX54_ENST00000549271.1_5'Flank	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	640	Interaction with nuclear receptors.				ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						ctctctcccgcctcctcctcctc	0.68																																																	0									,	23,3979		3,17,1981					,	-0.2	0.0			22	56,7794		7,42,3876	no	coding,coding	DDX54	NM_024072.3,NM_001111322.1	,	10,59,5857	A1A1,A1R,RR		0.7134,0.5747,0.6666	,	,		79,11773				SO:0001651	inframe_deletion	0			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.1919_1921delAGG	12.37:g.113601898_113601900delCCT	ENSP00000304072:p.Glu640del		Q86YT8|Q9BRZ1	In_Frame_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DBP10CT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.E640in_frame_del	ENST00000306014.5	37	c.1921_1919	CCDS31907.1	12																																																																																			DDX54	-	NULL	ENSG00000123064		0.680	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DDX54	HGNC	protein_coding	OTTHUMT00000405435.1		0.00	47	0	CCT	NM_024072		113601891	-1	tier1		no_errors	ENST00000314045	ensembl	human	known	74_37	in_frame_del	10.34	26	3	DEL	0.000:0.000:0.000	-
DHX9	1660	genome.wustl.edu	37	1	182829305	182829305	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:182829305A>T	ENST00000367549.3	+	12	1428	c.1318A>T	c.(1318-1320)Atc>Ttc	p.I440F		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	440	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AGAGTGTAACATCGTAGTAAC	0.378																																					Colon(69;210 1162 3697 13559 39565)												0													53.0	49.0	50.0					1																	182829305		1844	4084	5928	SO:0001583	missense	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1318A>T	1.37:g.182829305A>T	ENSP00000356520:p.Ile440Phe		B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_dsRNA-bd_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom	p.I440F	ENST00000367549.3	37	c.1318	CCDS41444.1	1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.878959	0.91740	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.15487	2.42	5.58	5.58	0.84498	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61085	0.2319	H	0.98818	4.34	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.78540	-0.2165	10	0.87932	D	0	.	15.4355	0.75143	1.0:0.0:0.0:0.0	.	440	Q08211	DHX9_HUMAN	F	440	ENSP00000356520:I440F	ENSP00000356520:I440F	I	+	1	0	DHX9	181095928	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	6.724000	0.74747	2.134000	0.65973	0.460000	0.39030	ATC	DHX9	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000135829		0.378	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	-	0.00	35	0	A	NM_030588		182829305	+1	tier1	-	no_errors	ENST00000367549	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124332585	124332585	+	Silent	SNP	G	G	A	rs377062646		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:124332585G>A	ENST00000409039.3	+	32	5563	c.5538G>A	c.(5536-5538)gcG>gcA	p.A1846A		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1846	AAA 1. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGGACCTGGCGAAAGCCTTGG	0.567																																																	0								G		1,4017		0,1,2008	117.0	120.0	119.0		5538	-1.9	1.0	12		119	1,8375		0,1,4187	no	coding-synonymous	DNAH10	NM_207437.3		0,2,6195	AA,AG,GG		0.0119,0.0249,0.0161		1846/4472	124332585	2,12392	2009	4188	6197	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5538G>A	12.37:g.124332585G>A			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.A1846	ENST00000409039.3	37	c.5538	CCDS9255.2	12																																																																																			DNAH10	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000197653		0.567	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3		0.00	59	0	G			124332585	+1			no_errors	ENST00000409039	ensembl	human	known	74_37	silent	5.13	37	2	SNP	1.000	A
DNAH12	201625	genome.wustl.edu	37	3	57391464	57391464	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:57391464G>T	ENST00000351747.2	-	41	6615	c.6435C>A	c.(6433-6435)ttC>ttA	p.F2145L		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2145					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TAGTTAACTGGAACAGCCATC	0.388																																																	0													100.0	76.0	83.0					3																	57391464		692	1591	2283	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.6435C>A	3.37:g.57391464G>T	ENSP00000295937:p.Phe2145Leu		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F2145L	ENST00000351747.2	37	c.6435		3	.	.	.	.	.	.	.	.	.	.	G	15.23	2.771054	0.49680	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.37915	1.17;1.17	5.92	4.13	0.48395	.	.	.	.	.	T	0.32285	0.0824	M	0.64170	1.965	0.80722	D	1	P	0.52463	0.953	B	0.39217	0.294	T	0.15578	-1.0432	9	0.40728	T	0.16	.	10.1698	0.42902	0.2044:0.0:0.7956:0.0	.	2145	Q6ZR08	DYH12_HUMAN	L	2145;2164	ENSP00000295937:F2145L;ENSP00000418137:F2164L	ENSP00000295937:F2145L	F	-	3	2	DNAH12	57366504	1.000000	0.71417	0.890000	0.34922	0.549000	0.35272	4.073000	0.57570	1.509000	0.48786	-0.142000	0.14014	TTC	DNAH12	-	NULL	ENSG00000174844		0.388	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		-	0.00	49	0	G	NM_178504		57391464	-1	tier1	-	no_errors	ENST00000351747	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.972	T
DNAH5	1767	genome.wustl.edu	37	5	13700767	13700767	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:13700767T>A	ENST00000265104.4	-	78	13809	c.13705A>T	c.(13705-13707)Att>Ttt	p.I4569F		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4569					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCTGCATAAATCCTTATGACA	0.383									Kartagener syndrome																																								0													164.0	159.0	161.0					5																	13700767		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13705A>T	5.37:g.13700767T>A	ENSP00000265104:p.Ile4569Phe		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.I4569F	ENST00000265104.4	37	c.13705	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	23.4	4.407056	0.83230	.	.	ENSG00000039139	ENST00000265104	T	0.08896	3.04	5.95	5.95	0.96441	Dynein heavy chain (1);	0.044796	0.85682	D	0.000000	T	0.12689	0.0308	L	0.31526	0.94	0.80722	D	1	P	0.41978	0.767	P	0.47941	0.562	T	0.02301	-1.1180	10	0.51188	T	0.08	.	16.4323	0.83853	0.0:0.0:0.0:1.0	.	4569	Q8TE73	DYH5_HUMAN	F	4569	ENSP00000265104:I4569F	ENSP00000265104:I4569F	I	-	1	0	DNAH5	13753767	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	7.793000	0.85851	2.281000	0.76405	0.528000	0.53228	ATT	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.383	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	23	0	T	NM_001369		13700767	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	29.63	19	8	SNP	1.000	A
EDAR	10913	genome.wustl.edu	37	2	109527234	109527234	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:109527234delG	ENST00000258443.2	-	8	1158	c.728delC	c.(727-729)ccafs	p.P243fs	EDAR_ENST00000409271.1_Frame_Shift_Del_p.P275fs|EDAR_ENST00000376651.1_Frame_Shift_Del_p.P275fs	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	243					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						TCACAGACCTGGGGCCTCTTT	0.632																																																	0													72.0	67.0	69.0					2																	109527234		2203	4300	6503	SO:0001589	frameshift_variant	0			AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.728delC	2.37:g.109527234delG	ENSP00000258443:p.Pro243fs		B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Frame_Shift_Del	DEL	pfam_Death_domain,superfamily_DEATH-like_dom	p.P275fs	ENST00000258443.2	37	c.824	CCDS2081.1	2																																																																																			EDAR	-	NULL	ENSG00000135960		0.632	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDAR	HGNC	protein_coding	OTTHUMT00000253595.1		0.00	55	0	G			109527234	-1	tier1		no_errors	ENST00000376651	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.995	-
EDC4	23644	genome.wustl.edu	37	16	67911274	67911274	+	Silent	SNP	C	C	T	rs368076076		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:67911274C>T	ENST00000358933.5	+	5	845	c.606C>T	c.(604-606)ttC>ttT	p.F202F	EDC4_ENST00000574770.1_3'UTR|AC040162.1_ENST00000408599.1_RNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	202					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.F202F(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		GCAACCTGTTCGTGTGGCGCT	0.587																																																	1	Substitution - coding silent(1)	lung(1)						C		0,4396		0,0,2198	119.0	117.0	117.0		606	-1.4	1.0	16		117	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	EDC4	NM_014329.3		0,2,6496	TT,TC,CC		0.0233,0.0,0.0154		202/1402	67911274	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.606C>T	16.37:g.67911274C>T			A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Silent	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F202	ENST00000358933.5	37	c.606	CCDS10849.1	16																																																																																			EDC4	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000038358		0.587	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2	-	0.00	104	0	C	NM_014329		67911274	+1	tier1	-	no_errors	ENST00000358933	ensembl	human	known	74_37	silent	58.90	30	43	SNP	0.992	T
EHBP1	23301	genome.wustl.edu	37	2	62998478	62998478	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:62998478C>A	ENST00000263991.5	+	5	745	c.263C>A	c.(262-264)cCt>cAt	p.P88H	EHBP1_ENST00000405289.1_Missense_Mutation_p.P88H|EHBP1_ENST00000431489.1_Missense_Mutation_p.P88H|EHBP1_ENST00000405015.3_Missense_Mutation_p.P88H|EHBP1_ENST00000354487.3_Missense_Mutation_p.P88H	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	88						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			TTACAGGATCCTCATGCGGAA	0.308																																																	0													122.0	121.0	122.0					2																	62998478		2203	4296	6499	SO:0001583	missense	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.263C>A	2.37:g.62998478C>A	ENSP00000263991:p.Pro88His		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P88H	ENST00000263991.5	37	c.263	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174735	0.78452	.	.	ENSG00000115504	ENST00000405015;ENST00000413434;ENST00000405482;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.79475	2.455	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;0.996;1.0;1.0	D;P;D;D	0.91635	0.999;0.864;0.996;0.998	T	0.72364	-0.4316	10	0.87932	D	0	.	17.8282	0.88672	0.0:1.0:0.0:0.0	.	88;88;88;88	Q8NDI1-2;A8K930;Q8NDI1-3;Q8NDI1	.;.;.;EHBP1_HUMAN	H	88;56;88;88;88;88;88	ENSP00000384143:P88H;ENSP00000392192:P56H;ENSP00000384829:P88H;ENSP00000403783:P88H;ENSP00000263991:P88H;ENSP00000346482:P88H;ENSP00000385524:P88H	ENSP00000263991:P88H	P	+	2	0	EHBP1	62851982	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.786000	0.69006	2.297000	0.77311	0.650000	0.86243	CCT	EHBP1	-	NULL	ENSG00000115504		0.308	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1	-	0.00	123	0	C	NM_015252		62998478	+1	tier1	-	no_errors	ENST00000263991	ensembl	human	known	74_37	missense	33.83	88	45	SNP	1.000	A
EHD1	10938	genome.wustl.edu	37	11	64627509	64627509	+	Missense_Mutation	SNP	G	G	A	rs145274478		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:64627509G>A	ENST00000320631.3	-	3	1056	c.802C>T	c.(802-804)Cgc>Tgc	p.R268C	EHD1_ENST00000359393.2_Missense_Mutation_p.R268C	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	268	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						AAGAGCTTGCGGTTGTCGGGG	0.617																																																	0								G	CYS/ARG	1,4401	2.1+/-5.4	0,1,2200	61.0	62.0	62.0		802	5.1	1.0	11	dbSNP_134	62	0,8594		0,0,4297	no	missense	EHD1	NM_006795.2	180	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	268/535	64627509	1,12995	2201	4297	6498	SO:0001583	missense	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.802C>T	11.37:g.64627509G>A	ENSP00000320516:p.Arg268Cys		O14611|Q2M3Q4|Q9UNR3	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.R268C	ENST00000320631.3	37	c.802	CCDS8084.1	11	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474404	0.63737	2.27E-4	0.0	ENSG00000110047	ENST00000320631;ENST00000359393;ENST00000541001;ENST00000421303;ENST00000421510;ENST00000433803;ENST00000455148	D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.97592	0.9211	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	P;P	0.62184	0.899;0.899	D	0.98186	1.0460	10	0.87932	D	0	.	15.9821	0.80116	0.0:0.0:1.0:0.0	.	268;268	B2R5U3;Q9H4M9	.;EHD1_HUMAN	C	268;268;244;282;132;282;132	ENSP00000320516:R268C;ENSP00000352354:R268C;ENSP00000391429:R132C;ENSP00000404944:R282C;ENSP00000396273:R132C	ENSP00000320516:R268C	R	-	1	0	EHD1	64384085	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.069000	0.41481	2.639000	0.89480	0.561000	0.74099	CGC	EHD1	-	superfamily_P-loop_NTPase	ENSG00000110047		0.617	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	-	0.00	67	0	G	NM_006795		64627509	-1	tier1	rs145274478	no_errors	ENST00000320631	ensembl	human	known	74_37	missense	34.38	42	22	SNP	1.000	A
EHD1	10938	genome.wustl.edu	37	11	64627713	64627713	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:64627713A>G	ENST00000320631.3	-	3	852	c.598T>C	c.(598-600)Ttc>Ctc	p.F200L	EHD1_ENST00000359393.2_Missense_Mutation_p.F200L	NM_001282445.1|NM_006795.2	NP_001269374.1|NP_006786.2	Q9H4M9	EHD1_HUMAN	EH-domain containing 1	200	Dynamin-type G.				blood coagulation (GO:0007596)|cellular response to nerve growth factor stimulus (GO:1990090)|cholesterol homeostasis (GO:0042632)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|low-density lipoprotein particle clearance (GO:0034383)|neuron projection development (GO:0031175)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of myoblast fusion (GO:1901741)|protein homooligomerization (GO:0051260)	early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)	12						ACTTCCGAGAACTCATCGGAG	0.577																																																	0													79.0	71.0	74.0					11																	64627713		2201	4297	6498	SO:0001583	missense	0			AF099011	CCDS8084.1, CCDS73315.1	11q13	2013-01-10			ENSG00000110047	ENSG00000110047		"""EF-hand domain containing"""	3242	protein-coding gene	gene with protein product	"""testilin"""	605888		PAST1		10395801, 10673336	Standard	NM_001282444		Approved	H-PAST, HPAST1, FLJ42622, FLJ44618	uc001obu.1	Q9H4M9	OTTHUMG00000066832	ENST00000320631.3:c.598T>C	11.37:g.64627713A>G	ENSP00000320516:p.Phe200Leu		O14611|Q2M3Q4|Q9UNR3	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.F200L	ENST00000320631.3	37	c.598	CCDS8084.1	11	.	.	.	.	.	.	.	.	.	.	A	23.8	4.463152	0.84425	.	.	ENSG00000110047	ENST00000320631;ENST00000359393;ENST00000541001;ENST00000421303;ENST00000421510;ENST00000433803;ENST00000455148	D;D;D;D;D	0.94828	-3.53;-3.53;-3.53;-3.53;-3.53	5.07	5.07	0.68467	Dynamin, GTPase domain (1);	0.000000	0.85682	D	0.000000	D	0.92410	0.7591	L	0.49256	1.55	0.58432	D	0.999999	B;B	0.24721	0.11;0.11	B;B	0.31016	0.123;0.123	D	0.90568	0.4520	10	0.52906	T	0.07	-46.5375	12.823	0.57704	1.0:0.0:0.0:0.0	.	200;200	B2R5U3;Q9H4M9	.;EHD1_HUMAN	L	200;200;176;214;64;214;64	ENSP00000320516:F200L;ENSP00000352354:F200L;ENSP00000391429:F64L;ENSP00000404944:F214L;ENSP00000396273:F64L	ENSP00000320516:F200L	F	-	1	0	EHD1	64384289	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.254000	0.78329	2.132000	0.65825	0.459000	0.35465	TTC	EHD1	-	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	ENSG00000110047		0.577	EHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD1	HGNC	protein_coding	OTTHUMT00000143229.2	-	0.00	35	0	A	NM_006795		64627713	-1	tier1	-	no_errors	ENST00000320631	ensembl	human	known	74_37	missense	52.00	24	26	SNP	1.000	G
NPIPA8	101059953	genome.wustl.edu	37	16	18437612	18437612	+	5'UTR	DEL	G	G	-			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:18437612delG	ENST00000339303.5	-	0	882				RP11-1212A22.1_ENST00000545152.1_RNA			P0DM63	NPIA8_HUMAN	nuclear pore complex interacting protein family, member A8																		AGTGCACCTTGGTGGTGAGAG	0.692																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS61865.1	16p12.3	2013-06-11			ENSG00000214940	ENSG00000214940			41983	protein-coding gene	gene with protein product	"""morpheus gene family member 9"""					11586358	Standard	NM_001282511		Approved	LCR16a9		P0DM63	OTTHUMG00000166284	ENST00000339303.5:c.-3177C>-	16.37:g.18437612delG				RNA	DEL	-	NULL	ENST00000339303.5	37	NULL		16																																																																																			RP11-1212A22.1	-	-	ENSG00000205746		0.692	NPIPA8-201	KNOWN	basic|appris_candidate	protein_coding	ENSG00000205746	Clone_based_vega_gene	protein_coding			0.00	30	0	G			18437612	-1	tier1		no_errors	ENST00000433020	ensembl	human	known	74_37	rna	27.59	21	8	DEL	0.416	-
AC026781.1	0	genome.wustl.edu	37	5	92053194	92053194	+	RNA	SNP	T	T	C	rs372610079		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:92053194T>C	ENST00000408883.1	-	0	26																											tatatatatatatacacagac	0.313																																																	0																																												0																															5.37:g.92053194T>C				RNA	SNP	-	NULL	ENST00000408883.1	37	NULL		5																																																																																			AC026781.1	-	-	ENSG00000221810		0.313	AC026781.1-201	NOVEL	basic	miRNA	ENSG00000221810	Clone_based_ensembl_gene	miRNA		-	0.00	13	0	T			92053194	-1	tier1	-	no_errors	ENST00000408883	ensembl	human	novel	74_37	rna	77.78	2	7	SNP	0.001	C
AFF3	3899	genome.wustl.edu	37	2	100722620	100722620	+	Intron	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:100722620C>A	ENST00000317233.4	-	2	92				AC092667.2_ENST00000434301.1_RNA|AFF3_ENST00000356421.2_5'Flank|AFF3_ENST00000409236.2_5'Flank|AFF3_ENST00000409579.1_5'Flank	NM_002285.2	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3						embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						CCCTTCTTCCCCCAGCTCTGA	0.408																																																	0																																										SO:0001627	intron_variant	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000317233.4:c.144-575G>T	2.37:g.100722620C>A			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	RNA	SNP	-	NULL	ENST00000317233.4	37	NULL	CCDS42723.1	2																																																																																			AC092667.2	-	-	ENSG00000230393		0.408	AFF3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000230393	Clone_based_vega_gene	protein_coding		-	0.00	16	0	C	NM_002285		100722620	+1	tier1	-	no_errors	ENST00000434301	ensembl	human	known	74_37	rna	27.78	13	5	SNP	0.078	A
EPHA5	2044	genome.wustl.edu	37	4	66197758	66197758	+	Silent	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:66197758G>T	ENST00000273854.3	-	17	3541	c.2941C>A	c.(2941-2943)Cgg>Agg	p.R981R	EPHA5_ENST00000432638.2_Silent_p.R818R|EPHA5_ENST00000511294.1_Silent_p.R982R|EPHA5_ENST00000354839.4_Silent_p.R959R	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	981	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						TCTGTATACCGGCCCATCTTG	0.403										TSP Lung(17;0.13)																																							0													92.0	87.0	89.0					4																	66197758		2203	4300	6503	SO:0001819	synonymous_variant	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.2941C>A	4.37:g.66197758G>T			Q7Z3F2	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R981	ENST00000273854.3	37	c.2941	CCDS3513.1	4																																																																																			EPHA5	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_SAM	ENSG00000145242		0.403	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2		0.00	52	0	G	NM_004439		66197758	-1			no_errors	ENST00000273854	ensembl	human	known	74_37	silent	5.41	35	2	SNP	1.000	T
ERMARD	55780	genome.wustl.edu	37	6	170154006	170154006	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:170154006A>G	ENST00000366773.3	+	2	86	c.53A>G	c.(52-54)tAt>tGt	p.Y18C	ERMARD_ENST00000588451.1_5'UTR|ERMARD_ENST00000392095.4_Intron|ERMARD_ENST00000418781.3_Missense_Mutation_p.Y18C|TCTE3_ENST00000366774.3_5'Flank|ERMARD_ENST00000366772.2_Missense_Mutation_p.Y18C	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	18					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											CCCTCAGTGTATGATATAATT	0.323																																																	0													73.0	69.0	70.0					6																	170154006		2203	4299	6502	SO:0001583	missense	0			AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.53A>G	6.37:g.170154006A>G	ENSP00000355735:p.Tyr18Cys		B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Missense_Mutation	SNP	NULL	p.Y18C	ENST00000366773.3	37	c.53	CCDS34576.1	6	.	.	.	.	.	.	.	.	.	.	A	16.02	3.004941	0.54254	.	.	ENSG00000130023	ENST00000366773;ENST00000366772;ENST00000418781	T	0.47528	0.84	5.66	4.5	0.54988	.	0.512932	0.17974	N	0.155765	T	0.46927	0.1418	L	0.51422	1.61	0.80722	D	1	D;D	0.76494	0.999;0.993	D;P	0.63192	0.912;0.781	T	0.51212	-0.8734	10	0.87932	D	0	.	9.6652	0.39981	0.9178:0.0:0.0822:0.0	.	18;18	Q5T6L9-2;Q5T6L9	.;CF070_HUMAN	C	18	ENSP00000355735:Y18C	ENSP00000355734:Y18C	Y	+	2	0	C6orf70	169895931	1.000000	0.71417	0.570000	0.28473	0.784000	0.44337	4.025000	0.57225	0.978000	0.38470	0.528000	0.53228	TAT	ERMARD	-	NULL	ENSG00000130023		0.323	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMARD	HGNC	protein_coding	OTTHUMT00000043238.2	-	0.00	55	0	A	NM_018341		170154006	+1	tier1	-	no_errors	ENST00000366773	ensembl	human	known	74_37	missense	51.28	19	20	SNP	0.924	G
ERVW-1	30816	genome.wustl.edu	37	7	92099372	92099372	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:92099372G>A	ENST00000493463.2	-	1	1247	c.324C>T	c.(322-324)taC>taT	p.Y108Y	ERVW-1_ENST00000604270.1_Intron|ERVW-1_ENST00000603053.1_Silent_p.Y108Y|AC007566.10_ENST00000427458.1_RNA	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	108					anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						tttgggtgaagtaagtccaac	0.443																																																	0													47.0	48.0	47.0					7																	92099372		2203	4300	6503	SO:0001819	synonymous_variant	0			AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.324C>T	7.37:g.92099372G>A			B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Silent	SNP	pfam_TLV/ENV_coat_polyprotein	p.Y108	ENST00000493463.2	37	c.324	CCDS5626.1	7																																																																																			ERVW-1	-	pfam_TLV/ENV_coat_polyprotein	ENSG00000242950		0.443	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2	-	0.00	32	0	G	NM_014590		92099372	-1	tier1	-	no_errors	ENST00000493463	ensembl	human	known	74_37	silent	33.33	32	16	SNP	0.489	A
ETNK1	55500	genome.wustl.edu	37	12	22826493	22826493	+	Missense_Mutation	SNP	C	C	T	rs371547299	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:22826493C>T	ENST00000266517.4	+	6	1200	c.1111C>T	c.(1111-1113)Cgt>Tgt	p.R371C		NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1	371					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCAGTGGCTGCGTGCTTACCT	0.363													C|||	2	0.000399361	0.0	0.0029	5008	,	,		16392	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(42;87 913 3224 6226 43339)												0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	89.0	90.0	90.0		1111	4.2	1.0	12		90	0,8600		0,0,4300	no	missense	ETNK1	NM_018638.4	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	371/453	22826493	1,13005	2203	4300	6503	SO:0001583	missense	0			BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	ENST00000266517.4:c.1111C>T	12.37:g.22826493C>T	ENSP00000266517:p.Arg371Cys		G5E969	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.R371C	ENST00000266517.4	37	c.1111	CCDS8698.1	12	.	.	.	.	.	.	.	.	.	.	C	18.10	3.548513	0.65311	2.27E-4	0.0	ENSG00000139163	ENST00000266517;ENST00000381409	T	0.59224	0.28	5.13	4.16	0.48862	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.68366	0.2993	M	0.80982	2.52	0.80722	D	1	D;B	0.71674	0.998;0.231	P;B	0.55260	0.772;0.055	T	0.72577	-0.4251	10	0.62326	D	0.03	-1.2295	9.9334	0.41537	0.3572:0.6428:0.0:0.0	.	371;371	E9PD44;Q9HBU6	.;EKI1_HUMAN	C	371	ENSP00000266517:R371C	ENSP00000266517:R371C	R	+	1	0	ETNK1	22717760	1.000000	0.71417	0.998000	0.56505	0.865000	0.49528	4.435000	0.59941	2.380000	0.81148	0.585000	0.79938	CGT	ETNK1	-	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	ENSG00000139163		0.363	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK1	HGNC	protein_coding	OTTHUMT00000401926.2		0.00	28	0	C	NM_018638		22826493	+1			no_errors	ENST00000266517	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
EXD1	161829	genome.wustl.edu	37	15	41508931	41508931	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:41508931G>T	ENST00000314992.5	-	3	339	c.149C>A	c.(148-150)cCt>cAt	p.P50H	EXD1_ENST00000458580.2_Missense_Mutation_p.P108H|EXD1_ENST00000559743.1_5'Flank	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	50	3'-5' exonuclease.						3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						AGGAGAAGCAGGCTCACATAC	0.418																																																	0													174.0	148.0	157.0					15																	41508931		2203	4300	6503	SO:0001583	missense	0			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.149C>A	15.37:g.41508931G>T	ENSP00000321029:p.Pro50His		A8K909|B7Z839|Q6ZW94	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.P50H	ENST00000314992.5	37	c.149	CCDS10072.1	15	.	.	.	.	.	.	.	.	.	.	G	15.38	2.817144	0.50633	.	.	ENSG00000178997	ENST00000314992;ENST00000458580	T;T	0.51574	0.7;0.82	4.89	4.89	0.63831	Ribonuclease H-like (1);	0.167212	0.40554	N	0.001077	T	0.52041	0.1710	M	0.63428	1.95	0.35919	D	0.831663	D;P	0.55172	0.97;0.926	P;P	0.47673	0.554;0.456	T	0.66681	-0.5862	10	0.87932	D	0	-15.7755	13.7517	0.62912	0.0:0.0:1.0:0.0	.	108;50	B7Z839;Q8NHP7	.;EXD1_HUMAN	H	50;108	ENSP00000321029:P50H;ENSP00000415056:P108H	ENSP00000321029:P50H	P	-	2	0	EXD1	39296223	0.037000	0.19845	0.944000	0.38274	0.294000	0.27393	2.062000	0.41413	2.704000	0.92352	0.655000	0.94253	CCT	EXD1	-	superfamily_RNaseH-like_dom	ENSG00000178997		0.418	EXD1-001	KNOWN	basic|CCDS	protein_coding	EXD1	HGNC	protein_coding	OTTHUMT00000252553.2	-	0.00	109	0	G	NM_152596		41508931	-1	tier1	-	no_errors	ENST00000314992	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.938	T
EXO5	64789	genome.wustl.edu	37	1	40981183	40981183	+	Missense_Mutation	SNP	A	A	G	rs145178039		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:40981183A>G	ENST00000372703.1	+	2	2041	c.967A>G	c.(967-969)Atg>Gtg	p.M323V	RP11-656D10.5_ENST00000453437.1_RNA|RP11-656D10.6_ENST00000437060.1_RNA|EXO5_ENST00000296380.4_Missense_Mutation_p.M323V|EXO5_ENST00000358527.2_Missense_Mutation_p.M323V			Q9H790	EXO5_HUMAN	exonuclease 5	323					DNA catabolic process, exonucleolytic (GO:0000738)|interstrand cross-link repair (GO:0036297)	cytosol (GO:0005829)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|single-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008310)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)										GCAGCATTATATGGCCTACTG	0.522													A|||	1	0.000199681	0.0	0.0014	5008	,	,		19723	0.0		0.0	False		,,,				2504	0.0																0								A	VAL/MET	0,4406		0,0,2203	78.0	66.0	70.0		967	-0.1	0.6	1	dbSNP_134	70	2,8598	2.2+/-6.3	0,2,4298	no	missense	DEM1	NM_022774.1	21	0,2,6501	GG,GA,AA		0.0233,0.0,0.0154	benign	323/374	40981183	2,13004	2203	4300	6503	SO:0001583	missense	0			AK024797	CCDS453.1	1p34.2	2012-11-02	2012-10-30	2012-10-30	ENSG00000164002	ENSG00000164002			26115	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 176"", ""defects in morphology 1 homolog (S. cerevisiae)"""	C1orf176, DEM1		23095756	Standard	NM_022774		Approved	FLJ21144	uc001cfp.3	Q9H790	OTTHUMG00000007305	ENST00000372703.1:c.967A>G	1.37:g.40981183A>G	ENSP00000361788:p.Met323Val		D3DPV4|Q5SWM7|Q5SWM8|Q5SWM9|Q5SWN0|Q5SWN1|Q8WTW9	Missense_Mutation	SNP	pfam_EXOV	p.M323V	ENST00000372703.1	37	c.967	CCDS453.1	1	.	.	.	.	.	.	.	.	.	.	A	3.411	-0.120150	0.06838	0.0	2.33E-4	ENSG00000164002	ENST00000358527;ENST00000372703;ENST00000296380	T;T;T	0.32023	1.47;1.47;1.47	5.28	-0.0492	0.13836	.	0.452778	0.19496	N	0.112854	T	0.19167	0.0460	L	0.43152	1.355	0.09310	N	0.999995	B	0.02656	0.0	B	0.10450	0.005	T	0.17561	-1.0365	10	0.21014	T	0.42	-31.8834	4.2545	0.10710	0.4708:0.3416:0.1877:0.0	.	323	Q9H790	EXO5_HUMAN	V	323	ENSP00000351328:M323V;ENSP00000361788:M323V;ENSP00000296380:M323V	ENSP00000296380:M323V	M	+	1	0	DEM1	40753770	0.003000	0.15002	0.647000	0.29507	0.368000	0.29767	-0.262000	0.08682	0.175000	0.19841	0.529000	0.55759	ATG	EXO5	-	pfam_EXOV	ENSG00000164002		0.522	EXO5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXO5	HGNC	protein_coding	OTTHUMT00000019087.1	-	0.00	20	0	A	NM_022774		40981183	+1	tier1	rs145178039	no_errors	ENST00000296380	ensembl	human	known	74_37	missense	41.67	14	10	SNP	0.171	G
FAM183B	340286	genome.wustl.edu	37	7	38725392	38725392	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:38725392G>T	ENST00000409072.3	-	2	1148	c.214C>A	c.(214-216)Cac>Aac	p.H72N				Q6ZVS7	F183B_HUMAN	family with sequence similarity 183, member B	72										endometrium(1)|lung(7)	8						GCAGCATGGTGAATGAGATTC	0.552																																																	0													102.0	103.0	103.0					7																	38725392		1910	4109	6019	SO:0001583	missense	0			AK124132, BC045803		7p14.1	2008-08-11			ENSG00000164556	ENSG00000164556			34511	protein-coding gene	gene with protein product							Standard	NR_028347		Approved	LOC340286	uc011kbd.2	Q6ZVS7	OTTHUMG00000153653	ENST00000409072.3:c.214C>A	7.37:g.38725392G>T	ENSP00000386657:p.His72Asn		A4D1Y1	Missense_Mutation	SNP	NULL	p.H72N	ENST00000409072.3	37	c.214		7	.	.	.	.	.	.	.	.	.	.	G	13.42	2.233030	0.39498	.	.	ENSG00000164556	ENST00000409072	.	.	.	1.16	1.16	0.20824	.	0.000000	0.85682	D	0.000000	T	0.45895	0.1365	.	.	.	0.31746	N	0.635206	.	.	.	.	.	.	T	0.53648	-0.8409	6	0.66056	D	0.02	.	5.574	0.17212	0.0:0.0:1.0:0.0	.	.	.	.	N	72	.	ENSP00000386657:H72N	H	-	1	0	FAM183B	38691917	1.000000	0.71417	0.088000	0.20740	0.085000	0.17905	1.773000	0.38563	0.556000	0.29098	0.563000	0.77884	CAC	FAM183B	-	NULL	ENSG00000164556		0.552	FAM183B-001	NOVEL	basic|appris_principal	protein_coding	FAM183B	HGNC	protein_coding	OTTHUMT00000331972.1	-	0.00	78	0	G	NM_001105282		38725392	-1	tier1	-	no_errors	ENST00000409072	ensembl	human	novel	74_37	missense	35.80	52	29	SNP	0.938	T
FAM133B	257415	genome.wustl.edu	37	7	92206427	92206427	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:92206427G>A	ENST00000445716.1	-	7	557	c.455C>T	c.(454-456)tCa>tTa	p.S152L	FAM133B_ENST00000427372.1_Missense_Mutation_p.S142L|FAM133B_ENST00000438306.1_Missense_Mutation_p.S142L	NM_152789.2	NP_690002.2	Q5BKY9	F133B_HUMAN	family with sequence similarity 133, member B	152	Lys-rich.|Ser-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	4	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CTTACTGTCTGATTCAGTTTC	0.264																																																	0													8.0	7.0	7.0					7																	92206427		1632	3643	5275	SO:0001583	missense	0				CCDS47640.1, CCDS47641.1	7q21.2	2014-02-12	2007-04-26		ENSG00000234545	ENSG00000234545			28629	protein-coding gene	gene with protein product						12477932	Standard	NM_152789		Approved	MGC40405	uc003umc.3	Q5BKY9	OTTHUMG00000155863	ENST00000445716.1:c.455C>T	7.37:g.92206427G>A	ENSP00000398401:p.Ser152Leu		B2R994|Q05D67|Q6P5S6|Q8N0W8	Missense_Mutation	SNP	NULL	p.S152L	ENST00000445716.1	37	c.455	CCDS47640.1	7	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437511	0.62955	.	.	ENSG00000234545	ENST00000438306;ENST00000445716;ENST00000427372;ENST00000494079	T;T;T	0.51071	0.72;0.73;0.72	5.4	5.4	0.78164	.	.	.	.	.	T	0.64305	0.2586	L	0.50919	1.6	0.41553	D	0.988587	D	0.61080	0.989	D	0.72625	0.978	T	0.64859	-0.6308	9	0.59425	D	0.04	-3.3975	17.7271	0.88368	0.0:0.0:1.0:0.0	.	152	Q5BKY9	F133B_HUMAN	L	142;152;142;49	ENSP00000389783:S142L;ENSP00000398401:S152L;ENSP00000402843:S142L	ENSP00000402843:S142L	S	-	2	0	FAM133B	92044363	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.901000	0.63259	2.695000	0.91970	0.650000	0.86243	TCA	FAM133B	-	NULL	ENSG00000234545		0.264	FAM133B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM133B	HGNC	protein_coding	OTTHUMT00000342181.2	-	0.00	24	0	G	NM_001040057		92206427	-1	tier1	-	no_errors	ENST00000445716	ensembl	human	known	74_37	missense	50.94	26	27	SNP	1.000	A
FAM208B	54906	genome.wustl.edu	37	10	5791064	5791064	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:5791064C>G	ENST00000328090.5	+	15	6305	c.5680C>G	c.(5680-5682)Cct>Gct	p.P1894A		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1894																	GACGAGCCTCCCTCCCGGGCA	0.557																																																	0													35.0	36.0	35.0					10																	5791064		1973	4154	6127	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.5680C>G	10.37:g.5791064C>G	ENSP00000328426:p.Pro1894Ala		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.P1894A	ENST00000328090.5	37	c.5680	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	10.42	1.344257	0.24339	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.04603	3.59	5.56	1.56	0.23342	.	0.517985	0.18206	N	0.148359	T	0.03348	0.0097	L	0.27053	0.805	0.09310	N	1	B	0.22276	0.067	B	0.18263	0.021	T	0.44050	-0.9353	10	0.30078	T	0.28	.	6.0861	0.19968	0.0:0.6367:0.1346:0.2287	.	1894	Q5VWN6	F208B_HUMAN	A	1894;1089	ENSP00000328426:P1894A	ENSP00000328426:P1894A	P	+	1	0	C10orf18	5831070	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.819000	0.04462	0.025000	0.15241	0.563000	0.77884	CCT	FAM208B	-	NULL	ENSG00000108021		0.557	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	-	0.00	42	0	C	NM_017782		5791064	+1	tier1	-	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	43.14	29	22	SNP	0.000	G
FAM76A	199870	genome.wustl.edu	37	1	28087091	28087091	+	Nonstop_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:28087091G>T	ENST00000373954.6	+	9	1025	c.923G>T	c.(922-924)tGa>tTa	p.*308L	FAM76A_ENST00000010299.6_Nonstop_Mutation_p.*342L|FAM76A_ENST00000419687.2_Nonstop_Mutation_p.*228L|FAM76A_ENST00000234549.7_Nonstop_Mutation_p.*313L|FAM76A_ENST00000373949.1_Nonstop_Mutation_p.*279L	NM_001143912.1|NM_152660.2	NP_001137384.1|NP_689873.1	Q8TAV0	FA76A_HUMAN	family with sequence similarity 76, member A	0										endometrium(4)|kidney(2)|large_intestine(1)|lung(2)	9		Colorectal(325;0.000147)|all_lung(284;0.00181)|Lung NSC(340;0.00278)|Renal(390;0.00357)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00253)|KIRC - Kidney renal clear cell carcinoma(1967;0.00292)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTCTCCATGACAGACCTCA	0.478																																																	0													42.0	41.0	41.0					1																	28087091		2203	4300	6503	SO:0001578	stop_lost	0			AK098318	CCDS309.1, CCDS44092.1, CCDS44093.1, CCDS44094.1, CCDS44095.1	1p35.3	2008-02-05			ENSG00000009780	ENSG00000009780			28530	protein-coding gene	gene with protein product							Standard	NM_001143912		Approved	MGC34648	uc001bor.3	Q8TAV0	OTTHUMG00000003729	ENST00000373954.6:c.923G>T	1.37:g.28087091G>T	ENSP00000363065:p.*308Leuext*32		B4DWT3|O95565|O95566|Q8N7J5	Nonstop_Mutation	SNP	NULL	p.*342L	ENST00000373954.6	37	c.1025	CCDS309.1	1	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900874	0.72754	.	.	ENSG00000009780	ENST00000373954;ENST00000419687;ENST00000234549;ENST00000373949;ENST00000010299	.	.	.	5.85	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.774	0.34751	0.1762:0.0:0.8238:0.0	.	.	.	.	L	308;228;313;279;342	.	.	X	+	2	2	FAM76A	27959678	1.000000	0.71417	0.749000	0.31150	0.704000	0.40688	3.073000	0.50057	1.484000	0.48361	-0.137000	0.14449	TGA	FAM76A	-	NULL	ENSG00000009780		0.478	FAM76A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM76A	HGNC	protein_coding	OTTHUMT00000010514.3	-	0.00	26	0	G	NM_152660		28087091	+1	tier1	-	no_errors	ENST00000010299	ensembl	human	known	74_37	nonstop	11.43	31	4	SNP	0.962	T
FAM83B	222584	genome.wustl.edu	37	6	54735248	54735248	+	Silent	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:54735248C>G	ENST00000306858.7	+	2	320	c.204C>G	c.(202-204)gtC>gtG	p.V68V		NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	68										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					TGAAAAATGTCCAGAAAGTTG	0.408																																																	0													96.0	101.0	99.0					6																	54735248		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.204C>G	6.37:g.54735248C>G			Q2M1P3|Q96DQ2	Silent	SNP	pfam_DUF1669	p.V68	ENST00000306858.7	37	c.204	CCDS34479.1	6																																																																																			FAM83B	-	pfam_DUF1669	ENSG00000168143		0.408	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	HGNC	protein_coding	OTTHUMT00000040994.1	-	0.00	47	0	C	XM_294139		54735248	+1	tier1	-	no_errors	ENST00000306858	ensembl	human	known	74_37	silent	52.00	12	13	SNP	0.915	G
FITM1	161247	genome.wustl.edu	37	14	24601457	24601457	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:24601457T>C	ENST00000267426.5	+	2	593	c.304T>C	c.(304-306)Ttc>Ctc	p.F102L	FITM1_ENST00000559294.1_5'UTR	NM_203402.2	NP_981947.1	A5D6W6	FITM1_HUMAN	fat storage-inducing transmembrane protein 1	102					lipid particle organization (GO:0034389)|positive regulation of sequestering of triglyceride (GO:0010890)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.F102I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						GACATGCACTTTCTTAGGGGG	0.567																																																	1	Substitution - Missense(1)	breast(1)											92.0	94.0	93.0					14																	24601457		2203	4300	6503	SO:0001583	missense	0				CCDS9611.1	14q12	2009-07-09			ENSG00000139914	ENSG00000139914			33714	protein-coding gene	gene with protein product	"""fat-inducing transcript 1"""	612028				18160536	Standard	NM_203402		Approved	FIT1	uc001wmf.2	A5D6W6	OTTHUMG00000133476	ENST00000267426.5:c.304T>C	14.37:g.24601457T>C	ENSP00000267426:p.Phe102Leu		Q8IUQ7	Missense_Mutation	SNP	pfam_FIT	p.F102L	ENST00000267426.5	37	c.304	CCDS9611.1	14	.	.	.	.	.	.	.	.	.	.	t	2.922	-0.223071	0.06061	.	.	ENSG00000139914	ENST00000267426	.	.	.	5.36	5.36	0.76844	.	0.061993	0.64402	D	0.000004	T	0.21590	0.0520	N	0.02368	-0.58	0.80722	D	1	B	0.16396	0.017	B	0.17433	0.018	T	0.21999	-1.0229	9	0.05620	T	0.96	-14.3606	7.9709	0.30127	0.0:0.091:0.0:0.909	.	102	A5D6W6	FITM1_HUMAN	L	102	.	ENSP00000267426:F102L	F	+	1	0	FITM1	23671297	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.463000	0.35277	2.028000	0.59812	0.379000	0.24179	TTC	FITM1	-	pfam_FIT	ENSG00000139914		0.567	FITM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FITM1	HGNC	protein_coding	OTTHUMT00000257366.1	-	0.00	30	0	T	NM_203402		24601457	+1	tier1	-	no_errors	ENST00000267426	ensembl	human	known	74_37	missense	23.33	23	7	SNP	1.000	C
FLRT3	23767	genome.wustl.edu	37	20	14306311	14306311	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:14306311T>C	ENST00000378053.3	-	2	2098	c.1842A>G	c.(1840-1842)atA>atG	p.I614M	MACROD2_ENST00000310348.4_Intron|MACROD2_ENST00000217246.4_Intron|FLRT3_ENST00000341420.4_Missense_Mutation_p.I614M	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	614					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		TAGGAGGAAATATGGTGTGTA	0.403																																																	0													245.0	215.0	225.0					20																	14306311		2203	4300	6503	SO:0001583	missense	0			AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.1842A>G	20.37:g.14306311T>C	ENSP00000367292:p.Ile614Met		D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.I614M	ENST00000378053.3	37	c.1842	CCDS13121.1	20	.	.	.	.	.	.	.	.	.	.	T	11.79	1.742481	0.30865	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.70516	-0.49;-0.49	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.81283	0.4790	M	0.61703	1.905	0.53005	D	0.999961	D	0.89917	1.0	D	0.77557	0.99	T	0.82961	-0.0197	10	0.87932	D	0	-16.1162	12.2619	0.54655	0.1341:0.0:0.0:0.8659	.	614	Q9NZU0	FLRT3_HUMAN	M	614	ENSP00000367292:I614M;ENSP00000339912:I614M	ENSP00000339912:I614M	I	-	3	3	FLRT3	14254311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.409000	0.34680	2.320000	0.78422	0.528000	0.53228	ATA	FLRT3	-	NULL	ENSG00000125848		0.403	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT3	HGNC	protein_coding	OTTHUMT00000078075.1	-	0.00	99	0	T	NM_013281		14306311	-1	tier1	-	no_errors	ENST00000341420	ensembl	human	known	74_37	missense	22.67	58	17	SNP	1.000	C
GARS	2617	genome.wustl.edu	37	7	30661051	30661051	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:30661051G>T	ENST00000389266.3	+	11	1643	c.1402G>T	c.(1402-1404)Gac>Tac	p.D468Y		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	468					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	TTCCTGTTATGACCTCTCCTG	0.388																																																	0													233.0	227.0	229.0					7																	30661051		1895	4128	6023	SO:0001583	missense	0			AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.1402G>T	7.37:g.30661051G>T	ENSP00000373918:p.Asp468Tyr		B3KQA2|B4DIA0|Q969Y1	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,prints_tRNA-synt_gly,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_tRNA-synt_gly	p.D468Y	ENST00000389266.3	37	c.1402	CCDS43564.1	7	.	.	.	.	.	.	.	.	.	.	G	26.6	4.754542	0.89843	.	.	ENSG00000106105	ENST00000389266	D	0.93247	-3.19	5.64	5.64	0.86602	Aminoacyl-tRNA synthetase, class II (1);	0.000000	0.85682	D	0.000000	D	0.98043	0.9355	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.98991	1.0808	10	0.87932	D	0	-24.4244	17.5762	0.87950	0.0:0.0:1.0:0.0	.	468	P41250	SYG_HUMAN	Y	468	ENSP00000373918:D468Y	ENSP00000373918:D468Y	D	+	1	0	GARS	30627576	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.823000	0.99369	2.831000	0.97527	0.650000	0.86243	GAC	GARS	-	pfscan_aa-tRNA-synth_II,tigrfam_tRNA-synt_gly	ENSG00000106105		0.388	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GARS	HGNC	protein_coding	OTTHUMT00000327735.1	-	0.00	41	0	G	NM_002047		30661051	+1	tier1	-	no_errors	ENST00000389266	ensembl	human	known	74_37	missense	31.11	31	14	SNP	1.000	T
GAL3ST4	79690	genome.wustl.edu	37	7	99758410	99758410	+	Missense_Mutation	SNP	C	C	T	rs146874152		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:99758410C>T	ENST00000360039.4	-	4	994	c.602G>A	c.(601-603)cGt>cAt	p.R201H	GAL3ST4_ENST00000411994.1_Missense_Mutation_p.V100M|C7orf43_ENST00000316937.3_5'Flank|GAL3ST4_ENST00000426974.2_Missense_Mutation_p.R139H|GAL3ST4_ENST00000423751.1_Missense_Mutation_p.V100M|C7orf43_ENST00000457641.1_5'Flank|GAL3ST4_ENST00000413800.1_Missense_Mutation_p.R201H	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4	201				RGDH -> VGTT (in Ref. 2; AAL55759). {ECO:0000305}.	cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTGGTCCCCACGGGCCCCAGG	0.562																																																	0								C	HIS/ARG	0,4406		0,0,2203	52.0	55.0	54.0		602	4.0	1.0	7	dbSNP_134	54	2,8598	2.2+/-6.3	0,2,4298	no	missense	GAL3ST4	NM_024637.4	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	201/487	99758410	2,13004	2203	4300	6503	SO:0001583	missense	0			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.602G>A	7.37:g.99758410C>T	ENSP00000353142:p.Arg201His		A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Missense_Mutation	SNP	pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	p.R201H	ENST00000360039.4	37	c.602	CCDS5688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.60|17.60	3.429649|3.429649	0.62844|0.62844	0.0|0.0	2.33E-4|2.33E-4	ENSG00000197093|ENSG00000197093	ENST00000413800;ENST00000360039;ENST00000426974|ENST00000423751;ENST00000411994	D;D;D|.	0.99727|.	-6.55;-6.55;-6.55|.	4.82|4.82	3.95|3.95	0.45737|0.45737	.|.	0.251277|.	0.30593|.	U|.	0.009287|.	T|T	0.58380|0.58380	0.2118|0.2118	L|L	0.41632|0.41632	1.29|1.29	0.44976|0.44976	D|D	0.997993|0.997993	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.87578|.	0.998;0.93|.	T|T	0.61710|0.61710	-0.7007|-0.7007	10|6	0.33141|0.87932	T|D	0.24|0	-6.8805|-6.8805	11.1047|11.1047	0.48197|0.48197	0.0:0.9095:0.0:0.0905|0.0:0.9095:0.0:0.0905	.|.	139;201|.	B4DWL8;Q96RP7|.	.;G3ST4_HUMAN|.	H|M	201;201;139|100	ENSP00000400451:R201H;ENSP00000353142:R201H;ENSP00000398304:R139H|.	ENSP00000353142:R201H|ENSP00000414733:V100M	R|V	-|-	2|1	0|0	GAL3ST4|GAL3ST4	99596346|99596346	0.000000|0.000000	0.05858|0.05858	0.995000|0.995000	0.50966|0.50966	0.912000|0.912000	0.54170|0.54170	0.668000|0.668000	0.25127|0.25127	1.283000|1.283000	0.44513|0.44513	-0.283000|-0.283000	0.09986|0.09986	CGT|GTG	GAL3ST4	-	pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	ENSG00000197093		0.562	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAL3ST4	HGNC	protein_coding	OTTHUMT00000337495.2		0.00	33	0	C	NM_024637		99758410	-1			no_errors	ENST00000360039	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.991	T
GGN	199720	genome.wustl.edu	37	19	38876922	38876922	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:38876922G>A	ENST00000334928.6	-	3	1112	c.980C>T	c.(979-981)tCg>tTg	p.S327L	GGN_ENST00000591809.1_Intron|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	327	Interaction with GGNBP1. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CGCAGGCGCCGAGGGAGGACC	0.687																																																	0													27.0	31.0	30.0					19																	38876922		2200	4297	6497	SO:0001583	missense	0			AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.980C>T	19.37:g.38876922G>A	ENSP00000334940:p.Ser327Leu		Q7RTU6|Q86UU4|Q8NAA1	Missense_Mutation	SNP	NULL	p.S327L	ENST00000334928.6	37	c.980	CCDS12516.1	19	.	.	.	.	.	.	.	.	.	.	G	8.740	0.918779	0.17982	.	.	ENSG00000179168	ENST00000334928	.	.	.	3.33	3.33	0.38152	.	0.568049	0.13357	N	0.393921	T	0.48926	0.1527	L	0.27053	0.805	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.29305	-1.0016	9	0.72032	D	0.01	-11.5471	10.004	0.41946	0.0:0.0:1.0:0.0	.	244;327	Q86UU5-2;Q86UU5	.;GGN_HUMAN	L	327	.	ENSP00000334940:S327L	S	-	2	0	GGN	43568762	0.918000	0.31147	0.557000	0.28306	0.162000	0.22319	2.040000	0.41203	1.679000	0.50963	0.462000	0.41574	TCG	GGN	-	NULL	ENSG00000179168		0.687	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGN	HGNC	protein_coding	OTTHUMT00000459205.1		0.00	36	0	G	NM_152657		38876922	-1			no_errors	ENST00000334928	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.042	A
GGT5	2687	genome.wustl.edu	37	22	24627486	24627486	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr22:24627486G>T	ENST00000327365.4	-	6	1183	c.767C>A	c.(766-768)aCg>aAg	p.T256K	GGT5_ENST00000398292.3_Missense_Mutation_p.T256K|GGT5_ENST00000263112.7_Missense_Mutation_p.T224K|GGT5_ENST00000418439.2_Missense_Mutation_p.T179K	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	256					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						GTCCTGCAGCGTCAGCTGGCT	0.622																																																	0													25.0	23.0	24.0					22																	24627486		2193	4296	6489	SO:0001583	missense	0			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.767C>A	22.37:g.24627486G>T	ENSP00000330080:p.Thr256Lys		Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.T256K	ENST00000327365.4	37	c.767	CCDS13825.1	22	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182869	0.78677	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.09445	2.98;2.98;2.98;2.98	4.91	3.82	0.43975	.	0.270011	0.37809	N	0.001935	T	0.37019	0.0988	M	0.88570	2.965	0.46874	D	0.999234	D;D;D;D;D	0.89917	1.0;0.995;0.996;0.998;0.996	D;P;D;D;D	0.87578	0.998;0.847;0.939;0.978;0.939	T	0.34179	-0.9839	10	0.59425	D	0.04	-54.9962	12.7468	0.57285	0.0:0.1668:0.8331:0.0	.	179;224;256;256;256	E7EUG3;P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;.;GGT5_HUMAN	K	256;224;171;256;179	ENSP00000330080:T256K;ENSP00000263112:T224K;ENSP00000381340:T256K;ENSP00000392146:T179K	ENSP00000263112:T224K	T	-	2	0	GGT5	22957486	0.999000	0.42202	0.891000	0.34965	0.835000	0.47333	3.303000	0.51858	2.470000	0.83445	0.485000	0.47835	ACG	GGT5	-	pfam_GGT_peptidase,prints_GGT_peptidase	ENSG00000099998		0.622	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GGT5	HGNC	protein_coding	OTTHUMT00000320119.1	-	0.00	38	0	G	NM_004121		24627486	-1	tier1	-	no_errors	ENST00000398292	ensembl	human	known	74_37	missense	27.45	37	14	SNP	0.966	T
GLTSCR1L	23506	genome.wustl.edu	37	6	42824919	42824920	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:42824919_42824920GC>TT	ENST00000314073.5	+	10	2375_2376	c.2199_2200GC>TT	c.(2197-2202)ctGCtc>ctTTtc	p.L734F	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.L734F			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	734																	TACAGAGACTGCTCTCCTACCA	0.53																																																	0																																										SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	Exception_encountered	6.37:g.42824919_42824920delinsTT	ENSP00000313933:p.Leu734Phe		A1L3W2|Q5TFZ3|Q92514	Silent|Missense_Mutation	SNP	NULL	p.L733|p.L734F	ENST00000314073.5	37	c.2199|c.2200	CCDS34451.1	6																																																																																			GLTSCR1L	-	NULL	ENSG00000112624		0.530	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1L	HGNC	protein_coding	OTTHUMT00000040562.3	-	0.00	28	0	G|C	NM_015349		42824919|42824920	+1	tier1	-	no_errors	ENST00000314073	ensembl	human	known	74_37	silent|missense	39.53|40.48	26|25	17	SNP	1.000	T
GNAI2	2771	genome.wustl.edu	37	3	50296329	50296329	+	3'UTR	DEL	G	G	-	rs146158517|rs199935816	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:50296329delG	ENST00000313601.6	+	0	2006				GNAI2_ENST00000491100.1_3'UTR|GNAI2_ENST00000266027.5_3'UTR|GNAI2_ENST00000422163.1_3'UTR|GNAI2_ENST00000536647.1_3'UTR|U73166.2_ENST00000439898.1_lincRNA	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		TGAAAGTAAAGGAAAAAAAAA	0.428													?|GG|G|unsure	833	0.166334	0.0015	0.2695	5008	,	,		16171	0.6161		0.0109	False		,,,				2504	0.0123																0																																										SO:0001624	3_prime_UTR_variant	0			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*554G>-	3.37:g.50296329delG			B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	RNA	DEL	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3																																																																																			GNAI2	-	-	ENSG00000114353		0.428	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	HGNC	protein_coding	OTTHUMT00000346688.1		0.00	9	0	G	NM_002070		50296329	+1	tier1		no_errors	ENST00000491100	ensembl	human	known	74_37	rna	50.00	3	3	DEL	0.001	-
GOLGA6B	55889	genome.wustl.edu	37	15	72958352	72958352	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:72958352C>T	ENST00000421285.3	+	17	1837	c.1837C>T	c.(1837-1839)Ctt>Ttt	p.L613F	RN7SL853P_ENST00000477951.2_RNA	NM_018652.4	NP_061122.4	A6NDN3	GOG6B_HUMAN	golgin A6 family, member B	613						Golgi apparatus (GO:0005794)				NS(1)|breast(1)|endometrium(1)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	16						GGTGTTGCCCCTTGTGGGCAA	0.657																																																	0													6.0	7.0	7.0					15																	72958352		1889	3938	5827	SO:0001583	missense	0				CCDS10245.2	15q24.1	2011-10-25	2010-02-12		ENSG00000215186	ENSG00000215186			32205	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6B"""				Standard	XM_006720604		Approved		uc010uks.1	A6NDN3	OTTHUMG00000133511	ENST00000421285.3:c.1837C>T	15.37:g.72958352C>T	ENSP00000408132:p.Leu613Phe		A8MYY7	Missense_Mutation	SNP	NULL	p.L613F	ENST00000421285.3	37	c.1837	CCDS10245.2	15	.	.	.	.	.	.	.	.	.	.	.	14.15	2.448095	0.43429	.	.	ENSG00000215186	ENST00000421285	T	0.39229	1.09	0.39	0.39	0.16275	.	.	.	.	.	T	0.41811	0.1175	M	0.73962	2.25	0.40188	D	0.977374	P	0.43973	0.823	B	0.42771	0.397	T	0.47249	-0.9132	9	0.87932	D	0	.	6.668	0.23052	0.0:0.9998:0.0:2.0E-4	.	613	A6NDN3	GOG6B_HUMAN	F	613	ENSP00000408132:L613F	ENSP00000408132:L613F	L	+	1	0	GOLGA6B	70745405	0.925000	0.31364	0.102000	0.21198	0.012000	0.07955	1.665000	0.37449	0.472000	0.27344	0.134000	0.15878	CTT	GOLGA6B	-	NULL	ENSG00000215186		0.657	GOLGA6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6B	HGNC	protein_coding	OTTHUMT00000257474.4		0.00	100	0	C	NM_018652		72958352	+1			no_errors	ENST00000421285	ensembl	human	known	74_37	missense	16.47	71	14	SNP	1.000	T
GPR107	57720	genome.wustl.edu	37	9	132816283	132816283	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:132816283C>T	ENST00000372406.1	+	1	579	c.72C>T	c.(70-72)ctC>ctT	p.L24L	GPR107_ENST00000347136.6_Silent_p.L24L|GPR107_ENST00000372410.3_Silent_p.L24L	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	24						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				TCCGGCTGCTCCCAATGCTGG	0.706																																																	0													5.0	7.0	6.0					9																	132816283		2097	4118	6215	SO:0001819	synonymous_variant	0			AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.72C>T	9.37:g.132816283C>T			A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Silent	SNP	pfam_TM_rcpt_euk,pfam_Intimal_thickness-rel_rcpt	p.L24	ENST00000372406.1	37	c.72	CCDS48041.1	9																																																																																			GPR107	-	NULL	ENSG00000148358		0.706	GPR107-003	NOVEL	basic|CCDS	protein_coding	GPR107	HGNC	protein_coding	OTTHUMT00000054643.2	-	0.00	15	0	C			132816283	+1	tier1	-	no_errors	ENST00000372410	ensembl	human	known	74_37	silent	26.67	11	4	SNP	0.162	T
GPR179	440435	genome.wustl.edu	37	17	36483731	36483731	+	Silent	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:36483731G>T	ENST00000342292.4	-	11	5741	c.5721C>A	c.(5719-5721)tcC>tcA	p.S1907S	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1907					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TTGCTTCCAAGGAATGTCCCT	0.522																																																	0													83.0	81.0	82.0					17																	36483731		1927	4148	6075	SO:0001819	synonymous_variant	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.5721C>A	17.37:g.36483731G>T				Silent	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C	p.S1907	ENST00000342292.4	37	c.5721	CCDS42308.1	17																																																																																			GPR179	-	NULL	ENSG00000188888		0.522	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	-	0.00	93	0	G			36483731	-1	tier1	-	no_errors	ENST00000342292	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.016	T
GPR98	84059	genome.wustl.edu	37	5	89948338	89948338	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:89948338G>A	ENST00000405460.2	+	19	3688	c.3592G>A	c.(3592-3594)Gaa>Aaa	p.E1198K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1198	Calx-beta 9. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TAAAATTCCTGAATTCAATGA	0.323																																																	0													62.0	56.0	58.0					5																	89948338		1835	4090	5925	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3592G>A	5.37:g.89948338G>A	ENSP00000384582:p.Glu1198Lys		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E1198K	ENST00000405460.2	37	c.3592	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.535454	0.96460	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.61274	0.12	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.69663	0.3136	L	0.36672	1.1	0.80722	D	1	D	0.69078	0.997	D	0.68039	0.955	T	0.70008	-0.4990	10	0.87932	D	0	.	20.6525	0.99598	0.0:0.0:1.0:0.0	.	1198	Q8WXG9	GPR98_HUMAN	K	1198	ENSP00000384582:E1198K	ENSP00000296619:E1198K	E	+	1	0	GPR98	89984094	1.000000	0.71417	1.000000	0.80357	0.722000	0.41435	9.592000	0.98245	2.890000	0.99128	0.585000	0.79938	GAA	GPR98	-	NULL	ENSG00000164199		0.323	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2		0.00	34	0	G	NM_032119		89948338	+1			no_errors	ENST00000405460	ensembl	human	known	74_37	missense	36.36	14	8	SNP	1.000	A
GRASP	160622	genome.wustl.edu	37	12	52407950	52407950	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:52407950G>T	ENST00000293662.4	+	7	727	c.647G>T	c.(646-648)aGg>aTg	p.R216M	GRASP_ENST00000552963.1_3'UTR|GRASP_ENST00000380039.2_Missense_Mutation_p.R73M|GRASP_ENST00000552049.1_Missense_Mutation_p.R73M	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	216	Interaction with PSCD3. {ECO:0000250}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GGAGAGTACAGGTCCCTAATG	0.582																																																	0													82.0	71.0	74.0					12																	52407950		2202	4300	6502	SO:0001583	missense	0			AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.647G>T	12.37:g.52407950G>T	ENSP00000293662:p.Arg216Met		Q6PIF8|Q7Z741	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R216M	ENST00000293662.4	37	c.647	CCDS8817.1	12	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615955	0.87359	.	.	ENSG00000161835	ENST00000293662;ENST00000552049;ENST00000546756;ENST00000380039	T;T	0.59638	0.25;0.55	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.71134	0.3304	L	0.60455	1.87	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	T	0.74621	-0.3604	10	0.87932	D	0	1.1324	13.6227	0.62146	0.0:0.0:1.0:0.0	.	73;216	Q7Z6J2-2;Q7Z6J2	.;GRASP_HUMAN	M	216;73;86;73	ENSP00000293662:R216M;ENSP00000448476:R86M	ENSP00000293662:R216M	R	+	2	0	GRASP	50694217	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.368000	0.90115	2.280000	0.76307	0.460000	0.39030	AGG	GRASP	-	NULL	ENSG00000161835		0.582	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRASP	HGNC	protein_coding	OTTHUMT00000404972.1	-	0.00	60	0	G			52407950	+1	tier1	-	no_errors	ENST00000293662	ensembl	human	known	74_37	missense	9.80	46	5	SNP	1.000	T
HCAR3	8843	genome.wustl.edu	37	12	123200613	123200613	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:123200613G>A	ENST00000528880.2	-	1	826	c.672C>T	c.(670-672)gcC>gcT	p.A224A	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	224					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	TCTTGATCTTGGCATGCCGGT	0.547																																																	0													37.0	39.0	39.0					12																	123200613		2201	4278	6479	SO:0001819	synonymous_variant	0			D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.672C>T	12.37:g.123200613G>A			A8K4G5|B2R830|E9PI97|Q8NGE4	Silent	SNP	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A224	ENST00000528880.2	37	c.672	CCDS53842.1	12																																																																																			HCAR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000255398		0.547	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR3	HGNC	protein_coding	OTTHUMT00000387549.2		0.00	14	0	G	NM_006018		123200613	-1			no_errors	ENST00000528880	ensembl	human	known	74_37	silent	57.14	3	4	SNP	0.446	A
HEATR1	55127	genome.wustl.edu	37	1	236730087	236730087	+	Missense_Mutation	SNP	G	G	C	rs143307751	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:236730087G>C	ENST00000366582.3	-	30	4281	c.4167C>G	c.(4165-4167)caC>caG	p.H1389Q	HEATR1_ENST00000366581.2_Missense_Mutation_p.H1308Q	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1389					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GCTCCGGGACGTGTGGCAGCG	0.443																																																	0													73.0	75.0	74.0					1																	236730087		2203	4300	6503	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4167C>G	1.37:g.236730087G>C	ENSP00000355541:p.His1389Gln		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.H1389Q	ENST00000366582.3	37	c.4167	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	G	12.26	1.885262	0.33255	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.31510	1.49;1.49	5.6	-3.08	0.05347	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	M	0.77616	2.38	0.80722	D	1	P;D	0.89917	0.877;1.0	P;D	0.75484	0.625;0.986	T	0.56811	-0.7917	10	0.72032	D	0.01	.	14.2368	0.65932	0.7221:0.0:0.2779:0.0	.	1308;1389	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	Q	1389;1308	ENSP00000355541:H1389Q;ENSP00000355540:H1308Q	ENSP00000355540:H1308Q	H	-	3	2	HEATR1	234796710	0.704000	0.27836	0.344000	0.25628	0.036000	0.12997	-0.048000	0.11944	-0.581000	0.05937	-0.880000	0.02959	CAC	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.443	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	-	0.00	22	0	G	XM_375853		236730087	-1	tier1	-	no_errors	ENST00000366582	ensembl	human	known	74_37	missense	53.33	7	8	SNP	0.918	C
HELZ2	85441	genome.wustl.edu	37	20	62196935	62196935	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:62196935G>A	ENST00000467148.1	-	8	3309	c.3240C>T	c.(3238-3240)gaC>gaT	p.D1080D	HELZ2_ENST00000427522.2_Silent_p.D511D	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1080					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TCTGGCTCTCGTCCAGAAGCT	0.672																																																	0													33.0	26.0	28.0					20																	62196935		2196	4294	6490	SO:0001819	synonymous_variant	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.3240C>T	20.37:g.62196935G>A			Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	superfamily_P-loop_NTPase	p.D1080	ENST00000467148.1	37	c.3240	CCDS33508.1	20																																																																																			HELZ2	-	NULL	ENSG00000130589		0.672	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	-	0.00	15	0	G	NM_001037335		62196935	-1	tier1	-	no_errors	ENST00000467148	ensembl	human	known	74_37	silent	25.00	12	4	SNP	0.799	A
HIST1H1B	3009	genome.wustl.edu	37	6	27834657	27834657	+	Missense_Mutation	SNP	C	C	A	rs200074459		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:27834657C>A	ENST00000331442.3	-	1	702	c.651G>T	c.(649-651)aaG>aaT	p.K217N		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	217				Missing (in Ref. 5; AA sequence). {ECO:0000305}.	chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						CCTTCTTGGCCTTTGCAGCTT	0.527																																																	0													54.0	49.0	51.0					6																	27834657		2203	4300	6503	SO:0001583	missense	0			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.651G>T	6.37:g.27834657C>A	ENSP00000330074:p.Lys217Asn		Q14529|Q3MJ42	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.K217N	ENST00000331442.3	37	c.651	CCDS4635.1	6	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271821	0.40194	.	.	ENSG00000184357	ENST00000331442	T	0.04758	3.56	4.79	4.79	0.61399	.	0.053637	0.64402	D	0.000001	T	0.01029	0.0034	N	0.08118	0	0.45899	D	0.998748	P	0.44627	0.839	B	0.38056	0.264	T	0.63717	-0.6574	10	0.21014	T	0.42	-5.6145	9.6232	0.39734	0.0:0.8364:0.0:0.1636	.	217	P16401	H15_HUMAN	N	217	ENSP00000330074:K217N	ENSP00000330074:K217N	K	-	3	2	HIST1H1B	27942636	0.875000	0.30112	0.641000	0.29422	0.763000	0.43281	1.065000	0.30592	2.600000	0.87896	0.655000	0.94253	AAG	HIST1H1B	-	NULL	ENSG00000184357		0.527	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1		0.00	54	0	C	NM_005322		27834657	-1			no_errors	ENST00000331442	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.995	A
HMGN2P46	283651	genome.wustl.edu	37	15	45848231	45848231	+	lincRNA	DEL	T	T	-	rs372861121|rs368577527		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:45848231delT	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							TTTGTTTAGCTTTTTTTTTTT	0.323																																																	0																																												0																															15.37:g.45848231delT				RNA	DEL	-	NULL	ENST00000557965.1	37	NULL		15																																																																																			HMGN2P46	-	-	ENSG00000179362		0.323	RP11-96O20.2-001	KNOWN	basic	lincRNA	HMGN2P46	HGNC	lincRNA	OTTHUMT00000416553.1		0.00	17	0	T			45848231	+1	tier1		no_errors	ENST00000313559	ensembl	human	known	74_37	rna	33.33	8	4	DEL	0.997	-
HNF4A	3172	genome.wustl.edu	37	20	43052981	43052981	+	Intron	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:43052981T>C	ENST00000316099.4	+	8	1218				HNF4A_ENST00000443598.2_Silent_p.L406L|HNF4A_ENST00000316673.4_Intron|HNF4A_ENST00000609795.1_Silent_p.L384L|HNF4A_ENST00000415691.2_Intron|AL132772.1_ENST00000581483.1_RNA|HNF4A_ENST00000457232.1_Intron	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha						blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			cctcagctccttggcttcccc	0.582																																					Colon(79;2 1269 8820 14841 52347)												0													45.0	36.0	39.0					20																	43052981		2192	4289	6481	SO:0001627	intron_variant	0			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.1129+87T>C	20.37:g.43052981T>C			A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoid-X_rcpt/HNF4,prints_COUP_TF	p.L406	ENST00000316099.4	37	c.1216	CCDS13330.1	20																																																																																			HNF4A	-	NULL	ENSG00000101076		0.582	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	-	0.00	18	0	T			43052981	+1	tier1	-	no_errors	ENST00000443598	ensembl	human	known	74_37	silent	33.33	8	4	SNP	0.000	C
HR	55806	genome.wustl.edu	37	8	21977925	21977925	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:21977925G>C	ENST00000381418.4	-	12	4186	c.2706C>G	c.(2704-2706)agC>agG	p.S902R	HR_ENST00000312841.8_Missense_Mutation_p.S902R	NM_005144.4	NP_005135.2	O43593	HAIR_HUMAN	hair growth associated	902					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	27		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)		GTCCGAGGGGGCTCAGCGCCT	0.637																																																	0													67.0	73.0	71.0					8																	21977925		2203	4300	6503	SO:0001583	missense	0			AF039196	CCDS6022.1, CCDS6023.1	8p12	2012-12-07	2012-12-07		ENSG00000168453	ENSG00000168453			5172	protein-coding gene	gene with protein product		602302	"""hairless (mouse) homolog"", ""hairless homolog (mouse)"""	ALUNC		10051399, 9463324	Standard	NM_018411		Approved	AU	uc003xas.3	O43593	OTTHUMG00000097089	ENST00000381418.4:c.2706C>G	8.37:g.21977925G>C	ENSP00000370826:p.Ser902Arg		Q6GS30|Q96H33|Q9NPE1	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S902R	ENST00000381418.4	37	c.2706	CCDS6022.1	8	.	.	.	.	.	.	.	.	.	.	G	6.689	0.495823	0.12762	.	.	ENSG00000168453	ENST00000381418;ENST00000312841;ENST00000517699	T;T;T	0.71698	-0.59;-0.59;-0.59	4.44	-3.32	0.04973	.	0.449341	0.21032	N	0.081322	T	0.59224	0.2178	L	0.40543	1.245	0.09310	N	1	P;P	0.46512	0.879;0.808	P;B	0.48270	0.572;0.368	T	0.56360	-0.7992	10	0.59425	D	0.04	-2.4706	4.4218	0.11484	0.2739:0.0:0.3126:0.4135	.	902;902	O43593-2;O43593	.;HAIR_HUMAN	R	902;902;125	ENSP00000370826:S902R;ENSP00000326765:S902R;ENSP00000430413:S125R	ENSP00000326765:S902R	S	-	3	2	HR	22033870	0.000000	0.05858	0.018000	0.16275	0.000000	0.00434	-1.584000	0.02114	-0.730000	0.04869	-1.951000	0.00486	AGC	HR	-	NULL	ENSG00000168453		0.637	HR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HR	HGNC	protein_coding	OTTHUMT00000214213.1	-	0.00	32	0	G			21977925	-1	tier1	-	no_errors	ENST00000381418	ensembl	human	known	74_37	missense	47.37	10	9	SNP	0.061	C
HSF4	3299	genome.wustl.edu	37	16	67203680	67203680	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:67203680T>C	ENST00000521374.1	+	13	1471	c.1471T>C	c.(1471-1473)Tcc>Ccc	p.S491P	HSF4_ENST00000421453.1_Missense_Mutation_p.S461P|HSF4_ENST00000584272.1_Missense_Mutation_p.S461P|HSF4_ENST00000264009.8_Missense_Mutation_p.S491P|NOL3_ENST00000564053.1_5'Flank|NOL3_ENST00000432069.2_5'Flank			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	491					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		AGCCAGTCCCTCCCCCTAAGA	0.662											OREG0023873	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													39.0	45.0	43.0					16																	67203680		1849	4065	5914	SO:0001583	missense	0			D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.1471T>C	16.37:g.67203680T>C	ENSP00000430947:p.Ser491Pro	1097	Q99472|Q9ULV6	Missense_Mutation	SNP	pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.S491P	ENST00000521374.1	37	c.1471	CCDS42175.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.48|15.48	2.846491|2.846491	0.51164|0.51164	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000519601;ENST00000520304|ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374	.|.	.|.	.|.	4.63|4.63	3.45|3.45	0.39498|0.39498	.|.	.|0.435053	.|0.19894	.|N	.|0.103661	T|T	0.40040|0.40040	0.1101|0.1101	N|N	0.24115|0.24115	0.695|0.695	0.26638|0.26638	N|N	0.97234|0.97234	.|D;P	.|0.76494	.|0.999;0.895	.|D;B	.|0.68943	.|0.961;0.38	T|T	0.08848|0.08848	-1.0702|-1.0702	5|9	.|0.72032	.|D	.|0.01	-12.8056|-12.8056	7.8381|7.8381	0.29382|0.29382	0.0:0.0:0.2114:0.7886|0.0:0.0:0.2114:0.7886	.|.	.|461;491	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	P|P	222;134|461;491;415;491	.|.	.|ENSP00000264009:S491P	L|S	+|+	2|1	0|0	HSF4|HSF4	65761181|65761181	0.215000|0.215000	0.23574|0.23574	0.982000|0.982000	0.44146|0.44146	0.184000|0.184000	0.23303|0.23303	1.280000|1.280000	0.33202|0.33202	2.063000|2.063000	0.61619|0.61619	0.460000|0.460000	0.39030|0.39030	CTC|TCC	HSF4	-	NULL	ENSG00000102878		0.662	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF4	HGNC	protein_coding	OTTHUMT00000375080.1	-	0.00	55	0	T	NM_001538		67203680	+1	tier1	-	no_errors	ENST00000264009	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.968	C
HTR1D	3352	genome.wustl.edu	37	1	23519984	23519984	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:23519984G>C	ENST00000374619.1	-	1	1238	c.729C>G	c.(727-729)caC>caG	p.H243Q	HTR1D_ENST00000314113.3_Missense_Mutation_p.H243Q	NM_000864.4	NP_000855.1	P28221	5HT1D_HUMAN	5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled	243					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intestine smooth muscle contraction (GO:0014827)|regulation of behavior (GO:0050795)|regulation of locomotion (GO:0040012)|response to toxic substance (GO:0009636)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000779)|all_lung(284;0.00135)|Breast(348;0.0385)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0561)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.69e-27)|Colorectal(126;4.86e-08)|COAD - Colon adenocarcinoma(152;2.86e-06)|GBM - Glioblastoma multiforme(114;0.00012)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(1967;0.00122)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.083)|LUSC - Lung squamous cell carcinoma(448;0.185)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Naratriptan(DB00952)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Risperidone(DB00734)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	CTGTGATGAGGTGGGCCGTGG	0.617																																																	0													44.0	49.0	47.0					1																	23519984		2203	4300	6503	SO:0001583	missense	0			M89955	CCDS231.1	1p36.3-p34.3	2012-08-08	2012-02-03		ENSG00000179546	ENSG00000179546		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5289	protein-coding gene	gene with protein product		182133	"""5-hydroxytryptamine (serotonin) receptor 1D"""	HTRL		2541503, 1662665	Standard	NM_000864		Approved	RDC4, HT1DA, 5-HT1D	uc001bgn.3	P28221	OTTHUMG00000003235	ENST00000374619.1:c.729C>G	1.37:g.23519984G>C	ENSP00000363748:p.His243Gln			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT1D_rcpt,prints_5HT_rcpt	p.H243Q	ENST00000374619.1	37	c.729	CCDS231.1	1	.	.	.	.	.	.	.	.	.	.	G	0.528	-0.858970	0.02610	.	.	ENSG00000179546	ENST00000314113;ENST00000374619	T;T	0.68479	-0.33;-0.33	5.35	-10.7	0.00240	GPCR, rhodopsin-like superfamily (1);	0.315657	0.35805	N	0.002961	T	0.33440	0.0863	N	0.10782	0.045	0.20926	N	0.99983	B	0.02656	0.0	B	0.13407	0.009	T	0.33803	-0.9854	10	0.02654	T	1	.	15.3222	0.74132	0.1466:0.626:0.2274:0.0	.	243	P28221	5HT1D_HUMAN	Q	243	ENSP00000313661:H243Q;ENSP00000363748:H243Q	ENSP00000313661:H243Q	H	-	3	2	HTR1D	23392571	0.000000	0.05858	0.118000	0.21660	0.933000	0.57130	-3.564000	0.00429	-2.480000	0.00523	-0.140000	0.14226	CAC	HTR1D	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT1D_rcpt	ENSG00000179546		0.617	HTR1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1D	HGNC	protein_coding	OTTHUMT00000008924.1	-	0.00	57	0	G	NM_000864		23519984	-1	tier1	-	no_errors	ENST00000314113	ensembl	human	known	74_37	missense	18.97	47	11	SNP	0.219	C
INPP5A	3632	genome.wustl.edu	37	10	134579331	134579331	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:134579331G>T	ENST00000368594.3	+	12	1235	c.958G>T	c.(958-960)Gac>Tac	p.D320Y	INPP5A_ENST00000368593.3_Missense_Mutation_p.D320Y	NM_005539.3	NP_005530.3	Q14642	I5P1_HUMAN	inositol polyphosphate-5-phosphatase, 40kDa	320					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inositol-1,3,4,5-tetrakisphosphate 5-phosphatase activity (GO:0052659)|inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|inositol-polyphosphate 5-phosphatase activity (GO:0004445)|PH domain binding (GO:0042731)	p.D320H(2)		cervix(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		all_cancers(35;8.59e-13)|all_epithelial(44;5.49e-09)|Lung NSC(174;0.000854)|all_lung(145;0.00146)|all_neural(114;0.0299)|Colorectal(31;0.0599)|Breast(234;0.0849)|Melanoma(40;0.124)|all_hematologic(284;0.196)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;0.000102)|Epithelial(32;0.00023)|all cancers(32;0.000326)		GTATGAACTGGACATCTCGTT	0.493																																					Pancreas(63;823 1267 11107 20380 51626)												2	Substitution - Missense(2)	lung(2)											173.0	166.0	169.0					10																	134579331		2203	4300	6503	SO:0001583	missense	0			X77567	CCDS7669.2	10q26.3	2008-08-07	2002-08-29		ENSG00000068383	ENSG00000068383	3.1.3.56		6076	protein-coding gene	gene with protein product	"""CTCL tumor antigen HD-CL-02"", ""43 kDa inositol polyphosphate 5-phophatase"", ""inositol polyphosphate 5-phophatase, 40kDa"", ""InsP3 5-phosphatase"", ""type I inositol-1,4,5-trisphosphate 5-phosphatase"""	600106	"""inositol polyphosphate-5-phosphatase, 40kD"""			8013665	Standard	NM_005539		Approved	5PTASE	uc001llp.3	Q14642	OTTHUMG00000019293	ENST00000368594.3:c.958G>T	10.37:g.134579331G>T	ENSP00000357583:p.Asp320Tyr		D3DXI3|Q14640|Q5JSF1	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	p.D320Y	ENST00000368594.3	37	c.958	CCDS7669.2	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.61|17.61	3.432368|3.432368	0.62844|0.62844	.|.	.|.	ENSG00000068383|ENSG00000068383	ENST00000368594;ENST00000368593;ENST00000416326;ENST00000432898;ENST00000445580|ENST00000342652	T;T|.	0.39592|.	1.07;1.07|.	4.25|4.25	4.25|4.25	0.50352|0.50352	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);|.	0.049986|.	0.85682|.	D|.	0.000000|.	T|T	0.69958|0.69958	0.3169|0.3169	L|L	0.59436|0.59436	1.845|1.845	0.49582|0.49582	D|D	0.999802|0.999802	D;D;D|.	0.61080|.	0.964;0.989;0.971|.	P;P;P|.	0.61070|.	0.844;0.883;0.837|.	T|T	0.69953|0.69953	-0.5005|-0.5005	10|5	0.72032|.	D|.	0.01|.	-22.3019|-22.3019	15.8293|15.8293	0.78739|0.78739	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	263;320;320|.	F5GWM1;Q14642;Q5T1B5|.	.;I5P1_HUMAN;.|.	Y|V	320;320;263;237;2|234	ENSP00000357583:D320Y;ENSP00000357582:D320Y|.	ENSP00000357582:D320Y|.	D|G	+|+	1|2	0|0	INPP5A|INPP5A	134429321|134429321	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.038000|7.038000	0.76537|0.76537	2.080000|2.080000	0.62538|0.62538	0.650000|0.650000	0.86243|0.86243	GAC|GGA	INPP5A	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000068383		0.493	INPP5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5A	HGNC	protein_coding	OTTHUMT00000051085.1	-	0.00	74	0	G	NM_005539		134579331	+1	tier1	-	no_errors	ENST00000368594	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
INTS4	92105	genome.wustl.edu	37	11	77690104	77690104	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:77690104T>C	ENST00000534064.1	-	4	443	c.409A>G	c.(409-411)Att>Gtt	p.I137V	INTS4_ENST00000529807.1_Missense_Mutation_p.I137V	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	137					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TTAGTGCCAATTGCAAGCAAA	0.403																																																	0													170.0	152.0	158.0					11																	77690104		2200	4292	6492	SO:0001583	missense	0			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.409A>G	11.37:g.77690104T>C	ENSP00000434466:p.Ile137Val		Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.I137V	ENST00000534064.1	37	c.409	CCDS31644.1	11	.	.	.	.	.	.	.	.	.	.	T	17.82	3.483052	0.63962	.	.	ENSG00000149262	ENST00000534064;ENST00000529807	T;T	0.68181	-0.31;1.35	4.99	4.99	0.66335	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61022	0.2314	L	0.54323	1.7	0.80722	D	1	P	0.38078	0.617	B	0.34418	0.182	T	0.64685	-0.6349	10	0.45353	T	0.12	-16.4411	14.8576	0.70351	0.0:0.0:0.0:1.0	.	137	Q96HW7	INT4_HUMAN	V	137	ENSP00000434466:I137V;ENSP00000433644:I137V	ENSP00000433644:I137V	I	-	1	0	INTS4	77367752	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.736000	0.74811	2.103000	0.63969	0.533000	0.62120	ATT	INTS4	-	superfamily_ARM-type_fold	ENSG00000149262		0.403	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS4	HGNC	protein_coding	OTTHUMT00000390927.1	-	0.00	61	0	T	NM_033547		77690104	-1	tier1	-	no_errors	ENST00000534064	ensembl	human	known	74_37	missense	45.24	23	19	SNP	1.000	C
ITGA8	8516	genome.wustl.edu	37	10	15573108	15573108	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:15573108C>A	ENST00000378076.3	-	28	3276	c.2923G>T	c.(2923-2925)Gaa>Taa	p.E975*		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	975					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TTCTTAACTTCAAAGGACACC	0.299																																																	0													101.0	102.0	101.0					10																	15573108		2203	4300	6503	SO:0001587	stop_gained	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.2923G>T	10.37:g.15573108C>A	ENSP00000367316:p.Glu975*		B0YJ31|Q5VX94	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E975*	ENST00000378076.3	37	c.2923	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	C	43	10.420269	0.99402	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	.	.	.	5.64	3.81	0.43845	.	0.556592	0.22054	N	0.065263	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	10.2895	0.43588	0.0:0.7815:0.0:0.2185	.	.	.	.	X	975;960	.	ENSP00000367316:E975X	E	-	1	0	ITGA8	15613114	0.999000	0.42202	0.999000	0.59377	0.940000	0.58332	0.790000	0.26900	0.748000	0.32831	0.643000	0.83706	GAA	ITGA8	-	NULL	ENSG00000077943		0.299	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	-	0.00	34	0	C	NM_003638		15573108	-1	tier1	-	no_errors	ENST00000378076	ensembl	human	known	74_37	nonsense	45.16	17	14	SNP	1.000	A
ITK	3702	genome.wustl.edu	37	5	156671417	156671417	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:156671417C>T	ENST00000422843.3	+	13	1530	c.1378C>T	c.(1378-1380)Ctg>Ttg	p.L460L	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	460	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	AGAGACCCTGCTGGGCATGTG	0.572			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													94.0	91.0	92.0					5																	156671417		2203	4300	6503	SO:0001819	synonymous_variant	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1378C>T	5.37:g.156671417C>T			B2R752|Q32ML7	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.L460	ENST00000422843.3	37	c.1378	CCDS4336.1	5																																																																																			ITK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000113263		0.572	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	52	0	C			156671417	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.997	T
KCNB1	3745	genome.wustl.edu	37	20	47991182	47991182	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:47991182G>A	ENST00000371741.4	-	2	1081	c.915C>T	c.(913-915)ctC>ctT	p.L305L		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	305					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	TAAGGATGCGGAGAATTCGCA	0.532																																																	0													83.0	76.0	78.0					20																	47991182		2203	4300	6503	SO:0001819	synonymous_variant	0			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.915C>T	20.37:g.47991182G>A			Q14193	Silent	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.1,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.L305	ENST00000371741.4	37	c.915	CCDS13418.1	20																																																																																			KCNB1	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000158445		0.532	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB1	HGNC	protein_coding	OTTHUMT00000080374.3	-	0.00	21	0	G	NM_004975		47991182	-1	tier1	-	no_errors	ENST00000371741	ensembl	human	known	74_37	silent	28.12	23	9	SNP	0.981	A
KCNQ4	9132	genome.wustl.edu	37	1	41300749	41300749	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:41300749G>A	ENST00000347132.5	+	12	1806	c.1724G>A	c.(1723-1725)cGg>cAg	p.R575Q	KCNQ4_ENST00000509682.2_Missense_Mutation_p.R521Q|KCNQ4_ENST00000506017.1_3'UTR	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	575	A-domain (Tetramerization).				inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	ATGCTGGGCCGGATCAAGAGC	0.612																																																	0													95.0	87.0	90.0					1																	41300749		2203	4300	6503	SO:0001583	missense	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1724G>A	1.37:g.41300749G>A	ENSP00000262916:p.Arg575Gln		O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.R575Q	ENST00000347132.5	37	c.1724	CCDS456.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.478525	0.96291	.	.	ENSG00000117013	ENST00000347132;ENST00000509682	D;D	0.99880	-7.46;-7.46	4.98	4.98	0.66077	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99887	0.9946	M	0.87269	2.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96092	0.9062	10	0.87932	D	0	-24.9292	16.1004	0.81167	0.0:0.0:1.0:0.0	.	521;575	P56696-2;P56696	.;KCNQ4_HUMAN	Q	575;521	ENSP00000262916:R575Q;ENSP00000423756:R521Q	ENSP00000262916:R575Q	R	+	2	0	KCNQ4	41073336	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.720000	0.98763	2.476000	0.83614	0.551000	0.68910	CGG	KCNQ4	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000117013		0.612	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	-	0.00	57	0	G	NM_004700		41300749	+1	tier1	-	no_errors	ENST00000347132	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	A
KCNQ5	56479	genome.wustl.edu	37	6	73904443	73904443	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:73904443T>C	ENST00000370398.1	+	14	2214	c.2105T>C	c.(2104-2106)tTc>tCc	p.F702S	KCNQ5_ENST00000355194.4_Missense_Mutation_p.F702S|KCNQ5_ENST00000355635.3_Missense_Mutation_p.F703S|KCNQ5_ENST00000414165.2_Missense_Mutation_p.F592S|KCNQ5_ENST00000342056.2_Missense_Mutation_p.F721S|KCNQ5_ENST00000403813.2_Missense_Mutation_p.F693S|KCNQ5_ENST00000402622.2_Missense_Mutation_p.F712S	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	702					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	GCCCAGACTTTCTACGCGCTT	0.507																																					GBM(142;1375 1859 14391 23261 44706)												0													134.0	133.0	134.0					6																	73904443		2203	4300	6503	SO:0001583	missense	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2105T>C	6.37:g.73904443T>C	ENSP00000359425:p.Phe702Ser		A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.F712S	ENST00000370398.1	37	c.2135	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	T	8.329	0.825970	0.16749	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99270	-5.46;-5.47;-5.47;-5.47;-5.47;-5.51;-5.66	5.32	5.32	0.75619	.	0.136123	0.51477	D	0.000089	D	0.96549	0.8874	L	0.44542	1.39	0.22366	N	0.999162	P;B;B;B;B	0.47604	0.898;0.012;0.002;0.003;0.147	P;B;B;B;B	0.46718	0.525;0.02;0.008;0.009;0.084	D	0.93282	0.6661	10	0.19590	T	0.45	.	9.0457	0.36345	0.2825:0.0:0.0:0.7175	.	592;712;721;693;702	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	S	721;721;702;702;712;703;693;592	ENSP00000345055:F721S;ENSP00000347326:F702S;ENSP00000359425:F702S;ENSP00000385501:F712S;ENSP00000347853:F703S;ENSP00000384453:F693S;ENSP00000409861:F592S	ENSP00000345055:F721S	F	+	2	0	KCNQ5	73961164	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.554000	0.45845	2.011000	0.59026	0.459000	0.35465	TTC	KCNQ5	-	NULL	ENSG00000185760		0.507	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	-	0.00	32	0	T	NM_019842		73904443	+1	tier1	-	no_errors	ENST00000402622	ensembl	human	known	74_37	missense	25.00	12	4	SNP	1.000	C
KDM4C	23081	genome.wustl.edu	37	9	6986499	6986499	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:6986499G>A	ENST00000381309.3	+	11	2075	c.1510G>A	c.(1510-1512)Gag>Aag	p.E504K	KDM4C_ENST00000543771.1_Missense_Mutation_p.E504K|KDM4C_ENST00000535193.1_Missense_Mutation_p.E526K|KDM4C_ENST00000381306.3_Missense_Mutation_p.E504K|KDM4C_ENST00000442236.2_Missense_Mutation_p.E323K|KDM4C_ENST00000536108.1_Missense_Mutation_p.E323K|KDM4C_ENST00000428870.2_Missense_Mutation_p.E191K	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	504					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AGACCCATCCGAGCTTTCATG	0.468																																																	0													131.0	118.0	123.0					9																	6986499		2203	4300	6503	SO:0001583	missense	0			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1510G>A	9.37:g.6986499G>A	ENSP00000370710:p.Glu504Lys		B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,superfamily_Chorismate_mutase_type_II,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.E504K	ENST00000381309.3	37	c.1510	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	G	1.733	-0.493765	0.04322	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000442236;ENST00000536108;ENST00000428870	T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.3	1.54	0.23209	.	1.082130	0.07056	N	0.832774	T	0.11196	0.0273	N	0.00583	-1.355	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.31971	-0.9924	10	0.02654	T	1	-6.2288	5.7379	0.18077	0.6537:0.1328:0.2134:0.0	.	323;504;526;504;504	E7EV17;F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;.;KDM4C_HUMAN;.	K	526;504;504;504;323;323;191	ENSP00000442382:E526K;ENSP00000445427:E504K;ENSP00000370710:E504K;ENSP00000370707:E504K;ENSP00000409353:E323K;ENSP00000440656:E323K;ENSP00000405739:E191K	ENSP00000370707:E504K	E	+	1	0	KDM4C	6976499	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.431000	0.21444	0.452000	0.26830	-0.238000	0.12139	GAG	KDM4C	-	NULL	ENSG00000107077		0.468	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	-	0.00	64	0	G	NM_015061		6986499	+1	tier1	-	no_errors	ENST00000381309	ensembl	human	known	74_37	missense	64.52	11	20	SNP	0.000	A
KIAA1109	84162	genome.wustl.edu	37	4	123258086	123258086	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:123258086A>G	ENST00000264501.4	+	71	12434	c.12061A>G	c.(12061-12063)Atg>Gtg	p.M4021V	KIAA1109_ENST00000388738.3_Missense_Mutation_p.M4021V			Q2LD37	K1109_HUMAN	KIAA1109	4021					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ACCAGATCCTATGGAAGAATC	0.358																																																	0													219.0	187.0	197.0					4																	123258086		1880	4113	5993	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.12061A>G	4.37:g.123258086A>G	ENSP00000264501:p.Met4021Val		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.M4021V	ENST00000264501.4	37	c.12061	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	A	11.70	1.715618	0.30413	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707	T;T;T	0.28895	2.57;2.57;1.59	5.39	5.39	0.77823	.	0.306680	0.33199	N	0.005170	T	0.17874	0.0429	N	0.19112	0.55	0.80722	D	1	B;B	0.10296	0.003;0.001	B;B	0.14023	0.01;0.005	T	0.10683	-1.0619	10	0.30078	T	0.28	.	6.3381	0.21306	0.6758:0.1328:0.0:0.1914	.	4020;4021	Q2LD37-4;Q2LD37	.;K1109_HUMAN	V	4021;4021;690	ENSP00000264501:M4021V;ENSP00000373390:M4021V;ENSP00000410874:M690V	ENSP00000264501:M4021V	M	+	1	0	KIAA1109	123477536	0.995000	0.38212	1.000000	0.80357	0.993000	0.82548	2.396000	0.44468	2.045000	0.60652	0.383000	0.25322	ATG	KIAA1109	-	NULL	ENSG00000138688		0.358	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	-	0.00	33	0	A	NM_020797		123258086	+1	tier1	-	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	59.46	15	22	SNP	0.997	G
CEMIP	57214	genome.wustl.edu	37	15	81235410	81235410	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:81235410delA	ENST00000394685.3	+	28	4243	c.3824delA	c.(3823-3825)cagfs	p.Q1275fs	KIAA1199_ENST00000356249.5_Frame_Shift_Del_p.Q1275fs|KIAA1199_ENST00000220244.3_Frame_Shift_Del_p.Q1275fs|RP11-351M8.2_ENST00000560873.1_RNA			Q8WUJ3	CEMIP_HUMAN		1275					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						ATACCATGGCAGCTTTTCAAC	0.582																																																	0													348.0	327.0	334.0					15																	81235410		2203	4300	6503	SO:0001589	frameshift_variant	0																														ENST00000394685.3:c.3824delA	15.37:g.81235410delA	ENSP00000378177:p.Gln1275fs		Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Frame_Shift_Del	DEL	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.Q1275fs	ENST00000394685.3	37	c.3824	CCDS10315.1	15																																																																																			KIAA1199	-	NULL	ENSG00000103888		0.582	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1		0.00	59	0	A			81235410	+1	tier1		no_errors	ENST00000220244	ensembl	human	known	74_37	frame_shift_del	42.86	16	12	DEL	1.000	-
KIF13A	63971	genome.wustl.edu	37	6	17781431	17781431	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:17781431T>C	ENST00000259711.6	-	30	3751	c.3646A>G	c.(3646-3648)Atc>Gtc	p.I1216V	KIF13A_ENST00000378826.2_Missense_Mutation_p.I1216V|KIF13A_ENST00000378843.2_Missense_Mutation_p.I1203V|KIF13A_ENST00000378816.5_Missense_Mutation_p.I1216V|KIF13A_ENST00000378814.5_Missense_Mutation_p.I1203V	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1216					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TGCTTTATGATGGGCAGGTAG	0.507																																																	0													99.0	99.0	99.0					6																	17781431		1916	4141	6057	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3646A>G	6.37:g.17781431T>C	ENSP00000259711:p.Ile1216Val		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I1216V	ENST00000259711.6	37	c.3646	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	T	24.9	4.579112	0.86645	.	.	ENSG00000137177	ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044	T;T;T;T;T;T	0.74737	-0.85;1.5;-0.87;-0.84;-0.85;-0.84	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.83004	0.5160	M	0.85299	2.745	0.80722	D	1	P;D;P;P	0.55385	0.911;0.971;0.944;0.949	P;P;P;P	0.60415	0.55;0.816;0.874;0.703	D	0.86482	0.1792	10	0.87932	D	0	.	15.1711	0.72875	0.0:0.0:0.0:1.0	.	1203;1216;1216;1203	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	V	1203;220;1216;1216;1203;1216;214	ENSP00000368091:I1203V;ENSP00000425616:I220V;ENSP00000259711:I1216V;ENSP00000368103:I1216V;ENSP00000368120:I1203V;ENSP00000368093:I1216V	ENSP00000259711:I1216V	I	-	1	0	KIF13A	17889410	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.997000	0.88414	2.128000	0.65567	0.459000	0.35465	ATC	KIF13A	-	pfam_Kinesin-like	ENSG00000137177		0.507	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	-	0.00	38	0	T			17781431	-1	tier1	-	no_errors	ENST00000259711	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	C
KIF4A	24137	genome.wustl.edu	37	X	69594099	69594099	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chrX:69594099A>T	ENST00000374403.3	+	16	1855	c.1773A>T	c.(1771-1773)caA>caT	p.Q591H	KIF4A_ENST00000374388.3_Missense_Mutation_p.Q591H	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	591					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						ATGCCAACCAAGCCAAGTAAG	0.368																																																	0													61.0	54.0	56.0					X																	69594099		2203	4300	6503	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1773A>T	X.37:g.69594099A>T	ENSP00000363524:p.Gln591His		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q591H	ENST00000374403.3	37	c.1773	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	A	14.42	2.530306	0.45073	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.69306	2.3;-0.39	4.25	0.477	0.16784	.	0.000000	0.49305	D	0.000154	T	0.69333	0.3099	L	0.47190	1.495	0.51482	D	0.999926	D;B	0.89917	1.0;0.216	D;B	0.91635	0.999;0.112	T	0.64334	-0.6432	10	0.49607	T	0.09	.	4.3065	0.10949	0.4802:0.0:0.3629:0.157	.	591;591	O95239;O95239-2	KIF4A_HUMAN;.	H	591	ENSP00000363509:Q591H;ENSP00000363524:Q591H	ENSP00000363509:Q591H	Q	+	3	2	KIF4A	69510824	1.000000	0.71417	0.998000	0.56505	0.584000	0.36387	1.999000	0.40806	-0.173000	0.10761	0.425000	0.28330	CAA	KIF4A	-	NULL	ENSG00000090889		0.368	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	-	0.00	18	0	A	NM_012310		69594099	+1	tier1	-	no_errors	ENST00000374403	ensembl	human	known	74_37	missense	61.90	8	13	SNP	0.997	T
KLHL20	27252	genome.wustl.edu	37	1	173751271	173751271	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:173751271G>T	ENST00000209884.4	+	11	1784	c.1648G>T	c.(1648-1650)Gca>Tca	p.A550S	KLHL20_ENST00000546011.1_Missense_Mutation_p.A361S	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	550					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GGTTGGCCTGGCAGTGGTCAA	0.393																																					GBM(159;862 2695 6559 23041)												0													182.0	173.0	176.0					1																	173751271		2203	4300	6503	SO:0001583	missense	0			AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1648G>T	1.37:g.173751271G>T	ENSP00000209884:p.Ala550Ser		B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A550S	ENST00000209884.4	37	c.1648	CCDS1310.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550462	0.86127	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.80824	-1.42;-1.42	4.97	4.97	0.65823	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.85035	0.5605	M	0.76433	2.335	0.80722	D	1	P;P	0.46859	0.88;0.885	P;P	0.57620	0.731;0.824	D	0.85251	0.1044	10	0.45353	T	0.12	.	17.0185	0.86427	0.0:0.0:1.0:0.0	.	361;550	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	S	361;550	ENSP00000443121:A361S;ENSP00000209884:A550S	ENSP00000209884:A550S	A	+	1	0	KLHL20	172017894	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.644000	0.98468	2.305000	0.77605	0.650000	0.86243	GCA	KLHL20	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000076321		0.393	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL20	HGNC	protein_coding	OTTHUMT00000097582.1	-	0.00	115	0	G	NM_014458		173751271	+1	tier1	-	no_errors	ENST00000209884	ensembl	human	known	74_37	missense	15.00	66	12	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49426774	49426774	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:49426774T>A	ENST00000301067.7	-	39	11713	c.11714A>T	c.(11713-11715)cAg>cTg	p.Q3905L	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3905	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										ctgttgcagctgctgctgctg	0.562																																																	0													11.0	15.0	14.0					12																	49426774		1761	3258	5019	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11714A>T	12.37:g.49426774T>A	ENSP00000301067:p.Gln3905Leu		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3905L	ENST00000301067.7	37	c.11714	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	T	1.076	-0.668547	0.03403	.	.	ENSG00000167548	ENST00000301067	D	0.91237	-2.81	4.42	3.23	0.37069	.	.	.	.	.	T	0.80433	0.4622	N	0.08118	0	0.19775	N	0.999956	B	0.12630	0.006	B	0.08055	0.003	T	0.71244	-0.4650	9	0.87932	D	0	.	9.494	0.38978	0.1586:0.0:0.0:0.8414	.	3905	O14686	MLL2_HUMAN	L	3905	ENSP00000301067:Q3905L	ENSP00000301067:Q3905L	Q	-	2	0	MLL2	47713041	0.985000	0.35326	0.779000	0.31741	0.321000	0.28281	2.346000	0.44027	0.789000	0.33779	0.533000	0.62120	CAG	KMT2D	-	NULL	ENSG00000167548		0.562	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2		0.00	64	0	T			49426774	-1			no_errors	ENST00000301067	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.688	A
KRT81	3887	genome.wustl.edu	37	12	52681102	52681102	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:52681102G>C	ENST00000327741.5	-	7	1099	c.1031C>G	c.(1030-1032)tCc>tGc	p.S344C	KRT86_ENST00000544024.1_Intron|KRT86_ENST00000423955.2_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	344	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCCAGCTTGGAGTTCTGAAG	0.607																																																	0													26.0	29.0	28.0					12																	52681102		2203	4300	6503	SO:0001583	missense	0			X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1031C>G	12.37:g.52681102G>C	ENSP00000369349:p.Ser344Cys		Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S344C	ENST00000327741.5	37	c.1031	CCDS31805.1	12	.	.	.	.	.	.	.	.	.	.	G	7.011	0.556868	0.13436	.	.	ENSG00000205426	ENST00000327741;ENST00000389388	D	0.89552	-2.53	4.99	4.99	0.66335	Filament (1);	0.372474	0.19474	U	0.113369	D	0.83041	0.5168	L	0.28400	0.85	0.34030	D	0.653679	B	0.10296	0.003	B	0.12837	0.008	T	0.83182	-0.0088	10	0.37606	T	0.19	.	13.9487	0.64101	0.0:0.1521:0.8479:0.0	.	344	Q14533	KRT81_HUMAN	C	344	ENSP00000369349:S344C	ENSP00000369349:S344C	S	-	2	0	KRT81	50967369	0.954000	0.32549	0.996000	0.52242	0.159000	0.22180	1.857000	0.39399	2.303000	0.77524	0.561000	0.74099	TCC	KRT81	-	pfam_IF	ENSG00000205426		0.607	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT81	HGNC	protein_coding	OTTHUMT00000395128.2	-	0.00	31	0	G	NM_002281		52681102	-1	tier1	-	no_errors	ENST00000327741	ensembl	human	known	74_37	missense	27.27	24	9	SNP	0.998	C
KRT73	319101	genome.wustl.edu	37	12	53004427	53004427	+	Missense_Mutation	SNP	G	G	T	rs555553903		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:53004427G>T	ENST00000305748.3	-	7	1337	c.1303C>A	c.(1303-1305)Cgc>Agc	p.R435S	RP11-641A6.2_ENST00000551089.1_RNA|RP11-641A6.2_ENST00000552364.1_RNA|RP11-641A6.2_ENST00000549180.1_RNA	NM_175068.2	NP_778238.1	Q86Y46	K2C73_HUMAN	keratin 73	435	Coil 2.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.R435G(1)		NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCAGCTTGCGGTAGGTGGCG	0.602																																																	1	Substitution - Missense(1)	lung(1)											91.0	78.0	82.0					12																	53004427		2203	4300	6503	SO:0001583	missense	0			AJ508776	CCDS8834.1	12q13.13	2013-06-25			ENSG00000186049	ENSG00000186049		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28928	protein-coding gene	gene with protein product		608247				12648212, 16831889	Standard	NM_175068		Approved	KRT6IRS3, K6IRS3	uc001sas.3	Q86Y46	OTTHUMG00000169746	ENST00000305748.3:c.1303C>A	12.37:g.53004427G>T	ENSP00000307014:p.Arg435Ser		Q32MB2	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R435S	ENST00000305748.3	37	c.1303	CCDS8834.1	12	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687584	0.68157	.	.	ENSG00000186049	ENST00000305748;ENST00000552855	D;D	0.94723	-3.5;-3.5	5.47	2.34	0.29019	Filament (1);Intermediate filament protein, conserved site (1);	0.000000	0.47093	D	0.000256	D	0.97393	0.9147	H	0.98238	4.18	0.35968	D	0.835127	P	0.45044	0.849	P	0.50490	0.642	D	0.99954	1.1586	10	0.72032	D	0.01	.	14.4561	0.67418	0.0:0.0:0.4254:0.5746	.	435	Q86Y46	K2C73_HUMAN	S	435;180	ENSP00000307014:R435S;ENSP00000449081:R180S	ENSP00000307014:R435S	R	-	1	0	KRT73	51290694	0.980000	0.34600	1.000000	0.80357	0.930000	0.56654	0.713000	0.25794	0.719000	0.32188	-0.397000	0.06425	CGC	KRT73	-	pfam_IF	ENSG00000186049		0.602	KRT73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT73	HGNC	protein_coding	OTTHUMT00000405700.1		0.00	48	0	G	NM_175068		53004427	-1			no_errors	ENST00000305748	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
LIG4	3981	genome.wustl.edu	37	13	108863310	108863310	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr13:108863310C>A	ENST00000356922.4	-	2	579	c.307G>T	c.(307-309)Gga>Tga	p.G103*	LIG4_ENST00000442234.1_Nonsense_Mutation_p.G103*|LIG4_ENST00000405925.1_Nonsense_Mutation_p.G103*	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	103					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					GCATCTTTTCCATCTCTAGGT	0.378								Non-homologous end-joining																																									0													130.0	137.0	134.0					13																	108863310		2203	4300	6503	SO:0001587	stop_gained	0			X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.307G>T	13.37:g.108863310C>A	ENSP00000349393:p.Gly103*		Q8IY66|Q8TEU5	Nonsense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_IV,pfam_BRCT_dom,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.G103*	ENST00000356922.4	37	c.307	CCDS9508.1	13	.	.	.	.	.	.	.	.	.	.	C	37	6.158901	0.97334	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.8212	0.92097	0.0:1.0:0.0:0.0	.	.	.	.	X	103	.	ENSP00000349393:G103X	G	-	1	0	LIG4	107661311	1.000000	0.71417	0.814000	0.32528	0.838000	0.47535	7.424000	0.80242	2.678000	0.91216	0.643000	0.83706	GGA	LIG4	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N,tigrfam_DNA_ligase_ATP-dep	ENSG00000174405		0.378	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG4	HGNC	protein_coding	OTTHUMT00000045738.4	-	0.00	37	0	C	NM_002312		108863310	-1	tier1	-	no_errors	ENST00000356922	ensembl	human	known	74_37	nonsense	27.27	16	6	SNP	1.000	A
LINC00982	440556	genome.wustl.edu	37	1	2979294	2979294	+	RNA	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:2979294C>T	ENST00000445317.1	-	0	2344				LINC00982_ENST00000415573.1_RNA|LINC00982_ENST00000453118.1_RNA|LINC00982_ENST00000321336.1_RNA|LINC00982_ENST00000606861.1_RNA|LINC00982_ENST00000321399.3_RNA|LINC00982_ENST00000413472.1_RNA	NR_015440.1				long intergenic non-protein coding RNA 982																		GAAGCCTCAGCTCCCCAGGCC	0.652																																																	0																																												0					1p36.32	2013-07-05			ENSG00000177133	ENSG00000177133		"""Long non-coding RNAs"""	48664	non-coding RNA	RNA, long non-coding						23801869	Standard	NR_015440		Approved	FLJ42875			OTTHUMG00000000563		1.37:g.2979294C>T				RNA	SNP	-	NULL	ENST00000445317.1	37	NULL		1																																																																																			LINC00982	-	-	ENSG00000177133		0.652	LINC00982-002	KNOWN	basic	antisense	LINC00982	HGNC	antisense	OTTHUMT00000001333.1	-	0.00	76	0	C			2979294	-1	tier1	-	no_errors	ENST00000321399	ensembl	human	known	74_37	rna	16.33	82	16	SNP	0.000	T
LIPJ	142910	genome.wustl.edu	37	10	90351161	90351161	+	Frame_Shift_Del	DEL	C	C	-	rs192611215	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:90351161delC	ENST00000371939.3	+	4	350	c.36delC	c.(34-36)tacfs	p.Y12fs		NM_001010939.2	NP_001010939.2	Q5W064	LIPJ_HUMAN	lipase, family member J	12					lipid catabolic process (GO:0016042)		hydrolase activity, acting on ester bonds (GO:0016788)			large_intestine(4)|lung(4)|ovary(1)	9		all_cancers(4;2.79e-10)|Prostate(4;1.68e-15)|all_epithelial(4;1.43e-09)|Colorectal(252;0.0381)|Breast(4;0.141)|Melanoma(5;0.2)|all_hematologic(4;0.222)		Colorectal(12;1.02e-05)|COAD - Colon adenocarcinoma(12;1.54e-05)		ACTGGGGCTACCCTGATGAAG	0.323																																																	0													67.0	69.0	68.0					10																	90351161		2203	4299	6502	SO:0001589	frameshift_variant	0			BC031219	CCDS31240.1	10q23.31	2008-02-04	2008-02-04	2007-02-27	ENSG00000204022	ENSG00000204022			21773	protein-coding gene	gene with protein product		613921	"""lipase-like, ab-hydrolase domain containing 1"", ""lipase, family member J"""	LIPL1			Standard	NM_001010939		Approved	bA425M17.2	uc001kff.3	Q5W064	OTTHUMG00000018691	ENST00000371939.3:c.36delC	10.37:g.90351161delC	ENSP00000361007:p.Tyr12fs		A8MT98|Q0P671	Frame_Shift_Del	DEL	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.P13fs	ENST00000371939.3	37	c.36	CCDS31240.1	10																																																																																			LIPJ	-	pfam_AB_hydrolase_lipase	ENSG00000204022		0.323	LIPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPJ	HGNC	protein_coding	OTTHUMT00000049248.2		0.00	57	0	C	XM_084377		90351161	+1	tier1		no_errors	ENST00000371939	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	0.996	-
RP11-782C8.1	0	genome.wustl.edu	37	1	143230253	143230253	+	lincRNA	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:143230253T>C	ENST00000438000.1	+	0	147				RP11-782C8.5_ENST00000427309.1_lincRNA																							AAAACAATGATAGGTAAACCA	0.318																																																	0																																												0																															1.37:g.143230253T>C				RNA	SNP	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			RP11-782C8.5	-	-	ENSG00000225278		0.318	RP11-782C8.1-002	KNOWN	basic	lincRNA	LOC101930284	Clone_based_vega_gene	lincRNA	OTTHUMT00000037560.1	-	0.00	26	0	T			143230253	-1	tier1	-	no_errors	ENST00000427309	ensembl	human	known	74_37	rna	25.00	6	2	SNP	0.000	C
LRBA	987	genome.wustl.edu	37	4	151791717	151791717	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:151791717C>T	ENST00000357115.3	-	20	2652	c.2409G>A	c.(2407-2409)caG>caA	p.Q803Q	LRBA_ENST00000507224.1_Silent_p.Q803Q|LRBA_ENST00000510413.1_Silent_p.Q803Q|LRBA_ENST00000535741.1_Silent_p.Q803Q	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	803						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.Q803Q(1)		breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GATCTGGATGCTGTTTATGTA	0.318																																																	1	Substitution - coding silent(1)	large_intestine(1)											118.0	116.0	117.0					4																	151791717		2203	4294	6497	SO:0001819	synonymous_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.2409G>A	4.37:g.151791717C>T			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.Q803	ENST00000357115.3	37	c.2409	CCDS3773.1	4																																																																																			LRBA	-	superfamily_ARM-type_fold	ENSG00000198589		0.318	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1		0.00	32	0	C			151791717	-1			no_errors	ENST00000357115	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.975	T
LRAT	9227	genome.wustl.edu	37	4	155665738	155665738	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:155665738G>A	ENST00000336356.3	+	2	513	c.260G>A	c.(259-261)cGc>cAc	p.R87H	LRAT_ENST00000507827.1_Missense_Mutation_p.R87H	NM_004744.3	NP_004735.2	O95237	LRAT_HUMAN	lecithin retinol acyltransferase (phosphatidylcholine--retinol O-acyltransferase)	87					phototransduction, visible light (GO:0007603)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)	phosphatidylcholine-retinol O-acyltransferase activity (GO:0047173)|retinoic acid binding (GO:0001972)|retinol binding (GO:0019841)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)	16	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	GACATGGGGCGCACGCAGAAG	0.597																																																	0													74.0	74.0	74.0					4																	155665738		2203	4300	6503	SO:0001583	missense	0			AF071510	CCDS3789.1	4q32.1	2014-01-28			ENSG00000121207	ENSG00000121207	2.3.1.135		6685	protein-coding gene	gene with protein product		604863				9920938	Standard	XM_006714412		Approved	LCA14	uc003ion.1	O95237	OTTHUMG00000161418	ENST00000336356.3:c.260G>A	4.37:g.155665738G>A	ENSP00000337224:p.Arg87His		A8K983|Q8N716	Missense_Mutation	SNP	pfam_LRAT-like_dom	p.R87H	ENST00000336356.3	37	c.260	CCDS3789.1	4	.	.	.	.	.	.	.	.	.	.	G	6.634	0.485462	0.12641	.	.	ENSG00000121207	ENST00000507827;ENST00000336356	T;T	0.45276	0.9;0.9	5.54	2.04	0.26737	.	0.642900	0.16085	N	0.230313	T	0.22859	0.0552	N	0.20685	0.6	0.20403	N	0.999909	B	0.18166	0.026	B	0.12156	0.007	T	0.21381	-1.0247	10	0.15066	T	0.55	-17.6934	7.1669	0.25695	0.1329:0.0:0.4661:0.4009	.	87	O95237	LRAT_HUMAN	H	87	ENSP00000426761:R87H;ENSP00000337224:R87H	ENSP00000337224:R87H	R	+	2	0	LRAT	155885188	0.930000	0.31532	0.572000	0.28498	0.104000	0.19210	0.305000	0.19254	0.501000	0.28013	0.655000	0.94253	CGC	LRAT	-	NULL	ENSG00000121207		0.597	LRAT-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRAT	HGNC	protein_coding	OTTHUMT00000365246.1	-	0.00	20	0	G	NM_004744		155665738	+1	tier1	-	no_errors	ENST00000336356	ensembl	human	known	74_37	missense	80.00	2	8	SNP	0.260	A
LRP2	4036	genome.wustl.edu	37	2	170027101	170027101	+	Silent	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:170027101A>G	ENST00000263816.3	-	59	11625	c.11340T>C	c.(11338-11340)caT>caC	p.H3780H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3780	LDL-receptor class A 32. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGTCGTTGTAATGGTCACAGA	0.507																																																	0													188.0	157.0	167.0					2																	170027101		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11340T>C	2.37:g.170027101A>G			O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.H3780	ENST00000263816.3	37	c.11340	CCDS2232.1	2																																																																																			LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.507	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	68	0	A	NM_004525		170027101	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	silent	66.67	15	30	SNP	0.998	G
LRRC37A3	374819	genome.wustl.edu	37	17	62892916	62892916	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:62892916G>T	ENST00000584306.1	-	3	990	c.460C>A	c.(460-462)Cca>Aca	p.P154T	RP11-927P21.2_ENST00000581622.1_RNA|RP11-927P21.1_ENST00000577938.1_RNA|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.P154T|LRRC37A3_ENST00000339474.5_Intron|LRRC37A3_ENST00000577487.1_5'Flank|RP11-927P21.1_ENST00000584959.1_RNA|RP11-927P21.1_ENST00000584131.1_RNA|LRRC37A3_ENST00000400877.3_Intron	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	154						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CGCTGAGCTGGATCTTTCTTC	0.468																																																	0													51.0	91.0	78.0					17																	62892916		1666	3512	5178	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.460C>A	17.37:g.62892916G>T	ENSP00000464535:p.Pro154Thr		Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P154T	ENST00000584306.1	37	c.460	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	3.696	-0.062532	0.07273	.	.	ENSG00000176809	ENST00000319651	T	0.57907	0.37	1.87	0.79	0.18613	.	.	.	.	.	T	0.23965	0.0580	N	0.08118	0	0.09310	N	1	B	0.22276	0.067	B	0.21360	0.034	T	0.25363	-1.0134	9	0.06757	T	0.87	.	5.3127	0.15839	0.0:0.0:0.6635:0.3365	.	154	O60309	L37A3_HUMAN	T	154	ENSP00000325713:P154T	ENSP00000325713:P154T	P	-	1	0	LRRC37A3	60323378	0.002000	0.14202	0.001000	0.08648	0.040000	0.13550	0.300000	0.19156	0.307000	0.22880	0.162000	0.16502	CCA	LRRC37A3	-	NULL	ENSG00000176809		0.468	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	-	0.00	67	0	G	NM_199340		62892916	-1	tier1	-	no_errors	ENST00000319651	ensembl	human	known	74_37	missense	40.30	40	27	SNP	0.001	T
LRRC37A6P	387646	genome.wustl.edu	37	10	27537671	27537671	+	lincRNA	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:27537671A>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							GCAGGCCTTTAAATGAATCGT	0.318																																																	0																																												0																															10.37:g.27537671A>T				RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.318	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	-	0.00	169	0	A			27537671	-1	tier1	-	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	33.74	108	55	SNP	0.011	T
LRRC4B	94030	genome.wustl.edu	37	19	51022489	51022489	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:51022489G>A	ENST00000599957.1	-	3	678	c.481C>T	c.(481-483)Cgg>Tgg	p.R161W	LRRC4B_ENST00000389201.3_Missense_Mutation_p.R161W			Q9NT99	LRC4B_HUMAN	leucine rich repeat containing 4B	161					positive regulation of synapse assembly (GO:0051965)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(1)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	30		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00284)|GBM - Glioblastoma multiforme(134;0.0188)		CAGAGCTCCCGCAGCTTGGAC	0.667																																																	0													57.0	62.0	60.0					19																	51022489		2202	4300	6502	SO:0001583	missense	0			BC032460	CCDS42595.1	19q13.33	2014-01-30	2004-06-14	2004-06-16	ENSG00000131409	ENSG00000131409		"""Immunoglobulin superfamily / I-set domain containing"", ""Endogenous ligands"""	25042	protein-coding gene	gene with protein product	"""netrin-G3 ligand"""		"""leucine-rich repeats and immunoglobulin-like domains 4"""	LRIG4		11441184	Standard	NM_001080457		Approved	DKFZp761A179, HSM	uc002pss.3	Q9NT99		ENST00000599957.1:c.481C>T	19.37:g.51022489G>A	ENSP00000471502:p.Arg161Trp		Q3ZCQ4|Q58F20	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R161W	ENST00000599957.1	37	c.481	CCDS42595.1	19	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711267	0.68730	.	.	ENSG00000131409	ENST00000389201;ENST00000535879	D	0.91577	-2.87	3.96	3.96	0.45880	.	0.000000	0.56097	U	0.000035	D	0.94656	0.8277	M	0.85299	2.745	0.49213	D	0.999766	D	0.89917	1.0	D	0.80764	0.994	D	0.94546	0.7749	10	0.87932	D	0	.	9.1887	0.37187	0.0:0.0:0.7833:0.2167	.	161	Q9NT99	LRC4B_HUMAN	W	161	ENSP00000373853:R161W	ENSP00000373853:R161W	R	-	1	2	LRRC4B	55714301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.660000	0.54496	2.235000	0.73313	0.491000	0.48974	CGG	LRRC4B	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000131409		0.667	LRRC4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4B	HGNC	protein_coding	OTTHUMT00000464907.1		0.00	92	0	G	NM_001080457		51022489	-1			no_errors	ENST00000389201	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
MALAT1	378938	genome.wustl.edu	37	11	65269897	65269898	+	lincRNA	INS	-	-	T	rs35843482|rs398016425|rs573496110	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:65269897_65269898insT	ENST00000534336.1	+	0	4665_4666					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GTGTAAGCAAGTTTTTTTTTAG	0.302													TTTTTTTTTT|TTTTTTTTT|TTTTTTTTTT|deletion	486	0.0970447	0.115	0.0706	5008	,	,		15821	0.0833		0.0686	False		,,,				2504	0.135																0																																												0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65269906_65269906dupT				RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.302	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	43	0	-	NR_002819		65269898	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	7.50	37	3	INS	0.985:0.013	T
MAML2	84441	genome.wustl.edu	37	11	95724824	95724825	+	Frame_Shift_Ins	INS	-	-	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:95724824_95724825insA	ENST00000524717.1	-	3	3486_3487	c.2202_2203insT	c.(2200-2205)aatccafs	p.P735fs		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	735					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CCAGTGTTTGGATTTGAGCAGG	0.475			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid																																			Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0																																										SO:0001589	frameshift_variant	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.2203dupT	11.37:g.95724825_95724825dupA	ENSP00000434552:p.Pro735fs		A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Frame_Shift_Ins	INS	pfam_Neuroggenic_mastermind-like_N	p.P734fs	ENST00000524717.1	37	c.2203_2202	CCDS44714.1	11																																																																																			MAML2	-	NULL	ENSG00000184384		0.475	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1		0.00	68	0	-			95724825	-1	tier1		no_errors	ENST00000524717	ensembl	human	known	74_37	frame_shift_ins	47.27	29	26	INS	1.000:1.000	A
MARC2	54996	genome.wustl.edu	37	1	220936256	220936256	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:220936256C>T	ENST00000366913.3	+	4	812	c.614C>T	c.(613-615)gCc>gTc	p.A205V	MARC2_ENST00000359316.2_Missense_Mutation_p.A205V	NM_017898.3	NP_060368.2	Q969Z3	MARC2_HUMAN	mitochondrial amidoxime reducing component 2	205	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										GGCAAGGTGGCCTACCCAGAC	0.478																																																	0													92.0	92.0	92.0					1																	220936256		2203	4300	6503	SO:0001583	missense	0				CCDS1525.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000117791	ENSG00000117791			26064	protein-coding gene	gene with protein product		614127	"""MOCO sulphurase C-terminal domain containing 2"""	MOSC2		11886751	Standard	NM_017898		Approved	FLJ20605	uc001hmq.3	Q969Z3	OTTHUMG00000037354	ENST00000366913.3:c.614C>T	1.37:g.220936256C>T	ENSP00000355880:p.Ala205Val		B2D0R5|D3DTB3|Q0JSK7|Q5VT67|Q5VXC7|Q7L317|Q9H066|Q9NWU0	Missense_Mutation	SNP	pfam_MOSC_N,pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	p.A205V	ENST00000366913.3	37	c.614	CCDS1525.1	1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.455280	0.84209	.	.	ENSG00000117791	ENST00000359316;ENST00000366913;ENST00000425560	T;T;T	0.37235	1.21;1.21;1.21	5.38	5.38	0.77491	Pyruvate kinase-like, insert domain (1);Molybdenum cofactor sulfurase, C-terminal (2);	0.080948	0.51477	D	0.000089	T	0.59487	0.2197	M	0.87971	2.92	0.58432	D	0.999991	P;P	0.44344	0.754;0.833	P;P	0.53760	0.55;0.734	T	0.63355	-0.6656	10	0.46703	T	0.11	-20.273	16.035	0.80621	0.0:1.0:0.0:0.0	.	205;205	Q969Z3-2;Q969Z3	.;MOSC2_HUMAN	V	205;205;106	ENSP00000352266:A205V;ENSP00000355880:A205V;ENSP00000416442:A106V	ENSP00000352266:A205V	A	+	2	0	MOSC2	219002879	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.221000	0.51215	2.508000	0.84585	0.655000	0.94253	GCC	MARC2	-	pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	ENSG00000117791		0.478	MARC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC2	HGNC	protein_coding	OTTHUMT00000090911.1	-	0.00	80	0	C	NM_017898		220936256	+1	tier1	-	no_errors	ENST00000366913	ensembl	human	known	74_37	missense	50.00	29	29	SNP	1.000	T
MCM3AP	8888	genome.wustl.edu	37	21	47662235	47662235	+	Intron	DEL	T	T	-	rs373542871		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr21:47662235delT	ENST00000397708.1	-	26	5681				MCM3AP_ENST00000467026.1_Intron|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP_ENST00000291688.1_Intron|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein						DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					aagttaggacttttttttttt	0.318																																																	0																																										SO:0001627	intron_variant	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5426+480A>-	21.37:g.47662235delT			C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	RNA	DEL	-	NULL	ENST00000397708.1	37	NULL	CCDS13734.1	21																																																																																			MCM3AP-AS1	-	-	ENSG00000215424		0.318	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP-AS1	HGNC	protein_coding	OTTHUMT00000207254.1		0.00	28	0	T	NM_003906		47662235	+1	tier1		no_errors	ENST00000421927	ensembl	human	known	74_37	rna	23.53	26	8	DEL	0.165	-
MGAM	8972	genome.wustl.edu	37	7	141799444	141799444	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:141799444A>G	ENST00000549489.2	+	44	5188	c.5093A>G	c.(5092-5094)aAg>aGg	p.K1698R	MGAM_ENST00000475668.2_Missense_Mutation_p.K2594R	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1698	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGAGAGTGGAAGACCTTGCCA	0.532																																																	0													89.0	88.0	89.0					7																	141799444		1925	4119	6044	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.5093A>G	7.37:g.141799444A>G	ENSP00000447378:p.Lys1698Arg		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.K1698R	ENST00000549489.2	37	c.5093	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	A	14.52	2.561374	0.45590	.	.	ENSG00000257335	ENST00000549489;ENST00000475668	D	0.91068	-2.78	5.84	0.375	0.16188	.	.	.	.	.	T	0.78960	0.4366	N	0.16567	0.415	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.63037	-0.6726	9	0.25106	T	0.35	.	4.0891	0.09962	0.4974:0.0:0.1398:0.3628	.	1698	O43451	MGA_HUMAN	R	1698;2595	ENSP00000447378:K1698R	ENSP00000373973:K1698R	K	+	2	0	MGAM	141445913	0.000000	0.05858	0.431000	0.26735	0.996000	0.88848	-0.556000	0.05992	0.107000	0.17824	0.533000	0.62120	AAG	MGAM	-	pfam_Glyco_hydro_31	ENSG00000257335		0.532	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	100	0	A			141799444	+1	tier1	-	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	56.32	38	49	SNP	0.006	G
MIA3	375056	genome.wustl.edu	37	1	222803584	222803584	+	Missense_Mutation	SNP	G	G	A	rs369678137		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:222803584G>A	ENST00000344922.5	+	4	3047	c.3022G>A	c.(3022-3024)Gaa>Aaa	p.E1008K	MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Missense_Mutation_p.E1008K|MIA3_ENST00000470521.1_3'UTR	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1008					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		GGGAATGAACGAAAATAACAT	0.428																																																	0													95.0	92.0	93.0					1																	222803584		1919	4133	6052	SO:0001583	missense	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.3022G>A	1.37:g.222803584G>A	ENSP00000340900:p.Glu1008Lys		A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.E1008K	ENST00000344922.5	37	c.3022	CCDS41470.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.67|13.67	2.307497|2.307497	0.40795|0.40795	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831|ENST00000354906	T;T|.	0.05717|.	3.4;3.4|.	5.25|5.25	4.33|4.33	0.51752|0.51752	.|.	.|.	.|.	.|.	.|.	T|T	0.53158|0.53158	0.1779|0.1779	M|M	0.64997|0.64997	1.995|1.995	0.09310|0.09310	N|N	1|1	D;D|.	0.69078|.	0.978;0.997|.	P;P|.	0.53809|.	0.525;0.735|.	T|T	0.45131|0.45131	-0.9282|-0.9282	9|5	0.72032|.	D|.	0.01|.	.|.	9.9578|9.9578	0.41678|0.41678	0.1531:0.0:0.8469:0.0|0.1531:0.0:0.8469:0.0	.|.	1008;1008|.	Q5JRA6-2;Q5JRA6|.	.;MIA3_HUMAN|.	K|Q	1008|590	ENSP00000340900:E1008K;ENSP00000340587:E1008K|.	ENSP00000325973:E1008K|.	E|R	+|+	1|2	0|0	MIA3|MIA3	220870207|220870207	1.000000|1.000000	0.71417|0.71417	0.105000|0.105000	0.21289|0.21289	0.004000|0.004000	0.04260|0.04260	3.733000|3.733000	0.55029|0.55029	2.624000|2.624000	0.88883|0.88883	0.462000|0.462000	0.41574|0.41574	GAA|CGA	MIA3	-	NULL	ENSG00000154305		0.428	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4		0.00	19	0	G	NM_198551		222803584	+1			no_errors	ENST00000344441	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.057	A
MIEN1	84299	genome.wustl.edu	37	17	37886006	37886006	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:37886006C>A	ENST00000394231.3	-	3	487	c.196G>T	c.(196-198)Gag>Tag	p.E66*	MIEN1_ENST00000577810.1_Nonsense_Mutation_p.E66*|ERBB2_ENST00000584888.1_Intron|MIEN1_ENST00000474210.1_5'UTR			Q9BRT3	MIEN1_HUMAN	migration and invasion enhancer 1	66					apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell migration (GO:0030335)|positive regulation of filopodium assembly (GO:0051491)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	selenium binding (GO:0008430)										ATCTCTATCTCAAAGGCACCT	0.488																																																	0													111.0	112.0	112.0					17																	37886006		2203	4300	6503	SO:0001587	stop_gained	0			AJ308025	CCDS11344.1	17q12	2011-09-21	2011-09-21	2011-09-21	ENSG00000141741	ENSG00000141741			28230	protein-coding gene	gene with protein product		611802	"""chromosome 17 open reading frame 37"""	C17orf37		17121940, 12739007, 17503775, 21628459	Standard	NM_032339		Approved	MGC14832, ORB3, XTP4, C35, Rdx12	uc002hsq.3	Q9BRT3	OTTHUMG00000133252	ENST00000394231.3:c.196G>T	17.37:g.37886006C>A	ENSP00000377778:p.Glu66*			Nonsense_Mutation	SNP	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ	p.E66*	ENST00000394231.3	37	c.196	CCDS11344.1	17	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640965	0.87859	.	.	ENSG00000141741	ENST00000394231	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-11.3085	18.8259	0.92119	0.0:1.0:0.0:0.0	.	.	.	.	X	66	.	ENSP00000377778:E66X	E	-	1	0	C17orf37	35139532	1.000000	0.71417	1.000000	0.80357	0.739000	0.42172	3.923000	0.56469	2.746000	0.94184	0.591000	0.81541	GAG	MIEN1	-	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ	ENSG00000141741		0.488	MIEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEN1	HGNC	protein_coding	OTTHUMT00000257020.3		0.00	25	0	C	NM_032339		37886006	-1			no_errors	ENST00000394231	ensembl	human	known	74_37	nonsense	11.76	15	2	SNP	1.000	A
MORF4L1	10933	genome.wustl.edu	37	15	79189830	79189830	+	3'UTR	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:79189830G>T	ENST00000331268.5	+	0	1714				RNU6-415P_ENST00000516252.1_RNA|MORF4L1_ENST00000379535.4_3'UTR|MORF4L1_ENST00000426013.2_3'UTR|MORF4L1_ENST00000561171.1_3'UTR	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1						cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						TTGTGCTTTTGTTTTTTTTTA	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.*421G>T	15.37:g.79189830G>T			B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	RNA	SNP	-	NULL	ENST00000331268.5	37	NULL	CCDS10307.1	15																																																																																			MORF4L1	-	-	ENSG00000185787		0.343	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	MORF4L1	HGNC	protein_coding	OTTHUMT00000290131.4	-	0.00	86	0	G	NM_006791		79189830	+1	tier1	-	no_errors	ENST00000561171	ensembl	human	known	74_37	rna	12.28	50	7	SNP	0.000	T
MROH2B	133558	genome.wustl.edu	37	5	41015519	41015519	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:41015519C>T	ENST00000399564.4	-	29	3396	c.2946G>A	c.(2944-2946)gtG>gtA	p.V982V	MROH2B_ENST00000506092.2_Silent_p.V537V	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	982																	TCTGAACCTGCACGTCATCAC	0.393																																																	0													91.0	92.0	92.0					5																	41015519		1877	4097	5974	SO:0001819	synonymous_variant	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2946G>A	5.37:g.41015519C>T			Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	superfamily_ARM-type_fold	p.V982	ENST00000399564.4	37	c.2946	CCDS47202.1	5																																																																																			MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.393	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	38	0	C	NM_173489		41015519	-1	tier1	-	no_errors	ENST00000399564	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.000	T
RNF123	63891	genome.wustl.edu	37	3	49725034	49725034	+	5'Flank	SNP	T	T	A	rs142964215		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:49725034T>A	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Missense_Mutation_p.T29S|MST1_ENST00000545762.1_Missense_Mutation_p.T90S|RNF123_ENST00000432042.1_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.T104S	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CGCAGCCTCGTGTGGGGCGAG	0.617																																																	0													64.0	56.0	59.0					3																	49725034		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725034T>A	Exception_encountered		A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.T104S	ENST00000327697.6	37	c.310	CCDS33758.1	3	.	.	.	.	.	.	.	.	.	.	T	8.993	0.978116	0.18812	.	.	ENSG00000173531	ENST00000449682;ENST00000383728;ENST00000545762	D;D;D	0.88664	-2.41;-2.41;-2.41	5.13	3.94	0.45596	.	0.366754	0.19842	N	0.104821	T	0.81389	0.4812	L	0.51422	1.61	0.09310	N	1	P;B	0.35192	0.489;0.019	B;B	0.30179	0.112;0.023	T	0.66284	-0.5962	10	0.12766	T	0.61	.	7.7821	0.29070	0.0:0.2455:0.0:0.7545	.	90;104	B7Z538;G3XAK1	.;.	S	104;29;90	ENSP00000414287:T104S;ENSP00000373234:T29S;ENSP00000437535:T90S	ENSP00000373234:T29S	T	-	1	0	MST1	49700038	0.183000	0.23186	0.007000	0.13788	0.244000	0.25665	0.974000	0.29436	0.858000	0.35431	0.482000	0.46254	ACG	MST1	-	pfam_PAN-1_domain,smart_Pan_app,pfscan_Pan_app	ENSG00000173531		0.617	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346475.2	-	0.00	66	0	T	NM_022064		49725034	-1	tier1	rs142964215	no_errors	ENST00000449682	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.009	A
RNF123	63891	genome.wustl.edu	37	3	49725038	49725038	+	5'Flank	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:49725038G>C	ENST00000327697.6	+	0	0				MST1_ENST00000383728.3_Silent_p.P27P|MST1_ENST00000545762.1_Silent_p.P88P|RNF123_ENST00000432042.1_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000494828.2_5'UTR|MST1_ENST00000449682.2_Silent_p.P102P	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123						protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.P88L(1)		NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		GCCTCGTGTGGGGCGAGTGTT	0.622																																																	1	Substitution - Missense(1)	skin(1)											64.0	56.0	58.0					3																	49725038		2203	4300	6503	SO:0001631	upstream_gene_variant	0			AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891		3.37:g.49725038G>C	Exception_encountered		A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.P102	ENST00000327697.6	37	c.306	CCDS33758.1	3																																																																																			MST1	-	pfam_PAN-1_domain,smart_Pan_app,pfscan_Pan_app	ENSG00000173531		0.622	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MST1	HGNC	protein_coding	OTTHUMT00000346475.2	-	0.00	66	0	G	NM_022064		49725038	-1	tier1	rs116125078	no_errors	ENST00000449682	ensembl	human	known	74_37	silent	19.05	34	8	SNP	0.001	C
MRPL47	57129	genome.wustl.edu	37	3	179322325	179322325	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:179322325C>A	ENST00000476781.1	-	1	117	c.88G>T	c.(88-90)Gcc>Tcc	p.A30S	MRPL47_ENST00000259038.2_Missense_Mutation_p.A30S|NDUFB5_ENST00000472629.1_5'Flank|MRPL47_ENST00000392659.2_5'UTR|NDUFB5_ENST00000259037.3_5'Flank|NDUFB5_ENST00000493866.1_5'Flank	NM_020409.2	NP_065142.2	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47	30					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|stomach(1)	11	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			CCTGTGCAGGCAGGGACCTGA	0.502																																																	0													78.0	84.0	82.0					3																	179322325		2203	4300	6503	SO:0001583	missense	0			AF285120	CCDS3232.1, CCDS3233.1	3q26.33	2012-11-14			ENSG00000136522	ENSG00000136522		"""Mitochondrial ribosomal proteins / large subunits"""	16652	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma metastasis-related 1"""	611852				11551941	Standard	NM_177988		Approved	CGI-204, NCM1	uc003fjz.3	Q9HD33	OTTHUMG00000157784	ENST00000476781.1:c.88G>T	3.37:g.179322325C>A	ENSP00000417602:p.Ala30Ser		Q6XRG1|Q8N5D1	Missense_Mutation	SNP	pfam_Ribosomal_L47_mit	p.A30S	ENST00000476781.1	37	c.88	CCDS3232.1	3	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051211	0.36181	.	.	ENSG00000136522	ENST00000476781;ENST00000259038	T;T	0.31247	1.5;1.5	5.12	1.23	0.21249	.	21.818500	0.00999	U	0.003652	T	0.28134	0.0694	L	0.51422	1.61	0.23298	N	0.997951	B;B	0.15473	0.013;0.008	B;B	0.12156	0.007;0.003	T	0.08889	-1.0700	10	0.23891	T	0.37	0.3177	4.0431	0.09760	0.1628:0.5726:0.0:0.2646	.	30;30	Q9HD33-2;Q9HD33	.;RM47_HUMAN	S	30	ENSP00000417602:A30S;ENSP00000259038:A30S	ENSP00000259038:A30S	A	-	1	0	MRPL47	180805019	0.000000	0.05858	0.001000	0.08648	0.553000	0.35397	-0.488000	0.06497	0.110000	0.17919	-0.145000	0.13849	GCC	MRPL47	-	NULL	ENSG00000136522		0.502	MRPL47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL47	HGNC	protein_coding	OTTHUMT00000349623.1	-	0.00	33	0	C	NM_020409		179322325	-1	tier1	-	no_errors	ENST00000476781	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.002	A
MT-CO2	4513	genome.wustl.edu	37	M	8009	8009	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chrM:8009G>A	ENST00000361739.1	+	1	424	c.424G>A	c.(424-426)Gta>Ata	p.V142I	MT-ATP6_ENST00000361899.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TD_ENST00000387419.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	142			V -> M (in colorectal cancer). {ECO:0000269|PubMed:9806551}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TTGACAATCGAGTAGTACTCC	0.468																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.424G>A	M.37:g.8009G>A	ENSP00000354876:p.Val142Ile		Q37526	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.V142M	ENST00000361739.1	37	c.424		MT																																																																																			MT-CO2	-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	ENSG00000198712		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	HGNC	protein_coding		-	0.00	87	0	G	YP_003024029		8009	+1	tier1	rs199474826	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	25.49	76	26	SNP	NULL	A
MTR	4548	genome.wustl.edu	37	1	237060945	237060946	+	3'UTR	INS	-	-	T	rs67705775		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:237060945_237060946insT	ENST00000366577.5	+	0	4193_4194				MTR_ENST00000470570.1_3'UTR|MTR_ENST00000535889.1_3'UTR	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	TACAGACTAACTTTTTTTTTTT	0.366																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.*2->T	1.37:g.237060956_237060956dupT			A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	RNA	INS	-	NULL	ENST00000366577.5	37	NULL	CCDS1614.1	1																																																																																			MTR	-	-	ENSG00000116984		0.366	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	HGNC	protein_coding	OTTHUMT00000096632.2		0.00	44	0	-	NM_000254		237060946	+1	tier1		no_errors	ENST00000470570	ensembl	human	known	74_37	rna	14.29	30	5	INS	0.008:0.000	T
MYH7B	57644	genome.wustl.edu	37	20	33567245	33567245	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:33567245G>A	ENST00000262873.7	+	4	362	c.270G>A	c.(268-270)gaG>gaA	p.E90E		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	48	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			TGGAGGCCGAGGTCAAGTCGG	0.607																																																	0													41.0	48.0	46.0					20																	33567245		2026	4200	6226	SO:0001819	synonymous_variant	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.270G>A	20.37:g.33567245G>A			Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E90	ENST00000262873.7	37	c.270	CCDS42869.1	20																																																																																			MYH7B	-	pfam_Myosin_N,superfamily_Myosin_S1_N	ENSG00000078814		0.607	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	-	0.00	49	0	G	NM_020884		33567245	+1	tier1	-	no_errors	ENST00000262873	ensembl	human	novel	74_37	silent	22.00	39	11	SNP	0.999	A
MYH9	4627	genome.wustl.edu	37	22	36690174	36690174	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr22:36690174C>T	ENST00000216181.5	-	28	4031	c.3801G>A	c.(3799-3801)gtG>gtA	p.V1267V		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1267					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GCTCTGTGCGCACGCGCTCTC	0.662			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													84.0	79.0	81.0					22																	36690174		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.3801G>A	22.37:g.36690174C>T			A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1267	ENST00000216181.5	37	c.3801	CCDS13927.1	22																																																																																			MYH9	-	pfam_Myosin_tail,superfamily_STAT_TF_coiled-coil	ENSG00000100345		0.662	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	-	0.00	25	0	C	NM_002473		36690174	-1	tier1	-	no_errors	ENST00000216181	ensembl	human	known	74_37	silent	45.83	13	11	SNP	1.000	T
NCAM2	4685	genome.wustl.edu	37	21	22841014	22841014	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr21:22841014G>T	ENST00000400546.1	+	14	2055	c.1806G>T	c.(1804-1806)caG>caT	p.Q602H	NCAM2_ENST00000284894.7_Missense_Mutation_p.Q460H	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	602	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.Q602H(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TACATGGACAGCCAAGCAGTG	0.378																																																	1	Substitution - Missense(1)	lung(1)											109.0	103.0	105.0					21																	22841014		1887	4106	5993	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1806G>T	21.37:g.22841014G>T	ENSP00000383392:p.Gln602His		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.Q602H	ENST00000400546.1	37	c.1806	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	G	18.46	3.628604	0.67015	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.57107	0.42;0.42	5.75	4.87	0.63330	Fibronectin, type III (5);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.59878	0.2226	L	0.40543	1.245	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.81914	0.995;0.995	T	0.60541	-0.7243	10	0.51188	T	0.08	-9.7952	7.8299	0.29336	0.2392:0.0:0.7608:0.0	.	460;602	B7Z5K2;O15394	.;NCAM2_HUMAN	H	602;460	ENSP00000383392:Q602H;ENSP00000284894:Q460H	ENSP00000284894:Q460H	Q	+	3	2	NCAM2	21762885	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.572000	0.36461	1.440000	0.47531	0.655000	0.94253	CAG	NCAM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000154654		0.378	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1		0.00	28	0	G	NM_004540		22841014	+1			no_errors	ENST00000400546	ensembl	human	known	74_37	missense	5.41	34	2	SNP	1.000	T
NLRP3	114548	genome.wustl.edu	37	1	247588559	247588559	+	Missense_Mutation	SNP	G	G	T	rs138802458		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:247588559G>T	ENST00000336119.3	+	3	2560	c.1814G>T	c.(1813-1815)aGg>aTg	p.R605M	NLRP3_ENST00000366497.2_Missense_Mutation_p.R605M|NLRP3_ENST00000391827.2_Missense_Mutation_p.R605M|NLRP3_ENST00000366496.2_Missense_Mutation_p.R605M|NLRP3_ENST00000348069.2_Missense_Mutation_p.R605M|NLRP3_ENST00000391828.3_Missense_Mutation_p.R605M|NLRP3_ENST00000474792.1_3'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	605					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)	p.R605K(1)		NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CAGCAAATCAGGCTGGAGCTG	0.443																																																	1	Substitution - Missense(1)	skin(1)											52.0	53.0	53.0					1																	247588559		2203	4300	6503	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1814G>T	1.37:g.247588559G>T	ENSP00000337383:p.Arg605Met		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R605M	ENST00000336119.3	37	c.1814	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.391508	0.42410	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31;-2.31;-2.31	3.96	3.03	0.35002	.	0.109657	0.40728	N	0.001021	D	0.88966	0.6581	L	0.45137	1.4	0.09310	N	0.999998	B;P;D;P;B	0.89917	0.398;0.867;1.0;0.864;0.398	B;P;D;P;B	0.76071	0.184;0.494;0.987;0.644;0.242	T	0.79773	-0.1662	10	0.56958	D	0.05	.	9.1297	0.36837	0.0:0.0:0.7827:0.2173	.	605;605;605;605;605	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	M	605	ENSP00000375704:R605M;ENSP00000355453:R605M;ENSP00000337383:R605M;ENSP00000294752:R605M;ENSP00000355452:R605M;ENSP00000375703:R605M	ENSP00000337383:R605M	R	+	2	0	NLRP3	245655182	0.000000	0.05858	0.155000	0.22561	0.930000	0.56654	0.249000	0.18216	1.236000	0.43740	0.655000	0.94253	AGG	NLRP3	-	NULL	ENSG00000162711		0.443	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1		0.00	44	0	G	NM_004895		247588559	+1			no_errors	ENST00000336119	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.250	T
NOTCH1	4851	genome.wustl.edu	37	9	139407900	139407900	+	Missense_Mutation	SNP	C	C	G	rs374434131		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:139407900C>G	ENST00000277541.6	-	14	2372	c.2297G>C	c.(2296-2298)gGc>gCc	p.G766A		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	766	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TTTGCAGGTGCCGCCGTTGAC	0.602			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													90.0	104.0	99.0					9																	139407900		2180	4282	6462	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2297G>C	9.37:g.139407900C>G	ENSP00000277541:p.Gly766Ala		Q59ED8|Q5SXM3	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.G766A	ENST00000277541.6	37	c.2297	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620526	0.66787	.	.	ENSG00000148400	ENST00000277541	D	0.96300	-3.97	4.76	4.76	0.60689	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.97297	0.9116	L	0.54863	1.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97255	0.9900	10	0.42905	T	0.14	.	16.7491	0.85480	0.0:1.0:0.0:0.0	.	766	P46531	NOTC1_HUMAN	A	766	ENSP00000277541:G766A	ENSP00000277541:G766A	G	-	2	0	NOTCH1	138527721	1.000000	0.71417	0.924000	0.36721	0.240000	0.25518	5.682000	0.68182	2.199000	0.70637	0.455000	0.32223	GGC	NOTCH1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.602	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	69	0	C	NM_017617		139407900	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	51.52	16	17	SNP	1.000	G
NOTCH1	4851	genome.wustl.edu	37	9	139407924	139407925	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:139407924_139407925delTC	ENST00000277541.6	-	14	2347_2348	c.2272_2273delGA	c.(2272-2274)gaafs	p.E758fs		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	758	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGGGTTGGATTCACACTCATTG	0.599			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0																																										SO:0001589	frameshift_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2272_2273delGA	9.37:g.139407924_139407925delTC	ENSP00000277541:p.Glu758fs		Q59ED8|Q5SXM3	Frame_Shift_Del	DEL	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.E758fs	ENST00000277541.6	37	c.2273_2272	CCDS43905.1	9																																																																																			NOTCH1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.599	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1		0.00	70	0	TC	NM_017617		139407925	-1	tier1		no_errors	ENST00000277541	ensembl	human	known	74_37	frame_shift_del	45.24	23	19	DEL	1.000:1.000	-
NOX3	50508	genome.wustl.edu	37	6	155743924	155743924	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:155743924G>A	ENST00000159060.2	-	10	1314	c.1212C>T	c.(1210-1212)tgC>tgT	p.C404C		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	404					detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		CCGCGGCAACGCACACACACA	0.532																																																	0													131.0	129.0	130.0					6																	155743924		2203	4300	6503	SO:0001819	synonymous_variant	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.1212C>T	6.37:g.155743924G>A			Q9HBJ9	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.C404	ENST00000159060.2	37	c.1212	CCDS5250.1	6																																																																																			NOX3	-	pfam_Fe_red_NAD-bd_6,prints_Cyt_b245_heavy_chain	ENSG00000074771		0.532	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1		0.00	60	0	G			155743924	-1			no_errors	ENST00000159060	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.999	A
NPR2	4882	genome.wustl.edu	37	9	35807138	35807138	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:35807138A>T	ENST00000342694.2	+	17	2893	c.2638A>T	c.(2638-2640)Atg>Ttg	p.M880L	SPAG8_ENST00000479751.1_5'Flank	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	880	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GAGCACCCCCATGCAGGTGAG	0.527																																																	0													61.0	57.0	58.0					9																	35807138		2203	4300	6503	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.2638A>T	9.37:g.35807138A>T	ENSP00000341083:p.Met880Leu		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.M880L	ENST00000342694.2	37	c.2638	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	A	3.963	-0.009944	0.07727	.	.	ENSG00000159899	ENST00000342694;ENST00000447210	T;T	0.80304	-1.36;-1.36	6.17	6.17	0.99709	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.56097	D	0.000038	T	0.64170	0.2574	N	0.12502	0.225	0.50313	D	0.999864	B;B	0.13145	0.007;0.003	B;B	0.20184	0.028;0.02	T	0.61118	-0.7127	10	0.02654	T	1	.	15.6572	0.77150	1.0:0.0:0.0:0.0	.	880;880	P20594-2;P20594	.;ANPRB_HUMAN	L	880;139	ENSP00000341083:M880L;ENSP00000393029:M139L	ENSP00000341083:M880L	M	+	1	0	NPR2	35797138	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.685000	0.61693	2.371000	0.80710	0.533000	0.62120	ATG	NPR2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000159899		0.527	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	21	0	A			35807138	+1	tier1	-	no_errors	ENST00000342694	ensembl	human	known	74_37	missense	52.63	9	10	SNP	0.999	T
NR1H3	10062	genome.wustl.edu	37	11	47282123	47282123	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:47282123C>T	ENST00000467728.1	+	3	1634	c.396C>T	c.(394-396)taC>taT	p.Y132Y	NR1H3_ENST00000405853.3_Silent_p.Y132Y|NR1H3_ENST00000441012.2_Silent_p.Y132Y|NR1H3_ENST00000395397.3_Silent_p.Y87Y|NR1H3_ENST00000405576.1_Silent_p.Y87Y|NR1H3_ENST00000481889.2_Silent_p.Y87Y|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000407404.1_Silent_p.Y132Y|NR1H3_ENST00000527949.1_Silent_p.Y41Y			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	132					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						GAGCGCACTACATCTGCCACA	0.627																																																	0													52.0	43.0	46.0					11																	47282123		2201	4298	6499	SO:0001819	synonymous_variant	0			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.396C>T	11.37:g.47282123C>T			A8K3J9|D3DQR1|Q8IW13|Q96H87	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Ecdystd_rcpt	p.Y132	ENST00000467728.1	37	c.396	CCDS7929.1	11																																																																																			NR1H3	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000025434		0.627	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H3	HGNC	protein_coding	OTTHUMT00000319214.3	-	0.00	36	0	C			47282123	+1	tier1	-	no_errors	ENST00000441012	ensembl	human	known	74_37	silent	25.00	26	9	SNP	0.221	T
NRXN3	9369	genome.wustl.edu	37	14	79111726	79111726	+	5'UTR	SNP	G	G	A	rs201052888	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:79111726G>A	ENST00000554719.1	+	0	393				NRXN3_ENST00000335750.5_5'UTR	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3						adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAACGACAACGCCTGGCATGA	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		17868	0.0		0.0	False		,,,				2504	0.002																0													35.0	30.0	32.0					14																	79111726		876	1991	2867	SO:0001623	5_prime_UTR_variant	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.-99G>A	14.37:g.79111726G>A			A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.A339T	ENST00000554719.1	37	c.1015	CCDS9870.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.35|11.35	1.613092|1.613092	0.28712|0.28712	.|.	.|.	ENSG00000021645|ENSG00000021645	ENST00000330071;ENST00000332068|ENST00000553363	.|.	.|.	.|.	6.17|6.17	5.28|5.28	0.74379|0.74379	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);|.	.|.	.|.	.|.	.|.	T|T	0.62490|0.62490	0.2432|0.2432	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.58126|0.58126	-0.7691|-0.7691	6|4	.|.	.|.	.|.	.|.	11.3144|11.3144	0.49383|0.49383	0.0676:0.1283:0.804:0.0|0.0676:0.1283:0.804:0.0	.|.	341|.	Q9Y4C0|.	NRX3A_HUMAN|.	T|H	341;339|105	.|.	.|.	A|R	+|+	1|2	0|0	NRXN3|NRXN3	78181479|78181479	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.935000|1.935000	0.40173|0.40173	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|CGC	NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.537	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413787.1	-	0.00	46	0	G	NM_001105250		79111726	+1	tier1	rs201052888	no_errors	ENST00000554738	ensembl	human	known	74_37	missense	20.00	28	7	SNP	1.000	A
NSRP1	84081	genome.wustl.edu	37	17	28512218	28512218	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:28512218G>T	ENST00000247026.5	+	7	1266	c.1203G>T	c.(1201-1203)caG>caT	p.Q401H	NSRP1_ENST00000540900.3_3'UTR	NM_001261467.1|NM_032141.3	NP_001248396.1|NP_115517.1	Q9H0G5	NSRP1_HUMAN	nuclear speckle splicing regulatory protein 1	401					developmental process (GO:0032502)|mRNA processing (GO:0006397)|nucleocytoplasmic transport (GO:0006913)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	14						aaaatgatcagaaccgaccca	0.373																																																	0													36.0	33.0	34.0					17																	28512218		2196	4290	6486	SO:0001583	missense	0			AL136806	CCDS11255.1, CCDS74025.1	17q11.2	2011-05-24	2011-05-24	2011-05-24	ENSG00000126653	ENSG00000126653			25305	protein-coding gene	gene with protein product			"""coiled-coil domain containing 55"""	CCDC55		11230166	Standard	NM_032141		Approved	DKFZP434K1421, NSrp70	uc002heu.4	Q9H0G5	OTTHUMG00000132754	ENST00000247026.5:c.1203G>T	17.37:g.28512218G>T	ENSP00000247026:p.Gln401His		Q6FI71	Missense_Mutation	SNP	pfam_DUF2040	p.Q401H	ENST00000247026.5	37	c.1203	CCDS11255.1	17	.	.	.	.	.	.	.	.	.	.	G	2.485	-0.318745	0.05386	.	.	ENSG00000126653	ENST00000247026;ENST00000540900;ENST00000394826	T	0.44482	0.92	5.98	-1.2	0.09554	.	0.838562	0.11065	N	0.603522	T	0.16685	0.0401	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.16748	-1.0392	10	0.28530	T	0.3	-0.8597	1.3764	0.02221	0.147:0.1525:0.212:0.4885	.	401	Q9H0G5	NSRP1_HUMAN	H	401;332;347	ENSP00000247026:Q401H	ENSP00000247026:Q401H	Q	+	3	2	NSRP1	25536344	0.003000	0.15002	0.003000	0.11579	0.637000	0.38172	-0.217000	0.09253	-0.121000	0.11787	-0.280000	0.10049	CAG	NSRP1	-	NULL	ENSG00000126653		0.373	NSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSRP1	HGNC	protein_coding	OTTHUMT00000256121.2	-	0.00	18	0	G	NM_032141		28512218	+1	tier1	-	no_errors	ENST00000247026	ensembl	human	known	74_37	missense	27.27	8	3	SNP	0.000	T
OR4K5	79317	genome.wustl.edu	37	14	20389443	20389444	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:20389443_20389444GC>TT	ENST00000315915.4	+	1	703_704	c.678_679GC>TT	c.(676-681)tgGCtc>tgTTtc	p.226_227WL>CF		NM_001005483.1	NP_001005483.1	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K, member 5	226						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|liver(1)|lung(27)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TTACAGTTTGGCTCAAGTCTTC	0.391																																																	0																																										SO:0001583	missense	0			BK004355	CCDS32024.1	14q11.22	2012-08-09				ENSG00000176281		"""GPCR / Class A : Olfactory receptors"""	14745	protein-coding gene	gene with protein product						14983052	Standard	NM_001005483		Approved		uc010tkw.2	Q8NGD3		Exception_encountered	14.37:g.20389443_20389444delinsTT	ENSP00000319511:p.W226_L227delinsCF		Q6IFA7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.W226C|p.L227F	ENST00000315915.4	37	c.678|c.679	CCDS32024.1	14																																																																																			OR4K5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176281		0.391	OR4K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K5	HGNC	protein_coding	OTTHUMT00000409867.1	-	0.00	80|81	0	G|C	NM_001005483		20389443|20389444	+1	tier1	-	no_errors	ENST00000315915	ensembl	human	known	74_37	missense	22.73|23.08	51|49	15	SNP	0.000	T
P2RX4	5025	genome.wustl.edu	37	12	121647986	121647986	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:121647986G>T	ENST00000337233.4	+	1	327	c.19G>T	c.(19-21)Gcg>Tcg	p.A7S	P2RX4_ENST00000543171.1_5'UTR|P2RX4_ENST00000540930.1_3'UTR|P2RX4_ENST00000541532.1_Missense_Mutation_p.A7S|P2RX4_ENST00000359949.7_Missense_Mutation_p.A7S	NM_001261397.1|NM_001261398.1|NM_002560.2	NP_001248326.1|NP_001248327.1|NP_002551.2	Q99571	P2RX4_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 4	7					apoptotic signaling pathway (GO:0097190)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular response to ATP (GO:0071318)|endothelial cell activation (GO:0042118)|ion transmembrane transport (GO:0034220)|membrane depolarization (GO:0051899)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|neuronal action potential (GO:0019228)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of prostaglandin secretion (GO:0032308)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction (GO:0055117)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sodium ion transport (GO:0002028)|relaxation of cardiac muscle (GO:0055119)|response to ATP (GO:0033198)|response to fluid shear stress (GO:0034405)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|tissue homeostasis (GO:0001894)|transport (GO:0006810)|vasodilation (GO:0042311)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadherin binding (GO:0045296)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CTGCTGCGCCGCGCTGGCGGC	0.721																																																	0													9.0	10.0	10.0					12																	121647986		2132	4200	6332	SO:0001583	missense	0			Y07684	CCDS9214.1, CCDS58282.1	12q24.32	2012-01-17			ENSG00000135124	ENSG00000135124		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8535	protein-coding gene	gene with protein product		600846				9016352	Standard	NM_002560		Approved	P2X4	uc031qjt.1	Q99571	OTTHUMG00000169155	ENST00000337233.4:c.19G>T	12.37:g.121647986G>T	ENSP00000336607:p.Ala7Ser		E7EPF7|F6RU17|O00450|O14722|Q5U089|Q5U090|Q8N4N1|Q9UBG9	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X4_purnocptor,prints_P2X_purnocptor,prints_P2X1_purnocptor,tigrfam_P2X_purnocptor	p.A7S	ENST00000337233.4	37	c.19	CCDS9214.1	12	.	.	.	.	.	.	.	.	.	.	G	5.564	0.288828	0.10513	.	.	ENSG00000135124	ENST00000337233;ENST00000359949;ENST00000541532;ENST00000538701;ENST00000542067	T;T;T;T;T	0.22336	3.67;3.66;1.96;2.77;3.56	3.91	1.82	0.25136	.	1.449520	0.03873	N	0.275931	T	0.13157	0.0319	N	0.14661	0.345	0.25937	N	0.982924	B;B;B	0.13594	0.005;0.008;0.003	B;B;B	0.11329	0.006;0.006;0.002	T	0.24012	-1.0172	10	0.13470	T	0.59	-3.2271	8.5869	0.33664	0.0:0.303:0.542:0.1549	.	7;7;7	F6RU17;E7EPF7;Q99571	.;.;P2RX4_HUMAN	S	7	ENSP00000336607:A7S;ENSP00000353032:A7S;ENSP00000443115:A7S;ENSP00000444033:A7S;ENSP00000438329:A7S	ENSP00000336607:A7S	A	+	1	0	P2RX4	120132369	0.016000	0.18221	0.004000	0.12327	0.854000	0.48673	1.790000	0.38734	0.960000	0.38005	0.407000	0.27541	GCG	P2RX4	-	prints_P2X4_purnocptor,prints_P2X1_purnocptor,tigrfam_P2X_purnocptor	ENSG00000135124		0.721	P2RX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX4	HGNC	protein_coding	OTTHUMT00000402545.1	-	0.00	17	0	G	NM_175567		121647986	+1	tier1	-	no_errors	ENST00000337233	ensembl	human	known	74_37	missense	61.54	5	8	SNP	0.002	T
PAPOLG	64895	genome.wustl.edu	37	2	61009902	61009902	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:61009902A>G	ENST00000238714.3	+	12	1358	c.1109A>G	c.(1108-1110)tAt>tGt	p.Y370C	PAPOLG_ENST00000483370.1_3'UTR	NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	370					mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			TTTCAAAAGTATAGGTACGTG	0.289																																					GBM(183;1497 2932 21839 46797)												0													49.0	52.0	51.0					2																	61009902		2202	4297	6499	SO:0001583	missense	0			AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.1109A>G	2.37:g.61009902A>G	ENSP00000238714:p.Tyr370Cys		B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.Y370C	ENST00000238714.3	37	c.1109	CCDS1863.1	2	.	.	.	.	.	.	.	.	.	.	A	22.7	4.322881	0.81580	.	.	ENSG00000115421	ENST00000238714;ENST00000378104;ENST00000412217	.	.	.	5.21	5.21	0.72293	Poly(A) polymerase, RNA-binding domain (2);Nucleotidyltransferase, class I, C-terminal-like (1);	0.000000	0.85682	D	0.000000	D	0.85544	0.5721	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.89244	0.3586	9	0.87932	D	0	-22.4614	14.7577	0.69579	1.0:0.0:0.0:0.0	.	59;370	E9PEP5;Q9BWT3	.;PAPOG_HUMAN	C	370;59;38	.	ENSP00000238714:Y370C	Y	+	2	0	PAPOLG	60863406	1.000000	0.71417	0.966000	0.40874	0.997000	0.91878	9.225000	0.95219	1.972000	0.57404	0.528000	0.53228	TAT	PAPOLG	-	pfam_PolA_pol_RNA-bd_dom,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	ENSG00000115421		0.289	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLG	HGNC	protein_coding	OTTHUMT00000251577.3	-	0.00	32	0	A	NM_022894		61009902	+1	tier1	-	no_errors	ENST00000238714	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	G
PCDHA1	56147	genome.wustl.edu	37	5	140168121	140168121	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:140168121C>A	ENST00000504120.2	+	1	2246	c.2246C>A	c.(2245-2247)tCg>tAg	p.S749*	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Nonsense_Mutation_p.S749*	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	749	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGAGCTGGTCGAACTCACAG	0.647																																																	0													43.0	40.0	41.0					5																	140168121		2203	4300	6503	SO:0001587	stop_gained	0			AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2246C>A	5.37:g.140168121C>A	ENSP00000420840:p.Ser749*		O75288|Q9NRT7	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S749*	ENST00000504120.2	37	c.2246	CCDS54913.1	5	.	.	.	.	.	.	.	.	.	.	c	18.08	3.544227	0.65198	.	.	ENSG00000204970	ENST00000504120;ENST00000378133	.	.	.	4.16	4.16	0.48862	.	0.000000	0.35555	U	0.003121	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4938	0.84209	0.0:1.0:0.0:0.0	.	.	.	.	X	749	.	ENSP00000367373:S749X	S	+	2	0	PCDHA1	140148305	0.937000	0.31787	0.896000	0.35187	0.118000	0.20060	2.398000	0.44486	2.041000	0.60428	0.644000	0.83932	TCG	PCDHA1	-	NULL	ENSG00000204970		0.647	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	-	0.00	58	0	C	NM_018900		140168121	+1	tier1	-	no_errors	ENST00000504120	ensembl	human	known	74_37	nonsense	37.93	36	22	SNP	0.941	A
PCLO	27445	genome.wustl.edu	37	7	82580258	82580258	+	Missense_Mutation	SNP	A	A	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:82580258A>C	ENST00000333891.9	-	6	9983	c.9646T>G	c.(9646-9648)Ttg>Gtg	p.L3216V	PCLO_ENST00000423517.2_Missense_Mutation_p.L3216V|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCACGCTCCAAGTCTAGCTGC	0.458																																																	0													52.0	50.0	51.0					7																	82580258		1862	4107	5969	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9646T>G	7.37:g.82580258A>C	ENSP00000334319:p.Leu3216Val			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.L3216V	ENST00000333891.9	37	c.9646	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	A	5.859	0.342584	0.11069	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.24350	1.86;1.87	5.33	2.99	0.34606	.	.	.	.	.	T	0.44664	0.1304	M	0.68593	2.085	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.999	D;D;D	0.80764	0.952;0.994;0.994	T	0.36648	-0.9739	9	0.87932	D	0	.	8.7523	0.34622	0.8441:0.0:0.1559:0.0	.	3147;3216;3216	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	V	3147;3216;3216	ENSP00000334319:L3216V;ENSP00000388393:L3216V	ENSP00000334319:L3216V	L	-	1	2	PCLO	82418194	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	1.811000	0.38942	0.875000	0.35847	0.260000	0.18958	TTG	PCLO	-	NULL	ENSG00000186472		0.458	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	35	0	A	NM_014510		82580258	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	42.86	20	15	SNP	1.000	C
PCM1	5108	genome.wustl.edu	37	8	17817936	17817936	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:17817936G>A	ENST00000519253.1	+	15	2556	c.2305G>A	c.(2305-2307)Gca>Aca	p.A769T	PCM1_ENST00000524226.1_Missense_Mutation_p.A770T|PCM1_ENST00000325083.8_Missense_Mutation_p.A769T			Q15154	PCM1_HUMAN	pericentriolar material 1	769					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		ATTGCAAACGGCATGCCCTGA	0.343			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																			Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0													60.0	60.0	60.0					8																	17817936		1835	4080	5915	SO:0001583	missense	0				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.2305G>A	8.37:g.17817936G>A	ENSP00000431099:p.Ala769Thr		Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	NULL	p.A769T	ENST00000519253.1	37	c.2305		8	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843370	0.91197	.	.	ENSG00000078674	ENST00000325083;ENST00000519253;ENST00000524226	T;T;T	0.29397	3.37;1.57;1.57	4.85	4.85	0.62838	.	0.047991	0.85682	D	0.000000	T	0.50854	0.1640	M	0.61703	1.905	0.80722	D	1	D;D;D	0.67145	0.996;0.992;0.996	P;P;P	0.60609	0.877;0.856;0.877	T	0.48768	-0.9006	10	0.46703	T	0.11	-15.8644	18.8588	0.92264	0.0:0.0:1.0:0.0	.	769;770;769	E7ETA6;E7EV56;Q15154	.;.;PCM1_HUMAN	T	769;769;770	ENSP00000327077:A769T;ENSP00000431099:A769T;ENSP00000430521:A770T	ENSP00000327077:A769T	A	+	1	0	PCM1	17862216	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.773000	0.91762	2.608000	0.88229	0.650000	0.86243	GCA	PCM1	-	NULL	ENSG00000078674		0.343	PCM1-003	NOVEL	basic|exp_conf	protein_coding	PCM1	HGNC	protein_coding	OTTHUMT00000374800.1	-	0.00	40	0	G	NM_006197		17817936	+1	tier1	-	no_errors	ENST00000325083	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	A
PCNXL4	64430	genome.wustl.edu	37	14	60574805	60574805	+	Missense_Mutation	SNP	C	C	T	rs557916204	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:60574805C>T	ENST00000406854.1	+	2	1003	c.449C>T	c.(448-450)gCg>gTg	p.A150V	PCNXL4_ENST00000391611.2_Missense_Mutation_p.A150V|PCNXL4_ENST00000404681.2_Missense_Mutation_p.A150V|PCNXL4_ENST00000317623.4_Intron|PCNXL4_ENST00000406949.1_Intron			Q63HM2	PCX4_HUMAN	pecanex-like 4 (Drosophila)	150						integral component of membrane (GO:0016021)											GCTGGATTAGCGTGTGGTCTT	0.413													C|||	4	0.000798722	0.0	0.0	5008	,	,		19170	0.0		0.0	False		,,,				2504	0.0041																0													75.0	73.0	74.0					14																	60574805		876	1991	2867	SO:0001583	missense	0			AK022861		14q23.1	2012-07-18	2012-07-18	2012-07-18	ENSG00000126773	ENSG00000126773			20349	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 135"""	C14orf135			Standard	NM_022495		Approved		uc001xer.4	Q63HM2	OTTHUMG00000150361	ENST00000406854.1:c.449C>T	14.37:g.60574805C>T	ENSP00000384801:p.Ala150Val		A8MXM2|Q9BQG8|Q9H9F2	Missense_Mutation	SNP	pfam_Pecanex	p.A150V	ENST00000406854.1	37	c.449		14	.	.	.	.	.	.	.	.	.	.	C	9.657	1.143127	0.21205	.	.	ENSG00000126773	ENST00000391611;ENST00000406854;ENST00000404681	T;T	0.19669	2.13;2.13	5.54	3.0	0.34707	.	0.085622	0.08080	U	1.000000	T	0.22589	0.0545	.	.	.	0.35687	D	0.814504	.	.	.	.	.	.	T	0.13683	-1.0500	7	0.29301	T	0.29	.	7.4291	0.27118	0.1277:0.0702:0.0:0.8021	.	.	.	.	V	150	ENSP00000384801:A150V;ENSP00000385713:A150V	ENSP00000375469:A150V	A	+	2	0	C14orf135	59644558	0.951000	0.32395	0.004000	0.12327	0.832000	0.47134	4.859000	0.62954	0.371000	0.24564	-0.290000	0.09829	GCG	PCNXL4	-	NULL	ENSG00000126773		0.413	PCNXL4-005	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PCNXL4	HGNC	protein_coding	OTTHUMT00000317847.1	-	0.00	41	0	C	NM_022495		60574805	+1	tier1	-	no_errors	ENST00000404681	ensembl	human	known	74_37	missense	42.86	16	12	SNP	0.021	T
PDS5B	23047	genome.wustl.edu	37	13	33338643	33338643	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr13:33338643A>G	ENST00000315596.10	+	31	3721	c.3535A>G	c.(3535-3537)Atg>Gtg	p.M1179V	RNY1P4_ENST00000384595.1_RNA	NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1179					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TAGTTCTGAAATGGATCACAG	0.343																																																	0													103.0	99.0	100.0					13																	33338643		1839	4087	5926	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3535A>G	13.37:g.33338643A>G	ENSP00000313851:p.Met1179Val		Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M1179V	ENST00000315596.10	37	c.3535	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	A	1.407	-0.576577	0.03854	.	.	ENSG00000083642	ENST00000315596;ENST00000421084;ENST00000447833	.	.	.	5.39	5.39	0.77823	.	0.120134	0.85682	D	0.000000	T	0.32971	0.0847	N	0.14661	0.345	0.37117	D	0.900616	B	0.06786	0.001	B	0.06405	0.002	T	0.29941	-0.9995	9	0.25751	T	0.34	-18.148	9.6813	0.40072	0.7327:0.0:0.0:0.2673	.	1179	Q9NTI5	PDS5B_HUMAN	V	1179;1179;133	.	ENSP00000313851:M1179V	M	+	1	0	PDS5B	32236643	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.012000	0.49575	2.149000	0.67028	0.528000	0.53228	ATG	PDS5B	-	NULL	ENSG00000083642		0.343	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	-	0.00	57	0	A	NM_015032		33338643	+1	tier1	-	no_errors	ENST00000315596	ensembl	human	known	74_37	missense	38.75	49	31	SNP	1.000	G
PEX7	5191	genome.wustl.edu	37	6	137191072	137191072	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:137191072G>T	ENST00000318471.4	+	7	759	c.678G>T	c.(676-678)tgG>tgT	p.W226C	PEX7_ENST00000541292.1_Missense_Mutation_p.W226C	NM_000288.3	NP_000279.1	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	226					endochondral ossification (GO:0001958)|ether lipid biosynthetic process (GO:0008611)|fatty acid beta-oxidation (GO:0006635)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	enzyme binding (GO:0019899)|peroxisome matrix targeting signal-2 binding (GO:0005053)|protein homodimerization activity (GO:0042803)			lung(7)|prostate(1)	8	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		TGAGAGGCTGGGACTTAAGGA	0.383																																																	0													248.0	250.0	249.0					6																	137191072		2203	4300	6503	SO:0001583	missense	0			AF180814	CCDS5180.1	6q21-q22.2	2013-01-10			ENSG00000112357	ENSG00000112357		"""WD repeat domain containing"""	8860	protein-coding gene	gene with protein product	"""Refsum disease"""	601757				9090381, 10673331	Standard	NM_000288		Approved	PTS2R, RD	uc003qhd.3	O00628	OTTHUMG00000015650	ENST00000318471.4:c.678G>T	6.37:g.137191072G>T	ENSP00000315680:p.Trp226Cys		C0H5X6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.W226C	ENST00000318471.4	37	c.678	CCDS5180.1	6	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281819	0.80692	.	.	ENSG00000112357	ENST00000541292;ENST00000318471	D;D	0.83506	-1.73;-1.73	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90625	0.7060	H	0.94385	3.53	0.80722	D	1	P	0.44578	0.838	P	0.50231	0.635	D	0.92439	0.5960	10	0.87932	D	0	-24.6788	18.9107	0.92483	0.0:0.0:1.0:0.0	.	226	O00628	PEX7_HUMAN	C	226	ENSP00000441004:W226C;ENSP00000315680:W226C	ENSP00000315680:W226C	W	+	3	0	PEX7	137232765	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.095000	0.76952	2.751000	0.94390	0.591000	0.81541	TGG	PEX7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000112357		0.383	PEX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX7	HGNC	protein_coding	OTTHUMT00000042387.2	-	0.00	87	0	G	NM_000288		137191072	+1	tier1	-	no_errors	ENST00000318471	ensembl	human	known	74_37	missense	6.35	58	4	SNP	1.000	T
PIK3CB	5291	genome.wustl.edu	37	3	138400822	138400822	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:138400822C>T	ENST00000477593.1	-	18	2564	c.2491G>A	c.(2491-2493)Ggt>Agt	p.G831S	PIK3CB_ENST00000544716.1_Missense_Mutation_p.G282S|PIK3CB_ENST00000289153.2_Missense_Mutation_p.G831S			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	831	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	AGATCCAAACCAGCTTCTTTC	0.363																																																	0													118.0	105.0	109.0					3																	138400822		2203	4300	6503	SO:0001583	missense	0				CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.2491G>A	3.37:g.138400822C>T	ENSP00000418143:p.Gly831Ser		D3DNF0|Q24JU2	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_C2_dom,superfamily_ARM-type_fold,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G831S	ENST00000477593.1	37	c.2491	CCDS3104.1	3	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382547	0.82792	.	.	ENSG00000051382	ENST00000477593;ENST00000544716;ENST00000289153	D;D;D	0.81739	-1.53;-1.53;-1.53	5.37	4.48	0.54585	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.098474	0.64402	D	0.000001	D	0.88665	0.6498	M	0.80847	2.515	0.47407	D	0.999418	D;D;D	0.71674	0.998;0.989;0.997	D;D;D	0.79108	0.992;0.962;0.986	D	0.88334	0.2970	10	0.44086	T	0.13	-10.0166	12.7762	0.57451	0.0:0.9221:0.0:0.0779	.	831;418;282	P42338;B4DZI3;Q68DL0	PK3CB_HUMAN;.;.	S	831;282;831	ENSP00000418143:G831S;ENSP00000438259:G282S;ENSP00000289153:G831S	ENSP00000289153:G831S	G	-	1	0	PIK3CB	139883512	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	2.556000	0.45862	2.494000	0.84150	0.585000	0.79938	GGT	PIK3CB	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000051382		0.363	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CB	HGNC	protein_coding	OTTHUMT00000358019.1	-	0.00	40	0	C			138400822	-1	tier1	-	no_errors	ENST00000289153	ensembl	human	known	74_37	missense	11.54	46	6	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110466969	110466969	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:110466969C>T	ENST00000378402.5	+	45	6866	c.6762C>T	c.(6760-6762)tcC>tcT	p.S2254S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2254	G8 1. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CAGAGACATCCCCATTCCAAC	0.448										HNSCC(38;0.096)																																							0													158.0	153.0	154.0					8																	110466969		2006	4172	6178	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6762C>T	8.37:g.110466969C>T			Q567P2|Q9UF27	Silent	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.S2254	ENST00000378402.5	37	c.6762	CCDS47911.1	8																																																																																			PKHD1L1	-	pfam_G8_domain	ENSG00000205038		0.448	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	69	0	C	NM_177531		110466969	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	silent	6.14	107	7	SNP	0.826	T
PLEKHH1	57475	genome.wustl.edu	37	14	68038605	68038605	+	Missense_Mutation	SNP	G	G	A	rs573848643	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:68038605G>A	ENST00000329153.5	+	10	1703	c.1571G>A	c.(1570-1572)cGg>cAg	p.R524Q		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	524						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		GGCAGCCCCCGGGCCATCAAG	0.627													G|||	2	0.000399361	0.0	0.0	5008	,	,		17306	0.0		0.0	False		,,,				2504	0.002																0													25.0	26.0	25.0					14																	68038605		1969	4149	6118	SO:0001583	missense	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1571G>A	14.37:g.68038605G>A	ENSP00000330278:p.Arg524Gln		A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.R524Q	ENST00000329153.5	37	c.1571	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.288722	0.95517	.	.	ENSG00000054690	ENST00000329153	T	0.11385	2.78	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.29749	0.0743	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.994;0.999	P;P	0.61874	0.56;0.895	T	0.01269	-1.1400	10	0.49607	T	0.09	.	16.2597	0.82535	0.0:0.0:1.0:0.0	.	39;524	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	Q	524	ENSP00000330278:R524Q	ENSP00000330278:R524Q	R	+	2	0	PLEKHH1	67108358	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.869000	0.92326	2.486000	0.83907	0.561000	0.74099	CGG	PLEKHH1	-	NULL	ENSG00000054690		0.627	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	-	0.00	21	0	G	XM_031054		68038605	+1	tier1	-	no_errors	ENST00000329153	ensembl	human	known	74_37	missense	31.43	24	11	SNP	1.000	A
PLG	5340	genome.wustl.edu	37	6	161152209	161152209	+	Silent	SNP	T	T	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:161152209T>G	ENST00000308192.9	+	11	1446	c.1383T>G	c.(1381-1383)gtT>gtG	p.V461V		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	461					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	AAGCGAGTGTTGTAGCACCTC	0.517																																																	0													112.0	104.0	107.0					6																	161152209		2203	4300	6503	SO:0001819	synonymous_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.1383T>G	6.37:g.161152209T>G			Q15146|Q5TEH4|Q6PA00	Silent	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1	p.V461	ENST00000308192.9	37	c.1383	CCDS5279.1	6																																																																																			PLG	-	pirsf_Pept_S1A_plasmin,superfamily_Kringle-like	ENSG00000122194		0.517	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	-	0.00	55	0	T	NM_000301		161152209	+1	tier1	-	no_errors	ENST00000308192	ensembl	human	known	74_37	silent	21.95	32	9	SNP	0.000	G
PLXNC1	10154	genome.wustl.edu	37	12	94691141	94691141	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:94691141G>A	ENST00000258526.4	+	26	4265	c.4016G>A	c.(4015-4017)cGa>cAa	p.R1339Q	PLXNC1_ENST00000547057.1_Missense_Mutation_p.R386Q|PLXNC1_ENST00000545312.1_Missense_Mutation_p.R78Q	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1339					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)	p.R1339Q(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AAGAGACATCGAGGGAAGCAC	0.463																																																	1	Substitution - Missense(1)	lung(1)											108.0	95.0	99.0					12																	94691141		2203	4300	6503	SO:0001583	missense	0			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.4016G>A	12.37:g.94691141G>A	ENSP00000258526:p.Arg1339Gln		Q59H25	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Plexin_repeat,pfam_IPT,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Plexin-like_fold,superfamily_Ig_E-set,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.R1339Q	ENST00000258526.4	37	c.4016	CCDS9049.1	12	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567859	0.45798	.	.	ENSG00000136040	ENST00000258526;ENST00000547057;ENST00000545312	T;T;T	0.11385	2.78;2.78;2.78	5.03	4.13	0.48395	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.201429	0.43747	D	0.000531	T	0.04003	0.0112	N	0.05124	-0.11	0.37532	D	0.917946	B;B	0.30511	0.007;0.282	B;B	0.22386	0.002;0.039	T	0.40421	-0.9564	10	0.32370	T	0.25	.	4.753	0.13070	0.3128:0.0:0.6872:0.0	.	386;1339	B4DHQ7;O60486	.;PLXC1_HUMAN	Q	1339;386;78	ENSP00000258526:R1339Q;ENSP00000446720:R386Q;ENSP00000439225:R78Q	ENSP00000258526:R1339Q	R	+	2	0	PLXNC1	93215272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.822000	0.62686	2.337000	0.79520	0.462000	0.41574	CGA	PLXNC1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000136040		0.463	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNC1	HGNC	protein_coding	OTTHUMT00000408126.2		0.00	45	0	G			94691141	+1			no_errors	ENST00000258526	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
PNPLA6	10908	genome.wustl.edu	37	19	7622121	7622121	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:7622121C>T	ENST00000221249.6	+	30	3665	c.3234C>T	c.(3232-3234)ccC>ccT	p.P1078P	PNPLA6_ENST00000600737.1_Silent_p.P1116P|PNPLA6_ENST00000414982.3_Silent_p.P1126P|PNPLA6_ENST00000450331.3_Silent_p.P1078P|PNPLA6_ENST00000545201.2_Silent_p.P1051P	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1117	Patatin.				angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						TGTGCGACCCCAAGGACGGGC	0.667																																																	0													56.0	49.0	51.0					19																	7622121		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3234C>T	19.37:g.7622121C>T			A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.P1126	ENST00000221249.6	37	c.3378	CCDS32891.1	19																																																																																			PNPLA6	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	ENSG00000032444		0.667	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	-	0.00	89	0	C	NM_006702		7622121	+1	tier1	-	no_errors	ENST00000414982	ensembl	human	known	74_37	silent	46.25	43	37	SNP	0.844	T
PPAP2A	8611	genome.wustl.edu	37	5	54771153	54771153	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:54771153T>C	ENST00000307259.8	-	2	604	c.184A>G	c.(184-186)Ata>Gta	p.I62V	PPAP2A_ENST00000515132.1_Intron|PPAP2A_ENST00000264775.5_Intron	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	62					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				GGAATGATTATTCCACCTAAT	0.363																																																	0													133.0	124.0	127.0					5																	54771153		2203	4300	6503	SO:0001583	missense	0			AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.184A>G	5.37:g.54771153T>C	ENSP00000302229:p.Ile62Val		B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.I62V	ENST00000307259.8	37	c.184	CCDS34159.1	5	.	.	.	.	.	.	.	.	.	.	T	3.934	-0.015640	0.07681	.	.	ENSG00000067113	ENST00000307259	T	0.74106	-0.81	5.95	4.79	0.61399	.	.	.	.	.	T	0.54951	0.1890	N	0.16567	0.415	0.25539	N	0.987198	B	0.02656	0.0	B	0.01281	0.0	T	0.30416	-0.9979	9	0.02654	T	1	.	12.113	0.53850	0.0:0.0668:0.0:0.9332	.	62	O14494	LPP1_HUMAN	V	62	ENSP00000302229:I62V	ENSP00000302229:I62V	I	-	1	0	PPAP2A	54806910	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.597000	0.61062	1.072000	0.40860	0.528000	0.53228	ATA	PPAP2A	-	superfamily_P_Acid_Pase_2/haloperoxidase	ENSG00000067113		0.363	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2A	HGNC	protein_coding	OTTHUMT00000368073.1	-	0.00	45	0	T			54771153	-1	tier1	-	no_errors	ENST00000307259	ensembl	human	known	74_37	missense	42.86	12	9	SNP	1.000	C
PPP2CA	5515	genome.wustl.edu	37	5	133537546	133537546	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr5:133537546T>C	ENST00000481195.1	-	3	759	c.479A>G	c.(478-480)gAt>gGt	p.D160G	PPP2CA_ENST00000231504.5_5'Flank|CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	160					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	TACCTGCCCATCCACCAAGGC	0.363																																																	0													67.0	63.0	64.0					5																	133537546		2203	4300	6503	SO:0001583	missense	0				CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.479A>G	5.37:g.133537546T>C	ENSP00000418447:p.Asp160Gly		P05323|P13197	Missense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.D160G	ENST00000481195.1	37	c.479	CCDS4173.1	5	.	.	.	.	.	.	.	.	.	.	T	22.1	4.241887	0.79912	.	.	ENSG00000113575	ENST00000481195;ENST00000522385	T;T	0.05025	3.51;3.51	5.98	5.98	0.97165	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.10637	0.0260	L	0.55743	1.74	0.80722	D	1	B	0.11235	0.004	B	0.20767	0.031	T	0.02477	-1.1153	10	0.87932	D	0	-18.8267	16.4696	0.84102	0.0:0.0:0.0:1.0	.	160	P67775	PP2AA_HUMAN	G	160;95	ENSP00000418447:D160G;ENSP00000430869:D95G	ENSP00000418447:D160G	D	-	2	0	PPP2CA	133565445	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.031000	0.88826	2.289000	0.77006	0.482000	0.46254	GAT	PPP2CA	-	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000113575		0.363	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CA	HGNC	protein_coding	OTTHUMT00000251165.1	-	0.00	44	0	T	NM_002715		133537546	-1	tier1	-	no_errors	ENST00000481195	ensembl	human	known	74_37	missense	29.82	40	17	SNP	1.000	C
PRDX2	7001	genome.wustl.edu	37	19	12910723	12910723	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:12910723T>A	ENST00000301522.2	-	5	589	c.461A>T	c.(460-462)gAg>gTg	p.E154V	PRDX2_ENST00000334482.5_Intron|CTD-2659N19.10_ENST00000585496.1_RNA	NM_005809.4	NP_005800.3	P32119	PRDX2_HUMAN	peroxiredoxin 2	154	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular response to oxidative stress (GO:0034599)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of apoptotic process (GO:0042981)|removal of superoxide radicals (GO:0019430)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4						CCGCAGAGCCTCATCCACGGA	0.557																																																	0													128.0	104.0	112.0					19																	12910723		2203	4300	6503	SO:0001583	missense	0				CCDS12281.1	19p13.2	2008-07-17			ENSG00000167815	ENSG00000167815			9353	protein-coding gene	gene with protein product	"""thioredoxin-dependent peroxide reductase 1"", ""thiol-specific antioxidant 1"", ""natural killer-enhancing factor B"", ""thioredoxin peroxidase 1"", ""torin"""	600538		TDPX1		7607688	Standard	NM_005809		Approved	PRP, NKEFB, TSA, PRXII, PRX2, MGC4104	uc002mvd.4	P32119	OTTHUMG00000134285	ENST00000301522.2:c.461A>T	19.37:g.12910723T>A	ENSP00000301522:p.Glu154Val		A8K0C0|P31945|P32118|P35701|Q6FHG4|Q92763|Q9UC23	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	p.E154V	ENST00000301522.2	37	c.461	CCDS12281.1	19	.	.	.	.	.	.	.	.	.	.	T	29.2	4.988236	0.93106	.	.	ENSG00000167815	ENST00000301522	T	0.21031	2.03	5.26	5.26	0.73747	Thioredoxin-like fold (3);	0.000000	0.64402	D	0.000004	T	0.64327	0.2588	H	0.98980	4.39	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.79815	-0.1644	10	0.87932	D	0	-17.0001	14.1386	0.65303	0.0:0.0:0.0:1.0	.	154	P32119	PRDX2_HUMAN	V	154	ENSP00000301522:E154V	ENSP00000301522:E154V	E	-	2	0	PRDX2	12771723	1.000000	0.71417	0.893000	0.35052	0.902000	0.53008	7.634000	0.83273	1.998000	0.58463	0.459000	0.35465	GAG	PRDX2	-	superfamily_Thioredoxin-like_fold	ENSG00000167815		0.557	PRDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX2	HGNC	protein_coding	OTTHUMT00000258950.2	-	0.00	69	0	T	NM_005809		12910723	-1	tier1	-	no_errors	ENST00000301522	ensembl	human	known	74_37	missense	44.19	24	19	SNP	1.000	A
PROM2	150696	genome.wustl.edu	37	2	95940353	95940353	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:95940353T>A	ENST00000317620.9	+	1	153	c.20T>A	c.(19-21)cTg>cAg	p.L7Q	PROM2_ENST00000463580.1_3'UTR|PROM2_ENST00000403131.2_Missense_Mutation_p.L7Q|PROM2_ENST00000542147.1_Missense_Mutation_p.L7Q|PROM2_ENST00000317668.4_Missense_Mutation_p.L7Q	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	7					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						ACACTGGCTCTGCTGGCTCCC	0.647																																																	0													37.0	41.0	40.0					2																	95940353		2203	4300	6503	SO:0001583	missense	0			AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.20T>A	2.37:g.95940353T>A	ENSP00000318270:p.Leu7Gln		A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	pfam_Prominin	p.L7Q	ENST00000317620.9	37	c.20	CCDS2012.1	2	.	.	.	.	.	.	.	.	.	.	T	12.47	1.946526	0.34377	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.66995	-0.22;-0.22;-0.22;-0.24	5.12	2.64	0.31445	.	0.382752	0.19125	N	0.122066	T	0.37183	0.0994	N	0.08118	0	0.09310	N	1	P	0.47762	0.9	B	0.36244	0.22	T	0.31613	-0.9937	10	0.62326	D	0.03	-8.2833	4.5896	0.12301	0.1687:0.0945:0.0:0.7369	.	7	Q8N271	PROM2_HUMAN	Q	7	ENSP00000385716:L7Q;ENSP00000318520:L7Q;ENSP00000318270:L7Q;ENSP00000442542:L7Q	ENSP00000318270:L7Q	L	+	2	0	PROM2	95304080	0.005000	0.15991	0.105000	0.21289	0.054000	0.15201	0.827000	0.27421	0.773000	0.33404	0.402000	0.26972	CTG	PROM2	-	NULL	ENSG00000155066		0.647	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PROM2	HGNC	protein_coding	OTTHUMT00000252771.1	-	0.00	73	0	T	NM_144707		95940353	+1	tier1	-	no_errors	ENST00000317620	ensembl	human	known	74_37	missense	23.75	61	19	SNP	0.035	A
PRR12	57479	genome.wustl.edu	37	19	50128144	50128144	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:50128144G>T	ENST00000418929.2	+	12	5777	c.5765G>T	c.(5764-5766)gGg>gTg	p.G1922V	CTB-33G10.11_ENST00000600665.1_RNA	NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	1101							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GAGCAGAGTGGGGAGGGCTCT	0.632																																																	0													38.0	41.0	40.0					19																	50128144		1996	4165	6161	SO:0001583	missense	0			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.5765G>T	19.37:g.50128144G>T	ENSP00000394510:p.Gly1922Val		E9PB06|Q8N4J6	Missense_Mutation	SNP	NULL	p.G1922V	ENST00000418929.2	37	c.5765	CCDS46143.1	19	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214817	0.39102	.	.	ENSG00000126464	ENST00000418929;ENST00000246798	T	0.46819	0.86	4.96	2.68	0.31781	.	0.343290	0.21680	N	0.070726	T	0.31796	0.0808	N	0.12182	0.205	0.48288	D	0.999621	P	0.40931	0.733	B	0.41646	0.362	T	0.13872	-1.0493	10	0.62326	D	0.03	-20.5087	11.2456	0.48996	0.0:0.3588:0.6412:0.0	.	1922	Q9ULL5-3	.	V	1922;1102	ENSP00000394510:G1922V	ENSP00000246798:G1102V	G	+	2	0	PRR12	54819956	0.183000	0.23186	0.981000	0.43875	0.880000	0.50808	1.356000	0.34079	0.434000	0.26340	0.492000	0.49549	GGG	PRR12	-	NULL	ENSG00000126464		0.632	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	HGNC	protein_coding	OTTHUMT00000465915.1	-	0.00	33	0	G	NM_020719		50128144	+1	tier1	-	no_errors	ENST00000418929	ensembl	human	novel	74_37	missense	15.38	22	4	SNP	0.972	T
PRR23A	729627	genome.wustl.edu	37	3	138724597	138724597	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:138724597C>T	ENST00000383163.2	-	1	513	c.514G>A	c.(514-516)Gca>Aca	p.A172T	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	172										endometrium(3)|kidney(1)|lung(7)	11						GAGCCGGCTGCGGAGTCCATC	0.662																																																	0													20.0	26.0	24.0					3																	138724597		692	1591	2283	SO:0001583	missense	0				CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.514G>A	3.37:g.138724597C>T	ENSP00000372649:p.Ala172Thr			Missense_Mutation	SNP	pfam_UPF0572	p.A172T	ENST00000383163.2	37	c.514	CCDS46923.1	3	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341080	0.41498	.	.	ENSG00000206260	ENST00000383163	.	.	.	3.09	-0.996	0.10218	.	0.847613	0.09851	N	0.747615	T	0.28333	0.0700	L	0.34521	1.04	0.09310	N	1	B	0.16603	0.018	B	0.12156	0.007	T	0.24261	-1.0165	9	0.27082	T	0.32	.	8.221	0.31541	0.0:0.6332:0.2276:0.1391	.	172	A6NEV1	PR23A_HUMAN	T	172	.	ENSP00000372649:A172T	A	-	1	0	PRR23A	140207287	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.437000	0.06914	-0.229000	0.09854	-0.347000	0.07816	GCA	PRR23A	-	pfam_UPF0572	ENSG00000206260		0.662	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23A	HGNC	protein_coding	OTTHUMT00000361503.1	-	0.00	35	0	C	NM_001134659		138724597	-1	tier1	-	no_errors	ENST00000383163	ensembl	human	known	74_37	missense	34.21	25	13	SNP	0.000	T
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000539239.1_Intron|PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																																	0													16.0	16.0	16.0					12																	28114898		875	1991	2866	SO:0001627	intron_variant	0				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT			Q15251|Q6FH74	Frame_Shift_Del	DEL	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			PTHLH	-	NULL	ENSG00000087494		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1		0.00	30	0	T	NM_198965		28114898	-1	tier1		no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_del	8.70	21	2	DEL	0.135	-
PTPN11	5781	genome.wustl.edu	37	12	112891121	112891121	+	Missense_Mutation	SNP	G	G	T	rs397507521		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:112891121G>T	ENST00000351677.2	+	4	653	c.455G>T	c.(454-456)cGc>cTc	p.R152L	PTPN11_ENST00000392597.1_Missense_Mutation_p.R152L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	152	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)	p.R152H(1)		NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						CTTTCTGTGCGCACTGGTGAT	0.443			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											129.0	125.0	126.0					12																	112891121		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.455G>T	12.37:g.112891121G>T	ENSP00000340944:p.Arg152Leu		A8K1D9|Q96HD7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.R152L	ENST00000351677.2	37	c.455	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118303	0.56505	.	.	ENSG00000179295	ENST00000392597;ENST00000351677;ENST00000392596	D;D	0.88431	-2.38;-2.38	5.55	5.55	0.83447	.	0.054496	0.85682	D	0.000000	D	0.84138	0.5406	L	0.33485	1.01	0.80722	D	1	B;B	0.20550	0.046;0.017	B;B	0.23574	0.022;0.047	T	0.78884	-0.2028	10	0.11794	T	0.64	.	19.5088	0.95132	0.0:0.0:1.0:0.0	.	152;152	Q06124-2;Q06124-3	.;.	L	152	ENSP00000376376:R152L;ENSP00000340944:R152L	ENSP00000340944:R152L	R	+	2	0	PTPN11	111375504	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.548000	0.67255	2.624000	0.88883	0.555000	0.69702	CGC	PTPN11	-	pfam_SH2,smart_SH2,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,prints_SH2	ENSG00000179295		0.443	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	HGNC	protein_coding	OTTHUMT00000259496.2		0.00	38	0	G			112891121	+1			no_errors	ENST00000351677	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
RAVER1	125950	genome.wustl.edu	37	19	10439506	10439506	+	Missense_Mutation	SNP	T	T	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:10439506T>G	ENST00000293677.6	-	3	700	c.619A>C	c.(619-621)Aag>Cag	p.K207Q		NM_133452.2	NP_597709.2	Q8IY67	RAVR1_HUMAN	ribonucleoprotein, PTB-binding 1	190	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	18			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			AGGTCCGACTTGGCACGGGCA	0.637																																																	0													26.0	32.0	30.0					19																	10439506		2144	4246	6390	SO:0001583	missense	0				CCDS45960.1	19p13.2	2013-02-12				ENSG00000161847		"""RNA binding motif (RRM) containing"""	30296	protein-coding gene	gene with protein product		609950				11853319, 11724819	Standard	NM_133452		Approved	KIAA1978	uc002moa.3	Q8IY67		ENST00000293677.6:c.619A>C	19.37:g.10439506T>G	ENSP00000293677:p.Lys207Gln		A6NMU4|Q8IY60|Q8TF24	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K207Q	ENST00000293677.6	37	c.619	CCDS45960.1	19	.	.	.	.	.	.	.	.	.	.	T	19.99	3.929483	0.73327	.	.	ENSG00000161847	ENST00000293677;ENST00000331131	T	0.17528	2.27	5.07	3.98	0.46160	.	0.000000	0.85682	D	0.000000	T	0.29749	0.0743	L	0.52364	1.645	0.42529	D	0.993039	D	0.71674	0.998	D	0.66979	0.948	T	0.01643	-1.1305	10	0.39692	T	0.17	-25.0321	8.9611	0.35847	0.166:0.0:0.0:0.834	.	207	E9PAU2	.	Q	207;190	ENSP00000293677:K207Q	ENSP00000293677:K207Q	K	-	1	0	RAVER1	10300506	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.799000	0.69101	1.911000	0.55334	0.528000	0.53228	AAG	RAVER1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000161847		0.637	RAVER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAVER1	HGNC	protein_coding	OTTHUMT00000451227.1	-	0.00	170	0	T	NM_133452		10439506	-1	tier1	-	no_errors	ENST00000293677	ensembl	human	known	74_37	missense	41.91	79	57	SNP	1.000	G
RAVER2	55225	genome.wustl.edu	37	1	65268698	65268698	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:65268698A>G	ENST00000294428.3	+	6	1223	c.1145A>G	c.(1144-1146)aAt>aGt	p.N382S	RAVER2_ENST00000371072.4_Missense_Mutation_p.N382S|RAVER2_ENST00000430964.2_Missense_Mutation_p.N88S			Q9HCJ3	RAVR2_HUMAN	ribonucleoprotein, PTB-binding 2	382						cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						CATCTGATGAATCCATCCATC	0.303																																																	0													133.0	124.0	127.0					1																	65268698		1857	4108	5965	SO:0001583	missense	0			AB046799	CCDS41345.1	1p31.3	2013-02-12			ENSG00000162437	ENSG00000162437		"""RNA binding motif (RRM) containing"""	25577	protein-coding gene	gene with protein product		609953				16051233	Standard	NM_018211		Approved	KIAA1579, FLJ10770	uc001dbs.2	Q9HCJ3	OTTHUMG00000009102	ENST00000294428.3:c.1145A>G	1.37:g.65268698A>G	ENSP00000294428:p.Asn382Ser		Q6P141|Q9NPV7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.N382S	ENST00000294428.3	37	c.1145		1	.	.	.	.	.	.	.	.	.	.	A	4.248	0.045111	0.08196	.	.	ENSG00000162437	ENST00000371072;ENST00000294428;ENST00000430964	T;T	0.33216	1.43;1.42	5.67	2.09	0.27110	.	0.312841	0.39407	N	0.001369	T	0.05410	0.0143	N	0.25647	0.755	0.26234	N	0.978977	B;B	0.23185	0.028;0.081	B;B	0.22152	0.014;0.038	T	0.42310	-0.9459	10	0.15499	T	0.54	-23.0133	5.1945	0.15230	0.5638:0.2895:0.1467:0.0	.	382;382	Q9HCJ3;Q9HCJ3-2	RAVR2_HUMAN;.	S	382;382;88	ENSP00000360112:N382S;ENSP00000294428:N382S	ENSP00000294428:N382S	N	+	2	0	RAVER2	65041286	0.727000	0.28069	0.662000	0.29724	0.074000	0.17049	1.504000	0.35726	0.104000	0.17725	-0.332000	0.08345	AAT	RAVER2	-	NULL	ENSG00000162437		0.303	RAVER2-201	KNOWN	basic	protein_coding	RAVER2	HGNC	protein_coding		-	0.00	56	0	A	NM_018211		65268698	+1	tier1	-	no_errors	ENST00000294428	ensembl	human	known	74_37	missense	28.57	25	10	SNP	0.847	G
REG3G	130120	genome.wustl.edu	37	2	79253229	79253229	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:79253229C>G	ENST00000272324.5	+	2	194	c.10C>G	c.(10-12)Ccc>Gcc	p.P4A	REG3G_ENST00000393897.2_Missense_Mutation_p.P4A|REG3G_ENST00000409471.1_Missense_Mutation_p.P4A	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	4					acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TATGCTGCCTCCCATGGCCCT	0.537																																																	0													184.0	138.0	154.0					2																	79253229		2203	4300	6503	SO:0001583	missense	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.10C>G	2.37:g.79253229C>G	ENSP00000272324:p.Pro4Ala		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.P4A	ENST00000272324.5	37	c.10	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	C	12.30	1.895957	0.33442	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.16457	4.4;4.4;2.34	4.3	1.38	0.22167	.	0.510651	0.16708	N	0.202818	T	0.17323	0.0416	M	0.75447	2.3	0.09310	N	1	P;P	0.37061	0.518;0.58	B;B	0.35114	0.164;0.196	T	0.10613	-1.0622	10	0.35671	T	0.21	.	6.1805	0.20468	0.0:0.6613:0.0:0.3387	.	4;4	Q3SYE6;Q6UW15	.;REG3G_HUMAN	A	4	ENSP00000377475:P4A;ENSP00000272324:P4A;ENSP00000387105:P4A	ENSP00000272324:P4A	P	+	1	0	REG3G	79106737	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-1.928000	0.01560	0.288000	0.22398	-0.142000	0.14014	CCC	REG3G	-	NULL	ENSG00000143954		0.537	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	-	0.00	101	0	C	NM_198448		79253229	+1	tier1	-	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	39.29	51	33	SNP	0.000	G
REL	5966	genome.wustl.edu	37	2	61149071	61149071	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:61149071C>T	ENST00000295025.8	+	11	1581	c.1261C>T	c.(1261-1263)Cgc>Tgc	p.R421C	REL_ENST00000394479.3_Missense_Mutation_p.R389C	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	421					cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R421C(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			CCCCACCCCACGCTCAGGCAA	0.507			A		Hodgkin Lymphoma																																			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	1	Substitution - Missense(1)	large_intestine(1)											96.0	91.0	93.0					2																	61149071		2203	4300	6503	SO:0001583	missense	0			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.1261C>T	2.37:g.61149071C>T	ENSP00000295025:p.Arg421Cys		Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.R421C	ENST00000295025.8	37	c.1261	CCDS1864.1	2	.	.	.	.	.	.	.	.	.	.	C	7.296	0.612119	0.14066	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.45668	0.89;0.9	5.45	3.3	0.37823	.	2.338690	0.01609	N	0.022420	T	0.33059	0.0850	N	0.19112	0.55	0.21967	N	0.999449	B;B	0.13594	0.004;0.008	B;B	0.04013	0.0;0.001	T	0.22347	-1.0219	10	0.54805	T	0.06	-13.0928	8.2695	0.31836	0.1607:0.7384:0.0:0.1009	.	389;421	Q17RU2;Q04864	.;REL_HUMAN	C	421;389	ENSP00000295025:R421C;ENSP00000377989:R389C	ENSP00000295025:R421C	R	+	1	0	REL	61002575	0.007000	0.16637	0.711000	0.30485	0.292000	0.27327	0.437000	0.21543	1.174000	0.42811	0.585000	0.79938	CGC	REL	-	NULL	ENSG00000162924		0.507	REL-001	KNOWN	basic|CCDS	protein_coding	REL	HGNC	protein_coding	OTTHUMT00000251576.3	-	0.00	38	0	C	NM_002908		61149071	+1	tier1	-	no_errors	ENST00000295025	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.290	T
REG3G	130120	genome.wustl.edu	37	2	79253939	79253939	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:79253939A>T	ENST00000272324.5	+	3	361	c.177A>T	c.(175-177)aaA>aaT	p.K59N	REG3G_ENST00000393897.2_Missense_Mutation_p.K59N|REG3G_ENST00000409471.1_Missense_Mutation_p.K59N	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	59	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTCACCAAAATCCTGGATGG	0.547																																																	0													97.0	95.0	96.0					2																	79253939		2203	4300	6503	SO:0001583	missense	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.177A>T	2.37:g.79253939A>T	ENSP00000272324:p.Lys59Asn		A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.K59N	ENST00000272324.5	37	c.177	CCDS1962.1	2	.	.	.	.	.	.	.	.	.	.	A	16.04	3.011031	0.54361	.	.	ENSG00000143954	ENST00000393897;ENST00000272324;ENST00000409471	T;T;T	0.21361	2.01;2.01;2.12	5.05	3.92	0.45320	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.237054	0.30519	N	0.009449	T	0.45597	0.1350	M	0.86953	2.85	0.09310	N	1	D;D	0.67145	0.996;0.994	D;D	0.74023	0.971;0.982	T	0.35724	-0.9777	10	0.66056	D	0.02	.	6.9665	0.24625	0.9013:0.0:0.0987:0.0	.	59;59	Q3SYE6;Q6UW15	.;REG3G_HUMAN	N	59	ENSP00000377475:K59N;ENSP00000272324:K59N;ENSP00000387105:K59N	ENSP00000272324:K59N	K	+	3	2	REG3G	79107447	0.006000	0.16342	0.060000	0.19600	0.005000	0.04900	0.612000	0.24283	2.254000	0.74563	0.533000	0.62120	AAA	REG3G	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000143954		0.547	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	-	0.00	45	0	A	NM_198448		79253939	+1	tier1	-	no_errors	ENST00000272324	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.065	T
RGAG1	57529	genome.wustl.edu	37	X	109697615	109697615	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chrX:109697615T>C	ENST00000465301.2	+	3	4016	c.3770T>C	c.(3769-3771)cTg>cCg	p.L1257P	RGAG1_ENST00000540313.1_Missense_Mutation_p.L1257P	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1257										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ACTGACTTCCTGCTGCTGGCC	0.502																																																	0													113.0	107.0	109.0					X																	109697615		2203	4300	6503	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3770T>C	X.37:g.109697615T>C	ENSP00000419786:p.Leu1257Pro		Q9P2M8	Missense_Mutation	SNP	NULL	p.L1257P	ENST00000465301.2	37	c.3770	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	T	14.57	2.574883	0.45902	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.48836	0.8;0.8	4.26	4.26	0.50523	.	0.000000	0.32901	N	0.005501	T	0.48660	0.1512	N	0.19112	0.55	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.42241	-0.9463	9	.	.	.	-11.8817	8.7451	0.34580	0.0:0.0:0.0:1.0	.	1257	Q8NET4	RGAG1_HUMAN	P	1257;1257;818	ENSP00000419786:L1257P;ENSP00000441452:L1257P	.	L	+	2	0	RGAG1	109584271	0.992000	0.36948	0.955000	0.39395	0.960000	0.62799	3.093000	0.50217	1.885000	0.54596	0.486000	0.48141	CTG	RGAG1	-	NULL	ENSG00000243978		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	-	0.00	21	0	T	NM_020769		109697615	+1	tier1	-	no_errors	ENST00000465301	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.954	C
RGL2	5863	genome.wustl.edu	37	6	33264024	33264024	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:33264024G>C	ENST00000497454.1	-	6	1044	c.549C>G	c.(547-549)gaC>gaG	p.D183E	RGL2_ENST00000444031.2_Missense_Mutation_p.D101E|RGL2_ENST00000437840.2_5'UTR|PFDN6_ENST00000463584.1_Intron	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	183	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						TCTCAAGCCGGTCAAGCTGAC	0.597																																																	0													100.0	108.0	105.0					6																	33264024		2203	4300	6503	SO:0001583	missense	0				CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.549C>G	6.37:g.33264024G>C	ENSP00000420211:p.Asp183Glu		B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.D183E	ENST00000497454.1	37	c.549	CCDS4774.1	6	.	.	.	.	.	.	.	.	.	.	G	9.781	1.175224	0.21704	.	.	ENSG00000237441	ENST00000497454;ENST00000421215;ENST00000444031	T;T	0.46451	0.87;0.87	4.88	4.88	0.63580	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (3);	3.571790	0.01027	N	0.004061	T	0.32255	0.0823	L	0.28556	0.865	0.38721	D	0.953454	P;D	0.54397	0.785;0.966	P;P	0.58928	0.492;0.848	T	0.53683	-0.8404	10	0.02654	T	1	.	13.4	0.60876	0.0:0.0:1.0:0.0	.	101;183	B4DG72;O15211	.;RGL2_HUMAN	E	183;47;101	ENSP00000420211:D183E;ENSP00000403070:D101E	ENSP00000400083:D47E	D	-	3	2	RGL2	33372002	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.558000	0.53749	2.512000	0.84698	0.643000	0.83706	GAC	RGL2	-	superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000237441		0.597	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL2	HGNC	protein_coding	OTTHUMT00000076098.2	-	0.00	55	0	G			33264024	-1	tier1	-	no_errors	ENST00000497454	ensembl	human	known	74_37	missense	47.50	21	19	SNP	1.000	C
ROM1	6094	genome.wustl.edu	37	11	62381901	62381901	+	Missense_Mutation	SNP	T	T	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:62381901T>A	ENST00000278833.3	+	2	1303	c.762T>A	c.(760-762)caT>caA	p.H254Q	EML3_ENST00000494176.2_5'Flank|EML3_ENST00000278845.4_5'Flank|EML3_ENST00000394773.2_5'Flank|ROM1_ENST00000534093.1_Missense_Mutation_p.M45K|EML3_ENST00000529309.1_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	254					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						AAGGGTGCCATGAGGTGCTGC	0.597																																																	0													83.0	77.0	79.0					11																	62381901		2202	4299	6501	SO:0001583	missense	0			L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.762T>A	11.37:g.62381901T>A	ENSP00000278833:p.His254Gln		B2R978	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1	p.H254Q	ENST00000278833.3	37	c.762	CCDS8024.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.98|16.98	3.271200|3.271200	0.59649|0.59649	.|.	.|.	ENSG00000149489|ENSG00000149489	ENST00000278833|ENST00000525801;ENST00000534093;ENST00000525947	T|.	0.78924|.	-1.22|.	5.38|5.38	-10.5|-10.5	0.00291|0.00291	Tetraspanin, EC2 domain (1);|.	0.148660|.	0.39146|.	N|.	0.001443|.	T|T	0.47838|0.47838	0.1467|0.1467	L|L	0.54323|0.54323	1.7|1.7	0.18873|0.18873	N|N	0.999986|0.999986	D|.	0.57257|.	0.979|.	P|.	0.57204|.	0.815|.	T|T	0.63743|0.63743	-0.6568|-0.6568	10|6	0.29301|0.87932	T|D	0.29|0	-22.1371|-22.1371	14.7386|14.7386	0.69437|0.69437	0.0:0.1659:0.0872:0.7469|0.0:0.1659:0.0872:0.7469	.|.	254|.	Q03395|.	ROM1_HUMAN|.	Q|K	254|45	ENSP00000278833:H254Q|.	ENSP00000278833:H254Q|ENSP00000433566:M45K	H|M	+|+	3|2	2|0	ROM1|ROM1	62138477|62138477	0.000000|0.000000	0.05858|0.05858	0.240000|0.240000	0.24138|0.24138	0.977000|0.977000	0.68977|0.68977	-3.641000|-3.641000	0.00406|0.00406	-2.131000|-2.131000	0.00815|0.00815	-0.464000|-0.464000	0.05259|0.05259	CAT|ATG	ROM1	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000149489		0.597	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROM1	HGNC	protein_coding	OTTHUMT00000394929.1	-	0.00	24	0	T	NM_000327		62381901	+1	tier1	-	no_errors	ENST00000278833	ensembl	human	known	74_37	missense	57.89	8	11	SNP	0.003	A
ROS1	6098	genome.wustl.edu	37	6	117609724	117609724	+	Silent	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:117609724A>T	ENST00000368508.3	-	43	7173	c.6975T>A	c.(6973-6975)ccT>ccA	p.P2325P	ROS1_ENST00000368507.3_Silent_p.P2319P	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2325					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GCTTGCCAGAAGGGCAGTAAG	0.458			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																			Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													109.0	106.0	107.0					6																	117609724		2203	4300	6503	SO:0001819	synonymous_variant	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6975T>A	6.37:g.117609724A>T			Q15368|Q5TDB5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P2325	ENST00000368508.3	37	c.6975	CCDS5116.1	6																																																																																			ROS1	-	NULL	ENSG00000047936		0.458	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	-	0.00	111	0	A			117609724	-1	tier1	-	no_errors	ENST00000368508	ensembl	human	known	74_37	silent	22.78	61	18	SNP	0.998	T
RPA3	6119	genome.wustl.edu	37	7	7713025	7713025	+	Intron	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:7713025C>A	ENST00000223129.4	-	4	415				RPA3-AS1_ENST00000469183.1_3'UTR	NM_002947.3	NP_002938.1	P35244	RFA3_HUMAN	replication protein A3, 14kDa						base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of cell proliferation (GO:0042127)|regulation of mitotic cell cycle (GO:0007346)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.202)		TTCAGAAAGCCTCCGGAATCT	0.448								Direct reversal of damage;Nucleotide excision repair (NER)																													Colon(148;376 1816 25359 26011 31717)												0																																										SO:0001627	intron_variant	0				CCDS5356.1	7p21.3	2013-09-23	2002-08-29		ENSG00000106399	ENSG00000106399			10291	protein-coding gene	gene with protein product		179837	"""replication protein A3 (14kD)"""			8454588	Standard	NM_002947		Approved	REPA3	uc003sri.3	P35244	OTTHUMG00000023748	ENST00000223129.4:c.756+12435G>T	7.37:g.7713025C>A			Q549U6	RNA	SNP	-	NULL	ENST00000223129.4	37	NULL	CCDS5356.1	7	.	.	.	.	.	.	.	.	.	.	C	15.35	2.806753	0.50421	.	.	ENSG00000219545	ENST00000433511	.	.	.	4.9	4.0	0.46444	.	.	.	.	.	T	0.51500	0.1678	.	.	.	0.20074	N	0.999937	D	0.56287	0.975	P	0.53062	0.717	T	0.41858	-0.9485	7	0.51188	T	0.08	.	12.575	0.56359	0.0:0.6026:0.3974:0.0	.	8	A4D104	.	H	8	.	ENSP00000399632:P8H	P	+	2	0	AC006465.3	7679550	0.550000	0.26489	0.320000	0.25306	0.849000	0.48306	1.928000	0.40104	1.388000	0.46506	0.650000	0.86243	CCT	RPA3-AS1	-	-	ENSG00000219545		0.448	RPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA3-AS1	HGNC	protein_coding	OTTHUMT00000324778.2	-	0.00	94	0	C	NM_002947		7713025	+1	tier1	-	no_errors	ENST00000463725	ensembl	human	known	74_37	rna	27.97	85	33	SNP	0.193	A
RRBP1	6238	genome.wustl.edu	37	20	17639256	17639256	+	Nonsense_Mutation	SNP	T	T	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:17639256T>A	ENST00000377813.1	-	3	2200	c.1897A>T	c.(1897-1899)Aaa>Taa	p.K633*	RRBP1_ENST00000377807.2_Nonsense_Mutation_p.K203*|RRBP1_ENST00000360807.4_Nonsense_Mutation_p.K203*|RRBP1_ENST00000455029.2_Intron|RRBP1_ENST00000246043.4_Nonsense_Mutation_p.K633*			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	633					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TCACCTTTTTTCTTTGAACCA	0.468																																																	0													170.0	151.0	158.0					20																	17639256		2203	4300	6503	SO:0001587	stop_gained	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.1897A>T	20.37:g.17639256T>A	ENSP00000367044:p.Lys633*		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Nonsense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.K633*	ENST00000377813.1	37	c.1897		20	.	.	.	.	.	.	.	.	.	.	T	40	8.382964	0.98786	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043	.	.	.	5.41	5.41	0.78517	.	0.000000	0.38005	N	0.001843	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-32.6544	14.5893	0.68351	0.0:0.0:0.0:1.0	.	.	.	.	X	203;633;203;633	.	ENSP00000246043:K633X	K	-	1	0	RRBP1	17587256	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.039000	0.57325	2.198000	0.70561	0.482000	0.46254	AAA	RRBP1	-	NULL	ENSG00000125844		0.468	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	-	0.00	69	0	T	NM_001042576		17639256	-1	tier1	-	no_errors	ENST00000246043	ensembl	human	known	74_37	nonsense	48.98	25	24	SNP	1.000	A
RPN2	6185	genome.wustl.edu	37	20	35827502	35827502	+	Missense_Mutation	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:35827502A>T	ENST00000237530.6	+	4	664	c.353A>T	c.(352-354)gAg>gTg	p.E118V	RPN2_ENST00000373622.5_Missense_Mutation_p.E86V	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	118					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GCTGTCAGTGAGGACTCATCT	0.468																																																	0													188.0	155.0	166.0					20																	35827502		2203	4300	6503	SO:0001583	missense	0			Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.353A>T	20.37:g.35827502A>T	ENSP00000237530:p.Glu118Val		Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	pfam_Swp1	p.E118V	ENST00000237530.6	37	c.353	CCDS13291.1	20	.	.	.	.	.	.	.	.	.	.	A	24.8	4.570593	0.86542	.	.	ENSG00000118705	ENST00000237530;ENST00000373622;ENST00000373632;ENST00000338768	T;T;T	0.52526	0.66;0.66;0.66	5.31	5.31	0.75309	.	0.051728	0.85682	D	0.000000	T	0.67711	0.2922	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.993;0.996;0.996	T	0.71527	-0.4566	10	0.72032	D	0.01	-12.8328	13.2663	0.60135	1.0:0.0:0.0:0.0	.	86;118;118	Q5JYR6;P04844;B2RE46	.;RPN2_HUMAN;.	V	118;86;118;118	ENSP00000237530:E118V;ENSP00000362724:E86V;ENSP00000362735:E118V	ENSP00000237530:E118V	E	+	2	0	RPN2	35260916	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.452000	0.90346	2.231000	0.72958	0.460000	0.39030	GAG	RPN2	-	pfam_Swp1	ENSG00000118705		0.468	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN2	HGNC	protein_coding	OTTHUMT00000079076.2	-	0.00	52	0	A	NM_002951		35827502	+1	tier1	-	no_errors	ENST00000237530	ensembl	human	known	74_37	missense	44.07	33	26	SNP	1.000	T
RUNX1T1	862	genome.wustl.edu	37	8	93017523	93017523	+	Silent	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:93017523G>T	ENST00000523629.1	-	6	1015	c.561C>A	c.(559-561)gcC>gcA	p.A187A	RUNX1T1_ENST00000396218.1_Silent_p.A160A|RUNX1T1_ENST00000521553.1_Silent_p.A150A|RUNX1T1_ENST00000436581.2_Silent_p.A198A|RUNX1T1_ENST00000360348.2_Silent_p.A150A|RUNX1T1_ENST00000265814.3_Silent_p.A187A|RUNX1T1_ENST00000422361.2_Silent_p.A150A|RUNX1T1_ENST00000520724.1_Silent_p.A150A|RUNX1T1_ENST00000518844.1_Silent_p.A160A	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	187	TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GGGGCAAGTTGGCCTGCAAGG	0.532																																																	0													94.0	77.0	83.0					8																	93017523		2203	4300	6503	SO:0001819	synonymous_variant	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.561C>A	8.37:g.93017523G>T			B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Silent	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.A198	ENST00000523629.1	37	c.594	CCDS6256.1	8																																																																																			RUNX1T1	-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1,prints_ETO	ENSG00000079102		0.532	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	-	0.00	26	0	G	NM_004349, NM_175635		93017523	-1	tier1	-	no_errors	ENST00000436581	ensembl	human	known	74_37	silent	25.00	24	8	SNP	1.000	T
S100A11	6282	genome.wustl.edu	37	1	152005018	152005018	+	3'UTR	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:152005018T>C	ENST00000271638.2	-	0	557				NBPF18P_ENST00000432386.1_RNA|S100A11_ENST00000478109.1_5'UTR	NM_005620.1	NP_005611.1	P31949	S10AB_HUMAN	S100 calcium binding protein A11						negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)			large_intestine(1)|lung(1)|prostate(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TTTATTACTATTGGCAGGTGG	0.458																																					Colon(152;1751 1834 12462 21158 46902)												0																																										SO:0001624	3_prime_UTR_variant	0			D38583	CCDS1009.1	1q21	2013-01-10	2006-09-11		ENSG00000163191	ENSG00000163191		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10488	protein-coding gene	gene with protein product		603114	"""S100 calcium-binding protein A11 (calgizzarin)"", ""S100 calcium binding protein A11 (calgizzarin)"""			8985590	Standard	NM_005620		Approved	S100C	uc001ezn.3	P31949	OTTHUMG00000013069	ENST00000271638.2:c.*120A>G	1.37:g.152005018T>C			Q5VTK0	RNA	SNP	-	NULL	ENST00000271638.2	37	NULL	CCDS1009.1	1																																																																																			S100A11	-	-	ENSG00000163191		0.458	S100A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A11	HGNC	protein_coding	OTTHUMT00000036676.1	-	0.00	33	0	T	NM_005620		152005018	-1	tier1	-	no_errors	ENST00000478109	ensembl	human	known	74_37	rna	15.00	34	6	SNP	0.000	C
SALL1	6299	genome.wustl.edu	37	16	51173964	51173964	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:51173964C>A	ENST00000251020.4	-	2	2202	c.2169G>T	c.(2167-2169)atG>atT	p.M723I	SALL1_ENST00000440970.1_Missense_Mutation_p.M626I|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	723					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCCTGTAGTGCATTTTCAAGG	0.512																																					GBM(103;1352 1446 1855 4775 8890)												0													62.0	62.0	62.0					16																	51173964		2198	4300	6498	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2169G>T	16.37:g.51173964C>A	ENSP00000251020:p.Met723Ile		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M723I	ENST00000251020.4	37	c.2169	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909364	0.72868	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07327	3.2;3.2	5.3	5.3	0.74995	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	N	0.11064	0.09	0.80722	D	1	P	0.42556	0.783	P	0.59948	0.866	T	0.39702	-0.9601	10	0.34782	T	0.22	.	19.0235	0.92923	0.0:1.0:0.0:0.0	.	723	Q9NSC2	SALL1_HUMAN	I	723;626;687	ENSP00000251020:M723I;ENSP00000407914:M626I	ENSP00000251020:M723I	M	-	3	0	SALL1	49731465	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.818000	0.86416	2.490000	0.84030	0.454000	0.30748	ATG	SALL1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000103449		0.512	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	71	0	C	NM_002968		51173964	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	59.46	15	22	SNP	1.000	A
SAP130	79595	genome.wustl.edu	37	2	128712725	128712725	+	Missense_Mutation	SNP	T	T	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:128712725T>C	ENST00000259235.3	-	15	2359	c.2230A>G	c.(2230-2232)Att>Gtt	p.I744V	SAP130_ENST00000259234.6_Missense_Mutation_p.I752V|SAP130_ENST00000357702.5_Missense_Mutation_p.I779V	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	744	Pro-rich.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		GCTCCAGGAATGGTTGAAAGG	0.607																																																	0													171.0	157.0	162.0					2																	128712725		2203	4300	6503	SO:0001583	missense	0			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.2230A>G	2.37:g.128712725T>C	ENSP00000259235:p.Ile744Val		B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NULL	p.I779V	ENST00000259235.3	37	c.2335	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527951	0.44969	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.21	4.04	0.47022	.	0.272597	0.37053	N	0.002274	T	0.33411	0.0862	N	0.19112	0.55	0.33272	D	0.561083	B;B;B;B	0.20671	0.047;0.047;0.047;0.047	B;B;B;B	0.19391	0.025;0.025;0.025;0.025	T	0.34204	-0.9838	9	0.07325	T	0.83	-3.0007	12.3042	0.54891	0.0:0.0:0.1417:0.8583	.	779;744;309;381	B7ZLM3;Q9H0E3;Q9H0E3-2;B3KRT9	.;SP130_HUMAN;.;.	V	779;744;752	.	ENSP00000259234:I752V	I	-	1	0	SAP130	128429195	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	2.597000	0.46214	0.812000	0.34326	0.514000	0.50259	ATT	SAP130	-	NULL	ENSG00000136715		0.607	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3	-	0.00	44	0	T	NM_024545		128712725	-1	tier1	-	no_errors	ENST00000357702	ensembl	human	known	74_37	missense	28.30	38	15	SNP	1.000	C
SART3	9733	genome.wustl.edu	37	12	108923976	108923976	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:108923976G>A	ENST00000228284.3	-	15	2092	c.1858C>T	c.(1858-1860)Cca>Tca	p.P620S	SART3_ENST00000431469.2_Missense_Mutation_p.P584S	NM_014706.3	NP_055521.1	Q15020	SART3_HUMAN	squamous cell carcinoma antigen recognized by T cells 3	620	Required for nuclear localization.				cell morphogenesis (GO:0000902)|hematopoietic stem cell proliferation (GO:0071425)|homeostasis of number of cells (GO:0048872)|regulation of gene expression (GO:0010468)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|stomach(1)	25						CGCTTCTCTGGGCCTCTGATC	0.458									Porokeratosis																																								0													183.0	161.0	169.0					12																	108923976		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl.: Porokeratosis of Mibelli, Disseminated Superficial Actinic Porokertosis, Porokeratosis Palmaris Plantaris et Disseminata, Porokeratosis Punctata Palmaris et Plantaris, Linear Porokeratosis	AB020880	CCDS9117.1	12q24.11	2013-02-12	2006-12-07			ENSG00000075856		"""RNA binding motif (RRM) containing"""	16860	protein-coding gene	gene with protein product		611684	"""squamous cell carcinoma antigen recognised by T cells 3"""			12032085, 15840095, 20595234	Standard	NM_014706		Approved	KIAA0156, RP11-13G14, TIP110, p110	uc001tmz.1	Q15020	OTTHUMG00000169449	ENST00000228284.3:c.1858C>T	12.37:g.108923976G>A	ENSP00000228284:p.Pro620Ser		A8K2E4|Q2M2H0|Q58F06|Q8IUS1|Q96J95	Missense_Mutation	SNP	pfam_RRM_dom,pfam_LSM_interact,smart_HAT,smart_RRM_dom,pfscan_RRM_dom	p.P620S	ENST00000228284.3	37	c.1858	CCDS9117.1	12	.	.	.	.	.	.	.	.	.	.	G	2.166	-0.390919	0.04932	.	.	ENSG00000075856	ENST00000228284;ENST00000431469;ENST00000535329;ENST00000412617;ENST00000546815	T;T;T	0.56444	2.47;2.42;0.46	5.79	0.861	0.19048	.	0.904892	0.09674	N	0.770773	T	0.25269	0.0614	N	0.08118	0	0.09310	N	0.999994	B;B;B;B	0.12630	0.0;0.005;0.001;0.006	B;B;B;B	0.15052	0.001;0.012;0.003;0.005	T	0.22871	-1.0204	10	0.11485	T	0.65	1.6652	3.5237	0.07752	0.1158:0.5697:0.1195:0.1949	.	568;638;584;620	E7EMI4;F8VV04;B7ZKM0;Q15020	.;.;.;SART3_HUMAN	S	620;584;196;568;638	ENSP00000228284:P620S;ENSP00000414453:P584S;ENSP00000449386:P638S	ENSP00000228284:P620S	P	-	1	0	SART3	107448106	0.006000	0.16342	0.000000	0.03702	0.129000	0.20672	1.758000	0.38410	-0.103000	0.12175	-0.867000	0.03001	CCA	SART3	-	NULL	ENSG00000075856		0.458	SART3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SART3	HGNC	protein_coding	OTTHUMT00000404094.1	-	0.00	30	0	G			108923976	-1	tier1	-	no_errors	ENST00000228284	ensembl	human	known	74_37	missense	75.00	6	18	SNP	0.008	A
SATL1	340562	genome.wustl.edu	37	X	84363348	84363348	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chrX:84363348G>T	ENST00000395409.3	-	1	626	c.66C>A	c.(64-66)agC>agA	p.S22R	SATL1_ENST00000509231.1_Missense_Mutation_p.S209R|SATL1_ENST00000332921.5_Missense_Mutation_p.S22R			Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	22	Gln-rich.						N-acetyltransferase activity (GO:0008080)			NS(1)|breast(5)|endometrium(2)|large_intestine(3)|lung(13)|skin(3)|stomach(1)|urinary_tract(1)	29						TGTCTGGGTGGCTTGGGACTT	0.552																																																	0													224.0	150.0	175.0					X																	84363348		2203	4300	6503	SO:0001583	missense	0			BC043215	CCDS35343.1, CCDS35343.2	Xq21	2008-02-05			ENSG00000184788	ENSG00000184788			27992	protein-coding gene	gene with protein product						12477932	Standard	NM_001012980		Approved		uc004een.3	Q86VE3	OTTHUMG00000021931	ENST00000395409.3:c.66C>A	X.37:g.84363348G>T	ENSP00000378804:p.Ser22Arg		A0AVK7|E9PB72|Q5H8V9	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.S209R	ENST00000395409.3	37	c.627		X	.	.	.	.	.	.	.	.	.	.	-	2.292	-0.362317	0.05103	.	.	ENSG00000184788	ENST00000395409;ENST00000332921;ENST00000509231	T;T;T	0.47869	0.83;0.83;0.83	3.36	-0.174	0.13319	.	.	.	.	.	T	0.31389	0.0795	L	0.42245	1.32	0.09310	N	1	B;B	0.16603	0.01;0.018	B;B	0.10450	0.002;0.005	T	0.23904	-1.0175	9	0.20046	T	0.44	.	2.5537	0.04755	0.1159:0.1575:0.501:0.2256	.	22;209	Q86VE3;E9PB72	SATL1_HUMAN;.	R	22;22;209	ENSP00000378804:S22R;ENSP00000329115:S22R;ENSP00000425421:S209R	ENSP00000329115:S22R	S	-	3	2	SATL1	84250004	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-2.477000	0.00985	-0.312000	0.08741	0.431000	0.28591	AGC	SATL1	-	NULL	ENSG00000184788		0.552	SATL1-202	KNOWN	basic|appris_principal	protein_coding	SATL1	HGNC	protein_coding		-	0.00	66	0	G	XM_291339		84363348	-1	tier1	-	no_errors	ENST00000509231	ensembl	human	known	74_37	missense	55.26	34	42	SNP	0.019	T
SCAP	22937	genome.wustl.edu	37	3	47469124	47469124	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr3:47469124C>T	ENST00000265565.5	-	5	856	c.444G>A	c.(442-444)ctG>ctA	p.L148L	SCAP_ENST00000441517.2_Intron|SCAP_ENST00000545718.1_Intron	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone	148					aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CGGTCACTTGCAGACACAACT	0.582																																					Pancreas(149;978 1908 29304 37806 46700)												0													65.0	59.0	61.0					3																	47469124		2203	4300	6503	SO:0001819	synonymous_variant	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.444G>A	3.37:g.47469124C>T			Q8N2E0|Q8WUA1	Silent	SNP	pfam_Patched,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_SSD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L148	ENST00000265565.5	37	c.444	CCDS2755.2	3																																																																																			SCAP	-	NULL	ENSG00000114650		0.582	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	HGNC	protein_coding	OTTHUMT00000246872.2	-	0.00	45	0	C	NM_012235		47469124	-1	tier1	-	no_errors	ENST00000265565	ensembl	human	known	74_37	silent	14.29	24	4	SNP	1.000	T
SCYL1	57410	genome.wustl.edu	37	11	65293808	65293808	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr11:65293808G>T	ENST00000270176.5	+	4	666	c.589G>T	c.(589-591)Gtc>Ttc	p.V197F	SCYL1_ENST00000279270.6_Missense_Mutation_p.V197F|SCYL1_ENST00000527009.1_Missense_Mutation_p.V54F|SCYL1_ENST00000524944.1_Missense_Mutation_p.V197F|SCYL1_ENST00000533862.1_Missense_Mutation_p.V197F|SCYL1_ENST00000420247.2_Missense_Mutation_p.V197F|SCYL1_ENST00000525364.1_Missense_Mutation_p.V197F	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						TGGCAGAGTGGTCAGAGAGAA	0.662																																																	0													19.0	22.0	21.0					11																	65293808		2103	4227	6330	SO:0001583	missense	0			AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.589G>T	11.37:g.65293808G>T	ENSP00000270176:p.Val197Phe		A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	p.V197F	ENST00000270176.5	37	c.589	CCDS41672.1	11	.	.	.	.	.	.	.	.	.	.	G	0.759	-0.769812	0.02974	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000417543;ENST00000527009	T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;2.21	4.82	3.88	0.44766	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.002470	0.08037	N	0.994527	T	0.49881	0.1583	L	0.39245	1.2	0.09310	N	1	B;B;B;B	0.13594	0.003;0.008;0.0;0.006	B;B;B;B	0.15870	0.013;0.014;0.003;0.013	T	0.38222	-0.9671	10	0.09338	T	0.73	-15.3039	8.0372	0.30499	0.0:0.1756:0.6431:0.1814	.	197;197;197;197	E9PS17;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;NTKL_HUMAN	F	197;197;197;197;197;197;197;197;197;54	ENSP00000270176:V197F;ENSP00000431635:V197F;ENSP00000408192:V197F;ENSP00000437254:V197F;ENSP00000433450:V197F;ENSP00000279270:V197F;ENSP00000432175:V197F;ENSP00000436993:V54F	ENSP00000270176:V197F	V	+	1	0	SCYL1	65050384	0.000000	0.05858	0.009000	0.14445	0.710000	0.40934	0.335000	0.19806	0.976000	0.38417	0.561000	0.74099	GTC	SCYL1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,pfscan_Prot_kinase_dom	ENSG00000142186		0.662	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL1	HGNC	protein_coding	OTTHUMT00000389159.2	-	0.00	33	0	G	NM_020680		65293808	+1	tier1	-	no_errors	ENST00000270176	ensembl	human	known	74_37	missense	17.95	32	7	SNP	0.002	T
SEMA3D	223117	genome.wustl.edu	37	7	84670056	84670056	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:84670056C>G	ENST00000284136.6	-	9	1022	c.979G>C	c.(979-981)Gat>Cat	p.D327H	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	327	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						AAATAAATATCTTCTATTAAA	0.284																																					Ovarian(63;442 1191 17318 29975 31528)												0													41.0	45.0	44.0					7																	84670056		2202	4295	6497	SO:0001583	missense	0			BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.979G>C	7.37:g.84670056C>G	ENSP00000284136:p.Asp327His		A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.D327H	ENST00000284136.6	37	c.979	CCDS34676.1	7	.	.	.	.	.	.	.	.	.	.	C	23.6	4.441430	0.83993	.	.	ENSG00000153993	ENST00000284136	T	0.26957	1.7	5.52	5.52	0.82312	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.082530	0.85682	D	0.000000	T	0.51736	0.1692	M	0.64676	1.99	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50516	-0.8819	10	0.87932	D	0	.	19.8046	0.96525	0.0:1.0:0.0:0.0	.	327	O95025	SEM3D_HUMAN	H	327	ENSP00000284136:D327H	ENSP00000284136:D327H	D	-	1	0	SEMA3D	84507992	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.583000	0.82559	2.754000	0.94517	0.650000	0.86243	GAT	SEMA3D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000153993		0.284	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3D	HGNC	protein_coding	OTTHUMT00000336084.2	-	0.00	48	0	C	NM_152754		84670056	-1	tier1	-	no_errors	ENST00000284136	ensembl	human	known	74_37	missense	21.62	29	8	SNP	1.000	G
SEPHS1	22929	genome.wustl.edu	37	10	13364865	13364865	+	Missense_Mutation	SNP	G	G	C			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:13364865G>C	ENST00000327347.5	-	8	1309	c.934C>G	c.(934-936)Ctc>Gtc	p.L312V	SEPHS1_ENST00000378614.4_Intron|SEPHS1_ENST00000545675.1_Missense_Mutation_p.L312V|SEPHS1_ENST00000537130.1_Missense_Mutation_p.L245V	NM_001195602.1|NM_012247.4	NP_001182531.1|NP_036379.2	P49903	SPS1_HUMAN	selenophosphate synthetase 1	312					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|selenide, water dikinase activity (GO:0004756)			cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|stomach(1)	16						CCGTGCATGAGGCCGAACATG	0.572																																																	0													52.0	44.0	47.0					10																	13364865		2203	4300	6503	SO:0001583	missense	0			BC000941	CCDS7098.1, CCDS55702.1, CCDS55703.1	10p14	2006-10-06			ENSG00000086475	ENSG00000086475			19685	protein-coding gene	gene with protein product		600902				7665581	Standard	NM_012247		Approved	SPS, SPS1	uc001imk.3	P49903	OTTHUMG00000017696	ENST00000327347.5:c.934C>G	10.37:g.13364865G>C	ENSP00000367893:p.Leu312Val		B4DWK0|D3DRS9|D6PSQ9|Q5T5U8|Q5T5U9|Q9BVT4	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.L312V	ENST00000327347.5	37	c.934	CCDS7098.1	10	.	.	.	.	.	.	.	.	.	.	G	28.9	4.956642	0.92726	.	.	ENSG00000086475	ENST00000327347;ENST00000545675;ENST00000537130	T;T;T	0.61980	0.9;0.06;0.9	5.09	5.09	0.68999	AIR synthase-related protein, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.80341	0.4605	M	0.78456	2.415	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.998;0.998;0.998;0.997	T	0.81529	-0.0891	10	0.52906	T	0.07	-12.6984	18.8485	0.92217	0.0:0.0:1.0:0.0	.	264;312;312;312;245	B4DLS1;P49903;D6PSQ9;D3DRS9;B4DWK0	.;SPS1_HUMAN;.;.;.	V	312;312;245	ENSP00000367893:L312V;ENSP00000441119:L312V;ENSP00000442768:L245V	ENSP00000367893:L312V	L	-	1	0	SEPHS1	13404871	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.848000	0.99507	2.517000	0.84864	0.561000	0.74099	CTC	SEPHS1	-	pfam_AIR_synth_C_dom,superfamily_AIR_synth_C_dom,pirsf_SelD,tigrfam_SelD	ENSG00000086475		0.572	SEPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPHS1	HGNC	protein_coding	OTTHUMT00000046856.1	-	0.00	34	0	G	NM_012247		13364865	-1	tier1	-	no_errors	ENST00000327347	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	C
SHROOM3	57619	genome.wustl.edu	37	4	77691999	77691999	+	Missense_Mutation	SNP	G	G	T	rs376718092		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:77691999G>T	ENST00000296043.6	+	10	6523	c.5570G>T	c.(5569-5571)cGt>cTt	p.R1857L	RP11-359D14.3_ENST00000449007.1_RNA	NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	1857	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CGTCTAGCCCGTGTTGAGAAT	0.517																																																	0													126.0	126.0	126.0					4																	77691999		2203	4300	6503	SO:0001583	missense	0			AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.5570G>T	4.37:g.77691999G>T	ENSP00000296043:p.Arg1857Leu		Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R1857L	ENST00000296043.6	37	c.5570	CCDS3579.2	4	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790953	0.90367	.	.	ENSG00000138771	ENST00000296043	T	0.53423	0.62	5.53	5.53	0.82687	Apx/shroom, ASD2 (2);	0.000000	0.64402	D	0.000001	T	0.74015	0.3661	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77086	-0.2718	10	0.87932	D	0	-14.9629	19.6591	0.95857	0.0:0.0:1.0:0.0	.	1857	Q8TF72	SHRM3_HUMAN	L	1857	ENSP00000296043:R1857L	ENSP00000296043:R1857L	R	+	2	0	SHROOM3	77911023	1.000000	0.71417	0.972000	0.41901	0.456000	0.32438	9.657000	0.98554	2.879000	0.98667	0.650000	0.86243	CGT	SHROOM3	-	pfam_ASD2	ENSG00000138771		0.517	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM3	HGNC	protein_coding	OTTHUMT00000252408.2		0.00	30	0	G	NM_020859		77691999	+1			no_errors	ENST00000296043	ensembl	human	known	74_37	missense	12.50	14	2	SNP	1.000	T
SIPA1L1	26037	genome.wustl.edu	37	14	72055491	72055491	+	Missense_Mutation	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:72055491A>G	ENST00000555818.1	+	2	1250	c.902A>G	c.(901-903)aAt>aGt	p.N301S	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.N301S|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.N301S	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	301					actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		AAATTGCGCAATGCCAAAGGT	0.438																																																	0													67.0	71.0	70.0					14																	72055491		2203	4300	6503	SO:0001583	missense	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.902A>G	14.37:g.72055491A>G	ENSP00000450832:p.Asn301Ser		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.N301S	ENST00000555818.1	37	c.902	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	A	2.117	-0.402303	0.04865	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550	T;T;T	0.39787	1.06;1.06;1.06	6.07	6.07	0.98685	.	0.078520	0.85682	D	0.000000	T	0.23572	0.0570	N	0.05383	-0.06	0.80722	D	1	B;B;B	0.25521	0.025;0.104;0.128	B;B;B	0.24155	0.02;0.051;0.039	T	0.13308	-1.0514	10	0.07175	T	0.84	-34.3801	16.6406	0.85098	1.0:0.0:0.0:0.0	.	301;301;301	A6H8W6;O43166-2;O43166	.;.;SI1L1_HUMAN	S	301	ENSP00000370630:N301S;ENSP00000450832:N301S;ENSP00000351352:N301S	ENSP00000351352:N301S	N	+	2	0	SIPA1L1	71125244	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	5.638000	0.67861	2.326000	0.78906	0.533000	0.62120	AAT	SIPA1L1	-	NULL	ENSG00000197555		0.438	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1		0.00	39	0	A	NM_015556		72055491	+1			no_errors	ENST00000555818	ensembl	human	known	74_37	missense	11.76	15	2	SNP	1.000	G
SLC16A6P1	440459	genome.wustl.edu	37	17	62950487	62950487	+	RNA	SNP	A	A	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:62950487A>T	ENST00000577423.1	+	0	817									SLC16A6 pseudogene 1																		TTGGAACAACAGGAGGGACCC	0.448																																																	0																																												0					17q24.1	2013-07-15			ENSG00000232457	ENSG00000232457			48932	pseudogene	pseudogene							Standard	NG_012727		Approved				OTTHUMG00000179314		17.37:g.62950487A>T				RNA	SNP	-	NULL	ENST00000577423.1	37	NULL		17																																																																																			SLC16A6P1	-	-	ENSG00000232457		0.448	SLC16A6P1-001	KNOWN	basic	processed_transcript	SLC16A6P1	HGNC	pseudogene	OTTHUMT00000445717.1	-	0.00	87	0	A			62950487	+1	tier1	-	no_errors	ENST00000577423	ensembl	human	known	74_37	rna	23.42	85	26	SNP	0.931	T
SLC22A7	10864	genome.wustl.edu	37	6	43266909	43266909	+	Intron	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:43266909G>A	ENST00000372585.5	+	2	494				SLC22A7_ENST00000372589.3_Intron|SLC22A7_ENST00000372574.3_Intron|SLC22A7_ENST00000487175.1_Intron	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7						organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GCAGGTCGAGGCCTTCCTTGG	0.542																																																	0													44.0	43.0	43.0					6																	43266909		692	1591	2283	SO:0001627	intron_variant	0			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.399+74G>A	6.37:g.43266909G>A			B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Missense_Mutation	SNP	NULL	p.G158D	ENST00000372585.5	37	c.473	CCDS4893.2	6	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672817	0.29693	.	.	ENSG00000137204	ENST00000449231	T	0.51071	0.72	4.05	-0.568	0.11760	.	.	.	.	.	T	0.14743	0.0356	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32719	-0.9896	6	0.23891	T	0.37	.	7.0578	0.25109	0.5061:0.0:0.4939:0.0	.	.	.	.	D	158	ENSP00000411818:G158D	ENSP00000411818:G158D	G	+	2	0	SLC22A7	43374887	0.000000	0.05858	0.000000	0.03702	0.051000	0.14879	-0.690000	0.05138	-0.263000	0.09378	-0.495000	0.04643	GGC	SLC22A7	-	NULL	ENSG00000137204		0.542	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	HGNC	protein_coding	OTTHUMT00000040588.1	-	0.00	34	0	G			43266909	+1	tier1	-	no_errors	ENST00000498232	ensembl	human	known	74_37	missense	11.63	38	5	SNP	0.000	A
SLC29A1	2030	genome.wustl.edu	37	6	44199101	44199101	+	Splice_Site	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:44199101G>T	ENST00000393841.1	+	10	1258	c.767G>T	c.(766-768)gGa>gTa	p.G256V	SLC29A1_ENST00000427851.2_Splice_Site_p.G256V|SLC29A1_ENST00000371724.1_Splice_Site_p.G256V|SLC29A1_ENST00000371708.1_Splice_Site_p.G256V|SLC29A1_ENST00000313248.7_Splice_Site_p.G335V|SLC29A1_ENST00000393844.1_Splice_Site_p.G256V|SLC29A1_ENST00000371731.1_Splice_Site_p.G256V|SLC29A1_ENST00000371755.3_Splice_Site_p.G256V|SLC29A1_ENST00000371740.5_Splice_Site_p.G256V|SLC29A1_ENST00000371713.1_Splice_Site_p.G256V|SLC29A1_ENST00000472176.1_3'UTR	NM_001078177.1	NP_001071645.1	Q99808	S29A1_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 1	256					cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|lactation (GO:0007595)|nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sleep (GO:0030431)|transmembrane transport (GO:0055085)|uridine transport (GO:0015862)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(2)	17	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)		Cytarabine(DB00987)|Didanosine(DB00900)|Fludarabine(DB01073)|Fluorouracil(DB00544)|Gemcitabine(DB00441)|Mercaptopurine(DB01033)|Pemetrexed(DB00642)|Ribavirin(DB00811)|Zalcitabine(DB00943)	CATCCCGCAGGAGAGGAGCCA	0.473																																																	0													65.0	58.0	60.0					6																	44199101		2203	4299	6502	SO:0001630	splice_region_variant	0			U81375	CCDS4908.1	6p21.1	2013-07-17	2013-07-17		ENSG00000112759	ENSG00000112759		"""Solute carriers"""	11003	protein-coding gene	gene with protein product		602193	"""solute carrier family 29 (nucleoside transporters), member 1"""	ENT1		8986748, 9344680	Standard	NM_004955		Approved		uc003owy.2	Q99808	OTTHUMG00000014759	ENST00000393841.1:c.767-1G>T	6.37:g.44199101G>T			B3KQV7|B3KQY5|Q5T9W9|Q9UJY2	Missense_Mutation	SNP	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt,tigrfam_Eqnu_transpt	p.G335V	ENST00000393841.1	37	c.1004	CCDS4908.1	6	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756923	0.89843	.	.	ENSG00000112759	ENST00000393844;ENST00000313248;ENST00000427851;ENST00000371755;ENST00000371740;ENST00000371731;ENST00000393841;ENST00000371724;ENST00000371713;ENST00000371708	T;T;T;T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.13	4.26	0.50523	.	0.903670	0.09540	N	0.788394	T	0.55800	0.1943	L	0.39326	1.205	0.80722	D	1	D;D	0.58268	0.97;0.982	P;P	0.59288	0.78;0.855	T	0.50931	-0.8769	9	.	.	.	.	9.9692	0.41743	0.0948:0.0:0.9052:0.0	.	335;256	B3KQV7;Q99808	.;S29A1_HUMAN	V	256;335;256;256;256;256;256;256;256;256	ENSP00000377427:G256V;ENSP00000319152:G335V;ENSP00000392668:G256V;ENSP00000360820:G256V;ENSP00000360805:G256V;ENSP00000360796:G256V;ENSP00000377424:G256V;ENSP00000360789:G256V;ENSP00000360778:G256V;ENSP00000360773:G256V	.	G	+	2	0	SLC29A1	44307079	1.000000	0.71417	0.992000	0.48379	0.794000	0.44872	4.333000	0.59285	1.306000	0.44926	0.655000	0.94253	GGA	SLC29A1	-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,tigrfam_Eqnu_transpt	ENSG00000112759		0.473	SLC29A1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A1	HGNC	protein_coding	OTTHUMT00000040721.1	-	0.00	127	0	G		Missense_Mutation	44199101	+1	tier1	-	no_errors	ENST00000313248	ensembl	human	known	74_37	missense	40.85	42	29	SNP	1.000	T
SLC7A6	9057	genome.wustl.edu	37	16	68325543	68325543	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:68325543C>A	ENST00000566454.1	+	8	1270	c.1001C>A	c.(1000-1002)gCa>gAa	p.A334E	SLC7A6_ENST00000219343.6_Missense_Mutation_p.A334E	NM_001076785.2	NP_001070253.1			solute carrier family 7 (amino acid transporter light chain, y+L system), member 6											breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.0948)		GGCCTCAATGCATCCATCTTT	0.493																																																	0													304.0	256.0	272.0					16																	68325543		2198	4300	6498	SO:0001583	missense	0			D87432	CCDS32470.1	16q22.1	2013-07-15	2011-07-12		ENSG00000103064	ENSG00000103064		"""Solute carriers"""	11064	protein-coding gene	gene with protein product		605641				9878049	Standard	NM_001076785		Approved	y+LAT-2, KIAA0245, LAT3, LAT-2	uc002evu.2	Q92536	OTTHUMG00000176544	ENST00000566454.1:c.1001C>A	16.37:g.68325543C>A	ENSP00000455064:p.Ala334Glu			Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.A334E	ENST00000566454.1	37	c.1001	CCDS32470.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.145202	0.94603	.	.	ENSG00000103064	ENST00000219343	D	0.90563	-2.69	5.09	5.09	0.68999	Amino acid permease domain (1);	0.104843	0.64402	D	0.000004	D	0.94601	0.8260	M	0.78456	2.415	0.80722	D	1	D	0.57571	0.98	P	0.62184	0.899	D	0.95150	0.8272	10	0.87932	D	0	.	16.3364	0.83064	0.0:1.0:0.0:0.0	.	334	Q92536	YLAT2_HUMAN	E	334	ENSP00000219343:A334E	ENSP00000219343:A334E	A	+	2	0	SLC7A6	66883044	1.000000	0.71417	0.985000	0.45067	0.985000	0.73830	7.506000	0.81665	2.518000	0.84900	0.655000	0.94253	GCA	SLC7A6	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	ENSG00000103064		0.493	SLC7A6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC7A6	HGNC	protein_coding	OTTHUMT00000432466.1	-	0.00	135	0	C	NM_003983		68325543	+1	tier1	-	no_errors	ENST00000219343	ensembl	human	known	74_37	missense	5.88	63	4	SNP	1.000	A
SOCS6	9306	genome.wustl.edu	37	18	67993381	67993381	+	Silent	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr18:67993381C>A	ENST00000397942.3	+	2	1793	c.1477C>A	c.(1477-1479)Cgg>Agg	p.R493R	SOCS6_ENST00000582322.1_Silent_p.R493R	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	493	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				CCCAGTGTCCCGGTTCATGCA	0.463																																					Melanoma(84;1024 1361 24382 36583 42651)												0													103.0	91.0	95.0					18																	67993381		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.1477C>A	18.37:g.67993381C>A			Q8WUM3	Silent	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.R493	ENST00000397942.3	37	c.1477	CCDS11998.1	18																																																																																			SOCS6	-	smart_SOCS_C,pfscan_SOCS_C	ENSG00000170677		0.463	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2		0.00	85	0	C			67993381	+1			no_errors	ENST00000397942	ensembl	human	known	74_37	silent	5.00	37	2	SNP	0.997	A
SP1	6667	genome.wustl.edu	37	12	53800472	53800472	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:53800472C>T	ENST00000327443.4	+	4	1877	c.1779C>T	c.(1777-1779)ccC>ccT	p.P593P	SP1_ENST00000426431.2_Silent_p.P586P	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	593	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		ATGCCCAACCCCAAGCCGGTC	0.537																																																	0													64.0	65.0	65.0					12																	53800472		2203	4300	6503	SO:0001819	synonymous_variant	0			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1779C>T	12.37:g.53800472C>T			E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P593	ENST00000327443.4	37	c.1779	CCDS8857.1	12																																																																																			SP1	-	NULL	ENSG00000185591		0.537	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP1	HGNC	protein_coding	OTTHUMT00000407044.1	-	0.00	48	0	C			53800472	+1	tier1	-	no_errors	ENST00000327443	ensembl	human	known	74_37	silent	47.83	24	22	SNP	1.000	T
SPACA7	122258	genome.wustl.edu	37	13	113055455	113055455	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr13:113055455G>T	ENST00000283550.3	+	5	489	c.422G>T	c.(421-423)aGt>aTt	p.S141I	SPACA7_ENST00000375699.3_Missense_Mutation_p.S110I	NM_145248.4	NP_660291.2	Q96KW9	SPAC7_HUMAN	sperm acrosome associated 7	141						acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)				large_intestine(5)|lung(4)|skin(3)|urinary_tract(1)	13						tctcctggcagtgagaagagt	0.493																																																	0													134.0	119.0	124.0					13																	113055455		2203	4300	6503	SO:0001583	missense	0			BC016750	CCDS9524.1	13q34	2013-10-11	2011-03-15	2011-03-15	ENSG00000153498	ENSG00000153498			29575	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 28"""	C13orf28		22495889	Standard	NM_145248		Approved		uc001vsd.2	Q96KW9	OTTHUMG00000017365	ENST00000283550.3:c.422G>T	13.37:g.113055455G>T	ENSP00000283550:p.Ser141Ile		Q5T8L1	Missense_Mutation	SNP	NULL	p.S141I	ENST00000283550.3	37	c.422	CCDS9524.1	13	.	.	.	.	.	.	.	.	.	.	G	11.85	1.761938	0.31228	.	.	ENSG00000153498	ENST00000283550;ENST00000375699	T;T	0.53423	0.65;0.62	2.52	-4.77	0.03219	.	.	.	.	.	T	0.22975	0.0555	N	0.19112	0.55	0.09310	N	1	P	0.35821	0.523	B	0.32724	0.151	T	0.10660	-1.0620	9	0.59425	D	0.04	-1.4936	1.1788	0.01841	0.432:0.1518:0.263:0.1531	.	141	Q96KW9	SPAC7_HUMAN	I	141;110	ENSP00000283550:S141I;ENSP00000364851:S110I	ENSP00000283550:S141I	S	+	2	0	SPACA7	112103456	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.027000	0.12371	-1.519000	0.01775	-1.108000	0.02087	AGT	SPACA7	-	NULL	ENSG00000153498		0.493	SPACA7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPACA7	HGNC	protein_coding	OTTHUMT00000045820.2	-	0.00	67	0	G	NM_145248		113055455	+1	tier1	-	no_errors	ENST00000283550	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.000	T
SPATS2L	26010	genome.wustl.edu	37	2	201281148	201281148	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:201281148G>T	ENST00000358677.5	+	5	442	c.195G>T	c.(193-195)aaG>aaT	p.K65N	SPATS2L_ENST00000409718.1_Missense_Mutation_p.K65N|SPATS2L_ENST00000409140.3_Missense_Mutation_p.K65N|SPATS2L_ENST00000360760.5_Missense_Mutation_p.K65N|SPATS2L_ENST00000451764.2_Missense_Mutation_p.K65N|SPATS2L_ENST00000409385.1_Missense_Mutation_p.K5N|SPATS2L_ENST00000409988.3_Missense_Mutation_p.K65N|SPATS2L_ENST00000409755.3_Missense_Mutation_p.K95N|SPATS2L_ENST00000409151.1_Missense_Mutation_p.K73N	NM_001282735.1|NM_001282743.1|NM_001282744.1|NM_015535.2	NP_001269664.1|NP_001269672.1|NP_001269673.1|NP_056350.2	Q9NUQ6	SPS2L_HUMAN	spermatogenesis associated, serine-rich 2-like	65						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	10						CAGGAAAAAAGAAGGTAAGAT	0.303																																																	0													84.0	78.0	80.0					2																	201281148		1806	4065	5871	SO:0001583	missense	0			AF193059	CCDS46483.1, CCDS46484.1, CCDS74621.1, CCDS74622.1	2q33.1	2009-06-12			ENSG00000196141	ENSG00000196141			24574	protein-coding gene	gene with protein product	"""DNA polymerase transactivated protein 6"""	613817				11230166	Standard	NM_001100422		Approved	DNAPTP6	uc002uvr.4	Q9NUQ6	OTTHUMG00000154589	ENST00000358677.5:c.195G>T	2.37:g.201281148G>T	ENSP00000351503:p.Lys65Asn		A8K381|B4DRE6|B4DT67|B7WNZ7|Q53T22|Q8WV53|Q8WYG1|Q9NTW4	Missense_Mutation	SNP	pfam_DUF1387,superfamily_UBA-like	p.K95N	ENST00000358677.5	37	c.285	CCDS46483.1	2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202566	0.79127	.	.	ENSG00000196141	ENST00000439084;ENST00000409718;ENST00000358677;ENST00000409988;ENST00000409385;ENST00000439395;ENST00000451764;ENST00000360760;ENST00000423749;ENST00000457757;ENST00000453663;ENST00000409140;ENST00000409397;ENST00000409755;ENST00000409151;ENST00000421573;ENST00000449647;ENST00000438761	.	.	.	5.4	5.4	0.78164	UBA-like (1);	0.000000	0.64402	D	0.000006	T	0.75347	0.3837	M	0.61703	1.905	0.52501	D	0.99995	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.87578	0.998;0.997;0.994	T	0.77397	-0.2603	9	0.87932	D	0	-22.1926	12.1909	0.54270	0.0787:0.0:0.9213:0.0	.	95;65;65	B4DT67;Q9NUQ6-2;Q9NUQ6	.;.;SPS2L_HUMAN	N	65;65;65;65;5;65;65;65;65;65;65;65;65;95;73;65;65;60	.	ENSP00000351503:K65N	K	+	3	2	SPATS2L	200989393	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.109000	0.71528	2.521000	0.84997	0.650000	0.86243	AAG	SPATS2L	-	pfam_DUF1387,superfamily_UBA-like	ENSG00000196141		0.303	SPATS2L-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATS2L	HGNC	protein_coding	OTTHUMT00000336208.3	-	0.00	60	0	G	NM_015535		201281148	+1	tier1	-	no_errors	ENST00000409755	ensembl	human	known	74_37	missense	20.00	44	11	SNP	1.000	T
SRSF11	9295	genome.wustl.edu	37	1	70716996	70716996	+	3'UTR	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr1:70716996A>G	ENST00000370950.3	+	0	2045				SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370949.1_3'UTR|SRSF11_ENST00000370951.1_3'UTR			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						TTATAGTTACATCTGGAAATG	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.*508A>G	1.37:g.70716996A>G			Q5T758|Q8IWE6	RNA	SNP	-	NULL	ENST00000370950.3	37	NULL	CCDS647.1	1																																																																																			SRSF11	-	-	ENSG00000116754		0.313	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRSF11	HGNC	protein_coding	OTTHUMT00000025889.1	-	0.00	93	0	A	NM_004768		70716996	+1	tier1	-	no_errors	ENST00000461935	ensembl	human	known	74_37	rna	26.23	45	16	SNP	1.000	G
STK39	27347	genome.wustl.edu	37	2	168811130	168811130	+	3'UTR	SNP	T	T	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:168811130T>G	ENST00000355999.4	-	0	3219				STK39_ENST00000487143.1_5'UTR	NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39						cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						GAAGCAAAACTTAACATATGC	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.*876A>C	2.37:g.168811130T>G			O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	RNA	SNP	-	NULL	ENST00000355999.4	37	NULL	CCDS42770.1	2																																																																																			STK39	-	-	ENSG00000198648		0.378	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK39	HGNC	protein_coding	OTTHUMT00000258112.2	-	0.00	29	0	T	NM_013233		168811130	-1	tier1	-	no_errors	ENST00000487143	ensembl	human	known	74_37	rna	57.69	11	15	SNP	0.937	G
SSFA2	6744	genome.wustl.edu	37	2	182766967	182766967	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr2:182766967G>T	ENST00000431877.2	+	8	1366	c.1187G>T	c.(1186-1188)aGt>aTt	p.S396I	SSFA2_ENST00000320370.7_Missense_Mutation_p.S396I|SSFA2_ENST00000409001.1_Missense_Mutation_p.S396I|SSFA2_ENST00000428267.2_Missense_Mutation_p.S243I	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	396						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			AATGAACAAAGTAAAGAAACT	0.373																																																	0													66.0	71.0	69.0					2																	182766967		2200	4299	6499	SO:0001583	missense	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.1187G>T	2.37:g.182766967G>T	ENSP00000388731:p.Ser396Ile		A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Missense_Mutation	SNP	NULL	p.S396I	ENST00000431877.2	37	c.1187	CCDS46467.1	2	.	.	.	.	.	.	.	.	.	.	G	12.30	1.895216	0.33442	.	.	ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267	T;T;T;T	0.15834	2.62;2.39;2.62;2.62	5.61	-0.819	0.10829	.	0.706131	0.14400	N	0.321967	T	0.18425	0.0442	L	0.57536	1.79	0.09310	N	1	D;P;P;D	0.53151	0.958;0.925;0.925;0.958	P;P;P;P	0.48227	0.563;0.571;0.571;0.571	T	0.12116	-1.0560	10	0.38643	T	0.18	-2.2829	5.6229	0.17467	0.4389:0.0:0.432:0.1291	.	243;396;396;396	E7END2;E9PHV5;P28290;P28290-3	.;.;SSFA2_HUMAN;.	I	396;396;396;243	ENSP00000388731:S396I;ENSP00000314669:S396I;ENSP00000387319:S396I;ENSP00000409867:S243I	ENSP00000314669:S396I	S	+	2	0	SSFA2	182475212	0.000000	0.05858	0.019000	0.16419	0.264000	0.26372	-0.304000	0.08199	0.111000	0.17947	0.650000	0.86243	AGT	SSFA2	-	NULL	ENSG00000138434		0.373	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2	-	0.00	30	0	G	NM_006751		182766967	+1	tier1	-	no_errors	ENST00000431877	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.000	T
RNF217-AS1	7955	genome.wustl.edu	37	6	125269130	125269130	+	RNA	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:125269130G>T	ENST00000439075.1	-	0	331					NR_026876.1																						AGAATTTCATGCACACATGCC	0.383																																																	0													84.0	81.0	82.0					6																	125269130		876	1991	2867			0																															6.37:g.125269130G>T				RNA	SNP	-	NULL	ENST00000439075.1	37	NULL		6																																																																																			RP11-510H23.1	-	-	ENSG00000236548		0.383	RP11-510H23.1-001	KNOWN	basic	antisense	STL	Clone_based_vega_gene	antisense	OTTHUMT00000042059.1	-	0.00	28	0	G			125269130	-1	tier1	-	no_errors	ENST00000439075	ensembl	human	known	74_37	rna	13.64	19	3	SNP	0.000	T
SYNE3	161176	genome.wustl.edu	37	14	95932472	95932472	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:95932472C>A	ENST00000334258.5	-	3	437	c.423G>T	c.(421-423)gaG>gaT	p.E141D	SYNE3_ENST00000553340.1_Missense_Mutation_p.E141D|SYNE3_ENST00000557275.1_Missense_Mutation_p.E141D	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	141					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						CCAGCTGGAGCTCGATGTGGG	0.632																																																	0													63.0	63.0	63.0					14																	95932472		2203	4300	6503	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.423G>T	14.37:g.95932472C>A	ENSP00000334308:p.Glu141Asp		A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.E141D	ENST00000334258.5	37	c.423	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	c	20.4	3.981592	0.74474	.	.	ENSG00000176438	ENST00000334258;ENST00000557275;ENST00000553340	T;T;T	0.32272	1.46;1.46;1.46	4.12	4.12	0.48240	.	0.000000	0.38778	N	0.001569	T	0.45054	0.1323	M	0.68952	2.095	0.52501	D	0.999957	D;D;D	0.67145	0.996;0.996;0.993	D;D;P	0.64410	0.925;0.925;0.843	T	0.33033	-0.9884	10	0.25751	T	0.34	-23.79	7.8678	0.29547	0.0:0.8129:0.0:0.1871	.	141;141;141	Q6ZMZ3-2;Q6ZMZ3-3;Q6ZMZ3	.;.;SYNE3_HUMAN	D	141	ENSP00000334308:E141D;ENSP00000450562:E141D;ENSP00000450774:E141D	ENSP00000334308:E141D	E	-	3	2	C14orf49	95002225	1.000000	0.71417	0.999000	0.59377	0.940000	0.58332	1.448000	0.35112	1.828000	0.53243	0.298000	0.19748	GAG	SYNE3	-	NULL	ENSG00000176438		0.632	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	-	0.00	58	0	C	NM_152592		95932472	-1	tier1	-	no_errors	ENST00000334258	ensembl	human	known	74_37	missense	32.08	36	17	SNP	1.000	A
TAS2R7	50837	genome.wustl.edu	37	12	10954348	10954348	+	Silent	SNP	A	A	T	rs558100889		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr12:10954348A>T	ENST00000240687.2	-	1	878	c.822T>A	c.(820-822)gcT>gcA	p.A274A		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	274					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						GGTAGATTAGAGCTATGGACT	0.378													A|||	1	0.000199681	0.0	0.0	5008	,	,		20280	0.0		0.0	False		,,,				2504	0.001																0													103.0	104.0	104.0					12																	10954348		2203	4300	6503	SO:0001819	synonymous_variant	0			AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.822T>A	12.37:g.10954348A>T			Q645Y1	Silent	SNP	pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A274	ENST00000240687.2	37	c.822	CCDS8631.1	12																																																																																			TAS2R7	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000121377		0.378	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R7	HGNC	protein_coding	OTTHUMT00000399931.1	-	0.00	35	0	A			10954348	-1	tier1	-	no_errors	ENST00000240687	ensembl	human	known	74_37	silent	16.13	26	5	SNP	0.002	T
TCAM1P	146771	genome.wustl.edu	37	17	61939715	61939715	+	RNA	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:61939715C>A	ENST00000478379.1	+	0	1486					NR_002947.2				testicular cell adhesion molecule 1, pseudogene																		ATGGAACACACGCTCGCCTGC	0.542																																																	0																																												0			AB026156		17q23.3	2013-09-26	2012-12-07	2010-03-12	ENSG00000240280	ENSG00000240280			30707	pseudogene	pseudogene		612756	"""testicular cell adhesion molecule 1 homolog (mouse)"", ""testicular cell adhesion molecule 1 homolog (mouse), pseudogene"""	TCAM1		11195349, 2744760, 19766163	Standard	NR_002947		Approved		uc031rdl.1		OTTHUMG00000154404		17.37:g.61939715C>A				RNA	SNP	-	NULL	ENST00000478379.1	37	NULL		17																																																																																			TCAM1P	-	-	ENSG00000240280		0.542	TCAM1P-002	KNOWN	basic	processed_transcript	TCAM1P	HGNC	pseudogene	OTTHUMT00000335083.1		0.00	51	0	C			61939715	+1			no_errors	ENST00000478379	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.037	A
TCAM1P	146771	genome.wustl.edu	37	17	61939720	61939720	+	RNA	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:61939720G>A	ENST00000478379.1	+	0	1491					NR_002947.2				testicular cell adhesion molecule 1, pseudogene																		ACACACGCTCGCCTGCGTCCC	0.547																																																	0																																												0			AB026156		17q23.3	2013-09-26	2012-12-07	2010-03-12	ENSG00000240280	ENSG00000240280			30707	pseudogene	pseudogene		612756	"""testicular cell adhesion molecule 1 homolog (mouse)"", ""testicular cell adhesion molecule 1 homolog (mouse), pseudogene"""	TCAM1		11195349, 2744760, 19766163	Standard	NR_002947		Approved		uc031rdl.1		OTTHUMG00000154404		17.37:g.61939720G>A				RNA	SNP	-	NULL	ENST00000478379.1	37	NULL		17																																																																																			TCAM1P	-	-	ENSG00000240280		0.547	TCAM1P-002	KNOWN	basic	processed_transcript	TCAM1P	HGNC	pseudogene	OTTHUMT00000335083.1		0.00	49	0	G			61939720	+1			no_errors	ENST00000478379	ensembl	human	known	74_37	rna	13.51	32	5	SNP	0.146	A
TFPT	29844	genome.wustl.edu	37	19	54617971	54617971	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:54617971C>T	ENST00000391759.1	-	2	538	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	TFPT_ENST00000391758.1_Missense_Mutation_p.V36M|PRPF31_ENST00000419967.1_5'Flank|PRPF31_ENST00000321030.4_5'Flank|TFPT_ENST00000391757.1_Missense_Mutation_p.V45M	NM_013342.3	NP_037474.1	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner (in childhood Leukemia)	45					apoptotic signaling pathway (GO:0097190)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(2)	4	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					ACAAACTCCACTTCCGTCTCC	0.642			T	TCF3	pre-B ALL																																			Dom	yes		19	19q13	29844	TCF3 (E2A) fusion partner (in childhood Leukemia)		L	0													129.0	138.0	135.0					19																	54617971		2203	4300	6503	SO:0001583	missense	0			AF052052	CCDS12878.1	19q13	2011-07-06			ENSG00000105619	ENSG00000105619		"""INO80 complex subunits"""	13630	protein-coding gene	gene with protein product	"""amida, partner of the E2A"", ""INO80 complex subunit F"""	609519				10644725, 16230350	Standard	NM_013342		Approved	FB1, amida, INO80F	uc010yej.1	P0C1Z6	OTTHUMG00000065906	ENST00000391759.1:c.133G>A	19.37:g.54617971C>T	ENSP00000375639:p.Val45Met			Missense_Mutation	SNP	NULL	p.V45M	ENST00000391759.1	37	c.133	CCDS12878.1	19	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524491	0.85600	.	.	ENSG00000105619	ENST00000391759;ENST00000391758;ENST00000391757	.	.	.	4.99	4.99	0.66335	.	0.077947	0.49916	D	0.000130	T	0.76004	0.3927	L	0.55481	1.735	0.49389	D	0.999784	D	0.89917	1.0	D	0.91635	0.999	T	0.78231	-0.2284	9	0.72032	D	0.01	-25.4342	17.4386	0.87559	0.0:1.0:0.0:0.0	.	45	P0C1Z6	TFPT_HUMAN	M	45;36;45	.	ENSP00000375637:V45M	V	-	1	0	TFPT	59309783	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	3.676000	0.54612	2.481000	0.83766	0.514000	0.50259	GTG	TFPT	-	NULL	ENSG00000105619		0.642	TFPT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPT	HGNC	protein_coding	OTTHUMT00000141215.4	-	0.00	35	0	C	NM_013342		54617971	-1	tier1	-	no_errors	ENST00000391759	ensembl	human	known	74_37	missense	57.69	11	15	SNP	1.000	T
TMCO3	55002	genome.wustl.edu	37	13	114201522	114201522	+	Intron	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr13:114201522A>G	ENST00000434316.2	+	11	2049				TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3							integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			TAATTCCTGTATTGAAGCAAG	0.517																																																	0																																										SO:0001627	intron_variant	0			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1691-93A>G	13.37:g.114201522A>G			Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	RNA	SNP	-	NULL	ENST00000434316.2	37	NULL	CCDS9537.1	13																																																																																			TMCO3	-	-	ENSG00000150403		0.517	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO3	HGNC	protein_coding	OTTHUMT00000045931.3	-	0.00	50	0	A	NM_017905		114201522	+1	tier1	-	no_errors	ENST00000491166	ensembl	human	known	74_37	rna	33.33	34	17	SNP	0.000	G
TMEM260	54916	genome.wustl.edu	37	14	57113980	57113980	+	Missense_Mutation	SNP	A	A	G	rs61739407	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr14:57113980A>G	ENST00000261556.6	+	16	2011	c.1889A>G	c.(1888-1890)tAt>tGt	p.Y630C	RP11-1085N6.2_ENST00000555924.1_RNA|TMEM260_ENST00000536419.1_Missense_Mutation_p.Y164C|RP11-1085N6.2_ENST00000553800.1_RNA	NM_017799.3	NP_060269.3	Q9NX78	TM260_HUMAN	transmembrane protein 260	630						integral component of membrane (GO:0016021)											GAGATTGTCTATTTACAAAAG	0.393													A|||	4	0.000798722	0.003	0.0	5008	,	,		17276	0.0		0.0	False		,,,				2504	0.0																0								A	CYS/TYR	7,4399	12.9+/-30.5	0,7,2196	43.0	42.0	42.0		1889	-1.5	0.0	14	dbSNP_129	42	0,8600		0,0,4300	yes	missense	C14orf101	NM_017799.3	194	0,7,6496	GG,GA,AA		0.0,0.1589,0.0538	benign	630/708	57113980	7,12999	2203	4300	6503	SO:0001583	missense	0			AK000399	CCDS9727.2	14q22.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000070269	ENSG00000070269			20185	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 101"""	C14orf101			Standard	XR_245695		Approved	FLJ20392	uc001xcm.3	Q9NX78	OTTHUMG00000152337	ENST00000261556.6:c.1889A>G	14.37:g.57113980A>G	ENSP00000261556:p.Tyr630Cys		A8KAN4|B3KPF5|Q86XE1	Missense_Mutation	SNP	pfam_DUF2723	p.Y630C	ENST00000261556.6	37	c.1889	CCDS9727.2	14	.	.	.	.	.	.	.	.	.	.	A	8.235	0.805443	0.16467	0.001589	0.0	ENSG00000070269	ENST00000261556;ENST00000536419	T;T	0.43688	1.52;0.94	5.54	-1.55	0.08558	.	0.487136	0.23489	N	0.047636	T	0.19287	0.0463	L	0.27053	0.805	0.09310	N	1	P	0.52463	0.953	B	0.36959	0.237	T	0.27331	-1.0077	10	0.37606	T	0.19	-1.5106	4.3556	0.11176	0.3397:0.4535:0.0965:0.1104	rs61739407	630	Q9NX78	CN101_HUMAN	C	630;164	ENSP00000261556:Y630C;ENSP00000438742:Y164C	ENSP00000261556:Y630C	Y	+	2	0	C14orf101	56183733	0.009000	0.17119	0.009000	0.14445	0.288000	0.27193	0.086000	0.14935	-0.388000	0.07797	-1.142000	0.01873	TAT	TMEM260	-	NULL	ENSG00000070269		0.393	TMEM260-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM260	HGNC	protein_coding	OTTHUMT00000276924.1	-	0.00	28	0	A	NM_017799		57113980	+1	tier1	rs61739407	no_errors	ENST00000261556	ensembl	human	known	74_37	missense	42.11	11	8	SNP	0.001	G
TMPRSS11A	339967	genome.wustl.edu	37	4	68812229	68812229	+	Silent	SNP	A	A	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:68812229A>G	ENST00000334830.7	-	2	818	c.72T>C	c.(70-72)atT>atC	p.I24I	TMPRSS11A_ENST00000396188.2_Silent_p.I24I|UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11A_ENST00000508048.1_Silent_p.I23I			Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A	24					cell cycle (GO:0007049)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|cervix(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	29						GGGACAACACAATGAGAACGG	0.443																																					NSCLC(26;2 894 10941 14480 22546)												0													85.0	76.0	79.0					4																	68812229		2203	4300	6503	SO:0001819	synonymous_variant	0			AF071882	CCDS3519.1	4q13.2	2010-04-13			ENSG00000187054	ENSG00000187054		"""Serine peptidases / Transmembrane"""	27954	protein-coding gene	gene with protein product		611704				15328353	Standard	NM_182606		Approved	ECRG1	uc003hdr.1	Q6ZMR5	OTTHUMG00000129303	ENST00000334830.7:c.72T>C	4.37:g.68812229A>G			J3KNQ8|Q2NKI9|Q6JE90|Q7RTY4|Q86TK8	Silent	SNP	pfam_Peptidase_S1,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.I24	ENST00000334830.7	37	c.72	CCDS3519.1	4																																																																																			TMPRSS11A	-	pirsf_Pept_S1A_HAT/DESC1	ENSG00000187054		0.443	TMPRSS11A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMPRSS11A	HGNC	protein_coding	OTTHUMT00000251433.3	-	0.00	34	0	A	NM_182606		68812229	-1	tier1	-	no_errors	ENST00000334830	ensembl	human	known	74_37	silent	38.46	8	5	SNP	0.000	G
TNFSF12	8742	genome.wustl.edu	37	17	7452584	7452584	+	Silent	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:7452584G>A	ENST00000293825.6	+	1	377	c.114G>A	c.(112-114)ctG>ctA	p.L38L	TNFSF12_ENST00000557233.1_Silent_p.L38L|TNFSF12-TNFSF13_ENST00000293826.4_Silent_p.L38L	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	38					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				TCGGCCTCCTGCTGGCCGTGG	0.751																																																	0													2.0	2.0	2.0					17																	7452584		1485	2939	4424	SO:0001819	synonymous_variant	0			AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.114G>A	17.37:g.7452584G>A			Q8IZK7|Q8WUZ7	Silent	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom	p.L38	ENST00000293825.6	37	c.114	CCDS11109.1	17																																																																																			TNFSF12-TNFSF13	-	NULL	ENSG00000248871		0.751	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF12-TNFSF13	HGNC	protein_coding	OTTHUMT00000226951.2		0.00	11	0	G	NM_003809		7452584	+1			no_errors	ENST00000293826	ensembl	human	known	74_37	silent	42.86	4	3	SNP	1.000	A
TOX3	27324	genome.wustl.edu	37	16	52473564	52473564	+	Missense_Mutation	SNP	G	G	A	rs146046759	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:52473564G>A	ENST00000219746.9	-	7	1588	c.1304C>T	c.(1303-1305)tCg>tTg	p.S435L	TOX3_ENST00000407228.3_Missense_Mutation_p.S430L	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	435	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						GGTTTGCACCGAAGGACTCAC	0.552													G|||	8	0.00159744	0.0008	0.0029	5008	,	,		20040	0.0		0.005	False		,,,				2504	0.0																0								G	LEU/SER,LEU/SER	3,4369		0,3,2183	92.0	87.0	89.0		1304,1289	5.7	1.0	16	dbSNP_134	89	33,8559		0,33,4263	yes	missense,missense	TOX3	NM_001080430.2,NM_001146188.1	145,145	0,36,6446	AA,AG,GG		0.3841,0.0686,0.2777	probably-damaging,probably-damaging	435/577,430/572	52473564	36,12928	2186	4296	6482	SO:0001583	missense	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1304C>T	16.37:g.52473564G>A	ENSP00000219746:p.Ser435Leu		B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.S435L	ENST00000219746.9	37	c.1304	CCDS54009.1	16	5	0.0022893772893772895	0	0.0	0	0.0	0	0.0	5	0.006596306068601583	G	14.16	2.451283	0.43531	6.86E-4	0.003841	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.10860	2.83;2.83	5.7	5.7	0.88788	.	0.249318	0.35262	N	0.003335	T	0.07728	0.0194	N	0.19112	0.55	0.49915	D	0.999832	D;D	0.63046	0.992;0.984	P;B	0.45794	0.493;0.248	T	0.23404	-1.0189	10	0.24483	T	0.36	.	19.8424	0.96695	0.0:0.0:1.0:0.0	.	430;435	B4DRD0;O15405	.;TOX3_HUMAN	L	435;430	ENSP00000219746:S435L;ENSP00000385705:S430L	ENSP00000219746:S435L	S	-	2	0	TOX3	51031065	1.000000	0.71417	0.977000	0.42913	0.996000	0.88848	9.476000	0.97823	2.673000	0.90976	0.655000	0.94253	TCG	TOX3	-	NULL	ENSG00000103460		0.552	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1		0.00	91	0	G	XM_049037		52473564	-1			no_errors	ENST00000219746	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578457	7578457	+	Missense_Mutation	SNP	C	C	A	rs587782144		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:7578457C>A	ENST00000269305.4	-	5	662	c.473G>T	c.(472-474)cGc>cTc	p.R158L	TP53_ENST00000359597.4_Missense_Mutation_p.R158L|TP53_ENST00000445888.2_Missense_Mutation_p.R158L|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R158L|TP53_ENST00000455263.2_Missense_Mutation_p.R158L|TP53_ENST00000413465.2_Missense_Mutation_p.R158L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	158	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R158L(77)|p.R158H(74)|p.R158P(9)|p.R65L(8)|p.0?(8)|p.R26L(8)|p.R158fs(6)|p.R158fs*11(6)|p.R65H(5)|p.R26H(5)|p.R158_A159insX(4)|p.R65fs(2)|p.R158_A159delRA(2)|p.R156_I162delRVRAMAI(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.R26fs(2)|p.V157fs*22(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.R158F(1)|p.P151_V173del23(1)|p.R156_R158delRVR(1)|p.R156fs*18(1)|p.R26fs*11(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.A159fs*21(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R65fs*11(1)|p.R156fs*20(1)|p.R158C(1)|p.V157_I162delVRAMAI(1)|p.V157fs*21(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCATGGCGCGGACGCGGGT	0.627		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	244	Substitution - Missense(188)|Deletion - Frameshift(19)|Deletion - In frame(13)|Complex(10)|Whole gene deletion(8)|Insertion - In frame(4)|Complex - frameshift(2)	lung(78)|central_nervous_system(33)|oesophagus(20)|haematopoietic_and_lymphoid_tissue(19)|large_intestine(18)|upper_aerodigestive_tract(12)|stomach(12)|urinary_tract(9)|prostate(7)|kidney(6)|liver(6)|breast(5)|bone(4)|soft_tissue(3)|ovary(3)|pancreas(3)|thyroid(2)|biliary_tract(2)|vulva(1)|thymus(1)	GRCh37	CM994513	TP53	M							49.0	51.0	50.0					17																	7578457		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.473G>T	17.37:g.7578457C>A	ENSP00000269305:p.Arg158Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R158L	ENST00000269305.4	37	c.473	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	18.06	3.538284	0.65085	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	5.59	4.63	0.57726	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.110116	0.64402	D	0.000010	D	0.99869	0.9938	M	0.92026	3.265	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.988;0.981;0.996;0.99;0.986;1.0	D	0.96498	0.9369	10	0.87932	D	0	-10.4795	12.6491	0.56751	0.0:0.9196:0.0:0.0804	.	119;158;158;65;158;158;158	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	158;158;158;158;158;158;147;65;26;65;26;158	ENSP00000410739:R158L;ENSP00000352610:R158L;ENSP00000269305:R158L;ENSP00000398846:R158L;ENSP00000391127:R158L;ENSP00000391478:R158L;ENSP00000425104:R26L;ENSP00000423862:R65L;ENSP00000424104:R158L	ENSP00000269305:R158L	R	-	2	0	TP53	7519182	1.000000	0.71417	0.034000	0.17996	0.175000	0.22909	7.775000	0.85489	1.514000	0.48869	-0.140000	0.14226	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.627	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	409	0	C	NM_000546		7578457	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	56.04	160	204	SNP	0.989	A
TRIM38	10475	genome.wustl.edu	37	6	25983525	25983525	+	Silent	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr6:25983525C>G	ENST00000357085.3	+	8	1484	c.1008C>G	c.(1006-1008)gtC>gtG	p.V336V	TRIM38_ENST00000349458.3_Silent_p.V336V|U91328.21_ENST00000608931.1_RNA	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	336	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TCCCCTGTGTCTTGGGTTGTG	0.478																																																	0													119.0	116.0	117.0					6																	25983525		2203	4300	6503	SO:0001819	synonymous_variant	0			U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.1008C>G	6.37:g.25983525C>G			B2R862	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.V336	ENST00000357085.3	37	c.1008	CCDS4568.1	6																																																																																			TRIM38	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000112343		0.478	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM38	HGNC	protein_coding	OTTHUMT00000040076.2	-	0.00	121	0	C			25983525	+1	tier1	-	no_errors	ENST00000349458	ensembl	human	known	74_37	silent	32.53	56	27	SNP	0.993	G
TSHZ2	128553	genome.wustl.edu	37	20	51872057	51872057	+	Missense_Mutation	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr20:51872057C>T	ENST00000371497.5	+	2	2947	c.2060C>T	c.(2059-2061)cCg>cTg	p.P687L	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.P684L|TSHZ2_ENST00000603338.2_Missense_Mutation_p.P684L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	687					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AACCACGCCCCGGCCCTGCCA	0.632																																																	0													48.0	44.0	45.0					20																	51872057		2203	4300	6503	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2060C>T	20.37:g.51872057C>T	ENSP00000360552:p.Pro687Leu		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.P687L	ENST00000371497.5	37	c.2060	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	C	9.015	0.983481	0.18889	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.61040	0.14;0.14	5.47	4.47	0.54385	.	1.013400	0.07882	N	0.969742	T	0.61999	0.2392	M	0.74647	2.275	0.22571	N	0.998978	B	0.28605	0.217	B	0.22152	0.038	T	0.57774	-0.7753	10	0.87932	D	0	-19.7893	15.7005	0.77538	0.0:0.8629:0.137:0.0	.	687	Q9NRE2	TSH2_HUMAN	L	687;684;213	ENSP00000360552:P687L;ENSP00000333114:P684L	ENSP00000333114:P684L	P	+	2	0	TSHZ2	51305464	0.222000	0.23652	0.103000	0.21229	0.178000	0.23041	3.583000	0.53928	2.558000	0.86282	0.643000	0.83706	CCG	TSHZ2	-	NULL	ENSG00000182463		0.632	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6		0.00	18	0	C	NM_173485		51872057	+1			no_errors	ENST00000371497	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.236	T
USP46	64854	genome.wustl.edu	37	4	53476753	53476753	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr4:53476753G>T	ENST00000441222.3	-	5	776	c.592C>A	c.(592-594)Ctt>Att	p.L198I	USP46_ENST00000508499.1_Missense_Mutation_p.L191I|USP46_ENST00000451218.2_Missense_Mutation_p.L171I	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	198	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TCAACAGAAAGGTCAAGAAAA	0.353																																																	0													79.0	75.0	77.0					4																	53476753		1970	4179	6149	SO:0001583	missense	0			AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.592C>A	4.37:g.53476753G>T	ENSP00000407818:p.Leu198Ile		B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.L198I	ENST00000441222.3	37	c.592	CCDS47053.1	4	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958177	0.92726	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.09073	3.02;3.02;3.02	5.72	5.72	0.89469	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.53938	D	0.000057	T	0.28532	0.0706	M	0.67569	2.06	0.80722	D	1	D;D;D;D	0.63046	0.992;0.986;0.981;0.976	D;D;D;P	0.70935	0.971;0.971;0.936;0.894	T	0.00089	-1.2088	10	0.42905	T	0.14	-13.1239	18.8634	0.92281	0.0:0.0:1.0:0.0	.	82;186;198;191	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	I	198;171;191	ENSP00000407818:L198I;ENSP00000390102:L171I;ENSP00000423244:L191I	ENSP00000407818:L198I	L	-	1	0	USP46	53171510	1.000000	0.71417	0.999000	0.59377	0.943000	0.58893	7.629000	0.83207	2.699000	0.92147	0.591000	0.81541	CTT	USP46	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000109189		0.353	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	HGNC	protein_coding	OTTHUMT00000361516.2	-	0.00	34	0	G	NM_022832		53476753	-1	tier1	-	no_errors	ENST00000441222	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	T
VAC14	55697	genome.wustl.edu	37	16	70796868	70796868	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:70796868G>T	ENST00000261776.5	-	11	1481	c.1221C>A	c.(1219-1221)caC>caA	p.H407Q	VAC14-AS1_ENST00000562507.1_RNA|VAC14-AS1_ENST00000398177.1_RNA	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	407					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				TGTCACTGAGGTGGCAGTTTA	0.577																																																	0													126.0	94.0	105.0					16																	70796868		2198	4300	6498	SO:0001583	missense	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1221C>A	16.37:g.70796868G>T	ENSP00000261776:p.His407Gln		B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_VAC14_Fig4p-bd,pfam_HEAT,superfamily_ARM-type_fold	p.H407Q	ENST00000261776.5	37	c.1221	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	G	13.97	2.395571	0.42512	.	.	ENSG00000103043	ENST00000261776	T	0.66099	-0.19	5.81	3.84	0.44239	Armadillo-like helical (1);Armadillo-type fold (1);	0.041768	0.85682	D	0.000000	T	0.49047	0.1534	L	0.41492	1.28	0.80722	D	1	P	0.37663	0.604	B	0.31751	0.135	T	0.41161	-0.9524	10	0.32370	T	0.25	-28.0554	12.5796	0.56383	0.1344:0.0:0.8656:0.0	.	407	Q08AM6	VAC14_HUMAN	Q	407	ENSP00000261776:H407Q	ENSP00000261776:H407Q	H	-	3	2	VAC14	69354369	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.112000	0.64634	0.789000	0.33779	0.655000	0.94253	CAC	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.577	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	-	0.00	73	0	G	NM_018052		70796868	-1	tier1	-	no_errors	ENST00000261776	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
VSIG4	11326	genome.wustl.edu	37	X	65259808	65259808	+	Silent	SNP	C	C	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chrX:65259808C>T	ENST00000374737.4	-	1	141	c.33G>A	c.(31-33)ggG>ggA	p.G11G	VSIG4_ENST00000455586.2_Silent_p.G11G|VSIG4_ENST00000412866.2_Silent_p.G11G	NM_001257403.1|NM_007268.2	NP_001244332.1|NP_009199.1	Q9Y279	VSIG4_HUMAN	V-set and immunoglobulin domain containing 4	11					complement activation, alternative pathway (GO:0006957)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of T cell proliferation (GO:0042130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTGTTAGGTGCCCCAGGAGTA	0.527																																																	0													143.0	94.0	111.0					X																	65259808		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ132502	CCDS14383.1, CCDS48132.1, CCDS55435.1	Xq12-q13.3	2013-01-29			ENSG00000155659	ENSG00000155659		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17032	protein-coding gene	gene with protein product		300353				10899594, 11004523, 17016555, 17016562	Standard	NM_007268		Approved	Z39IG	uc004dwh.2	Q9Y279	OTTHUMG00000021727	ENST00000374737.4:c.33G>A	X.37:g.65259808C>T			Q6UXI4	Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like_dom	p.G11	ENST00000374737.4	37	c.33	CCDS14383.1	X																																																																																			VSIG4	-	NULL	ENSG00000155659		0.527	VSIG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VSIG4	HGNC	protein_coding	OTTHUMT00000056986.1	-	0.00	35	0	C	NM_007268		65259808	-1	tier1	-	no_errors	ENST00000374737	ensembl	human	known	74_37	silent	79.41	7	27	SNP	0.065	T
WDR81	124997	genome.wustl.edu	37	17	1637328	1637328	+	Missense_Mutation	SNP	G	G	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr17:1637328G>A	ENST00000409644.1	+	7	4997	c.4997G>A	c.(4996-4998)gGc>gAc	p.G1666D	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000437219.2_Missense_Mutation_p.G463D|WDR81_ENST00000545662.1_Missense_Mutation_p.G297D|WDR81_ENST00000446363.1_Missense_Mutation_p.G305D|WDR81_ENST00000309182.5_Missense_Mutation_p.G615D|WDR81_ENST00000419248.1_Missense_Mutation_p.G439D	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1666					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TTCCTGAGCGGCAGCAAGGAT	0.657																																																	0													61.0	57.0	59.0					17																	1637328		2203	4298	6501	SO:0001583	missense	0			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.4997G>A	17.37:g.1637328G>A	ENSP00000386609:p.Gly1666Asp		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1666D	ENST00000409644.1	37	c.4997	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871018	0.72065	.	.	ENSG00000167716	ENST00000437219;ENST00000309182;ENST00000446363;ENST00000419248;ENST00000409644;ENST00000354680;ENST00000545662	T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	5.25	3.23	0.37069	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.052963	0.85682	D	0.000000	D	0.84000	0.5376	M	0.90425	3.115	0.80722	D	1	D;D;D;D	0.71674	0.979;0.989;0.998;0.957	D;D;D;D	0.67900	0.954;0.937;0.937;0.925	D	0.84356	0.0535	9	.	.	.	.	9.7133	0.40258	0.0772:0.1419:0.7809:0.0	.	297;463;793;615	B7Z6V3;B7Z579;Q8TEL1;Q562E7	.;.;.;WDR81_HUMAN	D	463;615;305;439;1666;417;297	ENSP00000391074:G463D;ENSP00000312074:G615D;ENSP00000401560:G305D;ENSP00000407845:G439D;ENSP00000386609:G1666D;ENSP00000442726:G297D	.	G	+	2	0	WDR81	1584078	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	6.532000	0.73825	0.592000	0.29728	0.557000	0.71058	GGC	WDR81	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000167716		0.657	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	-	0.00	54	0	G	NM_152348		1637328	+1	tier1	-	no_errors	ENST00000409644	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
ZC3H18	124245	genome.wustl.edu	37	16	88694049	88694049	+	Missense_Mutation	SNP	G	G	A	rs370561351		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr16:88694049G>A	ENST00000301011.5	+	14	2328	c.2128G>A	c.(2128-2130)Gtc>Atc	p.V710I	ZC3H18_ENST00000452588.2_Missense_Mutation_p.V734I	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	710	Ser-rich.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CGTGAGCAGCGTCTCCTCAGT	0.627																																					Ovarian(121;375 2276 20373 38669)												0													141.0	100.0	114.0					16																	88694049		2198	4300	6498	SO:0001583	missense	0			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2128G>A	16.37:g.88694049G>A	ENSP00000301011:p.Val710Ile		Q96DG4|Q96MP7	Missense_Mutation	SNP	smart_Znf_CCCH	p.V710I	ENST00000301011.5	37	c.2128	CCDS10967.1	16	.	.	.	.	.	.	.	.	.	.	G	17.32	3.358674	0.61403	.	.	ENSG00000158545	ENST00000301011;ENST00000452588	T;T	0.35605	1.3;1.31	4.69	4.69	0.59074	.	0.127443	0.52532	D	0.000069	T	0.57417	0.2052	M	0.61703	1.905	0.58432	D	0.999997	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.54957	-0.8215	10	0.33940	T	0.23	-25.3956	17.9725	0.89117	0.0:0.0:1.0:0.0	.	734;710	E7ERS3;Q86VM9	.;ZCH18_HUMAN	I	710;734	ENSP00000301011:V710I;ENSP00000416951:V734I	ENSP00000301011:V710I	V	+	1	0	ZC3H18	87221550	1.000000	0.71417	0.991000	0.47740	0.527000	0.34593	9.436000	0.97532	2.322000	0.78497	0.491000	0.48974	GTC	ZC3H18	-	NULL	ENSG00000158545		0.627	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	HGNC	protein_coding	OTTHUMT00000269168.1	-	0.00	65	0	G	NM_144604		88694049	+1	tier1	-	no_errors	ENST00000301011	ensembl	human	known	74_37	missense	52.00	24	26	SNP	1.000	A
ZCCHC7	84186	genome.wustl.edu	37	9	37357249	37357250	+	Frame_Shift_Ins	INS	-	-	A	rs1051465		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr9:37357249_37357250insA	ENST00000336755.5	+	9	1722_1723	c.1616_1617insA	c.(1615-1620)agaaaafs	p.RK539fs	ZCCHC7_ENST00000534928.1_Frame_Shift_Ins_p.RK249fs|ZCCHC7_ENST00000461038.1_3'UTR	NM_032226.2	NP_115602.2	Q8N3Z6	ZCHC7_HUMAN	zinc finger, CCHC domain containing 7	539			R -> K (in dbSNP:rs1051465).			cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	30				GBM - Glioblastoma multiforme(29;0.0137)		ATTAAGCAGAGAAAAAAAAAGT	0.411																																																	0																																										SO:0001589	frameshift_variant	0			AK026264	CCDS6608.2	9p13.1	2008-05-02			ENSG00000147905	ENSG00000147905		"""Zinc fingers, CCHC domain containing"""	26209	protein-coding gene	gene with protein product							Standard	NM_032226		Approved	FLJ22611, AIR1	uc003zzq.3	Q8N3Z6	OTTHUMG00000019915	ENST00000336755.5:c.1625dupA	9.37:g.37357258_37357258dupA	ENSP00000337839:p.Arg539fs		B2RCI4|D3DRQ0|Q5T0Q8|Q5T0Q9|Q5T0R0|Q8N2M1|Q8N4J2|Q8TBK8|Q9H648|Q9P0F0	Frame_Shift_Ins	INS	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.K543fs	ENST00000336755.5	37	c.1616_1617	CCDS6608.2	9																																																																																			ZCCHC7	-	NULL	ENSG00000147905		0.411	ZCCHC7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC7	HGNC	protein_coding	OTTHUMT00000052453.2		0.00	14	0	0	NM_032226		37357250	+1			no_errors	ENST00000336755	ensembl	human	known	74_37	frame_shift_ins	37.50	5	3	INS	1.000:1.000	A
ZNF285	26974	genome.wustl.edu	37	19	44891003	44891003	+	Silent	SNP	G	G	A	rs201302972		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:44891003G>A	ENST00000330997.4	-	4	1468	c.1404C>T	c.(1402-1404)agC>agT	p.S468S	CTC-512J12.6_ENST00000588212.1_Intron|ZNF285_ENST00000591679.1_Silent_p.S475S|ZNF285_ENST00000544719.2_Silent_p.S468S	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	468					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAAGAACAGAGCTATACGCAA	0.418																																																	0													86.0	87.0	87.0					19																	44891003		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1404C>T	19.37:g.44891003G>A			Q17RJ3|Q6B0A8|Q6ISR5	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S468	ENST00000330997.4	37	c.1404	CCDS12638.1	19																																																																																			ZNF285	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000267508		0.418	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	-	0.00	61	0	G	NM_152354		44891003	-1	tier1	rs201302972	no_errors	ENST00000330997	ensembl	human	known	74_37	silent	14.71	29	5	SNP	0.000	A
ZNF211	10520	genome.wustl.edu	37	19	58153099	58153099	+	Missense_Mutation	SNP	C	C	A			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:58153099C>A	ENST00000347302.3	+	3	1424	c.1245C>A	c.(1243-1245)caC>caA	p.H415Q	ZNF211_ENST00000391703.3_Missense_Mutation_p.H354Q|ZNF211_ENST00000299871.5_Missense_Mutation_p.H480Q|ZNF211_ENST00000541801.1_Missense_Mutation_p.H406Q|ZNF211_ENST00000240731.4_Missense_Mutation_p.H428Q|ZNF211_ENST00000420680.1_Missense_Mutation_p.H419Q|ZNF211_ENST00000544273.1_Missense_Mutation_p.H427Q|ZNF211_ENST00000254182.7_Missense_Mutation_p.H406Q	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCATTCACCACCGGAGACTTC	0.473																																																	0													66.0	71.0	69.0					19																	58153099		2203	4300	6503	SO:0001583	missense	0			U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.1245C>A	19.37:g.58153099C>A	ENSP00000339562:p.His415Gln		B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H428Q	ENST00000347302.3	37	c.1284	CCDS12957.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	10.39|10.39	1.337064|1.337064	0.24253|0.24253	.|.	.|.	ENSG00000121417|ENSG00000121417	ENST00000420680;ENST00000347302;ENST00000254182;ENST00000391703;ENST00000541801;ENST00000299871;ENST00000544273;ENST00000240731|ENST00000407202	D;D;D;D;D;D;D;D|.	0.86865|.	-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18|.	3.38|3.38	1.23|1.23	0.21249|0.21249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|T	0.61400|0.61400	0.2344|0.2344	M|M	0.89353|0.89353	3.025|3.025	0.09310|0.09310	N|N	1|1	D;D;B;D;D;D|.	0.89917|.	0.999;0.999;0.414;1.0;1.0;1.0|.	D;D;B;D;D;D|.	0.87578|.	0.938;0.938;0.078;0.998;0.963;0.963|.	T|T	0.53961|0.53961	-0.8364|-0.8364	9|5	0.87932|.	D|.	0|.	.|.	6.6002|6.6002	0.22697|0.22697	0.0:0.6632:0.0:0.3368|0.0:0.6632:0.0:0.3368	.|.	419;427;480;406;415;428|.	Q13398-4;Q13398-3;F8WDV2;Q13398-2;Q13398;B9ZVW1|.	.;.;.;.;ZN211_HUMAN;.|.	Q|T	419;415;406;354;406;480;427;428|419	ENSP00000399193:H419Q;ENSP00000339562:H415Q;ENSP00000254182:H406Q;ENSP00000375584:H354Q;ENSP00000442601:H406Q;ENSP00000299871:H480Q;ENSP00000441386:H427Q;ENSP00000240731:H428Q|.	ENSP00000240731:H428Q|.	H|P	+|+	3|1	2|0	ZNF211|ZNF211	62844911|62844911	0.041000|0.041000	0.20044|0.20044	0.031000|0.031000	0.17742|0.17742	0.998000|0.998000	0.95712|0.95712	0.362000|0.362000	0.20284|0.20284	0.756000|0.756000	0.33013|0.33013	0.585000|0.585000	0.79938|0.79938	CAC|CCG	ZNF211	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121417		0.473	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF211	HGNC	protein_coding	OTTHUMT00000397502.1	-	0.00	52	0	C			58153099	+1	tier1	-	no_errors	ENST00000240731	ensembl	human	known	74_37	missense	69.23	8	18	SNP	0.005	A
ZNF485	220992	genome.wustl.edu	37	10	44112021	44112021	+	Missense_Mutation	SNP	A	A	G	rs372395438	byFrequency	TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr10:44112021A>G	ENST00000361807.3	+	5	724	c.530A>G	c.(529-531)cAt>cGt	p.H177R	ZNF485_ENST00000374437.2_Missense_Mutation_p.H86R|ZNF485_ENST00000374435.3_Missense_Mutation_p.H177R	NM_145312.3	NP_660355.2	Q8NCK3	ZN485_HUMAN	zinc finger protein 485	177					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16						TTAAATCACCATAAGGTTCAT	0.393													A|||	2	0.000399361	0.0015	0.0	5008	,	,		21066	0.0		0.0	False		,,,				2504	0.0																0								A	ARG/HIS	0,4406		0,0,2203	106.0	103.0	104.0		530	-1.5	0.1	10		104	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNF485	NM_145312.3	29	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	177/442	44112021	1,13005	2203	4300	6503	SO:0001583	missense	0			AK074679	CCDS7205.2	10q11.21	2013-01-08			ENSG00000198298	ENSG00000198298		"""Zinc fingers, C2H2-type"", ""-"""	23440	protein-coding gene	gene with protein product							Standard	NM_145312		Approved		uc010qfc.2	Q8NCK3	OTTHUMG00000018040	ENST00000361807.3:c.530A>G	10.37:g.44112021A>G	ENSP00000354694:p.His177Arg		B4DSE6|Q96CL0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H177R	ENST00000361807.3	37	c.530	CCDS7205.2	10	.	.	.	.	.	.	.	.	.	.	A	2.554	-0.303305	0.05495	0.0	1.16E-4	ENSG00000198298	ENST00000361807;ENST00000374437;ENST00000374435	T;T;T	0.07114	3.22;3.22;3.22	2.52	-1.52	0.08637	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02649	0.0080	N	0.02142	-0.665	0.09310	N	0.999999	B	0.02656	0.0	B	0.15052	0.012	T	0.41556	-0.9502	9	0.46703	T	0.11	.	3.0456	0.06152	0.5725:0.0:0.2434:0.1841	.	177	Q8NCK3	ZN485_HUMAN	R	177;86;177	ENSP00000354694:H177R;ENSP00000363560:H86R;ENSP00000363558:H177R	ENSP00000354694:H177R	H	+	2	0	ZNF485	43432027	0.000000	0.05858	0.134000	0.22075	0.075000	0.17131	-0.565000	0.05929	-0.363000	0.08101	-0.609000	0.04063	CAT	ZNF485	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198298		0.393	ZNF485-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF485	HGNC	protein_coding	OTTHUMT00000047719.2	-	0.00	41	0	A	NM_145312		44112021	+1	tier1	-	no_errors	ENST00000361807	ensembl	human	known	74_37	missense	38.89	22	14	SNP	0.457	G
ZNF551	90233	genome.wustl.edu	37	19	58199504	58199504	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr19:58199504G>T	ENST00000282296.5	+	3	2046	c.1861G>T	c.(1861-1863)Ggg>Tgg	p.G621W	ZNF551_ENST00000356715.4_Missense_Mutation_p.G605W|AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000596085.1_Intron|AC003006.7_ENST00000599221.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CAGTCAATGTGGGAAACCCTT	0.453																																																	0													103.0	103.0	103.0					19																	58199504		2203	4300	6503	SO:0001583	missense	0			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.1861G>T	19.37:g.58199504G>T	ENSP00000282296:p.Gly621Trp		B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G621W	ENST00000282296.5	37	c.1861	CCDS12959.2	19	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659897	0.47572	.	.	ENSG00000204519	ENST00000356715;ENST00000282296;ENST00000359821	.	.	.	2.51	1.43	0.22495	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.78717	0.4327	M	0.93241	3.395	0.32350	N	0.558536	D	0.89917	1.0	D	0.87578	0.998	T	0.79626	-0.1725	8	0.72032	D	0.01	.	8.4007	0.32583	0.1282:0.0:0.8718:0.0	.	621	Q7Z340	ZN551_HUMAN	W	621;605;404	.	ENSP00000282296:G605W	G	+	1	0	ZNF551	62891316	0.018000	0.18449	0.058000	0.19502	0.039000	0.13416	0.210000	0.17455	0.390000	0.25115	0.561000	0.74099	GGG	ZNF551	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204519		0.453	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF551	HGNC	protein_coding	OTTHUMT00000466803.2		0.00	53	0	G	NM_138347		58199504	+1			no_errors	ENST00000282296	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	T
ZNF592	9640	genome.wustl.edu	37	15	85345259	85345259	+	Missense_Mutation	SNP	C	C	G			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr15:85345259C>G	ENST00000560079.2	+	11	3727	c.3439C>G	c.(3439-3441)Cag>Gag	p.Q1147E	ZNF592_ENST00000299927.3_Missense_Mutation_p.Q1147E	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	1147					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ACCTCAGCACCAGGTGGACAG	0.542																																																	0													72.0	62.0	66.0					15																	85345259		2203	4299	6502	SO:0001583	missense	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.3439C>G	15.37:g.85345259C>G	ENSP00000452877:p.Gln1147Glu		Q2M1T2|Q504Y9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q1147E	ENST00000560079.2	37	c.3439	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	C	14.57	2.575952	0.45902	.	.	ENSG00000166716	ENST00000299927	T	0.00599	6.3	5.62	5.62	0.85841	.	0.277636	0.34986	N	0.003527	T	0.00608	0.0020	N	0.25485	0.75	0.28789	N	0.899411	B	0.11235	0.004	B	0.15484	0.013	T	0.46527	-0.9185	10	0.62326	D	0.03	-8.0535	12.1498	0.54044	0.171:0.829:0.0:0.0	.	1147	Q92610	ZN592_HUMAN	E	1147	ENSP00000299927:Q1147E	ENSP00000299927:Q1147E	Q	+	1	0	ZNF592	83146263	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	3.550000	0.53691	2.648000	0.89879	0.655000	0.94253	CAG	ZNF592	-	NULL	ENSG00000166716		0.542	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	-	0.00	87	0	C	NM_014630		85345259	+1	tier1	-	no_errors	ENST00000299927	ensembl	human	known	74_37	missense	67.31	16	35	SNP	0.953	G
ZNF696	79943	genome.wustl.edu	37	8	144378416	144378416	+	Missense_Mutation	SNP	G	G	T			TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr8:144378416G>T	ENST00000330143.3	+	3	980	c.571G>T	c.(571-573)Ggc>Tgc	p.G191C		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CAAGGCCTTCGGCCAGAGCTT	0.716																																																	0													16.0	15.0	15.0					8																	144378416		2195	4292	6487	SO:0001583	missense	0			AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.571G>T	8.37:g.144378416G>T	ENSP00000328515:p.Gly191Cys		A0AVE2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G191C	ENST00000330143.3	37	c.571	CCDS6399.1	8	.	.	.	.	.	.	.	.	.	.	G	9.914	1.210270	0.22289	.	.	ENSG00000185730	ENST00000518575;ENST00000330143	T;T	0.18960	2.18;2.18	2.08	-0.702	0.11265	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13072	0.0317	L	0.37561	1.115	0.44162	D	0.996969	B	0.20052	0.041	B	0.19946	0.027	T	0.15838	-1.0423	8	.	.	.	.	5.7664	0.18229	0.4983:0.0:0.5017:0.0	.	191	Q9H7X3	ZN696_HUMAN	C	191	ENSP00000427857:G191C;ENSP00000328515:G191C	.	G	+	1	0	ZNF696	144449791	0.000000	0.05858	0.772000	0.31596	0.574000	0.36063	-0.419000	0.07071	-0.289000	0.09038	-0.361000	0.07541	GGC	ZNF696	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185730		0.716	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF696	HGNC	protein_coding	OTTHUMT00000381164.2	-	0.00	41	0	G	NM_030895		144378416	+1	tier1	-	no_errors	ENST00000330143	ensembl	human	known	74_37	missense	18.52	44	10	SNP	0.154	T
ZNF727	442319	genome.wustl.edu	37	7	63537695	63537695	+	Missense_Mutation	SNP	G	G	A	rs372078057		TCGA-LN-A4A1-01A-21D-A27G-09	TCGA-LN-A4A1-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a03ef5d0-0cf8-4303-941f-4e3045612671	be17983e-aeb5-495e-a39c-6bf4aa0baf9a	g.chr7:63537695G>A	ENST00000550760.3	+	4	447	c.268G>A	c.(268-270)Gac>Aac	p.D90N	RP11-3N2.13_ENST00000445978.1_RNA	NM_001159522.1	NP_001152994.1	A8MUV8	ZN727_HUMAN	zinc finger protein 727	90					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|skin(1)|stomach(1)|urinary_tract(1)	8						GCTGGAGCACGACATAAACGA	0.368													g|||	1	0.000199681	0.0008	0.0	5008	,	,		16289	0.0		0.0	False		,,,				2504	0.0																0								G	ASN/ASP	3,1381		0,3,689	55.0	47.0	49.0		268	0.2	0.0	7		49	0,3182		0,0,1591	no	missense	ZNF727	NM_001159522.1	23	0,3,2280	AA,AG,GG		0.0,0.2168,0.0657	benign	90/500	63537695	3,4563	692	1591	2283	SO:0001583	missense	0					7q11.21	2014-09-09	2014-09-09	2014-09-09	ENSG00000214652	ENSG00000214652		"""Zinc fingers, C2H2-type"", ""-"""	22785	pseudogene	pseudogene			"""zinc finger protein 727, pseudogene"""	ZNF727P			Standard	NM_001159522		Approved		uc011kdm.2	A8MUV8	OTTHUMG00000156536	ENST00000550760.3:c.268G>A	7.37:g.63537695G>A	ENSP00000447987:p.Asp90Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D90N	ENST00000550760.3	37	c.268	CCDS55113.1	7	.	.	.	.	.	.	.	.	.	.	G	5.957	0.360650	0.11296	0.002168	0.0	ENSG00000257482	ENST00000550760	T	0.04502	3.61	0.158	0.158	0.14942	.	.	.	.	.	T	0.03520	0.0101	L	0.33668	1.02	0.09310	N	1	B	0.25105	0.118	B	0.10450	0.005	T	0.45160	-0.9280	7	.	.	.	.	.	.	.	.	90	A8MUV8	ZN727_HUMAN	N	90	ENSP00000447987:D90N	.	D	+	1	0	ZNF727	63175130	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-0.523000	0.06230	0.202000	0.20498	0.205000	0.17691	GAC	ZNF727	-	NULL	ENSG00000257482		0.368	ZNF727-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF727	HGNC	protein_coding		-	0.00	24	0	G	NM_001159522		63537695	+1	tier1	-	no_errors	ENST00000550760	ensembl	human	known	74_37	missense	35.29	22	12	SNP	0.080	A
